#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
IFI16	3428	hgsc.bcm.edu	37	1	159002321	159002321	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr1:159002321A>G	ENST00000295809.7	+	7	1424	c.1169A>G	c.(1168-1170)aAa>aGa	p.K390R	IFI16_ENST00000448393.2_Missense_Mutation_p.K390R|IFI16_ENST00000368132.3_Missense_Mutation_p.K390R|IFI16_ENST00000340979.6_Missense_Mutation_p.K390R|IFI16_ENST00000359709.3_Missense_Mutation_p.K334R|IFI16_ENST00000430894.2_Missense_Mutation_p.K338R|IFI16_ENST00000368131.4_Missense_Mutation_p.K390R			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	390	Interaction with TP53 C-terminus.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					CAGATAAAGAAAAAAACAAAC	0.383																																					p.K390R		Atlas-SNP	.											.	IFI16	111	.	0			c.A1169G						.						56.0	57.0	57.0					1																	159002321		2203	4300	6503	SO:0001583	missense	3428	exon7			TAAAGAAAAAAAC	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1169A>G	chr1.hg19:g.159002321A>G	ENSP00000295809:p.Lys390Arg	36.0	0.0		41.0	4.0	NM_005531	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.414|7.414	0.635294|0.635294	0.14322|0.14322	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000448393|ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	.|T;T;T;T;T	.|0.06068	.|3.58;3.53;3.53;3.53;3.35	1.9|1.9	-0.624|-0.624	0.11552|0.11552	.|.	.|.	.|.	.|.	.|.	T|T	0.02888|0.02888	0.0086|0.0086	L|L	0.48642|0.48642	1.525|1.525	0.09310|0.09310	N|N	1|1	.|B;P	.|0.47762	.|0.009;0.9	.|B;P	.|0.48795	.|0.001;0.59	T|T	0.36432|0.36432	-0.9748|-0.9748	6|9	0.35671|0.45353	T|T	0.21|0.12	.|.	4.2894|4.2894	0.10870|0.10870	0.601:0.0:0.399:0.0|0.601:0.0:0.399:0.0	.|.	.|338;390	.|E7EPR3;Q16666-2	.|.;.	E|R	211|390;390;390;390;338	.|ENSP00000295809:K390R;ENSP00000342741:K390R;ENSP00000357113:K390R;ENSP00000357114:K390R;ENSP00000394935:K338R	ENSP00000404325:K211E|ENSP00000295809:K390R	K|K	+|+	1|2	0|0	IFI16|IFI16	157268945|157268945	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.690000|0.690000	0.40134|0.40134	0.185000|0.185000	0.16958|0.16958	-0.173000|-0.173000	0.10761|0.10761	0.379000|0.379000	0.24179|0.24179	AAA|AAA	.	.		0.383	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
PLXNA2	5362	hgsc.bcm.edu	37	1	208269429	208269429	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr1:208269429C>A	ENST00000367033.3	-	8	2684	c.1927G>T	c.(1927-1929)Ggg>Tgg	p.G643W		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	643					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AATATCTTCCCTGTCTCCTTG	0.498																																					p.G643W		Atlas-SNP	.											.	PLXNA2	178	.	0			c.G1927T						.						256.0	269.0	265.0					1																	208269429		2203	4300	6503	SO:0001583	missense	5362	exon8			TCTTCCCTGTCTC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1927G>T	chr1.hg19:g.208269429C>A	ENSP00000356000:p.Gly643Trp	109.0	0.0		179.0	17.0	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.774232	0.90108	.	.	ENSG00000076356	ENST00000367033	T	0.01092	5.35	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.08582	0.0213	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00766	-1.1575	10	0.87932	D	0	.	18.6344	0.91371	0.0:1.0:0.0:0.0	.	643	O75051	PLXA2_HUMAN	W	643	ENSP00000356000:G643W	ENSP00000356000:G643W	G	-	1	0	PLXNA2	206336052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.650000	0.67944	2.635000	0.89317	0.650000	0.86243	GGG	.	.		0.498	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
LPGAT1	9926	hgsc.bcm.edu	37	1	211952355	211952355	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr1:211952355T>C	ENST00000366997.4	-	6	985	c.759A>G	c.(757-759)atA>atG	p.I253M	LPGAT1_ENST00000366996.1_Missense_Mutation_p.I253M	NM_014873.2	NP_055688.1	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1	253					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		TCGTTGTATCTATTATCCACT	0.343																																					p.I253M		Atlas-SNP	.											.	LPGAT1	32	.	0			c.A759G						.						152.0	156.0	155.0					1																	211952355		2203	4300	6503	SO:0001583	missense	9926	exon6			TGTATCTATTATC	D86960	CCDS31018.1	1q32.3	2008-05-14	2004-11-25	2004-11-26	ENSG00000123684	ENSG00000123684			28985	protein-coding gene	gene with protein product		610473	"""family with sequence similarity 34, member A"""	FAM34A		9039502, 15485873	Standard	NM_014873		Approved	KIAA0205, FAM34A1, NET8	uc001hiv.3	Q92604	OTTHUMG00000037120	ENST00000366997.4:c.759A>G	chr1.hg19:g.211952355T>C	ENSP00000355964:p.Ile253Met	60.0	0.0		80.0	4.0	NM_014873	Q53YL2	Missense_Mutation	SNP	ENST00000366997.4	hg19	CCDS31018.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.975289	0.92919	.	.	ENSG00000123684	ENST00000366997;ENST00000366996	T;T	0.32272	1.46;1.46	5.89	5.89	0.94794	.	0.036291	0.85682	D	0.000000	T	0.50735	0.1633	M	0.73962	2.25	0.80722	D	1	D	0.57899	0.981	P	0.55161	0.77	T	0.55042	-0.8202	10	0.72032	D	0.01	-29.7876	16.3625	0.83273	0.0:0.0:0.0:1.0	.	253	Q92604	LGAT1_HUMAN	M	253	ENSP00000355964:I253M;ENSP00000355963:I253M	ENSP00000355963:I253M	I	-	3	3	LPGAT1	210018978	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.244000	0.43124	2.265000	0.75225	0.449000	0.29647	ATA	.	.		0.343	LPGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090150.1	NM_014873	
RAB4A	5867	hgsc.bcm.edu	37	1	229434759	229434759	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr1:229434759G>T	ENST00000366690.4	+	6	689	c.481G>T	c.(481-483)Gag>Tag	p.E161*	RAB4A_ENST00000473894.1_3'UTR	NM_004578.2	NP_004569.2	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	161					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein transporter activity (GO:0008565)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				GCTCACAGGGGAGAATGTAGA	0.333																																					p.E161X	Esophageal Squamous(11;250 603 9619 16563)	Atlas-SNP	.											.	RAB4A	29	.	0			c.G481T						.						119.0	117.0	118.0					1																	229434759		2203	4300	6503	SO:0001587	stop_gained	5867	exon6			ACAGGGGAGAATG	BC004309	CCDS31050.1, CCDS73046.1	1q42-q43	2014-04-03		2002-02-28	ENSG00000168118	ENSG00000168118		"""RAB, member RAS oncogene"""	9781	protein-coding gene	gene with protein product		179511		RAB4			Standard	NM_004578		Approved	HRES-1/RAB4	uc001hth.4	P20338	OTTHUMG00000037627	ENST00000366690.4:c.481G>T	chr1.hg19:g.229434759G>T	ENSP00000355651:p.Glu161*	85.0	0.0		155.0	23.0	NM_004578	Q5T7P7|Q9BQ44	Nonsense_Mutation	SNP	ENST00000366690.4	hg19	CCDS31050.1	.	.	.	.	.	.	.	.	.	.	G	38	7.082605	0.98051	.	.	ENSG00000168118	ENST00000366690	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	19.5035	0.95105	0.0:0.0:1.0:0.0	.	.	.	.	X	161	.	ENSP00000355651:E161X	E	+	1	0	RAB4A	227501382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.781000	0.99029	2.674000	0.91012	0.655000	0.94253	GAG	.	.		0.333	RAB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091727.3	NM_004578	
APOB	338	hgsc.bcm.edu	37	2	21259995	21259995	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr2:21259995G>A	ENST00000233242.1	-	6	797	c.670C>T	c.(670-672)Cca>Tca	p.P224S	APOB_ENST00000399256.4_Missense_Mutation_p.P224S	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	224	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAGCAAGTGGGCTGATGCCT	0.498																																					p.P224S		Atlas-SNP	.											.	APOB	761	.	0			c.C670T						.						154.0	124.0	134.0					2																	21259995		2203	4300	6503	SO:0001583	missense	338	exon6			CAAGTGGGCTGAT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.670C>T	chr2.hg19:g.21259995G>A	ENSP00000233242:p.Pro224Ser	204.0	0.0		219.0	24.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631711	0.87660	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.38401	1.14;1.14	5.64	5.64	0.86602	Lipid transport protein, beta-sheet shell (1);Lipid transport protein, N-terminal (3);Vitellinogen, beta-sheet N-terminal (1);	0.000000	0.56097	D	0.000027	T	0.65333	0.2681	M	0.80847	2.515	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.66444	-0.5922	10	0.59425	D	0.04	.	20.0869	0.97801	0.0:0.0:1.0:0.0	.	224	P04114	APOB_HUMAN	S	224	ENSP00000233242:P224S;ENSP00000382200:P224S	ENSP00000233242:P224S	P	-	1	0	APOB	21113500	1.000000	0.71417	0.998000	0.56505	0.732000	0.41865	8.485000	0.90448	2.831000	0.97527	0.650000	0.86243	CCA	.	.		0.498	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
CIB4	130106	hgsc.bcm.edu	37	2	26852279	26852279	+	Splice_Site	SNP	C	C	T	rs374300070		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr2:26852279C>T	ENST00000288861.4	-	3	238	c.185G>A	c.(184-186)cGg>cAg	p.R62Q		NM_001029881.1	NP_001025052.1	A0PJX0	CIB4_HUMAN	calcium and integrin binding family member 4	62	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGACTCACCCGCAGAGCTGG	0.627																																					p.R62Q		Atlas-SNP	.											.	CIB4	15	.	0			c.G185A						.						67.0	47.0	54.0					2																	26852279		2201	4290	6491	SO:0001630	splice_region_variant	130106	exon3			CTCACCCGCAGAG		CCDS33160.1	2p23.3	2013-01-10			ENSG00000157884	ENSG00000157884		"""EF-hand domain containing"""	33703	protein-coding gene	gene with protein product		610646				15574431	Standard	NM_001029881		Approved		uc002rhm.3	A0PJX0	OTTHUMG00000151993	ENST00000288861.4:c.186+1G>A	chr2.hg19:g.26852279C>T		77.0	0.0		96.0	19.0	NM_001029881	B2RU18	Missense_Mutation	SNP	ENST00000288861.4	hg19	CCDS33160.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442532	0.63067	.	.	ENSG00000157884	ENST00000288861	T	0.66638	-0.22	5.26	5.26	0.73747	EF-hand-like domain (1);	0.000000	0.53938	D	0.000044	T	0.51007	0.1649	L	0.28344	0.845	0.80722	D	1	B	0.33073	0.396	B	0.22880	0.042	T	0.54139	-0.8338	10	0.44086	T	0.13	.	14.3709	0.66838	0.0:1.0:0.0:0.0	.	62	A0PJX0	CIB4_HUMAN	Q	62	ENSP00000288861:R62Q	ENSP00000288861:R62Q	R	-	2	0	CIB4	26705783	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.458000	0.53014	2.459000	0.83118	0.563000	0.77884	CGG	.	.		0.627	CIB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324709.1		Missense_Mutation
ETAA1	54465	hgsc.bcm.edu	37	2	67631603	67631603	+	Missense_Mutation	SNP	G	G	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr2:67631603G>C	ENST00000272342.5	+	5	1919	c.1789G>C	c.(1789-1791)Gat>Cat	p.D597H	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	597						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TCATCAATTAGATAATACCTG	0.353																																					p.D597H		Atlas-SNP	.											.	ETAA1	88	.	0			c.G1789C						.						101.0	105.0	104.0					2																	67631603		2202	4300	6502	SO:0001583	missense	54465	exon5			CAATTAGATAATA	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1789G>C	chr2.hg19:g.67631603G>C	ENSP00000272342:p.Asp597His	73.0	0.0		81.0	11.0	NM_019002	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	hg19	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	G	11.77	1.738893	0.30774	.	.	ENSG00000143971	ENST00000272342	T	0.18016	2.24	5.83	4.95	0.65309	.	0.238496	0.38605	N	0.001624	T	0.22820	0.0551	L	0.39898	1.24	0.45150	D	0.998163	D	0.53151	0.958	P	0.51135	0.66	T	0.01010	-1.1482	10	0.66056	D	0.02	-17.7595	12.0508	0.53505	0.0664:0.1221:0.8115:0.0	.	597	Q9NY74	ETAA1_HUMAN	H	597	ENSP00000272342:D597H	ENSP00000272342:D597H	D	+	1	0	ETAA1	67485107	0.999000	0.42202	0.413000	0.26509	0.254000	0.26022	2.979000	0.49313	1.456000	0.47831	0.655000	0.94253	GAT	.	.		0.353	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
PMS1	5378	hgsc.bcm.edu	37	2	190742031	190742031	+	Missense_Mutation	SNP	A	A	G	rs537745271		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr2:190742031A>G	ENST00000441310.2	+	13	2901	c.2668A>G	c.(2668-2670)Atg>Gtg	p.M890V	PMS1_ENST00000409823.3_Missense_Mutation_p.M851V|PMS1_ENST00000447232.2_Missense_Mutation_p.M728V|PMS1_ENST00000432292.3_Missense_Mutation_p.M714V|PMS1_ENST00000418224.3_Missense_Mutation_p.M714V	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	890					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)	p.M890L(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			ACAATTACCCATGTACTTATC	0.403			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																													p.M890V		Atlas-SNP	.	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	PMS1,NS,carcinoma,0,1	PMS1	78	.	1	Substitution - Missense(1)	lung(1)	c.A2668G						.						129.0	119.0	122.0					2																	190742031		2203	4300	6503	SO:0001583	missense	5378	exon13			TTACCCATGTACT		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.2668A>G	chr2.hg19:g.190742031A>G	ENSP00000406490:p.Met890Val	111.0	1.0		152.0	16.0	NM_000534	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	ENST00000441310.2	hg19	CCDS2302.1	.	.	.	.	.	.	.	.	.	.	A	13.46	2.245289	0.39697	.	.	ENSG00000064933	ENST00000441310;ENST00000418224;ENST00000409823;ENST00000447232;ENST00000432292;ENST00000409593	D;D;D;D;D;D	0.96168	-2.24;-1.93;-2.4;-2.77;-1.93;-3.93	5.87	3.45	0.39498	.	0.252228	0.46145	D	0.000312	D	0.90024	0.6885	L	0.40543	1.245	0.31561	N	0.657558	B;B;B;B;B	0.26195	0.01;0.029;0.05;0.144;0.029	B;B;B;B;B	0.21546	0.002;0.021;0.013;0.035;0.013	D	0.84270	0.0488	10	0.20046	T	0.44	-20.2265	7.2379	0.26079	0.6946:0.1118:0.0:0.1936	.	206;513;851;728;890	Q5FBZ4;Q5FBZ6;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;PMS1_HUMAN	V	890;714;851;728;714;513	ENSP00000406490:M890V;ENSP00000404492:M714V;ENSP00000387125:M851V;ENSP00000401064:M728V;ENSP00000398378:M714V;ENSP00000387169:M513V	ENSP00000387169:M513V	M	+	1	0	PMS1	190450276	0.671000	0.27521	1.000000	0.80357	0.981000	0.71138	0.811000	0.27198	2.371000	0.80710	0.533000	0.62120	ATG	.	.		0.403	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2		
USP4	7375	hgsc.bcm.edu	37	3	49321560	49321560	+	Silent	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr3:49321560G>A	ENST00000265560.4	-	19	2446	c.2400C>T	c.(2398-2400)ccC>ccT	p.P800P	USP4_ENST00000351842.4_Silent_p.P753P	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	800	USP.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TCTTACAGTTGGGACAGTACC	0.517																																					p.P800P		Atlas-SNP	.											.	USP4	72	.	0			c.C2400T						.						122.0	108.0	113.0					3																	49321560		2203	4300	6503	SO:0001819	synonymous_variant	7375	exon19			ACAGTTGGGACAG	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.2400C>T	chr3.hg19:g.49321560G>A		202.0	0.0		253.0	37.0	NM_003363	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Silent	SNP	ENST00000265560.4	hg19	CCDS2793.1	.	.	.	.	.	.	.	.	.	.	G	8.788	0.929803	0.18131	.	.	ENSG00000114316	ENST00000431357	.	.	.	5.36	2.1	0.27182	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-19.5461	5.4554	0.16588	0.2197:0.3045:0.4758:0.0	.	.	.	.	X	539	.	.	Q	-	1	0	USP4	49296564	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.780000	0.38634	0.633000	0.30452	0.655000	0.94253	CAA	.	.		0.517	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346069.1	NM_199443	
UBA7	7318	hgsc.bcm.edu	37	3	49849633	49849633	+	Missense_Mutation	SNP	C	C	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr3:49849633C>A	ENST00000333486.3	-	7	859	c.701G>T	c.(700-702)gGg>gTg	p.G234V	UBA7_ENST00000494212.1_5'Flank	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	234	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTCCAGGGACCCATCCTCTGA	0.517																																					p.G234V		Atlas-SNP	.											.	UBA7	64	.	0			c.G701T						.						151.0	140.0	143.0					3																	49849633		2203	4300	6503	SO:0001583	missense	7318	exon7			AGGGACCCATCCT	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.701G>T	chr3.hg19:g.49849633C>A	ENSP00000333266:p.Gly234Val	165.0	0.0		196.0	32.0	NM_003335	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	hg19	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.545034	0.45280	.	.	ENSG00000182179	ENST00000333486	T	0.28454	1.61	5.78	5.78	0.91487	Molybdenum cofactor biosynthesis, MoeB (1);	0.583161	0.21006	N	0.081779	T	0.35158	0.0922	M	0.68317	2.08	0.52099	D	0.999944	B	0.22683	0.073	B	0.25759	0.063	T	0.14615	-1.0466	10	0.66056	D	0.02	-8.2445	12.4467	0.55654	0.1674:0.8326:0.0:0.0	.	234	P41226	UBA7_HUMAN	V	234	ENSP00000333266:G234V	ENSP00000333266:G234V	G	-	2	0	UBA7	49824637	0.000000	0.05858	0.787000	0.31911	0.906000	0.53458	0.635000	0.24629	2.739000	0.93911	0.561000	0.74099	GGG	.	.		0.517	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
DNAH12	201625	hgsc.bcm.edu	37	3	57391435	57391435	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr3:57391435T>C	ENST00000351747.2	-	41	6644	c.6464A>G	c.(6463-6465)cAt>cGt	p.H2155R		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2155					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TTCTTTAAAATGGTCCTTTAT	0.358																																					p.H2155R		Atlas-SNP	.											.	DNAH12	182	.	0			c.A6464G						.						76.0	60.0	65.0					3																	57391435		692	1591	2283	SO:0001583	missense	201625	exon41			TTAAAATGGTCCT	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.6464A>G	chr3.hg19:g.57391435T>C	ENSP00000295937:p.His2155Arg	90.0	0.0		121.0	26.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	hg19		.	.	.	.	.	.	.	.	.	.	T	14.26	2.483586	0.44147	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.23754	2.04;1.89	5.92	5.92	0.95590	.	.	.	.	.	T	0.31888	0.0811	M	0.71206	2.165	0.80722	D	1	B	0.24258	0.1	B	0.24006	0.05	T	0.05273	-1.0895	9	0.29301	T	0.29	.	16.3678	0.83341	0.0:0.0:0.0:1.0	.	2155	Q6ZR08	DYH12_HUMAN	R	2155;2174	ENSP00000295937:H2155R;ENSP00000418137:H2174R	ENSP00000295937:H2155R	H	-	2	0	DNAH12	57366475	1.000000	0.71417	0.999000	0.59377	0.489000	0.33432	7.896000	0.87350	2.254000	0.74563	0.528000	0.53228	CAT	.	.		0.358	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
LRRC58	116064	hgsc.bcm.edu	37	3	120067725	120067725	+	Silent	SNP	G	G	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr3:120067725G>T	ENST00000295628.3	-	1	461	c.366C>A	c.(364-366)ctC>ctA	p.L122L	RP11-174O3.3_ENST00000494869.1_RNA	NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	122										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		TGAGCACCTGGAGGCTGCGGC	0.701																																					p.L122L		Atlas-SNP	.											.	LRRC58	18	.	0			c.C366A						.						8.0	11.0	10.0					3																	120067725		1915	4114	6029	SO:0001819	synonymous_variant	116064	exon1			CACCTGGAGGCTG	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.366C>A	chr3.hg19:g.120067725G>T		31.0	0.0		73.0	14.0	NM_001099678		Silent	SNP	ENST00000295628.3	hg19	CCDS46892.1																																																																																			.	.		0.701	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296	
FAM157A	728262	hgsc.bcm.edu	37	3	197880164	197880164	+	lincRNA	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr3:197880164G>A	ENST00000437428.2	+	0	44							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						agcagcagcagcagcagcaAC	0.527																																					p.Q81Q		Atlas-SNP	.											.	FAM157A	4	.	0			c.G243A						.						3.0	6.0	5.0					3																	197880164		474	1113	1587			728262	exon2			GCAGCAGCAGCAG			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			chr3.hg19:g.197880164G>A		355.0	0.0		431.0	48.0	NM_001145248		Silent	SNP	ENST00000437428.2	hg19																																																																																				.	.		0.527	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
SLC10A7	84068	hgsc.bcm.edu	37	4	147179851	147179851	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr4:147179851C>T	ENST00000507030.1	-	11	985	c.986G>A	c.(985-987)aGg>aAg	p.R329K	SLC10A7_ENST00000264986.3_3'UTR|SLC10A7_ENST00000335472.7_Missense_Mutation_p.R329K|SLC10A7_ENST00000432059.2_Missense_Mutation_p.R316K|SLC10A7_ENST00000394062.3_Missense_Mutation_p.R329K			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7	329					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					CACCTTCTGCCTTGATACCAT	0.423																																					p.R329K		Atlas-SNP	.											.	SLC10A7	32	.	0			c.G986A						.						140.0	132.0	135.0					4																	147179851		2203	4300	6503	SO:0001583	missense	84068	exon11			TTCTGCCTTGATA	AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.986G>A	chr4.hg19:g.147179851C>T	ENSP00000421275:p.Arg329Lys	64.0	0.0		97.0	12.0	NM_001029998	A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Missense_Mutation	SNP	ENST00000507030.1	hg19	CCDS34073.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.340848	0.60963	.	.	ENSG00000120519	ENST00000432059;ENST00000335472;ENST00000507030;ENST00000394062	.	.	.	5.6	5.6	0.85130	.	0.044235	0.85682	D	0.000000	T	0.38108	0.1028	N	0.08118	0	0.80722	D	1	B;B;B	0.21071	0.022;0.013;0.051	B;B;B	0.18871	0.023;0.007;0.023	T	0.32561	-0.9902	9	0.07813	T	0.8	-15.5529	19.9855	0.97347	0.0:1.0:0.0:0.0	.	316;329;329	Q0GE19-3;Q0GE19;Q0GE19-2	.;NTCP7_HUMAN;.	K	316;329;329;329	.	ENSP00000334594:R329K	R	-	2	0	SLC10A7	147399301	1.000000	0.71417	0.984000	0.44739	0.927000	0.56198	2.309000	0.43699	2.806000	0.96561	0.655000	0.94253	AGG	.	.		0.423	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000366932.1	NM_032128	
SLC22A5	6584	hgsc.bcm.edu	37	5	131721132	131721132	+	Missense_Mutation	SNP	C	C	G			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr5:131721132C>G	ENST00000245407.3	+	4	986	c.765C>G	c.(763-765)gaC>gaG	p.D255E	SLC22A5_ENST00000435065.2_Missense_Mutation_p.D279E	NM_003060.3	NP_003051.1	O76082	S22A5_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 5	255					carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|positive regulation of intestinal epithelial structure maintenance (GO:0060731)|quaternary ammonium group transport (GO:0015697)|quorum sensing involved in interaction with host (GO:0052106)|sodium ion transport (GO:0006814)|sodium-dependent organic cation transport (GO:0070715)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|drug transmembrane transporter activity (GO:0015238)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|symporter activity (GO:0015293)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|stomach(1)	8		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Acetylcarnitine(DB08842)|Aminohippurate(DB00345)|Amphetamine(DB00182)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benzylpenicillin(DB01053)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefradine(DB01333)|Ceftazidime(DB00438)|Cephalexin(DB00567)|Cephaloglycin(DB00689)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Creatine(DB00148)|Cyclacillin(DB01000)|Dactinomycin(DB00970)|Desipramine(DB01151)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Epinephrine(DB00668)|Furosemide(DB00695)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Mepyramine(DB06691)|Methamphetamine(DB01577)|Niacin(DB00627)|Nicotine(DB00184)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Probenecid(DB01032)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Sparfloxacin(DB01208)|Thiamine(DB00152)|Tiotropium(DB01409)|Valproic Acid(DB00313)|Verapamil(DB00661)	TCATCCGAGACTGGCGGATGC	0.532											OREG0016766	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D255E		Atlas-SNP	.											.	SLC22A5	34	.	0			c.C765G						.						129.0	118.0	121.0					5																	131721132		2203	4300	6503	SO:0001583	missense	6584	exon4			CCGAGACTGGCGG	AF057164	CCDS4154.1	5q23.3	2013-05-22	2008-01-11		ENSG00000197375	ENSG00000197375		"""Solute carriers"""	10969	protein-coding gene	gene with protein product		603377		CDSP		9618255, 9916797, 9685390	Standard	NM_003060		Approved	OCTN2, SCD	uc003kww.4	O76082	OTTHUMG00000059634	ENST00000245407.3:c.765C>G	chr5.hg19:g.131721132C>G	ENSP00000245407:p.Asp255Glu	151.0	0.0	1589	274.0	78.0	NM_003060	A2Q0V1|B2R844|D3DQ87|Q6ZQZ8|Q96EH6	Missense_Mutation	SNP	ENST00000245407.3	hg19	CCDS4154.1	.	.	.	.	.	.	.	.	.	.	C	16.19	3.053816	0.55218	.	.	ENSG00000197375	ENST00000245407;ENST00000435065;ENST00000415928	T;T;T	0.59364	0.27;0.27;0.27	5.9	3.95	0.45737	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.131317	0.64402	D	0.000002	T	0.52354	0.1729	L	0.54908	1.71	0.48830	D	0.999711	B;B	0.18610	0.023;0.029	B;B	0.27887	0.068;0.084	T	0.54221	-0.8326	10	0.54805	T	0.06	.	9.6	0.39598	0.1266:0.7369:0.0:0.1365	.	279;255	A2Q0V1;O76082	.;S22A5_HUMAN	E	255;279;178	ENSP00000245407:D255E;ENSP00000402760:D279E;ENSP00000388838:D178E	ENSP00000245407:D255E	D	+	3	2	SLC22A5	131749031	0.996000	0.38824	1.000000	0.80357	0.902000	0.53008	0.519000	0.22862	1.496000	0.48567	0.650000	0.86243	GAC	.	.		0.532	SLC22A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132631.1	NM_003060	
PCDHB4	56131	hgsc.bcm.edu	37	5	140503231	140503231	+	Silent	SNP	C	C	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr5:140503231C>T	ENST00000194152.1	+	1	1651	c.1651C>T	c.(1651-1653)Ctg>Ttg	p.L551L	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	551	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGTGCTGGTGCTGGACACCAA	0.701																																					p.L551L		Atlas-SNP	.											.	PCDHB4	177	.	0			c.C1651T						.						40.0	44.0	43.0					5																	140503231		2200	4294	6494	SO:0001819	synonymous_variant	56131	exon1			CTGGTGCTGGACA	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1651C>T	chr5.hg19:g.140503231C>T		8.0	0.0		19.0	4.0	NM_018938	Q4V761	Silent	SNP	ENST00000194152.1	hg19	CCDS4246.1																																																																																			.	.		0.701	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251812.2	NM_018938	
FLOT1	10211	hgsc.bcm.edu	37	6	30698721	30698721	+	Missense_Mutation	SNP	G	G	C	rs576921685		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr6:30698721G>C	ENST00000376389.3	-	9	1100	c.880C>G	c.(880-882)Ctg>Gtg	p.L294V	FLOT1_ENST00000456573.2_Missense_Mutation_p.L246V	NM_005803.2	NP_005794.1	P41440	S19A1_HUMAN	flotillin 1	0					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	13					Methotrexate(DB00563)|Pralatrexate(DB06813)	AGGCGCTCCAGCTTGTAGCGC	0.657																																					p.L294V		Atlas-SNP	.											.	FLOT1	28	.	0			c.C880G						.						49.0	52.0	51.0					6																	30698721		2196	4296	6492	SO:0001583	missense	10211	exon9			GCTCCAGCTTGTA	AF089750	CCDS4688.1	6p21.3	2010-02-17			ENSG00000137312	ENSG00000137312			3757	protein-coding gene	gene with protein product		606998					Standard	XM_005248780		Approved		uc003nrm.3	O75955	OTTHUMG00000031151	ENST00000376389.3:c.880C>G	chr6.hg19:g.30698721G>C	ENSP00000365569:p.Leu294Val	31.0	0.0		53.0	6.0	NM_005803	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000376389.3	hg19	CCDS4688.1	.	.	.	.	.	.	.	.	.	.	G	6.247	0.413784	0.11812	.	.	ENSG00000137312	ENST00000376389;ENST00000456573;ENST00000413165	T;T	0.36340	1.26;1.36	4.67	3.79	0.43588	.	0.367801	0.25555	N	0.029879	T	0.11281	0.0275	N	0.20610	0.595	0.34549	D	0.711124	P;B	0.35600	0.511;0.36	B;B	0.39119	0.291;0.291	T	0.09729	-1.0661	10	0.17369	T	0.5	-0.595	10.9181	0.47148	0.0922:0.0:0.9078:0.0	.	246;294	B4DVY7;O75955	.;FLOT1_HUMAN	V	294;246;231	ENSP00000365569:L294V;ENSP00000394375:L246V	ENSP00000365569:L294V	L	-	1	2	FLOT1	30806700	0.995000	0.38212	0.952000	0.39060	0.823000	0.46562	1.053000	0.30442	1.339000	0.45563	0.650000	0.86243	CTG	.	.		0.657	FLOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076276.2		
CUL9	23113	hgsc.bcm.edu	37	6	43166474	43166474	+	Silent	SNP	C	C	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr6:43166474C>A	ENST00000252050.4	+	12	3015	c.2931C>A	c.(2929-2931)ccC>ccA	p.P977P	CUL9_ENST00000372647.2_Silent_p.P977P|CUL9_ENST00000354495.3_Silent_p.P867P	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	977					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						AGGGCAGCCCCGGAGGTGCCG	0.642																																					p.P977P		Atlas-SNP	.											.	CUL9	248	.	0			c.C2931A						.						77.0	82.0	81.0					6																	43166474		2203	4300	6503	SO:0001819	synonymous_variant	23113	exon12			CAGCCCCGGAGGT	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2931C>A	chr6.hg19:g.43166474C>A		42.0	0.0		72.0	12.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	hg19	CCDS4890.1																																																																																			.	.		0.642	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
IMPG1	3617	hgsc.bcm.edu	37	6	76731919	76731919	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr6:76731919G>T	ENST00000369950.3	-	6	769	c.580C>A	c.(580-582)Ctt>Att	p.L194I	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				AAAGGCCCAAGTGAGACGTTG	0.378																																					p.L194I	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.C580A						.						143.0	128.0	133.0					6																	76731919		2203	4300	6503	SO:0001583	missense	3617	exon6			GCCCAAGTGAGAC	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.580C>A	chr6.hg19:g.76731919G>T	ENSP00000358966:p.Leu194Ile	63.0	0.0		65.0	12.0	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	hg19	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	G	3.488	-0.104447	0.06967	.	.	ENSG00000112706	ENST00000369950	T	0.20881	2.04	5.2	3.31	0.37934	.	0.616116	0.14303	N	0.328140	T	0.07638	0.0192	M	0.66939	2.045	0.09310	N	1	B	0.18461	0.028	B	0.19946	0.027	T	0.31806	-0.9930	10	0.17832	T	0.49	.	6.0581	0.19822	0.1707:0.1572:0.6721:0.0	.	194	Q17R60	IMPG1_HUMAN	I	194	ENSP00000358966:L194I	ENSP00000358966:L194I	L	-	1	0	IMPG1	76788639	0.002000	0.14202	0.020000	0.16555	0.007000	0.05969	0.323000	0.19593	1.178000	0.42870	-0.145000	0.13849	CTT	.	.		0.378	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
TBC1D32	221322	hgsc.bcm.edu	37	6	121563360	121563360	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr6:121563360G>A	ENST00000398212.2	-	18	2193	c.2144C>T	c.(2143-2145)gCa>gTa	p.A715V	TBC1D32_ENST00000275159.6_Missense_Mutation_p.A715V	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	715					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TAATTTTTTTGCATATCGATT	0.343																																					p.A715V		Atlas-SNP	.											.	C6orf170	146	.	0			c.C2144T						.						93.0	86.0	88.0					6																	121563360		1827	4089	5916	SO:0001583	missense	221322	exon18			TTTTTTGCATATC	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.2144C>T	chr6.hg19:g.121563360G>A	ENSP00000381270:p.Ala715Val	43.0	0.0		50.0	7.0	NM_152730	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	ENST00000398212.2	hg19	CCDS43501.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699992	0.48307	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.20069	2.1;2.1	5.0	5.0	0.66597	.	0.352762	0.28595	N	0.014787	T	0.33614	0.0869	M	0.62723	1.935	0.33657	D	0.609255	D;B	0.71674	0.998;0.08	D;B	0.80764	0.994;0.067	T	0.04607	-1.0939	10	0.30078	T	0.28	.	18.2399	0.89963	0.0:0.0:1.0:0.0	.	715;715	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	V	715	ENSP00000275159:A715V;ENSP00000381270:A715V	ENSP00000275159:A715V	A	-	2	0	C6orf170	121605059	1.000000	0.71417	0.997000	0.53966	0.870000	0.49936	5.603000	0.67619	2.492000	0.84095	0.585000	0.79938	GCA	.	.		0.343	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
LPA	4018	hgsc.bcm.edu	37	6	160966524	160966524	+	Silent	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr6:160966524G>A	ENST00000316300.5	-	33	5390	c.5346C>T	c.(5344-5346)tgC>tgT	p.C1782C	LPA_ENST00000447678.1_Silent_p.C1782C			P08519	APOA_HUMAN	lipoprotein, Lp(a)	4290	Kringle 16. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TCATTGTGTAGCACCAGGGAC	0.448																																					p.C1782C		Atlas-SNP	.											.	LPA	237	.	0			c.C5346T						.						136.0	139.0	138.0					6																	160966524		2203	4300	6503	SO:0001819	synonymous_variant	4018	exon34			TGTGTAGCACCAG	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.5346C>T	chr6.hg19:g.160966524G>A		107.0	0.0		133.0	6.0	NM_005577	Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	hg19	CCDS43523.1																																																																																			.	.		0.448	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
SDK1	221935	hgsc.bcm.edu	37	7	4277393	4277393	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr7:4277393A>G	ENST00000404826.2	+	42	6246	c.6107A>G	c.(6106-6108)aAg>aGg	p.K2036R	SDK1_ENST00000466611.1_3'UTR|SDK1_ENST00000389531.3_Missense_Mutation_p.K2016R	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2036					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGGCAGAATAAGAAGTATAAG	0.567																																					p.K2036R		Atlas-SNP	.											.	SDK1	361	.	0			c.A6107G						.						139.0	128.0	132.0					7																	4277393		2203	4300	6503	SO:0001583	missense	221935	exon42			AGAATAAGAAGTA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6107A>G	chr7.hg19:g.4277393A>G	ENSP00000385899:p.Lys2036Arg	205.0	0.0		287.0	51.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	3.009	-0.204260	0.06180	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.62105	0.05;0.06	5.27	1.39	0.22231	.	0.072732	0.52532	N	0.000065	T	0.45637	0.1352	L	0.38649	1.16	0.23542	N	0.997453	B;B;B;B	0.20052	0.041;0.003;0.011;0.002	B;B;B;B	0.23419	0.046;0.012;0.033;0.002	T	0.28038	-1.0056	10	0.12103	T	0.63	.	8.9492	0.35779	0.7743:0.0:0.2257:0.0	.	2016;96;523;2036	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	R	2036;284;2016	ENSP00000385899:K2036R;ENSP00000374182:K2016R	ENSP00000374182:K2016R	K	+	2	0	SDK1	4243919	0.998000	0.40836	0.008000	0.14137	0.743000	0.42351	2.149000	0.42244	-0.004000	0.14419	0.496000	0.49642	AAG	.	.		0.567	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
VWC2	375567	hgsc.bcm.edu	37	7	49951654	49951654	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr7:49951654C>T	ENST00000340652.4	+	4	1407	c.851C>T	c.(850-852)gCg>gTg	p.A284V	ZPBP_ENST00000491129.1_Intron	NM_198570.3	NP_940972.2	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2	284					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|basement membrane (GO:0005604)|cell junction (GO:0030054)|extracellular space (GO:0005615)|interstitial matrix (GO:0005614)|synapse (GO:0045202)				cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|prostate(1)	8						GCAGAAACCGCGGTGATCCCT	0.418																																					p.A284V		Atlas-SNP	.											.	VWC2	30	.	0			c.C851T						.						92.0	82.0	86.0					7																	49951654		2203	4300	6503	SO:0001583	missense	375567	exon4			AAACCGCGGTGAT	AY358393	CCDS5508.1	7p12.3-p12.2	2007-07-19			ENSG00000188730	ENSG00000188730			30200	protein-coding gene	gene with protein product	"""brorin"", ""brain-specific chordin-like"""	611108				17400546	Standard	NM_198570		Approved	PSST739, UNQ739	uc003tot.1	Q2TAL6	OTTHUMG00000129265	ENST00000340652.4:c.851C>T	chr7.hg19:g.49951654C>T	ENSP00000341819:p.Ala284Val	141.0	0.0		143.0	22.0	NM_198570	Q6UXE2	Missense_Mutation	SNP	ENST00000340652.4	hg19	CCDS5508.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506945	0.44558	.	.	ENSG00000188730	ENST00000340652	T	0.13538	2.58	5.82	5.82	0.92795	.	0.298945	0.26711	N	0.022886	T	0.06917	0.0176	N	0.08118	0	0.45554	D	0.998505	B	0.27351	0.176	B	0.15484	0.013	T	0.40308	-0.9570	10	0.29301	T	0.29	.	11.3891	0.49804	0.0:0.8609:0.0:0.1391	.	284	Q2TAL6	VWC2_HUMAN	V	284	ENSP00000341819:A284V	ENSP00000341819:A284V	A	+	2	0	VWC2	49922200	0.210000	0.23517	0.898000	0.35279	0.907000	0.53573	2.647000	0.46639	2.751000	0.94390	0.650000	0.86243	GCG	.	.		0.418	VWC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251375.2	NM_198570	
MPDZ	8777	hgsc.bcm.edu	37	9	13126733	13126733	+	Silent	SNP	A	A	G			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr9:13126733A>G	ENST00000319217.7	-	33	4750	c.4503T>C	c.(4501-4503)gaT>gaC	p.D1501D	MPDZ_ENST00000381015.4_Silent_p.D1501D|MPDZ_ENST00000447879.1_Silent_p.D1468D|MPDZ_ENST00000541718.1_Silent_p.D1501D|MPDZ_ENST00000538841.1_Silent_p.D360D|MPDZ_ENST00000546205.1_Silent_p.D1515D|MPDZ_ENST00000541093.1_5'UTR|MPDZ_ENST00000381022.2_Silent_p.D1501D|MPDZ_ENST00000536827.1_Silent_p.D1468D	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1501	PDZ 9. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		CACTGAGTGTATCTTCTTCGC	0.413																																					p.D1501D		Atlas-SNP	.											.	MPDZ	324	.	0			c.T4503C						.						115.0	110.0	111.0					9																	13126733		1896	4124	6020	SO:0001819	synonymous_variant	8777	exon33			GAGTGTATCTTCT	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.4503T>C	chr9.hg19:g.13126733A>G		91.0	0.0		152.0	26.0	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Silent	SNP	ENST00000319217.7	hg19																																																																																				.	.		0.413	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
ATRNL1	26033	hgsc.bcm.edu	37	10	117486766	117486766	+	Silent	SNP	T	T	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr10:117486766T>C	ENST00000355044.3	+	27	3930	c.3804T>C	c.(3802-3804)ctT>ctC	p.L1268L	ATRNL1_ENST00000303745.7_Silent_p.L61L|ATRNL1_ENST00000423111.2_Silent_p.L319L	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1268					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AGCAACTGCTTCGAGAACGAC	0.433																																					p.L1268L		Atlas-SNP	.											.	ATRNL1	219	.	0			c.T3804C						.						47.0	45.0	46.0					10																	117486766		2203	4300	6503	SO:0001819	synonymous_variant	26033	exon27			ACTGCTTCGAGAA	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3804T>C	chr10.hg19:g.117486766T>C		20.0	0.0		37.0	10.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	hg19	CCDS7592.1																																																																																			.	.		0.433	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
DMBT1	1755	hgsc.bcm.edu	37	10	124335946	124335946	+	Silent	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr10:124335946G>A	ENST00000338354.3	+	7	421	c.315G>A	c.(313-315)gtG>gtA	p.V105V	DMBT1_ENST00000330163.4_Silent_p.V105V|DMBT1_ENST00000368956.2_Silent_p.V105V|DMBT1_ENST00000368909.3_Silent_p.V105V|DMBT1_ENST00000359586.6_Silent_p.V105V|DMBT1_ENST00000368955.3_Silent_p.V105V|DMBT1_ENST00000344338.3_Silent_p.V105V			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	105	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGAGGCTGGTGAATGGAGATG	0.567																																					p.V105V	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											.	DMBT1	677	.	0			c.G315A						.						134.0	137.0	136.0					10																	124335946		2030	4224	6254	SO:0001819	synonymous_variant	1755	exon7			GCTGGTGAATGGA		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.315G>A	chr10.hg19:g.124335946G>A		70.0	0.0		120.0	22.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	ENST00000338354.3	hg19																																																																																				.	.		0.567	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
DPYSL4	10570	hgsc.bcm.edu	37	10	134015481	134015481	+	Missense_Mutation	SNP	T	T	G			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr10:134015481T>G	ENST00000338492.4	+	11	1306	c.1142T>G	c.(1141-1143)gTc>gGc	p.V381G	DPYSL4_ENST00000368627.1_Missense_Mutation_p.V281G|DPYSL4_ENST00000368629.1_Missense_Mutation_p.V281G	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	381					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		AATGAGTTCGTCGCGGTGACC	0.577																																					p.V381G		Atlas-SNP	.											.	DPYSL4	91	.	0			c.T1142G						.						97.0	94.0	95.0					10																	134015481		2203	4300	6503	SO:0001583	missense	10570	exon11			AGTTCGTCGCGGT	AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.1142T>G	chr10.hg19:g.134015481T>G	ENSP00000339850:p.Val381Gly	87.0	0.0		120.0	11.0	NM_006426	B2RMQ1|D3DRG5|O00240|Q5T0Q7	Missense_Mutation	SNP	ENST00000338492.4	hg19	CCDS7665.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.354506	0.41700	.	.	ENSG00000151640	ENST00000338492;ENST00000368629;ENST00000368627	D;D;D	0.91351	-2.83;-2.83;-2.83	4.48	4.48	0.54585	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.066345	0.64402	D	0.000014	D	0.93083	0.7798	H	0.94385	3.53	0.80722	D	1	B	0.25105	0.118	B	0.26693	0.072	D	0.93042	0.6458	10	0.87932	D	0	-11.8436	13.9972	0.64409	0.0:0.0:0.0:1.0	.	381	O14531	DPYL4_HUMAN	G	381;281;281	ENSP00000339850:V381G;ENSP00000357618:V281G;ENSP00000357616:V281G	ENSP00000339850:V381G	V	+	2	0	DPYSL4	133865471	1.000000	0.71417	0.724000	0.30704	0.364000	0.29643	7.454000	0.80714	1.879000	0.54435	0.529000	0.55759	GTC	.	.		0.577	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2		
GDPD5	81544	hgsc.bcm.edu	37	11	75150967	75150967	+	Silent	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr11:75150967G>A	ENST00000336898.3	-	15	2350	c.1513C>T	c.(1513-1515)Ctg>Ttg	p.L505L	GDPD5_ENST00000529721.1_Silent_p.L505L|GDPD5_ENST00000526177.1_Silent_p.L367L|GDPD5_ENST00000376282.3_Silent_p.L386L|GDPD5_ENST00000533784.1_Silent_p.L386L|GDPD5_ENST00000443276.2_3'UTR|GDPD5_ENST00000533805.1_Silent_p.L260L	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	505					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						AAGGAGACCAGGTCGGCAGTG	0.622																																					p.L505L		Atlas-SNP	.											.	GDPD5	49	.	0			c.C1513T						.						127.0	103.0	111.0					11																	75150967		2200	4293	6493	SO:0001819	synonymous_variant	81544	exon15			AGACCAGGTCGGC	AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1513C>T	chr11.hg19:g.75150967G>A		107.0	0.0		163.0	27.0	NM_030792	Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Silent	SNP	ENST00000336898.3	hg19	CCDS8238.1																																																																																			.	.		0.622	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384409.1	NM_030792	
THRSP	7069	hgsc.bcm.edu	37	11	77774945	77774946	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr11:77774945_77774946GC>AG	ENST00000281030.2	+	1	39_40	c.18_19GC>AG	c.(16-21)aaGCgt>aaAGgt	p.R7G	NDUFC2-KCTD14_ENST00000530054.1_Intron|NDUFC2-KCTD14_ENST00000528251.1_Intron	NM_003251.3	NP_003242.1	Q92748	THRSP_HUMAN	thyroid hormone responsive	7					lipid metabolic process (GO:0006629)|regulation of lipid biosynthetic process (GO:0046890)|regulation of transcription, DNA-templated (GO:0006355)|regulation of triglyceride biosynthetic process (GO:0010866)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.R7C(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7	all_cancers(14;2.23e-19)|all_epithelial(13;7.49e-22)|Breast(9;6.38e-17)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;2.15e-25)			TGCTAACCAAGCGTTACCCCAA	0.569																																					p.K6K|p.R7G		Atlas-SNP	.											.|THRSP,colon,carcinoma,-1,1	THRSP	18	.	1	Substitution - Missense(1)	breast(1)	c.G18A|c.C19G						.																																			SO:0001583	missense	7069	exon1			AACCAAGCGTTAC|ACCAAGCGTTACC	Y08409	CCDS8256.1	11q14.1	2012-06-19	2010-06-25		ENSG00000151365	ENSG00000151365			11800	protein-coding gene	gene with protein product	"""SPOT14 homolog (rat)"""	601926	"""thyroid hormone responsive SPOT14 (rat) homolog"", ""lipogenic protein 1"""	LPGP1		9003802	Standard	NM_003251		Approved	SPOT14, Lpgp, S14, THRP	uc001oyx.3	Q92748	OTTHUMG00000166632	Exception_encountered	chr11.hg19:g.77774945_77774946delinsAG	ENSP00000281030:p.Arg7Gly	89.0	0.0		111.0|112.0	15.0	NM_003251	B2R4W7	Silent|Missense_Mutation	SNP	ENST00000281030.2	hg19	CCDS8256.1																																																																																			.	.		0.569	THRSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390939.1	NM_003251	
CDON	50937	hgsc.bcm.edu	37	11	125885319	125885319	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr11:125885319G>A	ENST00000392693.3	-	7	1142	c.1015C>T	c.(1015-1017)Cca>Tca	p.P339S	CDON_ENST00000263577.7_Missense_Mutation_p.P339S	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	339	Ig-like C2-type 4.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTGGGGGCTGGGTTCCCATGA	0.463																																					p.P339S		Atlas-SNP	.											.	CDON	137	.	0			c.C1015T						.						100.0	84.0	89.0					11																	125885319		2201	4299	6500	SO:0001583	missense	50937	exon7			GGGCTGGGTTCCC	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.1015C>T	chr11.hg19:g.125885319G>A	ENSP00000376458:p.Pro339Ser	164.0	0.0		272.0	48.0	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	hg19	CCDS58192.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.08|16.08	3.021587|3.021587	0.54576|0.54576	.|.	.|.	ENSG00000064309|ENSG00000064309	ENST00000534661|ENST00000392693;ENST00000263577	.|T;T	.|0.73897	.|-0.79;-0.79	5.58|5.58	4.67|4.67	0.58626|0.58626	.|Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000|0.000000	0.49305|0.49305	D|D	0.000147|0.000147	D|D	0.89602|0.89602	0.6762|0.6762	H|H	0.94183|0.94183	3.505|3.505	0.45899|0.45899	D|D	0.998747|0.998747	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.92328|0.92328	0.5871|0.5871	6|10	.|0.87932	.|D	.|0	-11.4224|-11.4224	14.4906|14.4906	0.67647|0.67647	0.0707:0.0:0.9293:0.0|0.0707:0.0:0.9293:0.0	.|.	.|339;339	.|Q4KMG0;Q4KMG0-2	.|CDON_HUMAN;.	L|S	314|339	.|ENSP00000376458:P339S;ENSP00000263577:P339S	.|ENSP00000263577:P339S	P|P	-|-	2|1	0|0	CDON|CDON	125390529|125390529	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.144000|0.144000	0.21451|0.21451	7.203000|7.203000	0.77864|0.77864	1.363000|1.363000	0.46019|0.46019	-0.258000|-0.258000	0.10820|0.10820	CCC|CCA	.	.		0.463	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
ITPR2	3709	hgsc.bcm.edu	37	12	26816709	26816709	+	Missense_Mutation	SNP	A	A	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr12:26816709A>C	ENST00000381340.3	-	15	2038	c.1622T>G	c.(1621-1623)cTg>cGg	p.L541R		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	541					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTGATCCCCCAGATCTTCAAG	0.468																																					p.L541R		Atlas-SNP	.											.	ITPR2	270	.	0			c.T1622G						.						264.0	261.0	262.0					12																	26816709		1882	4119	6001	SO:0001583	missense	3709	exon15			TCCCCCAGATCTT	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.1622T>G	chr12.hg19:g.26816709A>C	ENSP00000370744:p.Leu541Arg	58.0	0.0		94.0	13.0	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	hg19	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.455523	0.84209	.	.	ENSG00000123104	ENST00000381340	D	0.91124	-2.79	4.7	4.7	0.59300	Intracellular calcium-release channel (1);	0.075309	0.56097	D	0.000034	D	0.96015	0.8702	M	0.91196	3.185	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.96784	0.9577	10	0.66056	D	0.02	.	14.6573	0.68844	1.0:0.0:0.0:0.0	.	541	Q14571	ITPR2_HUMAN	R	541	ENSP00000370744:L541R	ENSP00000370744:L541R	L	-	2	0	ITPR2	26707976	1.000000	0.71417	0.935000	0.37517	0.961000	0.63080	9.123000	0.94387	2.099000	0.63709	0.533000	0.62120	CTG	.	.		0.468	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
ATP5B	506	hgsc.bcm.edu	37	12	57037684	57037684	+	Missense_Mutation	SNP	T	T	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr12:57037684T>C	ENST00000262030.3	-	4	594	c.544A>G	c.(544-546)Att>Gtt	p.I182V	ATP5B_ENST00000552919.1_Missense_Mutation_p.I182V|SNORD59A_ENST00000384304.1_RNA|ATP5B_ENST00000550162.1_5'Flank	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	182					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GTCACCAGAATTTCCTGCTCA	0.423																																					p.I182V		Atlas-SNP	.											.	ATP5B	48	.	0			c.A544G						.						127.0	107.0	114.0					12																	57037684		2203	4300	6503	SO:0001583	missense	506	exon4			CCAGAATTTCCTG	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.544A>G	chr12.hg19:g.57037684T>C	ENSP00000262030:p.Ile182Val	131.0	0.0		179.0	33.0	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	hg19	CCDS8924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.73|16.73	3.202852|3.202852	0.58234|0.58234	.|.	.|.	ENSG00000110955|ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020|ENST00000552959	T;T;T|.	0.81330|.	-1.48;-1.48;-1.48|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	0.047019|.	0.85682|.	D|.	0.000000|.	T|T	0.72145|0.72145	0.3424|0.3424	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.06405|.	0.002|.	T|T	0.71988|0.71988	-0.4426|-0.4426	10|5	0.35671|.	T|.	0.21|.	-9.2759|-9.2759	14.7018|14.7018	0.69162|0.69162	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	182|.	P06576|.	ATPB_HUMAN|.	V|S	182;182;121|118	ENSP00000262030:I182V;ENSP00000450297:I182V;ENSP00000446677:I121V|.	ENSP00000262030:I182V|.	I|N	-|-	1|2	0|0	ATP5B|ATP5B	55323951|55323951	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	7.314000|7.314000	0.78988|0.78988	2.123000|2.123000	0.65237|0.65237	0.260000|0.260000	0.18958|0.18958	ATT|AAT	.	.		0.423	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
TPH2	121278	hgsc.bcm.edu	37	12	72416191	72416191	+	Missense_Mutation	SNP	A	A	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr12:72416191A>T	ENST00000333850.3	+	9	1222	c.1081A>T	c.(1081-1083)Aca>Tca	p.T361S		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	361					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	CTATTTCTTCACAATCGAGTT	0.423																																					p.T361S		Atlas-SNP	.											.	TPH2	81	.	0			c.A1081T						.						117.0	106.0	110.0					12																	72416191		2203	4300	6503	SO:0001583	missense	121278	exon9			TTCTTCACAATCG	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1081A>T	chr12.hg19:g.72416191A>T	ENSP00000329093:p.Thr361Ser	67.0	0.0		58.0	8.0	NM_173353	A6NGA4|Q14CB0	Missense_Mutation	SNP	ENST00000333850.3	hg19	CCDS31859.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.783657	0.90282	.	.	ENSG00000139287	ENST00000333850	D	0.99820	-6.93	5.98	5.98	0.97165	Aromatic amino acid hydroxylase, C-terminal (3);	0.150965	0.64402	N	0.000014	D	0.99429	0.9798	M	0.67569	2.06	0.80722	D	1	P	0.39094	0.659	B	0.39971	0.315	D	0.99113	1.0847	10	0.59425	D	0.04	-18.4464	16.4696	0.84102	1.0:0.0:0.0:0.0	.	361	Q8IWU9	TPH2_HUMAN	S	361	ENSP00000329093:T361S	ENSP00000329093:T361S	T	+	1	0	TPH2	70702458	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.339000	0.96797	2.289000	0.77006	0.482000	0.46254	ACA	.	.		0.423	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405234.1	NM_173353	
SPATA13	221178	hgsc.bcm.edu	37	13	24861041	24861041	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr13:24861041A>G	ENST00000382095.4	+	6	1152	c.745A>G	c.(745-747)Atg>Gtg	p.M249V	SPATA13_ENST00000382108.3_Missense_Mutation_p.M874V|SPATA13_ENST00000343003.6_Missense_Mutation_p.M193V|SPATA13_ENST00000409126.1_Intron|SPATA13_ENST00000424834.2_Missense_Mutation_p.M874V|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.M752V|SPATA13_ENST00000399949.2_Missense_Mutation_p.M171V	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	249	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CCGGGAGATCATGGACACCGA	0.607																																					p.M874V		Atlas-SNP	.											.	SPATA13	92	.	0			c.A2620G						.						117.0	100.0	106.0					13																	24861041		2203	4300	6503	SO:0001583	missense	221178	exon7			GAGATCATGGACA	AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.745A>G	chr13.hg19:g.24861041A>G	ENSP00000371527:p.Met249Val	112.0	0.0		140.0	27.0	NM_001166271	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	ENST00000382095.4	hg19	CCDS9305.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.39|13.39	2.222784|2.222784	0.39300|0.39300	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000424834|ENST00000382108;ENST00000382095;ENST00000438694;ENST00000399949;ENST00000343003	.|T;T;T;T	.|0.60424	.|0.19;0.19;0.19;0.19	4.96|4.96	3.78|3.78	0.43462|0.43462	.|Src homology-3 domain (1);Dbl homology (DH) domain (5);	.|0.038199	.|0.85682	.|D	.|0.000000	T|T	0.27524|0.27524	0.0676|0.0676	N|N	0.01438|0.01438	-0.865|-0.865	0.51482|0.51482	D|D	0.999923|0.999923	.|B;B;B;B	.|0.15141	.|0.0;0.012;0.0;0.0	.|B;B;B;B	.|0.15484	.|0.004;0.012;0.004;0.013	T|T	0.10474|0.10474	-1.0628|-1.0628	5|10	.|0.35671	.|T	.|0.21	.|.	9.5763|9.5763	0.39459|0.39459	0.9165:0.0:0.0835:0.0|0.9165:0.0:0.0835:0.0	.|.	.|193;195;171;249	.|Q96N96-3;Q96N96-4;Q96N96-2;Q96N96	.|.;.;.;SPT13_HUMAN	R|V	911|874;249;195;171;193	.|ENSP00000371542:M874V;ENSP00000371527:M249V;ENSP00000382830:M171V;ENSP00000343631:M193V	.|ENSP00000343631:M193V	H|M	+|+	2|1	0|0	SPATA13|SPATA13	23759041|23759041	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.818000|0.818000	0.46254|0.46254	4.179000|4.179000	0.58290|0.58290	1.985000|1.985000	0.57927|0.57927	0.459000|0.459000	0.35465|0.35465	CAT|ATG	.	.		0.607	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044180.2	NM_153023	
NUBPL	80224	hgsc.bcm.edu	37	14	32257020	32257020	+	Missense_Mutation	SNP	A	A	G			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr14:32257020A>G	ENST00000281081.7	+	7	593	c.548A>G	c.(547-549)gAc>gGc	p.D183G	NUBPL_ENST00000418681.2_3'UTR|NUBPL_ENST00000536705.1_Missense_Mutation_p.D87G	NM_001201573.1|NM_001201574.1|NM_025152.2	NP_001188502.1|NP_001188503.1|NP_079428.2	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	183					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrion morphogenesis (GO:0070584)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)|prostate(1)|skin(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		TTAGTTGTAGACATGCCACCA	0.313																																					p.D183G		Atlas-SNP	.											.	NUBPL	21	.	0			c.A548G						.						97.0	89.0	92.0					14																	32257020		1867	4097	5964	SO:0001583	missense	80224	exon7			TTGTAGACATGCC	AK022722	CCDS41940.1	14q12	2012-10-12	2005-01-07	2005-01-07	ENSG00000151413	ENSG00000151413		"""Mitochondrial respiratory chain complex assembly factors"""	20278	protein-coding gene	gene with protein product	"""iron-sulfur protein required for NADH dehydrogenase"""	613621	"""chromosome 14 open reading frame 127"""	C14orf127			Standard	NM_025152		Approved	FLJ12660, IND1, huInd1	uc001wrk.4	Q8TB37	OTTHUMG00000170521	ENST00000281081.7:c.548A>G	chr14.hg19:g.32257020A>G	ENSP00000281081:p.Asp183Gly	50.0	0.0		75.0	13.0	NM_025152	B4DHZ1|Q86TZ4|Q9H9M2	Missense_Mutation	SNP	ENST00000281081.7	hg19	CCDS41940.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.422610	0.83559	.	.	ENSG00000151413	ENST00000281081;ENST00000551314;ENST00000536705	T;D;T	0.81821	-1.41;-1.54;-1.41	5.86	5.86	0.93980	Mrp, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94574	0.8252	H	0.99746	4.745	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.83275	0.996;0.992	D	0.96700	0.9517	10	0.87932	D	0	-31.2323	14.2085	0.65750	1.0:0.0:0.0:0.0	.	87;183	B4DWB0;Q8TB37	.;NUBPL_HUMAN	G	183;131;87	ENSP00000281081:D183G;ENSP00000447234:D131G;ENSP00000439286:D87G	ENSP00000281081:D183G	D	+	2	0	NUBPL	31326771	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.472000	0.80996	2.235000	0.73313	0.533000	0.62120	GAC	.	.		0.313	NUBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409519.1	NM_025152	
EXOC5	10640	hgsc.bcm.edu	37	14	57698355	57698355	+	Silent	SNP	T	T	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr14:57698355T>C	ENST00000413566.2	-	11	1376	c.1017A>G	c.(1015-1017)aaA>aaG	p.K339K	EXOC5_ENST00000340918.7_Silent_p.K274K	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	339					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						TGAAAATGGATTTGATAAGCT	0.363																																					p.K339K		Atlas-SNP	.											.	EXOC5	45	.	0			c.A1017G						.						71.0	67.0	69.0					14																	57698355		1829	4077	5906	SO:0001819	synonymous_variant	10640	exon11			AATGGATTTGATA	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1017A>G	chr14.hg19:g.57698355T>C		72.0	0.0		93.0	8.0	NM_006544	B2R6C5	Silent	SNP	ENST00000413566.2	hg19	CCDS45111.1																																																																																			.	.		0.363	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
KIF26A	26153	hgsc.bcm.edu	37	14	104644901	104644901	+	Missense_Mutation	SNP	C	C	T	rs375944046		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr14:104644901C>T	ENST00000423312.2	+	13	5125	c.5125C>T	c.(5125-5127)Cgc>Tgc	p.R1709C	KIF26A_ENST00000315264.7_Missense_Mutation_p.R1570C	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1709					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GCAGCGGCGGCGCCTGATTCC	0.756													C|||	1	0.000199681	0.0	0.0	5008	,	,		11748	0.0		0.0	False		,,,				2504	0.001				p.R1709C		Atlas-SNP	.											.	KIF26A	84	.	0			c.C5125T						.	C	CYS/ARG	0,3446		0,0,1723	4.0	5.0	4.0		5125	1.9	1.0	14		4	1,7591		0,1,3795	no	missense	KIF26A	NM_015656.1	180	0,1,5518	TT,TC,CC		0.0132,0.0,0.0091	probably-damaging	1709/1883	104644901	1,11037	1723	3796	5519	SO:0001583	missense	26153	exon13			CGGCGGCGCCTGA	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.5125C>T	chr14.hg19:g.104644901C>T	ENSP00000388241:p.Arg1709Cys	3.0	0.0		8.0	6.0	NM_015656	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	hg19	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850260	0.32699	0.0	1.32E-4	ENSG00000066735	ENST00000423312;ENST00000315264	D;D	0.89270	-2.49;-2.49	4.02	1.91	0.25777	.	.	.	.	.	D	0.93390	0.7892	M	0.82323	2.585	0.50039	D	0.99984	D	0.89917	1.0	D	0.67231	0.95	D	0.93059	0.6472	9	0.87932	D	0	.	11.4699	0.50261	0.5384:0.4616:0.0:0.0	.	1709	Q9ULI4	KI26A_HUMAN	C	1709;1570	ENSP00000388241:R1709C;ENSP00000325452:R1570C	ENSP00000325452:R1570C	R	+	1	0	KIF26A	103714654	0.382000	0.25148	0.976000	0.42696	0.076000	0.17211	0.974000	0.29436	0.616000	0.30141	0.462000	0.41574	CGC	.	.		0.756	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
GJD2	57369	hgsc.bcm.edu	37	15	35044889	35044889	+	Silent	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr15:35044889G>A	ENST00000290374.4	-	2	1232	c.756C>T	c.(754-756)gtC>gtT	p.V252V	RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_020660.2	NP_065711.1	Q9UKL4	CXD2_HUMAN	gap junction protein, delta 2, 36kDa	252					action potential (GO:0001508)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	19		all_lung(180;9.67e-07)		all cancers(64;2.75e-18)|GBM - Glioblastoma multiforme(113;1.9e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		ACACTAGAAAGACAGTCTTCT	0.507																																					p.V252V		Atlas-SNP	.											.	GJD2	49	.	0			c.C756T						.						151.0	118.0	129.0					15																	35044889		2201	4298	6499	SO:0001819	synonymous_variant	57369	exon2			TAGAAAGACAGTC	AB037509	CCDS10040.1	15q13.1	2008-02-04	2007-11-06	2007-11-06	ENSG00000159248	ENSG00000159248		"""Ion channels / Gap junction proteins (connexins)"""	19154	protein-coding gene	gene with protein product	"""connexin 36"""	607058	"""gap junction protein, alpha 9, 36kDa"""	GJA9		10462698	Standard	NM_020660		Approved	CX36	uc001zis.2	Q9UKL4	OTTHUMG00000129674	ENST00000290374.4:c.756C>T	chr15.hg19:g.35044889G>A		213.0	0.0		276.0	37.0	NM_020660	Q2M241|Q9P2R0	Silent	SNP	ENST00000290374.4	hg19	CCDS10040.1																																																																																			.	.		0.507	GJD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251875.2		
CEP152	22995	hgsc.bcm.edu	37	15	49054803	49054803	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr15:49054803C>T	ENST00000380950.2	-	18	2534	c.2347G>A	c.(2347-2349)Gca>Aca	p.A783T	CEP152_ENST00000325747.5_Missense_Mutation_p.A690T|CEP152_ENST00000399334.3_Missense_Mutation_p.A783T	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	783					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTTTTCATTGCCTTTATAGTT	0.373																																					p.A783T		Atlas-SNP	.											.	CEP152	145	.	0			c.G2347A						.						108.0	102.0	104.0					15																	49054803		1851	4093	5944	SO:0001583	missense	22995	exon18			TCATTGCCTTTAT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.2347G>A	chr15.hg19:g.49054803C>T	ENSP00000370337:p.Ala783Thr	58.0	0.0		78.0	9.0	NM_014985	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	hg19	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	C	10.36	1.327365	0.24080	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.53640	0.61;0.63;0.62	4.93	4.01	0.46588	.	0.656922	0.15090	N	0.281144	T	0.35682	0.0940	L	0.38838	1.175	0.33487	D	0.588207	B;B;B	0.22909	0.01;0.077;0.005	B;B;B	0.23275	0.007;0.045;0.006	T	0.40251	-0.9573	10	0.13470	T	0.59	-2.8577	11.5024	0.50446	0.0:0.9161:0.0:0.0839	.	690;783;783	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	T	783;690;783	ENSP00000370337:A783T;ENSP00000321000:A690T;ENSP00000382271:A783T	ENSP00000321000:A690T	A	-	1	0	CEP152	46842095	0.889000	0.30405	0.160000	0.22671	0.907000	0.53573	2.409000	0.44583	1.435000	0.47434	0.655000	0.94253	GCA	.	.		0.373	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
KRT33A	3883	hgsc.bcm.edu	37	17	39502874	39502874	+	Missense_Mutation	SNP	C	C	T	rs371555388		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr17:39502874C>T	ENST00000007735.3	-	6	967	c.923G>A	c.(922-924)aGc>aAc	p.S308N		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	308	Coil 2.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				CAGCTGGGAGCTGTAGCGGGC	0.587																																					p.S308N		Atlas-SNP	.											.	KRT33A	53	.	0			c.G923A						.	C	ASN/SER	0,4406		0,0,2203	60.0	59.0	60.0		923	4.6	1.0	17		60	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT33A	NM_004138.2	46	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	308/405	39502874	1,13005	2203	4300	6503	SO:0001583	missense	3883	exon6			TGGGAGCTGTAGC	Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.923G>A	chr17.hg19:g.39502874C>T	ENSP00000007735:p.Ser308Asn	61.0	0.0		87.0	23.0	NM_004138	B2RA87|Q6NTB9|Q6ZZB9	Missense_Mutation	SNP	ENST00000007735.3	hg19	CCDS11388.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557484	0.65425	0.0	1.16E-4	ENSG00000006059	ENST00000007735	D	0.89050	-2.46	4.55	4.55	0.56014	Filament (1);	0.000000	0.85682	D	0.000000	D	0.91095	0.7197	L	0.48986	1.54	0.35220	D	0.775908	P	0.45212	0.853	P	0.54590	0.756	D	0.94197	0.7446	10	0.59425	D	0.04	.	16.8343	0.85953	0.0:1.0:0.0:0.0	.	308	O76009	KT33A_HUMAN	N	308	ENSP00000007735:S308N	ENSP00000007735:S308N	S	-	2	0	KRT33A	36756400	0.000000	0.05858	1.000000	0.80357	0.982000	0.71751	0.305000	0.19254	2.501000	0.84356	0.655000	0.94253	AGC	.	.		0.587	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257295.1	NM_004138	
KRT36	8689	hgsc.bcm.edu	37	17	39643887	39643887	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr17:39643887G>A	ENST00000328119.6	-	4	801	c.802C>T	c.(802-804)Cag>Tag	p.Q268*	KRT36_ENST00000393986.2_Nonsense_Mutation_p.Q218*	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	268	Coil 2.|Rod.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				GCCTCGTACTGGCATCTCATA	0.602																																					p.Q268X		Atlas-SNP	.											.	KRT36	52	.	0			c.C802T						.						131.0	116.0	121.0					17																	39643887		2203	4300	6503	SO:0001587	stop_gained	8689	exon4			CGTACTGGCATCT	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.802C>T	chr17.hg19:g.39643887G>A	ENSP00000329165:p.Gln268*	137.0	0.0		209.0	27.0	NM_003771	Q86XG4	Nonsense_Mutation	SNP	ENST00000328119.6	hg19	CCDS11395.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922657	0.92319	.	.	ENSG00000126337	ENST00000393986;ENST00000328119	.	.	.	5.83	5.83	0.93111	.	0.000000	0.47852	D	0.000206	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.5841	0.84723	0.0:0.1386:0.8614:0.0	.	.	.	.	X	218;268	.	ENSP00000329165:Q268X	Q	-	1	0	KRT36	36897413	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	3.761000	0.55242	2.769000	0.95229	0.655000	0.94253	CAG	.	.		0.602	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	NM_003771	
FECH	2235	hgsc.bcm.edu	37	18	55226447	55226447	+	Missense_Mutation	SNP	A	A	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr18:55226447A>T	ENST00000262093.5	-	7	885	c.734T>A	c.(733-735)cTg>cAg	p.L245Q	FECH_ENST00000382873.3_Missense_Mutation_p.L251Q	NM_000140.3|NM_001012515.2	NP_000131.2|NP_001012533.1	P22830	HEMH_HUMAN	ferrochelatase	245					cellular response to dexamethasone stimulus (GO:0071549)|cholesterol metabolic process (GO:0008203)|detection of UV (GO:0009589)|erythrocyte differentiation (GO:0030218)|generation of precursor metabolites and energy (GO:0006091)|heme biosynthetic process (GO:0006783)|iron ion homeostasis (GO:0055072)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|regulation of gene expression (GO:0010468)|regulation of hemoglobin biosynthetic process (GO:0046984)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to insecticide (GO:0017085)|response to lead ion (GO:0010288)|response to light stimulus (GO:0009416)|response to methylmercury (GO:0051597)|response to platinum ion (GO:0070541)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle assembly (GO:0034379)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|ferrochelatase activity (GO:0004325)|ferrous iron binding (GO:0008198)|heme binding (GO:0020037)|iron-responsive element binding (GO:0030350)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	15		Colorectal(73;0.227)				AAAATGGTCCAGTTCCTTTAG	0.393																																					p.L251Q		Atlas-SNP	.											.	FECH	42	.	0			c.T752A	GRCh37	CM042047	FECH	M		.						108.0	99.0	102.0					18																	55226447		2203	4300	6503	SO:0001583	missense	2235	exon7			TGGTCCAGTTCCT	D00726	CCDS11964.1, CCDS32836.1	18q21.2-q21.3	2010-05-11	2010-05-11		ENSG00000066926	ENSG00000066926	4.99.1.1		3647	protein-coding gene	gene with protein product	"""protoporphyria"""	612386	"""ferrochelatase (protoporphyria)"""			1838349	Standard	NM_001012515		Approved		uc002lgp.4	P22830	OTTHUMG00000132740	ENST00000262093.5:c.734T>A	chr18.hg19:g.55226447A>T	ENSP00000262093:p.Leu245Gln	49.0	0.0		62.0	11.0	NM_001012515	A8KA72|Q8IXN1|Q8NAN0	Missense_Mutation	SNP	ENST00000262093.5	hg19	CCDS11964.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.382203	0.82792	.	.	ENSG00000066926	ENST00000262093;ENST00000382873	D;D	0.97772	-4.53;-4.53	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.99152	0.9707	H	0.97077	3.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	D	0.99078	1.0836	10	0.87932	D	0	-13.2122	14.6203	0.68579	1.0:0.0:0.0:0.0	.	245;251	P22830;P22830-2	HEMH_HUMAN;.	Q	245;251	ENSP00000262093:L245Q;ENSP00000372326:L251Q	ENSP00000262093:L245Q	L	-	2	0	FECH	53377445	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.463000	0.90377	1.993000	0.58246	0.459000	0.35465	CTG	.	.		0.393	FECH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256098.1		
TUBB4A	10382	hgsc.bcm.edu	37	19	6495513	6495513	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr19:6495513C>T	ENST00000264071.2	-	4	1368	c.997G>A	c.(997-999)Gtg>Atg	p.V333M	CTD-2396E7.9_ENST00000599292.1_RNA|TUBB4A_ENST00000540257.1_Missense_Mutation_p.V333M|CTD-2396E7.10_ENST00000596027.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	333					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										TTGCTCTGCACGCTCAGCATC	0.672																																					p.V333M		Atlas-SNP	.											.	.	.	.	0			c.G997A						.						174.0	139.0	151.0					19																	6495513		2203	4300	6503	SO:0001583	missense	10382	exon4			TCTGCACGCTCAG	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.997G>A	chr19.hg19:g.6495513C>T	ENSP00000264071:p.Val333Met	61.0	0.0		76.0	8.0	NM_006087	B3KQP4|Q969E5	Missense_Mutation	SNP	ENST00000264071.2	hg19	CCDS12168.1	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577392	0.45902	.	.	ENSG00000104833	ENST00000264071;ENST00000540257;ENST00000412858	D;D	0.83075	-1.68;-1.68	3.43	3.43	0.39272	.	0.000000	0.64402	U	0.000014	D	0.85452	0.5700	L	0.39085	1.19	0.51482	D	0.999924	D	0.53885	0.963	D	0.64595	0.927	D	0.87123	0.2192	10	0.87932	D	0	.	13.6752	0.62449	0.0:1.0:0.0:0.0	.	333	P04350	TBB4A_HUMAN	M	333;333;251	ENSP00000264071:V333M;ENSP00000443590:V333M	ENSP00000264071:V333M	V	-	1	0	TUBB4	6446513	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.793000	0.62474	1.473000	0.48159	0.306000	0.20318	GTG	.	.		0.672	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
LRRC8E	80131	hgsc.bcm.edu	37	19	7964686	7964686	+	Missense_Mutation	SNP	C	C	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr19:7964686C>T	ENST00000306708.6	+	3	1380	c.1279C>T	c.(1279-1281)Ccg>Tcg	p.P427S	RN7SL115P_ENST00000392196.5_RNA|AC010336.1_ENST00000539278.1_Missense_Mutation_p.G194D	NM_001268284.1|NM_001268285.1|NM_025061.4	NP_001255213.1|NP_001255214.1|NP_079337.2	Q6NSJ5	LRC8E_HUMAN	leucine rich repeat containing 8 family, member E	427					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(10)	35						CTGCATGCTGCCGGGTCTGCC	0.632																																					p.P427S		Atlas-SNP	.											LRRC8E,NS,carcinoma,0,1	LRRC8E	67	.	0			c.C1279T						.						29.0	28.0	29.0					19																	7964686		2203	4299	6502	SO:0001583	missense	80131	exon4			ATGCTGCCGGGTC		CCDS12189.1	19p13.2	2008-02-05				ENSG00000171017			26272	protein-coding gene	gene with protein product		612891				12477932	Standard	NM_025061		Approved	FLJ23420	uc002mir.3	Q6NSJ5		ENST00000306708.6:c.1279C>T	chr19.hg19:g.7964686C>T	ENSP00000306524:p.Pro427Ser	27.0	0.0		55.0	9.0	NM_001268284	B3KR78|Q2YDY3|Q7L236|Q8N3B0|Q9H5H8	Missense_Mutation	SNP	ENST00000306708.6	hg19	CCDS12189.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.53|11.53	1.666529|1.666529	0.29604|0.29604	.|.	.|.	ENSG00000214248|ENSG00000171017	ENST00000539278|ENST00000306708	.|T	.|0.12361	.|2.69	4.49|4.49	4.49|4.49	0.54785|0.54785	.|.	.|0.123338	.|0.56097	.|D	.|0.000039	T|T	0.06188|0.06188	0.0160|0.0160	N|N	0.03948|0.03948	-0.315|-0.315	0.58432|0.58432	D|D	0.999993|0.999993	.|B	.|0.30870	.|0.298	.|B	.|0.34242	.|0.178	T|T	0.18178|0.18178	-1.0345|-1.0345	6|10	0.87932|0.02654	D|T	0|1	.|.	14.7209|14.7209	0.69305|0.69305	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|427	.|Q6NSJ5	.|LRC8E_HUMAN	D|S	194|427	.|ENSP00000306524:P427S	ENSP00000441047:G194D|ENSP00000306524:P427S	G|P	-|+	2|1	0|0	AC010336.2|LRRC8E	7870686|7870686	0.984000|0.984000	0.35163|0.35163	0.971000|0.971000	0.41717|0.41717	0.236000|0.236000	0.25371|0.25371	1.690000|1.690000	0.37711|0.37711	2.340000|2.340000	0.79590|0.79590	0.555000|0.555000	0.69702|0.69702	GGC|CCG	.	.		0.632	LRRC8E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461354.1	NM_025061	
SLC5A5	6528	hgsc.bcm.edu	37	19	18001723	18001723	+	Silent	SNP	G	G	A	rs149937279		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr19:18001723G>A	ENST00000222248.3	+	14	2027	c.1680G>A	c.(1678-1680)ccG>ccA	p.P560P		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	560					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CCCTGGCCCCGGGATTGTTGT	0.602																																					p.P560P	Melanoma(65;1008 1708 7910 46650)	Atlas-SNP	.											.	SLC5A5	67	.	0			c.G1680A						.	G		1,4405	2.1+/-5.4	0,1,2202	101.0	104.0	103.0		1680	-6.5	0.4	19	dbSNP_134	103	0,8600		0,0,4300	no	coding-synonymous	SLC5A5	NM_000453.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		560/644	18001723	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6528	exon14			GGCCCCGGGATTG		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1680G>A	chr19.hg19:g.18001723G>A		64.0	0.0		78.0	20.0	NM_000453	O43702|Q2M335|Q9NYB6	Silent	SNP	ENST00000222248.3	hg19	CCDS12368.1																																																																																			.	G|1.000;C|0.000		0.602	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
KMT2B	9757	hgsc.bcm.edu	37	19	36219035	36219035	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr19:36219035G>A	ENST00000222270.7	+	19	4534	c.4534G>A	c.(4534-4536)Gac>Aac	p.D1512N	KMT2B_ENST00000420124.1_Missense_Mutation_p.D1512N|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	1512					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CGACGCCCACGACCCCAAGTA	0.637																																					p.D1512N		Atlas-SNP	.											.	MLL4	229	.	0			c.G4534A						.						16.0	16.0	16.0					19																	36219035		2003	4172	6175	SO:0001583	missense	8085	exon19			GCCCACGACCCCA	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.4534G>A	chr19.hg19:g.36219035G>A	ENSP00000222270:p.Asp1512Asn	102.0	0.0		112.0	16.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	hg19	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.748430	0.69533	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	D;D	0.84146	-1.81;-1.81	5.31	5.31	0.75309	.	0.000000	0.44285	D	0.000470	D	0.89305	0.6677	L	0.43152	1.355	0.53005	D	0.999965	D	0.89917	1.0	D	0.77557	0.99	D	0.89192	0.3551	10	0.54805	T	0.06	.	16.0062	0.80363	0.0:0.0:1.0:0.0	.	1512	Q9UMN6	MLL4_HUMAN	N	1512	ENSP00000222270:D1512N;ENSP00000398837:D1512N	ENSP00000222270:D1512N	D	+	1	0	AD000671.1	40910875	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.554000	0.67294	2.765000	0.95021	0.655000	0.94253	GAC	.	.		0.637	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
PPP5C	5536	hgsc.bcm.edu	37	19	46857241	46857241	+	Missense_Mutation	SNP	G	G	C			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr19:46857241G>C	ENST00000012443.4	+	2	461	c.358G>C	c.(358-360)Gag>Cag	p.E120Q	PPP5C_ENST00000391919.1_Missense_Mutation_p.E14Q	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	120					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		GCGAGACTACGAGACGGTGAG	0.642																																					p.E120Q		Atlas-SNP	.											.	PPP5C	44	.	0			c.G358C						.						21.0	18.0	19.0					19																	46857241		2201	4299	6500	SO:0001583	missense	5536	exon2			GACTACGAGACGG		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.358G>C	chr19.hg19:g.46857241G>C	ENSP00000012443:p.Glu120Gln	62.0	0.0		128.0	24.0	NM_006247	Q16722|Q53XV2	Missense_Mutation	SNP	ENST00000012443.4	hg19	CCDS12684.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208645	0.58343	.	.	ENSG00000011485	ENST00000012443;ENST00000451918;ENST00000391919	T;T	0.64260	-0.09;1.5	5.07	5.07	0.68467	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	U	0.000000	T	0.55609	0.1931	L	0.45698	1.435	0.80722	D	1	P;B	0.41624	0.757;0.392	B;B	0.39094	0.29;0.075	T	0.54036	-0.8353	10	0.23891	T	0.37	-21.617	16.3322	0.83039	0.0:0.0:1.0:0.0	.	120;120	B2R6R6;P53041	.;PPP5_HUMAN	Q	120;107;14	ENSP00000012443:E120Q;ENSP00000375786:E14Q	ENSP00000012443:E120Q	E	+	1	0	PPP5C	51549081	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.102000	0.77005	2.528000	0.85240	0.462000	0.41574	GAG	.	.		0.642	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
ZBTB45	84878	hgsc.bcm.edu	37	19	59029036	59029036	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr19:59029036G>A	ENST00000594051.1	-	2	485	c.5C>T	c.(4-6)gCg>gTg	p.A2V	ZBTB45_ENST00000600990.1_Missense_Mutation_p.A2V|ZBTB45_ENST00000354590.3_Missense_Mutation_p.A2V			Q96K62	ZBT45_HUMAN	zinc finger and BTB domain containing 45	2					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|lung(5)|urinary_tract(1)	11		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0165)|Lung(386;0.18)		CTCTGCAGCCGCCATCTGCAC	0.592																																					p.A2V	NSCLC(164;1383 2017 5233 27540 46677)	Atlas-SNP	.											.	ZBTB45	37	.	0			c.C5T						.						34.0	40.0	38.0					19																	59029036		2197	4296	6493	SO:0001583	missense	84878	exon2			GCAGCCGCCATCT	AK027392	CCDS12984.1	19q13.43	2013-10-10	2006-09-19	2006-09-19	ENSG00000119574	ENSG00000119574		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23715	protein-coding gene	gene with protein product			"""zinc finger protein 499"""	ZNF499			Standard	NM_032792		Approved	FLJ14486	uc002qtd.3	Q96K62	OTTHUMG00000183545	ENST00000594051.1:c.5C>T	chr19.hg19:g.59029036G>A	ENSP00000469089:p.Ala2Val	94.0	0.0		127.0	6.0	NM_032792		Missense_Mutation	SNP	ENST00000594051.1	hg19	CCDS12984.1	.	.	.	.	.	.	.	.	.	.	g	16.63	3.176981	0.57692	.	.	ENSG00000119574	ENST00000354590	T	0.10668	2.85	3.88	3.88	0.44766	.	0.284575	0.23618	U	0.046276	T	0.08537	0.0212	N	0.19112	0.55	0.31566	N	0.656973	D	0.63880	0.993	P	0.44897	0.463	T	0.04481	-1.0948	10	0.87932	D	0	.	9.8862	0.41264	0.0:0.2097:0.7903:0.0	.	2	Q96K62	ZBT45_HUMAN	V	2	ENSP00000346603:A2V	ENSP00000346603:A2V	A	-	2	0	ZBTB45	63720848	0.047000	0.20315	0.951000	0.38953	0.393000	0.30537	1.354000	0.34056	1.883000	0.54544	0.289000	0.19496	GCG	.	.		0.592	ZBTB45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467067.1	NM_032792	
ACSS2	55902	hgsc.bcm.edu	37	20	33464506	33464506	+	Missense_Mutation	SNP	G	G	A			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr20:33464506G>A	ENST00000360596.2	+	1	269	c.58G>A	c.(58-60)Gct>Act	p.A20T	ACSS2_ENST00000336325.4_Intron|ACSS2_ENST00000253382.5_Missense_Mutation_p.A20T|ACSS2_ENST00000476922.1_3'UTR	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	20					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCAGGAGGAAGCTGGAGCCGG	0.746																																					p.A20T		Atlas-SNP	.											.	ACSS2	75	.	0			c.G58A						.						3.0	4.0	4.0					20																	33464506		1732	3698	5430	SO:0001583	missense	55902	exon1			GAGGAAGCTGGAG	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.58G>A	chr20.hg19:g.33464506G>A	ENSP00000353804:p.Ala20Thr	1.0	0.0		9.0	6.0	NM_001076552	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	ENST00000360596.2	hg19	CCDS13243.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056168	0.36277	.	.	ENSG00000131069	ENST00000360596;ENST00000374693;ENST00000484354;ENST00000493805;ENST00000473172;ENST00000253382	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	4.54	-3.35	0.04928	.	0.658399	0.14855	N	0.294412	T	0.14141	0.0342	N	0.08118	0	0.25084	N	0.990901	B;B;B	0.18610	0.0;0.029;0.0	B;B;B	0.08055	0.001;0.003;0.0	T	0.13045	-1.0524	10	0.22109	T	0.4	-13.8251	0.7722	0.01026	0.1832:0.2778:0.2564:0.2826	.	20;20;20	Q5QPH3;B4DEH9;Q9NR19	.;.;ACSA_HUMAN	T	20	ENSP00000353804:A20T;ENSP00000419167:A20T;ENSP00000418812:A20T;ENSP00000419925:A20T;ENSP00000253382:A20T	ENSP00000253382:A20T	A	+	1	0	ACSS2	32928167	0.001000	0.12720	0.004000	0.12327	0.886000	0.51366	0.052000	0.14163	-0.666000	0.05310	0.462000	0.41574	GCT	.	.		0.746	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078823.3	NM_018677	
EPB41L1	2036	hgsc.bcm.edu	37	20	34797717	34797717	+	Missense_Mutation	SNP	G	G	T	rs140677677		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr20:34797717G>T	ENST00000338074.2	+	15	2137	c.1976G>T	c.(1975-1977)cGg>cTg	p.R659L	EPB41L1_ENST00000202028.5_Missense_Mutation_p.R585L|EPB41L1_ENST00000373941.1_Missense_Mutation_p.R659L|EPB41L1_ENST00000441639.1_Missense_Mutation_p.R585L|EPB41L1_ENST00000479336.1_3'UTR|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000373950.2_Missense_Mutation_p.R550L	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	659					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.R948L(1)|p.R659L(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CTGTTCTCCCGGGATCTCAAC	0.637																																					p.R659L		Atlas-SNP	.											EPB41L1_ENST00000344237,NS,carcinoma,0,2	EPB41L1	111	.	2	Substitution - Missense(2)	lung(2)	c.G1976T						.						32.0	35.0	34.0					20																	34797717		2203	4300	6503	SO:0001583	missense	2036	exon16			TCTCCCGGGATCT	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1976G>T	chr20.hg19:g.34797717G>T	ENSP00000337168:p.Arg659Leu	82.0	1.0		105.0	26.0	NM_001258329	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	ENST00000338074.2	hg19	CCDS13271.1	.	.	.	.	.	.	.	.	.	.	G	14.66	2.602254	0.46423	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000344237;ENST00000338074;ENST00000373941	D;D;D;D;D	0.83837	-1.77;-1.68;-1.77;-1.75;-1.75	5.87	3.91	0.45181	.	0.193405	0.49916	D	0.000132	T	0.75228	0.3821	N	0.24115	0.695	0.33013	D	0.527767	B;D;B;B;B;B	0.59767	0.026;0.986;0.016;0.039;0.18;0.15	B;P;B;B;B;B	0.51355	0.011;0.667;0.007;0.029;0.028;0.049	T	0.77411	-0.2598	10	0.32370	T	0.25	-8.0653	6.2374	0.20770	0.3153:0.0:0.6847:0.0	.	659;948;659;550;550;585	B7Z653;E9PCJ3;Q9H4G0;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;.;E41L1_HUMAN;.;.;.	L	585;550;659;550;585;948;659;659	ENSP00000202028:R585L;ENSP00000363061:R550L;ENSP00000399214:R585L;ENSP00000337168:R659L;ENSP00000363052:R659L	ENSP00000202028:R585L	R	+	2	0	EPB41L1	34261131	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.031000	0.41117	1.616000	0.50265	0.655000	0.94253	CGG	.	G|1.000;A|0.000		0.637	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
ITSN1	6453	hgsc.bcm.edu	37	21	35183471	35183471	+	Missense_Mutation	SNP	G	G	T			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr21:35183471G>T	ENST00000381318.3	+	21	2800	c.2512G>T	c.(2512-2514)Gta>Tta	p.V838L	AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000437442.2_Missense_Mutation_p.V833L|ITSN1_ENST00000399355.2_Missense_Mutation_p.V838L|ITSN1_ENST00000381285.4_Missense_Mutation_p.V838L|ITSN1_ENST00000399326.3_Missense_Mutation_p.V833L|ITSN1_ENST00000399353.1_Missense_Mutation_p.V796L|ITSN1_ENST00000399352.1_Missense_Mutation_p.V833L|ITSN1_ENST00000399338.4_Missense_Mutation_p.V833L|ITSN1_ENST00000381291.4_Missense_Mutation_p.V838L|ITSN1_ENST00000399367.3_Missense_Mutation_p.V833L|ITSN1_ENST00000399349.1_Missense_Mutation_p.V833L|ITSN1_ENST00000379960.5_Missense_Mutation_p.V833L	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	838					apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						CCCTTTGGCAGTAACCTCTTC	0.542																																					p.V838L		Atlas-SNP	.											.	ITSN1	166	.	0			c.G2512T						.						84.0	82.0	82.0					21																	35183471		2203	4300	6503	SO:0001583	missense	6453	exon21			TTGGCAGTAACCT	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.2512G>T	chr21.hg19:g.35183471G>T	ENSP00000370719:p.Val838Leu	146.0	0.0		179.0	36.0	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	hg19	CCDS33545.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.240|8.240	0.806515|0.806515	0.16467|0.16467	.|.	.|.	ENSG00000205726|ENSG00000205726	ENST00000440794|ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	.|T;T;T;T;T;T;T;T;T;T;T;T	.|0.44881	.|1.48;0.91;0.99;0.94;1.04;1.47;0.98;1.39;2.03;1.02;2.01;2.06	5.66|5.66	0.391|0.391	0.16282|0.16282	.|.	.|0.794609	.|0.11149	.|N	.|0.594338	T|T	0.19087|0.19087	0.0458|0.0458	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|B;P;B;B;P;B;B;B;B;P	.|0.37688	.|0.442;0.456;0.02;0.128;0.527;0.006;0.227;0.07;0.202;0.605	.|B;B;B;B;B;B;B;B;B;B	.|0.36766	.|0.17;0.084;0.01;0.101;0.232;0.01;0.079;0.028;0.153;0.175	T|T	0.14062|0.14062	-1.0486|-1.0486	5|10	.|0.41790	.|T	.|0.15	.|.	8.241|8.241	0.31660|0.31660	0.2745:0.1627:0.5628:0.0|0.2745:0.1627:0.5628:0.0	.|.	.|801;801;796;833;838;833;833;838;833;796	.|A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.|.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	I|L	72|796;838;838;838;838;833;833;833;838;833;833;833;833;833	.|ENSP00000382290:V796L;ENSP00000370719:V838L;ENSP00000370691:V838L;ENSP00000370685:V838L;ENSP00000382301:V833L;ENSP00000382289:V833L;ENSP00000382292:V838L;ENSP00000382286:V833L;ENSP00000382275:V833L;ENSP00000387377:V833L;ENSP00000382265:V833L;ENSP00000369294:V833L	.|ENSP00000369294:V833L	S|V	+|+	2|1	0|0	ITSN1|ITSN1	34105341|34105341	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.924000|0.924000	0.55760|0.55760	0.526000|0.526000	0.22971|0.22971	0.343000|0.343000	0.23821|0.23821	0.563000|0.563000	0.77884|0.77884	AGT|GTA	.	.		0.542	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
AHNAK	79026	hgsc.bcm.edu	37	11	62286109	62286109	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr11:62286109delG	ENST00000378024.4	-	5	16054	c.15780delC	c.(15778-15780)cccfs	p.P5260fs	AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5260					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTCAAGAGAGGGTAGCTGGG	0.522																																					p.S5261fs		Atlas-Indel,Pindel	.											.	AHNAK	532	.	0			c.15781delT						.						94.0	91.0	92.0					11																	62286109		2202	4299	6501	SO:0001589	frameshift_variant	79026	exon5			.	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.15780delC	chr11.hg19:g.62286109delG	ENSP00000367263:p.Pro5260fs	101.0	0.0		87.0	12.0	NM_001620	A1A586	Frame_Shift_Del	DEL	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.		0.522	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
CIRBP	1153	hgsc.bcm.edu	37	19	1271998	1271998	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr19:1271998delC	ENST00000588030.1	+	6	710	c.450delC	c.(448-450)ggcfs	p.G150fs	CIRBP_ENST00000588090.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000589660.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000589235.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000587896.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000591935.1_Frame_Shift_Del_p.G150fs|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000586472.1_Frame_Shift_Del_p.G150fs|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000586773.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000589710.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000444172.2_Frame_Shift_Del_p.G97fs|CIRBP_ENST00000413636.2_Frame_Shift_Del_p.G116fs|CIRBP_ENST00000320936.5_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000589686.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000588230.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000585630.1_Frame_Shift_Del_p.G150fs|CIRBP_ENST00000587323.1_Frame_Shift_Del_p.G150fs			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	150	Gly-rich.				mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGAGTGGTGGCTACAGTGACC	0.612																																					p.G150fs		Atlas-Indel,Pindel	.											.	CIRBP	19	.	0			c.449delG						.						123.0	105.0	111.0					19																	1271998		2203	4300	6503	SO:0001589	frameshift_variant	1153	exon6			.	D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.450delC	chr19.hg19:g.1271998delC	ENSP00000468788:p.Gly150fs	388.0	0.0		449.0	86.0	NM_001280	B3KT17|B4E2X2	Frame_Shift_Del	DEL	ENST00000588030.1	hg19	CCDS12059.1																																																																																			.	.		0.612	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449969.1	NM_001280	
DSPP	1834	hgsc.bcm.edu	37	4	88537069	88537070	+	In_Frame_Ins	INS	-	-	GATAGCAGC			TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr4:88537069_88537070insGATAGCAGC	ENST00000282478.7	+	4	3288_3289	c.3255_3256insGATAGCAGC	c.(3256-3258)gat>GATAGCAGCgat	p.1086_1086D>DSSD	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_In_Frame_Ins_p.1086_1086D>DSSD			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1086	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgaaagcagtgatagcagtga	0.545																																					p.S1085delinsSDSS		Atlas-INDEL	.											.	DSPP	174	.	0			c.3255_3256insGATAGCAGC						.																																			SO:0001652	inframe_insertion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	Exception_encountered	chr4.hg19:g.88537069_88537070insGATAGCAGC	ENSP00000282478:p.SerSerAsp1089dup	128.0	0.0		144.0	78.0	NM_014208	A8MUI0|O95815	In_Frame_Ins	INS	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.545	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
TIPARP	25976	hgsc.bcm.edu	37	3	156422743	156422766	+	In_Frame_Del	DEL	CAGTCATGGCATGAGAAGGCCCCC	CAGTCATGGCATGAGAAGGCCCCC	-	rs267599664		TCGA-HP-A5MZ-01A-21D-A27I-10	TCGA-HP-A5MZ-10A-01D-A27I-10	CAGTCATGGCATGAGAAGGCCCCC	CAGTCATGGCATGAGAAGGCCCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c36213e4-c057-46f5-ada5-f1f921855bb4	09ea881b-e60d-4cbe-9c35-d556da8bf86c	g.chr3:156422743_156422766delCAGTCATGGCATGAGAAGGCCCCC	ENST00000461166.1	+	6	2385_2408	c.1797_1820delCAGTCATGGCATGAGAAGGCCCCC	c.(1795-1821)ggcagtcatggcatgagaaggcccccg>ggg	p.SHGMRRPP600del	TIPARP_ENST00000295924.7_In_Frame_Del_p.SHGMRRPP600del|TIPARP_ENST00000486483.1_In_Frame_Del_p.SHGMRRPP600del|TIPARP_ENST00000542783.1_In_Frame_Del_p.SHGMRRPP600del	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	600	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ACACAATGGGCAGTCATGGCATGAGAAGGCCCCCGCCAGTCaat	0.455																																					p.599_607del	Ovarian(171;276 1987 3319 6837 11197)	Pindel	.											.	TIPARP	50	.	0			c.1796_1819del						.																																			SO:0001651	inframe_deletion	25976	exon6			.	BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.1797_1820delCAGTCATGGCATGAGAAGGCCCCC	chr3.hg19:g.156422743_156422766delCAGTCATGGCATGAGAAGGCCCCC	ENSP00000420612:p.Ser600_Pro607del	117.0	0.0		151.0	14.0	NM_001184717	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	In_Frame_Del	DEL	ENST00000461166.1	hg19	CCDS3177.1																																																																																			.	.		0.455	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351618.1	NM_015508	
