#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HIVEP3	59269	hgsc.bcm.edu	37	1	42047687	42047687	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:42047687G>T	ENST00000372583.1	-	4	3667	c.2782C>A	c.(2782-2784)Ctg>Atg	p.L928M	HIVEP3_ENST00000429157.2_Missense_Mutation_p.L928M|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000372584.1_Missense_Mutation_p.L928M|HIVEP3_ENST00000247584.5_Missense_Mutation_p.L928M	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	928	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.|Ser-rich.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTGCGAGACAGAGGCACAGAG	0.602																																					p.L928M		Atlas-SNP	.											.	HIVEP3	235	.	0			c.C2782A						.						85.0	92.0	90.0					1																	42047687		2203	4300	6503	SO:0001583	missense	59269	exon4			GAGACAGAGGCAC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2782C>A	chr1.hg19:g.42047687G>T	ENSP00000361664:p.Leu928Met	137.0	0.0		127.0	9.0	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	hg19	CCDS463.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.784173	0.70222	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	4.95	4.95	0.65309	.	0.000000	0.39210	N	0.001427	T	0.75852	0.3906	M	0.75615	2.305	0.44006	D	0.996712	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	T	0.77376	-0.2611	10	0.52906	T	0.07	-0.2663	16.9056	0.86127	0.0:0.0:1.0:0.0	.	928;928	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	M	928	ENSP00000361665:L928M;ENSP00000361664:L928M;ENSP00000247584:L928M;ENSP00000410828:L928M	ENSP00000247584:L928M	L	-	1	2	HIVEP3	41820274	1.000000	0.71417	0.996000	0.52242	0.948000	0.59901	6.278000	0.72614	2.562000	0.86427	0.462000	0.41574	CTG	.	.		0.602	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
SLC44A3	126969	hgsc.bcm.edu	37	1	95307574	95307574	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:95307574G>C	ENST00000271227.6	+	8	881	c.779G>C	c.(778-780)tGg>tCg	p.W260S	SLC44A3_ENST00000530397.1_3'UTR|SLC44A3_ENST00000446120.2_Missense_Mutation_p.W224S|SLC44A3_ENST00000527077.1_Missense_Mutation_p.W192S|RP11-465K1.2_ENST00000422162.1_RNA|SLC44A3_ENST00000532427.1_Missense_Mutation_p.W180S|SLC44A3_ENST00000467909.1_Missense_Mutation_p.W212S|SLC44A3_ENST00000529450.1_Missense_Mutation_p.W228S	NM_001114106.2|NM_001258340.1|NM_001258341.1	NP_001107578.1|NP_001245269.1|NP_001245270.1	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3	260					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|prostate(2)|stomach(1)|urinary_tract(1)	23		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)	GGTGTTTTATGGTGGCTGTAT	0.478																																					p.W260S		Atlas-SNP	.											.	SLC44A3	109	.	0			c.G779C						.						251.0	241.0	245.0					1																	95307574		2203	4300	6503	SO:0001583	missense	126969	exon8			TTTTATGGTGGCT	BC033858	CCDS751.1, CCDS44176.1, CCDS58011.1, CCDS58012.1, CCDS58013.1, CCDS72827.1	1p22.1	2013-05-22	2005-09-06		ENSG00000143036	ENSG00000143036		"""Solute carriers"""	28689	protein-coding gene	gene with protein product			"""solute carrier family, member 3"""			15715662, 12975309	Standard	NM_001114106		Approved	MGC45474, CTL3	uc001dqv.5	Q8N4M1	OTTHUMG00000010700	ENST00000271227.6:c.779G>C	chr1.hg19:g.95307574G>C	ENSP00000271227:p.Trp260Ser	80.0	0.0		106.0	7.0	NM_001114106	B4DVY4|B4E1M4|B7ZA08|E9PJH2|E9PJY8|Q6UWT1|Q7Z6C5|Q9BWY7	Missense_Mutation	SNP	ENST00000271227.6	hg19	CCDS44176.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163387	0.78226	.	.	ENSG00000143036	ENST00000446120;ENST00000271227;ENST00000527077;ENST00000529450;ENST00000467909;ENST00000532427	T;T;T;T;T;T	0.20463	2.57;2.77;2.08;2.09;2.57;2.07	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000006	T	0.43986	0.1272	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.999;0.999	D;D;D;D;D	0.85130	0.996;0.997;0.996;0.996;0.996	T	0.34403	-0.9830	10	0.87932	D	0	-14.3105	20.0189	0.97489	0.0:0.0:1.0:0.0	.	180;224;192;228;260	E9PIC5;Q8N4M1-3;E9PJY8;E9PJH2;Q8N4M1	.;.;.;.;CTL3_HUMAN	S	224;260;192;228;212;180	ENSP00000389143:W224S;ENSP00000271227:W260S;ENSP00000433641:W192S;ENSP00000431836:W228S;ENSP00000432789:W212S;ENSP00000436661:W180S	ENSP00000271227:W260S	W	+	2	0	SLC44A3	95080162	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.165000	0.77544	2.833000	0.97629	0.650000	0.86243	TGG	.	.		0.478	SLC44A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029544.3	NM_152369	
ASH1L	55870	hgsc.bcm.edu	37	1	155449069	155449069	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:155449069G>T	ENST00000368346.3	-	3	4231	c.3592C>A	c.(3592-3594)Ccc>Acc	p.P1198T	ASH1L_ENST00000392403.3_Missense_Mutation_p.P1198T			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1198					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CTATCACTGGGAATGGTCTCA	0.418																																					p.P1198T		Atlas-SNP	.											.	ASH1L	279	.	0			c.C3592A						.						111.0	115.0	114.0					1																	155449069		2203	4300	6503	SO:0001583	missense	55870	exon3			CACTGGGAATGGT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.3592C>A	chr1.hg19:g.155449069G>T	ENSP00000357330:p.Pro1198Thr	102.0	0.0		140.0	31.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	G	17.02	3.281267	0.59758	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90563	-2.69;-2.69	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.92116	0.7501	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.92626	0.6112	10	0.62326	D	0.03	.	18.5192	0.90945	0.0:0.0:1.0:0.0	.	1198;1198	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	T	1198	ENSP00000357330:P1198T;ENSP00000376204:P1198T	ENSP00000357330:P1198T	P	-	1	0	ASH1L	153715693	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.705000	0.92388	0.591000	0.81541	CCC	.	.		0.418	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
SPTA1	6708	hgsc.bcm.edu	37	1	158646003	158646003	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:158646003T>C	ENST00000368147.4	-	8	1220	c.1040A>G	c.(1039-1041)gAt>gGt	p.D347G		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	347					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GGAGACCAGATCTTCTTTCAT	0.473																																					p.D347G		Atlas-SNP	.											.	SPTA1	720	.	0			c.A1040G						.						194.0	184.0	187.0					1																	158646003		1922	4138	6060	SO:0001583	missense	6708	exon8			ACCAGATCTTCTT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1040A>G	chr1.hg19:g.158646003T>C	ENSP00000357129:p.Asp347Gly	67.0	0.0		129.0	39.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.414391	0.83449	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.36157	1.27;1.27	4.95	4.95	0.65309	.	0.248593	0.21031	N	0.081342	T	0.43986	0.1272	M	0.66939	2.045	0.53005	D	0.999966	P	0.46987	0.888	P	0.57009	0.811	T	0.46162	-0.9211	10	0.72032	D	0.01	.	13.6012	0.62020	0.0:0.0:0.0:1.0	.	347	P02549	SPTA1_HUMAN	G	347	ENSP00000357130:D347G;ENSP00000357129:D347G	ENSP00000357129:D347G	D	-	2	0	SPTA1	156912627	1.000000	0.71417	0.938000	0.37757	0.996000	0.88848	6.821000	0.75272	2.060000	0.61445	0.533000	0.62120	GAT	.	.		0.473	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
C1orf112	55732	hgsc.bcm.edu	37	1	169775144	169775144	+	Splice_Site	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:169775144G>C	ENST00000286031.6	+	7	1178		c.e7-1		C1orf112_ENST00000359326.4_Splice_Site|C1orf112_ENST00000456684.1_Splice_Site|C1orf112_ENST00000498289.1_Splice_Site|C1orf112_ENST00000413811.2_Splice_Site	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112											breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTTCTTTGCAGTTATTCATTC	0.308																																					.		Atlas-SNP	.											.	C1orf112	74	.	0			c.479-1G>C						.						98.0	88.0	91.0					1																	169775144		2200	4292	6492	SO:0001630	splice_region_variant	55732	exon7			TTTGCAGTTATTC	AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.479-1G>C	chr1.hg19:g.169775144G>C		37.0	0.0		54.0	11.0	NM_018186	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Splice_Site	SNP	ENST00000286031.6	hg19	CCDS1285.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164168	0.78339	.	.	ENSG00000000460	ENST00000413811;ENST00000359326;ENST00000456684;ENST00000286031	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9676	0.89103	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf112	168041768	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.637000	0.91014	2.657000	0.90304	0.655000	0.94253	.	.	.		0.308	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087126.3	NM_018186	Intron
ACBD6	84320	hgsc.bcm.edu	37	1	180471265	180471265	+	Missense_Mutation	SNP	A	A	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:180471265A>C	ENST00000367595.3	-	1	824	c.137T>G	c.(136-138)tTt>tGt	p.F46C		NM_032360.3	NP_115736.1	Q9BR61	ACBD6_HUMAN	acyl-CoA binding domain containing 6	46	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.					cytoplasm (GO:0005737)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)		ACBD6/RRP15(2)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)	7						AGCCTTCTCAAACAGCTCGGC	0.612																																					p.F46C		Atlas-SNP	.											.	ACBD6	20	.	0			c.T137G						.						39.0	39.0	39.0					1																	180471265		2203	4300	6503	SO:0001583	missense	84320	exon1			TTCTCAAACAGCT	BC006505	CCDS1339.1	1q25.1	2013-10-11	2010-04-30		ENSG00000135847			"""Ankyrin repeat domain containing"""	23339	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 6"""			18268358	Standard	NM_032360		Approved	MGC2404	uc001gog.3	Q9BR61	OTTHUMG00000035117	ENST00000367595.3:c.137T>G	chr1.hg19:g.180471265A>C	ENSP00000356567:p.Phe46Cys	206.0	0.0		208.0	51.0	NM_032360		Missense_Mutation	SNP	ENST00000367595.3	hg19	CCDS1339.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.028709	0.75504	.	.	ENSG00000135847	ENST00000367595	T	0.60171	0.21	4.9	4.9	0.64082	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (4);	0.000000	0.85682	D	0.000000	D	0.83198	0.5202	H	0.97131	3.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88563	0.3124	10	0.72032	D	0.01	-10.0939	13.6262	0.62165	1.0:0.0:0.0:0.0	.	46	Q9BR61	ACBD6_HUMAN	C	46	ENSP00000356567:F46C	ENSP00000356567:F46C	F	-	2	0	ACBD6	178737888	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	4.552000	0.60747	2.057000	0.61298	0.260000	0.18958	TTT	.	.		0.612	ACBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084998.1	NM_032360	
NEK2	4751	hgsc.bcm.edu	37	1	211842562	211842562	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:211842562G>C	ENST00000366999.4	-	6	1016	c.878C>G	c.(877-879)cCa>cGa	p.P293R	NEK2_ENST00000462283.1_5'UTR|NEK2_ENST00000540251.1_Missense_Mutation_p.P250R|NEK2_ENST00000366998.3_Missense_Mutation_p.P293R	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2	293	Interaction with PCNT.				blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		CGATTTTTCTGGCTCTCCTAA	0.438																																					p.P293R		Atlas-SNP	.											.	NEK2	49	.	0			c.C878G						.						134.0	136.0	136.0					1																	211842562		2203	4300	6503	SO:0001583	missense	4751	exon6			TTTTCTGGCTCTC	U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.878C>G	chr1.hg19:g.211842562G>C	ENSP00000355966:p.Pro293Arg	53.0	0.0		53.0	10.0	NM_002497	Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Missense_Mutation	SNP	ENST00000366999.4	hg19	CCDS1500.1	.	.	.	.	.	.	.	.	.	.	G	9.414	1.081309	0.20309	.	.	ENSG00000117650	ENST00000366999;ENST00000540251;ENST00000366998	D;D;T	0.87412	-2.25;-2.25;-0.59	4.91	4.91	0.64330	.	0.269488	0.42964	D	0.000629	D	0.83894	0.5353	L	0.54323	1.7	0.50467	D	0.999877	B;B;B	0.18610	0.0;0.001;0.029	B;B;B	0.26202	0.002;0.002;0.067	T	0.79009	-0.1978	10	0.28530	T	0.3	.	12.2836	0.54779	0.0:0.0:0.7038:0.2962	.	293;293;293	P51955-2;P51955;P51955-4	.;NEK2_HUMAN;.	R	293;250;293	ENSP00000355966:P293R;ENSP00000440237:P250R;ENSP00000355965:P293R	ENSP00000355965:P293R	P	-	2	0	NEK2	209909185	1.000000	0.71417	0.889000	0.34880	0.939000	0.58152	3.935000	0.56560	2.432000	0.82394	0.585000	0.79938	CCA	.	.		0.438	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090154.1	NM_002497	
COX20	116228	hgsc.bcm.edu	37	1	244999029	244999029	+	Missense_Mutation	SNP	C	C	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:244999029C>G	ENST00000411948.2	+	1	406	c.13C>G	c.(13-15)Ccg>Gcg	p.P5A	COX20_ENST00000366528.3_Missense_Mutation_p.P5A|COX20_ENST00000498262.1_3'UTR	NM_198076.4	NP_932342.1	Q5RI15	COX20_HUMAN	COX20 cytochrome C oxidase assembly factor	5						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											GGCCGCCCCGCCGGAGCCCGG	0.766																																					p.P5A		Atlas-SNP	.											.	.	.	.	0			c.C13G						.						2.0	2.0	2.0					1																	244999029		1279	2666	3945	SO:0001583	missense	116228	exon1			GCCCCGCCGGAGC	BC062419	CCDS31080.1	1q44	2013-05-24	2013-05-23	2012-02-24	ENSG00000203667	ENSG00000203667		"""Mitochondrial respiratory chain complex assembly factors"""	26970	protein-coding gene	gene with protein product		614698	"""family with sequence similarity 36, member A"", ""COX20 Cox2 chaperone homolog (S. cerevisiae)"""	FAM36A		22356826, 23125284	Standard	NM_198076		Approved	FLJ43269	uc001iar.3	Q5RI15	OTTHUMG00000040401	ENST00000411948.2:c.13C>G	chr1.hg19:g.244999029C>G	ENSP00000406327:p.Pro5Ala	54.0	0.0		83.0	19.0	NM_198076	Q8WV86	Missense_Mutation	SNP	ENST00000411948.2	hg19	CCDS31080.1	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987183	0.35036	.	.	ENSG00000203667	ENST00000411948;ENST00000366528	.	.	.	4.27	0.442	0.16582	.	0.876418	0.09914	N	0.739379	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B	0.19073	0.033	B	0.15052	0.012	T	0.25222	-1.0138	9	0.23891	T	0.37	1.9105	0.8223	0.01113	0.228:0.4031:0.1517:0.2172	.	5	Q5RI15	FA36A_HUMAN	A	5	.	ENSP00000355486:P5A	P	+	1	0	FAM36A	243065652	0.012000	0.17670	0.052000	0.19188	0.036000	0.12997	-0.233000	0.09041	0.338000	0.23692	0.455000	0.32223	CCG	.	.		0.766	COX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097174.1	NM_198076	
SNTG2	54221	hgsc.bcm.edu	37	2	1271232	1271232	+	Silent	SNP	C	C	A	rs370848778		TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr2:1271232C>A	ENST00000308624.5	+	14	1302	c.1173C>A	c.(1171-1173)atC>atA	p.I391I	SNTG2_ENST00000407292.1_Silent_p.I264I	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	391	PH.		I -> V (in dbSNP:rs13023962).		central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GCTTCAGCATCGTGGCCGGCC	0.522																																					p.I391I		Atlas-SNP	.											.	SNTG2	125	.	0			c.C1173A						.						53.0	52.0	52.0					2																	1271232		1937	4132	6069	SO:0001819	synonymous_variant	54221	exon14			CAGCATCGTGGCC	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1173C>A	chr2.hg19:g.1271232C>A		158.0	0.0		164.0	20.0	NM_018968	Q05AH5	Silent	SNP	ENST00000308624.5	hg19	CCDS46220.1																																																																																			.	.		0.522	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
SLC8A1	6546	hgsc.bcm.edu	37	2	40656037	40656037	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr2:40656037C>T	ENST00000403092.1	-	2	1417	c.1384G>A	c.(1384-1386)Gga>Aga	p.G462R	SLC8A1_ENST00000332839.4_Missense_Mutation_p.G462R|SLC8A1_ENST00000406391.2_Missense_Mutation_p.G462R|SLC8A1_ENST00000542756.1_Missense_Mutation_p.G462R|SLC8A1_ENST00000405901.3_Missense_Mutation_p.G462R|SLC8A1_ENST00000402441.1_Missense_Mutation_p.G462R|SLC8A1_ENST00000542024.1_Missense_Mutation_p.G462R|SLC8A1_ENST00000405269.1_Missense_Mutation_p.G462R|SLC8A1_ENST00000406785.2_Missense_Mutation_p.G462R|SLC8A1_ENST00000408028.2_Missense_Mutation_p.G462R			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	462	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.G462R(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	ACCACAGTTCCTTCAGTAAAT	0.418																																					p.G462R		Atlas-SNP	.											SLC8A1,face,carcinoma,0,1	SLC8A1	221	.	1	Substitution - Missense(1)	skin(1)	c.G1384A						.						81.0	71.0	75.0					2																	40656037		2203	4300	6503	SO:0001583	missense	6546	exon1			CAGTTCCTTCAGT		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1384G>A	chr2.hg19:g.40656037C>T	ENSP00000384763:p.Gly462Arg	72.0	0.0		54.0	4.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	hg19	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863057	0.71949	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	6.17	6.17	0.99709	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.76723	0.4027	M	0.90977	3.165	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0	T	0.80555	-0.1330	10	0.87932	D	0	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	462;462;462;462;462	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	R	462	ENSP00000383886:G462R;ENSP00000440727:G462R;ENSP00000384763:G462R;ENSP00000385678:G462R;ENSP00000385188:G462R;ENSP00000385535:G462R;ENSP00000332931:G462R;ENSP00000384908:G462R;ENSP00000385811:G462R;ENSP00000443515:G462R	ENSP00000332931:G462R	G	-	1	0	SLC8A1	40509541	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.663000	0.83820	2.941000	0.99782	0.655000	0.94253	GGA	.	.		0.418	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
VRK2	7444	hgsc.bcm.edu	37	2	58276008	58276008	+	Silent	SNP	A	A	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr2:58276008A>G	ENST00000435505.2	+	5	787	c.42A>G	c.(40-42)ccA>ccG	p.P14P	VRK2_ENST00000412104.2_Silent_p.P14P|VRK2_ENST00000417641.2_Silent_p.P14P|VRK2_ENST00000340157.4_Silent_p.P14P|VRK2_ENST00000440705.2_Intron			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	14					cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						TTCCTATTCCATTTCCAGAAG	0.383																																					p.P14P		Atlas-SNP	.											.	VRK2	46	.	0			c.A42G						.						93.0	98.0	96.0					2																	58276008		2203	4300	6503	SO:0001819	synonymous_variant	7444	exon2			TATTCCATTTCCA	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.42A>G	chr2.hg19:g.58276008A>G		189.0	0.0		183.0	22.0	NM_001130480	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Silent	SNP	ENST00000435505.2	hg19	CCDS1859.1																																																																																			.	.		0.383	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296	
UGGT1	56886	hgsc.bcm.edu	37	2	128877939	128877939	+	Silent	SNP	C	C	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr2:128877939C>T	ENST00000259253.6	+	9	929	c.882C>T	c.(880-882)caC>caT	p.H294H	UGGT1_ENST00000375990.3_Silent_p.H270H|RN7SL206P_ENST00000580933.1_RNA	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	294					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GAGATCTGCACCCCGACCTGG	0.388																																					p.H294H		Atlas-SNP	.											.	UGGT1	126	.	0			c.C882T						.						111.0	115.0	114.0					2																	128877939		2203	4300	6503	SO:0001819	synonymous_variant	56886	exon9			TCTGCACCCCGAC	AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.882C>T	chr2.hg19:g.128877939C>T		93.0	0.0		98.0	17.0	NM_020120	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Silent	SNP	ENST00000259253.6	hg19	CCDS2154.1																																																																																			.	.		0.388	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254435.2	NM_020120	
RBM44	375316	hgsc.bcm.edu	37	2	238726871	238726871	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr2:238726871A>G	ENST00000409864.1	+	3	1566	c.1312A>G	c.(1312-1314)Acc>Gcc	p.T438A	RBM44_ENST00000316997.4_Missense_Mutation_p.T438A|RBM44_ENST00000444524.2_Intron			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	437						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		TCATAGCAGTACCACAAAGAA	0.383																																					p.T438A		Atlas-SNP	.											.	RBM44	167	.	0			c.A1312G						.						63.0	59.0	60.0					2																	238726871		1915	4127	6042	SO:0001583	missense	375316	exon3			AGCAGTACCACAA	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.1312A>G	chr2.hg19:g.238726871A>G	ENSP00000386727:p.Thr438Ala	160.0	0.0		184.0	14.0	NM_001080504	A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	hg19	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	A	5.916	0.353160	0.11182	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.19669	2.13;2.13	5.86	-11.3	0.00108	.	1.049540	0.07417	N	0.893371	T	0.10981	0.0268	N	0.21448	0.665	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.33240	-0.9876	10	0.20519	T	0.43	7.7019	14.0856	0.64954	0.1871:0.1966:0.6163:0.0	.	437	Q6ZP01	RBM44_HUMAN	A	438	ENSP00000321179:T438A;ENSP00000386727:T438A	ENSP00000321179:T438A	T	+	1	0	RBM44	238391610	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.362000	0.07602	-1.946000	0.01035	-0.462000	0.05337	ACC	.	.		0.383	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504	
CACNA2D2	9254	hgsc.bcm.edu	37	3	50416567	50416567	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr3:50416567G>T	ENST00000479441.1	-	12	1215	c.1216C>A	c.(1216-1218)Cgc>Agc	p.R406S	CACNA2D2_ENST00000424201.2_Missense_Mutation_p.R406S|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.R406S|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.R406S|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.R337S|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.R406S|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.R406S|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.R406S			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	406	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TCCTGCACGCGGTCCTCACCA	0.597																																					p.R406S		Atlas-SNP	.											.	CACNA2D2	82	.	0			c.C1216A						.						164.0	125.0	138.0					3																	50416567		2203	4300	6503	SO:0001583	missense	9254	exon12			GCACGCGGTCCTC	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.1216C>A	chr3.hg19:g.50416567G>T	ENSP00000418081:p.Arg406Ser	56.0	0.0		57.0	13.0	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	hg19	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163305	0.78226	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.12984	2.63;2.63;2.63;2.63;2.63;2.63;2.63;2.63	4.82	4.82	0.62117	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.18130	0.0435	L	0.34521	1.04	0.80722	D	1	P;P	0.47409	0.895;0.872	P;P	0.48982	0.597;0.567	T	0.02173	-1.1201	10	0.27785	T	0.31	-14.7364	18.2971	0.90150	0.0:0.0:1.0:0.0	.	406;406	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	S	406;406;406;337;406;406;406;406	ENSP00000407393:R406S;ENSP00000404631:R406S;ENSP00000266039:R406S;ENSP00000354228:R337S;ENSP00000390526:R406S;ENSP00000378519:R406S;ENSP00000390329:R406S;ENSP00000418081:R406S	ENSP00000266039:R406S	R	-	1	0	CACNA2D2	50391571	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	5.472000	0.66768	2.407000	0.81776	0.650000	0.86243	CGC	.	.		0.597	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
CACNA1D	776	hgsc.bcm.edu	37	3	53834294	53834294	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr3:53834294C>T	ENST00000350061.5	+	41	5453	c.4942C>T	c.(4942-4944)Cat>Tat	p.H1648Y	CACNA1D_ENST00000288139.4_Missense_Mutation_p.H1668Y|RP11-884K10.6_ENST00000607740.1_RNA|CACNA1D_ENST00000544977.1_Missense_Mutation_p.H27Y|CACNA1D_ENST00000422281.2_Missense_Mutation_p.H1633Y	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1648					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AAGGACACTGCATGACATTGG	0.502																																					p.H1668Y		Atlas-SNP	.											.	CACNA1D	324	.	0			c.C5002T						.						226.0	200.0	209.0					3																	53834294		2203	4300	6503	SO:0001583	missense	776	exon42			ACACTGCATGACA	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4942C>T	chr3.hg19:g.53834294C>T	ENSP00000288133:p.His1648Tyr	94.0	0.0		92.0	11.0	NM_000720	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	ENST00000350061.5	hg19	CCDS46848.1	.	.	.	.	.	.	.	.	.	.	c	23.8	4.455961	0.84209	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000544977	D;D;D;D	0.96716	-4.07;-4.1;-4.09;-4.09	4.62	4.62	0.57501	.	0.542544	0.17149	N	0.185141	D	0.97757	0.9264	M	0.78916	2.43	0.51767	D	0.999933	D;B;D;D	0.64830	0.959;0.406;0.994;0.989	P;B;P;P	0.61201	0.643;0.375;0.885;0.852	D	0.98662	1.0684	10	0.87932	D	0	.	17.518	0.87779	0.0:1.0:0.0:0.0	.	1633;1341;1648;1668	B0FYA3;Q59GD8;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	Y	1648;1668;1633;1341;27	ENSP00000288133:H1648Y;ENSP00000288139:H1668Y;ENSP00000409174:H1633Y;ENSP00000418014:H1341Y	ENSP00000288139:H1668Y	H	+	1	0	CACNA1D	53809334	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.478000	0.81082	2.121000	0.65114	0.450000	0.29827	CAT	.	.		0.502	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
FOXP1	27086	hgsc.bcm.edu	37	3	71008538	71008538	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr3:71008538G>T	ENST00000318789.4	-	21	2419	c.1894C>A	c.(1894-1896)Cct>Act	p.P632T	FOXP1_ENST00000491238.1_Missense_Mutation_p.P634T|FOXP1_ENST00000493089.1_Missense_Mutation_p.P631T|FOXP1_ENST00000498215.1_Missense_Mutation_p.P632T|FOXP1_ENST00000484350.1_Missense_Mutation_p.P556T|FOXP1_ENST00000475937.1_Missense_Mutation_p.P632T|FOXP1_ENST00000468577.1_Missense_Mutation_p.P568T	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	632					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		ACGTGTACAGGATGCCTGGAA	0.517			T	PAX5	ALL																																p.P648T		Atlas-SNP	.		Dom	yes		3	3p14.1	27086	forkhead box P1		L	.	FOXP1	104	.	0			c.C1942A						.						99.0	91.0	94.0					3																	71008538		2203	4300	6503	SO:0001583	missense	27086	exon21			GTACAGGATGCCT	AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.1894C>A	chr3.hg19:g.71008538G>T	ENSP00000318902:p.Pro632Thr	64.0	0.0		73.0	9.0	NM_001244810	A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Missense_Mutation	SNP	ENST00000318789.4	hg19	CCDS2914.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895777	0.52121	.	.	ENSG00000114861	ENST00000318789;ENST00000358280;ENST00000475937;ENST00000497355;ENST00000491238;ENST00000493089;ENST00000498215;ENST00000484350;ENST00000468577	D;D;D;D;D;D;D;D	0.89552	-2.42;-2.42;-2.53;-2.53;-2.42;-2.42;-2.43;-2.21	6.16	6.16	0.99307	.	0.089396	0.85682	D	0.000000	D	0.85762	0.5772	N	0.24115	0.695	0.80722	D	1	P;P;P	0.47253	0.892;0.645;0.645	B;B;B	0.44163	0.443;0.23;0.297	D	0.85573	0.1235	10	0.46703	T	0.11	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	631;556;632	G5E9V8;Q8NAN6;Q9H334	.;.;FOXP1_HUMAN	T	632;444;632;528;634;631;632;556;568	ENSP00000318902:P632T;ENSP00000419393:P632T;ENSP00000418225:P528T;ENSP00000420736:P634T;ENSP00000418524:P631T;ENSP00000418102:P632T;ENSP00000417857:P556T;ENSP00000418883:P568T	ENSP00000318902:P632T	P	-	1	0	FOXP1	71091228	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	CCT	.	.		0.517	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352250.1	NM_032682	
MGLL	11343	hgsc.bcm.edu	37	3	127441291	127441291	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr3:127441291G>C	ENST00000434178.2	-	4	1247	c.351C>G	c.(349-351)ttC>ttG	p.F117L	MGLL_ENST00000265052.5_Missense_Mutation_p.F127L|MGLL_ENST00000453507.2_Missense_Mutation_p.F127L|MGLL_ENST00000398101.3_Missense_Mutation_p.F91L|MGLL_ENST00000398104.1_Missense_Mutation_p.F117L			Q99685	MGLL_HUMAN	monoglyceride lipase	117					acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						GGCCCAGAAGGAAGACAGGAA	0.557																																					p.F127L		Atlas-SNP	.											.	MGLL	19	.	0			c.C381G						.						86.0	90.0	88.0					3																	127441291		1955	4158	6113	SO:0001583	missense	11343	exon4			CAGAAGGAAGACA	BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.351C>G	chr3.hg19:g.127441291G>C	ENSP00000402798:p.Phe117Leu	91.0	0.0		82.0	10.0	NM_007283	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Missense_Mutation	SNP	ENST00000434178.2	hg19	CCDS43148.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605530	0.46527	.	.	ENSG00000074416	ENST00000434178;ENST00000265052;ENST00000398104;ENST00000398101;ENST00000487473;ENST00000536024;ENST00000453507;ENST00000484451;ENST00000493611	T;T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	4.69	3.81	0.43845	.	0.108393	0.64402	N	0.000005	T	0.62073	0.2398	M	0.62088	1.915	0.48288	D	0.99962	B;B;B;B;B	0.31949	0.329;0.098;0.059;0.269;0.348	B;B;B;B;B	0.41666	0.126;0.08;0.116;0.363;0.28	T	0.62530	-0.6835	10	0.62326	D	0.03	-37.1633	6.7379	0.23419	0.2831:0.0:0.7169:0.0	.	127;117;117;127;91	B7Z9D1;B2ZGL7;Q99685;B3KRC2;E7EWX8	.;.;MGLL_HUMAN;.;.	L	117;127;117;91;41;127;127;41;54	ENSP00000402798:F117L;ENSP00000265052:F127L;ENSP00000381176:F117L;ENSP00000381173:F91L;ENSP00000420125:F41L;ENSP00000419340:F41L;ENSP00000417689:F54L	ENSP00000265052:F127L	F	-	3	2	MGLL	128923981	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.045000	0.41250	0.976000	0.38417	0.306000	0.20318	TTC	.	.		0.557	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356637.2	NM_007283	
XRN1	54464	hgsc.bcm.edu	37	3	142030413	142030413	+	Silent	SNP	A	A	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr3:142030413A>T	ENST00000264951.4	-	42	5178	c.5061T>A	c.(5059-5061)tcT>tcA	p.S1687S	XRN1_ENST00000392981.2_Silent_p.S1675S	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1687					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						TTCTTCTTGAAGAAGAGATTG	0.363																																					p.S1687S		Atlas-SNP	.											.	XRN1	138	.	0			c.T5061A						.						113.0	124.0	120.0					3																	142030413		2203	4300	6503	SO:0001819	synonymous_variant	54464	exon42			TCTTGAAGAAGAG	AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.5061T>A	chr3.hg19:g.142030413A>T		144.0	0.0		143.0	23.0	NM_019001	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Silent	SNP	ENST00000264951.4	hg19	CCDS3123.1																																																																																			.	.		0.363	XRN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354087.2	NM_019001	
KCTD8	386617	hgsc.bcm.edu	37	4	44449696	44449696	+	Missense_Mutation	SNP	C	C	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr4:44449696C>A	ENST00000360029.3	-	1	1128	c.845G>T	c.(844-846)cGc>cTc	p.R282L	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	282					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)		p.R282H(1)		central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						CTCGGACAGGCGATCAAAGGC	0.632										HNSCC(17;0.042)																											p.R282L		Atlas-SNP	.											KCTD8,NS,carcinoma,0,1	KCTD8	96	.	1	Substitution - Missense(1)	endometrium(1)	c.G845T						.						51.0	45.0	47.0					4																	44449696		2203	4300	6503	SO:0001583	missense	386617	exon1			GACAGGCGATCAA	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.845G>T	chr4.hg19:g.44449696C>A	ENSP00000353129:p.Arg282Leu	98.0	1.0		66.0	9.0	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	hg19	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.825489	0.50739	.	.	ENSG00000183783	ENST00000360029	T	0.38887	1.11	4.19	4.19	0.49359	.	0.000000	0.64402	D	0.000002	T	0.35566	0.0936	L	0.34521	1.04	0.42680	D	0.993545	P	0.47841	0.901	B	0.42214	0.38	T	0.34204	-0.9838	10	0.51188	T	0.08	.	15.7002	0.77536	0.0:1.0:0.0:0.0	.	282	Q6ZWB6	KCTD8_HUMAN	L	282	ENSP00000353129:R282L	ENSP00000353129:R282L	R	-	2	0	KCTD8	44144453	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.777000	0.55364	2.173000	0.68751	0.585000	0.79938	CGC	.	.		0.632	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
CCDC125	202243	hgsc.bcm.edu	37	5	68609823	68609823	+	Missense_Mutation	SNP	C	C	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr5:68609823C>G	ENST00000396496.2	-	3	462	c.355G>C	c.(355-357)Gaa>Caa	p.E119Q	CCDC125_ENST00000396499.1_Missense_Mutation_p.E119Q|CCDC125_ENST00000383374.2_Missense_Mutation_p.E118Q|CCDC125_ENST00000511257.1_5'UTR|CCDC125_ENST00000460090.1_Intron			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	119						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TCTAAAGTTTCATTAAGACAT	0.398																																					p.E119Q		Atlas-SNP	.											.	CCDC125	41	.	0			c.G355C						.						118.0	130.0	126.0					5																	68609823		2203	4300	6503	SO:0001583	missense	202243	exon2			AAGTTTCATTAAG	AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.355G>C	chr5.hg19:g.68609823C>G	ENSP00000379754:p.Glu119Gln	93.0	0.0		76.0	9.0	NM_176816	Q86Z19	Missense_Mutation	SNP	ENST00000396496.2	hg19	CCDS4000.1	.	.	.	.	.	.	.	.	.	.	C	7.639	0.680469	0.14907	.	.	ENSG00000183323	ENST00000396496;ENST00000396499;ENST00000383374	T;T;T	0.49720	0.77;0.77;0.77	5.49	4.58	0.56647	.	0.058284	0.64402	D	0.000003	T	0.35128	0.0921	L	0.29908	0.895	0.33313	D	0.566287	B	0.09022	0.002	B	0.16722	0.016	T	0.43065	-0.9414	10	0.48119	T	0.1	-2.5396	9.4893	0.38948	0.0:0.8957:0.0:0.1043	.	119	Q86Z20	CC125_HUMAN	Q	119;119;118	ENSP00000379754:E119Q;ENSP00000379756:E119Q;ENSP00000372865:E118Q	ENSP00000372865:E118Q	E	-	1	0	CCDC125	68645579	0.998000	0.40836	0.942000	0.38095	0.009000	0.06853	4.633000	0.61318	1.235000	0.43724	-0.389000	0.06534	GAA	.	.		0.398	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254027.4	NM_176816	
PCDHA5	56143	hgsc.bcm.edu	37	5	140203606	140203606	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr5:140203606A>G	ENST00000529859.1	+	1	2246	c.2246A>G	c.(2245-2247)tAc>tGc	p.Y749C	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000378126.3_Missense_Mutation_p.Y749C|PCDHA5_ENST00000529619.1_Missense_Mutation_p.Y749C	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	749					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGGTCGTACTCGCAGCAG	0.647																																					p.Y749C		Atlas-SNP	.											.	PCDHA5	361	.	0			c.A2246G						.						73.0	66.0	68.0					5																	140203606		2203	4300	6503	SO:0001583	missense	56143	exon1			GGTCGTACTCGCA	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.2246A>G	chr5.hg19:g.140203606A>G	ENSP00000436557:p.Tyr749Cys	156.0	0.0		168.0	16.0	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	hg19	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	A	3.368	-0.129001	0.06753	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.15372	2.43;2.43;2.43	3.92	-1.96	0.07525	.	.	.	.	.	T	0.27489	0.0675	M	0.91717	3.235	0.09310	N	1	B;B;B	0.26547	0.053;0.152;0.152	B;B;B	0.31547	0.043;0.132;0.132	T	0.32295	-0.9912	9	0.62326	D	0.03	.	7.3622	0.26752	0.6049:0.1096:0.2854:0.0	.	749;749;749	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	C	749	ENSP00000433416:Y749C;ENSP00000436557:Y749C;ENSP00000367366:Y749C	ENSP00000367366:Y749C	Y	+	2	0	PCDHA5	140183790	0.056000	0.20664	0.002000	0.10522	0.001000	0.01503	0.220000	0.17660	-1.067000	0.03160	-1.751000	0.00678	TAC	.	.		0.647	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
PCDHA7	56141	hgsc.bcm.edu	37	5	140215307	140215307	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr5:140215307G>A	ENST00000525929.1	+	1	1339	c.1339G>A	c.(1339-1341)Gac>Aac	p.D447N	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.D447N|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	447	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGGTGGCCGACGTGAACGA	0.667																																					p.D447N	NSCLC(160;258 2013 5070 22440 28951)	Atlas-SNP	.											.	PCDHA7	367	.	0			c.G1339A						.						71.0	75.0	74.0					5																	140215307		2203	4298	6501	SO:0001583	missense	56141	exon1			GTGGCCGACGTGA	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1339G>A	chr5.hg19:g.140215307G>A	ENSP00000436426:p.Asp447Asn	182.0	0.0		161.0	11.0	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	hg19	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765133	0.69878	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	D;D	0.84298	-1.83;-1.83	4.04	4.04	0.47022	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.33180	U	0.005193	D	0.94178	0.8132	M	0.93638	3.44	0.44309	D	0.997182	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95982	0.8978	10	0.87932	D	0	.	16.5697	0.84608	0.0:0.0:1.0:0.0	.	447;447	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	N	447	ENSP00000436426:D447N;ENSP00000367365:D447N	ENSP00000367365:D447N	D	+	1	0	PCDHA7	140195491	1.000000	0.71417	0.992000	0.48379	0.247000	0.25773	7.816000	0.86201	1.955000	0.56771	0.305000	0.20034	GAC	.	.		0.667	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
HIST1H1A	3024	hgsc.bcm.edu	37	6	26017773	26017773	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr6:26017773G>A	ENST00000244573.3	-	1	267	c.188C>T	c.(187-189)gCa>gTa	p.A63V	HIST1H3A_ENST00000357647.3_5'Flank	NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	63	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						TTTAAGAGCTGCCAACGACAC	0.577																																					p.A63V		Atlas-SNP	.											.	HIST1H1A	25	.	0			c.C188T						.						51.0	52.0	52.0					6																	26017773		2203	4300	6503	SO:0001583	missense	3024	exon1			AGAGCTGCCAACG	AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.188C>T	chr6.hg19:g.26017773G>A	ENSP00000244573:p.Ala63Val	102.0	0.0		85.0	9.0	NM_005325	Q3MJ34	Missense_Mutation	SNP	ENST00000244573.3	hg19	CCDS4569.1	.	.	.	.	.	.	.	.	.	.	N	17.52	3.411253	0.62399	.	.	ENSG00000124610	ENST00000244573	T	0.15372	2.43	4.2	4.2	0.49525	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.111728	0.64402	D	0.000012	T	0.26521	0.0648	L	0.59967	1.855	0.80722	D	1	D	0.54397	0.966	D	0.64687	0.928	T	0.01156	-1.1434	10	0.39692	T	0.17	-1.553	16.4244	0.83809	0.0:0.0:1.0:0.0	.	63	Q02539	H11_HUMAN	V	63	ENSP00000244573:A63V	ENSP00000244573:A63V	A	-	2	0	HIST1H1A	26125752	1.000000	0.71417	0.197000	0.23402	0.015000	0.08874	9.771000	0.98977	2.260000	0.74910	0.609000	0.83330	GCA	.	.		0.577	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325	
HIST1H2AG	8969	hgsc.bcm.edu	37	6	27101160	27101160	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr6:27101160G>A	ENST00000359193.2	+	1	329	c.310G>A	c.(310-312)Gca>Aca	p.A104T	HIST1H2BJ_ENST00000541790.1_5'Flank|HIST1H2BJ_ENST00000607124.1_5'Flank|HIST1H2BJ_ENST00000339812.2_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	104						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						AGTCACCATCGCACAGGGCGG	0.572																																					p.A104T		Atlas-SNP	.											HIST1H2AG,NS,carcinoma,0,1	HIST1H2AG	37	.	0			c.G310A						.						111.0	104.0	106.0					6																	27101160		2203	4300	6503	SO:0001583	missense	8969	exon1			ACCATCGCACAGG	L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.310G>A	chr6.hg19:g.27101160G>A	ENSP00000352119:p.Ala104Thr	189.0	1.0		141.0	19.0	NM_021064	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359193.2	hg19	CCDS4619.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553793	0.86231	.	.	ENSG00000196787	ENST00000359193	T	0.44482	0.92	4.08	4.08	0.47627	Histone-fold (2);Histone H2A (2);	0.000000	0.39909	N	0.001235	T	0.54565	0.1866	.	.	.	0.39429	D	0.967052	D	0.89917	1.0	D	0.65443	0.935	T	0.62248	-0.6894	9	0.87932	D	0	.	14.6102	0.68510	0.0:0.0:1.0:0.0	.	104	P0C0S8	H2A1_HUMAN	T	104	ENSP00000352119:A104T	ENSP00000352119:A104T	A	+	1	0	HIST1H2AG	27209139	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	6.919000	0.75793	2.217000	0.71921	0.655000	0.94253	GCA	.	.		0.572	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064	
CDC5L	988	hgsc.bcm.edu	37	6	44394452	44394452	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr6:44394452G>C	ENST00000371477.3	+	13	2183	c.1884G>C	c.(1882-1884)gaG>gaC	p.E628D		NM_001253.3	NP_001244.1	Q99459	CDC5L_HUMAN	cell division cycle 5-like	628	Interaction with DAPK3. {ECO:0000250|UniProtKB:O08837}.				cell cycle (GO:0007049)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Prp19 complex (GO:0000974)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|WD40-repeat domain binding (GO:0071987)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(4)	29	all_lung(25;0.00433)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCAAAGAAGAGCTGAAAAAGG	0.348																																					p.E628D		Atlas-SNP	.											.	CDC5L	86	.	0			c.G1884C						.						75.0	75.0	75.0					6																	44394452		2202	4299	6501	SO:0001583	missense	988	exon13			AGAAGAGCTGAAA	D85423	CCDS4912.1	6p21.1	2013-01-17	2013-01-17		ENSG00000096401	ENSG00000096401			1743	protein-coding gene	gene with protein product		602868	"""CDC5 (cell division cycle 5, S. pombe, homolog)-like"", ""CDC5 cell division cycle 5-like (S. pombe)"""			9598309, 9038199	Standard	NM_001253		Approved	PCDC5RP, hCDC5, CEF1, CDC5	uc003oxl.3	Q99459	OTTHUMG00000014767	ENST00000371477.3:c.1884G>C	chr6.hg19:g.44394452G>C	ENSP00000360532:p.Glu628Asp	97.0	0.0		102.0	10.0	NM_001253	Q76N46|Q99974	Missense_Mutation	SNP	ENST00000371477.3	hg19	CCDS4912.1	.	.	.	.	.	.	.	.	.	.	G	8.203	0.798535	0.16397	.	.	ENSG00000096401	ENST00000371477	T	0.47869	0.83	5.71	-1.18	0.09617	.	0.261207	0.44688	N	0.000436	T	0.08133	0.0203	N	0.17723	0.515	0.40698	D	0.982455	B	0.06786	0.001	B	0.08055	0.003	T	0.15492	-1.0435	10	0.13470	T	0.59	-12.0426	0.8339	0.01136	0.25:0.1085:0.2463:0.3952	.	628	Q99459	CDC5L_HUMAN	D	628	ENSP00000360532:E628D	ENSP00000360532:E628D	E	+	3	2	CDC5L	44502430	0.007000	0.16637	0.973000	0.42090	0.994000	0.84299	-1.079000	0.03410	0.061000	0.16311	0.650000	0.86243	GAG	.	.		0.348	CDC5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040743.1		
COL9A1	1297	hgsc.bcm.edu	37	6	70964854	70964854	+	Splice_Site	SNP	G	G	A	rs141895443		TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr6:70964854G>A	ENST00000357250.6	-	23	1768	c.1610C>T	c.(1609-1611)aCg>aTg	p.T537M	COL9A1_ENST00000489611.1_5'UTR|COL9A1_ENST00000370499.4_Splice_Site_p.T294M|COL9A1_ENST00000320755.7_Splice_Site_p.T294M	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	537	Triple-helical region (COL2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						AGGACATACCGTGTCTCCTTT	0.433																																					p.T537M		Atlas-SNP	.											.	COL9A1	228	.	0			c.C1610T						.	G	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	162.0	164.0	163.0		1610,881	4.0	1.0	6	dbSNP_134	163	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice,missense-near-splice	COL9A1	NM_001851.4,NM_078485.3	81,81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,benign	537/922,294/679	70964854	2,13004	2203	4300	6503	SO:0001630	splice_region_variant	1297	exon23			CATACCGTGTCTC		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.1611+1C>T	chr6.hg19:g.70964854G>A		123.0	0.0		118.0	14.0	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	hg19	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	9.413	1.081059	0.20309	2.27E-4	1.16E-4	ENSG00000112280	ENST00000357250;ENST00000320755;ENST00000370499	D;D;D	0.93659	-3.26;-3.26;-3.26	5.92	3.99	0.46301	.	0.423225	0.27901	N	0.017395	T	0.72938	0.3523	N	0.16790	0.44	0.30352	N	0.784694	P;P;B	0.38992	0.653;0.521;0.006	B;B;B	0.21151	0.023;0.033;0.007	T	0.70967	-0.4728	10	0.48119	T	0.1	.	9.0928	0.36621	0.0804:0.0:0.7134:0.2062	.	537;294;110	P20849;P20849-2;B3KWS8	CO9A1_HUMAN;.;.	M	537;294;294	ENSP00000349790:T537M;ENSP00000315252:T294M;ENSP00000359530:T294M	ENSP00000315252:T294M	T	-	2	0	COL9A1	71021575	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	1.358000	0.34102	1.507000	0.48752	0.655000	0.94253	ACG	.	G|1.000;A|0.000		0.433	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		Missense_Mutation
CPA5	93979	hgsc.bcm.edu	37	7	130007818	130007818	+	Silent	SNP	C	C	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr7:130007818C>T	ENST00000485477.1	+	11	2239	c.1110C>T	c.(1108-1110)atC>atT	p.I370I	CPA5_ENST00000474905.1_Silent_p.I370I|CPA5_ENST00000393213.3_Silent_p.I370I|CPA5_ENST00000461828.1_Silent_p.I370I|CPA5_ENST00000431780.2_Intron|CPA5_ENST00000466363.2_Silent_p.I370I|CPA5_ENST00000355388.3_Silent_p.I370I			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	370						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					TTGGCAGCATCAGCACCACCC	0.572																																					p.I370I		Atlas-SNP	.											.	CPA5	61	.	0			c.C1110T						.						129.0	92.0	104.0					7																	130007818		2203	4300	6503	SO:0001819	synonymous_variant	93979	exon12			CAGCATCAGCACC	AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.1110C>T	chr7.hg19:g.130007818C>T		81.0	0.0		57.0	6.0	NM_080385	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Silent	SNP	ENST00000485477.1	hg19	CCDS5819.1																																																																																			.	.		0.572	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
ASB10	136371	hgsc.bcm.edu	37	7	150883497	150883497	+	Missense_Mutation	SNP	C	C	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr7:150883497C>A	ENST00000420175.2	-	2	590	c.566G>T	c.(565-567)cGg>cTg	p.R189L	ASB10_ENST00000275838.1_Missense_Mutation_p.R189L|ASB10_ENST00000422024.1_Missense_Mutation_p.R234L|ASB10_ENST00000377867.3_Missense_Mutation_p.R174L|ASB10_ENST00000434669.1_Missense_Mutation_p.R234L			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10	189			R -> W. {ECO:0000269|PubMed:22156576}.		intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCAGGCCCCCGGCAGAGATG	0.617																																					p.R189L		Atlas-SNP	.											.	ASB10	99	.	0			c.G566T						.						13.0	13.0	13.0					7																	150883497		2192	4276	6468	SO:0001583	missense	136371	exon2			GGCCCCCGGCAGA	AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013	ENST00000420175.2:c.566G>T	chr7.hg19:g.150883497C>A	ENSP00000391137:p.Arg189Leu	98.0	0.0		117.0	9.0	NM_001142459	A0AVH0|Q6ZUL6	Missense_Mutation	SNP	ENST00000420175.2	hg19	CCDS47750.2	.	.	.	.	.	.	.	.	.	.	C	12.36	1.915657	0.33815	.	.	ENSG00000146926	ENST00000275838;ENST00000377867;ENST00000422024;ENST00000434669;ENST00000420175	T;T;T;T;T	0.62788	-0.0;-0.0;-0.0;-0.0;-0.0	4.96	-1.53	0.08611	Ankyrin repeat-containing domain (4);	1.056820	0.07338	N	0.880316	T	0.44787	0.1310	N	0.04148	-0.265	0.09310	N	1	B;B;B	0.31705	0.123;0.256;0.336	B;B;B	0.39339	0.085;0.297;0.165	T	0.49437	-0.8940	10	0.54805	T	0.06	-1.5839	11.208	0.48782	0.0:0.3265:0.0:0.6735	.	174;189;234	Q8WXI3-3;Q8WXI3;D5MNW9	.;ASB10_HUMAN;.	L	189;174;234;234;189	ENSP00000275838:R189L;ENSP00000367098:R174L;ENSP00000401369:R234L;ENSP00000398247:R234L;ENSP00000391137:R189L	ENSP00000275838:R189L	R	-	2	0	ASB10	150514430	0.062000	0.20869	0.216000	0.23742	0.973000	0.67179	0.056000	0.14256	-0.272000	0.09259	-0.218000	0.12543	CGG	.	.		0.617	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347096.3	NM_080871	
CSMD1	64478	hgsc.bcm.edu	37	8	2823435	2823435	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr8:2823435G>A	ENST00000520002.1	-	60	9700	c.9145C>T	c.(9145-9147)Cag>Tag	p.Q3049*	CSMD1_ENST00000537824.1_Nonsense_Mutation_p.Q3048*|CSMD1_ENST00000602723.1_Intron|CSMD1_ENST00000400186.3_Intron|CSMD1_ENST00000542608.1_Intron|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.Q3049*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3049	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTCCCAAACTGGATGCCATTT	0.433																																					p.Q3048X		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C9142T						.						93.0	93.0	93.0					8																	2823435		2048	4195	6243	SO:0001587	stop_gained	64478	exon59			CAAACTGGATGCC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9145C>T	chr8.hg19:g.2823435G>A	ENSP00000430733:p.Gln3049*	142.0	0.0		348.0	19.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	ENST00000520002.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	48|48	14.003373|14.003373	0.99774|0.99774	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000520002;ENST00000318252;ENST00000537824	.|.	.|.	.|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.265060	.|0.31381	.|N	.|0.007758	T|.	0.72053|.	0.3413|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.67405|.	-0.5679|.	4|.	.|0.29301	.|T	.|0.29	.|.	19.2323|19.2323	0.93845|0.93845	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	2465|3049;2910;3048	.|.	.|ENSP00000320445:Q2910X	P|Q	-|-	2|1	0|0	CSMD1|CSMD1	2810842|2810842	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.843000|0.843000	0.47879|0.47879	4.550000|4.550000	0.60733|0.60733	2.541000|2.541000	0.85698|0.85698	0.655000|0.655000	0.94253|0.94253	CCA|CAG	.	.		0.433	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
APBA1	320	hgsc.bcm.edu	37	9	72071259	72071259	+	Silent	SNP	A	A	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr9:72071259A>T	ENST00000265381.4	-	8	1914	c.1692T>A	c.(1690-1692)ccT>ccA	p.P564P	APBA1_ENST00000470082.1_5'UTR	NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	564	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						AGTTGGAGCGAGGCATCCGCC	0.567																																					p.P564P		Atlas-SNP	.											.	APBA1	96	.	0			c.T1692A						.						245.0	232.0	237.0					9																	72071259		2203	4300	6503	SO:0001819	synonymous_variant	320	exon8			GGAGCGAGGCATC	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1692T>A	chr9.hg19:g.72071259A>T		69.0	0.0		75.0	13.0	NM_001163	O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	hg19	CCDS6630.1																																																																																			.	.		0.567	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
GALNT12	79695	hgsc.bcm.edu	37	9	101589127	101589127	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr9:101589127G>A	ENST00000375011.3	+	3	635	c.635G>A	c.(634-636)cGg>cAg	p.R212Q		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	212	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				GTGCGAGCCCGGCTGCTGGGG	0.652																																					p.R212Q		Atlas-SNP	.											.	GALNT12	37	.	0			c.G635A						.						27.0	27.0	27.0					9																	101589127		2203	4300	6503	SO:0001583	missense	79695	exon3			GAGCCCGGCTGCT	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.635G>A	chr9.hg19:g.101589127G>A	ENSP00000364150:p.Arg212Gln	80.0	0.0		64.0	14.0	NM_024642	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	hg19	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	G	37	5.993299	0.97184	.	.	ENSG00000119514	ENST00000375011	T	0.64085	-0.08	5.96	5.96	0.96718	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	D	0.86727	0.6002	H	0.96720	3.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90450	0.4438	10	0.87932	D	0	.	17.902	0.88907	0.0:0.0:1.0:0.0	.	212	Q8IXK2	GLT12_HUMAN	Q	212	ENSP00000364150:R212Q	ENSP00000364150:R212Q	R	+	2	0	GALNT12	100628948	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.809000	0.99208	2.814000	0.96858	0.655000	0.94253	CGG	.	.		0.652	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
SAA2	6289	hgsc.bcm.edu	37	11	18266927	18266927	+	Silent	SNP	G	G	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr11:18266927G>A	ENST00000526900.1	-	4	549	c.366C>T	c.(364-366)taC>taT	p.Y122Y	SAA2_ENST00000256733.4_Silent_p.Y122Y|SAA2_ENST00000528349.1_Intron|SAA2_ENST00000529528.1_Silent_p.Y122Y|SAA2_ENST00000530400.1_Intron|SAA2-SAA4_ENST00000524555.1_RNA|SAA2_ENST00000414546.2_Intron			P0DJI9	SAA2_HUMAN	serum amyloid A2	122					acute-phase response (GO:0006953)	extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(1)	6						AGGAAGCTCAGTATTTCTCAG	0.562																																					p.Y122Y		Atlas-SNP	.											.	SAA2	22	.	0			c.C366T						.						90.0	82.0	85.0					11																	18266927		2199	4293	6492	SO:0001819	synonymous_variant	6289	exon4			AGCTCAGTATTTC	M26152	CCDS7833.1, CCDS44548.1	11p15.1-p14	2008-07-21			ENSG00000134339	ENSG00000134339			10514	protein-coding gene	gene with protein product		104751				7686132	Standard	NM_030754		Approved			P0DJI9	OTTHUMG00000166484	ENST00000526900.1:c.366C>T	chr11.hg19:g.18266927G>A		96.0	0.0		104.0	10.0	NM_030754	G3XAK9|P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Silent	SNP	ENST00000526900.1	hg19	CCDS7833.1																																																																																			.	.		0.562	SAA2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389983.1	NM_030754	
MTA2	9219	hgsc.bcm.edu	37	11	62364838	62364839	+	Nonsense_Mutation	DNP	GC	GC	AT			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr11:62364838_62364839GC>AT	ENST00000278823.2	-	8	1031_1032	c.642_643GC>AT	c.(640-645)cgGCag>cgATag	p.Q215*	MTA2_ENST00000527204.1_Nonsense_Mutation_p.Q42*|MTA2_ENST00000524902.1_Nonsense_Mutation_p.Q42*	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	215	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						AAGCTTGGCTGCCGAATGGAGC	0.51																																					p.Q215X|p.R214R		Atlas-SNP	.											.	MTA2	54	.	0			c.C643T|c.G642A						.																																			SO:0001587	stop_gained	9219	exon8			TTGGCTGCCGAAT|TGGCTGCCGAATG	AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.642_643delinsAT	chr11.hg19:g.62364838_62364839delinsAT	ENSP00000278823:p.Gln215*	141.0	0.0		135.0|134.0	19.0|18.0	NM_004739	Q68DB1|Q9UQB5	Nonsense_Mutation|Silent	SNP	ENST00000278823.2	hg19	CCDS8022.1																																																																																			.	.		0.510	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395578.1	NM_004739	
NEDD1	121441	hgsc.bcm.edu	37	12	97331084	97331084	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr12:97331084G>C	ENST00000266742.4	+	9	1369	c.1030G>C	c.(1030-1032)Gca>Cca	p.A344P	NEDD1_ENST00000429527.2_Missense_Mutation_p.A344P|NEDD1_ENST00000457368.2_Missense_Mutation_p.A255P|NEDD1_ENST00000411739.2_Missense_Mutation_p.A255P|NEDD1_ENST00000557644.1_Missense_Mutation_p.A351P	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	344					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						TGTCAGAGAAGCACCTGCCAC	0.433																																					p.A351P		Atlas-SNP	.											.	NEDD1	47	.	0			c.G1051C						.						152.0	129.0	137.0					12																	97331084		2203	4300	6503	SO:0001583	missense	121441	exon8			AGAGAAGCACCTG		CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.1030G>C	chr12.hg19:g.97331084G>C	ENSP00000266742:p.Ala344Pro	114.0	0.0		129.0	17.0	NM_001135175	B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	hg19	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	G	13.28	2.189720	0.38707	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000557644;ENST00000457368	T;T;T;T;T	0.50001	0.76;0.76;1.54;0.76;1.54	5.65	-1.02	0.10135	.	1.346880	0.04337	N	0.353378	T	0.30230	0.0758	N	0.24115	0.695	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.23655	-1.0182	10	0.45353	T	0.12	.	2.0603	0.03591	0.1584:0.1195:0.2492:0.4729	.	351;344	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	P	344;344;255;351;255	ENSP00000266742:A344P;ENSP00000404978:A344P;ENSP00000411307:A255P;ENSP00000451211:A351P;ENSP00000407964:A255P	ENSP00000266742:A344P	A	+	1	0	NEDD1	95855215	0.000000	0.05858	0.185000	0.23176	0.213000	0.24496	-0.690000	0.05138	0.274000	0.22072	0.591000	0.81541	GCA	.	.		0.433	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1		
ANKRD13A	88455	hgsc.bcm.edu	37	12	110457106	110457106	+	Missense_Mutation	SNP	T	T	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr12:110457106T>G	ENST00000261739.4	+	6	873	c.707T>G	c.(706-708)cTc>cGc	p.L236R	ANKRD13A_ENST00000550404.1_3'UTR	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	236						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						AACACCAGCCTCGATACTAAA	0.418																																					p.L236R		Atlas-SNP	.											.	ANKRD13A	39	.	0			c.T707G						.						57.0	58.0	58.0					12																	110457106		2203	4300	6503	SO:0001583	missense	88455	exon6			CCAGCCTCGATAC	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.707T>G	chr12.hg19:g.110457106T>G	ENSP00000261739:p.Leu236Arg	213.0	0.0		192.0	21.0	NM_033121	O60736	Missense_Mutation	SNP	ENST00000261739.4	hg19	CCDS9140.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.8|24.8	4.566066|4.566066	0.86439|0.86439	.|.	.|.	ENSG00000076513|ENSG00000076513	ENST00000261738;ENST00000261739|ENST00000547639	T|.	0.56275|.	0.47|.	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77725|0.77725	0.4173|0.4173	M|M	0.82323|0.82323	2.585|2.585	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.77557|.	0.99;0.99;0.99|.	T|T	0.79645|0.79645	-0.1717|-0.1717	10|5	0.87932|.	D|.	0|.	-21.5323|-21.5323	14.9746|14.9746	0.71261|0.71261	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	236;236;236|.	B4DYP5;Q3ZTS7;Q8IZ07|.	.;.;AN13A_HUMAN|.	R|A	21;236|90	ENSP00000261739:L236R|.	ENSP00000261738:L21R|.	L|S	+|+	2|1	0|0	ANKRD13A|ANKRD13A	108941489|108941489	1.000000|1.000000	0.71417|0.71417	0.960000|0.960000	0.40013|0.40013	0.996000|0.996000	0.88848|0.88848	7.989000|7.989000	0.88205|0.88205	2.136000|2.136000	0.66102|0.66102	0.482000|0.482000	0.46254|0.46254	CTC|TCG	.	.		0.418	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403430.1	NM_033121	
KIF26A	26153	hgsc.bcm.edu	37	14	104638072	104638072	+	Silent	SNP	C	C	T	rs368488344		TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr14:104638072C>T	ENST00000423312.2	+	6	1126	c.1126C>T	c.(1126-1128)Ctg>Ttg	p.L376L	KIF26A_ENST00000315264.7_Silent_p.L237L	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	376	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GAAGGTTATGCTGCGGATCTG	0.672																																					p.L376L		Atlas-SNP	.											.	KIF26A	84	.	0			c.C1126T						.						9.0	13.0	12.0					14																	104638072		1956	4113	6069	SO:0001819	synonymous_variant	26153	exon6			GTTATGCTGCGGA	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.1126C>T	chr14.hg19:g.104638072C>T		90.0	0.0		85.0	6.0	NM_015656	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	hg19	CCDS45171.1																																																																																			.	.		0.672	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
CHRNA3	1136	hgsc.bcm.edu	37	15	78894061	78894061	+	Missense_Mutation	SNP	A	A	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr15:78894061A>C	ENST00000326828.5	-	5	1307	c.923T>G	c.(922-924)cTc>cGc	p.L308R	CHRNA3_ENST00000348639.3_Missense_Mutation_p.L308R	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	308					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	GGTGAACAGGAGGTACTCTCC	0.532																																					p.L308R		Atlas-SNP	.											.	CHRNA3	56	.	0			c.T923G						.						135.0	115.0	122.0					15																	78894061		2196	4293	6489	SO:0001583	missense	1136	exon5			AACAGGAGGTACT		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.923T>G	chr15.hg19:g.78894061A>C	ENSP00000315602:p.Leu308Arg	105.0	0.0		91.0	18.0	NM_000743	Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	ENST00000326828.5	hg19	CCDS10305.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.512654	0.85389	.	.	ENSG00000080644	ENST00000348639;ENST00000326828;ENST00000326858	T;T	0.75589	-0.95;-0.95	6.02	6.02	0.97574	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.057150	0.64402	D	0.000001	D	0.91112	0.7202	H	0.97051	3.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93883	0.7173	10	0.87932	D	0	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	308;308	P32297;P32297-3	ACHA3_HUMAN;.	R	308;308;172	ENSP00000267951:L308R;ENSP00000315602:L308R	ENSP00000315602:L308R	L	-	2	0	CHRNA3	76681116	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	9.332000	0.96446	2.311000	0.77944	0.533000	0.62120	CTC	.	.		0.532	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290111.3		
CRAMP1L	57585	hgsc.bcm.edu	37	16	1691138	1691138	+	Splice_Site	SNP	A	A	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr16:1691138A>C	ENST00000397412.3	+	6	877		c.e6-1		CRAMP1L_ENST00000436138.3_Splice_Site|LA16c-431H6.6_ENST00000454337.1_Splice_Site|CRAMP1L_ENST00000293925.5_Splice_Site			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)							nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						TTCCATTTAAAGGTATGGATG	0.378																																					.		Atlas-SNP	.											.	CRAMP1L	60	.	0			c.779-2A>C						.						104.0	102.0	103.0					16																	1691138		1862	4108	5970	SO:0001630	splice_region_variant	57585	exon5			ATTTAAAGGTATG	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.779-1A>C	chr16.hg19:g.1691138A>C		49.0	0.0		53.0	12.0	NM_020825	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Splice_Site	SNP	ENST00000397412.3	hg19	CCDS10440.2	.	.	.	.	.	.	.	.	.	.	A	13.50	2.256505	0.39896	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5282	0.75928	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CRAMP1L	1631139	1.000000	0.71417	0.995000	0.50966	0.942000	0.58702	8.836000	0.92105	2.076000	0.62316	0.459000	0.35465	.	.	.		0.378	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		Intron
LPCAT2	54947	hgsc.bcm.edu	37	16	55562430	55562430	+	Missense_Mutation	SNP	T	T	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr16:55562430T>A	ENST00000262134.5	+	3	637	c.453T>A	c.(451-453)gaT>gaA	p.D151E		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	151					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						CATTCTTTGATGGAATTGCCT	0.408																																					p.D151E		Atlas-SNP	.											.	LPCAT2	35	.	0			c.T453A						.						206.0	188.0	194.0					16																	55562430		2198	4300	6498	SO:0001583	missense	54947	exon3			CTTTGATGGAATT	AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.453T>A	chr16.hg19:g.55562430T>A	ENSP00000262134:p.Asp151Glu	197.0	0.0		169.0	26.0	NM_017839	A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	ENST00000262134.5	hg19	CCDS10753.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.101343	0.76983	.	.	ENSG00000087253	ENST00000262134	D	0.99933	-8.27	5.8	0.861	0.19048	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.99908	0.9956	M	0.84219	2.685	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97501	1.0060	10	0.45353	T	0.12	-35.2268	10.0072	0.41964	0.0:0.2502:0.0:0.7498	.	151	Q7L5N7	PCAT2_HUMAN	E	151	ENSP00000262134:D151E	ENSP00000262134:D151E	D	+	3	2	LPCAT2	54119931	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	1.225000	0.32551	-0.115000	0.11915	0.477000	0.44152	GAT	.	.		0.408	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256977.2	NM_017839	
TP53	7157	hgsc.bcm.edu	37	17	7577115	7577115	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr17:7577115A>G	ENST00000269305.4	-	8	1012	c.823T>C	c.(823-825)Tgt>Cgt	p.C275R	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C275R|TP53_ENST00000455263.2_Missense_Mutation_p.C275R|TP53_ENST00000445888.2_Missense_Mutation_p.C275R|TP53_ENST00000420246.2_Missense_Mutation_p.C275R|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C275G(7)|p.C275R(7)|p.C275fs*31(2)|p.?(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.C275fs*70(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGACAGGCACAAACACGCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.C275R	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,other,+1,2	TP53	33396	.	36	Substitution - Missense(14)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(4)|Insertion - Frameshift(2)|Unknown(2)	bone(5)|stomach(4)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|oesophagus(2)|peritoneum(1)|urinary_tract(1)|skin(1)|lung(1)|prostate(1)	c.T823C						.						70.0	60.0	64.0					17																	7577115		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGGCACAAACACG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.823T>C	chr17.hg19:g.7577115A>G	ENSP00000269305:p.Cys275Arg	77.0	0.0		76.0	13.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.225244	0.79576	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99873	0.9940	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.996;0.997	D	0.96415	0.9307	10	0.87932	D	0	-17.2181	12.5624	0.56288	1.0:0.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	R	275;275;275;275;275;264;143	ENSP00000352610:C275R;ENSP00000269305:C275R;ENSP00000398846:C275R;ENSP00000391127:C275R;ENSP00000391478:C275R;ENSP00000425104:C143R	ENSP00000269305:C275R	C	-	1	0	TP53	7517840	1.000000	0.71417	0.957000	0.39632	0.850000	0.48378	9.060000	0.93907	2.067000	0.61834	0.379000	0.24179	TGT	.	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
WNT9B	7484	hgsc.bcm.edu	37	17	44954034	44954034	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr17:44954034G>C	ENST00000290015.2	+	4	1077	c.1024G>C	c.(1024-1026)Gag>Cag	p.E342Q	WNT9B_ENST00000393461.2_Intron	NM_003396.1	NP_003387.1	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family, member 9B	342					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to starvation (GO:0009267)|collecting duct development (GO:0072044)|cornea development in camera-type eye (GO:0061303)|embryonic cranial skeleton morphogenesis (GO:0048701)|establishment of planar polarity involved in nephron morphogenesis (GO:0072046)|in utero embryonic development (GO:0001701)|kidney rudiment formation (GO:0072003)|male genitalia development (GO:0030539)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesonephric duct formation (GO:0072181)|metanephric tubule formation (GO:0072174)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|positive regulation of catalytic activity (GO:0043085)|regulation of asymmetric cell division (GO:0009786)|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003339)|regulation of protein phosphorylation (GO:0001932)|regulation of tube size (GO:0035150)|response to retinoic acid (GO:0032526)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(2)|lung(8)	10			BRCA - Breast invasive adenocarcinoma(9;0.0257)			CTGCTACGTGGAGTGCCAGCA	0.647																																					p.E342Q		Atlas-SNP	.											.	WNT9B	37	.	0			c.G1024C						.						40.0	38.0	39.0					17																	44954034		2203	4299	6502	SO:0001583	missense	7484	exon4			TACGTGGAGTGCC	AF028703	CCDS11506.1	17q21	2008-01-07	2003-03-11	2003-03-14		ENSG00000158955		"""Wingless-type MMTV integration sites"""	12779	protein-coding gene	gene with protein product		602864	"""wingless-type MMTV integration site family, member 15"""	WNT15		9441749, 11713592	Standard	NM_003396		Approved	WNT14B	uc002ikw.1	O14905		ENST00000290015.2:c.1024G>C	chr17.hg19:g.44954034G>C	ENSP00000290015:p.Glu342Gln	167.0	0.0		173.0	24.0	NM_003396	Q6UXT4|Q96Q09	Missense_Mutation	SNP	ENST00000290015.2	hg19	CCDS11506.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206995	0.79127	.	.	ENSG00000158955	ENST00000376843;ENST00000290015	T	0.75938	-0.98	5.39	5.39	0.77823	.	0.103621	0.64402	D	0.000004	T	0.82089	0.4961	L	0.46947	1.48	0.80722	D	1	D	0.69078	0.997	D	0.63192	0.912	D	0.83371	0.0007	10	0.66056	D	0.02	.	19.1452	0.93463	0.0:0.0:1.0:0.0	.	342	O14905	WNT9B_HUMAN	Q	336;342	ENSP00000290015:E342Q	ENSP00000290015:E342Q	E	+	1	0	WNT9B	42309033	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.059000	0.89462	2.517000	0.84864	0.561000	0.74099	GAG	.	.		0.647	WNT9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440433.1	NM_003396	
ACTL9	284382	hgsc.bcm.edu	37	19	8808811	8808811	+	Missense_Mutation	SNP	A	A	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr19:8808811A>T	ENST00000324436.3	-	1	361	c.241T>A	c.(241-243)Tgc>Agc	p.C81S		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	81						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TTGGGCTGGCAGCCCAGGATG	0.652																																					p.C81S		Atlas-SNP	.											.	ACTL9	74	.	0			c.T241A						.						23.0	25.0	25.0					19																	8808811		2203	4297	6500	SO:0001583	missense	284382	exon1			GCTGGCAGCCCAG		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.241T>A	chr19.hg19:g.8808811A>T	ENSP00000316674:p.Cys81Ser	78.0	0.0		84.0	10.0	NM_178525	A8K893|Q6X960	Missense_Mutation	SNP	ENST00000324436.3	hg19	CCDS12207.1	.	.	.	.	.	.	.	.	.	.	A	10.86	1.470112	0.26423	.	.	ENSG00000181786	ENST00000324436	D	0.93763	-3.28	4.0	4.0	0.46444	.	2.153300	0.02187	U	0.061029	D	0.88119	0.6351	N	0.20610	0.595	0.32051	N	0.596937	B	0.14805	0.011	B	0.13407	0.009	T	0.79692	-0.1697	10	0.56958	D	0.05	.	4.3137	0.10982	0.6879:0.2057:0.1064:0.0	.	81	Q8TC94	ACTL9_HUMAN	S	81	ENSP00000316674:C81S	ENSP00000316674:C81S	C	-	1	0	ACTL9	8669811	0.400000	0.25295	0.730000	0.30809	0.412000	0.31113	3.215000	0.51169	1.827000	0.53221	0.379000	0.24179	TGC	.	.		0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459953.1	NM_178525	
ZNF317	57693	hgsc.bcm.edu	37	19	9267979	9267979	+	Silent	SNP	T	T	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr19:9267979T>C	ENST00000247956.6	+	4	503	c.198T>C	c.(196-198)ttT>ttC	p.F66F	ZNF317_ENST00000360385.3_Silent_p.F66F	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						CTGTGGACTTTACCGAGAAGG	0.498																																					p.F66F		Atlas-SNP	.											.	ZNF317	61	.	0			c.T198C						.						100.0	92.0	94.0					19																	9267979		2203	4300	6503	SO:0001819	synonymous_variant	57693	exon4			GGACTTTACCGAG	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.198T>C	chr19.hg19:g.9267979T>C		107.0	0.0		103.0	20.0	NM_020933	Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Silent	SNP	ENST00000247956.6	hg19	CCDS12210.1																																																																																			.	.		0.498	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448995.1	NM_020933	
ZNF432	9668	hgsc.bcm.edu	37	19	52537481	52537481	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr19:52537481G>C	ENST00000594154.1	-	5	1663	c.1451C>G	c.(1450-1452)cCt>cGt	p.P484R	ZNF432_ENST00000221315.5_Missense_Mutation_p.P484R			O94892	ZN432_HUMAN	zinc finger protein 432	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GCACCTGTAAGGTTTCTCTCC	0.458																																					p.P484R		Atlas-SNP	.											.	ZNF432	172	.	0			c.C1451G						.						66.0	61.0	63.0					19																	52537481		2203	4300	6503	SO:0001583	missense	9668	exon5			CTGTAAGGTTTCT	AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.1451C>G	chr19.hg19:g.52537481G>C	ENSP00000470488:p.Pro484Arg	67.0	0.0		79.0	9.0	NM_014650		Missense_Mutation	SNP	ENST00000594154.1	hg19	CCDS12848.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.327008	0.60743	.	.	ENSG00000256087	ENST00000221315	T	0.17213	2.29	2.81	2.81	0.32909	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35008	0.0917	L	0.55017	1.72	0.38389	D	0.945357	D	0.89917	1.0	D	0.91635	0.999	T	0.35201	-0.9798	9	0.87932	D	0	.	12.7967	0.57564	0.0:0.0:1.0:0.0	.	484	O94892	ZN432_HUMAN	R	484	ENSP00000221315:P484R	ENSP00000221315:P484R	P	-	2	0	ZNF432	57229293	1.000000	0.71417	0.858000	0.33744	0.929000	0.56500	4.486000	0.60286	1.577000	0.49804	0.655000	0.94253	CCT	.	.		0.458	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1	NM_014650	
NDUFAF5	79133	hgsc.bcm.edu	37	20	13797788	13797788	+	Missense_Mutation	SNP	G	G	A	rs142611230		TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr20:13797788G>A	ENST00000378106.5	+	11	1089	c.970G>A	c.(970-972)Gca>Aca	p.A324T	NDUFAF5_ENST00000463598.1_Missense_Mutation_p.A296T|NDUFAF5_ENST00000475968.1_3'UTR	NM_024120.4	NP_077025.2	Q5TEU4	NDUF5_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 5	324					mitochondrial respiratory chain complex I assembly (GO:0032981)	extrinsic component of mitochondrial inner membrane (GO:0031314)	methyltransferase activity (GO:0008168)	p.A324T(1)									AAGAGGTTCCGCAACTGTGTC	0.353																																					p.A324T		Atlas-SNP	.											C20orf7,colon,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.G970A						.	G	THR/ALA,THR/ALA	0,4406		0,0,2203	99.0	113.0	108.0		886,970	4.4	0.8	20	dbSNP_134	108	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	C20orf7	NM_001039375.2,NM_024120.4	58,58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	296/318,324/346	13797788	1,13005	2203	4300	6503	SO:0001583	missense	79133	exon11			GGTTCCGCAACTG		CCDS13118.1, CCDS33441.1	20p12.1	2012-10-12	2012-05-08	2012-05-08	ENSG00000101247	ENSG00000101247		"""Mitochondrial respiratory chain complex assembly factors"""	15899	protein-coding gene	gene with protein product		612360	"""chromosome 20 open reading frame 7"""	C20orf7		18940309, 21607760	Standard	NM_024120		Approved	dJ842G6.1	uc002wom.3	Q5TEU4	OTTHUMG00000031909	ENST00000378106.5:c.970G>A	chr20.hg19:g.13797788G>A	ENSP00000367346:p.Ala324Thr	148.0	0.0		166.0	20.0	NM_024120	A8K166|Q6GPH3|Q9H6F4	Missense_Mutation	SNP	ENST00000378106.5	hg19	CCDS13118.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.838556	0.51057	0.0	1.16E-4	ENSG00000101247	ENST00000378106;ENST00000463598	D;T	0.83419	-1.72;-1.48	5.33	4.37	0.52481	.	0.000000	0.85682	D	0.000000	D	0.90335	0.6976	M	0.90870	3.155	0.54753	D	0.999987	D;D	0.59767	0.986;0.976	P;P	0.54815	0.761;0.581	D	0.91889	0.5522	10	0.62326	D	0.03	-49.6394	13.6665	0.62398	0.0:0.0:0.8451:0.1549	.	296;324	Q5TEU4-2;Q5TEU4	.;CT007_HUMAN	T	324;296	ENSP00000367346:A324T;ENSP00000420497:A296T	ENSP00000367346:A324T	A	+	1	0	C20orf7	13745788	1.000000	0.71417	0.849000	0.33467	0.069000	0.16628	8.052000	0.89448	1.224000	0.43551	-0.181000	0.13052	GCA	.	G|1.000;A|0.000		0.353	NDUFAF5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078057.2	NM_001039375	
HRH3	11255	hgsc.bcm.edu	37	20	60791400	60791400	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr20:60791400C>T	ENST00000340177.5	-	3	1284	c.1000G>A	c.(1000-1002)Gag>Aag	p.E334K	HRH3_ENST00000317393.6_Missense_Mutation_p.E334K	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	334					brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	ATGCGCTTCTCCAGCGAGGCC	0.647																																					p.E334K		Atlas-SNP	.											.	HRH3	25	.	0			c.G1000A						.						16.0	16.0	16.0					20																	60791400		2196	4294	6490	SO:0001583	missense	11255	exon3			GCTTCTCCAGCGA	AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.1000G>A	chr20.hg19:g.60791400C>T	ENSP00000342560:p.Glu334Lys	93.0	0.0		84.0	12.0	NM_007232	Q4QRI7|Q9GZX2|Q9H4K8	Missense_Mutation	SNP	ENST00000340177.5	hg19	CCDS13493.1	.	.	.	.	.	.	.	.	.	.	C	17.58	3.425300	0.62733	.	.	ENSG00000101180	ENST00000340177;ENST00000317393;ENST00000370797	T;T	0.66995	-0.21;-0.24	4.61	4.61	0.57282	GPCR, rhodopsin-like superfamily (1);	0.342793	0.31797	N	0.007053	T	0.62295	0.2416	L	0.50333	1.59	0.35106	D	0.765707	P;B	0.43287	0.802;0.316	B;B	0.43508	0.422;0.23	T	0.66006	-0.6030	10	0.07644	T	0.81	-29.3882	17.4157	0.87499	0.0:1.0:0.0:0.0	.	334;334	Q9Y5N1-2;Q9Y5N1	.;HRH3_HUMAN	K	334;334;304	ENSP00000342560:E334K;ENSP00000321482:E334K	ENSP00000321482:E334K	E	-	1	0	HRH3	60224795	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	5.930000	0.70104	2.077000	0.62373	0.407000	0.27541	GAG	.	.		0.647	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079994.1	NM_007232	
PKDREJ	10343	hgsc.bcm.edu	37	22	46656291	46656291	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr22:46656291A>G	ENST00000253255.5	-	1	2928	c.2929T>C	c.(2929-2931)Tcc>Ccc	p.S977P		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	977					acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TTCTTCAAGGACCCATCAACC	0.483																																					p.S977P		Atlas-SNP	.											.	PKDREJ	195	.	0			c.T2929C						.						145.0	142.0	143.0					22																	46656291		2203	4300	6503	SO:0001583	missense	10343	exon1			TCAAGGACCCATC	AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.2929T>C	chr22.hg19:g.46656291A>G	ENSP00000253255:p.Ser977Pro	126.0	0.0		129.0	7.0	NM_006071	B1AJY3|O95850	Missense_Mutation	SNP	ENST00000253255.5	hg19	CCDS14073.1	.	.	.	.	.	.	.	.	.	.	A	12.05	1.821371	0.32237	.	.	ENSG00000130943	ENST00000253255	T	0.36157	1.27	4.91	0.123	0.14709	.	1.498420	0.03733	N	0.253852	T	0.27967	0.0689	L	0.40543	1.245	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.12967	-1.0527	10	0.27082	T	0.32	-4.8539	4.3796	0.11288	0.3684:0.3815:0.2501:0.0	.	977	Q9NTG1	PKDRE_HUMAN	P	977	ENSP00000253255:S977P	ENSP00000253255:S977P	S	-	1	0	PKDREJ	45034955	0.000000	0.05858	0.005000	0.12908	0.210000	0.24377	-0.734000	0.04893	-0.003000	0.14444	-0.331000	0.08364	TCC	.	.		0.483	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318466.1	NM_006071	
POLA1	5422	hgsc.bcm.edu	37	X	24861714	24861714	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chrX:24861714G>A	ENST00000379059.3	+	34	3964	c.3949G>A	c.(3949-3951)Gct>Act	p.A1317T	POLA1_ENST00000379068.3_Missense_Mutation_p.A1323T	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1317	DNA-binding region. {ECO:0000255}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	CGATTGTAAGGCTTCACCTCT	0.358																																					p.A1317T		Atlas-SNP	.											.	POLA1	117	.	0			c.G3949A						.						153.0	114.0	127.0					X																	24861714		2203	4300	6503	SO:0001583	missense	5422	exon34			TGTAAGGCTTCAC		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.3949G>A	chrX.hg19:g.24861714G>A	ENSP00000368349:p.Ala1317Thr	220.0	0.0		234.0	20.0	NM_016937	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	hg19	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.385879	0.25031	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.18016	2.24;2.24	5.82	4.06	0.47325	Zinc finger, DNA-directed DNA polymerase, family B, alpha (1);	0.370388	0.31134	N	0.008182	T	0.10637	0.0260	N	0.20807	0.61	0.28163	N	0.928914	B	0.18968	0.032	B	0.15052	0.012	T	0.24764	-1.0151	10	0.18710	T	0.47	-3.5293	11.3692	0.49690	0.1512:0.0:0.8488:0.0	.	1317	P09884	DPOLA_HUMAN	T	1323;1317	ENSP00000368358:A1323T;ENSP00000368349:A1317T	ENSP00000368349:A1317T	A	+	1	0	POLA1	24771635	0.996000	0.38824	0.998000	0.56505	0.981000	0.71138	3.081000	0.50120	0.614000	0.30107	0.594000	0.82650	GCT	.	.		0.358	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
RAB40AL	282808	hgsc.bcm.edu	37	X	102192893	102192893	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chrX:102192893T>C	ENST00000218249.5	+	1	694	c.647T>C	c.(646-648)aTt>aCt	p.I216T	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	216	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						CCGCTCCCCATTGCCTTAAGA	0.597																																					p.I216T		Atlas-SNP	.											.	RAB40AL	33	.	0			c.T647C						.						159.0	130.0	140.0					X																	102192893		2203	4300	6503	SO:0001583	missense	282808	exon1			TCCCCATTGCCTT	BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	ENST00000218249.5:c.647T>C	chrX.hg19:g.102192893T>C	ENSP00000218249:p.Ile216Thr	116.0	0.0		116.0	6.0	NM_001031834	Q495H3	Missense_Mutation	SNP	ENST00000218249.5	hg19	CCDS35353.1	.	.	.	.	.	.	.	.	.	.	.	9.632	1.136683	0.21123	.	.	ENSG00000102128	ENST00000218249	T	0.39229	1.09	0.819	0.819	0.18785	SOCS protein, C-terminal (4);	0.157212	0.24363	U	0.039163	T	0.08980	0.0222	N	0.00413	-1.525	0.23010	N	0.998434	B	0.02656	0.0	B	0.09377	0.004	T	0.37753	-0.9692	10	0.07175	T	0.84	.	5.6153	0.17428	0.0:1.0E-4:0.0:0.9999	.	216	P0C0E4	RB40L_HUMAN	T	216	ENSP00000218249:I216T	ENSP00000218249:I216T	I	+	2	0	RAB40AL	102079549	1.000000	0.71417	0.079000	0.20413	0.380000	0.30137	2.842000	0.48230	0.563000	0.29222	0.376000	0.23039	ATT	.	.		0.597	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057679.1	NM_001031834	
CPSF4	10898	hgsc.bcm.edu	37	7	99047916	99047917	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr7:99047916_99047917insA	ENST00000292476.5	+	4	335_336	c.325_326insA	c.(325-327)gaafs	p.E109fs	CPSF4_ENST00000451876.1_Intron|ATP5J2-PTCD1_ENST00000437572.1_Intron|PTCD1_ENST00000555673.1_Intron|CPSF4_ENST00000471455.1_3'UTR|ATP5J2-PTCD1_ENST00000413834.1_Intron|CPSF4_ENST00000436336.2_Frame_Shift_Ins_p.E109fs|CPSF4_ENST00000441580.1_Frame_Shift_Ins_p.E56fs|ATP5J2_ENST00000466753.1_Intron			O95639	CPSF4_HUMAN	cleavage and polyadenylation specific factor 4, 30kDa	109					modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA processing (GO:0006397)|viral life cycle (GO:0019058)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(5)	14	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CAGCAACAAGGAATGTCCCTTC	0.599																																					p.E109fs		Atlas-INDEL	.											.	CPSF4	24	.	0			c.325_326insA						.																																			SO:0001589	frameshift_variant	10898	exon4			.		CCDS5664.1, CCDS47652.1	7q22	2007-10-18	2002-08-29		ENSG00000160917	ENSG00000160917			2327	protein-coding gene	gene with protein product		603052	"""cleavage and polyadenylation specific factor 4, 30kD subunit"""			9651582, 9224719	Standard	NM_006693		Approved	NAR, CPSF30	uc003uqj.3	O95639	OTTHUMG00000154599	ENST00000292476.5:c.327dupA	chr7.hg19:g.99047918_99047918dupA	ENSP00000292476:p.Glu109fs	113.0	0.0		110.0	28.0	NM_001081559	D6W5S8|Q6FGE6|Q86TF8|Q9BTW6	Frame_Shift_Ins	INS	ENST00000292476.5	hg19	CCDS5664.1																																																																																			.	.		0.599	CPSF4-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336254.1		
GUK1	2987	hgsc.bcm.edu	37	1	228328057	228328057	+	5'UTR	DEL	A	A	-			TCGA-GJ-A3OU-01A-31D-A382-10	TCGA-GJ-A3OU-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ee0963bc-f3c2-4738-bad9-84f54c572b69	a277f049-e97c-460c-8166-8424f4301d13	g.chr1:228328057delA	ENST00000312726.4	+	0	67				GUK1_ENST00000366730.1_Intron|GUK1_ENST00000366726.1_5'UTR|GUK1_ENST00000366728.2_Frame_Shift_Del_p.P19fs|GUK1_ENST00000366722.1_5'UTR|GUK1_ENST00000366723.1_Frame_Shift_Del_p.P19fs|GUK1_ENST00000391865.3_Frame_Shift_Del_p.P19fs|GUK1_ENST00000366721.1_5'UTR	NM_000858.5	NP_000849.1	Q16774	KGUA_HUMAN	guanylate kinase 1						ATP metabolic process (GO:0046034)|dATP metabolic process (GO:0046060)|dGDP biosynthetic process (GO:0006185)|dGMP metabolic process (GO:0046054)|drug metabolic process (GO:0017144)|GDP biosynthetic process (GO:0046711)|GDP-mannose metabolic process (GO:0019673)|glycoprotein transport (GO:0034436)|GMP metabolic process (GO:0046037)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleotide metabolic process (GO:0006163)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			endometrium(2)|lung(5)|prostate(1)|soft_tissue(1)	9		Prostate(94;0.0405)				GCCGGGCCCCACCGGACGGTG	0.751																																					p.P18fs		Atlas-INDEL	.											.	GUK1	34	.	0			c.53delC						.						4.0	5.0	5.0					1																	228328057		1420	3333	4753	SO:0001623	5_prime_UTR_variant	2987	exon1			.	BC006249	CCDS1568.1, CCDS53481.1, CCDS55689.1	1q32-q41	2012-10-02			ENSG00000143774	ENSG00000143774	2.7.4.8		4693	protein-coding gene	gene with protein product		139270				8647247	Standard	NM_000858		Approved		uc021pkf.1	Q16774	OTTHUMG00000039503	ENST00000312726.4:c.-175A>-	chr1.hg19:g.228328057delA		80.0	0.0		72.0	12.0	NM_001242840	B1ANH1	Frame_Shift_Del	DEL	ENST00000312726.4	hg19	CCDS1568.1																																																																																			.	.		0.751	GUK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000095312.3	NM_000858	
