#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ELTD1	64123	hgsc.bcm.edu	37	1	79357333	79357333	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr1:79357333G>T	ENST00000370742.3	-	14	1949	c.1886C>A	c.(1885-1887)aCc>aAc	p.T629N		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	629					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.T629I(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GATCCAGGTGGTGCCGAGAAG	0.463																																					p.T629N		Atlas-SNP	.											ELTD1,NS,carcinoma,0,1	ELTD1	143	.	1	Substitution - Missense(1)	lung(1)	c.C1886A						.						64.0	65.0	64.0					1																	79357333		1972	4144	6116	SO:0001583	missense	64123	exon14			CAGGTGGTGCCGA	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1886C>A	chr1.hg19:g.79357333G>T	ENSP00000359778:p.Thr629Asn	82.0	0.0		56.0	6.0	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	hg19	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	G	18.64	3.666751	0.67814	.	.	ENSG00000162618	ENST00000370742;ENST00000401034	T;T	0.44881	0.91;0.91	5.59	5.59	0.84812	GPCR, family 2-like (1);	0.185125	0.48767	D	0.000172	T	0.39545	0.1082	L	0.46819	1.47	0.32403	N	0.551694	P	0.48834	0.916	P	0.56865	0.808	T	0.31280	-0.9949	9	.	.	.	.	12.8706	0.57962	0.0745:0.0:0.9255:0.0	.	629	Q9HBW9	ELTD1_HUMAN	N	629;87	ENSP00000359778:T629N;ENSP00000383813:T87N	.	T	-	2	0	ELTD1	79129921	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	5.720000	0.68470	2.612000	0.88384	0.655000	0.94253	ACC	.	.		0.463	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
PTPN14	5784	hgsc.bcm.edu	37	1	214557166	214557166	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr1:214557166C>T	ENST00000366956.5	-	13	2226	c.2032G>A	c.(2032-2034)Gag>Aag	p.E678K	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	678					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GACCCCTCCTCGGGCGGTCCC	0.627																																					p.E678K	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.G2032A						.						42.0	42.0	42.0					1																	214557166		2203	4300	6503	SO:0001583	missense	5784	exon13			CCTCCTCGGGCGG	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2032G>A	chr1.hg19:g.214557166C>T	ENSP00000355923:p.Glu678Lys	69.0	0.0		67.0	20.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	1.191	-0.635274	0.03584	.	.	ENSG00000152104	ENST00000366956	T	0.67345	-0.26	3.45	1.09	0.20402	.	0.598863	0.17926	N	0.157360	T	0.50463	0.1617	L	0.52759	1.655	0.45883	D	0.998739	B	0.20052	0.041	B	0.06405	0.002	T	0.24905	-1.0147	10	0.16420	T	0.52	.	4.1616	0.10287	0.0:0.5742:0.1878:0.2379	.	678	Q15678	PTN14_HUMAN	K	678	ENSP00000355923:E678K	ENSP00000355923:E678K	E	-	1	0	PTPN14	212623789	0.966000	0.33281	0.113000	0.21522	0.017000	0.09413	2.761000	0.47589	0.327000	0.23409	0.563000	0.77884	GAG	.	.		0.627	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
CYP1B1	1545	hgsc.bcm.edu	37	2	38301854	38301854	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:38301854G>C	ENST00000260630.3	-	2	1079	c.678C>G	c.(676-678)agC>agG	p.S226R	CYP1B1-AS1_ENST00000589303.1_RNA|CYP1B1_ENST00000407341.1_Missense_Mutation_p.S226R|CYP1B1-AS1_ENST00000431999.1_RNA|CYP1B1_ENST00000494864.1_Intron	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	226					angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	CTTCGTTGTGGCTGAGCAGCT	0.677																																					p.S226R		Atlas-SNP	.											.	CYP1B1	39	.	0			c.C678G						.						19.0	21.0	20.0					2																	38301854		2200	4296	6496	SO:0001583	missense	1545	exon2			GTTGTGGCTGAGC	U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.678C>G	chr2.hg19:g.38301854G>C	ENSP00000260630:p.Ser226Arg	289.0	0.0		320.0	27.0	NM_000104	Q5TZW8|Q93089|Q9H316	Missense_Mutation	SNP	ENST00000260630.3	hg19	CCDS1793.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.601532	0.46423	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	T;T	0.67698	-0.28;-0.28	4.5	3.63	0.41609	.	0.048810	0.85682	D	0.000000	T	0.51346	0.1669	N	0.21545	0.675	0.36414	D	0.863895	P	0.42785	0.79	B	0.40565	0.333	T	0.61739	-0.7001	10	0.56958	D	0.05	.	10.0864	0.42421	0.0976:0.0:0.9024:0.0	.	226	Q53TK1	.	R	226	ENSP00000260630:S226R;ENSP00000384972:S226R	ENSP00000260630:S226R	S	-	3	2	CYP1B1	38155358	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.784000	0.26816	1.127000	0.42034	0.650000	0.86243	AGC	.	.		0.677	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218580.3	NM_000104	
XPO1	7514	hgsc.bcm.edu	37	2	61719221	61719221	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:61719221A>C	ENST00000401558.2	-	16	2563	c.1836T>G	c.(1834-1836)gaT>gaG	p.D612E	XPO1_ENST00000406957.1_Missense_Mutation_p.D612E|XPO1_ENST00000404992.2_Missense_Mutation_p.D612E	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	612	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TCAAAATTTCATCAATAAATG	0.358			Mis		CLL																																p.D612E		Atlas-SNP	.	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	.	XPO1	108	.	0			c.T1836G						.						85.0	81.0	82.0					2																	61719221		2203	4300	6503	SO:0001583	missense	7514	exon16			AATTTCATCAATA	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.1836T>G	chr2.hg19:g.61719221A>C	ENSP00000384863:p.Asp612Glu	156.0	0.0		138.0	42.0	NM_003400	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	ENST00000401558.2	hg19	CCDS33205.1	.	.	.	.	.	.	.	.	.	.	A	7.343	0.621214	0.14193	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.66280	-0.2;-0.2;-0.2	5.73	4.57	0.56435	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.31295	0.0792	N	0.02412	-0.56	0.53688	D	0.999977	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.29761	-1.0001	10	0.02654	T	1	-25.5132	12.1353	0.53968	0.9327:0.0:0.0673:0.0	.	259;612	B3KWD0;O14980	.;XPO1_HUMAN	E	612	ENSP00000384863:D612E;ENSP00000385942:D612E;ENSP00000385559:D612E	ENSP00000384863:D612E	D	-	3	2	XPO1	61572725	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.518000	0.45537	1.090000	0.41315	0.533000	0.62120	GAT	.	.		0.358	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325872.3	NM_003400	
NOTO	344022	hgsc.bcm.edu	37	2	73438038	73438038	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:73438038A>C	ENST00000398468.3	+	3	1146	c.737A>C	c.(736-738)gAg>gCg	p.E246A		NM_001134462.1	NP_001127934.1	A8MTQ0	NOTO_HUMAN	notochord homeobox	246					cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|notochord development (GO:0030903)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)	2						GATGATGCCGAGTCAGGAGTG	0.607																																					p.E246A		Atlas-SNP	.											.	NOTO	20	.	0			c.A737C						.						45.0	44.0	45.0					2																	73438038		692	1591	2283	SO:0001583	missense	344022	exon3			ATGCCGAGTCAGG		CCDS46335.1	2p13.2	2011-06-20	2007-02-15		ENSG00000214513	ENSG00000214513		"""Homeoboxes / ANTP class : NKL subclass"""	31839	protein-coding gene	gene with protein product			"""notochord homolog (Xenopus laevis)"""			15231714	Standard	NM_001134462		Approved		uc010yrd.2	A8MTQ0	OTTHUMG00000164128	ENST00000398468.3:c.737A>C	chr2.hg19:g.73438038A>C	ENSP00000381486:p.Glu246Ala	104.0	0.0		97.0	14.0	NM_001134462	B4DJ59|B7ZAU5	Missense_Mutation	SNP	ENST00000398468.3	hg19	CCDS46335.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.034583	0.35893	.	.	ENSG00000214513	ENST00000398468	D	0.92249	-3.0	5.03	-2.92	0.05615	.	.	.	.	.	D	0.84588	0.5505	L	0.32530	0.975	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.72792	-0.4186	9	0.66056	D	0.02	-0.7267	6.092	0.19999	0.4477:0.3941:0.1583:0.0	.	246	A8MTQ0	NOTO_HUMAN	A	246	ENSP00000381486:E246A	ENSP00000381486:E246A	E	+	2	0	NOTO	73291546	0.001000	0.12720	0.001000	0.08648	0.018000	0.09664	0.228000	0.17814	-0.263000	0.09378	0.528000	0.53228	GAG	.	.		0.607	NOTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377385.2	XM_292889	
DCTN1	1639	hgsc.bcm.edu	37	2	74598683	74598683	+	Missense_Mutation	SNP	G	G	C	rs112725508		TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:74598683G>C	ENST00000361874.3	-	8	943	c.626C>G	c.(625-627)cCg>cGg	p.P209R	DCTN1_ENST00000409438.1_Missense_Mutation_p.P75R|DCTN1_ENST00000394003.3_Missense_Mutation_p.P202R|DCTN1_ENST00000409567.3_Missense_Mutation_p.P189R|DCTN1_ENST00000409868.1_Missense_Mutation_p.P192R|DCTN1_ENST00000409240.1_Missense_Mutation_p.P172R|DCTN1_ENST00000407639.2_Missense_Mutation_p.P75R	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	209					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						GGAAGGAAGCGGGGGGACTGC	0.617																																					p.P209R		Atlas-SNP	.											.,1	DCTN1	110	.	0			c.C626G						.						18.0	19.0	18.0					2																	74598683		2197	4292	6489	SO:0001583	missense	1639	exon8			GGAAGCGGGGGGA		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.626C>G	chr2.hg19:g.74598683G>C	ENSP00000354791:p.Pro209Arg	118.0	0.0		98.0	25.0	NM_004082	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	hg19	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571405	0.65765	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	T;T;T;T;T;T;T	0.78364	-0.79;-0.94;-0.73;-0.73;-1.17;-0.97;-0.95	5.39	5.39	0.77823	.	0.000000	0.42964	D	0.000631	T	0.71693	0.3370	N	0.24115	0.695	0.58432	D	0.999994	P;B;P;P;P;D	0.53885	0.746;0.017;0.938;0.789;0.881;0.963	B;B;B;B;B;P	0.49922	0.222;0.007;0.422;0.164;0.333;0.626	T	0.73503	-0.3962	10	0.54805	T	0.06	-7.0089	11.4861	0.50354	0.0825:0.0:0.9175:0.0	.	189;172;209;202;75;75	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	R	209;202;192;75;75;172;192;189	ENSP00000354791:P209R;ENSP00000377571:P202R;ENSP00000384844:P75R;ENSP00000387270:P75R;ENSP00000386406:P172R;ENSP00000387327:P192R;ENSP00000386843:P189R	ENSP00000354791:P209R	P	-	2	0	DCTN1	74452191	1.000000	0.71417	0.914000	0.36105	0.740000	0.42216	3.674000	0.54598	2.795000	0.96236	0.655000	0.94253	CCG	.	G|0.500;C|0.500		0.617	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	
KDM3A	55818	hgsc.bcm.edu	37	2	86707311	86707311	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:86707311C>T	ENST00000409556.1	+	17	2703	c.2338C>T	c.(2338-2340)Ccg>Tcg	p.P780S	KDM3A_ENST00000542128.1_Missense_Mutation_p.P728S|KDM3A_ENST00000312912.5_Missense_Mutation_p.P780S|KDM3A_ENST00000409064.1_Missense_Mutation_p.P780S			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	780					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						TGGAGAAAAACCGACTCTTGG	0.498																																					p.P780S	NSCLC(96;1150 1523 6936 46253 49736)	Atlas-SNP	.											.	KDM3A	179	.	0			c.C2338T						.						61.0	63.0	62.0					2																	86707311		2203	4300	6503	SO:0001583	missense	55818	exon16			GAAAAACCGACTC	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2338C>T	chr2.hg19:g.86707311C>T	ENSP00000386660:p.Pro780Ser	90.0	0.0		82.0	41.0	NM_001146688	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	hg19	CCDS1990.1	.	.	.	.	.	.	.	.	.	.	C	6.811	0.518633	0.13005	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.58210	0.35;0.35;0.35;0.36	5.86	-1.08	0.09936	.	1.069350	0.07175	N	0.853032	T	0.22513	0.0543	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.18745	-1.0327	10	0.06365	T	0.9	.	1.4047	0.02278	0.1203:0.3442:0.2362:0.2993	.	728;780	F5H070;Q9Y4C1	.;KDM3A_HUMAN	S	780;780;780;780;728	ENSP00000386660:P780S;ENSP00000323659:P780S;ENSP00000386516:P780S;ENSP00000438324:P728S	ENSP00000323659:P780S	P	+	1	0	KDM3A	86560822	0.006000	0.16342	0.006000	0.13384	0.100000	0.18952	-0.012000	0.12699	-0.155000	0.11098	0.650000	0.86243	CCG	.	.		0.498	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252522.2	NM_018433	
MZT2B	80097	hgsc.bcm.edu	37	2	130948160	130948160	+	Silent	SNP	G	G	A	rs376967942		TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:130948160G>A	ENST00000281871.6	+	3	793	c.438G>A	c.(436-438)ggG>ggA	p.G146G	MZT2B_ENST00000409255.1_Silent_p.G206G	NM_025029.3	NP_079305.2	Q6NZ67	MZT2B_HUMAN	mitotic spindle organizing protein 2B	146						centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				lung(1)	1						TGCCCAAGGGGGGCGGGCCTG	0.647																																					p.G146G		Atlas-SNP	.											.	MZT2B	5	.	0			c.G438A						.						35.0	41.0	39.0					2																	130948160		2192	4295	6487	SO:0001819	synonymous_variant	80097	exon3			CAAGGGGGGCGGG	BC066296	CCDS2157.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000152082	ENSG00000152082			25886	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2B"""	613450	"""family with sequence similarity 128, member B"""	FAM128B		20360068	Standard	NM_025029		Approved	FLJ14346, MOZART2B	uc002tqu.3	Q6NZ67	OTTHUMG00000131625	ENST00000281871.6:c.438G>A	chr2.hg19:g.130948160G>A		227.0	0.0		391.0	56.0	NM_025029	Q96CG4	Silent	SNP	ENST00000281871.6	hg19	CCDS2157.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	2.742|2.742	-0.261905|-0.261905	0.05791|0.05791	.|.	.|.	ENSG00000152082|ENSG00000152082	ENST00000425361|ENST00000455239	T|.	0.31510|.	1.49|.	3.59|3.59	0.564|0.564	0.17302|0.17302	.|.	0.572258|0.572258	0.17506|0.17506	N|N	0.171814|0.171814	T|T	0.58836|0.58836	0.2150|0.2150	.|.	.|.	.|.	0.52099|0.52099	D|D	0.999945|0.999945	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.54022|0.54022	-0.8355|-0.8355	7|6	0.56958|0.54805	D|T	0.05|0.06	-15.9954|-15.9954	6.1906|6.1906	0.20522|0.20522	0.1909:0.2824:0.5267:0.0|0.1909:0.2824:0.5267:0.0	.|.	.|.	.|.	.|.	E|R	110|87	ENSP00000398749:G110E|.	ENSP00000398749:G110E|ENSP00000404629:G87R	G|G	+|+	2|1	0|0	MZT2B|MZT2B	130664630|130664630	0.838000|0.838000	0.29461|0.29461	0.111000|0.111000	0.21465|0.21465	0.321000|0.321000	0.28281|0.28281	0.106000|0.106000	0.15354|0.15354	-0.256000|-0.256000	0.09473|0.09473	-1.644000|-1.644000	0.00765|0.00765	GGG|GGG	.	.		0.647	MZT2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254518.1	NM_025029	
LRP1B	53353	hgsc.bcm.edu	37	2	141625315	141625315	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:141625315C>A	ENST00000389484.3	-	27	5394	c.4423G>T	c.(4423-4425)Gtg>Ttg	p.V1475L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1475					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TATAGAGACACAGCAAAGGGA	0.433										TSP Lung(27;0.18)																											p.V1475L	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.G4423T						.						152.0	145.0	147.0					2																	141625315		2203	4300	6503	SO:0001583	missense	53353	exon27			GAGACACAGCAAA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4423G>T	chr2.hg19:g.141625315C>A	ENSP00000374135:p.Val1475Leu	139.0	0.0		198.0	55.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631826	0.46944	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.90004	-2.6;-2.6	5.42	5.42	0.78866	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000003	D	0.85305	0.5666	N	0.20483	0.58	0.53688	D	0.999974	P;D	0.53312	0.879;0.959	P;P	0.52031	0.688;0.556	T	0.81326	-0.0983	10	0.02654	T	1	.	19.2069	0.93734	0.0:1.0:0.0:0.0	.	658;1475	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	L	1475;1413;620	ENSP00000374135:V1475L;ENSP00000413239:V620L	ENSP00000374135:V1475L	V	-	1	0	LRP1B	141341785	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.723000	0.84788	2.547000	0.85894	0.655000	0.94253	GTG	.	.		0.433	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
TTN	7273	hgsc.bcm.edu	37	2	179433557	179433557	+	Missense_Mutation	SNP	G	G	T	rs541266544	byFrequency	TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:179433557G>T	ENST00000591111.1	-	276	72603	c.72379C>A	c.(72379-72381)Ctt>Att	p.L24127I	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.L16895I|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.L25768I|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.L16828I|TTN_ENST00000460472.2_Missense_Mutation_p.L16703I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L23200I|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	24127	Fibronectin type-III 75. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTCTAAAAAGATATTCTTCC	0.418													G|||	2	0.000399361	0.0	0.0	5008	,	,		24017	0.0		0.0	False		,,,				2504	0.002				p.L25768I		Atlas-SNP	.											.	TTN	18412	.	0			c.C77302A						.						95.0	93.0	94.0					2																	179433557		1882	4109	5991	SO:0001583	missense	7273	exon326			TAAAAAGATATTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.72379C>A	chr2.hg19:g.179433557G>T	ENSP00000465570:p.Leu24127Ile	83.0	0.0		111.0	15.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	12.91	2.079889	0.36662	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	5.83	5.83	0.93111	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.38719	0.1051	N	0.05280	-0.08	0.44417	D	0.997331	B;B;B;B	0.25772	0.134;0.134;0.134;0.134	B;B;B;B	0.27170	0.077;0.077;0.077;0.077	T	0.36696	-0.9737	9	0.87932	D	0	.	20.111	0.97911	0.0:0.0:1.0:0.0	.	16703;16828;16895;24127	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	23200;16703;16895;16828;16701	ENSP00000343764:L23200I;ENSP00000434586:L16703I;ENSP00000340554:L16895I;ENSP00000352154:L16828I	ENSP00000340554:L16895I	L	-	1	0	TTN	179141803	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.263000	0.58853	2.747000	0.94245	0.650000	0.86243	CTT	.	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FZD7	8324	hgsc.bcm.edu	37	2	202900925	202900925	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:202900925C>T	ENST00000286201.1	+	1	1616	c.1555C>T	c.(1555-1557)Cac>Tac	p.H519Y	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	519					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CCCGCCCGGCCACTTCCCGCC	0.627											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H519Y		Atlas-SNP	.											.	FZD7	70	.	0			c.C1555T						.						55.0	58.0	57.0					2																	202900925		2203	4300	6503	SO:0001583	missense	8324	exon1			CCCGGCCACTTCC	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1555C>T	chr2.hg19:g.202900925C>T	ENSP00000286201:p.His519Tyr	64.0	0.0	2133	103.0	60.0	NM_003507	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	ENST00000286201.1	hg19	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	C	1.901	-0.453086	0.04540	.	.	ENSG00000155760	ENST00000286201	D	0.81821	-1.54	5.72	5.72	0.89469	GPCR, family 2-like (1);	0.110494	0.64402	D	0.000015	T	0.61362	0.2341	N	0.04508	-0.205	0.45378	D	0.998366	B	0.06786	0.001	B	0.04013	0.001	T	0.58418	-0.7640	10	0.16420	T	0.52	.	14.686	0.69049	0.1451:0.8549:0.0:0.0	.	519	O75084	FZD7_HUMAN	Y	519	ENSP00000286201:H519Y	ENSP00000286201:H519Y	H	+	1	0	FZD7	202609170	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.585000	0.46111	2.711000	0.92665	0.655000	0.94253	CAC	.	.		0.627	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
CCDC108	255101	hgsc.bcm.edu	37	2	219888857	219888857	+	Silent	SNP	A	A	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:219888857A>C	ENST00000341552.5	-	15	2558	c.2475T>G	c.(2473-2475)acT>acG	p.T825T	CCDC108_ENST00000441968.1_Silent_p.T825T|CCDC108_ENST00000453220.1_Silent_p.T825T	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	825						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAAGGCCCGAAGTGGGCCGAA	0.612																																					p.T825T		Atlas-SNP	.											.	CCDC108	208	.	0			c.T2475G						.						59.0	65.0	63.0					2																	219888857		2203	4300	6503	SO:0001819	synonymous_variant	255101	exon15			GCCCGAAGTGGGC	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.2475T>G	chr2.hg19:g.219888857A>C		168.0	0.0		232.0	30.0	NM_194302	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Silent	SNP	ENST00000341552.5	hg19	CCDS2430.2																																																																																			.	.		0.612	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
ABCB6	10058	hgsc.bcm.edu	37	2	220079752	220079752	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:220079752T>C	ENST00000265316.3	-	6	1523	c.1207A>G	c.(1207-1209)Atc>Gtc	p.I403V	ABCB6_ENST00000439002.2_Missense_Mutation_p.I357V	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	403	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGAAGTAGATGATGCCAATG	0.527																																					p.I403V		Atlas-SNP	.											.	ABCB6	76	.	0			c.A1207G						.						228.0	171.0	191.0					2																	220079752		2203	4300	6503	SO:0001583	missense	10058	exon6			AGTAGATGATGCC	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.1207A>G	chr2.hg19:g.220079752T>C	ENSP00000265316:p.Ile403Val	86.0	0.0		148.0	20.0	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	ENST00000265316.3	hg19	CCDS2436.1	.	.	.	.	.	.	.	.	.	.	T	9.985	1.229178	0.22542	.	.	ENSG00000115657	ENST00000265316;ENST00000439002	D;D	0.89485	-2.52;-2.52	5.97	-1.62	0.08372	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.285044	0.39475	N	0.001353	T	0.69975	0.3171	N	0.04203	-0.255	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.12837	0.003;0.008	T	0.59144	-0.7509	10	0.05721	T	0.95	-10.2155	12.8957	0.58098	0.0:0.6679:0.0:0.3321	.	357;403	Q9NP58-4;Q9NP58	.;ABCB6_HUMAN	V	403;357	ENSP00000265316:I403V;ENSP00000394333:I357V	ENSP00000265316:I403V	I	-	1	0	ABCB6	219787996	0.924000	0.31332	0.993000	0.49108	0.997000	0.91878	-0.003000	0.12901	-0.265000	0.09352	0.533000	0.62120	ATC	.	.		0.527	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
ATG7	10533	hgsc.bcm.edu	37	3	11406156	11406156	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr3:11406156G>T	ENST00000354449.3	+	16	1848	c.1823G>T	c.(1822-1824)aGt>aTt	p.S608I	ATG7_ENST00000354956.5_Missense_Mutation_p.S608I|ATG7_ENST00000446450.2_Missense_Mutation_p.S569I	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	608					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						GCCAGCAGCAGTGACGATCGG	0.473																																					p.S608I		Atlas-SNP	.											.	ATG7	56	.	0			c.G1823T						.						204.0	183.0	190.0					3																	11406156		2203	4300	6503	SO:0001583	missense	10533	exon16			GCAGCAGTGACGA	AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.1823G>T	chr3.hg19:g.11406156G>T	ENSP00000346437:p.Ser608Ile	97.0	0.0		85.0	4.0	NM_001136031	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	ENST00000354449.3	hg19	CCDS2605.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	25.9|25.9|25.9	4.689319|4.689319|4.689319	0.88735|0.88735|0.88735	.|.|.	.|.|.	ENSG00000197548|ENSG00000197548|ENSG00000197548	ENST00000446110|ENST00000446450;ENST00000354956;ENST00000354449;ENST00000414717|ENST00000427759	.|T;T;T|.	.|0.48836|.	.|0.83;0.8;0.84|.	5.32|5.32|5.32	5.32|5.32|5.32	0.75619|0.75619|0.75619	.|Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.76054|0.76054|0.76054	0.3934|0.3934|0.3934	M|M|M	0.70595|0.70595|0.70595	2.14|2.14|2.14	0.58432|0.58432|0.58432	D|D|D	0.999996|0.999996|0.999996	.|P;D;D|.	.|0.61080|.	.|0.947;0.989;0.981|.	.|P;P;P|.	.|0.59288|.	.|0.591;0.855;0.629|.	T|T|T	0.74728|0.74728|0.74728	-0.3567|-0.3567|-0.3567	5|10|5	.|0.54805|.	.|T|.	.|0.06|.	-15.5238|-15.5238|-15.5238	19.3933|19.3933|19.3933	0.94594|0.94594|0.94594	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|569;608;608|.	.|E9PB95;O95352-2;O95352|.	.|.;.;ATG7_HUMAN|.	H|I|L	8|569;608;608;9|9	.|ENSP00000412580:S569I;ENSP00000347042:S608I;ENSP00000346437:S608I|.	.|ENSP00000346437:S608I|.	Q|S|V	+|+|+	3|2|1	2|0|0	ATG7|ATG7|ATG7	11381156|11381156|11381156	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	9.079000|9.079000|9.079000	0.94032|0.94032|0.94032	2.648000|2.648000|2.648000	0.89879|0.89879|0.89879	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	CAG|AGT|GTG	.	.		0.473	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251951.3	NM_006395	
IQSEC1	9922	hgsc.bcm.edu	37	3	12944273	12944273	+	Splice_Site	SNP	T	T	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr3:12944273T>G	ENST00000273221.4	-	13	3063	c.2847A>C	c.(2845-2847)gaA>gaC	p.E949D		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	949					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCCTACTTACTTCCACATTGC	0.517																																					p.E949D		Atlas-SNP	.											.	IQSEC1	88	.	0			c.A2847C						.						81.0	65.0	70.0					3																	12944273		2203	4300	6503	SO:0001630	splice_region_variant	9922	exon13			ACTTACTTCCACA	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2847+1A>C	chr3.hg19:g.12944273T>G		258.0	0.0		252.0	17.0	NM_014869	O94863|Q96D85	Missense_Mutation	SNP	ENST00000273221.4	hg19	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	N	33	5.202967	0.94997	.	.	ENSG00000144711	ENST00000273221;ENST00000435445;ENST00000429247	T;T	0.53423	0.62;0.62	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.67363	0.2885	.	.	.	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.67900	0.954;0.876	T	0.69183	-0.5212	8	.	.	.	.	15.6315	0.76912	0.0:0.0:0.0:1.0	.	935;949	E9PG60;Q6DN90	.;IQEC1_HUMAN	D	949;935;935	ENSP00000273221:E949D;ENSP00000402299:E935D	.	E	-	3	2	IQSEC1	12919273	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.655000	0.67981	2.084000	0.62774	0.528000	0.53228	GAA	.	.		0.517	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	Missense_Mutation
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	180.0	0.0		116.0	45.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
TMF1	7110	hgsc.bcm.edu	37	3	69101099	69101099	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr3:69101099G>A	ENST00000398559.2	-	1	355	c.139C>T	c.(139-141)Ccg>Tcg	p.P47S	CTD-2013N24.2_ENST00000595925.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.P47S|MIR3136_ENST00000583498.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	47					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CTCTTACCCGGCTCTCCATAC	0.587																																					p.P47S		Atlas-SNP	.											.	TMF1	77	.	0			c.C139T						.						70.0	76.0	74.0					3																	69101099		1915	4133	6048	SO:0001583	missense	7110	exon1			TACCCGGCTCTCC		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.139C>T	chr3.hg19:g.69101099G>A	ENSP00000381567:p.Pro47Ser	77.0	0.0		70.0	4.0	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	hg19	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010581	0.35511	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248;ENST00000438636	T;T	0.16457	2.34;2.34	5.31	5.31	0.75309	.	0.325662	0.33477	N	0.004864	T	0.16128	0.0388	L	0.54323	1.7	0.39156	D	0.962329	B;B	0.27140	0.169;0.064	B;B	0.24006	0.05;0.023	T	0.04752	-1.0929	10	0.08837	T	0.75	.	14.058	0.64781	0.0:0.1505:0.8495:0.0	.	47;47	P82094-2;P82094	.;TMF1_HUMAN	S	47	ENSP00000381567:P47S;ENSP00000438706:P47S	ENSP00000348582:P47S	P	-	1	0	TMF1	69183789	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	2.680000	0.46918	2.633000	0.89246	0.591000	0.81541	CCG	.	.		0.587	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
KLHL6	89857	hgsc.bcm.edu	37	3	183212026	183212026	+	Silent	SNP	C	C	A	rs2256061	byFrequency	TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr3:183212026C>A	ENST00000341319.3	-	5	1226	c.1191G>T	c.(1189-1191)tcG>tcT	p.S397S		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	397					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			ACTTGTTGATCGAAGAATTAT	0.418																																					p.S397S		Atlas-SNP	.											.	KLHL6	100	.	0			c.G1191T						.						154.0	151.0	152.0					3																	183212026		2203	4300	6503	SO:0001819	synonymous_variant	89857	exon5			GTTGATCGAAGAA	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.1191G>T	chr3.hg19:g.183212026C>A		129.0	0.0		91.0	18.0	NM_130446	B2RB31|D3DNS8|Q8N5I1|Q8N892	Silent	SNP	ENST00000341319.3	hg19	CCDS3245.2																																																																																			.	C|0.818;T|0.182		0.418	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
ATP10D	57205	hgsc.bcm.edu	37	4	47527592	47527592	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr4:47527592G>A	ENST00000273859.3	+	5	978	c.709G>A	c.(709-711)Gag>Aag	p.E237K	ATP10D_ENST00000504445.1_Missense_Mutation_p.E237K	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	237					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						AGTTGATCCTGAGAAGTTTTC	0.348																																					p.E237K		Atlas-SNP	.											.	ATP10D	168	.	0			c.G709A						.						79.0	80.0	79.0					4																	47527592		2203	4300	6503	SO:0001583	missense	57205	exon5			GATCCTGAGAAGT	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.709G>A	chr4.hg19:g.47527592G>A	ENSP00000273859:p.Glu237Lys	89.0	0.0		93.0	46.0	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	hg19	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.186022	0.57909	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.74526	-0.85;-0.85	5.76	5.76	0.90799	ATPase, P-type, ATPase-associated domain (1);	0.115441	0.64402	D	0.000020	T	0.70090	0.3184	L	0.37630	1.12	0.39974	D	0.974832	B;B	0.33549	0.417;0.236	B;B	0.40982	0.345;0.261	T	0.64024	-0.6504	10	0.09084	T	0.74	-15.5687	19.3193	0.94231	0.0:0.0:1.0:0.0	.	237;237	Q9P241;Q6PEW3	AT10D_HUMAN;.	K	237	ENSP00000273859:E237K;ENSP00000420909:E237K	ENSP00000273859:E237K	E	+	1	0	ATP10D	47222349	1.000000	0.71417	0.997000	0.53966	0.926000	0.56050	7.654000	0.83653	2.871000	0.98454	0.655000	0.94253	GAG	.	.		0.348	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
SCD5	79966	hgsc.bcm.edu	37	4	83719510	83719510	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr4:83719510C>T	ENST00000319540.4	-	1	500	c.181G>A	c.(181-183)Gtg>Atg	p.V61M	SCD5_ENST00000282709.4_Missense_Mutation_p.V61M|SCD5_ENST00000273908.4_Missense_Mutation_p.V61M	NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	61					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				AGGGAGTACACGGCCCCCAAG	0.711																																					p.V61M		Atlas-SNP	.											.	SCD5	58	.	0			c.G181A						.						52.0	45.0	47.0					4																	83719510		2203	4300	6503	SO:0001583	missense	79966	exon1			AGTACACGGCCCC	AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.181G>A	chr4.hg19:g.83719510C>T	ENSP00000316329:p.Val61Met	140.0	0.0		97.0	4.0	NM_024906	B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	ENST00000319540.4	hg19	CCDS34024.1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782740	0.70222	.	.	ENSG00000145284	ENST00000319540;ENST00000273908;ENST00000282709	T	0.49432	0.78	4.77	0.537	0.17144	.	0.566432	0.17256	N	0.180944	T	0.56217	0.1970	L	0.51422	1.61	0.32879	D	0.510265	D;D;D	0.76494	0.999;0.998;0.963	D;D;P	0.65233	0.913;0.933;0.489	T	0.64859	-0.6308	10	0.72032	D	0.01	0.0619	10.0677	0.42315	0.1298:0.4496:0.4206:0.0	.	61;61;61	Q9BSN4;Q86SK9-2;Q86SK9	.;.;SCD5_HUMAN	M	61	ENSP00000316329:V61M	ENSP00000273908:V61M	V	-	1	0	SCD5	83938534	0.797000	0.28877	0.996000	0.52242	0.989000	0.77384	0.069000	0.14552	0.158000	0.19367	0.542000	0.68232	GTG	.	.		0.711	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252635.1	NM_024906	
CWC27	10283	hgsc.bcm.edu	37	5	64267604	64267604	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr5:64267604C>A	ENST00000381070.3	+	12	1334	c.1117C>A	c.(1117-1119)Caa>Aaa	p.Q373K	CWC27_ENST00000545000.1_3'UTR	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	373					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						TTTGAGGAAGCAACAGTCAAA	0.368																																					p.Q373K		Atlas-SNP	.											.	CWC27	47	.	0			c.C1117A						.						58.0	60.0	59.0					5																	64267604		2203	4300	6503	SO:0001583	missense	10283	exon12			AGGAAGCAACAGT	AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.1117C>A	chr5.hg19:g.64267604C>A	ENSP00000370460:p.Gln373Lys	266.0	0.0		217.0	43.0	NM_005869	O60529|O60530|Q96EM3	Missense_Mutation	SNP	ENST00000381070.3	hg19	CCDS3982.2	.	.	.	.	.	.	.	.	.	.	C	5.965	0.361948	0.11296	.	.	ENSG00000153015	ENST00000381070;ENST00000538793	T	0.21543	2.0	6.01	6.01	0.97437	.	0.117930	0.64402	D	0.000017	T	0.13030	0.0316	N	0.17723	0.515	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.0	T	0.05370	-1.0889	10	0.02654	T	1	.	15.2612	0.73625	0.1402:0.8598:0.0:0.0	.	373;373	Q6UX04-2;Q6UX04	.;CWC27_HUMAN	K	373	ENSP00000370460:Q373K	ENSP00000370460:Q373K	Q	+	1	0	CWC27	64303360	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.829000	0.55760	2.861000	0.98227	0.650000	0.86243	CAA	.	.		0.368	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157247.4	NM_005869	
DMXL1	1657	hgsc.bcm.edu	37	5	118485628	118485628	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr5:118485628G>A	ENST00000311085.8	+	18	4186	c.4106G>A	c.(4105-4107)cGc>cAc	p.R1369H	DMXL1_ENST00000539542.1_Missense_Mutation_p.R1369H	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1369										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		AATCATGAACGCCGCCTTAGG	0.463																																					p.R1369H		Atlas-SNP	.											DMXL1,NS,carcinoma,0,1	DMXL1	268	.	0			c.G4106A						.						78.0	78.0	78.0					5																	118485628		2202	4300	6502	SO:0001583	missense	1657	exon18			ATGAACGCCGCCT	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.4106G>A	chr5.hg19:g.118485628G>A	ENSP00000309690:p.Arg1369His	81.0	0.0		80.0	16.0	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	hg19	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.057785	0.55325	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.42513	0.97;0.97	5.56	5.56	0.83823	.	0.045776	0.85682	D	0.000000	T	0.45438	0.1342	M	0.83012	2.62	0.43756	D	0.99626	B;B	0.33379	0.41;0.329	B;B	0.26094	0.058;0.066	T	0.52540	-0.8562	10	0.72032	D	0.01	-8.6645	12.6884	0.56960	0.1185:0.0:0.8815:0.0	.	1369;1369	F5H269;Q9Y485	.;DMXL1_HUMAN	H	1369	ENSP00000309690:R1369H;ENSP00000439479:R1369H	ENSP00000309690:R1369H	R	+	2	0	DMXL1	118513527	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.343000	0.52167	2.778000	0.95560	0.655000	0.94253	CGC	.	.		0.463	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
CTXN3	613212	hgsc.bcm.edu	37	5	126993411	126993411	+	Silent	SNP	T	T	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr5:126993411T>C	ENST00000379445.3	+	3	749	c.198T>C	c.(196-198)gaT>gaC	p.D66D	CTC-548H10.2_ENST00000512352.1_RNA|CTXN3_ENST00000395322.3_Silent_p.D66D	NM_001048252.2	NP_001041717.1	Q4LDR2	CTXN3_HUMAN	cortexin 3	66						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0128)|COAD - Colon adenocarcinoma(49;0.0234)|OV - Ovarian serous cystadenocarcinoma(64;0.038)		CCTGGGCTGATGGACTTGAAG	0.498																																					p.D66D		Atlas-SNP	.											.	CTXN3	19	.	0			c.T198C						.						92.0	86.0	88.0					5																	126993411		2203	4300	6503	SO:0001819	synonymous_variant	613212	exon3			GGCTGATGGACTT	AB219764	CCDS34221.1	5q23.2	2006-09-21				ENSG00000205279			31110	protein-coding gene	gene with protein product							Standard	NM_001048252		Approved		uc003kum.4	Q4LDR2		ENST00000379445.3:c.198T>C	chr5.hg19:g.126993411T>C		148.0	0.0		112.0	27.0	NM_001048252	B2RV32|D3DQ82	Silent	SNP	ENST00000379445.3	hg19	CCDS34221.1																																																																																			.	.		0.498	CTXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372467.1	XM_932841	
STK32A	202374	hgsc.bcm.edu	37	5	146750236	146750236	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr5:146750236C>G	ENST00000397936.3	+	9	1013	c.680C>G	c.(679-681)tCc>tGc	p.S227C	STK32A_ENST00000398523.3_Missense_Mutation_p.S227C	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	227	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.S227F(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATATTCGCTCCAGTACTTCC	0.373																																					p.S227C		Atlas-SNP	.											STK32A,NS,carcinoma,0,1	STK32A	54	.	1	Substitution - Missense(1)	lung(1)	c.C680G						.						172.0	150.0	156.0					5																	146750236		1568	3582	5150	SO:0001583	missense	202374	exon9			TTCGCTCCAGTAC		CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.680C>G	chr5.hg19:g.146750236C>G	ENSP00000381030:p.Ser227Cys	107.0	0.0		74.0	21.0	NM_001112724	B3KSY0	Missense_Mutation	SNP	ENST00000397936.3	hg19	CCDS47299.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486314	0.84854	.	.	ENSG00000169302	ENST00000397936;ENST00000398523	T;T	0.27720	1.65;1.65	5.52	5.52	0.82312	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47093	D	0.000250	T	0.54111	0.1838	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.989;0.985;0.987	T	0.53690	-0.8403	10	0.87932	D	0	.	18.563	0.91107	0.0:1.0:0.0:0.0	.	227;227;227	B7Z9H7;Q8WU08;Q8WU08-3	.;ST32A_HUMAN;.	C	227	ENSP00000381030:S227C;ENSP00000381535:S227C	ENSP00000381030:S227C	S	+	2	0	STK32A	146730429	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.980000	0.76160	2.761000	0.94854	0.655000	0.94253	TCC	.	.		0.373	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373306.1	NM_145001	
ANKRD6	22881	hgsc.bcm.edu	37	6	90312775	90312775	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr6:90312775A>C	ENST00000522441.1	+	4	888	c.247A>C	c.(247-249)Aca>Cca	p.T83P	ANKRD6_ENST00000339746.4_Missense_Mutation_p.T83P|ANKRD6_ENST00000520793.1_Missense_Mutation_p.T83P|ANKRD6_ENST00000485637.1_Missense_Mutation_p.T83P|ANKRD6_ENST00000369408.5_Missense_Mutation_p.T83P|ANKRD6_ENST00000520886.2_3'UTR|ANKRD6_ENST00000447838.2_Missense_Mutation_p.T83P	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	83					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		GCACCGGGCCACAGTGGTGGG	0.602																																					p.T83P		Atlas-SNP	.											.	ANKRD6	51	.	0			c.A247C						.						36.0	42.0	40.0					6																	90312775		2110	4219	6329	SO:0001583	missense	22881	exon4			CGGGCCACAGTGG	AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.247A>C	chr6.hg19:g.90312775A>C	ENSP00000430985:p.Thr83Pro	78.0	0.0		55.0	7.0	NM_001242809	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Missense_Mutation	SNP	ENST00000522441.1	hg19	CCDS56441.1	.	.	.	.	.	.	.	.	.	.	A	19.19	3.778898	0.70107	.	.	ENSG00000135299	ENST00000369408;ENST00000339746;ENST00000447838;ENST00000465722;ENST00000523798;ENST00000522441;ENST00000522779;ENST00000485637;ENST00000522705;ENST00000520793	T;T;T;T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;0.93;-0.14;-0.14;-0.14	5.93	-2.33	0.06724	Ankyrin repeat-containing domain (4);	0.462791	0.20253	N	0.096025	T	0.41811	0.1175	L	0.54965	1.715	0.80722	D	1	B;P;P;B	0.44006	0.324;0.824;0.789;0.25	B;P;B;B	0.44772	0.268;0.46;0.33;0.197	T	0.49123	-0.8972	10	0.72032	D	0.01	-1.773	7.9158	0.29816	0.3798:0.0:0.4991:0.1211	.	83;83;83;83	B3KUC3;Q9Y2G4;Q9Y2G4-1;C9JJE8	.;ANKR6_HUMAN;.;.	P	83;83;83;83;83;83;50;83;83;83	ENSP00000358416:T83P;ENSP00000345767:T83P;ENSP00000396771:T83P;ENSP00000429431:T83P;ENSP00000428377:T83P;ENSP00000430985:T83P;ENSP00000429337:T50P;ENSP00000430954:T83P;ENSP00000428309:T83P;ENSP00000429782:T83P	ENSP00000345767:T83P	T	+	1	0	ANKRD6	90369494	0.958000	0.32768	0.827000	0.32855	0.903000	0.53119	1.096000	0.30976	-0.066000	0.12998	0.533000	0.62120	ACA	.	.		0.602	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376594.1		
PHF14	9678	hgsc.bcm.edu	37	7	11082380	11082380	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr7:11082380C>G	ENST00000403050.3	+	13	2703	c.2251C>G	c.(2251-2253)Cat>Gat	p.H751D	PHF14_ENST00000445996.2_Missense_Mutation_p.H466D	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	751					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		ACTACATTACCATCTTGGATG	0.348																																					p.H751D		Atlas-SNP	.											.	PHF14	90	.	0			c.C2251G						.						115.0	106.0	109.0					7																	11082380		1840	4093	5933	SO:0001583	missense	9678	exon13			CATTACCATCTTG	AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.2251C>G	chr7.hg19:g.11082380C>G	ENSP00000385795:p.His751Asp	67.0	0.0		89.0	38.0	NM_014660	A7MCZ3|B4DI82	Missense_Mutation	SNP	ENST00000403050.3	hg19	CCDS47542.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287471	0.80803	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	D;D	0.99005	-5.32;-5.32	5.5	5.5	0.81552	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.049085	0.85682	D	0.000000	D	0.99674	0.9878	H	0.99325	4.515	0.80722	D	1	P;D;D;D	0.76494	0.948;0.968;0.992;0.999	B;D;P;D	0.75484	0.279;0.954;0.817;0.986	D	0.97259	0.9903	10	0.87932	D	0	.	19.4032	0.94639	0.0:1.0:0.0:0.0	.	466;466;751;751	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	D	751;466	ENSP00000385795:H751D;ENSP00000403907:H466D	ENSP00000385795:H751D	H	+	1	0	PHF14	11048905	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.748000	0.85085	2.590000	0.87494	0.591000	0.81541	CAT	.	.		0.348	PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1	NM_014660	
AMPH	273	hgsc.bcm.edu	37	7	38429486	38429486	+	Silent	SNP	A	A	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr7:38429486A>G	ENST00000356264.2	-	20	2114	c.1899T>C	c.(1897-1899)ttT>ttC	p.F633F	AMPH_ENST00000428293.2_Silent_p.F591F|AMPH_ENST00000471913.1_5'Flank|AMPH_ENST00000325590.5_Silent_p.F591F	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	633	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						TTGCTGCCTCAAAATCATGCA	0.418																																					p.F633F		Atlas-SNP	.											.	AMPH	157	.	0			c.T1899C						.						154.0	145.0	148.0					7																	38429486		2203	4300	6503	SO:0001819	synonymous_variant	273	exon20			TGCCTCAAAATCA		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1899T>C	chr7.hg19:g.38429486A>G		69.0	0.0		60.0	29.0	NM_001635	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Silent	SNP	ENST00000356264.2	hg19	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	A	10.33	1.319136	0.23994	.	.	ENSG00000078053	ENST00000441628	.	.	.	5.04	-0.846	0.10734	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-16.6732	9.4145	0.38512	0.6506:0.0:0.3494:0.0	.	.	.	.	R	516	.	.	X	-	1	0	AMPH	38396011	0.998000	0.40836	0.996000	0.52242	0.986000	0.74619	0.684000	0.25364	-0.197000	0.10350	0.383000	0.25322	TGA	.	.		0.418	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
ROR2	4920	hgsc.bcm.edu	37	9	94487147	94487147	+	Silent	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr9:94487147C>T	ENST00000375708.3	-	9	1827	c.1629G>A	c.(1627-1629)gtG>gtA	p.V543V	ROR2_ENST00000375715.1_Silent_p.V403V|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	543	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GGTCCTTGGTCACCACGCCCA	0.647																																					p.V543V		Atlas-SNP	.											.	ROR2	167	.	0			c.G1629A						.						71.0	70.0	71.0					9																	94487147		2203	4300	6503	SO:0001819	synonymous_variant	4920	exon9			CTTGGTCACCACG	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1629G>A	chr9.hg19:g.94487147C>T		47.0	0.0		48.0	15.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Silent	SNP	ENST00000375708.3	hg19	CCDS6691.1																																																																																			.	.		0.647	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
ACTL7B	10880	hgsc.bcm.edu	37	9	111617803	111617803	+	Silent	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr9:111617803G>A	ENST00000374667.3	-	1	1436	c.408C>T	c.(406-408)acC>acT	p.T136T		NM_006686.3	NP_006677.1	Q9Y614	ACL7B_HUMAN	actin-like 7B	136						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TCTTCATGGCGGTGCGGAAGA	0.622																																					p.T136T		Atlas-SNP	.											.	ACTL7B	57	.	0			c.C408T						.						68.0	49.0	55.0					9																	111617803		2203	4300	6503	SO:0001819	synonymous_variant	10880	exon1			CATGGCGGTGCGG	BC033789	CCDS6771.1	9q31	2009-05-15			ENSG00000148156	ENSG00000148156			162	protein-coding gene	gene with protein product		604304				10373328, 12907721	Standard	NM_006686		Approved	Tact1	uc004bdi.3	Q9Y614	OTTHUMG00000020462	ENST00000374667.3:c.408C>T	chr9.hg19:g.111617803G>A		74.0	0.0		86.0	14.0	NM_006686	B2R9Q2|Q5JSV1	Silent	SNP	ENST00000374667.3	hg19	CCDS6771.1																																																																																			.	.		0.622	ACTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053571.1	NM_006686	
FBXW5	54461	hgsc.bcm.edu	37	9	139836598	139836598	+	Silent	SNP	G	G	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr9:139836598G>C	ENST00000325285.3	-	6	1075	c.996C>G	c.(994-996)gcC>gcG	p.A332A	FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	332					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		TGTGGCCCTGGGCCAGCAGCT	0.662																																					p.A332A		Atlas-SNP	.											.	FBXW5	36	.	0			c.C996G						.						76.0	82.0	80.0					9																	139836598		2195	4297	6492	SO:0001819	synonymous_variant	54461	exon6			GCCCTGGGCCAGC	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.996C>G	chr9.hg19:g.139836598G>C		54.0	0.0		72.0	23.0	NM_018998	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Silent	SNP	ENST00000325285.3	hg19	CCDS7014.1																																																																																			.	.		0.662	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1	NM_018998	
CACNA1B	774	hgsc.bcm.edu	37	9	140773613	140773613	+	Splice_Site	SNP	T	T	C	rs201604190		TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr9:140773613T>C	ENST00000371372.1	+	2	535		c.e2+2		RP11-188C12.3_ENST00000371390.1_RNA|CACNA1B_ENST00000371355.4_Splice_Site|CACNA1B_ENST00000371363.1_Splice_Site|CACNA1B_ENST00000371357.1_Splice_Site|CACNA1B_ENST00000277549.5_Splice_Site|CACNA1B_ENST00000277551.2_Splice_Site	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit						calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.?(2)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGCGGCTGGTGAGTGCCCGG	0.632																																					.		Atlas-SNP	.											CACNA1B,colon,carcinoma,0,8	CACNA1B	266	.	2	Unknown(2)	lung(1)|breast(1)	c.390+2T>C						.						25.0	29.0	28.0					9																	140773613		2104	4235	6339	SO:0001630	splice_region_variant	774	exon2			GGCTGGTGAGTGC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.390+2T>C	chr9.hg19:g.140773613T>C		54.0	0.0		49.0	0.0	NM_001243812	B1AQK5	Splice_Site	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.860228	0.71834	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	.	.	.	4.73	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6445	0.51253	0.0:0.0:0.1485:0.8515	.	.	.	.	.	-1	.	.	.	+	.	.	CACNA1B	139893434	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.830000	0.86741	0.644000	0.30656	0.459000	0.35465	.	.	.		0.632	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	Intron
BMS1	9790	hgsc.bcm.edu	37	10	43312903	43312903	+	Nonsense_Mutation	SNP	T	T	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr10:43312903T>G	ENST00000374518.5	+	15	2604	c.2541T>G	c.(2539-2541)taT>taG	p.Y847*		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	847					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AAAGCACATATTTTGATGATC	0.408																																					p.Y847X		Atlas-SNP	.											.	BMS1	132	.	0			c.T2541G						.						45.0	47.0	46.0					10																	43312903		2126	3979	6105	SO:0001587	stop_gained	9790	exon15			CACATATTTTGAT	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.2541T>G	chr10.hg19:g.43312903T>G	ENSP00000363642:p.Tyr847*	81.0	0.0		72.0	21.0	NM_014753	Q5QPT5|Q86XJ9	Nonsense_Mutation	SNP	ENST00000374518.5	hg19	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	T	39	7.516801	0.98332	.	.	ENSG00000165733	ENST00000374518	.	.	.	5.56	-4.7	0.03288	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5885	0.87989	0.0:0.7442:0.0:0.2558	.	.	.	.	X	847	.	ENSP00000363642:Y847X	Y	+	3	2	BMS1	42632909	0.953000	0.32496	0.935000	0.37517	0.998000	0.95712	0.119000	0.15626	-0.894000	0.03925	0.451000	0.29950	TAT	.	.		0.408	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
ERCC6	2074	hgsc.bcm.edu	37	10	50681069	50681069	+	Silent	SNP	T	T	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr10:50681069T>C	ENST00000355832.5	-	15	2793	c.2715A>G	c.(2713-2715)acA>acG	p.T905T	ERCC6_ENST00000542458.1_Silent_p.T275T|ERCC6_ENST00000465653.1_5'Flank|RP11-123B3.2_ENST00000423283.1_RNA	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	905	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CAAATATGGATGTGTCCTAGA	0.493								Direct reversal of damage;Nucleotide excision repair (NER)																													p.X905W		Atlas-SNP	.											.	ERCC6	162	.	0			c.A2715G						.						69.0	63.0	65.0					10																	50681069		2203	4300	6503	SO:0001819	synonymous_variant	2074	exon15			TATGGATGTGTCC	L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2715A>G	chr10.hg19:g.50681069T>C		196.0	0.0		215.0	70.0	NM_000124	D3DX94|Q5W0L9	Missense_Mutation	SNP	ENST00000355832.5	hg19	CCDS7229.1																																																																																			.	.		0.493	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047990.1	NM_000124	
EGR2	1959	hgsc.bcm.edu	37	10	64573833	64573833	+	Silent	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr10:64573833G>A	ENST00000242480.3	-	2	890	c.565C>T	c.(565-567)Ctg>Ttg	p.L189L	EGR2_ENST00000493899.2_5'Flank|EGR2_ENST00000439032.1_Silent_p.L189L|EGR2_ENST00000411732.1_Silent_p.L139L	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	189					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					GCTGCTGACAGGAACGCAGAA	0.622																																					p.L189L		Atlas-SNP	.											.	EGR2	77	.	0			c.C565T						.						94.0	93.0	93.0					10																	64573833		2203	4300	6503	SO:0001819	synonymous_variant	1959	exon2			CTGACAGGAACGC	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.565C>T	chr10.hg19:g.64573833G>A		144.0	0.0		157.0	14.0	NM_000399	B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Silent	SNP	ENST00000242480.3	hg19	CCDS7267.1																																																																																			.	.		0.622	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2	NM_000399	
HKDC1	80201	hgsc.bcm.edu	37	10	71010157	71010157	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr10:71010157T>C	ENST00000354624.5	+	11	1815	c.1682T>C	c.(1681-1683)aTc>aCc	p.I561T	HKDC1_ENST00000395086.2_Missense_Mutation_p.I561T	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	561	Hexokinase type-1 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						ATCTTCGCCATCCCCCTGGAG	0.592																																					p.I561T		Atlas-SNP	.											.	HKDC1	98	.	0			c.T1682C						.						114.0	99.0	104.0					10																	71010157		2203	4300	6503	SO:0001583	missense	80201	exon11			TCGCCATCCCCCT		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.1682T>C	chr10.hg19:g.71010157T>C	ENSP00000346643:p.Ile561Thr	88.0	0.0		79.0	4.0	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	hg19	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.417035	0.83449	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	D;D	0.98717	-5.09;-5.09	4.98	4.98	0.66077	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99217	0.9728	M	0.90542	3.125	0.54753	D	0.999989	P	0.48230	0.907	D	0.69479	0.964	D	0.99075	1.0835	10	0.72032	D	0.01	-20.7428	14.8099	0.69985	0.0:0.0:0.0:1.0	.	561	Q2TB90	HKDC1_HUMAN	T	561	ENSP00000346643:I561T;ENSP00000378521:I561T	ENSP00000346643:I561T	I	+	2	0	HKDC1	70680163	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.831000	0.86748	2.090000	0.63153	0.459000	0.35465	ATC	.	.		0.592	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
OPN4	94233	hgsc.bcm.edu	37	10	88422074	88422074	+	Missense_Mutation	SNP	G	G	A	rs150092638		TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr10:88422074G>A	ENST00000241891.5	+	8	1306	c.1139G>A	c.(1138-1140)cGc>cAc	p.R380H	OPN4_ENST00000372071.2_Missense_Mutation_p.R391H	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	380					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						CGGCACAGTCGCCCCTACCCC	0.682																																					p.R391H		Atlas-SNP	.											.	OPN4	61	.	0			c.G1172A						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	38.0	29.0	32.0		1172,1139	0.6	0.1	10	dbSNP_134	32	1,8597		0,1,4298	no	missense,missense	OPN4	NM_001030015.2,NM_033282.3	29,29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	391/490,380/479	88422074	1,13003	2203	4299	6502	SO:0001583	missense	94233	exon9			ACAGTCGCCCCTA	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.1139G>A	chr10.hg19:g.88422074G>A	ENSP00000241891:p.Arg380His	59.0	0.0		72.0	13.0	NM_001030015	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	ENST00000241891.5	hg19	CCDS7376.1	.	.	.	.	.	.	.	.	.	.	G	5.796	0.331258	0.10956	0.0	1.16E-4	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.69435	-0.35;0.03;-0.4	5.39	0.571	0.17352	.	0.846040	0.10657	N	0.649149	T	0.45074	0.1324	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.06405	0.001;0.001;0.002	T	0.24119	-1.0169	10	0.22706	T	0.39	.	8.5819	0.33634	0.187:0.1204:0.6926:0.0	.	391;380;391	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	H	391;380;391	ENSP00000361141:R391H;ENSP00000241891:R380H;ENSP00000393132:R391H	ENSP00000241891:R380H	R	+	2	0	OPN4	88412054	0.001000	0.12720	0.095000	0.20976	0.944000	0.59088	0.583000	0.23849	0.097000	0.17492	-0.940000	0.02684	CGC	.	G|1.000;A|0.000		0.682	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
SEC31B	25956	hgsc.bcm.edu	37	10	102256096	102256096	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr10:102256096C>A	ENST00000370345.3	-	18	2326	c.2229G>T	c.(2227-2229)agG>agT	p.R743S	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	743					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		ACTGAGTGACCCTGTAGGTTG	0.597																																					p.R743S		Atlas-SNP	.											.	SEC31B	84	.	0			c.G2229T						.						102.0	92.0	95.0					10																	102256096		2203	4300	6503	SO:0001583	missense	25956	exon18			AGTGACCCTGTAG	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2229G>T	chr10.hg19:g.102256096C>A	ENSP00000359370:p.Arg743Ser	99.0	0.0		85.0	10.0	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	hg19	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.758444	0.49468	.	.	ENSG00000075826	ENST00000370345	T	0.51817	0.69	5.78	-4.52	0.03472	.	0.270914	0.46442	N	0.000291	T	0.37517	0.1006	M	0.73598	2.24	0.25990	N	0.98226	B;B	0.11235	0.004;0.003	B;B	0.18561	0.022;0.01	T	0.30475	-0.9977	10	0.54805	T	0.06	-3.0951	3.7149	0.08434	0.1345:0.5199:0.1152:0.2304	.	742;743	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	S	743	ENSP00000359370:R743S	ENSP00000359370:R743S	R	-	3	2	SEC31B	102246086	0.003000	0.15002	0.001000	0.08648	0.996000	0.88848	0.005000	0.13129	-0.776000	0.04578	0.455000	0.32223	AGG	.	.		0.597	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
QSER1	79832	hgsc.bcm.edu	37	11	32954330	32954330	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr11:32954330G>T	ENST00000399302.2	+	4	1474	c.1139G>T	c.(1138-1140)gGg>gTg	p.G380V	QSER1_ENST00000527788.1_Intron	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	380	Ser-rich.									breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					ACTTTTTCTGGGTCATCTCAG	0.383																																					p.G380V		Atlas-SNP	.											.	QSER1	153	.	0			c.G1139T						.						103.0	95.0	97.0					11																	32954330		1835	4077	5912	SO:0001583	missense	79832	exon4			TTTCTGGGTCATC	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.1139G>T	chr11.hg19:g.32954330G>T	ENSP00000382241:p.Gly380Val	137.0	0.0		147.0	10.0	NM_001076786	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	ENST00000399302.2	hg19	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686751	0.29962	.	.	ENSG00000060749	ENST00000399302	T	0.47177	0.85	4.89	3.98	0.46160	.	0.175311	0.26109	U	0.026296	T	0.31888	0.0811	N	0.24115	0.695	0.80722	D	1	P	0.39282	0.666	B	0.33339	0.162	T	0.15464	-1.0436	10	0.48119	T	0.1	.	13.5502	0.61728	0.0762:0.0:0.9238:0.0	.	380	Q2KHR3	QSER1_HUMAN	V	380	ENSP00000382241:G380V	ENSP00000382241:G380V	G	+	2	0	QSER1	32910906	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.718000	0.54919	1.194000	0.43101	0.591000	0.81541	GGG	.	.		0.383	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
TCP11L1	55346	hgsc.bcm.edu	37	11	33076187	33076187	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr11:33076187G>T	ENST00000334274.4	+	3	612	c.212G>T	c.(211-213)aGa>aTa	p.R71I	TCP11L1_ENST00000530171.1_Intron|TCP11L1_ENST00000531632.2_Missense_Mutation_p.R71I|TCP11L1_ENST00000432887.1_Missense_Mutation_p.R71I	NM_018393.3	NP_060863.3	Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	71						microtubule (GO:0005874)				kidney(1)|liver(2)|lung(2)|skin(1)	6						GAGACAGCGAGAGGTGTCACC	0.418																																					p.R71I		Atlas-SNP	.											.	TCP11L1	40	.	0			c.G212T						.						119.0	118.0	119.0					11																	33076187		2202	4298	6500	SO:0001583	missense	55346	exon3			CAGCGAGAGGTGT	BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000334274.4:c.212G>T	chr11.hg19:g.33076187G>T	ENSP00000335595:p.Arg71Ile	104.0	0.0		97.0	16.0	NM_001145541	D3DR01|Q8IVX4	Missense_Mutation	SNP	ENST00000334274.4	hg19	CCDS7882.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.734785	0.48939	.	.	ENSG00000176148	ENST00000530419;ENST00000334274;ENST00000531632;ENST00000432887	T;T;T;T	0.23754	1.89;2.9;2.9;2.9	5.96	3.52	0.40303	.	0.083576	0.85682	D	0.000000	T	0.15912	0.0383	N	0.19112	0.55	0.80722	D	1	B	0.14438	0.01	B	0.06405	0.002	T	0.04551	-1.0943	10	0.48119	T	0.1	-25.019	9.3351	0.38045	0.8405:0.0:0.1595:0.0	.	71	Q9NUJ3	T11L1_HUMAN	I	71	ENSP00000436428:R71I;ENSP00000335595:R71I;ENSP00000433067:R71I;ENSP00000395070:R71I	ENSP00000335595:R71I	R	+	2	0	TCP11L1	33032763	1.000000	0.71417	0.342000	0.25602	0.057000	0.15508	7.441000	0.80485	0.439000	0.26476	-0.345000	0.07892	AGA	.	.		0.418	TCP11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383377.4	NM_018393	
ANO2	57101	hgsc.bcm.edu	37	12	5860094	5860094	+	Silent	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr12:5860094C>A	ENST00000356134.5	-	12	1160	c.1089G>T	c.(1087-1089)ctG>ctT	p.L363L	ANO2_ENST00000546188.1_Silent_p.L363L|ANO2_ENST00000327087.8_Silent_p.L362L	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	367					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						TATATAATCCCAGCCAGGCAA	0.323																																					p.L362L		Atlas-SNP	.											.	ANO2	309	.	0			c.G1086T						.						75.0	70.0	72.0					12																	5860094		1830	4089	5919	SO:0001819	synonymous_variant	57101	exon11			TAATCCCAGCCAG	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1089G>T	chr12.hg19:g.5860094C>A		164.0	0.0		241.0	11.0	NM_020373	C4N787|Q9H847	Silent	SNP	ENST00000356134.5	hg19																																																																																				.	.		0.323	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373	
KRT6B	3854	hgsc.bcm.edu	37	12	52845384	52845384	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr12:52845384C>T	ENST00000252252.3	-	1	526	c.479G>A	c.(478-480)cGg>cAg	p.R160Q		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	160	Head.			VR -> IG (in Ref. 2; AAA59466). {ECO:0000305}.	ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CTCCTCGGCCCGCACCCGCTG	0.597																																					p.R160Q		Atlas-SNP	.											.	KRT6B	90	.	0			c.G479A						.						53.0	72.0	65.0					12																	52845384		2203	4296	6499	SO:0001583	missense	3854	exon1			TCGGCCCGCACCC	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.479G>A	chr12.hg19:g.52845384C>T	ENSP00000252252:p.Arg160Gln	375.0	0.0		416.0	54.0	NM_005555	P48669	Missense_Mutation	SNP	ENST00000252252.3	hg19	CCDS8828.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606483	0.46527	.	.	ENSG00000185479	ENST00000252252;ENST00000544607	D	0.85556	-2.0	3.28	0.429	0.16506	.	0.089287	0.44902	D	0.000418	D	0.88890	0.6560	M	0.94021	3.485	0.32244	N	0.572368	D	0.60160	0.987	P	0.48552	0.581	D	0.88941	0.3380	10	0.87932	D	0	.	8.7904	0.34848	0.0:0.7388:0.0:0.2612	.	160	P04259	K2C6B_HUMAN	Q	160	ENSP00000252252:R160Q	ENSP00000252252:R160Q	R	-	2	0	KRT6B	51131651	0.168000	0.22989	0.024000	0.17045	0.255000	0.26057	0.832000	0.27490	0.094000	0.17404	0.298000	0.19748	CGG	.	.		0.597	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
ERCC5	2073	hgsc.bcm.edu	37	13	103520547	103520547	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr13:103520547C>A	ENST00000355739.4	+	12	4041	c.2618C>A	c.(2617-2619)aCc>aAc	p.T873N	ERCC5_ENST00000375954.1_Missense_Mutation_p.T106N|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.N1298K	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	873	I-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GGTTGTGTAACCGCCATGGAA	0.368			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.T1327N		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	.	.	0			c.C3980A						.						85.0	93.0	90.0					13																	103520547		2203	4300	6503	SO:0001583	missense	0	exon20	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GTGTAACCGCCAT	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2618C>A	chr13.hg19:g.103520547C>A	ENSP00000347978:p.Thr873Asn	276.0	0.0		300.0	50.0	NM_001204425	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	hg19	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.767516	0.90020	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.67523	-0.27;-0.27	5.02	5.02	0.67125	-3&apos (1);Helix-hairpin-helix motif, class 2 (1); exonuclease, C-terminal domain (1);5&apos (1);	0.163740	0.53938	D	0.000053	T	0.61615	0.2361	L	0.42686	1.345	0.80722	D	1	P;B	0.40534	0.72;0.368	B;B	0.40982	0.345;0.159	T	0.58521	-0.7622	10	0.18276	T	0.48	-6.7919	18.34	0.90302	0.0:1.0:0.0:0.0	.	873;1298	P28715;Q59FZ7	ERCC5_HUMAN;.	N	1298;873;705;106	ENSP00000347978:T873N;ENSP00000365121:T106N	ENSP00000347978:T873N	T	+	2	0	ERCC5	102318548	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.691000	0.84191	2.353000	0.79882	0.491000	0.48974	ACC	.	.		0.368	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
NOP9	161424	hgsc.bcm.edu	37	14	24769239	24769239	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr14:24769239G>A	ENST00000267425.3	+	1	172	c.79G>A	c.(79-81)Ggg>Agg	p.G27R	DHRS1_ENST00000288111.7_5'Flank|DHRS1_ENST00000396813.1_5'Flank|NOP9_ENST00000396802.3_Missense_Mutation_p.G27R	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	27							poly(A) RNA binding (GO:0044822)										CGGGGCCAAGGGGTCGGGGCG	0.731																																					p.G27R		Atlas-SNP	.											.	.	.	.	0			c.G79A						.						9.0	11.0	10.0					14																	24769239		1921	3913	5834	SO:0001583	missense	161424	exon1			GCCAAGGGGTCGG		CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.79G>A	chr14.hg19:g.24769239G>A	ENSP00000267425:p.Gly27Arg	106.0	0.0		171.0	93.0	NM_174913	A8MY76|Q8IVF0|Q8TBS6	Missense_Mutation	SNP	ENST00000267425.3	hg19	CCDS9624.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297802	0.81025	.	.	ENSG00000196943	ENST00000267425;ENST00000396802	T;T	0.35236	1.37;1.32	4.87	3.98	0.46160	.	0.427204	0.19988	N	0.101621	T	0.28034	0.0691	L	0.51422	1.61	0.09310	N	0.999998	P	0.36837	0.571	B	0.33799	0.17	T	0.10613	-1.0622	10	0.20519	T	0.43	-6.0855	9.0942	0.36629	0.0995:0.0:0.9005:0.0	.	27	Q86U38	CN021_HUMAN	R	27	ENSP00000267425:G27R;ENSP00000380020:G27R	ENSP00000267425:G27R	G	+	1	0	C14orf21	23839079	0.751000	0.28327	0.061000	0.19648	0.365000	0.29674	0.265000	0.18515	1.425000	0.47237	0.655000	0.94253	GGG	.	.		0.731	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073186.2		
PSMA3	5684	hgsc.bcm.edu	37	14	58734222	58734222	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr14:58734222A>G	ENST00000216455.4	+	8	664	c.574A>G	c.(574-576)Aaa>Gaa	p.K192E	RP11-349A22.5_ENST00000556002.1_RNA|PSMA3_ENST00000412908.2_Missense_Mutation_p.K185E|RP11-349A22.5_ENST00000555275.1_RNA|CTD-2002H8.2_ENST00000557322.1_RNA|RP11-349A22.5_ENST00000555162.1_RNA|RP11-349A22.5_ENST00000554378.1_RNA|RP11-349A22.5_ENST00000554360.1_RNA|PSMA3_ENST00000557508.1_Missense_Mutation_p.K117E	NM_002788.3|NM_152132.2	NP_002779.1|NP_687033.1	P25788	PSA3_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 3	192					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(2)	12						TGATATCGTTAAAGAAGTTGC	0.279																																					p.K192E		Atlas-SNP	.											.	PSMA3	30	.	0			c.A574G						.						54.0	58.0	57.0					14																	58734222		2203	4290	6493	SO:0001583	missense	5684	exon8			ATCGTTAAAGAAG		CCDS9731.1, CCDS45113.1	14q23	2008-08-29			ENSG00000100567	ENSG00000100567		"""Proteasome (prosome, macropain) subunits"""	9532	protein-coding gene	gene with protein product		176843				2025653, 8811196	Standard	NM_002788		Approved	HC8	uc001xdj.2	P25788	OTTHUMG00000140319	ENST00000216455.4:c.574A>G	chr14.hg19:g.58734222A>G	ENSP00000216455:p.Lys192Glu	57.0	0.0		85.0	11.0	NM_002788	B2RCK6|Q86U83|Q8N1D8|Q9BS70	Missense_Mutation	SNP	ENST00000216455.4	hg19	CCDS9731.1	.	.	.	.	.	.	.	.	.	.	A	16.94	3.261566	0.59431	.	.	ENSG00000100567	ENST00000216455;ENST00000412908;ENST00000557508	T;T;T	0.19806	2.12;2.12;2.12	4.69	4.69	0.59074	.	0.090096	0.85682	D	0.000000	T	0.25680	0.0625	M	0.62723	1.935	0.80722	D	1	B;B	0.24426	0.084;0.103	B;B	0.26969	0.045;0.075	T	0.05241	-1.0897	10	0.49607	T	0.09	-15.667	14.5987	0.68424	1.0:0.0:0.0:0.0	.	185;192	P25788-2;P25788	.;PSA3_HUMAN	E	192;185;117	ENSP00000216455:K192E;ENSP00000390491:K185E;ENSP00000452056:K117E	ENSP00000216455:K192E	K	+	1	0	PSMA3	57803975	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.472000	0.90407	2.097000	0.63578	0.477000	0.44152	AAA	.	.		0.279	PSMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276923.1	NM_002788	
RTN1	6252	hgsc.bcm.edu	37	14	60193689	60193689	+	Silent	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr14:60193689C>A	ENST00000267484.5	-	3	2048	c.1713G>T	c.(1711-1713)ggG>ggT	p.G571G		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	571					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GACCTAGAGGCCCAGGGCCCT	0.592																																					p.G571G		Atlas-SNP	.											.	RTN1	139	.	0			c.G1713T						.						22.0	23.0	23.0					14																	60193689		2203	4300	6503	SO:0001819	synonymous_variant	6252	exon3			TAGAGGCCCAGGG	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1713G>T	chr14.hg19:g.60193689C>A		181.0	0.0		188.0	22.0	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Silent	SNP	ENST00000267484.5	hg19	CCDS9740.1																																																																																			.	.		0.592	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
RAB8B	51762	hgsc.bcm.edu	37	15	63547751	63547751	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr15:63547751A>G	ENST00000321437.4	+	4	448	c.292A>G	c.(292-294)Aat>Gat	p.N98D	RAB8B_ENST00000448330.2_Missense_Mutation_p.N98D	NM_016530.2	NP_057614.1	Q92930	RAB8B_HUMAN	RAB8B, member RAS oncogene family	98					adherens junction organization (GO:0034332)|antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|positive regulation of cell projection organization (GO:0031346)|positive regulation of corticotropin secretion (GO:0051461)|protein import into peroxisome membrane (GO:0045046)|small GTPase mediated signal transduction (GO:0007264)	cell tip (GO:0051286)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|receptor binding (GO:0005102)			kidney(3)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9						ATCCTTTGACAATATTAAAAA	0.343																																					p.N98D		Atlas-SNP	.											.	RAB8B	23	.	0			c.A292G						.						57.0	61.0	60.0					15																	63547751		2203	4300	6503	SO:0001583	missense	51762	exon4			TTTGACAATATTA	AL833365	CCDS10183.1	15q22	2008-11-18			ENSG00000166128	ENSG00000166128		"""RAB, member RAS oncogene"""	30273	protein-coding gene	gene with protein product		613532				9030196, 18772196	Standard	XM_006720569		Approved		uc002alz.3	Q92930	OTTHUMG00000132862	ENST00000321437.4:c.292A>G	chr15.hg19:g.63547751A>G	ENSP00000312734:p.Asn98Asp	486.0	1.0		291.0	113.0	NM_016530	Q5JPC4|Q9P293	Missense_Mutation	SNP	ENST00000321437.4	hg19	CCDS10183.1	.	.	.	.	.	.	.	.	.	.	A	31	5.072778	0.93950	.	.	ENSG00000166128	ENST00000321437;ENST00000448330	T;T	0.78364	-1.17;-1.17	5.92	5.92	0.95590	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.82742	0.5103	L	0.41573	1.285	0.58432	D	0.999999	P;P	0.49635	0.854;0.926	P;P	0.62382	0.686;0.901	D	0.84440	0.0582	10	0.87932	D	0	.	15.5479	0.76123	1.0:0.0:0.0:0.0	.	98;98	F5GY21;Q92930	.;RAB8B_HUMAN	D	98	ENSP00000312734:N98D;ENSP00000405463:N98D	ENSP00000312734:N98D	N	+	1	0	RAB8B	61334804	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.279000	0.95777	2.268000	0.75426	0.454000	0.30748	AAT	.	.		0.343	RAB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256336.1	NM_016530	
HMG20A	10363	hgsc.bcm.edu	37	15	77763375	77763375	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr15:77763375C>T	ENST00000381714.3	+	6	1002	c.574C>T	c.(574-576)Cat>Tat	p.H192Y	HMG20A_ENST00000336216.4_Missense_Mutation_p.H192Y	NM_018200.2	NP_060670.1	Q9NP66	HM20A_HUMAN	high mobility group 20A	192					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						AGGCAAATCTCATAGGCAAGG	0.408																																					p.H192Y		Atlas-SNP	.											.	HMG20A	48	.	0			c.C574T						.						121.0	114.0	116.0					15																	77763375		2196	4294	6490	SO:0001583	missense	10363	exon6			AAATCTCATAGGC	AF146222	CCDS10295.1	15q24	2011-07-01	2011-04-05		ENSG00000140382	ENSG00000140382		"""High mobility group / Non-canonical"""	5001	protein-coding gene	gene with protein product	"""HMG box domain containing 1"""	605534	"""high-mobility group 20A"""			10773667	Standard	NM_018200		Approved	HMGX1, FLJ10739, HMGXB1	uc002bcr.3	Q9NP66	OTTHUMG00000143729	ENST00000381714.3:c.574C>T	chr15.hg19:g.77763375C>T	ENSP00000371133:p.His192Tyr	400.0	0.0		214.0	72.0	NM_018200	A6NHY3|D3DW78|Q53G31|Q9NSF6	Missense_Mutation	SNP	ENST00000381714.3	hg19	CCDS10295.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.353760	0.61293	.	.	ENSG00000140382	ENST00000336216;ENST00000381714	T;T	0.68181	-0.31;-0.31	5.97	5.97	0.96955	.	0.236335	0.49305	D	0.000151	T	0.64832	0.2634	L	0.44542	1.39	0.50171	D	0.999859	B	0.12013	0.005	B	0.23150	0.044	T	0.58544	-0.7618	10	0.54805	T	0.06	-17.6161	20.4388	0.99107	0.0:1.0:0.0:0.0	.	192	Q9NP66	HM20A_HUMAN	Y	192	ENSP00000336856:H192Y;ENSP00000371133:H192Y	ENSP00000336856:H192Y	H	+	1	0	HMG20A	75550430	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	5.742000	0.68646	2.836000	0.97738	0.655000	0.94253	CAT	.	.		0.408	HMG20A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419512.2	NM_018200	
ABCA3	21	hgsc.bcm.edu	37	16	2342161	2342161	+	Silent	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr16:2342161G>A	ENST00000301732.5	-	19	3193	c.2493C>T	c.(2491-2493)acC>acT	p.T831T	ABCA3_ENST00000382381.3_Silent_p.T773T	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	831					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CTTCCTCCATGGTGGTGATGG	0.483																																					p.T831T		Atlas-SNP	.											.	ABCA3	176	.	0			c.C2493T						.						144.0	112.0	123.0					16																	2342161		2198	4300	6498	SO:0001819	synonymous_variant	21	exon19			CTCCATGGTGGTG	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2493C>T	chr16.hg19:g.2342161G>A		102.0	0.0		104.0	15.0	NM_001089	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	hg19	CCDS10466.1																																																																																			.	.		0.483	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250784.2	NM_001089	
ATP6V0C	527	hgsc.bcm.edu	37	16	2569246	2569246	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr16:2569246A>C	ENST00000330398.4	+	2	341	c.107A>C	c.(106-108)aAg>aCg	p.K36T	AMDHD2_ENST00000413459.3_5'Flank|AMDHD2_ENST00000302956.4_5'Flank|ATP6V0C_ENST00000568562.1_Missense_Mutation_p.Q18H|RP11-20I23.1_ENST00000564543.1_Missense_Mutation_p.Q331H|ATP6V0C_ENST00000565223.1_5'UTR|ATP6V0C_ENST00000564973.1_5'UTR|ATP6C_ENST00000569317.1_Intron|AMDHD2_ENST00000293971.6_5'Flank	NM_001198569.1|NM_001694.3	NP_001185498.1|NP_001685.1	P27449	VATL_HUMAN	ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c	36					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|lung(1)|ovary(1)	3		Ovarian(90;0.17)				GGCACAGCCAAGAGCGGTACC	0.622																																					p.K36T		Atlas-SNP	.											.	ATP6V0C	10	.	0			c.A107C						.						59.0	41.0	47.0					16																	2569246		2198	4300	6498	SO:0001583	missense	527	exon3			CAGCCAAGAGCGG	M62762	CCDS10470.1	16p13.3	2010-04-21	2002-08-29	2002-05-10	ENSG00000185883	ENSG00000185883	3.6.3.14	"""ATPases / V-type"""	855	protein-coding gene	gene with protein product		108745	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16kD"""	ATPL, ATP6C, ATP6L		1709739, 8250920	Standard	NM_001694		Approved	VATL, Vma3	uc021tav.1	P27449	OTTHUMG00000128865	ENST00000330398.4:c.107A>C	chr16.hg19:g.2569246A>C	ENSP00000329757:p.Lys36Thr	61.0	0.0		58.0	32.0	NM_001198569	Q6FH26	Missense_Mutation	SNP	ENST00000330398.4	hg19	CCDS10470.1	.	.	.	.	.	.	.	.	.	.	A	14.21	2.466990	0.43839	.	.	ENSG00000185883	ENST00000330398	T	0.45668	0.89	4.85	4.85	0.62838	ATPase, F0/V0 complex, subunit C (2);	0.000000	0.85682	D	0.000000	T	0.57562	0.2062	M	0.82323	2.585	0.80722	D	1	B	0.26002	0.139	B	0.41917	0.37	T	0.62205	-0.6903	10	0.59425	D	0.04	-6.3055	13.3519	0.60607	1.0:0.0:0.0:0.0	.	36	P27449	VATL_HUMAN	T	36	ENSP00000329757:K36T	ENSP00000329757:K36T	K	+	2	0	ATP6V0C	2509247	1.000000	0.71417	0.997000	0.53966	0.192000	0.23643	9.230000	0.95299	1.832000	0.53329	0.454000	0.30748	AAG	.	.		0.622	ATP6V0C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250810.1	NM_001694	
CBFA2T3	863	hgsc.bcm.edu	37	16	88968033	88968033	+	Silent	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr16:88968033C>A	ENST00000268679.4	-	2	579	c.183G>T	c.(181-183)gcG>gcT	p.A61A	CBFA2T3_ENST00000360302.2_5'UTR|CBFA2T3_ENST00000327483.5_5'UTR|CBFA2T3_ENST00000448839.1_Intron|CBFA2T3_ENST00000436887.2_Silent_p.A61A	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	61	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|Pro-rich.|Required for nucleolar targeting (in isoform 1).				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		AGTCCGGCATCGCTGAGGCCT	0.687			T	RUNX1	AML																																p.A61A		Atlas-SNP	.		Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	.	CBFA2T3	47	.	0			c.G183T						.						38.0	41.0	40.0					16																	88968033		2197	4300	6497	SO:0001819	synonymous_variant	863	exon2			CGGCATCGCTGAG	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.183G>T	chr16.hg19:g.88968033C>A		23.0	0.0		21.0	10.0	NM_005187	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Silent	SNP	ENST00000268679.4	hg19	CCDS10972.1																																																																																			.	.		0.687	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187	
DNAH2	146754	hgsc.bcm.edu	37	17	7682620	7682620	+	Silent	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr17:7682620G>A	ENST00000572933.1	+	36	7061	c.5601G>A	c.(5599-5601)gtG>gtA	p.V1867V	DNAH2_ENST00000389173.2_Silent_p.V1867V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1867	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGCTGTCAGTGGTGGCCCACC	0.567																																					p.V1867V		Atlas-SNP	.											.	DNAH2	498	.	0			c.G5601A						.						105.0	82.0	90.0					17																	7682620		2203	4300	6503	SO:0001819	synonymous_variant	146754	exon35			GTCAGTGGTGGCC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.5601G>A	chr17.hg19:g.7682620G>A		98.0	0.0		137.0	20.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	hg19	CCDS32551.1																																																																																			.	.		0.567	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
GAS7	8522	hgsc.bcm.edu	37	17	9850209	9850209	+	Splice_Site	SNP	A	A	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr17:9850209A>G	ENST00000432992.2	-	6	776		c.e6+1		GAS7_ENST00000437099.2_Splice_Site|GAS7_ENST00000580865.1_Splice_Site|GAS7_ENST00000585266.1_Splice_Site|GAS7_ENST00000323816.4_Splice_Site|GAS7_ENST00000396115.2_Intron|GAS7_ENST00000583882.1_Splice_Site|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000579158.1_Splice_Site|GAS7_ENST00000578655.1_Splice_Site|GAS7_ENST00000542249.1_Splice_Site	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7						actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						GGCGCTGCTTACCCAGAAGTA	0.592			T	MLL	AML*																																.		Atlas-SNP	.		Dom	yes		17	17p	8522	growth arrest-specific 7		L	.	GAS7	113	.	0			c.423+2T>C						.						90.0	59.0	70.0					17																	9850209		2203	4299	6502	SO:0001630	splice_region_variant	8522	exon7			CTGCTTACCCAGA	AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.615+1T>C	chr17.hg19:g.9850209A>G		52.0	0.0		65.0	6.0	NM_001130831	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Splice_Site	SNP	ENST00000432992.2	hg19	CCDS11152.1	.	.	.	.	.	.	.	.	.	.	A	17.64	3.440408	0.63067	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5244	0.67878	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GAS7	9790934	1.000000	0.71417	0.996000	0.52242	0.558000	0.35554	8.237000	0.89807	2.324000	0.78689	0.533000	0.62120	.	.	.		0.592	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439883.1	NM_003644, NM_201432, NM_201433	Intron
GAS2L2	246176	hgsc.bcm.edu	37	17	34072962	34072962	+	Silent	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr17:34072962G>A	ENST00000254466.6	-	6	1581	c.1554C>T	c.(1552-1554)agC>agT	p.S518S	GAS2L2_ENST00000587565.1_Silent_p.S502S	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	518					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CACCAGGAAAGCTCCTTCCTG	0.622																																					p.S518S		Atlas-SNP	.											.	GAS2L2	94	.	0			c.C1554T						.						39.0	44.0	42.0					17																	34072962		2203	4300	6503	SO:0001819	synonymous_variant	246176	exon6			AGGAAAGCTCCTT	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1554C>T	chr17.hg19:g.34072962G>A		36.0	0.0		44.0	15.0	NM_139285	Q8NHY4	Silent	SNP	ENST00000254466.6	hg19	CCDS11298.1																																																																																			.	.		0.622	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
TNS4	84951	hgsc.bcm.edu	37	17	38643429	38643429	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr17:38643429G>A	ENST00000254051.6	-	4	1305	c.1147C>T	c.(1147-1149)Cca>Tca	p.P383S		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	383					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GAAGACCCTGGTTCTGGGCAG	0.602																																					p.P383S		Atlas-SNP	.											.	TNS4	72	.	0			c.C1147T						.						166.0	161.0	163.0					17																	38643429		2203	4300	6503	SO:0001583	missense	84951	exon4			ACCCTGGTTCTGG	AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1147C>T	chr17.hg19:g.38643429G>A	ENSP00000254051:p.Pro383Ser	154.0	0.0		157.0	29.0	NM_032865	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	ENST00000254051.6	hg19	CCDS11368.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769772	0.49680	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.18502	2.21	5.4	4.39	0.52855	.	2.964170	0.00986	N	0.003445	T	0.16642	0.0400	L	0.32530	0.975	0.30280	N	0.791388	P	0.45126	0.851	B	0.37550	0.253	T	0.19386	-1.0307	10	0.23891	T	0.37	-9.8293	12.8456	0.57827	0.0:0.288:0.7119:0.0	.	383	Q8IZW8	TENS4_HUMAN	S	383	ENSP00000254051:P383S	ENSP00000254051:P383S	P	-	1	0	TNS4	35896955	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	0.726000	0.25984	2.539000	0.85634	0.655000	0.94253	CCA	.	.		0.602	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257154.3	NM_032865	
KRTAP16-1	100505753	hgsc.bcm.edu	37	17	39465245	39465245	+	Silent	SNP	G	G	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr17:39465245G>A	ENST00000391352.1	-	1	260	c.261C>T	c.(259-261)agC>agT	p.S87S		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	87	11 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						GTTGGCAGCCGCTGCTCACGG	0.602																																					p.S87S		Atlas-SNP	.											.	KRTAP16-1	12	.	0			c.C261T						.																																			SO:0001819	synonymous_variant	100505753	exon1			GCAGCCGCTGCTC	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.261C>T	chr17.hg19:g.39465245G>A		264.0	1.0		275.0	117.0	NM_001146182		Silent	SNP	ENST00000391352.1	hg19	CCDS56032.1																																																																																			.	.		0.602	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257785.1	NM_001146182	
DAZAP1	26528	hgsc.bcm.edu	37	19	1422373	1422373	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:1422373C>G	ENST00000233078.4	+	6	602	c.441C>G	c.(439-441)gaC>gaG	p.D147E	DAZAP1_ENST00000336761.6_Missense_Mutation_p.D147E|DAZAP1_ENST00000586579.1_3'UTR	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	147	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGATCTATGACGCCGAGAAGC	0.612																																					p.D147E		Atlas-SNP	.											.	DAZAP1	52	.	0			c.C441G						.						160.0	122.0	135.0					19																	1422373		2203	4300	6503	SO:0001583	missense	26528	exon6			CTATGACGCCGAG		CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.441C>G	chr19.hg19:g.1422373C>G	ENSP00000233078:p.Asp147Glu	81.0	0.0		80.0	31.0	NM_018959	Q96MJ3|Q9NRR9	Missense_Mutation	SNP	ENST00000233078.4	hg19	CCDS12065.1	.	.	.	.	.	.	.	.	.	.	T	13.59	2.282151	0.40394	.	.	ENSG00000071626	ENST00000233078;ENST00000336761	D;D	0.92199	-2.99;-2.99	4.3	-0.967	0.10316	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.94377	0.8192	M	0.75447	2.3	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	D	0.91616	0.5307	10	0.66056	D	0.02	.	10.1831	0.42980	0.0:0.5561:0.0:0.4439	.	147;147	Q96EP5;Q96EP5-2	DAZP1_HUMAN;.	E	147	ENSP00000233078:D147E;ENSP00000337132:D147E	ENSP00000233078:D147E	D	+	3	2	DAZAP1	1373373	0.912000	0.30974	0.626000	0.29213	0.120000	0.20174	0.006000	0.13152	-0.804000	0.04410	-1.390000	0.01156	GAC	.	.		0.612	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449522.3	NM_170711	
UBA52	7311	hgsc.bcm.edu	37	19	18684552	18684552	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:18684552C>T	ENST00000442744.2	+	3	242	c.184C>T	c.(184-186)Cag>Tag	p.Q62*	UBA52_ENST00000595158.1_Nonsense_Mutation_p.Q62*|UBA52_ENST00000597451.1_Nonsense_Mutation_p.Q62*|UBA52_ENST00000430157.2_Nonsense_Mutation_p.Q62*|UBA52_ENST00000596304.1_Nonsense_Mutation_p.Q62*|UBA52_ENST00000598780.1_Nonsense_Mutation_p.Q62*|UBA52_ENST00000599551.1_Nonsense_Mutation_p.Q62*|UBA52_ENST00000595683.1_Nonsense_Mutation_p.Q62*|CRLF1_ENST00000594325.1_Intron|UBA52_ENST00000599595.1_Nonsense_Mutation_p.Q62*|UBA52_ENST00000596273.1_Nonsense_Mutation_p.Q62*	NM_001033930.1	NP_001029102.1	P62987	RL40_HUMAN	ubiquitin A-52 residue ribosomal protein fusion product 1	62	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|viral transcription (GO:0019083)|virion assembly (GO:0019068)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(2)	3						CTACAACATCCAGAAAGGTAC	0.582																																					p.Q62X		Atlas-SNP	.											.	UBA52	6	.	0			c.C184T						.						41.0	40.0	41.0					19																	18684552		2203	4300	6503	SO:0001587	stop_gained	7311	exon3			AACATCCAGAAAG		CCDS12382.1	19p13.1-p12	2011-04-06			ENSG00000221983	ENSG00000221983		"""L ribosomal proteins"""	12458	protein-coding gene	gene with protein product	"""ribosomal protein L40"", ""ubiquitin-52 amino acid fusion protein"", ""ubiquitin carboxyl extension protein 52"", ""60S ribosomal protein L40"", ""ubiquitin-CEP52"""	191321				8188300	Standard	XM_005260051		Approved	RPL40, CEP52, HUBCEP52, MGC57125, MGC126879, MGC126881, L40	uc002njs.3	P62987		ENST00000442744.2:c.184C>T	chr19.hg19:g.18684552C>T	ENSP00000388107:p.Gln62*	50.0	0.0		62.0	31.0	NM_001033930	P02248|P02249|P02250|P14793|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Nonsense_Mutation	SNP	ENST00000442744.2	hg19	CCDS12382.1	.	.	.	.	.	.	.	.	.	.	C	35	5.559118	0.96514	.	.	ENSG00000221983	ENST00000442744;ENST00000430157	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-22.8343	15.3581	0.74443	0.0:1.0:0.0:0.0	.	.	.	.	X	62	.	ENSP00000396910:Q62X	Q	+	1	0	UBA52	18545552	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	7.663000	0.83820	2.220000	0.72140	0.462000	0.41574	CAG	.	.		0.582	UBA52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465117.2	NM_003333	
ZNF208	7757	hgsc.bcm.edu	37	19	22170031	22170031	+	Silent	SNP	C	C	A			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:22170031C>A	ENST00000397126.4	-	3	361	c.213G>T	c.(211-213)gtG>gtT	p.V71V	ZNF208_ENST00000597040.1_Silent_p.V39V|ZNF208_ENST00000601773.1_Silent_p.V71V|ZNF208_ENST00000599916.1_Silent_p.V71V	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	71	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GGGATTCTTCCACCATCTCAT	0.428																																					p.V71V		Atlas-SNP	.											.	ZNF208	817	.	0			c.G213T						.						67.0	69.0	68.0					19																	22170031		2196	4299	6495	SO:0001819	synonymous_variant	7757	exon3			TTCTTCCACCATC	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.213G>T	chr19.hg19:g.22170031C>A		124.0	0.0		109.0	32.0	NM_007153		Silent	SNP	ENST00000397126.4	hg19	CCDS54240.1																																																																																			.	.		0.428	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF91	7644	hgsc.bcm.edu	37	19	23543281	23543281	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:23543281C>T	ENST00000300619.7	-	4	2705	c.2500G>A	c.(2500-2502)Gct>Act	p.A834T	ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.A802T|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	834					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGCTTAAAAGCTTTGCCACAT	0.383																																					p.A834T		Atlas-SNP	.											.	ZNF91	349	.	0			c.G2500A						.						57.0	60.0	59.0					19																	23543281		2138	4264	6402	SO:0001583	missense	7644	exon4			TAAAAGCTTTGCC	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2500G>A	chr19.hg19:g.23543281C>T	ENSP00000300619:p.Ala834Thr	61.0	0.0		71.0	31.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	hg19	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	3.304	-0.142327	0.06669	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.13778	2.56;2.56	1.34	1.34	0.21922	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12561	0.0305	N	0.02721	-0.515	0.22710	N	0.998825	P;D	0.89917	0.851;1.0	B;D	0.79108	0.395;0.992	T	0.23940	-1.0174	9	0.45353	T	0.12	.	6.4545	0.21922	0.2877:0.7123:0.0:0.0	.	802;834	Q05481-2;Q05481	.;ZNF91_HUMAN	T	834;802	ENSP00000300619:A834T;ENSP00000380272:A802T	ENSP00000300619:A834T	A	-	1	0	ZNF91	23335121	0.000000	0.05858	0.324000	0.25361	0.029000	0.11900	-1.232000	0.02936	0.682000	0.31407	0.205000	0.17691	GCT	.	.		0.383	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
CYP2B6	1555	hgsc.bcm.edu	37	19	41515201	41515201	+	Silent	SNP	C	C	T	rs35349987	byFrequency	TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:41515201C>T	ENST00000324071.4	+	5	730	c.723C>T	c.(721-723)atC>atT	p.I241I	CYP2B6_ENST00000330446.5_Intron|CYP2B6_ENST00000593831.1_Intron	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	241					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	TGCAGGAAATCAATGCTTACA	0.512																																					p.I241I		Atlas-SNP	.											.	CYP2B6	79	.	0			c.C723T						.						100.0	100.0	100.0					19																	41515201		2202	4300	6502	SO:0001819	synonymous_variant	1555	exon5			GGAAATCAATGCT	AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.723C>T	chr19.hg19:g.41515201C>T		520.0	0.0		566.0	116.0	NM_000767	B4DWP3|Q2V565|Q9UK46	Silent	SNP	ENST00000324071.4	hg19	CCDS12570.1																																																																																			.	C|0.999;A|0.001		0.512	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463260.1	NM_000767	
FKRP	79147	hgsc.bcm.edu	37	19	47260089	47260089	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:47260089C>T	ENST00000318584.5	+	4	1679	c.1382C>T	c.(1381-1383)gCg>gTg	p.A461V	FKRP_ENST00000391909.3_Missense_Mutation_p.A461V|FKRP_ENST00000600646.1_Intron	NM_001039885.2|NM_024301.4	NP_001034974.1|NP_077277.1	Q9H9S5	FKRP_HUMAN	fukutin related protein	461					glycoprotein biosynthetic process (GO:0009101)|protein processing (GO:0016485)	dystrophin-associated glycoprotein complex (GO:0016010)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)	transferase activity (GO:0016740)			NS(1)|large_intestine(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_epithelial(76;5.08e-05)|Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000541)|all cancers(93;0.00128)|Epithelial(262;0.0207)|GBM - Glioblastoma multiforme(486;0.0336)		GTGGCGCAGGCGCCTAACAAC	0.657																																					p.A461V		Atlas-SNP	.											.	FKRP	16	.	0			c.C1382T						.						14.0	14.0	14.0					19																	47260089		2201	4285	6486	SO:0001583	missense	79147	exon4			CGCAGGCGCCTAA	AJ314847	CCDS12691.1	19q13.32	2014-09-17			ENSG00000181027	ENSG00000181027			17997	protein-coding gene	gene with protein product		606596				11592034, 11741828	Standard	NM_024301		Approved	LGMD2I, MDC1C	uc002pfp.2	Q9H9S5		ENST00000318584.5:c.1382C>T	chr19.hg19:g.47260089C>T	ENSP00000326570:p.Ala461Val	51.0	0.0		52.0	24.0	NM_024301	A8K5G7	Missense_Mutation	SNP	ENST00000318584.5	hg19	CCDS12691.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879511	0.51801	.	.	ENSG00000181027	ENST00000391909;ENST00000318584	D;D	0.99545	-6.13;-6.13	5.44	5.44	0.79542	.	0.247022	0.39210	N	0.001430	D	0.97567	0.9203	N	0.12746	0.255	0.45962	D	0.998785	B	0.31837	0.342	B	0.26864	0.074	D	0.97649	1.0153	10	0.33141	T	0.24	-20.4647	18.0247	0.89265	0.0:1.0:0.0:0.0	.	461	Q9H9S5	FKRP_HUMAN	V	461	ENSP00000375776:A461V;ENSP00000326570:A461V	ENSP00000326570:A461V	A	+	2	0	FKRP	51951929	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	3.970000	0.56824	2.573000	0.86826	0.305000	0.20034	GCG	.	.		0.657	FKRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465473.1	NM_024301	
ACPT	93650	hgsc.bcm.edu	37	19	51293729	51293729	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:51293729C>G	ENST00000270593.1	+	1	58	c.58C>G	c.(58-60)Ctg>Gtg	p.L20V	ACPT_ENST00000270594.3_Missense_Mutation_p.L20V|CTD-2568A17.8_ENST00000594114.1_RNA	NM_033068.2	NP_149059.1	Q9BZG2	PPAT_HUMAN	acid phosphatase, testicular	20						integral component of membrane (GO:0016021)	acid phosphatase activity (GO:0003993)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(3)	11		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		gctgctgctgctggtgctgcC	0.706																																					p.L20V		Atlas-SNP	.											ACPT,NS,carcinoma,0,1	ACPT	43	.	0			c.C58G						.						14.0	13.0	14.0					19																	51293729		2179	4266	6445	SO:0001583	missense	93650	exon1			CTGCTGCTGGTGC	AF321918	CCDS12802.1	19q13.33	2012-10-02			ENSG00000142513	ENSG00000142513			14376	protein-coding gene	gene with protein product		606362				11414767	Standard	NM_033068		Approved		uc002pta.1	Q9BZG2		ENST00000270593.1:c.58C>G	chr19.hg19:g.51293729C>G	ENSP00000270593:p.Leu20Val	58.0	0.0		77.0	5.0	NM_033068	C0H3P7|Q9BZG3|Q9BZG4	Missense_Mutation	SNP	ENST00000270593.1	hg19	CCDS12802.1	.	.	.	.	.	.	.	.	.	.	c	2.381	-0.342101	0.05243	.	.	ENSG00000142513	ENST00000270593;ENST00000270594	T;T	0.13089	2.79;2.62	4.41	0.74	0.18330	.	1.036450	0.07721	N	0.943623	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40961	-0.9535	10	0.32370	T	0.25	-8.5866	3.8343	0.08888	0.0:0.5162:0.2203:0.2635	.	20	Q9BZG2	PPAT_HUMAN	V	20	ENSP00000270593:L20V;ENSP00000270594:L20V	ENSP00000270593:L20V	L	+	1	2	ACPT	55985541	0.000000	0.05858	0.020000	0.16555	0.062000	0.15995	-1.802000	0.01741	0.117000	0.18138	-0.333000	0.08304	CTG	.	.		0.706	ACPT-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464434.1	NM_033068	
NLRP11	204801	hgsc.bcm.edu	37	19	56320851	56320851	+	Silent	SNP	A	A	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr19:56320851A>T	ENST00000589093.1	-	3	1218	c.1125T>A	c.(1123-1125)gcT>gcA	p.A375A	NLRP11_ENST00000443188.1_Silent_p.A375A|NLRP11_ENST00000592953.1_Silent_p.A276A|NLRP11_ENST00000360133.3_Silent_p.A375A|NLRP11_ENST00000589824.2_Silent_p.A375A			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	375	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TCAACGCATCAGCAAGAAAGT	0.527																																					p.A375A		Atlas-SNP	.											.	NLRP11	139	.	0			c.T1125A						.						112.0	103.0	106.0					19																	56320851		2203	4300	6503	SO:0001819	synonymous_variant	204801	exon5			CGCATCAGCAAGA	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.1125T>A	chr19.hg19:g.56320851A>T		113.0	0.0		105.0	10.0	NM_145007	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Silent	SNP	ENST00000589093.1	hg19	CCDS12935.1																																																																																			.	.		0.527	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
TGM6	343641	hgsc.bcm.edu	37	20	2411162	2411162	+	Silent	SNP	G	G	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr20:2411162G>C	ENST00000202625.2	+	11	1810	c.1749G>C	c.(1747-1749)ctG>ctC	p.L583L	TGM6_ENST00000381423.1_Silent_p.L583L	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	583					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	AGAAGATCCTGTTGGCTGCCA	0.468																																					p.L583L		Atlas-SNP	.											.	TGM6	126	.	0			c.G1749C						.						107.0	92.0	97.0					20																	2411162		2203	4300	6503	SO:0001819	synonymous_variant	343641	exon11			GATCCTGTTGGCT	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1749G>C	chr20.hg19:g.2411162G>C		116.0	0.0		118.0	7.0	NM_198994	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	ENST00000202625.2	hg19	CCDS13025.1																																																																																			.	.		0.468	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
ZHX3	23051	hgsc.bcm.edu	37	20	39832198	39832198	+	Silent	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr20:39832198C>T	ENST00000309060.3	-	4	1774	c.1359G>A	c.(1357-1359)caG>caA	p.Q453Q	ZHX3_ENST00000432768.2_Silent_p.Q453Q|ZHX3_ENST00000544979.2_Silent_p.Q453Q|ZHX3_ENST00000559234.1_Silent_p.Q453Q|ZHX3_ENST00000540170.1_Silent_p.Q453Q|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000560361.1_Silent_p.Q453Q|ZHX3_ENST00000557816.1_Intron			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	453	Required for homodimerization and interaction with NFYA.|Required for repressor activity.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				CCACACCTGGCTGCTTGGGGA	0.572																																					p.Q453Q		Atlas-SNP	.											.	ZHX3	78	.	0			c.G1359A						.						58.0	48.0	52.0					20																	39832198		2203	4300	6503	SO:0001819	synonymous_variant	23051	exon3			ACCTGGCTGCTTG	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.1359G>A	chr20.hg19:g.39832198C>T		88.0	0.0		139.0	7.0	NM_015035	E1P5W5|F5H820|O43145|Q6NUJ7	Silent	SNP	ENST00000309060.3	hg19	CCDS13315.1	.	.	.	.	.	.	.	.	.	.	C	1.838	-0.468081	0.04476	.	.	ENSG00000174306	ENST00000421422	.	.	.	5.46	4.52	0.55395	.	.	.	.	.	T	0.54208	0.1844	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52609	-0.8553	4	.	.	.	-2.4736	4.7374	0.12995	0.0:0.5703:0.158:0.2718	.	.	.	.	T	162	.	.	A	-	1	0	ZHX3	39265612	0.851000	0.29673	0.996000	0.52242	0.815000	0.46073	0.911000	0.28584	1.309000	0.44985	-0.150000	0.13652	GCC	.	.		0.572	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	
IL17RA	23765	hgsc.bcm.edu	37	22	17590239	17590239	+	Silent	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr22:17590239C>T	ENST00000319363.6	+	13	2263	c.2130C>T	c.(2128-2130)ggC>ggT	p.G710G		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	710					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		GCAGCCCGGGCGCTGGGCGAA	0.736																																					p.G710G		Atlas-SNP	.											.	IL17RA	62	.	0			c.C2130T						.						11.0	12.0	11.0					22																	17590239		2188	4273	6461	SO:0001819	synonymous_variant	23765	exon13			CCCGGGCGCTGGG	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.2130C>T	chr22.hg19:g.17590239C>T		310.0	1.0		304.0	110.0	NM_014339	O43844|Q20WK1	Silent	SNP	ENST00000319363.6	hg19	CCDS13739.1																																																																																			.	.		0.736	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
PFKFB1	5207	hgsc.bcm.edu	37	X	54978348	54978348	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chrX:54978348C>T	ENST00000375006.3	-	8	906	c.836G>A	c.(835-837)cGc>cAc	p.R279H	PFKFB1_ENST00000545676.1_Missense_Mutation_p.R214H|PFKFB1_ENST00000374992.2_Intron	NM_002625.2	NP_002616.2	P16118	F261_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	279	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|intracellular signal transduction (GO:0035556)|organ regeneration (GO:0031100)|positive regulation of glucokinase activity (GO:0033133)|response to cAMP (GO:0051591)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase complex (GO:0043540)|cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|fructose-6-phosphate binding (GO:0070095)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)	24						CTGCTTGCCGCGAACTGAGAG	0.592																																					p.R279H		Atlas-SNP	.											.	PFKFB1	64	.	0			c.G836A						.						72.0	47.0	55.0					X																	54978348		2201	4297	6498	SO:0001583	missense	5207	exon8			TTGCCGCGAACTG		CCDS14364.1, CCDS65273.1	Xp11.21	2012-07-13			ENSG00000158571	ENSG00000158571	2.7.1.105, 3.1.3.46		8872	protein-coding gene	gene with protein product		311790		PFRX		9119406	Standard	NM_002625		Approved		uc004dty.2	P16118	OTTHUMG00000021643	ENST00000375006.3:c.836G>A	chrX.hg19:g.54978348C>T	ENSP00000364145:p.Arg279His	68.0	0.0		82.0	40.0	NM_002625	B2RA88|B4DUN5|Q5JXS5|Q99951	Missense_Mutation	SNP	ENST00000375006.3	hg19	CCDS14364.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058944	0.55325	.	.	ENSG00000158571	ENST00000375006;ENST00000545676	T;T	0.72505	-0.66;-0.66	4.53	4.53	0.55603	Histidine phosphatase superfamily, clade-1 (2);	0.052657	0.85682	D	0.000000	T	0.73273	0.3566	M	0.84511	2.7	0.80722	D	1	P;B	0.41748	0.761;0.321	B;B	0.37015	0.239;0.094	T	0.80638	-0.1293	10	0.72032	D	0.01	-11.0959	15.6194	0.76793	0.0:1.0:0.0:0.0	.	214;279	B4DUN5;P16118	.;F261_HUMAN	H	279;214	ENSP00000364145:R279H;ENSP00000444074:R214H	ENSP00000364145:R279H	R	-	2	0	PFKFB1	54995073	0.921000	0.31238	0.985000	0.45067	0.301000	0.27625	4.775000	0.62346	2.015000	0.59207	0.519000	0.50382	CGC	.	.		0.592	PFKFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056847.1		
GPR112	139378	hgsc.bcm.edu	37	X	135428654	135428654	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chrX:135428654T>C	ENST00000394143.1	+	6	3080	c.2789T>C	c.(2788-2790)aTg>aCg	p.M930T	GPR112_ENST00000412101.1_Missense_Mutation_p.M725T|GPR112_ENST00000394141.1_Missense_Mutation_p.M725T|GPR112_ENST00000287534.4_Missense_Mutation_p.M867T|GPR112_ENST00000370652.1_Missense_Mutation_p.M930T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	930					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ATGACAGAAATGTTTAATTTT	0.393																																					p.M930T		Atlas-SNP	.											.	GPR112	459	.	0			c.T2789C						.						117.0	115.0	116.0					X																	135428654		2202	4299	6501	SO:0001583	missense	139378	exon6			CAGAAATGTTTAA	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.2789T>C	chrX.hg19:g.135428654T>C	ENSP00000377699:p.Met930Thr	239.0	0.0		203.0	107.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	hg19	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	T	1.139	-0.650140	0.03506	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.27402	1.7;1.7;1.67;1.81;1.67	2.53	4.44E-4	0.14042	.	.	.	.	.	T	0.14830	0.0358	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.22487	-1.0215	9	0.52906	T	0.07	.	2.5999	0.04864	0.0:0.1782:0.3001:0.5217	.	867;725;930	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	T	930;930;725;867;725	ENSP00000377699:M930T;ENSP00000359686:M930T;ENSP00000416526:M725T;ENSP00000287534:M867T;ENSP00000377697:M725T	ENSP00000287534:M867T	M	+	2	0	GPR112	135256320	0.752000	0.28338	0.475000	0.27278	0.136000	0.21042	-0.025000	0.12413	-0.074000	0.12820	0.235000	0.17854	ATG	.	.		0.393	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
GJB1	2705	hgsc.bcm.edu	37	X	70443636	70443637	+	In_Frame_Ins	INS	-	-	TCATCT			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chrX:70443636_70443637insTCATCT	ENST00000374022.3	+	2	174_175	c.79_80insTCATCT	c.(79-81)gtc>gTCATCTtc	p.31_32insIF	GJB1_ENST00000361726.6_In_Frame_Ins_p.31_32insIF|GJB1_ENST00000374029.1_In_Frame_Ins_p.31_32insIF	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	31					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					ATGGCTCTCGGTCATCTTCATC	0.53																																					p.V27delinsVIF		Atlas-INDEL	.											.	GJB1	21	.	0			c.79_80insTCATCT						.																																			SO:0001652	inframe_insertion	2705	exon2			.	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.86_91dupTCATCT	chrX.hg19:g.70443637_70443642dupTCATCT	ENSP00000363134:p.Ile30_Phe31dup	116.0	0.0		86.0	16.0	NM_001097642	B2R8R2|D3DVV2|Q5U0S4	In_Frame_Ins	INS	ENST00000374022.3	hg19	CCDS14408.1																																																																																			.	.		0.530	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	NM_000166	
TMEM257	9142	hgsc.bcm.edu	37	X	144909207	144909207	+	Silent	SNP	A	A	G			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chrX:144909207A>G	ENST00000408967.2	+	1	280	c.12A>G	c.(10-12)agA>agG	p.R4R		NM_004709.2	NP_004700.1	O96002	TM257_HUMAN	transmembrane protein 257	4						integral component of membrane (GO:0016021)											TGTATTCCAGACTATTTTATT	0.249																																					p.R4R		Atlas-SNP	.											.	.	.	.	0			c.A12G						.						22.0	22.0	22.0					X																	144909207		2186	4243	6429	SO:0001819	synonymous_variant	9142	exon1			TTCCAGACTATTT	Y08902	CCDS14681.1	Xq27.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000221870	ENSG00000221870			2562	protein-coding gene	gene with protein product		300565	"""chromosome X open reading frame 1"""	CXorf1		9881668	Standard	NM_004709		Approved		uc004fch.3	O96002	OTTHUMG00000159605	ENST00000408967.2:c.12A>G	chrX.hg19:g.144909207A>G		265.0	0.0		332.0	61.0	NM_004709	Q14CW0	Silent	SNP	ENST00000408967.2	hg19	CCDS14681.1																																																																																			.	.		0.249	TMEM257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356465.1	NM_004709	
NACAD	23148	hgsc.bcm.edu	37	7	45123003	45123003	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr7:45123003delG	ENST00000490531.2	-	2	2795	c.2776delC	c.(2776-2778)ctgfs	p.L926fs		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	926					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TGCAGAGGCAGAGGTGCTGTC	0.637																																					p.L926fs		Atlas-INDEL	.											.	NACAD	44	.	0			c.2777delT						.						29.0	27.0	28.0					7																	45123003		691	1591	2282	SO:0001589	frameshift_variant	23148	exon2			.	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.2776delC	chr7.hg19:g.45123003delG	ENSP00000420477:p.Leu926fs	61.0	0.0		75.0	27.0	NM_001146334		Frame_Shift_Del	DEL	ENST00000490531.2	hg19	CCDS47582.1																																																																																			.	.		0.637	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
PNPT1	87178	hgsc.bcm.edu	37	2	55871841	55871846	+	In_Frame_Del	DEL	GAACCT	GAACCT	-			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	GAACCT	GAACCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:55871841_55871846delGAACCT	ENST00000447944.2	-	23	1918_1923	c.1832_1837delAGGTTC	c.(1831-1839)caggttcca>cca	p.QV611del		NM_033109.3	NP_149100.2	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	611	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA polyadenylation (GO:0097222)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA 5'-end processing (GO:0000964)|mitochondrial RNA catabolic process (GO:0000957)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle arrest (GO:0071850)|mRNA catabolic process (GO:0006402)|negative regulation of growth (GO:0045926)|nuclear polyadenylation-dependent mRNA catabolic process (GO:0071042)|positive regulation of miRNA catabolic process (GO:2000627)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|positive regulation of mRNA catabolic process (GO:0061014)|protein homooligomerization (GO:0051260)|protein homotrimerization (GO:0070207)|regulation of cellular respiration (GO:0043457)|regulation of cellular senescence (GO:2000772)|RNA catabolic process (GO:0006401)|RNA import into mitochondrion (GO:0035927)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA polyadenylation (GO:0043631)|rRNA import into mitochondrion (GO:0035928)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrial degradosome (GO:0045025)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	3'-5'-exoribonuclease activity (GO:0000175)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|polyribonucleotide nucleotidyltransferase activity (GO:0004654)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTTGATAATGGAACCTGAACAGTTTC	0.325																																					p.611_613del		Atlas-INDEL	.											.	PNPT1	68	.	0			c.1833_1838del						.																																			SO:0001651	inframe_deletion	87178	exon23			.	BC053660	CCDS1856.1	2p15	2013-01-08			ENSG00000138035	ENSG00000138035			23166	protein-coding gene	gene with protein product	"""polynucleotide phosphorylase"", ""3'-5' RNA exonuclease"""	610316	"""deafness, autosomal recessive 70"""	DFNB70		12419256	Standard	NM_033109		Approved	PNPase, OLD35, old-35	uc002rzf.3	Q8TCS8	OTTHUMG00000129335	ENST00000447944.2:c.1832_1837delAGGTTC	chr2.hg19:g.55871841_55871846delGAACCT	ENSP00000400646:p.Gln611_Val612del	43.0	0.0		51.0	10.0	NM_033109	Q53SU0|Q68CN1|Q7Z7D1|Q8IWX1|Q96T05|Q9BRU3|Q9BVX0	In_Frame_Del	DEL	ENST00000447944.2	hg19	CCDS1856.1																																																																																			.	.		0.325	PNPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251481.2	NM_033109	
APOB	338	hgsc.bcm.edu	37	2	21239420	21239421	+	Frame_Shift_Ins	INS	-	-	TCCGAGGTCAACATCAAAA			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr2:21239420_21239421insTCCGAGGTCAACATCAAAA	ENST00000233242.1	-	21	3349_3350	c.3222_3223insTTTTGATGTTGACCTCGGA	c.(3220-3225)ggaacafs	p.T1075fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1075					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGAGGATTGTTCCGAGGTCAA	0.45																																					p.T1075_I1076delinsFX		Atlas-INDEL	.											.	APOB	761	.	0			c.3223_3224insTTTTGATGTTGACCTCGGA						.																																			SO:0001589	frameshift_variant	338	exon21			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3204_3222dupTTTTGATGTTGACCTCGGA	chr2.hg19:g.21239420_21239421insTCCGAGGTCAACATCAAAA	ENSP00000233242:p.Thr1075fs	165.0	0.0		145.0	10.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.450	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ABCA10	10349	hgsc.bcm.edu	37	17	67212097	67212120	+	In_Frame_Del	DEL	CATAGGTTTCCTTATTAAAACACT	CATAGGTTTCCTTATTAAAACACT	-	rs143678315		TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	CATAGGTTTCCTTATTAAAACACT	CATAGGTTTCCTTATTAAAACACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chr17:67212097_67212120delCATAGGTTTCCTTATTAAAACACT	ENST00000269081.4	-	9	1603_1626	c.694_717delAGTGTTTTAATAAGGAAACCTATG	c.(694-717)agtgttttaataaggaaacctatgdel	p.SVLIRKPM232del	ABCA10_ENST00000416101.2_In_Frame_Del_p.SVLIRKPM232del|ABCA10_ENST00000432313.2_In_Frame_Del_p.SVLIRKPM232del	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	232					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S232R(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					AACCAGCGAGCATAGGTTTCCTTATTAAAACACTCATGAGGAAA	0.366																																					p.232_240del		Atlas-INDEL	.											.	ABCA10	209	.	1	Substitution - Missense(1)	breast(1)	c.695_718del						.																																			SO:0001651	inframe_deletion	10349	exon9			.	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.694_717delAGTGTTTTAATAAGGAAACCTATG	chr17.hg19:g.67212097_67212120delCATAGGTTTCCTTATTAAAACACT	ENSP00000269081:p.Ser232_Met239del	295.0	0.0		417.0	29.0	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	In_Frame_Del	DEL	ENST00000269081.4	hg19	CCDS11684.1																																																																																			.	.		0.366	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
NKAP	79576	hgsc.bcm.edu	37	X	119059265	119059267	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-G3-AAV6-01A-21D-A36X-10	TCGA-G3-AAV6-10A-01D-A370-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4543d206-bcd0-4bfc-a021-4b04cb3d5fb8	64362bb7-93d9-42fc-8259-b19ea7e0030f	g.chrX:119059265_119059267delTCT	ENST00000371410.3	-	9	1330_1332	c.1164_1166delAGA	c.(1162-1167)gaagag>gag	p.388_389EE>E	RP3-327A19.5_ENST00000455986.1_RNA|NKAP_ENST00000477789.1_5'UTR|AC002477.1_ENST00000581061.1_RNA	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	388	Necessary for interaction with HDAC3 and transcriptional repression.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						CTTTCGTCTCTCTTCTTGGTTAA	0.448																																					p.389_389del		Atlas-INDEL	.											.	NKAP	53	.	0			c.1165_1167del						.																																			SO:0001651	inframe_deletion	79576	exon9			.	BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.1164_1166delAGA	chrX.hg19:g.119059268_119059270delTCT	ENSP00000360464:p.Glu389del	101.0	0.0		90.0	23.0	NM_024528	Q6IPW6|Q96BQ2|Q9H638	In_Frame_Del	DEL	ENST00000371410.3	hg19	CCDS14592.1																																																																																			.	.		0.448	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058072.1	NM_024528	
