#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF4	400735	hgsc.bcm.edu	37	1	12942173	12942173	+	Missense_Mutation	SNP	C	C	G	rs201789683		TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr1:12942173C>G	ENST00000235349.5	-	3	447	c.377G>C	c.(376-378)tGc>tCc	p.C126S		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	126					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGAGGAAGCACCCATGGGC	0.493																																					p.C126S		Atlas-SNP	.											PRAMEF4,NS,carcinoma,0,1	PRAMEF4	62	.	0			c.G377C						.						44.0	56.0	52.0					1																	12942173		1381	2629	4010	SO:0001583	missense	400735	exon3			AGGAAGCACCCAT		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.377G>C	chr1.hg19:g.12942173C>G	ENSP00000235349:p.Cys126Ser	22.0	1.0		45.0	3.0	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	hg19	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	c	8.575	0.881031	0.17467	.	.	ENSG00000243073	ENST00000235349	T	0.18016	2.24	1.35	0.315	0.15852	.	1.371720	0.04624	N	0.402516	T	0.19406	0.0466	L	0.53671	1.685	0.09310	N	1	P	0.50272	0.933	P	0.44811	0.461	T	0.23190	-1.0195	10	0.33940	T	0.23	.	5.2546	0.15540	0.0:0.6297:0.3703:0.0	.	126	O60810	PRAM4_HUMAN	S	126	ENSP00000235349:C126S	ENSP00000235349:C126S	C	-	2	0	PRAMEF4	12864760	0.002000	0.14202	0.003000	0.11579	0.008000	0.06430	0.188000	0.17018	0.112000	0.17975	0.194000	0.17425	TGC	.	C|0.500;G|0.500		0.493	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
ABCA4	24	hgsc.bcm.edu	37	1	94564351	94564351	+	Splice_Site	SNP	A	A	G			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr1:94564351A>G	ENST00000370225.3	-	6	853	c.767T>C	c.(766-768)gTg>gCg	p.V256A	ABCA4_ENST00000535735.1_Splice_Site_p.V256A	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	256					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CTCCCTTACCACACGGAAGAG	0.572																																					p.V256A		Atlas-SNP	.											.	ABCA4	275	.	0			c.T767C						.						86.0	83.0	84.0					1																	94564351		2203	4300	6503	SO:0001630	splice_region_variant	24	exon6			CTTACCACACGGA	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.768+1T>C	chr1.hg19:g.94564351A>G		56.0	0.0		55.0	21.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	A	11.42	1.634269	0.29068	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.90955	-2.64;-2.76	5.83	5.83	0.93111	.	0.258733	0.28146	U	0.016425	T	0.81029	0.4738	L	0.50333	1.59	0.39881	D	0.973643	B;B	0.18968	0.032;0.012	B;B	0.25884	0.064;0.004	T	0.77281	-0.2646	10	0.08599	T	0.76	.	15.8674	0.79074	1.0:0.0:0.0:0.0	.	256;256	F5H6E5;P78363	.;ABCA4_HUMAN	A	256	ENSP00000359245:V256A;ENSP00000437682:V256A	ENSP00000359245:V256A	V	-	2	0	ABCA4	94336939	1.000000	0.71417	0.998000	0.56505	0.237000	0.25408	6.888000	0.75622	2.225000	0.72522	0.460000	0.39030	GTG	.	.		0.572	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	Missense_Mutation
CYP1B1	1545	hgsc.bcm.edu	37	2	38301745	38301745	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr2:38301745G>A	ENST00000260630.3	-	2	1188	c.787C>T	c.(787-789)Cag>Tag	p.Q263*	CYP1B1_ENST00000407341.1_Nonsense_Mutation_p.Q263*|CYP1B1-AS1_ENST00000431999.1_RNA|CYP1B1_ENST00000494864.1_Intron|CYP1B1-AS1_ENST00000589303.1_RNA	NM_000104.3	NP_000095	Q16678	CP1B1_HUMAN	cytochrome P450, family 1, subfamily B, polypeptide 1	263					angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|blood vessel morphogenesis (GO:0048514)|cell adhesion (GO:0007155)|cellular aromatic compound metabolic process (GO:0006725)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to organic cyclic compound (GO:0071407)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell-cell adhesion (GO:0071603)|epoxygenase P450 pathway (GO:0019373)|estrogen metabolic process (GO:0008210)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|membrane lipid catabolic process (GO:0046466)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nitric oxide biosynthetic process (GO:0006809)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to toxic substance (GO:0009636)|retinal blood vessel morphogenesis (GO:0061304)|retinal metabolic process (GO:0042574)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|toxin metabolic process (GO:0009404)|trabecular meshwork development (GO:0002930)|visual perception (GO:0007601)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	13		all_hematologic(82;0.21)			Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Biotin(DB00121)|Caffeine(DB00201)|Clozapine(DB00363)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Flutamide(DB00499)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Melatonin(DB01065)|Mitoxantrone(DB01204)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Primaquine(DB01087)|Procarbazine(DB01168)|Progesterone(DB00396)|Propofol(DB00818)|Tamoxifen(DB00675)|Testosterone(DB00624)|Theophylline(DB00277)	CGGTTGAGCTGCTCGAATTCG	0.642																																					p.Q263X		Atlas-SNP	.											.	CYP1B1	39	.	0			c.C787T						.						43.0	39.0	40.0					2																	38301745		2203	4300	6503	SO:0001587	stop_gained	1545	exon2			TGAGCTGCTCGAA	U56438	CCDS1793.1	2p22.2	2008-02-05	2003-01-14		ENSG00000138061	ENSG00000138061		"""Cytochrome P450s"""	2597	protein-coding gene	gene with protein product		601771	"""cytochrome P450, subfamily I (dioxin-inducible), polypeptide 1 (glaucoma 3, primary infantile)"""	GLC3A		8175734, 15128046	Standard	NM_000104		Approved	CP1B	uc002rqo.2	Q16678	OTTHUMG00000100970	ENST00000260630.3:c.787C>T	chr2.hg19:g.38301745G>A	ENSP00000260630:p.Gln263*	204.0	0.0		194.0	11.0	NM_000104	Q5TZW8|Q93089|Q9H316	Nonsense_Mutation	SNP	ENST00000260630.3	hg19	CCDS1793.1	.	.	.	.	.	.	.	.	.	.	G	38	6.657105	0.97739	.	.	ENSG00000138061	ENST00000260630;ENST00000407341	.	.	.	4.51	-0.0439	0.13857	.	0.534588	0.20863	N	0.084312	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	7.9908	0.30239	0.0:0.255:0.4596:0.2854	.	.	.	.	X	263	.	ENSP00000260630:Q263X	Q	-	1	0	CYP1B1	38155249	0.000000	0.05858	0.906000	0.35671	0.943000	0.58893	0.097000	0.15168	0.128000	0.18479	0.650000	0.86243	CAG	.	.		0.642	CYP1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218580.3	NM_000104	
BAZ2B	29994	hgsc.bcm.edu	37	2	160206490	160206490	+	Missense_Mutation	SNP	G	G	A	rs372658436		TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr2:160206490G>A	ENST00000392783.2	-	28	5087	c.4592C>T	c.(4591-4593)aCt>aTt	p.T1531I	BAZ2B_ENST00000343439.5_Missense_Mutation_p.T1431I|BAZ2B_ENST00000392782.1_Missense_Mutation_p.T1495I|BAZ2B_ENST00000355831.2_Missense_Mutation_p.T1497I	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ACTTGAACCAGTATTAAACAG	0.418																																					p.T1531I		Atlas-SNP	.											.	BAZ2B	196	.	0			c.C4592T						.						147.0	140.0	142.0					2																	160206490		1997	4184	6181	SO:0001583	missense	29994	exon28			GAACCAGTATTAA	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.4592C>T	chr2.hg19:g.160206490G>A	ENSP00000376534:p.Thr1531Ile	135.0	0.0		134.0	11.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	hg19	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	G	1.684	-0.505713	0.04261	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.06849	3.25;3.25;3.25;3.25	6.17	4.35	0.52113	.	0.501674	0.14458	U	0.318345	T	0.06462	0.0166	N	0.22421	0.69	0.09310	N	1	B;B	0.33739	0.045;0.422	B;B	0.24848	0.045;0.056	T	0.28364	-1.0046	10	0.38643	T	0.18	2.0E-4	13.6731	0.62438	0.0:0.1195:0.7559:0.1246	.	1495;1531	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	I	1495;1531;1497;1431	ENSP00000376533:T1495I;ENSP00000376534:T1531I;ENSP00000348087:T1497I;ENSP00000339670:T1431I	ENSP00000339670:T1431I	T	-	2	0	BAZ2B	159914736	0.928000	0.31464	0.001000	0.08648	0.042000	0.13812	5.458000	0.66679	0.906000	0.36621	-0.150000	0.13652	ACT	.	.		0.418	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
CHST13	166012	hgsc.bcm.edu	37	3	126260674	126260674	+	Silent	SNP	G	G	A			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr3:126260674G>A	ENST00000319340.2	+	3	329	c.279G>A	c.(277-279)ccG>ccA	p.P93P		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	93					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		TGCTACAGCCGGAGGACCTGC	0.706																																					p.P93P		Atlas-SNP	.											.	CHST13	21	.	0			c.G279A						.						17.0	13.0	14.0					3																	126260674		2181	4259	6440	SO:0001819	synonymous_variant	166012	exon3			ACAGCCGGAGGAC	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.279G>A	chr3.hg19:g.126260674G>A		50.0	0.0		49.0	15.0	NM_152889	Q3SYA3|Q3SYA5	Silent	SNP	ENST00000319340.2	hg19	CCDS3039.1																																																																																			.	.		0.706	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889	
NOA1	84273	hgsc.bcm.edu	37	4	57842963	57842963	+	Silent	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr4:57842963C>T	ENST00000264230.4	-	1	2026	c.789G>A	c.(787-789)agG>agA	p.R263R	POLR2B_ENST00000381227.1_5'Flank|POLR2B_ENST00000441246.2_5'Flank|POLR2B_ENST00000314595.5_5'Flank|POLR2B_ENST00000431623.2_5'Flank	NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	263	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										GCTCCCGCAGCCTCTGCCGGT	0.701																																					p.R263R		Atlas-SNP	.											.	.	.	.	0			c.G789A						.						28.0	34.0	32.0					4																	57842963		2195	4279	6474	SO:0001819	synonymous_variant	84273	exon1			CCGCAGCCTCTGC	AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.789G>A	chr4.hg19:g.57842963C>T		84.0	0.0		64.0	10.0	NM_032313	Q8N7L6|Q9BSQ9	Silent	SNP	ENST00000264230.4	hg19	CCDS3510.1																																																																																			.	.		0.701	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250694.2	NM_032313	
IRX2	153572	hgsc.bcm.edu	37	5	2751518	2751518	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr5:2751518G>T	ENST00000382611.6	-	1	258	c.10C>A	c.(10-12)Ccg>Acg	p.P4T	IRX2_ENST00000302057.5_Missense_Mutation_p.P4T|C5orf38_ENST00000457752.2_5'Flank|IRX2_ENST00000502957.1_Intron|C5orf38_ENST00000397835.4_5'Flank|C5orf38_ENST00000515640.1_5'Flank|C5orf38_ENST00000505778.1_5'Flank|C5orf38_ENST00000334000.3_5'Flank	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	4					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		TAGCCCTGCGGGTAGGACATG	0.801																																					p.P4T		Atlas-SNP	.											.	IRX2	60	.	0			c.C10A						.						2.0	2.0	2.0					5																	2751518		1323	2902	4225	SO:0001583	missense	153572	exon1			CCTGCGGGTAGGA	AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.10C>A	chr5.hg19:g.2751518G>T	ENSP00000372056:p.Pro4Thr	32.0	0.0		23.0	10.0	NM_001134222	Q68A19|Q7Z2I7	Missense_Mutation	SNP	ENST00000382611.6	hg19	CCDS3868.1	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788514	0.49997	.	.	ENSG00000170561	ENST00000382611;ENST00000302057	D;D	0.87256	-2.23;-2.23	3.23	2.34	0.29019	.	0.061211	0.64402	U	0.000002	D	0.91680	0.7370	M	0.76574	2.34	0.58432	D	0.999994	D	0.89917	1.0	D	0.69307	0.963	D	0.91658	0.5340	10	0.87932	D	0	-20.0605	11.948	0.52938	0.0:0.0:0.8245:0.1755	.	4	Q9BZI1	IRX2_HUMAN	T	4	ENSP00000372056:P4T;ENSP00000307006:P4T	ENSP00000307006:P4T	P	-	1	0	IRX2	2804518	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	7.723000	0.84788	0.716000	0.32124	0.289000	0.19496	CCG	.	.		0.801	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206749.2		
C5orf60	285679	hgsc.bcm.edu	37	5	179069453	179069453	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr5:179069453G>A	ENST00000448248.2	-	5	746	c.721C>T	c.(721-723)Cgc>Tgc	p.R241C	C5orf60_ENST00000506142.1_5'Flank	NM_001142306.1	NP_001135778.1	A6NFR6	CE060_HUMAN	chromosome 5 open reading frame 60	0						integral component of membrane (GO:0016021)				NS(1)|breast(1)|kidney(5)	7						TGAGGAAAGCGGGACCCCTGC	0.552																																					p.R241C		Atlas-SNP	.											.	C5orf60	24	.	0			c.C721T						.						90.0	81.0	84.0					5																	179069453		692	1591	2283	SO:0001583	missense	285679	exon5			GAAAGCGGGACCC	BC043435	CCDS47353.1	5q35.3	2010-08-19			ENSG00000204661	ENSG00000204661			27753	protein-coding gene	gene with protein product						12477932	Standard	NM_001142306		Approved		uc003mki.3	A6NFR6	OTTHUMG00000163221	ENST00000448248.2:c.721C>T	chr5.hg19:g.179069453G>A	ENSP00000404583:p.Arg241Cys	70.0	0.0		55.0	27.0	NM_001142306	A1L488|B7ZM52|B7ZM53	Missense_Mutation	SNP	ENST00000448248.2	hg19	CCDS47353.1	.	.	.	.	.	.	.	.	.	.	g	1.431	-0.570177	0.03910	.	.	ENSG00000204661	ENST00000448248	T	0.30981	1.51	0.517	0.517	0.17025	.	.	.	.	.	T	0.15825	0.0381	.	.	.	0.09310	N	1	P;P	0.46277	0.875;0.875	B;B	0.28553	0.091;0.091	T	0.16041	-1.0416	7	0.72032	D	0.01	.	.	.	.	.	245;241	A6NFR6-2;A6NFR6-4	.;.	C	241	ENSP00000404583:R241C	ENSP00000404583:R241C	R	-	1	0	C5orf60	179002059	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.383000	0.07398	0.539000	0.28788	0.306000	0.20318	CGC	.	.		0.552	C5orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372148.2	NM_001142306	
RAPGEF5	9771	hgsc.bcm.edu	37	7	22347988	22347988	+	Missense_Mutation	SNP	A	A	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr7:22347988A>T	ENST00000405243.1	-	5	733	c.650T>A	c.(649-651)cTc>cAc	p.L217H	RAPGEF5_ENST00000344041.6_Missense_Mutation_p.L64H			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	0					nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						GGCAGGAATGAGAGGCACAAG	0.403																																					p.L64H		Atlas-SNP	.											.	RAPGEF5	96	.	0			c.T191A						.						70.0	66.0	67.0					7																	22347988		1937	4120	6057	SO:0001583	missense	9771	exon5			GGAATGAGAGGCA	D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000405243.1:c.650T>A	chr7.hg19:g.22347988A>T	ENSP00000384870:p.Leu217His	61.0	0.0		64.0	19.0	NM_012294	A4D140|Q8IXU5	Missense_Mutation	SNP	ENST00000405243.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.46	1.357644	0.24598	.	.	ENSG00000136237	ENST00000344041;ENST00000405243	T;T	0.13778	2.56;2.56	5.92	5.92	0.95590	.	0.415413	0.20130	N	0.098603	T	0.14700	0.0355	L	0.38175	1.15	0.39726	D	0.971546	B	0.18741	0.03	B	0.15052	0.012	T	0.02781	-1.1111	10	0.72032	D	0.01	.	16.371	0.83361	1.0:0.0:0.0:0.0	.	64	A8MQ07	.	H	64;217	ENSP00000343656:L64H;ENSP00000384870:L217H	ENSP00000343656:L64H	L	-	2	0	RAPGEF5	22314513	0.990000	0.36364	0.998000	0.56505	0.964000	0.63967	4.549000	0.60726	2.267000	0.75376	0.477000	0.44152	CTC	.	.		0.403	RAPGEF5-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000326591.1	NM_012294	
MUC17	140453	hgsc.bcm.edu	37	7	100683043	100683043	+	Silent	SNP	C	C	T	rs371681290		TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr7:100683043C>T	ENST00000306151.4	+	3	8410	c.8346C>T	c.(8344-8346)gtC>gtT	p.V2782V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2782	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.V2782V(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCATACCTGTCACCACTTCTA	0.473																																					p.V2782V		Atlas-SNP	.											MUC17,NS,carcinoma,0,1	MUC17	804	.	1	Substitution - coding silent(1)	lung(1)	c.C8346T						.	C		0,4406		0,0,2203	252.0	244.0	246.0		8346	-2.4	0.0	7		246	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MUC17	NM_001040105.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		2782/4494	100683043	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			ACCTGTCACCACT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8346C>T	chr7.hg19:g.100683043C>T		84.0	2.0		74.0	11.0	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
ARHGEF10	9639	hgsc.bcm.edu	37	8	1871942	1871942	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr8:1871942C>T	ENST00000398564.1	+	21	2465	c.2465C>T	c.(2464-2466)tCt>tTt	p.S822F	ARHGEF10_ENST00000520359.1_Missense_Mutation_p.S759F|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.S822F|ARHGEF10_ENST00000349830.3_Missense_Mutation_p.S797F|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.S821F			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	822					centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		TCTGGCAGATCTGGGCGACCG	0.468																																					p.S797F		Atlas-SNP	.											.	ARHGEF10	255	.	0			c.C2390T						.						134.0	110.0	118.0					8																	1871942		2203	4300	6503	SO:0001583	missense	9639	exon21			GCAGATCTGGGCG	AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.2465C>T	chr8.hg19:g.1871942C>T	ENSP00000381571:p.Ser822Phe	137.0	0.0		110.0	10.0	NM_014629	O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	ENST00000398564.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.97	3.924475	0.73213	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T	0.61742	0.09;0.14;0.08;0.08;0.11;0.27	5.32	5.32	0.75619	.	0.062472	0.64402	D	0.000003	T	0.79293	0.4421	M	0.86651	2.83	0.80722	D	1	D;D;D	0.60160	0.978;0.987;0.963	P;P;D	0.64687	0.77;0.885;0.928	T	0.83299	-0.0029	10	0.87932	D	0	-28.0951	18.993	0.92801	0.0:1.0:0.0:0.0	.	822;759;797	O15013;O15013-7;O15013-5	ARHGA_HUMAN;.;.	F	797;759;821;822;822;470	ENSP00000340297:S797F;ENSP00000427909:S759F;ENSP00000431012:S821F;ENSP00000381571:S822F;ENSP00000262112:S822F;ENSP00000427768:S470F	ENSP00000262112:S822F	S	+	2	0	ARHGEF10	1859349	0.988000	0.35896	0.962000	0.40283	0.508000	0.34012	2.669000	0.46825	2.465000	0.83290	0.655000	0.94253	TCT	.	.		0.468	ARHGEF10-203	KNOWN	basic	protein_coding	protein_coding			
MUC2	4583	hgsc.bcm.edu	37	11	1085941	1085941	+	Silent	SNP	G	G	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr11:1085941G>T	ENST00000441003.2	+	22	2808	c.2781G>T	c.(2779-2781)acG>acT	p.T927T	MUC2_ENST00000359061.5_Silent_p.T927T	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	927	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T927T(2)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GGCAGAGGACGGAGCTGAAGT	0.652																																					p.T927T		Atlas-SNP	.											MUC2_ENST00000441003,NS,carcinoma,0,2	MUC2	614	.	2	Substitution - coding silent(2)	lung(2)	c.G2781T						.						49.0	56.0	54.0					11																	1085941		2122	4215	6337	SO:0001819	synonymous_variant	4583	exon22			GAGGACGGAGCTG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2781G>T	chr11.hg19:g.1085941G>T		25.0	0.0		27.0	3.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.		0.652	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
RRM1	6240	hgsc.bcm.edu	37	11	4148364	4148364	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr11:4148364G>T	ENST00000300738.5	+	14	1774	c.1570G>T	c.(1570-1572)Gcc>Tcc	p.A524S	RRM1_ENST00000534285.1_Missense_Mutation_p.A302S|RRM1_ENST00000423050.2_Missense_Mutation_p.A427S|RRM1_ENST00000537197.1_Missense_Mutation_p.A186S	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	524					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	GAGTGCAGAAGCCCAGTTACT	0.468																																					p.A524S	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	Atlas-SNP	.											.	RRM1	31	.	0			c.G1570T						.						116.0	119.0	118.0					11																	4148364		2201	4298	6499	SO:0001583	missense	6240	exon14			GCAGAAGCCCAGT	X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.1570G>T	chr11.hg19:g.4148364G>T	ENSP00000300738:p.Ala524Ser	102.0	0.0		91.0	4.0	NM_001033	Q9UNN2	Missense_Mutation	SNP	ENST00000300738.5	hg19	CCDS7750.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099144	0.76983	.	.	ENSG00000167325	ENST00000300738;ENST00000423050;ENST00000536894;ENST00000534285;ENST00000543838;ENST00000537197	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.54	5.54	0.83059	Ribonucleoside-diphosphate reductase, alpha subunit (1);Ribonucleotide reductase large subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73776	0.3630	M	0.85777	2.775	0.80722	D	1	P	0.38250	0.624	P	0.53689	0.732	T	0.75045	-0.3456	10	0.59425	D	0.04	-10.2399	18.4056	0.90535	0.0:0.0:1.0:0.0	.	524	P23921	RIR1_HUMAN	S	524;427;437;302;302;186	ENSP00000300738:A524S;ENSP00000390539:A427S;ENSP00000431464:A302S;ENSP00000442148:A186S	ENSP00000300738:A524S	A	+	1	0	RRM1	4104940	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	9.352000	0.97076	2.775000	0.95449	0.655000	0.94253	GCC	.	.		0.468	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033	
MRGPRX3	117195	hgsc.bcm.edu	37	11	18159634	18159634	+	Silent	SNP	G	G	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr11:18159634G>T	ENST00000396275.2	+	3	1246	c.885G>T	c.(883-885)ctG>ctT	p.L295L		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						AGAGGGCTCTGCAGGACACGC	0.557																																					p.L295L		Atlas-SNP	.											.	MRGPRX3	59	.	0			c.G885T						.																																			SO:0001819	synonymous_variant	117195	exon3			GGCTCTGCAGGAC		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.885G>T	chr11.hg19:g.18159634G>T		51.0	0.0		53.0	19.0	NM_054031	B0M0L1|Q8TDE0|Q8TDE1	Silent	SNP	ENST00000396275.2	hg19	CCDS7830.1																																																																																			.	.		0.557	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389767.1	NM_054031	
OR6M1	390261	hgsc.bcm.edu	37	11	123676932	123676932	+	Silent	SNP	G	G	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr11:123676932G>T	ENST00000309154.2	-	1	163	c.126C>A	c.(124-126)acC>acA	p.T42T		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GGGAGATGATGGTGATGTTTC	0.413																																					p.T42T		Atlas-SNP	.											.	OR6M1	60	.	0			c.C126A						.						155.0	134.0	141.0					11																	123676932		2202	4299	6501	SO:0001819	synonymous_variant	390261	exon1			GATGATGGTGATG	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.126C>A	chr11.hg19:g.123676932G>T		129.0	0.0		100.0	15.0	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Silent	SNP	ENST00000309154.2	hg19	CCDS31696.1																																																																																			.	.		0.413	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
HEPACAM	220296	hgsc.bcm.edu	37	11	124794662	124794662	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr11:124794662G>C	ENST00000298251.4	-	2	794	c.389C>G	c.(388-390)aCc>aGc	p.T130S		NM_152722.4	NP_689935.2			hepatic and glial cell adhesion molecule											breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.54e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		CCCAGTGAAGGTGTCGTCGGT	0.562																																					p.T130S		Atlas-SNP	.											.	HEPACAM	64	.	0			c.C389G						.						201.0	190.0	193.0					11																	124794662		2201	4299	6500	SO:0001583	missense	220296	exon2			GTGAAGGTGTCGT	AK098396	CCDS8456.1	11q24.2	2013-01-29	2011-02-11		ENSG00000165478	ENSG00000165478		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26361	protein-coding gene	gene with protein product	"""glial cell adhesion molecule"""	611642	"""hepatocyte cell adhesion molecule"""			15885354, 15917256	Standard	NM_152722		Approved	FLJ25530, hepaCAM, GLIALCAM	uc001qbk.3	Q14CZ8	OTTHUMG00000165938	ENST00000298251.4:c.389C>G	chr11.hg19:g.124794662G>C	ENSP00000298251:p.Thr130Ser	64.0	0.0		34.0	13.0	NM_152722		Missense_Mutation	SNP	ENST00000298251.4	hg19	CCDS8456.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288620	0.80914	.	.	ENSG00000165478	ENST00000298251;ENST00000374961	T	0.65178	-0.14	5.97	5.97	0.96955	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.041711	0.85682	D	0.000000	T	0.65396	0.2687	L	0.41027	1.25	0.51482	D	0.999922	P;D	0.52996	0.845;0.957	P;P	0.50490	0.55;0.642	T	0.60042	-0.7340	10	0.32370	T	0.25	-34.4757	20.428	0.99075	0.0:0.0:1.0:0.0	.	130;130	Q14CZ8-2;Q14CZ8	.;HECAM_HUMAN	S	130	ENSP00000298251:T130S	ENSP00000298251:T130S	T	-	2	0	HEPACAM	124299872	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.581000	0.67471	2.837000	0.97791	0.655000	0.94253	ACC	.	.		0.562	HEPACAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387125.1	NM_152722	
NCKAP5L	57701	hgsc.bcm.edu	37	12	50186524	50186524	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr12:50186524G>A	ENST00000335999.6	-	11	3787	c.3586C>T	c.(3586-3588)Cca>Tca	p.P1196S		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	1192	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						GGGAAGGCTGGCATGCTGGGG	0.697																																					p.P1196S		Atlas-SNP	.											.	NCKAP5L	142	.	0			c.C3586T						.						11.0	14.0	13.0					12																	50186524		2166	4266	6432	SO:0001583	missense	57701	exon11			AGGCTGGCATGCT	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.3586C>T	chr12.hg19:g.50186524G>A	ENSP00000337998:p.Pro1196Ser	57.0	0.0		96.0	29.0	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	ENST00000335999.6	hg19	CCDS41781.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.94|16.94	3.259505|3.259505	0.59321|0.59321	.|.	.|.	ENSG00000167566|ENSG00000167566	ENST00000433948|ENST00000335999;ENST00000354423	.|T	.|0.46451	.|0.87	4.3|4.3	4.3|4.3	0.51218|0.51218	.|.	.|0.000000	.|0.43260	.|D	.|0.000592	T|T	0.36880|0.36880	0.0983|0.0983	L|L	0.40543|0.40543	1.245|1.245	0.37241|0.37241	D|D	0.906101|0.906101	.|P;P;P	.|0.41393	.|0.748;0.518;0.748	.|B;B;B	.|0.43225	.|0.412;0.33;0.412	T|T	0.24977|0.24977	-1.0145|-1.0145	5|10	.|0.18276	.|T	.|0.48	-11.7271|-11.7271	14.1922|14.1922	0.65646|0.65646	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1170;1192;1192	.|E2QRB5;Q9HCH0;Q9HCH0-2	.|.;NCK5L_HUMAN;.	V|S	910|1196;1170	.|ENSP00000337998:P1196S	.|ENSP00000337998:P1196S	A|P	-|-	2|1	0|0	NCKAP5L|NCKAP5L	48472791|48472791	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.988000|0.988000	0.76386|0.76386	5.348000|5.348000	0.66004|0.66004	2.420000|2.420000	0.82092|0.82092	0.561000|0.561000	0.74099|0.74099	GCC|CCA	.	.		0.697	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
OS9	10956	hgsc.bcm.edu	37	12	58087958	58087958	+	Missense_Mutation	SNP	C	C	T	rs150848860	byFrequency	TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr12:58087958C>T	ENST00000315970.7	+	1	55	c.14C>T	c.(13-15)aCg>aTg	p.T5M	OS9_ENST00000552285.1_Missense_Mutation_p.T5M|OS9_ENST00000389146.6_Missense_Mutation_p.T5M|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000413095.2_Missense_Mutation_p.T5M|OS9_ENST00000257966.8_Missense_Mutation_p.T5M|OS9_ENST00000435406.2_Missense_Mutation_p.T5M|OS9_ENST00000551035.1_Missense_Mutation_p.T5M|OS9_ENST00000439210.2_Missense_Mutation_p.T5M|OS9_ENST00000389142.5_Missense_Mutation_p.T5M	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin	5					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GCGGCGGAAACGCTGCTGTCC	0.582																																					p.T5M		Atlas-SNP	.											.	OS9	55	.	0			c.C14T						.						139.0	138.0	138.0					12																	58087958		2203	4300	6503	SO:0001583	missense	10956	exon1			CGGAAACGCTGCT	AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.14C>T	chr12.hg19:g.58087958C>T	ENSP00000318165:p.Thr5Met	80.0	0.0		124.0	32.0	NM_001261423	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Missense_Mutation	SNP	ENST00000315970.7	hg19	CCDS31843.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.239248	0.39598	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000547079;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000550372;ENST00000389142	T;T;T;T;T;T;T;T;T;T	0.46451	1.87;1.87;0.87;1.86;1.87;1.46;1.88;1.87;1.87;1.87	5.0	0.892	0.19230	.	0.694322	0.14596	N	0.309924	T	0.19406	0.0466	N	0.08118	0	0.19300	N	0.999973	B;B;B;D;D;P;P;P	0.59767	0.007;0.029;0.002;0.957;0.986;0.834;0.798;0.834	B;B;B;P;B;B;B;B	0.44811	0.004;0.01;0.002;0.461;0.425;0.272;0.212;0.182	T	0.08046	-1.0741	10	0.38643	T	0.18	-1.205	1.4232	0.02317	0.1516:0.4555:0.1473:0.2455	.	5;5;5;5;5;5;5;5	E7EW91;F8VUH2;B4E321;G3XA88;E9PEY5;Q9BW99;A6NLB2;Q13438	.;.;.;.;.;.;.;OS9_HUMAN	M	5	ENSP00000450010:T5M;ENSP00000318165:T5M;ENSP00000447031:T5M;ENSP00000407360:T5M;ENSP00000373798:T5M;ENSP00000413112:T5M;ENSP00000447866:T5M;ENSP00000257966:T5M;ENSP00000389632:T5M;ENSP00000373794:T5M	ENSP00000257966:T5M	T	+	2	0	OS9	56374225	0.002000	0.14202	0.919000	0.36401	0.865000	0.49528	0.151000	0.16283	0.061000	0.16311	0.563000	0.77884	ACG	.	C|0.997;G|0.003		0.582	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408344.1	NM_006812	
FANCM	57697	hgsc.bcm.edu	37	14	45658377	45658377	+	Missense_Mutation	SNP	G	G	A	rs371629950		TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr14:45658377G>A	ENST00000267430.5	+	20	5237	c.5152G>A	c.(5152-5154)Gtg>Atg	p.V1718M	FANCM_ENST00000542564.2_Missense_Mutation_p.V1692M	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1718					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GCAGTCCAAGGTGCGTTCTAC	0.408								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V1718M		Atlas-SNP	.											.	FANCM	225	.	0			c.G5152A						.	G	MET/VAL	0,4406		0,0,2203	140.0	139.0	139.0		5152	2.5	0.0	14		139	1,8599	1.2+/-3.3	0,1,4299	no	missense	FANCM	NM_020937.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1718/2049	45658377	1,13005	2203	4300	6503	SO:0001583	missense	57697	exon20	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TCCAAGGTGCGTT	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.5152G>A	chr14.hg19:g.45658377G>A	ENSP00000267430:p.Val1718Met	174.0	0.0		176.0	77.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.608|7.608	0.674106|0.674106	0.14841|0.14841	0.0|0.0	1.16E-4|1.16E-4	ENSG00000187790|ENSG00000187790	ENST00000554809|ENST00000267430;ENST00000542564;ENST00000556250	.|T;T;T	.|0.77358	.|-1.09;-1.09;-1.09	5.28|5.28	2.45|2.45	0.29901|0.29901	.|.	.|1.660690	.|0.03081	.|N	.|0.158562	T|T	0.63022|0.63022	0.2476|0.2476	N|N	0.04959|0.04959	-0.14|-0.14	0.09310|0.09310	N|N	1|1	.|B;B	.|0.14012	.|0.009;0.001	.|B;B	.|0.11329	.|0.006;0.003	T|T	0.52366|0.52366	-0.8585|-0.8585	5|10	.|0.45353	.|T	.|0.12	.|.	10.0425|10.0425	0.42166|0.42166	0.3005:0.0:0.6995:0.0|0.3005:0.0:0.6995:0.0	.|.	.|1692;1718	.|B2RTQ9;Q8IYD8	.|.;FANCM_HUMAN	D|M	650|1718;1692;1234	.|ENSP00000267430:V1718M;ENSP00000442493:V1692M;ENSP00000452033:V1234M	.|ENSP00000267430:V1718M	G|V	+|+	2|1	0|0	FANCM|FANCM	44728127|44728127	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.713000|0.713000	0.25794|0.25794	0.068000|0.068000	0.16574|0.16574	-1.761000|-1.761000	0.00669|0.00669	GGT|GTG	.	.		0.408	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
TMEM30B	161291	hgsc.bcm.edu	37	14	61747549	61747549	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr14:61747549C>T	ENST00000555868.1	-	1	1009	c.317G>A	c.(316-318)gGc>gAc	p.G106D	TMEM30B_ENST00000557163.1_5'UTR|TMEM30B_ENST00000355702.2_Missense_Mutation_p.G106D	NM_001017970.2	NP_001017970.1	Q3MIR4	CC50B_HUMAN	transmembrane protein 30B	106					lipid transport (GO:0006869)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.107)|BRCA - Breast invasive adenocarcinoma(234;0.181)		GTACACTGGGCCCTGGAAGAG	0.697																																					p.G106D		Atlas-SNP	.											.	TMEM30B	13	.	0			c.G317A						.						10.0	10.0	10.0					14																	61747549		2118	4155	6273	SO:0001583	missense	161291	exon1			ACTGGGCCCTGGA	AK091169	CCDS32093.1	14q23.1	2006-09-20				ENSG00000182107			27254	protein-coding gene	gene with protein product		611029				15375526	Standard	NM_001017970		Approved	CDC50B	uc001xfl.3	Q3MIR4		ENST00000555868.1:c.317G>A	chr14.hg19:g.61747549C>T	ENSP00000450842:p.Gly106Asp	14.0	0.0		25.0	9.0	NM_001017970	B3KR84|Q14D00	Missense_Mutation	SNP	ENST00000555868.1	hg19	CCDS32093.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498253	0.85069	.	.	ENSG00000182107	ENST00000555868;ENST00000355702	.	.	.	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.75339	0.3836	M	0.85041	2.73	0.49798	D	0.999824	P	0.52170	0.951	P	0.54270	0.747	T	0.80190	-0.1485	9	0.56958	D	0.05	-16.3792	14.0112	0.64498	0.0:1.0:0.0:0.0	.	106	Q3MIR4	CC50B_HUMAN	D	106	.	ENSP00000347930:G106D	G	-	2	0	TMEM30B	60817302	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.314000	0.51943	2.163000	0.67991	0.650000	0.86243	GGC	.	.		0.697	TMEM30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413358.1	XM_090844	
DLST	1743	hgsc.bcm.edu	37	14	75359658	75359658	+	Silent	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr14:75359658C>T	ENST00000334220.4	+	8	625	c.564C>T	c.(562-564)ccC>ccT	p.P188P	DLST_ENST00000334212.6_Silent_p.P102P|DLST_ENST00000555190.1_3'UTR	NM_001933.4	NP_001924.2	P36957	ODO2_HUMAN	dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex)	188					cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|generation of precursor metabolites and energy (GO:0006091)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|oxoglutarate dehydrogenase complex (GO:0045252)	dihydrolipoyllysine-residue succinyltransferase activity (GO:0004149)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00698)		CACCGGTGCCCTCGCCCTCAC	0.572																																					p.P188P		Atlas-SNP	.											.	DLST	42	.	0			c.C564T						.						67.0	56.0	60.0					14																	75359658		2203	4300	6503	SO:0001819	synonymous_variant	1743	exon8			GGTGCCCTCGCCC		CCDS9833.1	14q23.1	2008-08-11			ENSG00000119689	ENSG00000119689	2.3.1.61		2911	protein-coding gene	gene with protein product		126063		DLTS		8009371	Standard	NM_001933		Approved		uc001xqv.2	P36957		ENST00000334220.4:c.564C>T	chr14.hg19:g.75359658C>T		62.0	0.0		78.0	8.0	NM_001933	B7Z5W8|E7ESY5|Q7LDY7|Q9BQ32	Silent	SNP	ENST00000334220.4	hg19	CCDS9833.1																																																																																			.	.		0.572	DLST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413637.1		
IL16	3603	hgsc.bcm.edu	37	15	81593848	81593848	+	Missense_Mutation	SNP	T	T	G			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr15:81593848T>G	ENST00000302987.4	+	14	3313	c.3313T>G	c.(3313-3315)Tta>Gta	p.L1105V	IL16_ENST00000394652.2_Missense_Mutation_p.L404V|RP11-761I4.4_ENST00000607019.1_RNA|IL16_ENST00000394660.2_Missense_Mutation_p.L1105V			Q14005	IL16_HUMAN	interleukin 16	1105	Interaction with HTLV-1 tax.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						TGAAGCAACATTAAAGGTAGG	0.473																																					p.L1105V		Atlas-SNP	.											.	IL16	254	.	0			c.T3313G						.						95.0	93.0	94.0					15																	81593848		2203	4300	6503	SO:0001583	missense	3603	exon15			GCAACATTAAAGG	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.3313T>G	chr15.hg19:g.81593848T>G	ENSP00000302935:p.Leu1105Val	56.0	0.0		63.0	19.0	NM_001172128	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	ENST00000302987.4	hg19	CCDS42069.1	.	.	.	.	.	.	.	.	.	.	T	10.34	1.323405	0.24080	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653;ENST00000394652;ENST00000394656	T;T;T	0.13307	2.6;2.61;3.24	4.87	-3.11	0.05299	PDZ/DHR/GLGF (1);	0.000000	0.30565	N	0.009356	T	0.21962	0.0529	L	0.36672	1.1	0.32316	N	0.563122	D;D;D;P;D;B	0.63880	0.983;0.993;0.981;0.843;0.977;0.152	D;D;P;D;D;P	0.83275	0.986;0.996;0.727;0.956;0.985;0.558	T	0.03662	-1.1015	10	0.59425	D	0.04	.	12.1584	0.54091	0.0:0.5327:0.0:0.4673	.	937;598;642;495;1105;1105	F8W7Z5;Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;.;IL16_HUMAN;.	V	1105;937;1105;642;495;404;404	ENSP00000378155:L1105V;ENSP00000302935:L1105V;ENSP00000378147:L404V	ENSP00000302935:L1105V	L	+	1	2	IL16	79380903	0.007000	0.16637	0.001000	0.08648	0.141000	0.21300	-0.021000	0.12504	-0.667000	0.05303	0.459000	0.35465	TTA	.	.		0.473	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217	
ITGAD	3681	hgsc.bcm.edu	37	16	31414896	31414896	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr16:31414896C>T	ENST00000389202.2	+	7	683	c.634C>T	c.(634-636)Cag>Tag	p.Q212*	RP11-120K18.2_ENST00000567545.1_RNA	NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	212	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CCCGAGCCAGCAGAGCCTGGT	0.602																																					p.Q212X		Atlas-SNP	.											.	ITGAD	154	.	0			c.C634T						.						107.0	86.0	93.0					16																	31414896		2197	4300	6497	SO:0001587	stop_gained	3681	exon7			AGCCAGCAGAGCC	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.634C>T	chr16.hg19:g.31414896C>T	ENSP00000373854:p.Gln212*	62.0	0.0		76.0	27.0	NM_005353	Q15575|Q15576	Nonsense_Mutation	SNP	ENST00000389202.2	hg19	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	C	16.80	3.223352	0.58668	.	.	ENSG00000156886	ENST00000316569;ENST00000444228;ENST00000389202	.	.	.	4.69	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	7.1887	0.25814	0.1785:0.625:0.1964:0.0	.	.	.	.	X	76;228;212	.	ENSP00000323325:Q76X	Q	+	1	0	ITGAD	31322397	0.000000	0.05858	0.227000	0.23927	0.034000	0.12701	0.172000	0.16704	2.430000	0.82344	0.503000	0.49774	CAG	.	.		0.602	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
ANKRD13B	124930	hgsc.bcm.edu	37	17	27940598	27940598	+	Nonstop_Mutation	SNP	T	T	C			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr17:27940598T>C	ENST00000394859.3	+	15	2033	c.1879T>C	c.(1879-1881)Tag>Cag	p.*627Q	RP11-68I3.2_ENST00000581474.1_RNA|CORO6_ENST00000577909.1_5'Flank	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	0						endosome (GO:0005768)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						GACCGAGCAGTAGCGCCCCCT	0.741																																					p.X627Q		Atlas-SNP	.											.	ANKRD13B	39	.	0			c.T1879C						.						6.0	11.0	9.0					17																	27940598		1747	3446	5193	SO:0001578	stop_lost	124930	exon15			GAGCAGTAGCGCC	AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.1879T>C	chr17.hg19:g.27940598T>C	ENSP00000378328:p.*627Glnext*108	24.0	0.0		20.0	8.0	NM_152345	Q8N7S9	Missense_Mutation	SNP	ENST00000394859.3	hg19	CCDS11251.1	.	.	.	.	.	.	.	.	.	.	T	18.36	3.606729	0.66558	.	.	ENSG00000198720	ENST00000394859	.	.	.	5.0	2.6	0.31112	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2728	0.31855	0.1314:0.0:0.1375:0.7311	.	.	.	.	Q	627	.	.	X	+	1	0	ANKRD13B	24964724	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.733000	0.68571	0.898000	0.36418	0.460000	0.39030	TAG	.	.		0.741	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256077.1	NM_152345	
SLC16A6	9120	hgsc.bcm.edu	37	17	66268836	66268836	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr17:66268836A>G	ENST00000327268.4	-	5	613	c.449T>C	c.(448-450)aTa>aCa	p.I150T	SLC16A6_ENST00000580666.1_Missense_Mutation_p.I150T|ARSG_ENST00000448504.2_Intron	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	150					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	TGCAGTGACTATGGAACGTCT	0.428																																					p.I150T		Atlas-SNP	.											.	SLC16A6	56	.	0			c.T449C						.						190.0	165.0	174.0					17																	66268836		2203	4300	6503	SO:0001583	missense	9120	exon5			GTGACTATGGAAC	U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.449T>C	chr17.hg19:g.66268836A>G	ENSP00000319991:p.Ile150Thr	107.0	0.0		135.0	32.0	NM_001174166	Q6P1X3	Missense_Mutation	SNP	ENST00000327268.4	hg19	CCDS11675.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296930	0.23650	.	.	ENSG00000108932	ENST00000327268	T	0.38722	1.12	5.41	5.41	0.78517	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.443462	0.22581	N	0.058217	T	0.31167	0.0788	N	0.14661	0.345	0.32400	N	0.55204	B	0.29955	0.263	B	0.32928	0.155	T	0.48080	-0.9066	10	0.87932	D	0	.	14.9216	0.70843	1.0:0.0:0.0:0.0	.	150	O15403	MOT7_HUMAN	T	150	ENSP00000319991:I150T	ENSP00000319991:I150T	I	-	2	0	SLC16A6	63780431	0.995000	0.38212	0.010000	0.14722	0.383000	0.30230	8.673000	0.91186	2.171000	0.68590	0.533000	0.62120	ATA	.	.		0.428	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1	NM_004694	
ZNF728	388523	hgsc.bcm.edu	37	19	23170207	23170207	+	Splice_Site	SNP	T	T	A			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr19:23170207T>A	ENST00000594710.1	-	3	276		c.e3-2			NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										CAGCAATACCTGTTTTATTAA	0.388																																					.		Atlas-SNP	.											.	.	.	.	0			c.131-2A>T						.																																			SO:0001630	splice_region_variant	388523	exon4			AATACCTGTTTTA	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.131-2A>T	chr19.hg19:g.23170207T>A		56.0	0.0		31.0	12.0	NM_001267716		Splice_Site	SNP	ENST00000594710.1	hg19	CCDS59370.1																																																																																			.	.		0.388	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465176.1	NM_001267716	Intron
WDR87	83889	hgsc.bcm.edu	37	19	38385769	38385769	+	Missense_Mutation	SNP	T	T	A			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr19:38385769T>A	ENST00000303868.5	-	4	681	c.457A>T	c.(457-459)Atg>Ttg	p.M153L	WDR87_ENST00000447313.2_Missense_Mutation_p.M192L	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	153										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TCACCTGGCATGGAGACCATG	0.597																																					p.M153L		Atlas-SNP	.											.	WDR87	191	.	0			c.A457T						.						51.0	52.0	52.0					19																	38385769		692	1591	2283	SO:0001583	missense	83889	exon4			CTGGCATGGAGAC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.457A>T	chr19.hg19:g.38385769T>A	ENSP00000368025:p.Met153Leu	65.0	0.0		45.0	22.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	T	1.886	-0.456588	0.04540	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.73363	-0.74;-0.74	5.77	2.49	0.30216	.	0.239248	0.37530	N	0.002058	T	0.43277	0.1240	N	0.05230	-0.09	0.09310	N	1	B;B	0.13145	0.007;0.007	B;B	0.08055	0.003;0.003	T	0.34551	-0.9824	10	0.02654	T	1	-9.5125	5.6572	0.17648	0.0:0.0857:0.3381:0.5762	.	153;192	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	L	192;153	ENSP00000405012:M192L;ENSP00000368025:M153L	ENSP00000368025:M153L	M	-	1	0	WDR87	43077609	0.532000	0.26346	0.859000	0.33776	0.021000	0.10359	0.189000	0.17037	0.421000	0.25980	0.523000	0.50628	ATG	.	.		0.597	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
STRN4	29888	hgsc.bcm.edu	37	19	47231256	47231256	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr19:47231256G>C	ENST00000263280.6	-	8	1097	c.1048C>G	c.(1048-1050)Cgg>Ggg	p.R350G	STRN4_ENST00000594357.2_5'UTR|CTB-174O21.2_ENST00000600716.1_RNA|STRN4_ENST00000391910.3_Missense_Mutation_p.R350G|STRN4_ENST00000539396.1_Missense_Mutation_p.R231G	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	350						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		AGTTTGACCCGACGGCTTTCT	0.657																																					p.R350G		Atlas-SNP	.											.	STRN4	33	.	0			c.C1048G						.						46.0	41.0	43.0					19																	47231256		2203	4300	6503	SO:0001583	missense	29888	exon8			TGACCCGACGGCT	AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.1048C>G	chr19.hg19:g.47231256G>C	ENSP00000263280:p.Arg350Gly	50.0	0.0		51.0	13.0	NM_001039877	A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Missense_Mutation	SNP	ENST00000263280.6	hg19	CCDS12690.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.588039	0.66105	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396	T;T;T	0.70631	-0.5;-0.32;-0.18	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.80592	0.4652	M	0.72353	2.195	0.80722	D	1	D;D	0.76494	0.999;0.993	D;D	0.74674	0.984;0.972	T	0.80511	-0.1350	10	0.45353	T	0.12	-20.9293	10.2599	0.43421	0.0:0.0:0.8026:0.1974	.	350;350	F8VYA6;Q9NRL3	.;STRN4_HUMAN	G	350;350;231	ENSP00000375777:R350G;ENSP00000263280:R350G;ENSP00000440901:R231G	ENSP00000263280:R350G	R	-	1	2	STRN4	51923096	0.999000	0.42202	0.996000	0.52242	0.984000	0.73092	2.112000	0.41892	2.107000	0.64212	0.561000	0.74099	CGG	.	.		0.657	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466607.2		
LILRB1	10859	hgsc.bcm.edu	37	19	55148029	55148029	+	Missense_Mutation	SNP	C	C	T	rs370268778		TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr19:55148029C>T	ENST00000396331.1	+	15	2089	c.1732C>T	c.(1732-1734)Cct>Tct	p.P578S	LILRB1_ENST00000427581.2_Missense_Mutation_p.P629S|LILRB1_ENST00000448689.1_3'UTR|LILRB1_ENST00000396327.3_Missense_Mutation_p.P579S|LILRB1_ENST00000396332.4_Missense_Mutation_p.P579S|LILRB1_ENST00000434867.2_Missense_Mutation_p.P578S|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396321.2_Missense_Mutation_p.P578S|LILRB1_ENST00000396317.1_Missense_Mutation_p.P562S|LILRB1_ENST00000324602.7_Missense_Mutation_p.P580S|AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396315.1_Missense_Mutation_p.P580S|LILRB1_ENST00000418536.2_Missense_Mutation_p.P562S	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	578					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GGCCTCTCCTCCTTCCCCACT	0.582										HNSCC(37;0.09)																											p.P580S		Atlas-SNP	.											LILRB1,NS,carcinoma,0,1	LILRB1	140	.	0			c.C1738T						.						112.0	96.0	101.0					19																	55148029		2201	4298	6499	SO:0001583	missense	10859	exon14			TCTCCTCCTTCCC	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1732C>T	chr19.hg19:g.55148029C>T	ENSP00000379622:p.Pro578Ser	134.0	0.0		122.0	10.0	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	hg19	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	C	7.396	0.631747	0.14322	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T	0.00518	7.0;6.92;7.0;7.03;6.99;7.0;7.02;6.86;6.92;6.99	1.59	0.511	0.16989	.	.	.	.	.	T	0.01124	0.0037	M	0.82323	2.585	0.09310	N	1	B;D;B;P;D	0.63046	0.411;0.992;0.339;0.882;0.964	B;P;B;P;P	0.58928	0.055;0.848;0.035;0.528;0.601	T	0.47328	-0.9126	9	0.52906	T	0.07	.	3.7747	0.08656	0.0:0.7538:0.0:0.2462	.	562;580;579;579;578	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	S	578;562;578;579;580;578;579;629;562;580	ENSP00000379614:P578S;ENSP00000391514:P562S;ENSP00000379622:P578S;ENSP00000379618:P579S;ENSP00000315997:P580S;ENSP00000405243:P578S;ENSP00000379623:P579S;ENSP00000395004:P629S;ENSP00000379610:P562S;ENSP00000379608:P580S	ENSP00000315997:P580S	P	+	1	0	LILRB1	59839841	0.003000	0.15002	0.001000	0.08648	0.091000	0.18340	0.942000	0.29017	0.254000	0.21573	0.194000	0.17425	CCT	.	.		0.582	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
ADRA1D	146	hgsc.bcm.edu	37	20	4228867	4228867	+	Nonsense_Mutation	SNP	G	G	T	rs140080149	byFrequency	TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr20:4228867G>T	ENST00000379453.4	-	1	854	c.738C>A	c.(736-738)tgC>tgA	p.C246*		NM_000678.3	NP_000669.1	P25100	ADA1D_HUMAN	adrenoceptor alpha 1D	246					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			endometrium(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	14					Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CGGTGATACCGCAGAAGCGCT	0.672																																					p.C246X		Atlas-SNP	.											.	ADRA1D	36	.	0			c.C738A						.						29.0	27.0	28.0					20																	4228867		2198	4300	6498	SO:0001587	stop_gained	146	exon1			GATACCGCAGAAG	U03864	CCDS13079.1	20p13	2012-08-08	2012-05-09		ENSG00000171873	ENSG00000171873		"""GPCR / Class A : Adrenoceptors : alpha"""	280	protein-coding gene	gene with protein product		104219	"""adrenergic, alpha-1D-, receptor"""			8039425	Standard	NM_000678		Approved	ADRA1R, ADRA1A, ADRA1	uc002wkr.2	P25100	OTTHUMG00000031779	ENST00000379453.4:c.738C>A	chr20.hg19:g.4228867G>T	ENSP00000368766:p.Cys246*	97.0	0.0		86.0	35.0	NM_000678	Q9NPY0	Nonsense_Mutation	SNP	ENST00000379453.4	hg19	CCDS13079.1	.	.	.	.	.	.	.	.	.	.	g	38	6.699864	0.97772	.	.	ENSG00000171873	ENST00000379453	.	.	.	4.25	1.16	0.20824	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.5193	0.22266	0.4102:0.0:0.5898:0.0	.	.	.	.	X	246	.	ENSP00000368766:C246X	C	-	3	2	ADRA1D	4176867	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.685000	0.37659	0.448000	0.26722	0.552000	0.68991	TGC	.	G|0.996;A|0.004		0.672	ADRA1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077812.2	NM_000678	
SLC9A8	23315	hgsc.bcm.edu	37	20	48497559	48497559	+	Silent	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr20:48497559C>T	ENST00000361573.2	+	13	1299	c.1257C>T	c.(1255-1257)atC>atT	p.I419I	SLC9A8_ENST00000541138.1_Silent_p.I119I|SLC9A8_ENST00000417961.1_Silent_p.I435I|SLC9A8_ENST00000539601.1_Silent_p.I200I			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8	419					ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TGATGTTCATCATGTGGTTTA	0.458																																					p.I435I		Atlas-SNP	.											.	SLC9A8	63	.	0			c.C1305T						.						144.0	128.0	133.0					20																	48497559		2203	4300	6503	SO:0001819	synonymous_variant	23315	exon13			GTTCATCATGTGG	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.1257C>T	chr20.hg19:g.48497559C>T		115.0	0.0		113.0	34.0	NM_001260491	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Silent	SNP	ENST00000361573.2	hg19	CCDS13421.1																																																																																			.	.		0.458	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106483.3	XM_030524	
ZNF512B	57473	hgsc.bcm.edu	37	20	62594086	62594086	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr20:62594086C>T	ENST00000450537.1	-	13	2077	c.2017G>A	c.(2017-2019)Ggt>Agt	p.G673S	ZNF512B_ENST00000369888.1_Missense_Mutation_p.G673S|ZNF512B_ENST00000217130.3_Missense_Mutation_p.G673S			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	673					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CGCTCCACACCCAGCGGGTCC	0.692																																					p.G673S		Atlas-SNP	.											.	ZNF512B	72	.	0			c.G2017A						.						10.0	11.0	11.0					20																	62594086		2180	4261	6441	SO:0001583	missense	57473	exon13			CCACACCCAGCGG	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.2017G>A	chr20.hg19:g.62594086C>T	ENSP00000393795:p.Gly673Ser	77.0	0.0		69.0	21.0	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	hg19	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431940	0.62844	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.22134	1.97;1.97;1.97	5.22	4.27	0.50696	.	0.135951	0.46442	D	0.000283	T	0.10423	0.0255	N	0.03608	-0.345	0.35703	D	0.815806	B	0.06786	0.001	B	0.13407	0.009	T	0.14559	-1.0468	10	0.35671	T	0.21	-12.2131	14.0508	0.64734	0.0:0.926:0.0:0.074	.	673	Q96KM6	Z512B_HUMAN	S	673	ENSP00000358904:G673S;ENSP00000393795:G673S;ENSP00000217130:G673S	ENSP00000217130:G673S	G	-	1	0	ZNF512B	62064530	0.988000	0.35896	1.000000	0.80357	0.936000	0.57629	4.424000	0.59868	2.434000	0.82447	0.563000	0.77884	GGT	.	.		0.692	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
EIF4ENIF1	56478	hgsc.bcm.edu	37	22	31845450	31845450	+	Missense_Mutation	SNP	A	A	C			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr22:31845450A>C	ENST00000397525.1	-	12	1875	c.1652T>G	c.(1651-1653)tTg>tGg	p.L551W	EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.L376W|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.L551W|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.L206W|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.L527W	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	551						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGTAGGCTCCAAGCTCCCCAT	0.507																																					p.L551W		Atlas-SNP	.											.	EIF4ENIF1	80	.	0			c.T1652G						.						118.0	118.0	118.0					22																	31845450		2203	4300	6503	SO:0001583	missense	56478	exon12			GGCTCCAAGCTCC	AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.1652T>G	chr22.hg19:g.31845450A>C	ENSP00000380659:p.Leu551Trp	77.0	0.0		72.0	24.0	NM_019843	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	ENST00000397525.1	hg19	CCDS13898.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.017915	0.75275	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180	.	.	.	5.93	4.89	0.63831	.	0.197661	0.43110	D	0.000604	T	0.74696	0.3750	L	0.59436	1.845	0.44694	D	0.997684	D;D;D;B	0.89917	1.0;1.0;1.0;0.013	D;D;D;B	0.91635	0.999;0.999;0.988;0.013	T	0.75204	-0.3400	9	0.54805	T	0.06	-7.5621	12.6931	0.56988	0.8624:0.1376:0.0:0.0	.	376;551;376;527	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	W	376;551;551;527;206	.	ENSP00000328103:L551W	L	-	2	0	EIF4ENIF1	30175450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.629000	0.61290	1.050000	0.40346	0.455000	0.32223	TTG	.	.		0.507	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
EP300	2033	hgsc.bcm.edu	37	22	41574846	41574846	+	Silent	SNP	T	T	C			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chr22:41574846T>C	ENST00000263253.7	+	31	8350	c.7131T>C	c.(7129-7131)gcT>gcC	p.A2377A	RP1-85F18.5_ENST00000420537.1_RNA|RP1-85F18.6_ENST00000415054.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2377					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CTCAGCTTGCTAGCAATCCAG	0.542			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.A2377A		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.T7131C						.						50.0	51.0	50.0					22																	41574846		2203	4300	6503	SO:0001819	synonymous_variant	2033	exon31	Familial Cancer Database	Broad Thumb-Hallux syndrome	GCTTGCTAGCAAT	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.7131T>C	chr22.hg19:g.41574846T>C		87.0	0.0		63.0	22.0	NM_001429	B1AKC2	Silent	SNP	ENST00000263253.7	hg19	CCDS14010.1																																																																																			.	.		0.542	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
SHROOM4	57477	hgsc.bcm.edu	37	X	50378093	50378093	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chrX:50378093C>T	ENST00000289292.7	-	4	1263	c.980G>A	c.(979-981)tGc>tAc	p.C327Y	SHROOM4_ENST00000460112.3_Missense_Mutation_p.C211Y|SHROOM4_ENST00000376020.2_Missense_Mutation_p.C327Y			Q9ULL8	SHRM4_HUMAN	shroom family member 4	327					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					CCCACTGAGGCAACAGAACCT	0.552																																					p.C327Y		Atlas-SNP	.											.	SHROOM4	171	.	0			c.G980A						.						59.0	43.0	48.0					X																	50378093		2203	4300	6503	SO:0001583	missense	57477	exon4			CTGAGGCAACAGA	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.980G>A	chrX.hg19:g.50378093C>T	ENSP00000289292:p.Cys327Tyr	76.0	0.0		101.0	32.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	hg19	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	C	4.540	0.100320	0.08731	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.15603	2.86;2.86;2.41	5.81	4.93	0.64822	.	0.331162	0.27668	N	0.018342	T	0.22166	0.0534	M	0.65975	2.015	0.39464	D	0.967615	P	0.49961	0.93	P	0.44732	0.459	T	0.03773	-1.1005	10	0.59425	D	0.04	.	8.6758	0.34179	0.171:0.667:0.1619:0.0	.	327	Q9ULL8	SHRM4_HUMAN	Y	327;327;211	ENSP00000289292:C327Y;ENSP00000365188:C327Y;ENSP00000421450:C211Y	ENSP00000289292:C327Y	C	-	2	0	SHROOM4	50394833	0.963000	0.33076	0.924000	0.36721	0.191000	0.23601	2.125000	0.42016	1.171000	0.42768	0.600000	0.82982	TGC	.	.		0.552	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
MAGEE1	57692	hgsc.bcm.edu	37	X	75648383	75648383	+	Silent	SNP	G	G	A			TCGA-GJ-A6C0-01A-12D-A30V-10	TCGA-GJ-A6C0-10A-01D-A30V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36b33892-0a4d-42f1-8a5c-b51efd4d40a1	6fbe0c9d-a6ae-4737-8e50-926b0b027cdb	g.chrX:75648383G>A	ENST00000361470.2	+	1	338	c.60G>A	c.(58-60)gcG>gcA	p.A20A		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	20						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						AGGCTACTGCGCACAACAGCA	0.662																																					p.A20A		Atlas-SNP	.											.	MAGEE1	236	.	0			c.G60A						.						16.0	17.0	17.0					X																	75648383		2199	4289	6488	SO:0001819	synonymous_variant	57692	exon1			TACTGCGCACAAC	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.60G>A	chrX.hg19:g.75648383G>A		152.0	0.0		138.0	15.0	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	ENST00000361470.2	hg19	CCDS14433.1																																																																																			.	.		0.662	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
