#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CHD5	26038	hgsc.bcm.edu	37	1	6214807	6214807	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:6214807C>T	ENST00000262450.3	-	5	757	c.658G>A	c.(658-660)Gtc>Atc	p.V220I	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GAGATGGTGACCGTCTCTACA	0.687																																					p.V220I		Atlas-SNP	.											.	CHD5	267	.	0			c.G658A						.						22.0	21.0	22.0					1																	6214807		2203	4299	6502	SO:0001583	missense	26038	exon5			TGGTGACCGTCTC	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.658G>A	chr1.hg19:g.6214807C>T	ENSP00000262450:p.Val220Ile	134.0	0.0		118.0	34.0	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	hg19	CCDS57.1	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744928	0.49151	.	.	ENSG00000116254	ENST00000262450	D	0.90844	-2.74	3.84	3.84	0.44239	.	0.000000	0.64402	D	0.000008	D	0.92935	0.7752	L	0.55481	1.735	0.80722	D	1	D	0.56521	0.976	P	0.62184	0.899	D	0.92951	0.6380	10	0.45353	T	0.12	-40.9189	16.1333	0.81461	0.0:1.0:0.0:0.0	.	220	Q8TDI0	CHD5_HUMAN	I	220	ENSP00000262450:V220I	ENSP00000262450:V220I	V	-	1	0	CHD5	6137394	1.000000	0.71417	0.920000	0.36463	0.062000	0.15995	4.437000	0.59955	1.876000	0.54355	0.313000	0.20887	GTC	.	.		0.687	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
KDM1A	23028	hgsc.bcm.edu	37	1	23370953	23370953	+	Intron	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:23370953G>C	ENST00000356634.3	+	3	666				MIR3115_ENST00000577915.1_RNA|KDM1A_ENST00000542151.1_Missense_Mutation_p.G184A|KDM1A_ENST00000400181.4_Missense_Mutation_p.G184A|RP1-184J9.2_ENST00000427154.1_RNA	NM_015013.3	NP_055828.2	O60341	KDM1A_HUMAN	lysine (K)-specific demethylase 1A						blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|histone H3-K4 demethylation (GO:0034720)|histone H3-K9 demethylation (GO:0033169)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of DNA binding (GO:0043392)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of protein binding (GO:0032091)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein demethylation (GO:0006482)|regulation of primitive erythrocyte differentiation (GO:0010725)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|demethylase activity (GO:0032451)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-K4 specific) (GO:0032453)|histone demethylase activity (H3-K9 specific) (GO:0032454)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|MRF binding (GO:0043426)|oxidoreductase activity (GO:0016491)|p53 binding (GO:0002039)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(2)|endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GACAGTTCTGGAGGGTATGGA	0.478																																					p.G184A		Atlas-SNP	.											.	KDM1A	49	.	0			c.G551C						.						56.0	50.0	52.0					1																	23370953		1568	3582	5150	SO:0001627	intron_variant	23028	exon3			GTTCTGGAGGGTA	AL031428	CCDS30627.1, CCDS53278.1	1p36.12	2011-07-01	2009-09-29	2009-09-29	ENSG00000004487	ENSG00000004487		"""Chromatin-modifying enzymes / K-demethylases"""	29079	protein-coding gene	gene with protein product		609132	"""amine oxidase (flavin containing) domain 2"", ""lysine (K)-specific demethylase 1"""	AOF2, KDM1		9628581, 12493763	Standard	NM_015013		Approved	KIAA0601, BHC110, LSD1	uc001bgj.2	O60341	OTTHUMG00000003220	ENST00000356634.3:c.518-5927G>C	chr1.hg19:g.23370953G>C		109.0	0.0		114.0	19.0	NM_001009999	A8MWP9|Q5TH94|Q5TH95|Q86VT7|Q8IXK4|Q8NDP6|Q8TAZ3|Q96AW4	Missense_Mutation	SNP	ENST00000356634.3	hg19	CCDS30627.1	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298385	0.23650	.	.	ENSG00000004487	ENST00000400181;ENST00000542151	T;T	0.28454	1.61;1.61	5.55	5.55	0.83447	.	0.496724	0.19159	N	0.121250	T	0.32133	0.0819	N	0.08118	0	0.44908	D	0.997929	D	0.61697	0.99	D	0.72625	0.978	T	0.03993	-1.0986	10	0.06625	T	0.88	-18.6337	17.0077	0.86397	0.0:0.0:1.0:0.0	.	184	O60341-2	.	A	184	ENSP00000383042:G184A;ENSP00000439072:G184A	ENSP00000383042:G184A	G	+	2	0	KDM1A	23243540	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.008000	0.70739	2.755000	0.94549	0.655000	0.94253	GGA	.	.		0.478	KDM1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000008880.3	NM_015013	
COL8A2	1296	hgsc.bcm.edu	37	1	36565003	36565003	+	Silent	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:36565003G>C	ENST00000397799.1	-	4	503	c.279C>G	c.(277-279)ccC>ccG	p.P93P	COL8A2_ENST00000481785.1_Silent_p.P28P|COL8A2_ENST00000303143.4_Silent_p.P93P			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	93	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGAAGCCAGGGGGGCCAGGGG	0.677																																					p.P93P		Atlas-SNP	.											.	COL8A2	41	.	0			c.C279G						.						3.0	4.0	4.0					1																	36565003		1619	3636	5255	SO:0001819	synonymous_variant	1296	exon2			GCCAGGGGGGCCA	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.279C>G	chr1.hg19:g.36565003G>C		46.0	0.0		46.0	15.0	NM_005202	Q5JV31|Q8TEJ5	Silent	SNP	ENST00000397799.1	hg19	CCDS403.1																																																																																			.	.		0.677	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
HIVEP3	59269	hgsc.bcm.edu	37	1	42041241	42041241	+	Silent	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:42041241C>T	ENST00000372583.1	-	5	6066	c.5181G>A	c.(5179-5181)ccG>ccA	p.P1727P	HIVEP3_ENST00000372584.1_Silent_p.P1727P|HIVEP3_ENST00000247584.5_Silent_p.P1727P|HIVEP3_ENST00000429157.2_Silent_p.P1727P|HIVEP3_ENST00000460604.1_5'UTR	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1727					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TGATCCTCGCCGGCTCCCCTC	0.557																																					p.P1727P		Atlas-SNP	.											.	HIVEP3	235	.	0			c.G5181A						.						151.0	161.0	158.0					1																	42041241		2203	4300	6503	SO:0001819	synonymous_variant	59269	exon5			CCTCGCCGGCTCC	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.5181G>A	chr1.hg19:g.42041241C>T		61.0	0.0		87.0	31.0	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.		0.557	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
CYP4A22	284541	hgsc.bcm.edu	37	1	47610597	47610597	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:47610597C>T	ENST00000371891.3	+	9	1208	c.1177C>T	c.(1177-1179)Ctc>Ttc	p.L393F	CYP4A22_ENST00000294337.3_Missense_Mutation_p.L393F|CYP4A22_ENST00000371890.3_Missense_Mutation_p.L295F|CYP4A22_ENST00000485117.1_3'UTR|CYP4A22-AS1_ENST00000444042.2_lincRNA	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	393						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGGAAGAGAGCTCAGCACTCC	0.577																																					p.L393F	Pancreas(88;1240 1470 2099 14214 37557)	Atlas-SNP	.											.	CYP4A22	60	.	0			c.C1177T						.						126.0	104.0	111.0					1																	47610597		2203	4300	6503	SO:0001583	missense	284541	exon9			AGAGAGCTCAGCA		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.1177C>T	chr1.hg19:g.47610597C>T	ENSP00000360958:p.Leu393Phe	169.0	0.0		174.0	55.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	ENST00000371891.3	hg19	CCDS30707.1	.	.	.	.	.	.	.	.	.	.	c	15.82	2.946698	0.53186	.	.	ENSG00000162365	ENST00000371890;ENST00000371891;ENST00000294337	T;T;T	0.70164	-0.46;-0.4;-0.4	1.51	0.497	0.16902	.	0.323945	0.34435	N	0.003974	T	0.74596	0.3737	M	0.81112	2.525	0.34446	D	0.70009	P;P	0.46952	0.887;0.779	P;P	0.56648	0.803;0.589	T	0.78481	-0.2187	10	0.87932	D	0	.	7.6464	0.28323	0.0:0.859:0.0:0.141	.	295;393	Q5TCH5;Q5TCH4	.;CP4AM_HUMAN	F	295;393;393	ENSP00000360957:L295F;ENSP00000360958:L393F;ENSP00000294337:L393F	ENSP00000294337:L393F	L	+	1	0	CYP4A22	47383184	0.011000	0.17503	0.253000	0.24343	0.455000	0.32408	0.635000	0.24629	0.000000	0.14550	0.194000	0.17425	CTC	.	.		0.577	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
L1TD1	54596	hgsc.bcm.edu	37	1	62672399	62672399	+	Silent	SNP	T	T	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:62672399T>A	ENST00000498273.1	+	3	394	c.99T>A	c.(97-99)acT>acA	p.T33T		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	33										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						taacagaaactgataaggaca	0.328																																					p.T33T		Atlas-SNP	.											.	L1TD1	114	.	0			c.T99A						.						26.0	23.0	24.0					1																	62672399		2025	3947	5972	SO:0001819	synonymous_variant	54596	exon4			AGAAACTGATAAG	BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.99T>A	chr1.hg19:g.62672399T>A		324.0	0.0		371.0	27.0	NM_001164835	Q8NDA1|Q9NUV8|Q9NV78	Silent	SNP	ENST00000498273.1	hg19	CCDS619.1																																																																																			.	.		0.328	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024688.1	NM_019079	
FOXD3	27022	hgsc.bcm.edu	37	1	63788897	63788897	+	Silent	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:63788897C>T	ENST00000371116.2	+	1	168	c.168C>T	c.(166-168)gaC>gaT	p.D56D	RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	56					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						TGCGCCTGGACGAGGCGGACG	0.731																																					p.D56D	Pancreas(68;276 1750 11966 31252)	Atlas-SNP	.											.	FOXD3	15	.	0			c.C168T						.						12.0	13.0	13.0					1																	63788897		2054	4035	6089	SO:0001819	synonymous_variant	27022	exon1			CCTGGACGAGGCG	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.168C>T	chr1.hg19:g.63788897C>T		147.0	0.0		111.0	38.0	NM_012183	Q9BYM2|Q9UDD1	Silent	SNP	ENST00000371116.2	hg19	CCDS624.1																																																																																			.	.		0.731	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1		
PDE4DIP	9659	hgsc.bcm.edu	37	1	145075831	145075831	+	Missense_Mutation	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:145075831C>A	ENST00000530740.1	-	1	70	c.32G>T	c.(31-33)cGc>cTc	p.R11L	PDE4DIP_ENST00000369345.4_Missense_Mutation_p.R11L|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.R11L|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R11L			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GCATCGGCGGCGGCAGCAGGA	0.667			T	PDGFRB	MPD																																p.R11L		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.G32T						.						39.0	47.0	44.0					1																	145075831		2173	4272	6445	SO:0001583	missense	9659	exon1			CGGCGGCGGCAGC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.32G>T	chr1.hg19:g.145075831C>A	ENSP00000435654:p.Arg11Leu	182.0	0.0		220.0	25.0	NM_022359	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000530740.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.02	3.281053	0.59758	.	.	ENSG00000178104	ENST00000530740;ENST00000369359;ENST00000369348;ENST00000369345	T;T;T	0.13657	4.08;4.06;2.57	2.04	1.11	0.20524	.	.	.	.	.	T	0.04770	0.0129	N	0.19112	0.55	0.22571	N	0.99898	P;B	0.50443	0.935;0.159	P;B	0.50825	0.651;0.063	T	0.25606	-1.0127	9	0.87932	D	0	.	4.3682	0.11235	0.0:0.8:0.0:0.2	.	11;11	Q5TB27;E9PJ64	.;.	L	11	ENSP00000435654:R11L;ENSP00000358366:R11L;ENSP00000358354:R11L	ENSP00000358351:R11L	R	-	2	0	PDE4DIP	143787188	0.004000	0.15560	0.986000	0.45419	0.758000	0.43043	0.890000	0.28295	0.411000	0.25702	0.511000	0.50034	CGC	.	.		0.667	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000384663.2	NM_022359	
CD5L	922	hgsc.bcm.edu	37	1	157803090	157803090	+	Missense_Mutation	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:157803090C>A	ENST00000368174.4	-	5	1027	c.931G>T	c.(931-933)Gat>Tat	p.D311Y	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	311	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CGAACATTATCCAGCCAGATG	0.582																																					p.D311Y		Atlas-SNP	.											CD5L,right_upper_lobe,carcinoma,0,1	CD5L	112	.	0			c.G931T						.						100.0	100.0	100.0					1																	157803090		2203	4300	6503	SO:0001583	missense	922	exon5			CATTATCCAGCCA	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.931G>T	chr1.hg19:g.157803090C>A	ENSP00000357156:p.Asp311Tyr	125.0	0.0		125.0	28.0	NM_005894	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	hg19	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.640674	0.67244	.	.	ENSG00000073754	ENST00000368174	T	0.37235	1.21	5.06	5.06	0.68205	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.222845	0.34555	N	0.003876	T	0.58352	0.2116	M	0.92367	3.3	0.36566	D	0.872727	D	0.89917	1.0	D	0.81914	0.995	T	0.68588	-0.5369	10	0.72032	D	0.01	.	9.3594	0.38186	0.0:0.905:0.0:0.095	.	311	O43866	CD5L_HUMAN	Y	311	ENSP00000357156:D311Y	ENSP00000357156:D311Y	D	-	1	0	CD5L	156069714	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	3.695000	0.54749	2.615000	0.88500	0.655000	0.94253	GAT	.	.		0.582	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
PRG4	10216	hgsc.bcm.edu	37	1	186277296	186277296	+	Silent	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:186277296T>C	ENST00000445192.2	+	7	2490	c.2445T>C	c.(2443-2445)tcT>tcC	p.S815S	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367483.4_Silent_p.S774S|PRG4_ENST00000367485.4_Silent_p.S722S|PRG4_ENST00000367486.3_Silent_p.S772S	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	815	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CCACCACCTCTGACAAGCCTG	0.592																																					p.S815S		Atlas-SNP	.											PRG4,NS,carcinoma,0,1	PRG4	259	.	0			c.T2445C						.						216.0	243.0	234.0					1																	186277296		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon7			CACCTCTGACAAG	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.2445T>C	chr1.hg19:g.186277296T>C		130.0	1.0		163.0	67.0	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	hg19	CCDS1369.1																																																																																			.	.		0.592	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
CNTN2	6900	hgsc.bcm.edu	37	1	205027106	205027106	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:205027106C>T	ENST00000331830.4	+	3	412	c.128C>T	c.(127-129)cCc>cTc	p.P43L		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	43	Ig-like C2-type 1.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GAAGACCAGCCCCTCAGTGTG	0.627																																					p.P43L	Melanoma(183;2548 2817 37099 41192)	Atlas-SNP	.											.	CNTN2	116	.	0			c.C128T						.						48.0	46.0	47.0					1																	205027106		2203	4300	6503	SO:0001583	missense	6900	exon3			ACCAGCCCCTCAG	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.128C>T	chr1.hg19:g.205027106C>T	ENSP00000330633:p.Pro43Leu	213.0	0.0		181.0	54.0	NM_005076	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	hg19	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916184	0.73098	.	.	ENSG00000184144	ENST00000331830	T	0.44083	0.93	5.4	5.4	0.78164	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000061	T	0.65923	0.2738	M	0.74389	2.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69495	-0.5130	10	0.87932	D	0	.	16.9422	0.86221	0.0:1.0:0.0:0.0	.	43	Q02246	CNTN2_HUMAN	L	43	ENSP00000330633:P43L	ENSP00000330633:P43L	P	+	2	0	CNTN2	203293729	1.000000	0.71417	0.850000	0.33497	0.195000	0.23768	7.072000	0.76777	2.508000	0.84585	0.655000	0.94253	CCC	.	.		0.627	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
NUP133	55746	hgsc.bcm.edu	37	1	229631653	229631653	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:229631653T>C	ENST00000261396.3	-	7	1052	c.961A>G	c.(961-963)Acc>Gcc	p.T321A	NUP133_ENST00000537506.1_Missense_Mutation_p.T305A	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	321					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				ATAGCATCGGTAATGTTTTCC	0.328																																					p.T321A		Atlas-SNP	.											.	NUP133	111	.	0			c.A961G						.						120.0	121.0	120.0					1																	229631653		2203	4300	6503	SO:0001583	missense	55746	exon7			CATCGGTAATGTT		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.961A>G	chr1.hg19:g.229631653T>C	ENSP00000261396:p.Thr321Ala	33.0	0.0		28.0	9.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	hg19	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	T	8.283	0.815938	0.16607	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.40225	1.04;1.04;1.04	5.57	0.468	0.16732	WD40/YVTN repeat-like-containing domain (1);Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.434585	0.28322	N	0.015769	T	0.18257	0.0438	N	0.13043	0.29	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24012	-1.0172	10	0.08837	T	0.75	-27.3619	6.0272	0.19662	0.1233:0.3829:0.0:0.4937	.	321	Q8WUM0	NU133_HUMAN	A	321;321;321;305	ENSP00000261396:T321A;ENSP00000355640:T321A;ENSP00000443496:T305A	ENSP00000261396:T321A	T	-	1	0	NUP133	227698276	0.001000	0.12720	0.063000	0.19743	0.974000	0.67602	0.011000	0.13264	0.045000	0.15804	0.528000	0.53228	ACC	.	.		0.328	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
LGALS8	3964	hgsc.bcm.edu	37	1	236703931	236703931	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:236703931T>C	ENST00000366584.4	+	5	979	c.413T>C	c.(412-414)cTg>cCg	p.L138P	LGALS8_ENST00000341872.6_Missense_Mutation_p.L138P|LGALS8_ENST00000352231.2_Missense_Mutation_p.L138P|RP11-385F5.4_ENST00000433131.1_RNA|LGALS8_ENST00000526634.1_Missense_Mutation_p.L138P|LGALS8_ENST00000323938.6_Missense_Mutation_p.L111P|LGALS8_ENST00000526589.1_Missense_Mutation_p.L138P|LGALS8_ENST00000450372.2_Missense_Mutation_p.L138P|LGALS8_ENST00000527974.1_Missense_Mutation_p.L138P|LGALS8_ENST00000525042.1_Intron|LGALS8_ENST00000416919.2_Intron	NM_201544.2	NP_963838.1	O00214	LEG8_HUMAN	lectin, galactoside-binding, soluble, 8	138	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				plasma cell differentiation (GO:0002317)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(5)	20	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ATAGACACTCTGGGCATTTAT	0.478																																					p.L138P		Atlas-SNP	.											.	LGALS8	42	.	0			c.T413C						.						172.0	175.0	174.0					1																	236703931		2203	4300	6503	SO:0001583	missense	3964	exon6			ACACTCTGGGCAT	X91790	CCDS1611.1, CCDS1612.1	1q43	2011-08-04	2008-07-25		ENSG00000116977	ENSG00000116977		"""Lectins, galactoside-binding"""	6569	protein-coding gene	gene with protein product	"""galectin 8"""	606099				7852431, 8692978	Standard	NM_201545		Approved	PCTA-1	uc001hxy.2	O00214	OTTHUMG00000039953	ENST00000366584.4:c.413T>C	chr1.hg19:g.236703931T>C	ENSP00000355543:p.Leu138Pro	51.0	0.0		57.0	17.0	NM_006499	O15215|Q5T3P5|Q5T3Q4|Q8TEV1|Q96B92|Q9BXC8|Q9H584|Q9H585|Q9UEZ6|Q9UP32|Q9UP33|Q9UP34	Missense_Mutation	SNP	ENST00000366584.4	hg19	CCDS1612.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.462896	0.84425	.	.	ENSG00000116977	ENST00000454943;ENST00000527974;ENST00000352231;ENST00000406509;ENST00000526589;ENST00000341872;ENST00000450372;ENST00000366584;ENST00000356238;ENST00000323938;ENST00000526634	T;T;T;T;T;T;T;T;T;T	0.10573	2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86;2.86	5.46	5.46	0.80206	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.300108	0.32218	N	0.006418	T	0.48572	0.1507	H	0.96996	3.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.66728	-0.5850	10	0.87932	D	0	-3.484	15.7119	0.77635	0.0:0.0:0.0:1.0	.	138;138	O00214;O00214-2	LEG8_HUMAN;.	P	138;138;138;138;138;138;138;138;138;111;138	ENSP00000405504:L138P;ENSP00000431398:L138P;ENSP00000309576:L138P;ENSP00000385999:L138P;ENSP00000435460:L138P;ENSP00000342139:L138P;ENSP00000408657:L138P;ENSP00000355543:L138P;ENSP00000434860:L111P;ENSP00000437040:L138P	ENSP00000434860:L111P	L	+	2	0	LGALS8	234770554	1.000000	0.71417	0.994000	0.49952	0.959000	0.62525	7.340000	0.79292	2.291000	0.77112	0.533000	0.62120	CTG	.	.		0.478	LGALS8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000096365.2	NM_006499	
FOXN2	3344	hgsc.bcm.edu	37	2	48602270	48602270	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr2:48602270G>C	ENST00000340553.3	+	7	1245	c.984G>C	c.(982-984)gaG>gaC	p.E328D		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	328					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			CTGTGGATGAGGTATATGAAT	0.438																																					p.E328D		Atlas-SNP	.											.	FOXN2	39	.	0			c.G984C						.						123.0	106.0	112.0					2																	48602270		2203	4300	6503	SO:0001583	missense	3344	exon7			GGATGAGGTATAT		CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.984G>C	chr2.hg19:g.48602270G>C	ENSP00000343633:p.Glu328Asp	100.0	0.0		107.0	16.0	NM_002158	Q15769|Q6P4Q2	Missense_Mutation	SNP	ENST00000340553.3	hg19	CCDS1838.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400247	0.25291	.	.	ENSG00000170802	ENST00000304367;ENST00000340553	D	0.92647	-3.08	4.69	1.92	0.25849	.	0.165824	0.51477	D	0.000098	D	0.90092	0.6905	L	0.28344	0.845	0.40539	D	0.981003	D	0.63880	0.993	D	0.70016	0.967	D	0.84567	0.0653	10	0.13470	T	0.59	.	7.9389	0.29946	0.3965:0.0:0.6035:0.0	.	328	P32314	FOXN2_HUMAN	D	237;328	ENSP00000343633:E328D	ENSP00000305685:E237D	E	+	3	2	FOXN2	48455774	1.000000	0.71417	0.949000	0.38748	0.976000	0.68499	0.692000	0.25482	0.311000	0.23014	-0.145000	0.13849	GAG	.	.		0.438	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251240.3	NM_002158	
VPS54	51542	hgsc.bcm.edu	37	2	64208898	64208898	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr2:64208898G>T	ENST00000272322.4	-	3	414	c.260C>A	c.(259-261)tCt>tAt	p.S87Y	VPS54_ENST00000409558.4_Missense_Mutation_p.S75Y			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	87					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						GAAGAAGTCAGATTCTCTTTT	0.393																																					p.S87Y		Atlas-SNP	.											.	VPS54	57	.	0			c.C260A						.						245.0	224.0	231.0					2																	64208898		2203	4300	6503	SO:0001583	missense	51542	exon3			AAGTCAGATTCTC	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.260C>A	chr2.hg19:g.64208898G>T	ENSP00000272322:p.Ser87Tyr	142.0	0.0		101.0	41.0	NM_016516	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	ENST00000272322.4	hg19	CCDS33208.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018588	0.93404	.	.	ENSG00000143952	ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T	0.35236	1.32;1.32	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.62122	0.2402	M	0.71036	2.16	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.67548	0.915;0.952	T	0.60697	-0.7212	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	87;75	Q9P1Q0;Q9P1Q0-4	VPS54_HUMAN;.	Y	87;75;75;87	ENSP00000272322:S87Y;ENSP00000386980:S75Y	ENSP00000272322:S87Y	S	-	2	0	VPS54	64062402	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.564000	0.98151	2.937000	0.99478	0.650000	0.86243	TCT	.	.		0.393	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516	
MOGS	7841	hgsc.bcm.edu	37	2	74689306	74689306	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr2:74689306G>A	ENST00000233616.4	-	4	1772	c.1610C>T	c.(1609-1611)gCc>gTc	p.A537V	MOGS_ENST00000452063.2_Missense_Mutation_p.A431V|MOGS_ENST00000409065.1_3'UTR|MOGS_ENST00000462443.1_5'Flank	NM_006302.2	NP_006293.2	Q13724	MOGS_HUMAN	mannosyl-oligosaccharide glucosidase	537					cellular protein metabolic process (GO:0044267)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosidase activity (GO:0015926)|mannosyl-oligosaccharide glucosidase activity (GO:0004573)			cervix(1)|endometrium(6)|large_intestine(3)|lung(10)|prostate(1)|urinary_tract(2)	23						GCGGGGCAAGGCCTTTCGGAG	0.607																																					p.A537V		Atlas-SNP	.											.	MOGS	58	.	0			c.C1610T						.						75.0	82.0	80.0					2																	74689306		1986	4160	6146	SO:0001583	missense	7841	exon4			GGCAAGGCCTTTC	X87237	CCDS42700.1, CCDS54370.1	2p13.1	2012-01-31			ENSG00000115275	ENSG00000115275	3.2.1.106		24862	protein-coding gene	gene with protein product	"""glucosidase I"", ""processing A-glucosidase I"""	601336				7635146, 8786151	Standard	NM_006302		Approved	GCS1, CWH41, DER7	uc010ffj.3	Q13724	OTTHUMG00000152886	ENST00000233616.4:c.1610C>T	chr2.hg19:g.74689306G>A	ENSP00000233616:p.Ala537Val	137.0	0.0		119.0	32.0	NM_006302	A8K938|F5H6D0|Q17RN9|Q8TCT5	Missense_Mutation	SNP	ENST00000233616.4	hg19	CCDS42700.1	.	.	.	.	.	.	.	.	.	.	G	4.979	0.181823	0.09495	.	.	ENSG00000115275	ENST00000233616;ENST00000452063;ENST00000448666	T;T;T	0.38077	1.16;1.16;1.16	5.19	5.19	0.71726	Six-hairpin glycosidase-like (1);	0.320352	0.30630	N	0.009205	T	0.25044	0.0608	N	0.20807	0.61	0.80722	D	1	B	0.29612	0.251	B	0.29862	0.108	T	0.05484	-1.0882	10	0.15066	T	0.55	-15.8438	16.2431	0.82426	0.0:0.0:1.0:0.0	.	537	Q13724	MOGS_HUMAN	V	537;431;431	ENSP00000233616:A537V;ENSP00000388201:A431V;ENSP00000410992:A431V	ENSP00000233616:A537V	A	-	2	0	MOGS	74542814	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.399000	0.66314	2.710000	0.92621	0.655000	0.94253	GCC	.	.		0.607	MOGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328382.1	NM_006302	
BIN1	274	hgsc.bcm.edu	37	2	127808484	127808484	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr2:127808484G>T	ENST00000316724.5	-	17	1877	c.1466C>A	c.(1465-1467)tCt>tAt	p.S489Y	BIN1_ENST00000466111.1_5'UTR|BIN1_ENST00000393041.3_Missense_Mutation_p.S371Y|BIN1_ENST00000393040.3_Missense_Mutation_p.S378Y|BIN1_ENST00000346226.3_Missense_Mutation_p.S414Y|BIN1_ENST00000259238.4_Missense_Mutation_p.S393Y|BIN1_ENST00000376113.2_Missense_Mutation_p.S320Y|BIN1_ENST00000357970.3_Missense_Mutation_p.S446Y|BIN1_ENST00000348750.4_Missense_Mutation_p.S305Y|BIN1_ENST00000351659.3_Missense_Mutation_p.S402Y|BIN1_ENST00000409400.1_Missense_Mutation_p.S335Y|BIN1_ENST00000352848.3_Missense_Mutation_p.S350Y	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	489					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		AGCAGGAAGAGAGCTCTGGTG	0.662																																					p.S489Y		Atlas-SNP	.											.	BIN1	85	.	0			c.C1466A						.						49.0	51.0	51.0					2																	127808484		2203	4300	6503	SO:0001583	missense	274	exon17			GGAAGAGAGCTCT	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.1466C>A	chr2.hg19:g.127808484G>T	ENSP00000316779:p.Ser489Tyr	323.0	0.0		215.0	31.0	NM_139343	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Missense_Mutation	SNP	ENST00000316724.5	hg19	CCDS2138.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419808	0.83559	.	.	ENSG00000136717	ENST00000376113;ENST00000357970;ENST00000393040;ENST00000348750;ENST00000259238;ENST00000346226;ENST00000393041;ENST00000351659;ENST00000352848;ENST00000316724;ENST00000409400	T;T;T;T;T;T;T;T;T;T;T	0.65916	0.39;-0.18;0.35;0.38;0.37;0.39;0.32;0.32;0.36;-0.18;0.4	4.82	4.82	0.62117	.	0.216060	0.41001	D	0.000975	T	0.69450	0.3112	L	0.27053	0.805	0.38360	D	0.944577	D;P;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.997;0.94;0.999;0.999;0.997;0.997;0.988;0.994;0.999;0.997;0.998;0.997;0.995	P;P;D;D;D;D;D;P;D;D;D;D;D	0.91635	0.854;0.61;0.998;0.968;0.999;0.964;0.972;0.854;0.999;0.976;0.968;0.935;0.943	T	0.75513	-0.3291	10	0.72032	D	0.01	-22.7633	16.8717	0.86041	0.0:0.0:1.0:0.0	.	366;281;371;335;378;414;402;350;393;446;320;305;489	B7Z2Z2;B7Z6Y2;O00499-4;O00499-7;O00499-6;O00499-2;O00499-3;O00499-8;O00499-11;O00499-5;O00499-10;O00499-9;O00499	.;.;.;.;.;.;.;.;.;.;.;.;BIN1_HUMAN	Y	320;446;378;305;393;414;371;402;350;489;335	ENSP00000365281:S320Y;ENSP00000350654:S446Y;ENSP00000376760:S378Y;ENSP00000259237:S305Y;ENSP00000259238:S393Y;ENSP00000315411:S414Y;ENSP00000376761:S371Y;ENSP00000315388:S402Y;ENSP00000315284:S350Y;ENSP00000316779:S489Y;ENSP00000386797:S335Y	ENSP00000259238:S393Y	S	-	2	0	BIN1	127524954	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.561000	0.73955	2.506000	0.84524	0.555000	0.69702	TCT	.	.		0.662	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254298.2	NM_139343	
TMEFF2	23671	hgsc.bcm.edu	37	2	192820997	192820997	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr2:192820997G>A	ENST00000272771.5	-	8	2037	c.853C>T	c.(853-855)Cag>Tag	p.Q285*	TMEFF2_ENST00000392314.1_Nonsense_Mutation_p.Q285*|AC098617.1_ENST00000424116.2_RNA|AC098617.1_ENST00000428980.2_RNA	NM_016192.2	NP_057276.2	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 2	285	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|kidney(2)|large_intestine(4)|liver(1)|lung(12)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			GATGGCTCCTGCATATTGATA	0.353																																					p.Q285X	Pancreas(50;1277 1381 28487 47072)	Atlas-SNP	.											.	TMEFF2	54	.	0			c.C853T						.						127.0	111.0	116.0					2																	192820997		2202	4300	6502	SO:0001587	stop_gained	23671	exon8			GCTCCTGCATATT	AB017269	CCDS2314.1	2q32.3	2010-05-04			ENSG00000144339	ENSG00000144339			11867	protein-coding gene	gene with protein product	"""transmembrane protein TENB2"", ""tomoregulin"", ""cancer/testis antigen family 120, member 2"""	605734				10903839	Standard	NM_016192		Approved	TENB2, HPP1, TR, TPEF, CT120.2	uc002utc.3	Q9UIK5	OTTHUMG00000132723	ENST00000272771.5:c.853C>T	chr2.hg19:g.192820997G>A	ENSP00000272771:p.Gln285*	72.0	0.0		84.0	11.0	NM_016192	Q2FA44|Q4ZFW4|Q53H90|Q53RE1|Q8N2R5|Q9NR15|Q9NSS5|Q9P2Y9|Q9UK65	Nonsense_Mutation	SNP	ENST00000272771.5	hg19	CCDS2314.1	.	.	.	.	.	.	.	.	.	.	G	47	13.140383	0.99722	.	.	ENSG00000144339	ENST00000392314;ENST00000272771	.	.	.	4.55	4.55	0.56014	.	0.469460	0.22838	N	0.055005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-7.7253	17.8495	0.88740	0.0:0.0:1.0:0.0	.	.	.	.	X	285	.	ENSP00000272771:Q285X	Q	-	1	0	TMEFF2	192529242	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.180000	0.50895	2.499000	0.84300	0.491000	0.48974	CAG	.	.		0.353	TMEFF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256065.2	NM_016192	
MTMR14	64419	hgsc.bcm.edu	37	3	9739394	9739394	+	Splice_Site	SNP	G	G	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr3:9739394G>T	ENST00000296003.4	+	18	1735		c.e18-1		MTMR14_ENST00000420925.1_Intron|MTMR14_ENST00000351233.5_Intron|MTMR14_ENST00000353332.5_Intron	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14						phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)	p.?(1)		breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					CTCTGCCCCAGATCAGTGGAC	0.617																																					.		Atlas-SNP	.											MTMR14,NS,carcinoma,0,1	MTMR14	43	.	1	Unknown(1)	lung(1)	c.1614-1G>T						.						126.0	128.0	127.0					3																	9739394		1982	4176	6158	SO:0001630	splice_region_variant	64419	exon18			GCCCCAGATCAGT	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1614-1G>T	chr3.hg19:g.9739394G>T		50.0	0.0		57.0	29.0	NM_001077525	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Splice_Site	SNP	ENST00000296003.4	hg19	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.417945	0.83449	.	.	ENSG00000163719	ENST00000296003	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7013	0.96054	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTMR14	9714394	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.856000	0.75450	2.657000	0.90304	0.655000	0.94253	.	.	.		0.617	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	Intron
CLCN2	1181	hgsc.bcm.edu	37	3	184071474	184071474	+	Missense_Mutation	SNP	T	T	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr3:184071474T>A	ENST00000265593.4	-	16	2002	c.1831A>T	c.(1831-1833)Atg>Ttg	p.M611L	CLCN2_ENST00000475279.1_5'Flank|CLCN2_ENST00000434054.2_Missense_Mutation_p.M567L|CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000457512.1_Missense_Mutation_p.M611L|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000344937.7_Missense_Mutation_p.M594L	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	611	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	AGGGCCAGCATTCGGCCCTTG	0.657																																					p.M611L		Atlas-SNP	.											.	CLCN2	74	.	0			c.A1831T						.						38.0	37.0	37.0					3																	184071474		2202	4300	6502	SO:0001583	missense	1181	exon16			CCAGCATTCGGCC	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.1831A>T	chr3.hg19:g.184071474T>A	ENSP00000265593:p.Met611Leu	68.0	0.0		82.0	22.0	NM_004366	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	hg19	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	t	16.38	3.107384	0.56291	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.0	3.81	0.43845	Cystathionine beta-synthase, core (1);	0.387182	0.31709	N	0.007192	T	0.76364	0.3977	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B	0.16166	0.016;0.009;0.015;0.004;0.009	B;B;B;B;B	0.15052	0.005;0.005;0.012;0.005;0.005	T	0.69172	-0.5215	10	0.62326	D	0.03	-12.1521	5.9788	0.19395	0.1445:0.0793:0.0:0.7762	.	567;611;594;611;567	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	L	611;594;567;611	ENSP00000265593:M611L;ENSP00000345056:M594L;ENSP00000400425:M567L;ENSP00000391928:M611L	ENSP00000265593:M611L	M	-	1	0	CLCN2	185554168	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.305000	0.51873	0.734000	0.32515	0.460000	0.39030	ATG	.	.		0.657	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
SMCO1	255798	hgsc.bcm.edu	37	3	196242031	196242031	+	Splice_Site	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr3:196242031C>T	ENST00000397537.2	-	1	206	c.50G>A	c.(49-51)aGa>aAa	p.R17K		NM_001077657.1	NP_001071125.1	Q147U7	SMCO1_HUMAN	single-pass membrane protein with coiled-coil domains 1	17						integral component of membrane (GO:0016021)											CCTCAGCAACCTTTTCATTGC	0.408																																					p.R17K		Atlas-SNP	.											.	C3orf43	25	.	0			c.G50A						.						218.0	213.0	215.0					3																	196242031		1866	4107	5973	SO:0001630	splice_region_variant	255798	exon1			AGCAACCTTTTCA	AK123917	CCDS43192.1	3q29	2013-03-08	2013-03-08	2013-03-08	ENSG00000214097	ENSG00000214097			27407	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 43"""	C3orf43			Standard	NM_001077657		Approved	FLJ41923, DKFZp313B0440		Q147U7	OTTHUMG00000155581	ENST00000397537.2:c.50+1G>A	chr3.hg19:g.196242031C>T		62.0	0.0		65.0	24.0	NM_001077657	B3KW20	Missense_Mutation	SNP	ENST00000397537.2	hg19	CCDS43192.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851109	0.71719	.	.	ENSG00000214097	ENST00000397537	T	0.36340	1.26	5.09	5.09	0.68999	.	.	.	.	.	T	0.47116	0.1428	N	0.24115	0.695	0.37112	D	0.900407	D	0.76494	0.999	D	0.80764	0.994	T	0.57665	-0.7772	9	0.87932	D	0	-10.7046	16.279	0.82658	0.0:1.0:0.0:0.0	.	17	Q147U7	CC043_HUMAN	K	17	ENSP00000380671:R17K	ENSP00000380671:R17K	R	-	2	0	C3orf43	197726428	1.000000	0.71417	0.998000	0.56505	0.366000	0.29705	4.032000	0.57274	2.372000	0.80975	0.313000	0.20887	AGA	.	.		0.408	SMCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340776.1	NM_001006109	Missense_Mutation
PIGZ	80235	hgsc.bcm.edu	37	3	196674641	196674641	+	Missense_Mutation	SNP	A	A	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr3:196674641A>C	ENST00000412723.1	-	3	1273	c.1127T>G	c.(1126-1128)aTg>aGg	p.M376R		NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	376					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)			breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		GGCCAGAGGCATGAAGTAGAG	0.627																																					p.M376R		Atlas-SNP	.											.	PIGZ	34	.	0			c.T1127G						.						54.0	65.0	61.0					3																	196674641		2203	4300	6503	SO:0001583	missense	80235	exon3			AGAGGCATGAAGT	BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.1127T>G	chr3.hg19:g.196674641A>C	ENSP00000413405:p.Met376Arg	269.0	0.0		246.0	77.0	NM_025163	Q9H9G6	Missense_Mutation	SNP	ENST00000412723.1	hg19	CCDS3324.1	.	.	.	.	.	.	.	.	.	.	a	3.946	-0.013307	0.07727	.	.	ENSG00000119227	ENST00000412723	T	0.63096	-0.02	5.17	-10.3	0.00346	.	1.714580	0.03005	N	0.148641	T	0.53997	0.1831	L	0.43152	1.355	0.09310	N	0.999999	B	0.24768	0.111	B	0.26693	0.072	T	0.45542	-0.9254	10	0.39692	T	0.17	0.6406	16.9534	0.86251	0.7203:0.0:0.2797:0.0	.	376	Q86VD9	PIGZ_HUMAN	R	376	ENSP00000413405:M376R	ENSP00000413405:M376R	M	-	2	0	PIGZ	198159038	0.006000	0.16342	0.000000	0.03702	0.027000	0.11550	-0.189000	0.09629	-2.234000	0.00715	-1.325000	0.01285	ATG	.	.		0.627	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340486.2	NM_025163	
NFXL1	152518	hgsc.bcm.edu	37	4	47887522	47887522	+	Missense_Mutation	SNP	G	G	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr4:47887522G>T	ENST00000507489.1	-	14	1993	c.1817C>A	c.(1816-1818)aCt>aAt	p.T606N	NFXL1_ENST00000329043.3_Missense_Mutation_p.T606N|NFXL1_ENST00000381538.3_Missense_Mutation_p.T606N	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	606						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TACCCTGCCAGTCTGCTTTAT	0.398																																					p.T606N		Atlas-SNP	.											.	NFXL1	79	.	0			c.C1817A						.						146.0	141.0	143.0					4																	47887522		2203	4300	6503	SO:0001583	missense	152518	exon14			CTGCCAGTCTGCT	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.1817C>A	chr4.hg19:g.47887522G>T	ENSP00000422037:p.Thr606Asn	131.0	0.0		115.0	46.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	ENST00000507489.1	hg19	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	G	12.25	1.880432	0.33255	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.28666	1.6;1.6;1.6	5.66	5.66	0.87406	Zinc finger, NF-X1-type (1);	0.610086	0.16413	N	0.215518	T	0.30166	0.0756	L	0.53249	1.67	0.36092	D	0.843556	B	0.29253	0.239	B	0.28709	0.093	T	0.22034	-1.0228	10	0.17369	T	0.5	-2.7067	14.5822	0.68300	0.0:0.0:0.854:0.146	.	606	Q6ZNB6	NFXL1_HUMAN	N	606	ENSP00000370949:T606N;ENSP00000422037:T606N;ENSP00000333113:T606N	ENSP00000333113:T606N	T	-	2	0	NFXL1	47582279	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.461000	0.60115	2.663000	0.90544	0.555000	0.69702	ACT	.	.		0.398	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
PAICS	10606	hgsc.bcm.edu	37	4	57312864	57312864	+	Missense_Mutation	SNP	T	T	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr4:57312864T>G	ENST00000512576.1	+	3	379	c.218T>G	c.(217-219)aTt>aGt	p.I73S	PAICS_ENST00000514888.1_De_novo_Start_InFrame|PAICS_ENST00000399688.3_Missense_Mutation_p.I80S|PAICS_ENST00000264221.2_Missense_Mutation_p.I73S	NM_001079524.1	NP_001072992.1	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	73	SAICAR synthetase.				'de novo' IMP biosynthetic process (GO:0006189)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|phosphoribosylaminoimidazole carboxylase activity (GO:0004638)|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity (GO:0004639)			endometrium(1)|kidney(2)|large_intestine(1)|urinary_tract(1)	5	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	TATGTAGGTATTAAAACTGCC	0.363																																					p.I80S	GBM(53;429 1144 8755 40726)	Atlas-SNP	.											.	PAICS	21	.	0			c.T239G						.						30.0	28.0	29.0					4																	57312864		1830	4092	5922	SO:0001583	missense	10606	exon4			TAGGTATTAAAAC	X53793	CCDS47060.1, CCDS47061.1	4q12	2012-07-13			ENSG00000128050	ENSG00000128050	4.1.1.21, 6.3.2.6		8587	protein-coding gene	gene with protein product		172439		PAIS		2253271, 8106516	Standard	NM_006452		Approved	ADE2H1, AIRC	uc003hbt.1	P22234	OTTHUMG00000160957	ENST00000512576.1:c.218T>G	chr4.hg19:g.57312864T>G	ENSP00000421096:p.Ile73Ser	208.0	0.0		234.0	61.0	NM_001079525	E9PDH9|Q68CQ5	Missense_Mutation	SNP	ENST00000512576.1	hg19	CCDS47061.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.048076	0.75846	.	.	ENSG00000128050	ENST00000264221;ENST00000505164;ENST00000399688;ENST00000512576	T;T;T;T	0.55052	0.54;0.54;0.69;0.54	5.43	5.43	0.79202	.	0.046141	0.85682	D	0.000000	T	0.81079	0.4748	H	0.96239	3.79	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.72075	0.976;0.972;0.976	D	0.87427	0.2386	10	0.87932	D	0	-17.5636	15.7797	0.78249	0.0:0.0:0.0:1.0	.	73;80;73	E9PBS1;P22234-2;P22234	.;.;PUR6_HUMAN	S	73;73;80;73	ENSP00000264221:I73S;ENSP00000424053:I73S;ENSP00000382595:I80S;ENSP00000421096:I73S	ENSP00000264221:I73S	I	+	2	0	PAICS	57007621	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	7.901000	0.87382	2.195000	0.70347	0.477000	0.44152	ATT	.	.		0.363	PAICS-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363136.2	NM_006452	
SLC39A8	64116	hgsc.bcm.edu	37	4	103265762	103265762	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr4:103265762C>A	ENST00000394833.2	-	1	534	c.58G>T	c.(58-60)Gga>Tga	p.G20*	SLC39A8_ENST00000510255.1_Intron|SLC39A8_ENST00000356736.4_Nonsense_Mutation_p.G20*|SLC39A8_ENST00000424970.2_Nonsense_Mutation_p.G20*	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	20					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		TCCGCCACTCCTCCGAGGCCG	0.736																																					p.G20X		Atlas-SNP	.											.	SLC39A8	24	.	0			c.G58T						.						3.0	6.0	5.0					4																	103265762		1732	3670	5402	SO:0001587	stop_gained	64116	exon1			CCACTCCTCCGAG		CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.58G>T	chr4.hg19:g.103265762C>A	ENSP00000378310:p.Gly20*	115.0	0.0		128.0	40.0	NM_022154	B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Nonsense_Mutation	SNP	ENST00000394833.2	hg19	CCDS3656.1	.	.	.	.	.	.	.	.	.	.	C	39	7.442824	0.98286	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	.	.	.	3.87	0.948	0.19561	.	0.907354	0.09048	U	0.856272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-13.5435	5.995	0.19489	0.0:0.4967:0.3895:0.1138	.	.	.	.	X	20	.	ENSP00000349174:G20X	G	-	1	0	SLC39A8	103484785	0.003000	0.15002	0.179000	0.23059	0.808000	0.45660	0.071000	0.14594	0.274000	0.22072	0.491000	0.48974	GGA	.	.		0.736	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253798.1	NM_022154	
ANKRD50	57182	hgsc.bcm.edu	37	4	125592001	125592001	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr4:125592001C>T	ENST00000504087.1	-	4	3468	c.2431G>A	c.(2431-2433)Gat>Aat	p.D811N	ANKRD50_ENST00000515641.1_Missense_Mutation_p.D632N	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	811										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						CCTTCACTATCAATACTATCC	0.443																																					p.D811N		Atlas-SNP	.											.	ANKRD50	136	.	0			c.G2431A						.						141.0	129.0	133.0					4																	125592001		2203	4300	6503	SO:0001583	missense	57182	exon4			CACTATCAATACT	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.2431G>A	chr4.hg19:g.125592001C>T	ENSP00000425658:p.Asp811Asn	89.0	0.0		95.0	35.0	NM_020337	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	hg19	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279626	0.80692	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.17854	2.25;2.25	4.99	4.99	0.66335	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.42426	0.1202	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.22034	-1.0228	10	0.54805	T	0.06	.	18.4729	0.90781	0.0:1.0:0.0:0.0	.	811	Q9ULJ7	ANR50_HUMAN	N	811;632	ENSP00000425658:D811N;ENSP00000425355:D632N	ENSP00000425658:D811N	D	-	1	0	ANKRD50	125811451	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	7.164000	0.77533	2.606000	0.88127	0.561000	0.74099	GAT	.	.		0.443	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
INTU	27152	hgsc.bcm.edu	37	4	128625405	128625405	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr4:128625405G>C	ENST00000335251.6	+	10	1629	c.1526G>C	c.(1525-1527)aGg>aCg	p.R509T	INTU_ENST00000512995.1_3'UTR	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	509					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						TATGACATGAGGCGGCTGTAT	0.313																																					p.R509T		Atlas-SNP	.											.	INTU	92	.	0			c.G1526C						.						123.0	127.0	125.0					4																	128625405		2203	4300	6503	SO:0001583	missense	27152	exon10			ACATGAGGCGGCT	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1526G>C	chr4.hg19:g.128625405G>C	ENSP00000334003:p.Arg509Thr	74.0	0.0		80.0	18.0	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	hg19	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782416	0.90282	.	.	ENSG00000164066	ENST00000335251	T	0.30448	1.53	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.58061	0.2096	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61252	-0.7100	10	0.72032	D	0.01	-16.4587	18.4011	0.90516	0.0:0.0:1.0:0.0	.	509	Q9ULD6	PDZD6_HUMAN	T	509	ENSP00000334003:R509T	ENSP00000334003:R509T	R	+	2	0	INTU	128844855	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.131000	0.94446	2.672000	0.90937	0.555000	0.69702	AGG	.	.		0.313	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
ARHGAP10	79658	hgsc.bcm.edu	37	4	148787952	148787952	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr4:148787952G>A	ENST00000336498.3	+	7	926	c.687G>A	c.(685-687)caG>caA	p.Q229Q		NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		TGGAACTACAGATCAACATTC	0.333											OREG0016355	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q229Q		Atlas-SNP	.											.	ARHGAP10	92	.	0			c.G687A						.						109.0	102.0	105.0					4																	148787952		2203	4300	6503	SO:0001819	synonymous_variant	79658	exon7			ACTACAGATCAAC	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.687G>A	chr4.hg19:g.148787952G>A		218.0	0.0	1720	231.0	41.0	NM_024605	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Silent	SNP	ENST00000336498.3	hg19	CCDS34075.1																																																																																			.	.		0.333	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605	
TRIML1	339976	hgsc.bcm.edu	37	4	189061021	189061021	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr4:189061021G>A	ENST00000332517.3	+	1	449	c.309G>A	c.(307-309)aaG>aaA	p.K103K	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	103					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		CCACTGCCAAGGCGCTCTCCG	0.647																																					p.K103K	Melanoma(31;213 1036 16579 23968 32372)	Atlas-SNP	.											.	TRIML1	126	.	0			c.G309A						.						42.0	41.0	41.0					4																	189061021		2203	4300	6503	SO:0001819	synonymous_variant	339976	exon1			TGCCAAGGCGCTC	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.309G>A	chr4.hg19:g.189061021G>A		135.0	0.0		138.0	46.0	NM_178556	Q96BE5	Silent	SNP	ENST00000332517.3	hg19	CCDS3851.1																																																																																			.	.		0.647	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556	
PCDHA11	56138	hgsc.bcm.edu	37	5	140250310	140250310	+	Missense_Mutation	SNP	T	T	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr5:140250310T>G	ENST00000398640.2	+	1	1622	c.1622T>G	c.(1621-1623)gTg>gGg	p.V541G	PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	541	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATGCGGGCGTGCCGCCTCTG	0.687																																					p.V541G		Atlas-SNP	.											.	PCDHA11	209	.	0			c.T1622G						.						72.0	80.0	77.0					5																	140250310		2202	4298	6500	SO:0001583	missense	56138	exon1			CGGGCGTGCCGCC	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1622T>G	chr5.hg19:g.140250310T>G	ENSP00000381636:p.Val541Gly	75.0	0.0		88.0	28.0	NM_018902	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	hg19	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.754905	0.49362	.	.	ENSG00000249158	ENST00000398640	T	0.48836	0.8	5.15	5.15	0.70609	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.35566	0.0936	N	0.12611	0.24	0.38941	D	0.958148	P;P	0.42123	0.771;0.678	B;P	0.45794	0.211;0.493	T	0.32052	-0.9921	9	0.37606	T	0.19	.	11.5782	0.50877	0.0:0.0:0.1489:0.8511	.	541;541	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	G	541	ENSP00000381636:V541G	ENSP00000381636:V541G	V	+	2	0	PCDHA11	140230494	0.000000	0.05858	0.999000	0.59377	0.943000	0.58893	-0.427000	0.06999	1.942000	0.56320	0.454000	0.30748	GTG	.	.		0.687	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
RBM27	54439	hgsc.bcm.edu	37	5	145664265	145664265	+	Silent	SNP	T	T	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr5:145664265T>A	ENST00000265271.5	+	20	3235	c.3069T>A	c.(3067-3069)acT>acA	p.T1023T	RBM27_ENST00000506502.1_Intron	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	1023					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTATATCCACTGAGACTGAAG	0.353																																					p.T1023T		Atlas-SNP	.											.	RBM27	119	.	0			c.T3069A						.						91.0	87.0	88.0					5																	145664265		1568	3582	5150	SO:0001819	synonymous_variant	54439	exon20			ATCCACTGAGACT	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.3069T>A	chr5.hg19:g.145664265T>A		277.0	0.0		393.0	169.0	NM_018989	Q8IYW9	Silent	SNP	ENST00000265271.5	hg19	CCDS43378.1																																																																																			.	.		0.353	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	
KIF13A	63971	hgsc.bcm.edu	37	6	17837188	17837188	+	Missense_Mutation	SNP	T	T	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:17837188T>A	ENST00000259711.6	-	11	1181	c.1076A>T	c.(1075-1077)aAt>aTt	p.N359I	KIF13A_ENST00000378843.2_Missense_Mutation_p.N359I|KIF13A_ENST00000378816.5_Missense_Mutation_p.N359I|KIF13A_ENST00000378814.5_Missense_Mutation_p.N359I|KIF13A_ENST00000378826.2_Missense_Mutation_p.N359I	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	359					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GGGGTCCTCATTCACAACAGC	0.512																																					p.N359I		Atlas-SNP	.											.	KIF13A	276	.	0			c.A1076T						.						294.0	287.0	289.0					6																	17837188		1991	4170	6161	SO:0001583	missense	63971	exon11			TCCTCATTCACAA	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1076A>T	chr6.hg19:g.17837188T>A	ENSP00000259711:p.Asn359Ile	108.0	0.0		117.0	50.0	NM_001105567	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	hg19	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.873838	0.91664	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51	6.03	6.03	0.97812	Kinesin, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.95633	0.8580	M	0.93638	3.44	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;1.0;0.999	D	0.96637	0.9471	10	0.87932	D	0	.	16.5724	0.84622	0.0:0.0:0.0:1.0	.	330;359;359;359;359	E7ER65;Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;.;KI13A_HUMAN;.	I	359	ENSP00000368091:N359I;ENSP00000259711:N359I;ENSP00000368103:N359I;ENSP00000368120:N359I;ENSP00000368093:N359I	ENSP00000259711:N359I	N	-	2	0	KIF13A	17945167	1.000000	0.71417	0.995000	0.50966	0.908000	0.53690	7.997000	0.88414	2.313000	0.78055	0.455000	0.32223	AAT	.	.		0.512	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
HLA-DQA1	3117	hgsc.bcm.edu	37	6	32610000	32610000	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:32610000G>A	ENST00000343139.5	+	3	685	c.583G>A	c.(583-585)Ggc>Agc	p.G195S	HLA-DQA1_ENST00000374949.2_Missense_Mutation_p.G195S|HLA-DQA1_ENST00000395363.1_Missense_Mutation_p.G195S	NM_002122.3	NP_002113.2	P01909	DQA1_HUMAN	major histocompatibility complex, class II, DQ alpha 1	194	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			NS(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						GGAGCACTGGGGCCTGGACCA	0.458																																					p.G195S		Atlas-SNP	.											.	HLA-DQA1	52	.	0			c.G583A						.						94.0	99.0	97.0					6																	32610000		1507	2706	4213	SO:0001583	missense	3117	exon3			CACTGGGGCCTGG		CCDS4752.1	6p21.3	2013-01-11			ENSG00000196735	ENSG00000196735		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4942	protein-coding gene	gene with protein product		146880		HLA-DQA			Standard	NM_002122		Approved	CELIAC1	uc003obr.3	P01909	OTTHUMG00000031106	ENST00000343139.5:c.583G>A	chr6.hg19:g.32610000G>A	ENSP00000339398:p.Gly195Ser	261.0	0.0		245.0	111.0	NM_002122	O19630|O19706|P01907|P01908|P04225|P04226|P05536|P79553|Q06751|Q29876|Q29994|Q2Q6Y6|Q2Q6Y7|Q2Q6Y8|Q2WCM3|Q30064|Q30067|Q30068|Q30070|Q30071|Q30072|Q30073|Q30086|Q30101|Q5Y7D5|Q5Y7F5|Q6ICU6|Q6PR46|Q6QDB1|Q860W2|Q860W4|Q9BD37|Q9TPM3|Q9UM31	Missense_Mutation	SNP	ENST00000343139.5	hg19	CCDS4752.1	.	.	.	.	.	.	.	.	.	.	.	20.2	3.951973	0.73787	.	.	ENSG00000196735	ENST00000343139;ENST00000395364;ENST00000395363;ENST00000496318;ENST00000374949	T;T;T;T	0.02709	4.19;4.19;4.19;4.19	4.1	4.1	0.47936	.	0.234509	0.35615	N	0.003094	T	0.05502	0.0145	L	0.39692	1.235	0.40836	D	0.983632	D;P	0.89917	1.0;0.918	D;P	0.97110	1.0;0.797	T	0.38478	-0.9659	10	0.66056	D	0.02	.	14.2269	0.65866	0.0:0.0:1.0:0.0	.	201;195	Q59F33;G4XQK2	.;.	S	195	ENSP00000339398:G195S;ENSP00000378767:G195S;ENSP00000437302:G195S;ENSP00000364087:G195S	ENSP00000339398:G195S	G	+	1	0	HLA-DQA1	32717978	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.303000	0.59098	2.291000	0.77112	0.655000	0.94253	GGC	.	.		0.458	HLA-DQA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076176.3	NM_002122	
FRS3	10817	hgsc.bcm.edu	37	6	41740590	41740590	+	Missense_Mutation	SNP	G	G	T	rs545980178		TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:41740590G>T	ENST00000373018.3	-	5	612	c.361C>A	c.(361-363)Cgc>Agc	p.R121S	FRS3_ENST00000259748.2_Missense_Mutation_p.R121S	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	121					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)	p.R121C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGGCTATTGCGGGTGATGATG	0.547																																					p.R121S		Atlas-SNP	.											FRS3,colon,carcinoma,0,4	FRS3	53	.	1	Substitution - Missense(1)	ovary(1)	c.C361A						.						124.0	125.0	125.0					6																	41740590		2203	4300	6503	SO:0001583	missense	10817	exon5			TATTGCGGGTGAT	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.361C>A	chr6.hg19:g.41740590G>T	ENSP00000362109:p.Arg121Ser	76.0	0.0		76.0	4.0	NM_006653	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	hg19	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.589072	0.86851	.	.	ENSG00000137218	ENST00000373018;ENST00000259748;ENST00000426290	D;D	0.82433	-1.61;-1.61	5.46	3.49	0.39957	.	0.207707	0.33875	N	0.004468	D	0.83312	0.5227	M	0.68593	2.085	0.58432	D	0.999998	D	0.76494	0.999	D	0.85130	0.997	T	0.80200	-0.1481	10	0.08179	T	0.78	-37.7643	12.373	0.55265	0.0:0.0:0.6461:0.3539	.	121	O43559	FRS3_HUMAN	S	121;121;145	ENSP00000362109:R121S;ENSP00000259748:R121S	ENSP00000259748:R121S	R	-	1	0	FRS3	41848568	1.000000	0.71417	0.996000	0.52242	0.966000	0.64601	4.032000	0.57274	2.573000	0.86826	0.655000	0.94253	CGC	.	.		0.547	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653	
USP49	25862	hgsc.bcm.edu	37	6	41774615	41774615	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:41774615C>T	ENST00000394253.3	-	3	436	c.107G>A	c.(106-108)tGg>tAg	p.W36*	USP49_ENST00000373009.3_Nonsense_Mutation_p.W36*|USP49_ENST00000373006.1_Nonsense_Mutation_p.W36*|USP49_ENST00000373010.1_Nonsense_Mutation_p.W36*|USP49_ENST00000297229.2_Nonsense_Mutation_p.W36*			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	36					histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GAGGCAGGCCCACACGGACTC	0.602																																					p.W36X		Atlas-SNP	.											.	USP49	58	.	0			c.G107A						.						79.0	82.0	81.0					6																	41774615		2203	4300	6503	SO:0001587	stop_gained	25862	exon4			CAGGCCCACACGG	AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.107G>A	chr6.hg19:g.41774615C>T	ENSP00000377797:p.Trp36*	113.0	0.0		97.0	34.0	NM_018561	Q5T3D9|Q5T3E0|Q96CK4	Nonsense_Mutation	SNP	ENST00000394253.3	hg19		.	.	.	.	.	.	.	.	.	.	C	19.30	3.800986	0.70567	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229;ENST00000437061	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8314	18.203	0.89844	0.0:1.0:0.0:0.0	.	.	.	.	X	36	.	ENSP00000297229:W36X	W	-	2	0	USP49	41882593	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.272000	0.78516	2.624000	0.88883	0.655000	0.94253	TGG	.	.		0.602	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3	NM_018561	
TTBK1	84630	hgsc.bcm.edu	37	6	43222834	43222834	+	Silent	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:43222834C>T	ENST00000259750.4	+	7	707	c.624C>T	c.(622-624)gtC>gtT	p.V208V	TTBK1_ENST00000304139.5_Silent_p.V157V	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	208	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			ATGCCTCAGTCAATGCCCACA	0.632																																					p.V208V		Atlas-SNP	.											.	TTBK1	124	.	0			c.C624T						.						116.0	90.0	98.0					6																	43222834		2203	4300	6503	SO:0001819	synonymous_variant	84630	exon7			CTCAGTCAATGCC	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.624C>T	chr6.hg19:g.43222834C>T		86.0	0.0		107.0	14.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	hg19	CCDS34455.1																																																																																			.	.		0.632	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
AARS2	57505	hgsc.bcm.edu	37	6	44272421	44272421	+	Silent	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:44272421C>T	ENST00000244571.4	-	12	1715	c.1713G>A	c.(1711-1713)caG>caA	p.Q571Q	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGTCTGAAGCCTGGCCCCCCT	0.622											OREG0017473	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q571Q		Atlas-SNP	.											.	AARS2	77	.	0			c.G1713A						.						62.0	59.0	60.0					6																	44272421		2203	4300	6503	SO:0001819	synonymous_variant	57505	exon12			TGAAGCCTGGCCC	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1713G>A	chr6.hg19:g.44272421C>T		149.0	0.0	922	185.0	67.0	NM_020745		Silent	SNP	ENST00000244571.4	hg19	CCDS34464.1																																																																																			.	.		0.622	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
FAM46A	55603	hgsc.bcm.edu	37	6	82461742	82461742	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:82461742G>A	ENST00000320172.6	-	2	431	c.117C>T	c.(115-117)ggC>ggT	p.G39G	FAM46A_ENST00000369756.3_Silent_p.G120G|FAM46A_ENST00000369754.3_Silent_p.G58G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		cgaagtcgccgccgccgaagt	0.667																																					p.G39G		Atlas-SNP	.											.	FAM46A	37	.	0			c.C117T						.						7.0	8.0	8.0					6																	82461742		1601	3424	5025	SO:0001819	synonymous_variant	55603	exon2			GTCGCCGCCGCCG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117C>T	chr6.hg19:g.82461742G>A		53.0	0.0		70.0	9.0	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	hg19	CCDS34489.1																																																																																			.	.		0.667	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
ZBTB2	57621	hgsc.bcm.edu	37	6	151687782	151687782	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr6:151687782T>C	ENST00000325144.4	-	3	559	c.419A>G	c.(418-420)cAt>cGt	p.H140R		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		TCTCAACTGATGATCTGCAAT	0.537																																					p.H140R		Atlas-SNP	.											.	ZBTB2	30	.	0			c.A419G						.						102.0	96.0	98.0					6																	151687782		2203	4300	6503	SO:0001583	missense	57621	exon3			AACTGATGATCTG	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.419A>G	chr6.hg19:g.151687782T>C	ENSP00000323183:p.His140Arg	131.0	0.0		132.0	41.0	NM_020861	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	ENST00000325144.4	hg19	CCDS5231.1	.	.	.	.	.	.	.	.	.	.	T	8.118	0.780319	0.16120	.	.	ENSG00000181472	ENST00000325144	T	0.04758	3.56	5.76	4.58	0.56647	.	0.046141	0.85682	D	0.000000	T	0.01661	0.0053	N	0.24115	0.695	0.50632	D	0.999885	B	0.34015	0.435	B	0.30572	0.117	T	0.53982	-0.8361	10	0.52906	T	0.07	-36.1224	13.0429	0.58910	0.0:0.0:0.1346:0.8654	.	140	Q8N680	ZBTB2_HUMAN	R	140	ENSP00000323183:H140R	ENSP00000323183:H140R	H	-	2	0	ZBTB2	151729475	1.000000	0.71417	0.176000	0.23000	0.830000	0.47004	7.691000	0.84191	0.986000	0.38683	-0.313000	0.08912	CAT	.	.		0.537	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861	
THSD7A	221981	hgsc.bcm.edu	37	7	11416199	11416199	+	Silent	SNP	A	A	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr7:11416199A>T	ENST00000423059.4	-	27	5138	c.4887T>A	c.(4885-4887)gcT>gcA	p.A1629A	AC004538.3_ENST00000445839.1_RNA|AC004538.3_ENST00000599875.1_RNA|AC004538.3_ENST00000595972.1_RNA|AC004538.3_ENST00000428967.1_RNA|AC004538.3_ENST00000421121.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1629					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ACACTCACCAAGCTAGATAAA	0.358										HNSCC(18;0.044)																											p.A1629A		Atlas-SNP	.											.	THSD7A	219	.	0			c.T4887A						.						48.0	49.0	49.0					7																	11416199		1842	4082	5924	SO:0001819	synonymous_variant	221981	exon26			TCACCAAGCTAGA		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4887T>A	chr7.hg19:g.11416199A>T		35.0	0.0		71.0	24.0	NM_015204		Silent	SNP	ENST00000423059.4	hg19	CCDS47543.1																																																																																			.	.		0.358	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
CCT6A	908	hgsc.bcm.edu	37	7	56127966	56127966	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr7:56127966A>G	ENST00000275603.4	+	10	1289	c.1070A>G	c.(1069-1071)gAa>gGa	p.E357G	SNORA15_ENST00000384439.1_RNA|CCT6A_ENST00000540286.1_Missense_Mutation_p.E326G|CCT6A_ENST00000335503.3_Missense_Mutation_p.E312G	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)	357					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATAGGGAGAAGAGAAGTTT	0.353																																					p.E357G		Atlas-SNP	.											.	CCT6A	44	.	0			c.A1070G						.						67.0	64.0	65.0					7																	56127966		2203	4300	6503	SO:0001583	missense	908	exon10			AGGGAGAAGAGAA	M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.1070A>G	chr7.hg19:g.56127966A>G	ENSP00000275603:p.Glu357Gly	149.0	0.0		139.0	58.0	NM_001762	A6NCD2|Q3KP28|Q75LP4|Q96S46	Missense_Mutation	SNP	ENST00000275603.4	hg19	CCDS5523.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.409710	0.83340	.	.	ENSG00000146731	ENST00000275603;ENST00000335503;ENST00000540286;ENST00000539340	T;T;T	0.67523	-0.27;-0.27;-0.27	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.70815	0.3267	L	0.60957	1.885	0.80722	D	1	B;P;B	0.40731	0.286;0.728;0.127	P;B;B	0.48677	0.586;0.33;0.39	T	0.67337	-0.5696	10	0.23891	T	0.37	-26.5914	15.1098	0.72346	1.0:0.0:0.0:0.0	.	326;312;357	B4DPJ8;A6NCD2;P40227	.;.;TCPZ_HUMAN	G	357;312;326;215	ENSP00000275603:E357G;ENSP00000352019:E312G;ENSP00000438488:E326G	ENSP00000275603:E357G	E	+	2	0	CCT6A	56095460	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.561000	0.90715	2.162000	0.67917	0.482000	0.46254	GAA	.	.		0.353	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251526.2	NM_001762	
WBSCR22	114049	hgsc.bcm.edu	37	7	73097969	73097969	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr7:73097969G>C	ENST00000265758.2	+	1	72	c.14G>C	c.(13-15)gGc>gCc	p.G5A	WBSCR22_ENST00000423166.2_5'UTR|WBSCR22_ENST00000464615.1_Intron|WBSCR22_ENST00000423497.1_Missense_Mutation_p.G5A|DNAJC30_ENST00000395176.2_5'Flank	NM_017528.4	NP_059998.2	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	5					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|large_intestine(2)|lung(9)|prostate(1)	13		Lung NSC(55;0.0908)|all_lung(88;0.198)				GCGTCCCGCGGCCGGCGTCCG	0.667																																					p.G5A		Atlas-SNP	.											.	WBSCR22	27	.	0			c.G14C						.						11.0	14.0	13.0					7																	73097969		2193	4294	6487	SO:0001583	missense	114049	exon1			CCCGCGGCCGGCG	AF420248	CCDS5557.1, CCDS56490.1	7q11.23	2012-06-12			ENSG00000071462	ENSG00000071462			16405	protein-coding gene	gene with protein product	"""metastasis-related methyltransferase 1"""	615733				12073013, 11978965, 21148752	Standard	NM_001202560		Approved	MGC19709, MGC2022, MGC5140, PP3381, WBMT, MERM1	uc003tyt.3	O43709	OTTHUMG00000023306	ENST00000265758.2:c.14G>C	chr7.hg19:g.73097969G>C	ENSP00000265758:p.Gly5Ala	134.0	0.0		116.0	6.0	NM_001202560	A8K501|C9K060|Q96P12|Q9BQ58|Q9HBP9	Missense_Mutation	SNP	ENST00000265758.2	hg19	CCDS5557.1	.	.	.	.	.	.	.	.	.	.	G	0.100	-1.153666	0.01700	.	.	ENSG00000071462	ENST00000265758;ENST00000423497	T;T	0.39406	1.08;1.08	4.97	4.08	0.47627	.	0.549084	0.19896	N	0.103624	T	0.21267	0.0512	N	0.14661	0.345	0.28468	N	0.915572	B;B	0.16166	0.016;0.012	B;B	0.14023	0.007;0.01	T	0.19128	-1.0315	10	0.07813	T	0.8	-15.7673	8.4949	0.33121	0.0:0.1692:0.6555:0.1753	.	5;5	C9K060;O43709	.;WBS22_HUMAN	A	5	ENSP00000265758:G5A;ENSP00000401191:G5A	ENSP00000265758:G5A	G	+	2	0	WBSCR22	72735905	0.936000	0.31750	0.013000	0.15412	0.003000	0.03518	4.495000	0.60353	1.427000	0.47276	-0.302000	0.09304	GGC	.	.		0.667	WBSCR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252303.1		
TMEM130	222865	hgsc.bcm.edu	37	7	98445808	98445808	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr7:98445808G>A	ENST00000416379.2	-	8	1183	c.1179C>T	c.(1177-1179)gtC>gtT	p.V393V	TMEM130_ENST00000345589.4_Silent_p.V279V|TMEM130_ENST00000546258.1_Silent_p.V362V|TMEM130_ENST00000474857.1_5'Flank|TMEM130_ENST00000339375.4_Silent_p.V381V|TMEM130_ENST00000450876.1_Silent_p.V297V			Q8N3G9	TM130_HUMAN	transmembrane protein 130	393						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AGCAGCACCTGACCCCAGAGG	0.562																																					p.V393V		Atlas-SNP	.											.	TMEM130	54	.	0			c.C1179T						.						51.0	49.0	50.0					7																	98445808		2203	4300	6503	SO:0001819	synonymous_variant	222865	exon8			GCACCTGACCCCA		CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.1179C>T	chr7.hg19:g.98445808G>A		302.0	0.0		269.0	100.0	NM_001134450	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Silent	SNP	ENST00000416379.2	hg19	CCDS47650.1																																																																																			.	.		0.562	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913	
MUC17	140453	hgsc.bcm.edu	37	7	100679095	100679095	+	Silent	SNP	G	G	A	rs527976330	byFrequency	TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr7:100679095G>A	ENST00000306151.4	+	3	4462	c.4398G>A	c.(4396-4398)ccG>ccA	p.P1466P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1466	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCAACACGCCGGTGGCCAATT	0.478													A|||	23	0.00459265	0.0106	0.0014	5008	,	,		24214	0.005		0.001	False		,,,				2504	0.002				p.P1466P		Atlas-SNP	.											.	MUC17	804	.	0			c.G4398A						.						181.0	195.0	190.0					7																	100679095		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			CACGCCGGTGGCC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4398G>A	chr7.hg19:g.100679095G>A		78.0	0.0		82.0	27.0	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
ST18	9705	hgsc.bcm.edu	37	8	53074116	53074116	+	Silent	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr8:53074116C>T	ENST00000276480.7	-	14	2096	c.1413G>A	c.(1411-1413)gtG>gtA	p.V471V		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	471					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CAATTTGCTTCACCAAACTTG	0.408																																					p.V471V		Atlas-SNP	.											.	ST18	212	.	0			c.G1413A						.						109.0	102.0	104.0					8																	53074116		2203	4300	6503	SO:0001819	synonymous_variant	9705	exon14			TTGCTTCACCAAA	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1413G>A	chr8.hg19:g.53074116C>T		190.0	0.0		196.0	69.0	NM_014682	Q17RY1	Silent	SNP	ENST00000276480.7	hg19	CCDS6149.1																																																																																			.	.		0.408	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
KCNB2	9312	hgsc.bcm.edu	37	8	73848416	73848416	+	Missense_Mutation	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr8:73848416C>A	ENST00000523207.1	+	3	1414	c.826C>A	c.(826-828)Ccg>Acg	p.P276T		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	276					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GGCCATCTTGCCGTACTATGT	0.468																																					p.P276T		Atlas-SNP	.											.	KCNB2	228	.	0			c.C826A						.						133.0	126.0	128.0					8																	73848416		2203	4300	6503	SO:0001583	missense	9312	exon3			ATCTTGCCGTACT	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.826C>A	chr8.hg19:g.73848416C>A	ENSP00000430846:p.Pro276Thr	140.0	0.0		171.0	69.0	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	hg19	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.956102	0.92726	.	.	ENSG00000182674	ENST00000523207	D	0.98345	-4.88	5.74	5.74	0.90152	Ion transport (1);	0.000000	0.45126	D	0.000385	D	0.99477	0.9814	H	0.98466	4.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98119	1.0424	10	0.87932	D	0	.	19.91	0.97023	0.0:1.0:0.0:0.0	.	276	Q92953	KCNB2_HUMAN	T	276	ENSP00000430846:P276T	ENSP00000430846:P276T	P	+	1	0	KCNB2	74010970	1.000000	0.71417	0.967000	0.41034	0.979000	0.70002	7.818000	0.86416	2.702000	0.92279	0.655000	0.94253	CCG	.	.		0.468	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
TRPS1	7227	hgsc.bcm.edu	37	8	116616728	116616728	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr8:116616728T>C	ENST00000220888.5	-	3	1588	c.1429A>G	c.(1429-1431)Agg>Ggg	p.R477G	TRPS1_ENST00000519674.1_Missense_Mutation_p.R477G|TRPS1_ENST00000395715.3_Missense_Mutation_p.R490G|TRPS1_ENST00000519076.1_Intron|TRPS1_ENST00000520276.1_Missense_Mutation_p.R481G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	477					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ACAGAGCCCCTGGAAAGCTTA	0.453									Langer-Giedion syndrome																												p.R490G		Atlas-SNP	.											.	TRPS1	516	.	0			c.A1468G						.						65.0	63.0	63.0					8																	116616728		1896	4121	6017	SO:0001583	missense	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AGCCCCTGGAAAG	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1429A>G	chr8.hg19:g.116616728T>C	ENSP00000220888:p.Arg477Gly	92.0	0.0		85.0	25.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	T	15.55	2.867237	0.51588	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674	D;D;D;T	0.98822	-5.16;-5.13;-5.13;0.66	5.6	1.7	0.24286	.	0.053759	0.64402	D	0.000001	D	0.97745	0.9260	N	0.19112	0.55	0.41707	D	0.989439	D;D;D	0.61080	0.989;0.981;0.989	D;D;D	0.75020	0.985;0.966;0.985	D	0.96955	0.9697	10	0.87932	D	0	.	13.4229	0.61009	0.0:0.0:0.3737:0.6263	.	481;477;490	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	G	490;477;481;477	ENSP00000379065:R490G;ENSP00000220888:R477G;ENSP00000428680:R481G;ENSP00000429174:R477G	ENSP00000220888:R477G	R	-	1	2	TRPS1	116685903	1.000000	0.71417	0.994000	0.49952	0.921000	0.55340	1.895000	0.39778	0.107000	0.17824	-0.435000	0.05868	AGG	.	.		0.453	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
PTPRD	5789	hgsc.bcm.edu	37	9	8500869	8500869	+	Missense_Mutation	SNP	T	T	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr9:8500869T>G	ENST00000381196.4	-	21	2556	c.2013A>C	c.(2011-2013)aaA>aaC	p.K671N	PTPRD_ENST00000358503.5_Missense_Mutation_p.K658N|PTPRD_ENST00000486161.1_Intron|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000356435.5_Missense_Mutation_p.K671N|PTPRD_ENST00000360074.4_Missense_Mutation_p.K658N|PTPRD_ENST00000471274.1_5'UTR|PTPRD_ENST00000397606.3_Intron|PTPRD_ENST00000540109.1_Missense_Mutation_p.K671N|PTPRD_ENST00000355233.5_Intron|PTPRD_ENST00000397611.3_Intron|PTPRD_ENST00000397617.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	671	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CCAAAAGGTATTTGGTAGTGT	0.478										TSP Lung(15;0.13)																											p.K671N		Atlas-SNP	.											.	PTPRD	1348	.	0			c.A2013C						.						236.0	223.0	228.0					9																	8500869		2203	4300	6503	SO:0001583	missense	5789	exon24			AAGGTATTTGGTA	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.2013A>C	chr9.hg19:g.8500869T>G	ENSP00000370593:p.Lys671Asn	195.0	0.0		127.0	63.0	NM_002839	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	hg19	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.092206	0.36952	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000540109	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.64	-1.98	0.07480	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.220732	0.48286	D	0.000194	T	0.23886	0.0578	N	0.02011	-0.69	0.36524	D	0.8703	B;B;B	0.26081	0.141;0.033;0.045	B;B;B	0.33121	0.133;0.025;0.158	T	0.13202	-1.0518	9	.	.	.	.	13.0381	0.58882	0.0:0.7342:0.0:0.2658	.	658;671;671	G3XAE2;Q2HXI4;P23468	.;.;PTPRD_HUMAN	N	671;671;658;658;671	ENSP00000370593:K671N;ENSP00000348812:K671N;ENSP00000353187:K658N;ENSP00000351293:K658N;ENSP00000438164:K671N	.	K	-	3	2	PTPRD	8490869	0.255000	0.24002	0.977000	0.42913	0.996000	0.88848	-0.230000	0.09083	-0.418000	0.07450	0.459000	0.35465	AAA	.	.		0.478	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
BNC2	54796	hgsc.bcm.edu	37	9	16436852	16436852	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr9:16436852C>T	ENST00000380672.4	-	6	1397	c.1340G>A	c.(1339-1341)gGg>gAg	p.G447E	BNC2_ENST00000545497.1_Missense_Mutation_p.G352E|BNC2_ENST00000380667.2_Missense_Mutation_p.G380E|BNC2_ENST00000380666.2_Missense_Mutation_p.G447E	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		GAATGTCTTCCCACATGCATT	0.423																																					p.G447E		Atlas-SNP	.											.	BNC2	166	.	0			c.G1340A						.						107.0	99.0	102.0					9																	16436852		2203	4300	6503	SO:0001583	missense	54796	exon6			GTCTTCCCACATG	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.1340G>A	chr9.hg19:g.16436852C>T	ENSP00000370047:p.Gly447Glu	80.0	0.0		69.0	38.0	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	hg19	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827916	0.32329	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.34250	0.0891	L	0.33093	0.98	0.80722	D	1	P;D;D;B;D;D;D;D;D	0.89917	0.51;1.0;1.0;0.08;1.0;1.0;1.0;1.0;1.0	B;D;D;B;D;D;D;D;D	0.97110	0.147;0.997;1.0;0.086;0.999;0.999;0.993;0.997;1.0	T	0.01591	-1.1317	10	0.02654	T	1	-19.5438	20.8794	0.99867	0.0:1.0:0.0:0.0	.	352;380;447;273;447;404;447;352;212	F5H586;B1APH0;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;BNC2_HUMAN;.;.	E	447;404;380;352;273;447;447	ENSP00000370047:G447E;ENSP00000408370:G404E;ENSP00000370042:G380E;ENSP00000444640:G352E;ENSP00000370041:G447E	ENSP00000370041:G447E	G	-	2	0	BNC2	16426852	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	4.968000	0.63728	2.941000	0.99782	0.655000	0.94253	GGG	.	.		0.423	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
MTAP	4507	hgsc.bcm.edu	37	9	21837985	21837985	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr9:21837985G>C	ENST00000460874.2	+	5	702	c.477G>C	c.(475-477)gaG>gaC	p.E159D	RP11-145E5.5_ENST00000404796.2_Intron|MTAP_ENST00000380172.4_Missense_Mutation_p.E142D|MTAP_ENST00000580900.1_Missense_Mutation_p.E142D					methylthioadenosine phosphorylase									p.0(1)|p.E142E(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		CAATGGCTGAGCCGTTTTGCC	0.458																																					p.E142D		Atlas-SNP	.											MTAP,NS,carcinoma,0,1	MTAP	23	.	3	Whole gene deletion(2)|Substitution - coding silent(1)	lung(2)|endometrium(1)	c.G426C						.						249.0	249.0	249.0					9																	21837985		2203	4300	6503	SO:0001583	missense	4507	exon5			GGCTGAGCCGTTT	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.477G>C	chr9.hg19:g.21837985G>C	ENSP00000461932:p.Glu159Asp	110.0	0.0		67.0	33.0	NM_002451		Missense_Mutation	SNP	ENST00000460874.2	hg19		.	.	.	.	.	.	.	.	.	.	G	12.89	2.074830	0.36566	.	.	ENSG00000099810	ENST00000380172	D	0.86865	-2.18	5.54	-1.69	0.08186	Nucleoside phosphorylase domain (1);	0.050401	0.85682	N	0.000000	T	0.70281	0.3206	L	0.27944	0.81	0.54753	D	0.999985	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.58154	-0.7686	10	0.02654	T	1	-15.3699	7.2062	0.25909	0.6104:0.1375:0.2521:0.0	.	159;142	B4DUC8;Q13126	.;MTAP_HUMAN	D	142	ENSP00000369519:E142D	ENSP00000369519:E142D	E	+	3	2	MTAP	21827985	0.999000	0.42202	0.607000	0.28956	0.990000	0.78478	0.391000	0.20784	-0.382000	0.07870	0.655000	0.94253	GAG	.	.		0.458	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000051929.2	NM_002451	
SLC28A3	64078	hgsc.bcm.edu	37	9	86894924	86894924	+	Silent	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr9:86894924C>T	ENST00000376238.4	-	16	1843	c.1794G>A	c.(1792-1794)ggG>ggA	p.G598G	SLC28A3_ENST00000537648.1_Silent_p.G529G|RP11-380F14.2_ENST00000419815.1_RNA	NM_001199633.1|NM_022127.2	NP_001186562.1|NP_071410.1	Q9HAS3	S28A3_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 3	598					pyrimidine nucleoside transport (GO:0015864)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|purine-specific nucleoside:sodium symporter activity (GO:0015390)|pyrimidine- and adenine-specific:sodium symporter activity (GO:0015389)			endometrium(2)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31					Adenosine(DB00640)|Cladribine(DB00242)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Ribavirin(DB00811)	AGGCCACGGTCCCCGCAATCA	0.572																																					p.G598G	Ovarian(106;425 1539 34835 42413 43572)	Atlas-SNP	.											.	SLC28A3	72	.	0			c.G1794A						.						87.0	72.0	77.0					9																	86894924		2203	4300	6503	SO:0001819	synonymous_variant	64078	exon16			CACGGTCCCCGCA	AF305210	CCDS6670.1	9q21.33	2013-07-17	2013-07-17		ENSG00000197506	ENSG00000197506		"""Solute carriers"""	16484	protein-coding gene	gene with protein product		608269	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 3"""			11032837	Standard	NM_001199633		Approved	CNT3	uc010mpz.3	Q9HAS3	OTTHUMG00000020117	ENST00000376238.4:c.1794G>A	chr9.hg19:g.86894924C>T		39.0	0.0		40.0	18.0	NM_001199633	A8K9Y4|B1AML0|B2RA51|B4E2S8|F5GYE3	Silent	SNP	ENST00000376238.4	hg19	CCDS6670.1																																																																																			.	.		0.572	SLC28A3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052874.1	NM_022127	
CUBN	8029	hgsc.bcm.edu	37	10	16979768	16979768	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr10:16979768T>C	ENST00000377833.4	-	39	5814	c.5749A>G	c.(5749-5751)Agc>Ggc	p.S1917G		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1917	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCGTGAATGCTAGGCCCATCA	0.343																																					p.S1917G		Atlas-SNP	.											.	CUBN	515	.	0			c.A5749G						.						56.0	59.0	58.0					10																	16979768		2203	4300	6503	SO:0001583	missense	8029	exon39			GAATGCTAGGCCC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5749A>G	chr10.hg19:g.16979768T>C	ENSP00000367064:p.Ser1917Gly	68.0	0.0		63.0	11.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	0.079	-1.187462	0.01620	.	.	ENSG00000107611	ENST00000377833	T	0.36699	1.24	5.14	1.71	0.24356	CUB (5);	0.865227	0.09619	N	0.777837	T	0.23766	0.0575	L	0.35341	1.055	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.30995	-0.9959	10	0.13108	T	0.6	.	6.6094	0.22743	0.0:0.526:0.0:0.474	.	1917	O60494	CUBN_HUMAN	G	1917	ENSP00000367064:S1917G	ENSP00000367064:S1917G	S	-	1	0	CUBN	17019774	0.002000	0.14202	0.012000	0.15200	0.078000	0.17371	1.214000	0.32419	0.636000	0.30508	-0.462000	0.05337	AGC	.	.		0.343	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
MYO3A	53904	hgsc.bcm.edu	37	10	26432443	26432443	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr10:26432443G>C	ENST00000265944.5	+	21	2495	c.2329G>C	c.(2329-2331)Gat>Cat	p.D777H	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	777	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D777Y(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GCCCCTCTTAGATATGTTTCT	0.373																																					p.D777H		Atlas-SNP	.											MYO3A,NS,carcinoma,0,1	MYO3A	371	.	1	Substitution - Missense(1)	kidney(1)	c.G2329C						.						146.0	143.0	144.0					10																	26432443		2203	4300	6503	SO:0001583	missense	53904	exon21			CTCTTAGATATGT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2329G>C	chr10.hg19:g.26432443G>C	ENSP00000265944:p.Asp777His	133.0	0.0		137.0	13.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277643	0.80692	.	.	ENSG00000095777	ENST00000265944	D	0.90444	-2.67	6.02	5.12	0.69794	Myosin head, motor domain (3);	0.134780	0.64402	D	0.000004	D	0.96377	0.8818	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97317	0.9941	10	0.87932	D	0	.	15.5933	0.76558	0.0656:0.0:0.9344:0.0	.	777	Q8NEV4	MYO3A_HUMAN	H	777	ENSP00000265944:D777H	ENSP00000265944:D777H	D	+	1	0	MYO3A	26472449	1.000000	0.71417	0.999000	0.59377	0.928000	0.56348	9.869000	0.99810	1.570000	0.49709	-0.127000	0.14921	GAT	.	.		0.373	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
TSPAN15	23555	hgsc.bcm.edu	37	10	71244958	71244958	+	Missense_Mutation	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr10:71244958C>A	ENST00000373290.2	+	3	466	c.344C>A	c.(343-345)aCc>aAc	p.T115N		NM_012339.3	NP_036471.1	O95858	TSN15_HUMAN	tetraspanin 15	115					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	9						GTGGCCTTGACCTTCCGGAAC	0.552																																					p.T115N		Atlas-SNP	.											.	TSPAN15	22	.	0			c.C344A						.						277.0	209.0	232.0					10																	71244958		2203	4300	6503	SO:0001583	missense	23555	exon3			CCTTGACCTTCCG	AY358934	CCDS7294.1	10q22.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000099282	ENSG00000099282		"""Tetraspanins"""	23298	protein-coding gene	gene with protein product		613140	"""transmembrane 4 superfamily member 15"""	TM4SF15		11739647, 10719184	Standard	NM_012339		Approved	NET-7	uc001jpo.1	O95858	OTTHUMG00000018381	ENST00000373290.2:c.344C>A	chr10.hg19:g.71244958C>A	ENSP00000362387:p.Thr115Asn	142.0	0.0		189.0	8.0	NM_012339	Q6UW79	Missense_Mutation	SNP	ENST00000373290.2	hg19	CCDS7294.1	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786716	0.31593	.	.	ENSG00000099282	ENST00000373290;ENST00000452130	T;T	0.79352	-1.26;-1.26	5.04	1.2	0.21068	Tetraspanin, EC2 domain (1);	0.354234	0.29266	N	0.012645	T	0.67496	0.2899	L	0.38175	1.15	0.22240	N	0.999265	B	0.26876	0.162	B	0.31495	0.131	T	0.61855	-0.6977	10	0.87932	D	0	-22.0167	9.3633	0.38208	0.0:0.1995:0.0:0.8005	.	115	O95858	TSN15_HUMAN	N	115;24	ENSP00000362387:T115N;ENSP00000404528:T24N	ENSP00000362387:T115N	T	+	2	0	TSPAN15	70914964	0.996000	0.38824	1.000000	0.80357	0.792000	0.44763	0.292000	0.19011	0.266000	0.21894	-1.012000	0.02466	ACC	.	.		0.552	TSPAN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048444.1	NM_012339	
ENO4	387712	hgsc.bcm.edu	37	10	118609206	118609206	+	Silent	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr10:118609206C>T	ENST00000409522.1	+	1	184	c.129C>T	c.(127-129)acC>acT	p.T43T	ENO4_ENST00000341276.5_Silent_p.T43T|RP11-539I5.1_ENST00000434227.1_RNA|RP11-539I5.1_ENST00000453491.1_RNA			A6NNW6	ENO4_HUMAN	enolase family member 4	43					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						TCAACTCCACCTTCTACCTCC	0.662																																					p.T43T		Atlas-SNP	.											.	ENO4	1	.	0			c.C129T						.																																			SO:0001819	synonymous_variant	387712	exon1			CTCCACCTTCTAC		CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000409522.1:c.129C>T	chr10.hg19:g.118609206C>T		203.0	0.0		197.0	68.0	NM_001242699	B8ZZN9	Silent	SNP	ENST00000409522.1	hg19																																																																																				.	.		0.662	ENO4-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331643.1	NM_001242699	
EBF3	253738	hgsc.bcm.edu	37	10	131761727	131761727	+	Silent	SNP	G	G	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr10:131761727G>T	ENST00000355311.5	-	2	267	c.195C>A	c.(193-195)tcC>tcA	p.S65S	EBF3_ENST00000368648.3_Silent_p.S65S			Q9H4W6	COE3_HUMAN	early B-cell factor 3	65	Interaction with DNA. {ECO:0000250}.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		GGAAGAAATTGGATTTCCGGA	0.607																																					p.S65S		Atlas-SNP	.											.	EBF3	193	.	0			c.C195A						.						54.0	59.0	58.0					10																	131761727		2203	4300	6503	SO:0001819	synonymous_variant	253738	exon2			GAAATTGGATTTC		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.195C>A	chr10.hg19:g.131761727G>T		74.0	0.0		78.0	28.0	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	ENST00000355311.5	hg19																																																																																				.	.		0.607	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
TOLLIP	54472	hgsc.bcm.edu	37	11	1309926	1309926	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:1309926G>A	ENST00000317204.6	-	4	570	c.447C>T	c.(445-447)gaC>gaT	p.D149D	TOLLIP_ENST00000528719.1_5'UTR|TOLLIP_ENST00000525159.1_Silent_p.D88D|TOLLIP_ENST00000527886.1_Silent_p.D80D|TOLLIP_ENST00000263646.7_Silent_p.D121D|TOLLIP_ENST00000542915.1_Silent_p.D99D|TOLLIP_ENST00000527938.1_Intron	NM_019009.3	NP_061882.2	Q9H0E2	TOLIP_HUMAN	toll interacting protein	149					autophagy (GO:0006914)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte activation (GO:0045321)|phosphorylation (GO:0016310)|positive regulation of protein sumoylation (GO:0033235)|protein localization to endosome (GO:0036010)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|interleukin-1 receptor complex (GO:0045323)|interleukin-18 receptor complex (GO:0045092)|nuclear body (GO:0016604)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|signal transducer activity (GO:0004871)|Toll-like receptor binding (GO:0035325)			large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	6		all_cancers(49;7.62e-05)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00152)|Lung(200;0.09)|LUSC - Lung squamous cell carcinoma(625;0.107)		TGTACCACTTGTCCTCCACCT	0.647																																					p.D149D		Atlas-SNP	.											.	TOLLIP	25	.	0			c.C447T						.						177.0	101.0	127.0					11																	1309926		2202	4298	6500	SO:0001819	synonymous_variant	54472	exon4			CCACTTGTCCTCC	AJ242972	CCDS7723.1	11p	2008-02-05			ENSG00000078902	ENSG00000078902			16476	protein-coding gene	gene with protein product		606277				9426216, 10854325	Standard	NM_019009		Approved	IL-1RAcPIP	uc001lte.3	Q9H0E2	OTTHUMG00000133333	ENST00000317204.6:c.447C>T	chr11.hg19:g.1309926G>A		89.0	0.0		72.0	26.0	NM_019009	B3KXC6|Q9H9E6|Q9UJ69	Silent	SNP	ENST00000317204.6	hg19	CCDS7723.1																																																																																			.	.		0.647	TOLLIP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000257162.2	NM_019009	
OR52E4	390081	hgsc.bcm.edu	37	11	5905748	5905748	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:5905748T>C	ENST00000316987.2	+	1	248	c.226T>C	c.(226-228)Tcc>Ccc	p.S76P		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTGGGTCTGTCCACATCCAC	0.438																																					p.S76P		Atlas-SNP	.											.	OR52E4	65	.	0			c.T226C						.						164.0	139.0	148.0					11																	5905748		2201	4296	6497	SO:0001583	missense	390081	exon1			GGTCTGTCCACAT	AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.226T>C	chr11.hg19:g.5905748T>C	ENSP00000321426:p.Ser76Pro	73.0	0.0		63.0	13.0	NM_001005165	Q6IFG0	Missense_Mutation	SNP	ENST00000316987.2	hg19	CCDS31401.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.966462	0.53507	.	.	ENSG00000180974	ENST00000316987	T	0.00832	5.64	5.04	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000153	T	0.06371	0.0164	M	0.90082	3.085	0.09310	N	1	D	0.69078	0.997	D	0.70227	0.968	T	0.07271	-1.0781	10	0.87932	D	0	.	10.488	0.44733	0.0:0.0:0.1627:0.8373	.	76	Q8NGH9	O52E4_HUMAN	P	76	ENSP00000321426:S76P	ENSP00000321426:S76P	S	+	1	0	OR52E4	5862324	0.000000	0.05858	0.887000	0.34795	0.997000	0.91878	-0.252000	0.08806	2.106000	0.64143	0.523000	0.50628	TCC	.	.		0.438	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401146.1	NM_001005165	
DKK3	27122	hgsc.bcm.edu	37	11	11990020	11990020	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:11990020G>A	ENST00000396505.2	-	5	688	c.450C>T	c.(448-450)gaC>gaT	p.D150D	DKK3_ENST00000525493.1_Silent_p.D150D|DKK3_ENST00000450094.2_Silent_p.D122D|DKK3_ENST00000326932.4_Silent_p.D150D|DKK3_ENST00000527132.1_Intron	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	150	DKK-type Cys-1.				adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		CACAGTCCTCGTCGATGATGC	0.632																																					p.D150D		Atlas-SNP	.											.	DKK3	35	.	0			c.C450T						.						89.0	75.0	79.0					11																	11990020		2201	4294	6495	SO:0001819	synonymous_variant	27122	exon4			GTCCTCGTCGATG	AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.450C>T	chr11.hg19:g.11990020G>A		71.0	0.0		66.0	19.0	NM_001018057	A8K1I2|D3DQW1|Q9ULB7	Silent	SNP	ENST00000396505.2	hg19	CCDS7808.1																																																																																			.	.		0.632	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385863.1	NM_013253	
IGSF22	283284	hgsc.bcm.edu	37	11	18733863	18733863	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:18733863A>G	ENST00000513874.1	-	15	2303	c.2164T>C	c.(2164-2166)Tgg>Cgg	p.W722R	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	721	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						GGGGCCTTCCACTTCATGTGC	0.557																																					p.W722R		Atlas-SNP	.											.	IGSF22	211	.	0			c.T2164C						.						96.0	82.0	86.0					11																	18733863		692	1591	2283	SO:0001583	missense	283284	exon15			CCTTCCACTTCAT	AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2164T>C	chr11.hg19:g.18733863A>G	ENSP00000421191:p.Trp722Arg	188.0	0.0		180.0	54.0	NM_173588	A6NNA0|D6RGV7	Missense_Mutation	SNP	ENST00000513874.1	hg19	CCDS41625.2	.	.	.	.	.	.	.	.	.	.	a	14.49	2.550306	0.45383	.	.	ENSG00000179057	ENST00000513874	D	0.91011	-2.77	4.24	3.12	0.35913	.	.	.	.	.	D	0.93177	0.7827	H	0.98155	4.16	0.31692	N	0.64175	B	0.34161	0.439	B	0.33196	0.159	D	0.92150	0.5727	9	0.59425	D	0.04	.	7.9731	0.30138	0.9039:0.0:0.0961:0.0	.	722	D6RGV7	.	R	722	ENSP00000421191:W722R	ENSP00000421191:W722R	W	-	1	0	IGSF22	18690439	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.410000	0.66381	0.696000	0.31696	0.524000	0.50904	TGG	.	.		0.557	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360850.2	NM_173588	
BTBD18	643376	hgsc.bcm.edu	37	11	57513122	57513122	+	Missense_Mutation	SNP	T	T	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:57513122T>G	ENST00000436147.3	-	2	810	c.623A>C	c.(622-624)aAg>aCg	p.K208T	RP11-691N7.6_ENST00000531074.1_Intron|BTBD18_ENST00000422652.1_Missense_Mutation_p.K208T|TMX2-CTNND1_ENST00000528395.1_Intron			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18	208										endometrium(3)|kidney(1)	4						GGCCTTCCTCTTGAGCAGAAG	0.493																																					p.K208T		Atlas-SNP	.											.	BTBD18	26	.	0			c.A623C						.						117.0	88.0	97.0					11																	57513122		692	1591	2283	SO:0001583	missense	643376	exon3			TTCCTCTTGAGCA		CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203	ENST00000436147.3:c.623A>C	chr11.hg19:g.57513122T>G	ENSP00000397020:p.Lys208Thr	99.0	0.0		128.0	47.0	NM_001145101		Missense_Mutation	SNP	ENST00000436147.3	hg19	CCDS44603.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962662	0.53507	.	.	ENSG00000233436	ENST00000422652;ENST00000436147	T;T	0.80909	-1.43;-1.43	4.67	4.67	0.58626	.	.	.	.	.	T	0.76601	0.4010	L	0.27053	0.805	0.22835	N	0.998679	D	0.58620	0.983	P	0.53401	0.725	T	0.67280	-0.5710	9	0.72032	D	0.01	.	7.0843	0.25249	0.0:0.1001:0.0:0.8999	.	208	B2RXH4	BTBDI_HUMAN	T	208	ENSP00000394472:K208T;ENSP00000397020:K208T	ENSP00000394472:K208T	K	-	2	0	BTBD18	57269698	0.998000	0.40836	0.998000	0.56505	0.961000	0.63080	2.240000	0.43088	2.092000	0.63282	0.459000	0.35465	AAG	.	.		0.493	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393718.2	NM_001145101	
FAT3	120114	hgsc.bcm.edu	37	11	92087690	92087690	+	Silent	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:92087690T>C	ENST00000298047.6	+	1	2429	c.2412T>C	c.(2410-2412)taT>taC	p.Y804Y	FAT3_ENST00000541502.1_Silent_p.Y804Y|FAT3_ENST00000525166.1_Silent_p.Y654Y|FAT3_ENST00000409404.2_Silent_p.Y804Y			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	804	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCACCATCTATGACTTAGGTA	0.408										TCGA Ovarian(4;0.039)																											p.Y804Y		Atlas-SNP	.											.	FAT3	1822	.	0			c.T2412C						.						102.0	97.0	99.0					11																	92087690		1964	4168	6132	SO:0001819	synonymous_variant	120114	exon1			CATCTATGACTTA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.2412T>C	chr11.hg19:g.92087690T>C		84.0	0.0		92.0	34.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	hg19																																																																																				.	.		0.408	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
BCO2	83875	hgsc.bcm.edu	37	11	112064319	112064319	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:112064319G>A	ENST00000357685.5	+	3	551	c.416G>A	c.(415-417)cGa>cAa	p.R139Q	BCO2_ENST00000526088.1_Missense_Mutation_p.R105Q|BCO2_ENST00000532593.1_Missense_Mutation_p.R34Q|SDHD_ENST00000525468.1_3'UTR|AP002884.3_ENST00000532612.1_Missense_Mutation_p.R110Q|BCO2_ENST00000393032.2_Missense_Mutation_p.R105Q|BCO2_ENST00000531169.1_Missense_Mutation_p.R105Q|BCO2_ENST00000438022.1_Missense_Mutation_p.R105Q|BCO2_ENST00000361053.4_Missense_Mutation_p.R139Q			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	139					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						GCTAAAAACCGAATTGTGATC	0.463																																					p.R139Q	GBM(177;1916 2099 21049 29541 39946)	Atlas-SNP	.											BCO2,NS,carcinoma,+1,2	BCO2	44	.	0			c.G416A						.						132.0	111.0	119.0					11																	112064319		2201	4297	6498	SO:0001583	missense	83875	exon3			AAAACCGAATTGT	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.416G>A	chr11.hg19:g.112064319G>A	ENSP00000350314:p.Arg139Gln	158.0	0.0		152.0	49.0	NM_001256398	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Missense_Mutation	SNP	ENST00000357685.5	hg19	CCDS8358.2	.	.	.	.	.	.	.	.	.	.	G	31	5.068707	0.93950	.	.	ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000361053;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169	D;D;D;D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62;-3.62;-3.62;-3.62	5.58	4.66	0.58398	.	0.057288	0.64402	N	0.000001	D	0.97583	0.9208	M	0.90369	3.11	0.80722	D	1	D;P;D	0.89917	1.0;0.944;1.0	D;P;D	0.91635	0.999;0.488;0.999	D	0.98202	1.0468	9	.	.	.	-1.3105	14.8123	0.70006	0.0697:0.0:0.9303:0.0	.	116;139;139	C9JEZ9;E9PBI8;Q9BYV7	.;.;BCDO2_HUMAN	Q	139;105;139;105;105;34;105	ENSP00000350314:R139Q;ENSP00000376752:R105Q;ENSP00000354338:R139Q;ENSP00000414843:R105Q;ENSP00000436615:R105Q;ENSP00000431802:R34Q;ENSP00000437053:R105Q	.	R	+	2	0	BCO2	111569529	1.000000	0.71417	0.876000	0.34364	0.938000	0.57974	7.266000	0.78452	1.346000	0.45694	0.655000	0.94253	CGA	.	.		0.463	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290	
NXPE4	54827	hgsc.bcm.edu	37	11	114453434	114453434	+	Missense_Mutation	SNP	C	C	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:114453434C>G	ENST00000375478.3	-	3	586	c.406G>C	c.(406-408)Gat>Cat	p.D136H	NXPE4_ENST00000424261.2_Intron	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	136						extracellular vesicular exosome (GO:0070062)											CTCAGGAAATCCCCGCCATAT	0.577																																					p.D136H		Atlas-SNP	.											.	.	.	.	0			c.G406C						.						80.0	85.0	83.0					11																	114453434		2198	4296	6494	SO:0001583	missense	54827	exon3			GGAAATCCCCGCC	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.406G>C	chr11.hg19:g.114453434C>G	ENSP00000364627:p.Asp136His	135.0	0.0		131.0	31.0	NM_001077639	Q6QDB4|Q9NXP5	Missense_Mutation	SNP	ENST00000375478.3	hg19	CCDS41718.1	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895503	0.52121	.	.	ENSG00000137634	ENST00000375478	T	0.49432	0.78	5.01	5.01	0.66863	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.079753	0.50627	D	0.000114	T	0.76765	0.4033	H	0.95365	3.66	0.42043	D	0.991088	D	0.89917	1.0	D	0.91635	0.999	D	0.83736	0.0201	10	0.87932	D	0	.	13.1986	0.59754	0.1599:0.8401:0.0:0.0	.	136	Q6UWF7	FA55D_HUMAN	H	136	ENSP00000364627:D136H	ENSP00000364627:D136H	D	-	1	0	FAM55D	113958644	1.000000	0.71417	0.960000	0.40013	0.369000	0.29798	4.592000	0.61027	2.479000	0.83701	0.591000	0.81541	GAT	.	.		0.577	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399179.1	NM_017678	
OR8A1	390275	hgsc.bcm.edu	37	11	124440405	124440405	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr11:124440405G>A	ENST00000284287.3	+	1	513	c.441G>A	c.(439-441)ttG>ttA	p.L147L		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	147					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		GCCACCCTTTGCTTTACAACA	0.493																																					p.L147L		Atlas-SNP	.											.	OR8A1	61	.	0			c.G441A						.						164.0	138.0	147.0					11																	124440405		2201	4299	6500	SO:0001819	synonymous_variant	390275	exon1			CCCTTTGCTTTAC	BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.441G>A	chr11.hg19:g.124440405G>A		57.0	0.0		65.0	20.0	NM_001005194	Q6IEW7|Q96RC6	Silent	SNP	ENST00000284287.3	hg19	CCDS31712.1																																																																																			.	.		0.493	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387062.1	NM_001005194	
ZCRB1	85437	hgsc.bcm.edu	37	12	42717863	42717863	+	Silent	SNP	T	T	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr12:42717863T>A	ENST00000266529.3	-	2	225	c.42A>T	c.(40-42)gtA>gtT	p.V14V	PPHLN1_ENST00000358314.7_5'Flank|PPHLN1_ENST00000337898.6_5'Flank|PPHLN1_ENST00000395580.3_5'Flank|PPHLN1_ENST00000317560.9_5'Flank|PPHLN1_ENST00000549190.1_Intron|ZCRB1_ENST00000551102.1_5'Flank|PPHLN1_ENST00000395568.2_5'Flank|PPHLN1_ENST00000432191.2_5'Flank|PPHLN1_ENST00000449194.2_5'Flank|ZCRB1_ENST00000552673.1_Intron|PPHLN1_ENST00000552761.1_5'Flank|PPHLN1_ENST00000256678.8_5'Flank	NM_033114.3	NP_149105.3	Q8TBF4	ZCRB1_HUMAN	zinc finger CCHC-type and RNA binding motif 1	14	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)	8	all_cancers(12;0.000348)|Breast(8;0.221)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0689)		GCAAGTTGGATACATACACTG	0.368																																					p.V14V		Atlas-SNP	.											.	ZCRB1	20	.	0			c.A42T						.						138.0	130.0	133.0					12																	42717863		2203	4300	6503	SO:0001819	synonymous_variant	85437	exon2			GTTGGATACATAC	BC022543	CCDS8740.1	12q12	2013-02-12				ENSG00000139168		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	29620	protein-coding gene	gene with protein product	"""U11/U12 snRNP 31K"""	610750				15146077, 16959469	Standard	NM_033114		Approved	MADP-1, MADP1, RBM36, ZCCHC19, SNRNP31	uc001rmz.3	Q8TBF4	OTTHUMG00000169382	ENST00000266529.3:c.42A>T	chr12.hg19:g.42717863T>A		127.0	0.0		114.0	32.0	NM_033114	Q6PJX0|Q96TA6	Silent	SNP	ENST00000266529.3	hg19	CCDS8740.1																																																																																			.	.		0.368	ZCRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403813.1	NM_033114	
LMBR1L	55716	hgsc.bcm.edu	37	12	49491852	49491852	+	Missense_Mutation	SNP	C	C	A	rs367631047		TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr12:49491852C>A	ENST00000267102.8	-	16	1619	c.1277G>T	c.(1276-1278)cGc>cTc	p.R426L	LMBR1L_ENST00000547382.1_Missense_Mutation_p.R406L|LMBR1L_ENST00000395141.4_Missense_Mutation_p.R421L	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like	426					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CCAGTTGAAGCGTCCAAAGTC	0.557											OREG0021783	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R426L		Atlas-SNP	.											.	LMBR1L	61	.	0			c.G1277T						.						145.0	139.0	141.0					12																	49491852		2203	4300	6503	SO:0001583	missense	55716	exon16			TTGAAGCGTCCAA	AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.1277G>T	chr12.hg19:g.49491852C>A	ENSP00000267102:p.Arg426Leu	66.0	0.0	962	60.0	15.0	NM_018113	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Missense_Mutation	SNP	ENST00000267102.8	hg19	CCDS8780.2	.	.	.	.	.	.	.	.	.	.	C	34	5.296074	0.95574	.	.	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000395141	T;T;T	0.32515	1.45;1.45;1.45	5.54	5.54	0.83059	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.58481	0.2125	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	0.996;0.997;1.0	D;D;D	0.87578	0.977;0.992;0.998	T	0.60094	-0.7330	10	0.72032	D	0.01	.	18.6171	0.91306	0.0:1.0:0.0:0.0	.	406;426;421	Q6UX01-3;Q6UX01;Q6UX01-4	.;LMBRL_HUMAN;.	L	426;406;421	ENSP00000267102:R426L;ENSP00000447329:R406L;ENSP00000378573:R421L	ENSP00000267102:R426L	R	-	2	0	LMBR1L	47778119	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.756000	0.85195	2.769000	0.95229	0.563000	0.77884	CGC	.	.		0.557	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318696.1	NM_018113	
DHX37	57647	hgsc.bcm.edu	37	12	125470692	125470692	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr12:125470692C>A	ENST00000308736.2	-	2	324	c.226G>T	c.(226-228)Gag>Tag	p.E76*		NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	76							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		ACTTTCTTCTCCTTCTTGGTC	0.512																																					p.E76X		Atlas-SNP	.											.	DHX37	114	.	0			c.G226T						.						190.0	186.0	187.0					12																	125470692		2203	4300	6503	SO:0001587	stop_gained	57647	exon2			TCTTCTCCTTCTT	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.226G>T	chr12.hg19:g.125470692C>A	ENSP00000311135:p.Glu76*	57.0	0.0		74.0	21.0	NM_032656	Q9BUI7|Q9P211	Nonsense_Mutation	SNP	ENST00000308736.2	hg19	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.891854	0.91889	.	.	ENSG00000150990	ENST00000308736	.	.	.	4.04	4.04	0.47022	.	0.131071	0.51477	D	0.000086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-1.2702	10.9356	0.47243	0.0:0.67:0.33:0.0	.	.	.	.	X	76	.	ENSP00000311135:E76X	E	-	1	0	DHX37	124036645	1.000000	0.71417	0.992000	0.48379	0.499000	0.33736	2.925000	0.48884	1.948000	0.56530	0.491000	0.48974	GAG	.	.		0.512	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
LTB4R	1241	hgsc.bcm.edu	37	14	24785802	24785802	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr14:24785802G>A	ENST00000396789.4	+	2	2670	c.945G>A	c.(943-945)acG>acA	p.T315T	LTB4R_ENST00000396782.2_Silent_p.T315T|LTB4R_ENST00000345363.3_Silent_p.T315T	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	315					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CGTCCAGCACGCGCCGCGGGG	0.751																																					p.T315T		Atlas-SNP	.											.	LTB4R	18	.	0			c.G945A						.						2.0	2.0	2.0					14																	24785802		1271	2627	3898	SO:0001819	synonymous_variant	1241	exon2			CAGCACGCGCCGC	X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.945G>A	chr14.hg19:g.24785802G>A		25.0	0.0		31.0	10.0	NM_181657	Q13305|Q53XV5|Q92641|Q9BSU5	Silent	SNP	ENST00000396789.4	hg19	CCDS9626.1																																																																																			.	.		0.751	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073198.4		
NKX2-1	7080	hgsc.bcm.edu	37	14	36986874	36986874	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr14:36986874G>C	ENST00000518149.1	-	3	1330	c.725C>G	c.(724-726)aCc>aGc	p.T242S	NKX2-1_ENST00000522719.2_Missense_Mutation_p.T242S|NKX2-1_ENST00000354822.5_Missense_Mutation_p.T272S|RP11-896J10.3_ENST00000521945.1_RNA|NKX2-1-AS1_ENST00000521292.2_RNA|NKX2-1_ENST00000498187.2_Missense_Mutation_p.T242S			P43699	NKX21_HUMAN	NK2 homeobox 1	242	Poly-Gly.				anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		cgggcacccggtgcccccgcc	0.711			A		NSCLC																																p.T272S		Atlas-SNP	.		Dom	yes		14	14q13	7080	NK2 homeobox 1		E	.	NKX2-1	21	.	0			c.C815G						.						4.0	4.0	4.0					14																	36986874		1946	3771	5717	SO:0001583	missense	7080	exon3			CACCCGGTGCCCC		CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000518149.1:c.725C>G	chr14.hg19:g.36986874G>C	ENSP00000428341:p.Thr242Ser	228.0	0.0		217.0	28.0	NM_001079668	D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	Missense_Mutation	SNP	ENST00000518149.1	hg19	CCDS9659.1	.	.	.	.	.	.	.	.	.	.	G	2.562	-0.301694	0.05495	.	.	ENSG00000136352	ENST00000354822;ENST00000498187;ENST00000518149;ENST00000522719	D;D;D;D	0.90385	-2.66;-2.65;-2.65;-2.65	2.73	2.73	0.32206	.	1.530320	0.04717	N	0.418568	T	0.79476	0.4452	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.66073	-0.6014	10	0.07030	T	0.85	.	9.1075	0.36707	0.0:0.0:1.0:0.0	.	272;242	P43699-3;P43699	.;NKX21_HUMAN	S	272;242;242;242	ENSP00000346879:T272S;ENSP00000429607:T242S;ENSP00000428341:T242S;ENSP00000429519:T242S	ENSP00000346879:T272S	T	-	2	0	NKX2-1	36056625	0.974000	0.33945	0.996000	0.52242	0.944000	0.59088	0.000000	0.12993	1.844000	0.53588	0.455000	0.32223	ACC	.	.		0.711	NKX2-1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376225.2	NM_003317	
CDKL1	8814	hgsc.bcm.edu	37	14	50862544	50862544	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr14:50862544A>G	ENST00000216378.2	-	2	690	c.46T>C	c.(46-48)Tat>Cat	p.Y16H	RP11-247L20.3_ENST00000556713.1_lincRNA|CDKL1_ENST00000356146.1_5'UTR|CDKL1_ENST00000395834.1_Missense_Mutation_p.Y16H	NM_001282236.1	NP_001269165.1	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1 (CDC2-related kinase)	15	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				heart development (GO:0007507)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|stomach(1)	12	all_epithelial(31;0.000746)|Breast(41;0.0102)					ACAACTCCATAGGATCCTTCT	0.403																																					p.Y16H		Atlas-SNP	.											.	CDKL1	50	.	0			c.T46C						.						81.0	84.0	83.0					14																	50862544		2203	4300	6503	SO:0001583	missense	8814	exon1			CTCCATAGGATCC	AF390028	CCDS9699.1, CCDS73637.1	14q21.3	2011-11-04			ENSG00000100490	ENSG00000100490		"""Cyclin-dependent kinases"""	1781	protein-coding gene	gene with protein product		603441				1639063, 7595554	Standard	XM_005268157		Approved	KKIALRE	uc010anu.2	Q00532	OTTHUMG00000140290	ENST00000216378.2:c.46T>C	chr14.hg19:g.50862544A>G	ENSP00000216378:p.Tyr16His	138.0	0.0		129.0	38.0	NM_004196	Q2M3A4|Q6QUA0|Q8WXQ5	Missense_Mutation	SNP	ENST00000216378.2	hg19		.	.	.	.	.	.	.	.	.	.	A	17.85	3.491299	0.64074	.	.	ENSG00000100490	ENST00000395834;ENST00000216378	T;T	0.51071	0.72;0.72	4.34	4.34	0.51931	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.65544	0.2701	M	0.69248	2.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.69826	-0.5040	9	0.87932	D	0	.	13.2349	0.59965	1.0:0.0:0.0:0.0	.	205;15	Q00532-2;Q00532	.;CDKL1_HUMAN	H	16	ENSP00000379176:Y16H;ENSP00000216378:Y16H	ENSP00000216378:Y16H	Y	-	1	0	CDKL1	49932294	1.000000	0.71417	1.000000	0.80357	0.401000	0.30781	8.712000	0.91403	1.918000	0.55548	0.459000	0.35465	TAT	.	.		0.403	CDKL1-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382103.1		
AREL1	9870	hgsc.bcm.edu	37	14	75130767	75130767	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr14:75130767C>T	ENST00000356357.4	-	19	2719	c.2204G>A	c.(2203-2205)tGg>tAg	p.W735*	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	735	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										AGTCCAAAACCACCTCATGAC	0.542																																					p.W735X		Atlas-SNP	.											.	KIAA0317	68	.	0			c.G2204A						.						49.0	49.0	49.0					14																	75130767		2011	4189	6200	SO:0001587	stop_gained	9870	exon19			CAAAACCACCTCA	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.2204G>A	chr14.hg19:g.75130767C>T	ENSP00000348714:p.Trp735*	91.0	0.0		91.0	26.0	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Nonsense_Mutation	SNP	ENST00000356357.4	hg19	CCDS41971.1	.	.	.	.	.	.	.	.	.	.	C	46	12.871266	0.99702	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9084	0.97016	0.0:1.0:0.0:0.0	.	.	.	.	X	735;574;574	.	ENSP00000348714:W735X	W	-	2	0	KIAA0317	74200520	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.711000	0.92665	0.650000	0.86243	TGG	.	.		0.542	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
C14orf80	283643	hgsc.bcm.edu	37	14	105958483	105958483	+	Missense_Mutation	SNP	A	A	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr14:105958483A>T	ENST00000392523.4	+	3	387	c.266A>T	c.(265-267)cAg>cTg	p.Q89L	C14orf80_ENST00000329886.7_Missense_Mutation_p.Q50L|C14orf80_ENST00000334656.7_Missense_Mutation_p.Q48L|C14orf80_ENST00000392522.3_Missense_Mutation_p.Q89L|C14orf80_ENST00000551054.1_3'UTR|C14orf80_ENST00000450383.1_De_novo_Start_OutOfFrame|C14orf80_ENST00000354560.6_Missense_Mutation_p.Q89L|C14orf80_ENST00000392527.1_Missense_Mutation_p.Q48L			Q86SX3	CN080_HUMAN	chromosome 14 open reading frame 80	89										central_nervous_system(1)	1		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.239)		CTATGCTCCCAGGGCTACCCG	0.632																																					p.Q89L		Atlas-SNP	.											.	C14orf80	19	.	0			c.A266T						.						63.0	59.0	60.0					14																	105958483		692	1591	2283	SO:0001583	missense	283643	exon3			GCTCCCAGGGCTA		CCDS45180.1, CCDS45181.1, CCDS45182.1, CCDS55955.1	14q32.33	2012-09-25			ENSG00000185347	ENSG00000185347			20127	protein-coding gene	gene with protein product							Standard	NM_001134875		Approved		uc001yrn.3	Q86SX3	OTTHUMG00000170426	ENST00000392523.4:c.266A>T	chr14.hg19:g.105958483A>T	ENSP00000376308:p.Gln89Leu	44.0	0.0		58.0	20.0	NM_001134876	B5MDG3|E9PAQ4|Q86TT3|Q86TT4|Q86TT5|Q96B41|Q9H7H4	Missense_Mutation	SNP	ENST00000392523.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.991|1.991	-0.431879|-0.431879	0.04669|0.04669	.|.	.|.	ENSG00000185347|ENSG00000185347	ENST00000548920|ENST00000329886;ENST00000427614;ENST00000455454;ENST00000432805;ENST00000392527;ENST00000443229;ENST00000334656;ENST00000392522;ENST00000392523;ENST00000354560	.|.	.|.	.|.	5.22|5.22	-1.26|-1.26	0.09376|0.09376	.|.	.|0.820114	.|0.10824	.|N	.|0.630078	.|T	.|0.31670	.|0.0804	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B	.|0.26547	.|0.144;0.066;0.144;0.152;0.11	.|B;B;B;B;B	.|0.28011	.|0.037;0.053;0.037;0.085;0.059	.|T	.|0.34675	.|-0.9819	.|9	.|0.10636	.|T	.|0.68	.|-8.2165	10.392|10.392	0.44179|0.44179	0.5163:0.0:0.4837:0.0|0.5163:0.0:0.4837:0.0	.|.	.|89;89;89;48;50	.|Q86SX3-2;E9PAQ4;Q86SX3;B5MDG3;Q86SX3-3	.|.;.;CN080_HUMAN;.;.	.|L	-1|50;48;48;48;48;48;48;89;89;89	.|.	.|ENSP00000333010:Q50L	.|Q	+|+	.|2	.|0	C14orf80|C14orf80	105029528|105029528	0.000000|0.000000	0.05858|0.05858	0.070000|0.070000	0.20053|0.20053	0.191000|0.191000	0.23601|0.23601	-0.434000|-0.434000	0.06939|0.06939	-0.240000|-0.240000	0.09696|0.09696	-0.421000|-0.421000	0.06004|0.06004	.|CAG	.	.		0.632	C14orf80-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409090.1	NM_001134875	
AP4E1	23431	hgsc.bcm.edu	37	15	51289823	51289823	+	Missense_Mutation	SNP	A	A	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr15:51289823A>G	ENST00000261842.5	+	18	2753	c.2647A>G	c.(2647-2649)Atg>Gtg	p.M883V	AP4E1_ENST00000560508.1_Missense_Mutation_p.M808V	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	883					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		TAATAACAACATGGAAATTTT	0.388																																					p.M883V		Atlas-SNP	.											.	AP4E1	78	.	0			c.A2647G						.						105.0	101.0	103.0					15																	51289823		2196	4294	6490	SO:0001583	missense	23431	exon18			AACAACATGGAAA	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.2647A>G	chr15.hg19:g.51289823A>G	ENSP00000261842:p.Met883Val	69.0	0.0		89.0	18.0	NM_007347	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Missense_Mutation	SNP	ENST00000261842.5	hg19	CCDS32240.1	.	.	.	.	.	.	.	.	.	.	A	5.845	0.340125	0.11069	.	.	ENSG00000081014	ENST00000261842	T	0.15952	2.38	5.47	2.99	0.34606	Coatomer, beta subunit, C-terminal (1);	0.288944	0.38164	N	0.001791	T	0.12305	0.0299	L	0.50333	1.59	0.37071	D	0.89855	B	0.02656	0.0	B	0.04013	0.001	T	0.12502	-1.0545	10	0.07482	T	0.82	-12.0471	7.1219	0.25450	0.7026:0.1375:0.0:0.1599	.	883	Q9UPM8	AP4E1_HUMAN	V	883	ENSP00000261842:M883V	ENSP00000261842:M883V	M	+	1	0	AP4E1	49077115	0.985000	0.35326	0.947000	0.38551	0.676000	0.39594	1.983000	0.40648	0.883000	0.36040	0.383000	0.25322	ATG	.	.		0.388	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1		
EFTUD1	79631	hgsc.bcm.edu	37	15	82444220	82444220	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr15:82444220C>T	ENST00000268206.7	-	18	2743	c.2575G>A	c.(2575-2577)Gcc>Acc	p.A859T	EFTUD1_ENST00000359445.3_Missense_Mutation_p.A808T	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	859					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						TATCTACTGGCTTCTTTTGAA	0.463																																					p.A859T		Atlas-SNP	.											.	EFTUD1	74	.	0			c.G2575A						.						51.0	51.0	51.0					15																	82444220		1880	4109	5989	SO:0001583	missense	79631	exon18			TACTGGCTTCTTT	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.2575G>A	chr15.hg19:g.82444220C>T	ENSP00000268206:p.Ala859Thr	113.0	0.0		109.0	35.0	NM_024580	A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	ENST00000268206.7	hg19	CCDS42071.1	.	.	.	.	.	.	.	.	.	.	C	4.706	0.131297	0.08981	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	T;T	0.24538	1.85;1.85	6.06	3.17	0.36434	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.303968	0.22942	N	0.053780	T	0.10766	0.0263	N	0.08118	0	0.31224	N	0.697124	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.21759	-1.0236	10	0.14252	T	0.57	2.6917	7.4321	0.27134	0.1176:0.691:0.0:0.1914	.	808;859	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	T	859;808	ENSP00000268206:A859T;ENSP00000352418:A808T	ENSP00000268206:A859T	A	-	1	0	EFTUD1	80231275	0.151000	0.22747	0.073000	0.20177	0.098000	0.18820	0.977000	0.29475	0.906000	0.36621	-0.142000	0.14014	GCC	.	.		0.463	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419252.1	NM_024580	
NLRC3	197358	hgsc.bcm.edu	37	16	3613191	3613191	+	RNA	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr16:3613191C>T	ENST00000301749.7	-	0	2152				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000324659.8_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCTCCTCCACGCTGCGGGCC	0.711																																					p.V583M		Atlas-SNP	.											.	NLRC3	103	.	0			c.G1747A						.						9.0	12.0	11.0					16																	3613191		2107	4212	6319			197358	exon5			CCTCCACGCTGCG	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3613191C>T		103.0	0.0		118.0	43.0	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	hg19		.	.	.	.	.	.	.	.	.	.	C	4.380	0.070128	0.08436	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99	4.89	1.73	0.24493	.	0.220217	0.38058	N	0.001827	T	0.76572	0.4006	.	.	.	0.20489	N	0.999892	B	0.14438	0.01	B	0.08055	0.003	T	0.65615	-0.6125	9	0.56958	D	0.05	.	8.4145	0.32664	0.0:0.7195:0.0:0.2805	.	630	C9JLH9	.	M	583;583;583;630;565	ENSP00000301749:V583M;ENSP00000352039:V583M;ENSP00000414415:V630M;ENSP00000323897:V565M	ENSP00000301749:V583M	V	-	1	0	NLRC3	3553192	0.520000	0.26250	0.257000	0.24404	0.021000	0.10359	1.184000	0.32053	0.089000	0.17243	-1.105000	0.02106	GTG	.	.		0.711	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
SPN	6693	hgsc.bcm.edu	37	16	29675716	29675716	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr16:29675716G>A	ENST00000360121.3	+	2	759	c.667G>A	c.(667-669)Gtc>Atc	p.V223I	SPN_ENST00000395389.2_Missense_Mutation_p.V223I	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						TGGACCCCAGGTCTCTAGCGT	0.577																																					p.V223I		Atlas-SNP	.											.	SPN	44	.	0			c.G667A						.						74.0	75.0	75.0					16																	29675716		2197	4300	6497	SO:0001583	missense	6693	exon2			CCCCAGGTCTCTA	J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.667G>A	chr16.hg19:g.29675716G>A	ENSP00000353238:p.Val223Ile	99.0	0.0		85.0	18.0	NM_001030288	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	ENST00000360121.3	hg19	CCDS10650.1	.	.	.	.	.	.	.	.	.	.	.	9.300	1.052914	0.19907	.	.	ENSG00000197471	ENST00000395389;ENST00000436527;ENST00000360121	T;T;T	0.79845	-1.31;-1.31;-1.31	4.57	-3.69	0.04450	.	2.677570	0.01419	N	0.014316	T	0.73164	0.3552	L	0.47016	1.485	0.09310	N	1	B	0.27229	0.172	B	0.29598	0.104	T	0.55805	-0.8083	10	0.11182	T	0.66	-0.7568	10.1697	0.42902	0.5878:0.0:0.4122:0.0	.	223	P16150	LEUK_HUMAN	I	223	ENSP00000378787:V223I;ENSP00000412907:V223I;ENSP00000353238:V223I	ENSP00000353238:V223I	V	+	1	0	SPN	29583217	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.847000	0.04331	-0.586000	0.05898	0.591000	0.81541	GTC	.	.		0.577	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215001.2		
SETD1A	9739	hgsc.bcm.edu	37	16	30982811	30982811	+	Silent	SNP	C	C	A	rs531337171|rs569719496	byFrequency	TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr16:30982811C>A	ENST00000262519.8	+	13	3815	c.3129C>A	c.(3127-3129)tcC>tcA	p.S1043S		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1043	Ser-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						Gctcctcatcctcctcctcct	0.542																																					p.S1043S		Atlas-SNP	.											.	SETD1A	143	.	0			c.C3129A						.						79.0	79.0	79.0					16																	30982811		2197	4300	6497	SO:0001819	synonymous_variant	9739	exon13			CTCATCCTCCTCC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3129C>A	chr16.hg19:g.30982811C>A		89.0	0.0		96.0	4.0	NM_014712	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	hg19	CCDS32435.1																																																																																			.	.		0.542	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318244.2	NM_014712	
KATNB1	10300	hgsc.bcm.edu	37	16	57788908	57788908	+	Splice_Site	SNP	A	A	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr16:57788908A>C	ENST00000379661.3	+	14	1687	c.1295A>C	c.(1294-1296)aAt>aCt	p.N432T		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				CCGGTGCCAAATGTATGTCCA	0.627																																					p.N432T		Atlas-SNP	.											.	KATNB1	35	.	0			c.A1295C						.						107.0	110.0	109.0					16																	57788908		2198	4300	6498	SO:0001630	splice_region_variant	10300	exon14			TGCCAAATGTATG	AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.1296+1A>C	chr16.hg19:g.57788908A>C		86.0	0.0		75.0	23.0	NM_005886		Missense_Mutation	SNP	ENST00000379661.3	hg19	CCDS10788.1	.	.	.	.	.	.	.	.	.	.	A	8.820	0.937297	0.18206	.	.	ENSG00000140854	ENST00000379661	T	0.54479	0.57	5.24	4.12	0.48240	.	0.246207	0.47093	D	0.000242	T	0.39963	0.1098	L	0.36672	1.1	0.80722	D	1	B	0.19331	0.035	B	0.17433	0.018	T	0.15954	-1.0419	10	0.33141	T	0.24	-29.7787	8.918	0.35594	0.9126:0.0:0.0874:0.0	.	432	Q9BVA0	KTNB1_HUMAN	T	432	ENSP00000368982:N432T	ENSP00000368982:N432T	N	+	2	0	KATNB1	56346409	0.934000	0.31675	0.722000	0.30670	0.020000	0.10135	1.962000	0.40442	0.806000	0.34183	0.477000	0.44152	AAT	.	.		0.627	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257343.3		Missense_Mutation
FHOD1	29109	hgsc.bcm.edu	37	16	67263800	67263800	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr16:67263800G>A	ENST00000258201.4	-	21	3555	c.3308C>T	c.(3307-3309)aCa>aTa	p.T1103I	LRRC29_ENST00000462169.1_5'Flank|AC040160.1_ENST00000454102.2_5'Flank|LRRC29_ENST00000409509.1_5'Flank|LRRC29_ENST00000341546.3_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	1103	DAD.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CTCATCTGATGTATCACTGGG	0.587																																					p.T1103I		Atlas-SNP	.											.	FHOD1	86	.	0			c.C3308T						.						72.0	74.0	73.0					16																	67263800		2198	4300	6498	SO:0001583	missense	29109	exon21			TCTGATGTATCAC	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.3308C>T	chr16.hg19:g.67263800G>A	ENSP00000258201:p.Thr1103Ile	86.0	0.0		94.0	27.0	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	hg19	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.567245	0.45694	.	.	ENSG00000135723	ENST00000258201	T	0.36699	1.24	5.46	4.49	0.54785	.	0.156564	0.56097	D	0.000030	T	0.33644	0.0870	L	0.53249	1.67	0.38355	D	0.944434	B	0.26708	0.157	B	0.25291	0.059	T	0.17961	-1.0352	10	0.34782	T	0.22	.	13.4633	0.61239	0.077:0.0:0.923:0.0	.	1103	Q9Y613	FHOD1_HUMAN	I	1103	ENSP00000258201:T1103I	ENSP00000258201:T1103I	T	-	2	0	FHOD1	65821301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.469000	0.80959	2.840000	0.97914	0.655000	0.94253	ACA	.	.		0.587	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
CYBA	1535	hgsc.bcm.edu	37	16	88713210	88713210	+	Missense_Mutation	SNP	G	G	T	rs373948664		TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr16:88713210G>T	ENST00000261623.3	-	4	378	c.240C>A	c.(238-240)ttC>ttA	p.F80L	CYBA_ENST00000567174.1_Missense_Mutation_p.F80L|CYBA_ENST00000569359.1_Missense_Mutation_p.F80L|CYBA_ENST00000561972.1_5'Flank	NM_000101.3	NP_000092.2	P13498	CY24A_HUMAN	cytochrome b-245, alpha polypeptide	80					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to amino acid stimulus (GO:0071230)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|cytochrome complex assembly (GO:0017004)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|negative regulation of glomerular filtration by angiotensin (GO:0003106)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of cell growth (GO:0030307)|positive regulation of endothelial cell proliferation (GO:0001938)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|response to nutrient levels (GO:0031667)|smooth muscle hypertrophy (GO:0014895)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|secretory granule (GO:0030141)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)|superoxide-generating NADPH oxidase activity (GO:0016175)			endometrium(1)|liver(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0478)	Dextromethorphan(DB00514)	TAAAGGGCCCGAACAGCTTCA	0.652																																					p.F80L		Atlas-SNP	.											.	CYBA	12	.	0			c.C240A						.						82.0	91.0	88.0					16																	88713210		2198	4300	6498	SO:0001583	missense	1535	exon4			GGGCCCGAACAGC		CCDS32504.1	16q24	2014-09-17				ENSG00000051523		"""Cytochrome b genes"""	2577	protein-coding gene	gene with protein product	"""flavocytochrome b-558 alpha polypeptide"""	608508				2243141	Standard	NM_000101		Approved	p22-PHOX	uc002flb.4	P13498		ENST00000261623.3:c.240C>A	chr16.hg19:g.88713210G>T	ENSP00000261623:p.Phe80Leu	66.0	0.0		71.0	23.0	NM_000101	Q14090|Q9BR72	Missense_Mutation	SNP	ENST00000261623.3	hg19	CCDS32504.1	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564713	0.27915	.	.	ENSG00000051523	ENST00000261623	D	0.82893	-1.66	4.46	-8.91	0.00778	.	0.213482	0.49305	N	0.000147	T	0.61578	0.2358	L	0.34521	1.04	0.33695	D	0.613844	B;B	0.15930	0.015;0.015	B;B	0.20184	0.028;0.028	T	0.58769	-0.7578	10	0.06099	T	0.92	-3.6037	8.2117	0.31488	0.5075:0.2727:0.2197:0.0	.	16;80	B4DT46;P13498	.;CY24A_HUMAN	L	80	ENSP00000261623:F80L	ENSP00000261623:F80L	F	-	3	2	CYBA	87240711	0.008000	0.16893	0.254000	0.24359	0.809000	0.45718	-1.150000	0.03178	-1.895000	0.01104	-0.362000	0.07510	TTC	.	.		0.652	CYBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422765.1	NM_000101	
MYBBP1A	10514	hgsc.bcm.edu	37	17	4451500	4451500	+	Silent	SNP	A	A	G			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr17:4451500A>G	ENST00000254718.4	-	12	1968	c.1662T>C	c.(1660-1662)aaT>aaC	p.N554N	MYBBP1A_ENST00000381556.2_Silent_p.N554N			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	554	Interaction with MYB. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						TGTGGCTGTGATTCAACAGGA	0.652																																					p.N554N		Atlas-SNP	.											.	MYBBP1A	69	.	0			c.T1662C						.						67.0	61.0	63.0					17																	4451500		2203	4300	6503	SO:0001819	synonymous_variant	10514	exon12			GCTGTGATTCAAC	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.1662T>C	chr17.hg19:g.4451500A>G		67.0	0.0		59.0	14.0	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Silent	SNP	ENST00000254718.4	hg19	CCDS11046.1																																																																																			.	.		0.652	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
SBNO2	22904	hgsc.bcm.edu	37	19	1119995	1119995	+	Missense_Mutation	SNP	T	T	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:1119995T>C	ENST00000361757.3	-	12	1414	c.1177A>G	c.(1177-1179)Aag>Gag	p.K393E	SBNO2_ENST00000438103.2_Missense_Mutation_p.K336E|SBNO2_ENST00000587024.1_Missense_Mutation_p.K393E	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	393					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGCATTCTTGGCTTTGTGA	0.627																																					p.K393E		Atlas-SNP	.											.	SBNO2	112	.	0			c.A1177G						.						49.0	52.0	51.0					19																	1119995		1990	4019	6009	SO:0001583	missense	22904	exon12			CATTCTTGGCTTT	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.1177A>G	chr19.hg19:g.1119995T>C	ENSP00000354733:p.Lys393Glu	74.0	0.0		68.0	11.0	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	hg19	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.556292	0.65425	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	D;D	0.95171	-3.63;-3.63	3.91	3.91	0.45181	.	0.000000	0.85682	D	0.000000	D	0.96846	0.8970	M	0.88775	2.98	0.58432	D	0.999995	D;P;D;D	0.57571	0.98;0.925;0.963;0.975	P;P;P;P	0.61003	0.846;0.882;0.789;0.761	D	0.97202	0.9865	10	0.72032	D	0.01	-42.3101	11.9804	0.53117	0.0:0.0:0.0:1.0	.	336;393;393;336	B4DL53;B4DV91;Q9Y2G9;Q9Y2G9-3	.;.;SBNO2_HUMAN;.	E	393;336;417	ENSP00000354733:K393E;ENSP00000400762:K336E	ENSP00000250872:K417E	K	-	1	0	SBNO2	1070995	1.000000	0.71417	1.000000	0.80357	0.169000	0.22640	7.738000	0.84966	1.747000	0.51819	0.450000	0.29827	AAG	.	.		0.627	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
DPP9	91039	hgsc.bcm.edu	37	19	4683489	4683489	+	Splice_Site	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:4683489C>A	ENST00000598800.1	-	20	2749	c.2244G>T	c.(2242-2244)aaG>aaT	p.K748N	DPP9_ENST00000262960.9_Splice_Site_p.K777N|DPP9_ENST00000601173.1_5'UTR|DPP9_ENST00000594671.1_Splice_Site_p.K748N|AC005594.3_ENST00000381796.1_RNA			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	748						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		TGGGACCCACCTTGAACACCT	0.672																																					p.K777N		Atlas-SNP	.											.	DPP9	59	.	0			c.G2331T						.						34.0	43.0	40.0					19																	4683489		1950	4130	6080	SO:0001630	splice_region_variant	91039	exon19			ACCCACCTTGAAC	AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.2244+1G>T	chr19.hg19:g.4683489C>A		121.0	0.0		110.0	31.0	NM_139159	O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Missense_Mutation	SNP	ENST00000598800.1	hg19		.	.	.	.	.	.	.	.	.	.	C	22.8	4.341751	0.81911	.	.	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	T	0.51817	0.69	4.0	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.72985	0.3529	M	0.90759	3.145	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	T	0.80214	-0.1475	9	.	.	.	-33.276	15.3398	0.74287	0.0:1.0:0.0:0.0	.	777	Q1ZZB8	.	N	856;718;777	ENSP00000262960:K777N	.	K	-	3	2	DPP9	4634489	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.590000	0.82653	2.092000	0.63282	0.456000	0.33151	AAG	.	.		0.672	DPP9-026	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000459343.2		Missense_Mutation
MCOLN1	57192	hgsc.bcm.edu	37	19	7593583	7593583	+	Silent	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:7593583G>A	ENST00000264079.6	+	8	1103	c.978G>A	c.(976-978)ctG>ctA	p.L326L		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	326					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GCTTCCTGCTGCAGAACGTGA	0.627																																					p.L326L		Atlas-SNP	.											.	MCOLN1	54	.	0			c.G978A						.						128.0	82.0	97.0					19																	7593583		2203	4300	6503	SO:0001819	synonymous_variant	57192	exon8			CCTGCTGCAGAAC	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.978G>A	chr19.hg19:g.7593583G>A		82.0	0.0		102.0	37.0	NM_020533	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	ENST00000264079.6	hg19	CCDS12180.1																																																																																			.	.		0.627	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458974.2	NM_020533	
ZNF442	79973	hgsc.bcm.edu	37	19	12461659	12461659	+	Missense_Mutation	SNP	G	G	C			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:12461659G>C	ENST00000242804.4	-	6	1322	c.740C>G	c.(739-741)cCt>cGt	p.P247R	ZNF442_ENST00000438182.1_Missense_Mutation_p.P178R|CTD-3105H18.13_ENST00000563695.2_lincRNA	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	247					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P247R(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						ACTGTAAATAGGGAAGGCTTT	0.408																																					p.P247R		Atlas-SNP	.											ZNF442,NS,carcinoma,0,2	ZNF442	102	.	1	Substitution - Missense(1)	lung(1)	c.C740G						.						164.0	165.0	165.0					19																	12461659		2203	4300	6503	SO:0001583	missense	79973	exon6			TAAATAGGGAAGG	AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.740C>G	chr19.hg19:g.12461659G>C	ENSP00000242804:p.Pro247Arg	106.0	0.0		103.0	20.0	NM_030824	B4DJ48	Missense_Mutation	SNP	ENST00000242804.4	hg19	CCDS12271.1	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.402021	0.01165	.	.	ENSG00000198342	ENST00000242804;ENST00000438182	T;T	0.14144	2.53;2.53	0.832	-1.66	0.08265	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04272	0.0118	N	0.02315	-0.6	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.40831	-0.9542	9	0.20519	T	0.43	.	5.0246	0.14378	0.0:0.4253:0.3888:0.1859	.	247	Q9H7R0	ZN442_HUMAN	R	247;178	ENSP00000242804:P247R;ENSP00000388634:P178R	ENSP00000242804:P247R	P	-	2	0	ZNF442	12322659	.	.	0.000000	0.03702	0.335000	0.28730	.	.	-1.607000	0.01589	-0.656000	0.03901	CCT	.	.		0.408	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344109.1	NM_030824	
SLC25A42	284439	hgsc.bcm.edu	37	19	19217109	19217109	+	Missense_Mutation	SNP	G	G	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:19217109G>A	ENST00000318596.7	+	6	563	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	SLC25A42_ENST00000600275.1_3'UTR	NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	138					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			CCTCTTCGCCGGCGCACTGGC	0.647																																					p.G138S		Atlas-SNP	.											.	SLC25A42	18	.	0			c.G412A						.						62.0	66.0	64.0					19																	19217109		2203	4300	6503	SO:0001583	missense	284439	exon6			TTCGCCGGCGCAC		CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.412G>A	chr19.hg19:g.19217109G>A	ENSP00000326693:p.Gly138Ser	44.0	0.0		58.0	6.0	NM_178526	D2T2J5|O14553|O43378	Missense_Mutation	SNP	ENST00000318596.7	hg19	CCDS32966.1	.	.	.	.	.	.	.	.	.	.	G	32	5.186075	0.94885	.	.	ENSG00000181035	ENST00000318596	D	0.91686	-2.89	4.5	4.5	0.54988	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.96364	0.8814	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97237	0.9888	10	0.87932	D	0	-0.0015	15.7734	0.78190	0.0:0.0:1.0:0.0	.	190;138	B7Z8R5;Q86VD7	.;S2542_HUMAN	S	138	ENSP00000326693:G138S	ENSP00000326693:G138S	G	+	1	0	SLC25A42	19078109	1.000000	0.71417	0.038000	0.18304	0.701000	0.40568	8.756000	0.91651	2.056000	0.61249	0.491000	0.48974	GGC	.	.		0.647	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465931.1	NM_178526	
ZNF565	147929	hgsc.bcm.edu	37	19	36686037	36686037	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:36686037C>T	ENST00000355114.5	-	3	877	c.151G>A	c.(151-153)Gtg>Atg	p.V51M	ZNF565_ENST00000392173.2_Missense_Mutation_p.V11M|ZNF565_ENST00000304116.5_Missense_Mutation_p.V11M			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			TCTATGGCCACGTCCCTGAAT	0.433																																					p.V11M		Atlas-SNP	.											.	ZNF565	46	.	0			c.G31A						.						132.0	117.0	122.0					19																	36686037		2203	4300	6503	SO:0001583	missense	147929	exon3			TGGCCACGTCCCT	AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.151G>A	chr19.hg19:g.36686037C>T	ENSP00000347234:p.Val51Met	187.0	0.0		178.0	64.0	NM_001042474	B3KQ35|Q6NUS2	Missense_Mutation	SNP	ENST00000355114.5	hg19		.	.	.	.	.	.	.	.	.	.	C	18.89	3.720472	0.68959	.	.	ENSG00000196357	ENST00000392173;ENST00000304116;ENST00000355114	T;T;T	0.10382	2.88;2.88;2.88	4.44	4.44	0.53790	Krueppel-associated box (4);	0.000000	0.29676	U	0.011496	T	0.35422	0.0931	M	0.85041	2.73	0.25777	N	0.984779	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.14783	-1.0460	10	0.66056	D	0.02	.	12.4231	0.55532	0.0:1.0:0.0:0.0	.	51;11	B3KQ35;Q8N9K5	.;ZN565_HUMAN	M	11;11;51	ENSP00000376013:V11M;ENSP00000306869:V11M;ENSP00000347234:V51M	ENSP00000306869:V11M	V	-	1	0	ZNF565	41377877	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.814000	0.55643	2.276000	0.75962	0.555000	0.69702	GTG	.	.		0.433	ZNF565-003	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000451697.1	NM_152477	
CEACAM8	1088	hgsc.bcm.edu	37	19	43093887	43093887	+	Splice_Site	SNP	G	G	T	rs142428970		TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:43093887G>T	ENST00000244336.5	-	3	526	c.425C>A	c.(424-426)cCg>cAg	p.P142Q	LIPE-AS1_ENST00000594688.1_RNA|CEACAM8_ENST00000599005.1_Intron|LIPE-AS1_ENST00000594624.2_RNA	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	142	Ig-like V-type.				immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.P142L(1)		endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				GGGAGTCTCCGCTGTGCAGAA	0.527																																					p.P142Q		Atlas-SNP	.											CEACAM8,NS,carcinoma,0,1	CEACAM8	44	.	1	Substitution - Missense(1)	prostate(1)	c.C425A						.						132.0	130.0	131.0					19																	43093887		2203	4300	6503	SO:0001630	splice_region_variant	1088	exon3			GTCTCCGCTGTGC	D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.425-1C>A	chr19.hg19:g.43093887G>T		54.0	0.0		51.0	13.0	NM_001816	O60399|Q16574	Missense_Mutation	SNP	ENST00000244336.5	hg19	CCDS12610.1	.	.	.	.	.	.	.	.	.	.	g	3.053	-0.195049	0.06259	.	.	ENSG00000124469	ENST00000244336	T	0.19938	2.11	2.7	-1.51	0.08664	.	.	.	.	.	T	0.15392	0.0371	L	0.42686	1.345	0.09310	N	1	B	0.21452	0.056	B	0.29440	0.102	T	0.39272	-0.9622	9	0.22706	T	0.39	.	4.7298	0.12959	0.143:0.4359:0.4211:0.0	.	142	P31997	CEAM8_HUMAN	Q	142	ENSP00000244336:P142Q	ENSP00000244336:P142Q	P	-	2	0	CEACAM8	47785727	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-2.633000	0.00869	-0.343000	0.08351	-0.657000	0.03884	CCG	.	G|1.000;A|0.000		0.527	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321430.1		Missense_Mutation
MYPOP	339344	hgsc.bcm.edu	37	19	46394252	46394252	+	Missense_Mutation	SNP	C	C	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:46394252C>T	ENST00000322217.5	-	3	915	c.829G>A	c.(829-831)Gcc>Acc	p.A277T		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	277	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						AGGGTGCCGGCCAGCTCCCGG	0.692																																					p.A277T		Atlas-SNP	.											.	MYPOP	23	.	0			c.G829A						.						8.0	7.0	7.0					19																	46394252		2159	4222	6381	SO:0001583	missense	339344	exon3			TGCCGGCCAGCTC	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.829G>A	chr19.hg19:g.46394252C>T	ENSP00000325402:p.Ala277Thr	88.0	0.0		101.0	44.0	NM_001012643		Missense_Mutation	SNP	ENST00000322217.5	hg19	CCDS33055.1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.808608	0.31961	.	.	ENSG00000176182	ENST00000322217	T	0.45668	0.89	4.5	3.45	0.39498	.	0.416780	0.19022	N	0.124790	T	0.18718	0.0449	N	0.08118	0	0.23645	N	0.997215	B	0.26363	0.147	B	0.20384	0.029	T	0.20706	-1.0267	10	0.11182	T	0.66	-3.7428	8.404	0.32603	0.0:0.8886:0.0:0.1114	.	277	Q86VE0	MYPOP_HUMAN	T	277	ENSP00000325402:A277T	ENSP00000325402:A277T	A	-	1	0	MYPOP	51086092	0.997000	0.39634	0.988000	0.46212	0.989000	0.77384	1.362000	0.34148	0.866000	0.35629	0.561000	0.74099	GCC	.	.		0.692	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461684.1	NM_001012643	
KLK9	284366	hgsc.bcm.edu	37	19	51507011	51507011	+	Silent	SNP	C	C	T	rs147491832		TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:51507011C>T	ENST00000594211.1	-	4	552	c.552G>A	c.(550-552)tcG>tcA	p.S184S	KLK8_ENST00000593490.1_5'Flank|KLK8_ENST00000320838.5_5'Flank|KLK8_ENST00000600767.1_5'Flank|KLK8_ENST00000391806.2_5'Flank|KLK8_ENST00000347619.4_5'Flank|CTB-147C22.9_ENST00000594512.1_RNA|KLK9_ENST00000376832.4_Silent_p.S184S|KLK9_ENST00000250366.6_Silent_p.S184S|KLK8_ENST00000291726.7_5'Flank			Q9UKQ9	KLK9_HUMAN	kallikrein-related peptidase 9	184	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7		all_neural(266;0.0652)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		GCATGCTGTCCGAGATGTGTC	0.567																																					p.S184S		Atlas-SNP	.											.	KLK9	27	.	0			c.G552A						.	C		1,4405	2.1+/-5.4	0,1,2202	106.0	79.0	88.0		552	-9.4	0.0	19	dbSNP_134	88	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	KLK9	NM_012315.1		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		184/251	51507011	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	284366	exon4			GCTGTCCGAGATG	AF135026	CCDS12816.1	19q13.33	2008-02-05	2006-10-27					"""Kallikreins"""	6370	protein-coding gene	gene with protein product		605504	"""kallikrein 9"""			16800724, 16800723	Standard	NM_012315		Approved	KLK-L3	uc002pux.1	Q9UKQ9		ENST00000594211.1:c.552G>A	chr19.hg19:g.51507011C>T		99.0	0.0		111.0	37.0	NM_012315	Q6QA55	Silent	SNP	ENST00000594211.1	hg19	CCDS12816.1																																																																																			.	C|1.000;T|0.000		0.567	KLK9-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465226.1	NM_012315	
VN1R2	317701	hgsc.bcm.edu	37	19	53761895	53761895	+	Silent	SNP	G	G	T			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr19:53761895G>T	ENST00000341702.3	+	1	351	c.267G>T	c.(265-267)ggG>ggT	p.G89G		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	89					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		aacctgtggggctggacccta	0.423																																					p.G89G		Atlas-SNP	.											.	VN1R2	71	.	0			c.G267T						.						46.0	48.0	48.0					19																	53761895		2184	4282	6466	SO:0001819	synonymous_variant	317701	exon1			TGTGGGGCTGGAC	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.267G>T	chr19.hg19:g.53761895G>T		133.0	0.0		150.0	49.0	NM_173856	A1L411|Q8TDU4	Silent	SNP	ENST00000341702.3	hg19	CCDS12862.1																																																																																			.	.		0.423	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
OLIG2	10215	hgsc.bcm.edu	37	21	34399755	34399755	+	Silent	SNP	C	C	A			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr21:34399755C>A	ENST00000333337.3	+	1	1513	c.585C>A	c.(583-585)tcC>tcA	p.S195S	OLIG2_ENST00000382357.3_Silent_p.S195S|AP000282.2_ENST00000454622.1_RNA|AP000282.2_ENST00000420356.1_RNA			Q13516	OLIG2_HUMAN	oligodendrocyte lineage transcription factor 2	195					myelination (GO:0042552)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|positive regulation of oligodendrocyte differentiation (GO:0048714)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|thalamus development (GO:0021794)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|central_nervous_system(2)	3						TGGCGCACTCCGCGCCCCTGC	0.751			T	TRA@	T-ALL																																p.S195S		Atlas-SNP	.		Dom	yes		21	21q22.11	10215	oligodendrocyte lineage transcription factor 2 (BHLHB1)		L	.	OLIG2	22	.	0			c.C585A						.						4.0	4.0	4.0					21																	34399755		1684	3217	4901	SO:0001819	synonymous_variant	10215	exon2			GCACTCCGCGCCC	U48250	CCDS13620.1	21q22.11	2013-05-21	2001-12-04	2001-12-07	ENSG00000205927	ENSG00000205927		"""Basic helix-loop-helix proteins"""	9398	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 2"", ""protein kinase C binding protein 2"", ""human protein kinase C-binding protein RACK17"", ""basic domain, helix-loop-helix protein, class B, 1"""	606386	"""protein kinase C binding protein 2"""	PRKCBP2, BHLHB1		11526205	Standard	NM_005806		Approved	RACK17, OLIGO2, bHLHe19	uc002yqx.2	Q13516	OTTHUMG00000065032	ENST00000333337.3:c.585C>A	chr21.hg19:g.34399755C>A		34.0	0.0		46.0	15.0	NM_005806	B3KRF3|Q05BP9|Q49AL3|Q86X04|Q9NZ14	Silent	SNP	ENST00000333337.3	hg19	CCDS13620.1																																																																																			.	.		0.751	OLIG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139663.1	NM_005806	
SRCAP	10847	hgsc.bcm.edu	37	16	30748580	30748584	+	Frame_Shift_Del	DEL	CAAGG	CAAGG	-			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	CAAGG	CAAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr16:30748580_30748584delCAAGG	ENST00000262518.4	+	34	7604_7608	c.7219_7223delCAAGG	c.(7219-7224)caagggfs	p.QG2407fs	SRCAP_ENST00000395059.2_Frame_Shift_Del_p.QG2345fs|SRCAP_ENST00000344771.4_Frame_Shift_Del_p.QG2249fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2407					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGCTGAGACTCAAGGGGCAAACCAC	0.639																																					p.2406_2408del		Atlas-INDEL	.											.	SRCAP	298	.	0			c.7218_7222del						.																																			SO:0001589	frameshift_variant	10847	exon34			.	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.7219_7223delCAAGG	chr16.hg19:g.30748580_30748584delCAAGG	ENSP00000262518:p.Gln2407fs	92.0	0.0		102.0	33.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Del	DEL	ENST00000262518.4	hg19	CCDS10689.2																																																																																			.	.		0.639	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
RASGRF2	5924	hgsc.bcm.edu	37	5	80388721	80388721	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr5:80388721delT	ENST00000265080.4	+	10	1559	c.1492delT	c.(1492-1494)tttfs	p.F498fs		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	498	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		ATGCTTCTTATTTACAAAACA	0.393																																					p.L497fs		Atlas-INDEL	.											.	RASGRF2	165	.	0			c.1491delA						.						113.0	114.0	113.0					5																	80388721		2203	4300	6503	SO:0001589	frameshift_variant	5924	exon10			.	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1492delT	chr5.hg19:g.80388721delT	ENSP00000265080:p.Phe498fs	129.0	0.0		135.0	36.0	NM_006909	B9EG89|Q9UK56	Frame_Shift_Del	DEL	ENST00000265080.4	hg19	CCDS4052.1																																																																																			.	.		0.393	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
TP73	7161	hgsc.bcm.edu	37	1	3599744	3599744	+	Splice_Site	DEL	G	G	-			TCGA-GJ-A9DB-01A-11D-A36X-10	TCGA-GJ-A9DB-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	84dd6525-b3f4-4225-854b-d8ea04ae087d	1feb671e-5b85-48f9-b96b-19e5a877a13e	g.chr1:3599744delG	ENST00000378295.4	+	3	341	c.186delG	c.(184-186)atg>at	p.M62fs	TP73_ENST00000604074.1_Splice_Site_p.M62fs|TP73_ENST00000346387.4_Splice_Site_p.M62fs|TP73_ENST00000604479.1_Splice_Site_p.M62fs|TP73_ENST00000357733.3_Splice_Site_p.M62fs|TP73_ENST00000354437.4_Splice_Site_p.M62fs|TP73_ENST00000603362.1_Splice_Site_p.M62fs	NM_001204185.1|NM_005427.3	NP_001191114.1|NP_005418.1	O15350	P73_HUMAN	tumor protein p73	62					activation of MAPK activity (GO:0000187)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|cerebrospinal fluid secretion (GO:0033326)|digestive tract morphogenesis (GO:0048546)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|hippocampus development (GO:0021766)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|kidney development (GO:0001822)|mismatch repair (GO:0006298)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron development (GO:0048666)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell size (GO:0045793)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein tetramerization (GO:0051262)|release of cytochrome c from mitochondria (GO:0001836)|response to gamma radiation (GO:0010332)|response to organonitrogen compound (GO:0010243)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|lung(8)|ovary(1)|prostate(1)	20	all_cancers(77;0.0395)|Ovarian(185;0.0634)|Lung NSC(156;0.188)|all_lung(157;0.198)	all_epithelial(116;7.42e-17)|all_lung(118;1.86e-06)|Lung NSC(185;0.000163)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.109)|Ovarian(437;0.127)		Epithelial(90;5.57e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.87e-22)|GBM - Glioblastoma multiforme(42;5.72e-16)|Colorectal(212;2.22e-05)|COAD - Colon adenocarcinoma(227;8.48e-05)|Kidney(185;0.000539)|BRCA - Breast invasive adenocarcinoma(365;0.000868)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.00751)|Lung(427;0.226)		CATCTGTCATGGTGAGTGGGG	0.587																																					p.M62fs		Atlas-INDEL	.											.	TP73	54	.	0			c.185delT						.						75.0	75.0	75.0					1																	3599744		2203	4300	6503	SO:0001630	splice_region_variant	7161	exon3			.	AB055065	CCDS49.1, CCDS44049.1, CCDS44050.1, CCDS44051.1, CCDS55566.1, CCDS55567.1, CCDS55568.1, CCDS55569.1, CCDS59965.1	1p36.3	2010-06-15			ENSG00000078900	ENSG00000078900			12003	protein-coding gene	gene with protein product		601990				9296498, 9288759	Standard	NM_001204186		Approved	P73	uc001akp.3	O15350	OTTHUMG00000000610	ENST00000378295.4:c.186+1G>-	chr1.hg19:g.3599744delG		110.0	0.0		84.0	25.0	NM_005427	B7Z7J4|B7Z8Z1|B7Z9C1|C9J521|O15351|Q17RN8|Q5TBV5|Q5TBV6|Q8NHW9|Q8TDY5|Q8TDY6|Q9NTK8	Frame_Shift_Del	DEL	ENST00000378295.4	hg19	CCDS49.1																																																																																			.	.		0.587	TP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001468.4	NM_005427	Frame_Shift_Del
