#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBXN10	127733	hgsc.bcm.edu	37	1	20517668	20517668	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr1:20517668C>T	ENST00000375099.3	+	2	698	c.614C>T	c.(613-615)tCa>tTa	p.S205L		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	205	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.									endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						GCTGTTAGATCACCAACAGGC	0.493																																					p.S205L		Atlas-SNP	.											.	UBXN10	29	.	0			c.C614T						.						124.0	119.0	120.0					1																	20517668		2203	4300	6503	SO:0001583	missense	127733	exon2			TTAGATCACCAAC	AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.614C>T	chr1.hg19:g.20517668C>T	ENSP00000364240:p.Ser205Leu	66.0	0.0		61.0	20.0	NM_152376	Q5R386	Missense_Mutation	SNP	ENST00000375099.3	hg19	CCDS205.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.250616	0.80135	.	.	ENSG00000162543	ENST00000375099	.	.	.	4.92	4.92	0.64577	UBX (3);	0.114875	0.37136	N	0.002227	T	0.73892	0.3645	L	0.50333	1.59	0.49798	D	0.999826	D	0.76494	0.999	D	0.72982	0.979	T	0.73151	-0.4073	9	0.42905	T	0.14	-15.0667	16.8349	0.85954	0.0:1.0:0.0:0.0	.	205	Q96LJ8	UBX10_HUMAN	L	205	.	ENSP00000364240:S205L	S	+	2	0	UBXN10	20390255	1.000000	0.71417	0.253000	0.24343	0.748000	0.42578	6.810000	0.75216	2.543000	0.85770	0.591000	0.81541	TCA	.	.		0.493	UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007693.1	NM_152376	
CEP85	64793	hgsc.bcm.edu	37	1	26603246	26603246	+	Missense_Mutation	SNP	T	T	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr1:26603246T>A	ENST00000252992.4	+	13	2254	c.2123T>A	c.(2122-2124)aTt>aAt	p.I708N	CEP85_ENST00000451429.2_Missense_Mutation_p.I657N|CEP85_ENST00000469609.1_3'UTR|SH3BGRL3_ENST00000270792.5_5'Flank	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	708						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						CTCCTGGGCATTCACTGTGAG	0.552																																					p.I708N		Atlas-SNP	.											.	CEP85	61	.	0			c.T2123A						.						40.0	32.0	35.0					1																	26603246		2203	4300	6503	SO:0001583	missense	64793	exon13			TGGGCATTCACTG	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.2123T>A	chr1.hg19:g.26603246T>A	ENSP00000252992:p.Ile708Asn	133.0	0.0		105.0	29.0	NM_022778	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Missense_Mutation	SNP	ENST00000252992.4	hg19	CCDS277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.2|25.2	4.609720|4.609720	0.87258|0.87258	.|.	.|.	ENSG00000130695|ENSG00000130695	ENST00000453146|ENST00000451429;ENST00000252992	.|T;T	.|0.11169	.|2.8;2.8	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.048397	.|0.85682	.|D	.|0.000000	T|T	0.34048|0.34048	0.0884|0.0884	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;1.0	.|D;D;D	.|0.78314	.|0.965;0.977;0.991	T|T	0.07578|0.07578	-1.0765|-1.0765	5|10	.|0.72032	.|D	.|0.01	-7.3726|-7.3726	15.6105|15.6105	0.76713|0.76713	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|657;708;708	.|F8W7K4;Q6P2H3;Q6P2H3-2	.|.;CEP85_HUMAN;.	I|N	382|657;708	.|ENSP00000417002:I657N;ENSP00000252992:I708N	.|ENSP00000252992:I708N	F|I	+|+	1|2	0|0	CEP85|CEP85	26475833|26475833	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	7.665000|7.665000	0.83852|0.83852	2.105000|2.105000	0.64084|0.64084	0.454000|0.454000	0.30748|0.30748	TTC|ATT	.	.		0.552	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009492.2	NM_022778	
KIAA1324	57535	hgsc.bcm.edu	37	1	109734359	109734359	+	Silent	SNP	T	T	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr1:109734359T>C	ENST00000369939.3	+	13	1740	c.1557T>C	c.(1555-1557)tcT>tcC	p.S519S	KIAA1324_ENST00000369938.1_3'UTR|KIAA1324_ENST00000529753.1_Silent_p.S432S	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	519					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		GTGTGAATTCTAGGACCAACA	0.557																																					p.S519S		Atlas-SNP	.											.	KIAA1324	77	.	0			c.T1557C						.						139.0	131.0	133.0					1																	109734359		2203	4300	6503	SO:0001819	synonymous_variant	57535	exon13			GAATTCTAGGACC	AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.1557T>C	chr1.hg19:g.109734359T>C		88.0	0.0		83.0	15.0	NM_020775	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Silent	SNP	ENST00000369939.3	hg19	CCDS794.1																																																																																			.	.		0.557	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775	
RFWD2	64326	hgsc.bcm.edu	37	1	175957534	175957534	+	Missense_Mutation	SNP	T	T	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr1:175957534T>A	ENST00000367669.3	-	17	2376	c.1862A>T	c.(1861-1863)cAg>cTg	p.Q621L	RFWD2_ENST00000308769.8_Missense_Mutation_p.Q597L	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	621					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CAGTTTTAGCTGACTGTCTGT	0.393																																					p.Q621L	Ovarian(134;1413 1765 5706 35534 51541)	Atlas-SNP	.											.	RFWD2	67	.	0			c.A1862T						.						126.0	109.0	115.0					1																	175957534		2203	4300	6503	SO:0001583	missense	64326	exon17			TTTAGCTGACTGT	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1862A>T	chr1.hg19:g.175957534T>A	ENSP00000356641:p.Gln621Leu	116.0	0.0		100.0	28.0	NM_022457	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	hg19	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.465121	0.84425	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	T;T;T	0.41400	1.0;1.0;1.0	4.98	4.98	0.66077	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.41743	0.1172	N	0.04686	-0.185	0.80722	D	1	D;P;D;P;P	0.67145	0.97;0.705;0.996;0.925;0.705	P;P;P;D;P	0.65140	0.79;0.6;0.899;0.932;0.6	T	0.55140	-0.8187	10	0.72032	D	0.01	-8.4906	14.6158	0.68547	0.0:0.0:0.0:1.0	.	396;381;597;621;621	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	L	396;621;456;597	ENSP00000356641:Q621L;ENSP00000356638:Q456L;ENSP00000310943:Q597L	ENSP00000310943:Q597L	Q	-	2	0	RFWD2	174224157	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	7.806000	0.86020	1.978000	0.57642	0.482000	0.46254	CAG	.	.		0.393	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	
PTPN14	5784	hgsc.bcm.edu	37	1	214557934	214557934	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr1:214557934G>A	ENST00000366956.5	-	13	1458	c.1264C>T	c.(1264-1266)Cgg>Tgg	p.R422W	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	422					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TAGTCGGCCCGCATGATGTCA	0.587																																					p.R422W	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.C1264T						.						136.0	126.0	129.0					1																	214557934		2203	4300	6503	SO:0001583	missense	5784	exon13			CGGCCCGCATGAT	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1264C>T	chr1.hg19:g.214557934G>A	ENSP00000355923:p.Arg422Trp	103.0	0.0		100.0	30.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489143	0.64074	.	.	ENSG00000152104	ENST00000366956	T	0.73363	-0.74	5.5	2.23	0.28157	.	0.000000	0.85682	D	0.000000	T	0.82250	0.4996	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.81428	-0.0937	10	0.87932	D	0	.	8.6931	0.34278	0.0:0.113:0.3439:0.5431	.	422	Q15678	PTN14_HUMAN	W	422	ENSP00000355923:R422W	ENSP00000355923:R422W	R	-	1	2	PTPN14	212624557	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.522000	0.45572	0.590000	0.29694	0.655000	0.94253	CGG	.	.		0.587	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
MYT1L	23040	hgsc.bcm.edu	37	2	1895870	1895870	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr2:1895870G>A	ENST00000399161.2	-	15	2969	c.2222C>T	c.(2221-2223)aCg>aTg	p.T741M	MYT1L_ENST00000428368.2_Missense_Mutation_p.T739M	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	741					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCGGCAGCGCGTGGACAGGTT	0.701																																					p.T739M		Atlas-SNP	.											.	MYT1L	241	.	0			c.C2216T						.						11.0	23.0	19.0					2																	1895870		1685	3108	4793	SO:0001583	missense	23040	exon15			CAGCGCGTGGACA	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2222C>T	chr2.hg19:g.1895870G>A	ENSP00000382114:p.Thr741Met	65.0	0.0		66.0	21.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	G	32	5.153386	0.94645	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.58652	0.32;0.32	4.93	4.93	0.64822	Myelin transcription factor 1 (1);	0.000000	0.85682	D	0.000000	T	0.78811	0.4342	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.983	T	0.82790	-0.0283	10	0.87932	D	0	-28.9357	18.1375	0.89624	0.0:0.0:1.0:0.0	.	741;739	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	M	741;687;739	ENSP00000382114:T741M;ENSP00000396103:T739M	ENSP00000295067:T687M	T	-	2	0	MYT1L	1874877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.749000	0.98871	2.298000	0.77334	0.467000	0.42956	ACG	.	.		0.701	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
LTBP1	4052	hgsc.bcm.edu	37	2	33518280	33518280	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr2:33518280C>T	ENST00000404816.2	+	20	3519	c.3166C>T	c.(3166-3168)Ctt>Ttt	p.L1056F	LTBP1_ENST00000418533.2_Missense_Mutation_p.L730F|LTBP1_ENST00000354476.3_Missense_Mutation_p.L1057F|LTBP1_ENST00000407925.1_Missense_Mutation_p.L730F|LTBP1_ENST00000272273.5_5'UTR|LTBP1_ENST00000404525.1_Missense_Mutation_p.L677F|LTBP1_ENST00000390003.4_Missense_Mutation_p.L731F|LTBP1_ENST00000402934.1_Missense_Mutation_p.L677F|LTBP1_ENST00000498013.1_3'UTR			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1056	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TTGTTCCAACCTTGAAGGCTC	0.433																																					p.L1056F		Atlas-SNP	.											.	LTBP1	317	.	0			c.C3166T						.						109.0	97.0	101.0					2																	33518280		2203	4300	6503	SO:0001583	missense	4052	exon20			TCCAACCTTGAAG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.3166C>T	chr2.hg19:g.33518280C>T	ENSP00000386043:p.Leu1056Phe	414.0	1.0		356.0	98.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	hg19	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.330116	0.81690	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.91996	-2.95;-2.95;-2.95;-2.95;-2.95;-2.95;-2.95	5.66	5.66	0.87406	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.94922	0.8358	M	0.64997	1.995	0.80722	D	1	D;D;B;D;B;D	0.57257	0.979;0.975;0.154;0.974;0.035;0.974	D;P;B;P;B;P	0.63033	0.91;0.791;0.16;0.756;0.045;0.854	D	0.95073	0.8206	9	0.72032	D	0.01	.	17.2525	0.87046	0.0:1.0:0.0:0.0	.	1056;730;677;730;731;1057	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	F	1056;1057;731;730;677;677;730	ENSP00000386043:L1056F;ENSP00000346467:L1057F;ENSP00000374653:L731F;ENSP00000393057:L730F;ENSP00000384373:L677F;ENSP00000385359:L677F;ENSP00000384091:L730F	ENSP00000346467:L1057F	L	+	1	0	LTBP1	33371784	0.998000	0.40836	0.998000	0.56505	0.995000	0.86356	2.025000	0.41059	2.663000	0.90544	0.555000	0.69702	CTT	.	.		0.433	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
TTN	7273	hgsc.bcm.edu	37	2	179571276	179571276	+	Silent	SNP	G	G	A	rs377442695	byFrequency	TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr2:179571276G>A	ENST00000591111.1	-	100	28598	c.28374C>T	c.(28372-28374)aaC>aaT	p.N9458N	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Silent_p.N9775N|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Silent_p.N8531N|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13552	Ig-like 77.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCATGTTCGTTAAATGCCA	0.403													G|||	2	0.000399361	0.0	0.0	5008	,	,		18712	0.002		0.0	False		,,,				2504	0.0				p.N9775N		Atlas-SNP	.											.	TTN	18412	.	0			c.C29325T						.	G	,,,	0,3818		0,0,1909	177.0	162.0	167.0		,25593,,	3.6	1.0	2		167	1,8259		0,1,4129	no	intron,coding-synonymous,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,1,6038	AA,AG,GG		0.0121,0.0,0.0083	,,,	,8531/33424,,	179571276	1,12077	1909	4130	6039	SO:0001819	synonymous_variant	7273	exon102			ATGTTCGTTAAAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.28374C>T	chr2.hg19:g.179571276G>A		119.0	0.0		113.0	20.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CELSR3	1951	hgsc.bcm.edu	37	3	48699034	48699034	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr3:48699034A>G	ENST00000164024.4	-	1	1314	c.1034T>C	c.(1033-1035)cTa>cCa	p.L345P	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.L345P	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	345	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AACCACGCGTAGCACCGCGGT	0.672																																					p.L345P		Atlas-SNP	.											.	CELSR3	237	.	0			c.T1034C						.						39.0	44.0	42.0					3																	48699034		2192	4285	6477	SO:0001583	missense	1951	exon1			ACGCGTAGCACCG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.1034T>C	chr3.hg19:g.48699034A>G	ENSP00000164024:p.Leu345Pro	80.0	0.0		54.0	20.0	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	hg19	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	A	19.17	3.776616	0.70107	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.56444	0.46;0.46	5.83	5.83	0.93111	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.73659	0.3615	M	0.82630	2.6	0.80722	D	1	D;D	0.71674	0.988;0.998	P;D	0.66979	0.904;0.948	T	0.76386	-0.2978	9	0.49607	T	0.09	.	15.8624	0.79035	1.0:0.0:0.0:0.0	.	345;415	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	P	345	ENSP00000164024:L345P;ENSP00000445694:L345P	ENSP00000164024:L345P	L	-	2	0	CELSR3	48674038	0.499000	0.26083	0.998000	0.56505	0.335000	0.28730	4.433000	0.59929	2.235000	0.73313	0.533000	0.62120	CTA	.	.		0.672	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
DCUN1D4	23142	hgsc.bcm.edu	37	4	52757946	52757946	+	Silent	SNP	T	T	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr4:52757946T>G	ENST00000334635.5	+	7	615	c.435T>G	c.(433-435)gcT>gcG	p.A145A	DCUN1D4_ENST00000451288.2_Silent_p.A189A|DCUN1D4_ENST00000381441.3_Silent_p.A145A|DCUN1D4_ENST00000381437.4_Silent_p.A85A	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	145	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.					nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			TTGTCCTAGCTTGGAAATTGG	0.323																																					p.A145A		Atlas-SNP	.											.	DCUN1D4	26	.	0			c.T435G						.						112.0	115.0	114.0					4																	52757946		2203	4300	6503	SO:0001819	synonymous_variant	23142	exon7			CCTAGCTTGGAAA	D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.435T>G	chr4.hg19:g.52757946T>G		60.0	0.0		75.0	15.0	NM_015115	B4DH25|Q7Z3F3|Q7Z6B8	Silent	SNP	ENST00000334635.5	hg19	CCDS33982.1																																																																																			.	.		0.323	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
C4orf26	152816	hgsc.bcm.edu	37	4	76481309	76481309	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr4:76481309G>C	ENST00000311623.4	+	1	52	c.17G>C	c.(16-18)tGc>tCc	p.C6S	C4orf26_ENST00000514064.1_3'UTR|C4orf26_ENST00000435974.2_Missense_Mutation_p.C6S	NM_001257072.1|NM_178497.3	NP_001244001.1|NP_848592.2	Q17RF5	CD026_HUMAN	chromosome 4 open reading frame 26	6						extracellular region (GO:0005576)				kidney(1)|large_intestine(4)|stomach(1)	6			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CGCAGACACTGCTTCTCCTAC	0.473																																					p.C6S		Atlas-SNP	.											.	C4orf26	24	.	0			c.G17C						.						159.0	144.0	149.0					4																	76481309		2203	4300	6503	SO:0001583	missense	152816	exon1			GACACTGCTTCTC	AK074237	CCDS3569.1, CCDS56334.1, CCDS75142.1	4q21.1	2012-10-31			ENSG00000174792	ENSG00000174792			26300	protein-coding gene	gene with protein product		614829				22901946	Standard	NM_001206981		Approved	FLJ23657	uc011cbo.2	Q17RF5	OTTHUMG00000130104	ENST00000311623.4:c.17G>C	chr4.hg19:g.76481309G>C	ENSP00000311307:p.Cys6Ser	116.0	0.0		107.0	24.0	NM_001257072	B4DTI3|E7ETQ0|Q8TEC3	Missense_Mutation	SNP	ENST00000311623.4	hg19	CCDS3569.1	.	.	.	.	.	.	.	.	.	.	G	4.674	0.125313	0.08931	.	.	ENSG00000174792	ENST00000311623;ENST00000435974	T;T	0.60040	1.4;0.22	4.96	2.78	0.32641	.	0.285410	0.25241	N	0.032094	T	0.33990	0.0882	L	0.27053	0.805	0.09310	N	1	B;B	0.22003	0.063;0.002	B;B	0.15484	0.013;0.005	T	0.15636	-1.0430	10	0.09338	T	0.73	.	4.2792	0.10824	0.152:0.0:0.6466:0.2014	.	6;6	E7ETQ0;Q17RF5	.;CD026_HUMAN	S	6	ENSP00000311307:C6S;ENSP00000406925:C6S	ENSP00000311307:C6S	C	+	2	0	C4orf26	76700333	0.004000	0.15560	0.014000	0.15608	0.044000	0.14063	0.394000	0.20834	0.527000	0.28560	-0.181000	0.13052	TGC	.	.		0.473	C4orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252410.1	NM_178497	
HPSE	10855	hgsc.bcm.edu	37	4	84216608	84216608	+	Silent	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr4:84216608G>A	ENST00000405413.2	-	13	1657	c.1521C>T	c.(1519-1521)acC>acT	p.T507T	HPSE_ENST00000513463.1_Silent_p.T449T|HPSE_ENST00000311412.5_Silent_p.T507T|HPSE_ENST00000512196.1_Silent_p.T433T	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	507					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	AAGGTGGCAAGGTTTGATCAT	0.448																																					p.T507T		Atlas-SNP	.											.	HPSE	55	.	0			c.C1521T						.						95.0	96.0	96.0					4																	84216608		2203	4300	6503	SO:0001819	synonymous_variant	10855	exon12			TGGCAAGGTTTGA	AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.1521C>T	chr4.hg19:g.84216608G>A		149.0	0.0		135.0	35.0	NM_001098540	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Silent	SNP	ENST00000405413.2	hg19	CCDS3602.1																																																																																			.	.		0.448	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252812.2	NM_006665	
MTNR1A	4543	hgsc.bcm.edu	37	4	187455203	187455203	+	Silent	SNP	T	T	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr4:187455203T>C	ENST00000307161.5	-	2	894	c.693A>G	c.(691-693)ccA>ccG	p.P231P	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	231					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TGAAGTCCTGTGGTTTCAGTT	0.488																																					p.P231P		Atlas-SNP	.											.	MTNR1A	46	.	0			c.A693G						.						140.0	149.0	146.0					4																	187455203		2203	4300	6503	SO:0001819	synonymous_variant	4543	exon2			GTCCTGTGGTTTC		CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.693A>G	chr4.hg19:g.187455203T>C		164.0	0.0		137.0	32.0	NM_005958	A0AVC5|B0M0L2	Silent	SNP	ENST00000307161.5	hg19	CCDS3848.1																																																																																			.	.		0.488	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360189.1		
IL7R	3575	hgsc.bcm.edu	37	5	35867558	35867558	+	Silent	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr5:35867558C>T	ENST00000303115.3	+	3	501	c.372C>T	c.(370-372)acC>acT	p.T124T	IL7R_ENST00000506850.1_Silent_p.T124T|IL7R_ENST00000511982.1_Silent_p.T124T|IL7R_ENST00000511031.1_3'UTR|IL7R_ENST00000343305.4_Silent_p.T124T	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	124					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.T124T(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TAGACCTAACCACTATAGGTA	0.343			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																														p.T124T		Atlas-SNP	.		Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	IL7R,NS,carcinoma,0,1	IL7R	200	.	1	Substitution - coding silent(1)	lung(1)	c.C372T						.						71.0	72.0	72.0					5																	35867558		2203	4300	6503	SO:0001819	synonymous_variant	3575	exon3			CCTAACCACTATA	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.372C>T	chr5.hg19:g.35867558C>T		57.0	0.0		54.0	9.0	NM_002185	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Silent	SNP	ENST00000303115.3	hg19	CCDS3911.1																																																																																			.	.		0.343	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2		
FST	10468	hgsc.bcm.edu	37	5	52776663	52776663	+	Silent	SNP	G	G	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr5:52776663G>C	ENST00000256759.3	+	1	425	c.42G>C	c.(40-42)ctG>ctC	p.L14L	FST_ENST00000396947.3_Silent_p.L14L	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	14					BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)	p.L14L(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				TTTGCCTCCTGCTGCTGCTGC	0.731																																					p.L14L		Atlas-SNP	.											FST,colon,carcinoma,0,1	FST	42	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G42C						.						20.0	15.0	17.0					5																	52776663		2000	3838	5838	SO:0001819	synonymous_variant	10468	exon1			CCTCCTGCTGCTG	M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.42G>C	chr5.hg19:g.52776663G>C		85.0	0.0		63.0	3.0	NM_013409	B5BU94|Q9BTH0	Silent	SNP	ENST00000256759.3	hg19	CCDS3959.1																																																																																			.	.		0.731	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253906.1	NM_013409	
PDE4D	5144	hgsc.bcm.edu	37	5	59189173	59189173	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr5:59189173C>T	ENST00000340635.6	-	1	452	c.277G>A	c.(277-279)Ggc>Agc	p.G93S	PDE4D_ENST00000502484.2_Intron|PDE4D_ENST00000546160.1_Intron	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	93					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GCGTAGCGGCCGCGGGCAGCC	0.801																																					p.G93S		Atlas-SNP	.											.	PDE4D	345	.	0			c.G277A						.						2.0	2.0	2.0					5																	59189173		926	2138	3064	SO:0001583	missense	5144	exon1			AGCGGCCGCGGGC		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.277G>A	chr5.hg19:g.59189173C>T	ENSP00000345502:p.Gly93Ser	362.0	0.0		272.0	67.0	NM_001104631	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000340635.6	hg19	CCDS47213.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941440	0.53079	.	.	ENSG00000113448	ENST00000340635	T	0.65364	-0.15	4.09	3.22	0.36961	.	.	.	.	.	T	0.41558	0.1164	N	0.24115	0.695	0.58432	D	0.999991	B	0.28208	0.203	B	0.17433	0.018	T	0.17806	-1.0357	9	0.21540	T	0.41	.	8.6276	0.33899	0.0:0.8226:0.0:0.1774	.	93	Q08499	PDE4D_HUMAN	S	93	ENSP00000345502:G93S	ENSP00000345502:G93S	G	-	1	0	PDE4D	59224930	0.995000	0.38212	0.064000	0.19789	0.787000	0.44495	1.519000	0.35888	1.057000	0.40506	0.484000	0.47621	GGC	.	.		0.801	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
PCDHA7	56141	hgsc.bcm.edu	37	5	140215179	140215179	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr5:140215179A>G	ENST00000525929.1	+	1	1211	c.1211A>G	c.(1210-1212)tAc>tGc	p.Y404C	PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.Y404C	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	404	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCAAGAATTACTATTCATTG	0.577																																					p.Y404C	NSCLC(160;258 2013 5070 22440 28951)	Atlas-SNP	.											.	PCDHA7	367	.	0			c.A1211G						.						128.0	128.0	128.0					5																	140215179		2203	4299	6502	SO:0001583	missense	56141	exon1			AGAATTACTATTC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1211A>G	chr5.hg19:g.140215179A>G	ENSP00000436426:p.Tyr404Cys	152.0	0.0		115.0	23.0	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	hg19	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	A	12.05	1.821903	0.32237	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.01745	4.66;4.66	4.04	4.04	0.47022	Cadherin (4);Cadherin-like (1);	0.000000	0.29537	U	0.011878	T	0.14184	0.0343	H	0.94264	3.515	0.31404	N	0.676281	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.13335	-1.0513	10	0.87932	D	0	.	10.7335	0.46111	0.8409:0.1591:0.0:0.0	.	404;404	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	C	404	ENSP00000436426:Y404C;ENSP00000367365:Y404C	ENSP00000367365:Y404C	Y	+	2	0	PCDHA7	140195363	0.011000	0.17503	0.984000	0.44739	0.207000	0.24258	2.361000	0.44160	1.592000	0.50018	0.254000	0.18369	TAC	.	.		0.577	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHA9	9752	hgsc.bcm.edu	37	5	140229434	140229434	+	Missense_Mutation	SNP	G	G	A	rs145248721		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr5:140229434G>A	ENST00000532602.1	+	1	2387	c.1354G>A	c.(1354-1356)Gca>Aca	p.A452T	PCDHA9_ENST00000378122.3_Missense_Mutation_p.A452T|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	452	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGACAACGCACCAGCGTT	0.672																																					p.A452T	Melanoma(55;1800 1972 14909)	Atlas-SNP	.											.	PCDHA9	373	.	0			c.G1354A						.	G	THR/ALA,,,,,,,,,,,THR/ALA	1,4391	2.1+/-5.4	0,1,2195	89.0	82.0	85.0		1354,,,,,,,,,,,1354	3.6	1.0	5	dbSNP_134	85	0,8538		0,0,4269	no	missense,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,missense	PCDHA9,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_014005.3,NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1	58,,,,,,,,,,,58	0,1,6464	AA,AG,GG		0.0,0.0228,0.0077	,,,,,,,,,,,	452/843,,,,,,,,,,,452/951	140229434	1,12929	2196	4269	6465	SO:0001583	missense	9752	exon1			GACAACGCACCAG	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1354G>A	chr5.hg19:g.140229434G>A	ENSP00000436042:p.Ala452Thr	207.0	0.0		212.0	60.0	NM_031857	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	hg19	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354424	0.61293	2.28E-4	0.0	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.61742	0.08;0.08	3.56	3.56	0.40772	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.31519	U	0.007517	T	0.77811	0.4186	M	0.86028	2.79	0.23524	N	0.997498	P;D	0.89917	0.925;1.0	B;D	0.87578	0.135;0.998	T	0.71590	-0.4547	10	0.87932	D	0	.	15.7535	0.78005	0.0:0.0:1.0:0.0	.	452;452	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	T	452	ENSP00000436042:A452T;ENSP00000367362:A452T	ENSP00000367362:A452T	A	+	1	0	PCDHA9	140209618	0.000000	0.05858	1.000000	0.80357	0.449000	0.32228	0.847000	0.27696	1.973000	0.57446	0.306000	0.20318	GCA	.	G|1.000;A|0.000		0.672	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
NT5E	4907	hgsc.bcm.edu	37	6	86176881	86176881	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr6:86176881G>A	ENST00000257770.3	+	2	492	c.443G>A	c.(442-444)gGg>gAg	p.G148E	NT5E_ENST00000369646.3_Missense_Mutation_p.G148E|NT5E_ENST00000369651.3_Missense_Mutation_p.G148E	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	148					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	AAAGCAAAGGGGCCACTAGCA	0.413																																					p.G148E	Melanoma(140;797 1765 2035 2752 18208)	Atlas-SNP	.											.	NT5E	56	.	0			c.G443A						.						134.0	124.0	127.0					6																	86176881		2203	4300	6503	SO:0001583	missense	4907	exon2			CAAAGGGGCCACT	X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.443G>A	chr6.hg19:g.86176881G>A	ENSP00000257770:p.Gly148Glu	159.0	0.0		113.0	31.0	NM_001204813	B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	ENST00000257770.3	hg19	CCDS5002.1	.	.	.	.	.	.	.	.	.	.	G	8.409	0.843766	0.16963	.	.	ENSG00000135318	ENST00000257770;ENST00000369646;ENST00000369651	D;D;D	0.83837	-1.77;-1.77;-1.77	5.57	1.26	0.21427	Metallophosphoesterase domain (1);	0.851095	0.11050	N	0.605173	T	0.41003	0.1140	N	0.11313	0.125	0.09310	N	1	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.11329	0.006;0.006;0.006	T	0.32955	-0.9887	10	0.15952	T	0.53	-4.0844	5.8042	0.18430	0.4144:0.1461:0.4395:0.0	.	148;148;148	B3KQI8;P21589;Q96B60	.;5NTD_HUMAN;.	E	148	ENSP00000257770:G148E;ENSP00000358660:G148E;ENSP00000358665:G148E	ENSP00000257770:G148E	G	+	2	0	NT5E	86233600	0.000000	0.05858	0.383000	0.26132	0.978000	0.69477	-0.059000	0.11731	0.313000	0.23062	0.462000	0.41574	GGG	.	.		0.413	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041388.1		
AKAP12	9590	hgsc.bcm.edu	37	6	151671011	151671011	+	Silent	SNP	C	C	T	rs370245999		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr6:151671011C>T	ENST00000253332.1	+	3	1674	c.1485C>T	c.(1483-1485)ggC>ggT	p.G495G	snoU13_ENST00000458767.1_RNA|AKAP12_ENST00000354675.6_Silent_p.G397G|AKAP12_ENST00000402676.2_Silent_p.G495G|AKAP12_ENST00000359755.5_Silent_p.G390G			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	495	Involved in PKC-binding. {ECO:0000305}.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		CCCCCGAAGGCGTTGTGAGTG	0.502																																					p.G495G	Melanoma(141;1616 1805 10049 24534 51979)	Atlas-SNP	.											.	AKAP12	170	.	0			c.C1485T						.	C	,	1,4405	2.1+/-5.4	0,1,2202	107.0	113.0	111.0		1485,1191	4.2	0.1	6		111	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	AKAP12	NM_005100.3,NM_144497.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	495/1783,397/1685	151671011	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9590	exon4			CGAAGGCGTTGTG	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.1485C>T	chr6.hg19:g.151671011C>T		85.0	0.0		93.0	23.0	NM_005100	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	ENST00000253332.1	hg19	CCDS5229.1																																																																																			.	.		0.502	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042712.1		
AEBP1	165	hgsc.bcm.edu	37	7	44149650	44149650	+	Missense_Mutation	SNP	A	A	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr7:44149650A>T	ENST00000223357.3	+	10	1492	c.1187A>T	c.(1186-1188)gAg>gTg	p.E396V	AEBP1_ENST00000454218.1_3'UTR|MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_5'Flank	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	396	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.|Required for DNA-binding and interaction with NFKBIA. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CACCGTATTGAGGACAACCAG	0.627																																					p.E396V		Atlas-SNP	.											.	AEBP1	102	.	0			c.A1187T						.						60.0	52.0	55.0					7																	44149650		2203	4300	6503	SO:0001583	missense	165	exon10			GTATTGAGGACAA	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1187A>T	chr7.hg19:g.44149650A>T	ENSP00000223357:p.Glu396Val	90.0	0.0		81.0	22.0	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	ENST00000223357.3	hg19	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.520613	0.85495	.	.	ENSG00000106624	ENST00000223357	D	0.97186	-4.28	5.05	5.05	0.67936	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.96380	0.8819	L	0.39514	1.22	0.80722	D	1	P	0.51933	0.949	P	0.56343	0.796	D	0.96381	0.9281	10	0.87932	D	0	-38.7085	10.6252	0.45504	0.839:0.161:0.0:0.0	.	396	Q8IUX7	AEBP1_HUMAN	V	396	ENSP00000223357:E396V	ENSP00000223357:E396V	E	+	2	0	AEBP1	44116175	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	5.984000	0.70548	1.908000	0.55244	0.459000	0.35465	GAG	.	.		0.627	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
DUS4L	11062	hgsc.bcm.edu	37	7	107217956	107217956	+	Nonsense_Mutation	SNP	C	C	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr7:107217956C>G	ENST00000265720.3	+	8	1267	c.905C>G	c.(904-906)tCa>tGa	p.S302*	BCAP29_ENST00000379117.2_5'Flank|BCAP29_ENST00000005259.4_5'Flank|BCAP29_ENST00000465919.1_5'Flank|RP4-593H12.1_ENST00000610269.1_RNA|BCAP29_ENST00000445771.2_5'Flank|DUS4L_ENST00000402620.1_Nonsense_Mutation_p.S181*	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	302							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						AATGCTCTGTCAAGCACATCA	0.358																																					p.S302X		Atlas-SNP	.											.	DUS4L	27	.	0			c.C905G						.						124.0	130.0	128.0					7																	107217956		2203	4300	6503	SO:0001587	stop_gained	11062	exon8			CTCTGTCAAGCAC	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.905C>G	chr7.hg19:g.107217956C>G	ENSP00000265720:p.Ser302*	118.0	0.0		103.0	25.0	NM_001270419	B4DLX0|Q2NKK1	Nonsense_Mutation	SNP	ENST00000265720.3	hg19	CCDS5745.1	.	.	.	.	.	.	.	.	.	.	C	38	7.261954	0.98171	.	.	ENSG00000105865	ENST00000265720;ENST00000402620	.	.	.	5.67	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	15.1503	0.72692	0.0:0.9319:0.0:0.0681	.	.	.	.	X	302;181	.	ENSP00000265720:S302X	S	+	2	0	DUS4L	107005192	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.447000	0.60020	1.536000	0.49237	0.655000	0.94253	TCA	.	.		0.358	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117431557	117431557	+	Missense_Mutation	SNP	C	C	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr7:117431557C>A	ENST00000160373.3	-	4	1784	c.1693G>T	c.(1693-1695)Gtt>Ttt	p.V565F	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	565					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TCTATAATAACCTTGAGTTGG	0.512																																					p.V565F		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.G1693T						.						112.0	119.0	117.0					7																	117431557		2203	4300	6503	SO:0001583	missense	83992	exon4			TAATAACCTTGAG		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1693G>T	chr7.hg19:g.117431557C>A	ENSP00000160373:p.Val565Phe	188.0	0.0		177.0	43.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	hg19	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.49|16.49	3.138871|3.138871	0.56936|0.56936	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000446636|ENST00000160373	.|T	.|0.68025	.|-0.3	5.37|5.37	3.5|3.5	0.40072|0.40072	.|.	.|0.289894	.|0.37809	.|N	.|0.001924	T|T	0.68210|0.68210	0.2976|0.2976	M|M	0.83852|0.83852	2.665|2.665	0.31045|0.31045	N|N	0.71585|0.71585	.|P	.|0.39576	.|0.679	.|B	.|0.38562	.|0.276	T|T	0.72887|0.72887	-0.4156|-0.4156	5|10	.|0.66056	.|D	.|0.02	-1.9558|-1.9558	11.3863|11.3863	0.49787|0.49787	0.0:0.862:0.0:0.138|0.0:0.862:0.0:0.138	.|.	.|565	.|Q8WZ74	.|CTTB2_HUMAN	V|F	93|565	.|ENSP00000160373:V565F	.|ENSP00000160373:V565F	G|V	-|-	2|1	0|0	CTTNBP2|CTTNBP2	117218793|117218793	1.000000|1.000000	0.71417|0.71417	0.778000|0.778000	0.31720|0.31720	0.996000|0.996000	0.88848|0.88848	4.037000|4.037000	0.57311|0.57311	0.691000|0.691000	0.31592|0.31592	0.563000|0.563000	0.77884|0.77884	GGT|GTT	.	.		0.512	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
IMPDH1	3614	hgsc.bcm.edu	37	7	128034577	128034577	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr7:128034577G>A	ENST00000480861.1	-	12	1434	c.1357C>T	c.(1357-1359)Ccc>Tcc	p.P453S	IMPDH1_ENST00000338791.6_Missense_Mutation_p.P543S|IMPDH1_ENST00000419067.2_Missense_Mutation_p.P510S|IMPDH1_ENST00000348127.6_Missense_Mutation_p.P507S|IMPDH1_ENST00000470772.1_Missense_Mutation_p.P457S|IMPDH1_ENST00000354269.5_Missense_Mutation_p.P533S|IMPDH1_ENST00000496200.1_Missense_Mutation_p.P433S|IMPDH1_ENST00000343214.4_Missense_Mutation_p.P433S|IMPDH1_ENST00000378717.4_Missense_Mutation_p.P474S	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						ATGAGGTAGGGCACGAACTTC	0.602																																					p.P543S		Atlas-SNP	.											.	IMPDH1	38	.	0			c.C1627T						.						92.0	87.0	89.0					7																	128034577		2203	4300	6503	SO:0001583	missense	3614	exon15			GGTAGGGCACGAA		CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.1357C>T	chr7.hg19:g.128034577G>A	ENSP00000420185:p.Pro453Ser	40.0	0.0		45.0	15.0	NM_000883		Missense_Mutation	SNP	ENST00000480861.1	hg19	CCDS55161.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.714827	0.89112	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861	T;T;T;T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.18	5.18	0.71444	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.87325	0.6149	M	0.83223	2.63	0.80722	D	1	P;P;D;P;D;D;D;P	0.65815	0.939;0.928;0.964;0.928;0.973;0.981;0.995;0.911	P;P;P;P;P;P;P;P	0.61722	0.762;0.629;0.629;0.629;0.846;0.599;0.893;0.496	D	0.87986	0.2746	10	0.46703	T	0.11	-28.3939	16.1961	0.82025	0.0:0.0:1.0:0.0	.	510;453;458;474;533;507;543;433	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	S	510;543;433;533;474;507;433;457;453	ENSP00000399400:P510S;ENSP00000345096:P543S;ENSP00000420803:P433S;ENSP00000346219:P533S;ENSP00000367989:P474S;ENSP00000265385:P507S;ENSP00000342438:P433S;ENSP00000417296:P457S;ENSP00000420185:P453S	ENSP00000345096:P543S	P	-	1	0	IMPDH1	127821813	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.912000	0.92726	2.409000	0.81822	0.561000	0.74099	CCC	.	.		0.602	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349462.1	NM_000883	
OR9A2	135924	hgsc.bcm.edu	37	7	142723576	142723576	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr7:142723576G>A	ENST00000350513.2	-	1	706	c.644C>T	c.(643-645)aCc>aTc	p.T215I		NM_001001658.1	NP_001001658.1	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A, member 2	215						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(3)|endometrium(4)|large_intestine(1)|lung(14)|skin(3)	25	Melanoma(164;0.059)					GATAATGTAGGTGTAGGAGAC	0.453																																					p.T215I		Atlas-SNP	.											.	OR9A2	52	.	0			c.C644T						.						84.0	90.0	88.0					7																	142723576		2203	4300	6503	SO:0001583	missense	135924	exon1			ATGTAGGTGTAGG		CCDS34767.1	7q34	2014-07-10			ENSG00000179468	ENSG00000179468		"""GPCR / Class A : Olfactory receptors"""	15093	protein-coding gene	gene with protein product							Standard	NM_001001658		Approved		uc003wcc.1	Q8NGT5	OTTHUMG00000158386	ENST00000350513.2:c.644C>T	chr7.hg19:g.142723576G>A	ENSP00000316518:p.Thr215Ile	72.0	0.0		68.0	11.0	NM_001001658	B9EH51|Q6IF71|Q8NGD9	Missense_Mutation	SNP	ENST00000350513.2	hg19	CCDS34767.1	.	.	.	.	.	.	.	.	.	.	G	2.387	-0.340807	0.05243	.	.	ENSG00000179468	ENST00000350513	T	0.00054	8.8	4.62	2.77	0.32553	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41294	U	0.000918	T	0.00073	0.0002	N	0.12746	0.255	0.27876	N	0.939866	B	0.14805	0.011	B	0.20955	0.032	T	0.01786	-1.1274	10	0.17369	T	0.5	-12.5647	4.7669	0.13137	0.1932:0.1803:0.6266:0.0	.	215	Q8NGT5	OR9A2_HUMAN	I	215	ENSP00000316518:T215I	ENSP00000316518:T215I	T	-	2	0	OR9A2	142433698	0.001000	0.12720	1.000000	0.80357	0.047000	0.14425	0.700000	0.25601	0.639000	0.30564	0.561000	0.74099	ACC	.	.		0.453	OR9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350862.1		
C8orf74	203076	hgsc.bcm.edu	37	8	10557811	10557811	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr8:10557811C>T	ENST00000304519.5	+	4	744	c.715C>T	c.(715-717)Cgc>Tgc	p.R239C	RP1L1_ENST00000329335.3_Intron	NM_001040032.1	NP_001035121	Q6P047	CH074_HUMAN	chromosome 8 open reading frame 74	239										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13				COAD - Colon adenocarcinoma(149;0.0811)		GCTGCTGCAGCGCCAGATCCA	0.602																																					p.R239C		Atlas-SNP	.											.	C8orf74	28	.	0			c.C715T						.						79.0	88.0	85.0					8																	10557811		2020	4192	6212	SO:0001583	missense	203076	exon4			CTGCAGCGCCAGA	BC038534	CCDS47800.1	8p23.1	2012-04-17			ENSG00000171060	ENSG00000171060			32296	protein-coding gene	gene with protein product							Standard	NM_001040032		Approved		uc003wtd.1	Q6P047	OTTHUMG00000163807	ENST00000304519.5:c.715C>T	chr8.hg19:g.10557811C>T	ENSP00000307129:p.Arg239Cys	84.0	0.0		57.0	27.0	NM_001040032	A2RUD6	Missense_Mutation	SNP	ENST00000304519.5	hg19	CCDS47800.1	.	.	.	.	.	.	.	.	.	.	C	3.345	-0.133780	0.06711	.	.	ENSG00000171060	ENST00000304519	T	0.30448	1.53	5.01	-4.92	0.03075	.	1.842940	0.02311	N	0.072098	T	0.09423	0.0232	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15752	-1.0426	10	0.38643	T	0.18	.	2.082	0.03637	0.1564:0.3974:0.1444:0.3018	.	239	Q6P047	CH074_HUMAN	C	239	ENSP00000307129:R239C	ENSP00000307129:R239C	R	+	1	0	C8orf74	10595221	0.000000	0.05858	0.011000	0.14972	0.001000	0.01503	-1.050000	0.03510	-0.483000	0.06772	-1.149000	0.01842	CGC	.	.		0.602	C8orf74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375675.1	NM_001040032	
PLEKHA2	59339	hgsc.bcm.edu	37	8	38793565	38793565	+	Silent	SNP	G	G	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr8:38793565G>C	ENST00000521746.1	+	3	429	c.195G>C	c.(193-195)tcG>tcC	p.S65S	PLEKHA2_ENST00000388745.4_3'UTR|PLEKHA2_ENST00000420274.1_Silent_p.S65S			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	65	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			CCTACATCTCGAAGGTAATGT	0.458																																					p.S65S		Atlas-SNP	.											.	PLEKHA2	22	.	0			c.G195C						.						144.0	142.0	142.0					8																	38793565		1934	4152	6086	SO:0001819	synonymous_variant	59339	exon3			CATCTCGAAGGTA	AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000521746.1:c.195G>C	chr8.hg19:g.38793565G>C		56.0	0.0		33.0	8.0	NM_021623		Silent	SNP	ENST00000521746.1	hg19																																																																																				.	.		0.458	PLEKHA2-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000377068.1	NM_021623	
MTSS1	9788	hgsc.bcm.edu	37	8	125568510	125568510	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr8:125568510T>C	ENST00000518547.1	-	12	1840	c.1367A>G	c.(1366-1368)cAg>cGg	p.Q456R	MTSS1_ENST00000524090.1_Missense_Mutation_p.Q346R|MTSS1_ENST00000378017.3_Missense_Mutation_p.Q431R|MTSS1_ENST00000431961.2_Missense_Mutation_p.Q174R|MTSS1_ENST00000523587.1_5'UTR|MTSS1_ENST00000395508.2_Missense_Mutation_p.Q230R|MTSS1_ENST00000354184.4_Missense_Mutation_p.Q174R|MTSS1_ENST00000325064.5_Missense_Mutation_p.Q460R|NDUFB9_ENST00000522532.1_Intron	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	456					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CCGTGGTCTCTGAGCCTCCTC	0.632																																					p.Q456R	Esophageal Squamous(160;622 1893 3862 8546 12509)	Atlas-SNP	.											.	MTSS1	79	.	0			c.A1367G						.						87.0	73.0	78.0					8																	125568510		2203	4300	6503	SO:0001583	missense	9788	exon12			GGTCTCTGAGCCT	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1367A>G	chr8.hg19:g.125568510T>C	ENSP00000429064:p.Gln456Arg	73.0	0.0		126.0	21.0	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	ENST00000518547.1	hg19	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	T	13.93	2.385426	0.42308	.	.	ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090	T;T;T;T;T;T;T	0.32272	1.48;1.47;1.49;1.48;1.47;1.49;1.46	4.65	4.65	0.58169	.	0.333994	0.29172	N	0.012922	T	0.28300	0.0699	L	0.36672	1.1	0.40924	D	0.984332	B;P;B;P;D	0.56968	0.0;0.824;0.0;0.89;0.978	B;B;B;B;P	0.49085	0.001;0.258;0.0;0.245;0.6	T	0.03840	-1.0999	10	0.16896	T	0.51	-16.8762	10.2923	0.43603	0.0:0.0:0.1656:0.8344	.	346;230;456;431;174	E7EWW5;B7Z3B6;O43312;O43312-4;O43312-2	.;.;MTSS1_HUMAN;.;.	R	431;456;174;230;460;174;346	ENSP00000367256:Q431R;ENSP00000429064:Q456R;ENSP00000346119:Q174R;ENSP00000378884:Q230R;ENSP00000322804:Q460R;ENSP00000393606:Q174R;ENSP00000428319:Q346R	ENSP00000322804:Q460R	Q	-	2	0	MTSS1	125637691	1.000000	0.71417	0.996000	0.52242	0.924000	0.55760	5.383000	0.66219	1.733000	0.51620	0.374000	0.22700	CAG	.	.		0.632	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
ADCY8	114	hgsc.bcm.edu	37	8	132052016	132052016	+	Silent	SNP	C	C	T	rs80098122		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr8:132052016C>T	ENST00000286355.5	-	1	2656	c.564G>A	c.(562-564)ctG>ctA	p.L188L	ADCY8_ENST00000377928.3_Silent_p.L188L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	188					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TCAGCACGTCCAGCACGTTCA	0.582										HNSCC(32;0.087)																											p.L188L		Atlas-SNP	.											.	ADCY8	291	.	0			c.G564A						.						99.0	100.0	100.0					8																	132052016		2203	4300	6503	SO:0001819	synonymous_variant	114	exon1			CACGTCCAGCACG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.564G>A	chr8.hg19:g.132052016C>T		116.0	0.0		182.0	22.0	NM_001115		Silent	SNP	ENST00000286355.5	hg19	CCDS6363.1																																																																																			.	.		0.582	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
NPR2	4882	hgsc.bcm.edu	37	9	35806115	35806115	+	Missense_Mutation	SNP	G	G	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr9:35806115G>T	ENST00000342694.2	+	15	2512	c.2257G>T	c.(2257-2259)Gac>Tac	p.D753Y		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	753	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GCCAAGCATTGACCGGACCCA	0.512																																					p.D753Y		Atlas-SNP	.											.	NPR2	162	.	0			c.G2257T						.						71.0	72.0	71.0					9																	35806115		2203	4300	6503	SO:0001583	missense	4882	exon15			AGCATTGACCGGA	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2257G>T	chr9.hg19:g.35806115G>T	ENSP00000341083:p.Asp753Tyr	63.0	0.0		49.0	15.0	NM_003995	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	hg19	CCDS6590.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.81|19.81	3.897022|3.897022	0.72639|0.72639	.|.	.|.	ENSG00000159899|ENSG00000159899	ENST00000342694;ENST00000447210|ENST00000421267	T;D|.	0.85556|.	0.0;-2.0|.	5.82|5.82	5.82|5.82	0.92795|0.92795	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.46442|.	D|.	0.000291|.	T|T	0.77164|0.77164	0.4090|0.4090	M|M	0.76727|0.76727	2.345|2.345	0.80722|0.80722	D|D	1|1	D;P|.	0.89917|.	1.0;0.804|.	D;P|.	0.72075|.	0.976;0.643|.	T|T	0.76005|0.76005	-0.3117|-0.3117	10|5	0.66056|.	D|.	0.02|.	.|.	18.6867|18.6867	0.91567|0.91567	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	753;753|.	P20594-2;P20594|.	.;ANPRB_HUMAN|.	Y|F	753;12|99	ENSP00000341083:D753Y;ENSP00000393029:D12Y|.	ENSP00000341083:D753Y|.	D|L	+|+	1|3	0|2	NPR2|NPR2	35796115|35796115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.865000|2.865000	0.48412|0.48412	2.756000|2.756000	0.94617|0.94617	0.563000|0.563000	0.77884|0.77884	GAC|TTG	.	.		0.512	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052345.1		
ABHD17B	51104	hgsc.bcm.edu	37	9	74485146	74485146	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr9:74485146T>C	ENST00000333421.6	-	3	611	c.500A>G	c.(499-501)tAt>tGt	p.Y167C	ABHD17B_ENST00000377041.2_Missense_Mutation_p.Y167C	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	167						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										ACTTTGGCCATATATAATCAC	0.408																																					p.Y167C		Atlas-SNP	.											.	FAM108B1	24	.	0			c.A500G						.						146.0	139.0	141.0					9																	74485146		2203	4300	6503	SO:0001583	missense	51104	exon3			TGGCCATATATAA	AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.500A>G	chr9.hg19:g.74485146T>C	ENSP00000330222:p.Tyr167Cys	97.0	0.0		71.0	19.0	NM_016014	A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Missense_Mutation	SNP	ENST00000333421.6	hg19	CCDS35043.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.757528	0.49468	.	.	ENSG00000107362	ENST00000377041;ENST00000333421	T;T	0.44083	0.93;0.93	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.73369	0.3578	M	0.93808	3.46	0.80722	D	1	D;P	0.89917	1.0;0.926	D;P	0.97110	1.0;0.814	T	0.81575	-0.0870	10	0.87932	D	0	-3.7809	15.6113	0.76721	0.0:0.0:0.0:1.0	.	167;167	Q5VST6;Q5VST6-2	F108B_HUMAN;.	C	167	ENSP00000366240:Y167C;ENSP00000330222:Y167C	ENSP00000330222:Y167C	Y	-	2	0	FAM108B1	73674966	1.000000	0.71417	1.000000	0.80357	0.045000	0.14185	7.884000	0.87274	2.151000	0.67156	0.533000	0.62120	TAT	.	.		0.408	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052625.1	NM_016014	
GAPVD1	26130	hgsc.bcm.edu	37	9	128074846	128074846	+	Silent	SNP	A	A	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr9:128074846A>G	ENST00000495955.1	+	9	1847	c.1557A>G	c.(1555-1557)ttA>ttG	p.L519L	GAPVD1_ENST00000394105.2_Silent_p.L519L|GAPVD1_ENST00000470056.1_Silent_p.L519L|GAPVD1_ENST00000394083.2_Silent_p.L519L|GAPVD1_ENST00000297933.6_Silent_p.L519L|GAPVD1_ENST00000265956.4_Silent_p.L519L|GAPVD1_ENST00000312123.9_Silent_p.L519L|GAPVD1_ENST00000394104.2_Silent_p.L519L			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	519					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TCATTTCCTTAGGTACAGGTC	0.438																																					p.L519L		Atlas-SNP	.											.	GAPVD1	124	.	0			c.A1557G						.						171.0	143.0	152.0					9																	128074846		2203	4300	6503	SO:0001819	synonymous_variant	26130	exon7			TTCCTTAGGTACA		CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.1557A>G	chr9.hg19:g.128074846A>G		102.0	0.0		80.0	19.0	NM_015635	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Silent	SNP	ENST00000495955.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.885|9.885	1.202557|1.202557	0.22121|0.22121	.|.	.|.	ENSG00000165219|ENSG00000165219	ENST00000436712|ENST00000431329	.|.	.|.	.|.	5.8|5.8	4.67|4.67	0.58626|0.58626	.|.	.|.	.|.	.|.	.|.	T|.	0.55737|.	0.1939|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.54649|.	-0.8262|.	4|.	.|.	.|.	.|.	.|.	6.0598|6.0598	0.19832|0.19832	0.839:0.0:0.161:0.0|0.839:0.0:0.161:0.0	.|.	.|.	.|.	.|.	G|W	377|382	.|.	.|.	R|X	+|+	1|2	2|0	GAPVD1|GAPVD1	127114667|127114667	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.793000|2.793000	0.47845|0.47845	2.216000|2.216000	0.71823|0.71823	0.402000|0.402000	0.26972|0.26972	AGG|TAG	.	.		0.438	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000355644.1		
FBXO18	84893	hgsc.bcm.edu	37	10	5952981	5952981	+	Silent	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr10:5952981C>T	ENST00000362091.4	+	6	1216	c.1101C>T	c.(1099-1101)tgC>tgT	p.C367C	FBXO18_ENST00000379999.5_Silent_p.C418C|FBXO18_ENST00000397269.3_5'UTR	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	367					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TGCTCTTCTGCCTCCGGAGAC	0.597																																					p.C418C		Atlas-SNP	.											.	FBXO18	108	.	0			c.C1254T						.						104.0	94.0	97.0					10																	5952981		2203	4300	6503	SO:0001819	synonymous_variant	84893	exon7			CTTCTGCCTCCGG	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1101C>T	chr10.hg19:g.5952981C>T		46.0	0.0		39.0	11.0	NM_032807	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Silent	SNP	ENST00000362091.4	hg19	CCDS7072.1																																																																																			.	.		0.597	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046596.1	NM_032807	
SGPL1	8879	hgsc.bcm.edu	37	10	72636985	72636985	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr10:72636985G>A	ENST00000373202.3	+	15	1800	c.1600G>A	c.(1600-1602)Gac>Aac	p.D534N		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	534					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						GACAACTGTTGACAGGAATAT	0.473																																					p.D534N	Colon(151;1054 2458 6676 40971)	Atlas-SNP	.											.	SGPL1	37	.	0			c.G1600A						.						116.0	102.0	107.0					10																	72636985		2203	4300	6503	SO:0001583	missense	8879	exon15			ACTGTTGACAGGA	AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.1600G>A	chr10.hg19:g.72636985G>A	ENSP00000362298:p.Asp534Asn	82.0	0.0		59.0	21.0	NM_003901	B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	ENST00000373202.3	hg19	CCDS31216.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248405	0.80024	.	.	ENSG00000166224	ENST00000373202	T	0.49139	0.79	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.65091	0.2658	L	0.52011	1.625	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	T	0.62671	-0.6805	10	0.49607	T	0.09	-28.5977	19.9035	0.96999	0.0:0.0:1.0:0.0	.	534	O95470	SGPL1_HUMAN	N	534	ENSP00000362298:D534N	ENSP00000362298:D534N	D	+	1	0	SGPL1	72306991	1.000000	0.71417	0.962000	0.40283	0.121000	0.20230	9.434000	0.97515	2.712000	0.92718	0.650000	0.86243	GAC	.	.		0.473	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048533.1	NM_003901	
KLLN	100144748	hgsc.bcm.edu	37	10	89621709	89621709	+	Silent	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr10:89621709C>T	ENST00000445946.3	-	1	1485	c.536G>A	c.(535-537)tGa>tAa	p.*179*	PTEN_ENST00000371953.3_5'Flank	NM_001126049.1	NP_001119521.1	B2CW77	KILIN_HUMAN	killin, p53-regulated DNA replication inhibitor	0					apoptotic process (GO:0006915)|cell cycle (GO:0007049)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)	1						TCTCAGGTCTCAGTCCTTTGG	0.607											OREG0020351	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.X179X		Atlas-SNP	.											.	KLLN	10	.	0			c.G536A						.						58.0	58.0	58.0					10																	89621709		692	1591	2283	SO:0001819	synonymous_variant	100144748	exon1			AGGTCTCAGTCCT		CCDS44454.1	10q23	2011-02-18	2011-02-18		ENSG00000227268	ENSG00000227268			37212	protein-coding gene	gene with protein product		612105				18385383	Standard	NM_001126049		Approved	killin	uc009xti.3	B2CW77		ENST00000445946.3:c.536G>A	chr10.hg19:g.89621709C>T		114.0	0.0	1268	88.0	25.0	NM_001126049		Silent	SNP	ENST00000445946.3	hg19	CCDS44454.1																																																																																			.	.		0.607	KLLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000473179.1	NM_001126049	
TNKS2	80351	hgsc.bcm.edu	37	10	93579739	93579739	+	Missense_Mutation	SNP	T	T	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr10:93579739T>C	ENST00000371627.4	+	6	1056	c.677T>C	c.(676-678)aTt>aCt	p.I226T		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	226					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				AGAGTAAAGATTGTACAGCTG	0.313																																					p.I226T		Atlas-SNP	.											.	TNKS2	103	.	0			c.T677C						.						116.0	121.0	119.0					10																	93579739		2203	4300	6503	SO:0001583	missense	80351	exon6			TAAAGATTGTACA	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.677T>C	chr10.hg19:g.93579739T>C	ENSP00000360689:p.Ile226Thr	381.0	0.0		365.0	93.0	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	hg19	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940586	0.52972	.	.	ENSG00000107854	ENST00000371627	T	0.67171	-0.25	5.46	5.46	0.80206	Ankyrin repeat-containing domain (4);	0.178092	0.35179	N	0.003392	T	0.62889	0.2465	L	0.45051	1.395	0.58432	D	0.999999	B	0.13594	0.008	B	0.28305	0.088	T	0.59547	-0.7434	10	0.42905	T	0.14	.	15.5302	0.75952	0.0:0.0:0.0:1.0	.	226	Q9H2K2	TNKS2_HUMAN	T	226	ENSP00000360689:I226T	ENSP00000360689:I226T	I	+	2	0	TNKS2	93569719	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.199000	0.72112	2.070000	0.61991	0.455000	0.32223	ATT	.	.		0.313	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
PDZD8	118987	hgsc.bcm.edu	37	10	119044292	119044292	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr10:119044292A>C	ENST00000334464.5	-	5	2191	c.1952T>G	c.(1951-1953)tTt>tGt	p.F651C	PDZD8_ENST00000482496.1_5'UTR	NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	651					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		CTTTGCTAAAAATTGCTTAGG	0.448																																					p.F651C		Atlas-SNP	.											.	PDZD8	85	.	0			c.T1952G						.						80.0	80.0	80.0					10																	119044292		2203	4300	6503	SO:0001583	missense	118987	exon5			GCTAAAAATTGCT	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1952T>G	chr10.hg19:g.119044292A>C	ENSP00000334642:p.Phe651Cys	109.0	0.0		86.0	26.0	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Missense_Mutation	SNP	ENST00000334464.5	hg19	CCDS7600.1	.	.	.	.	.	.	.	.	.	.	A	11.13	1.547795	0.27652	.	.	ENSG00000165650	ENST00000334464	D	0.85339	-1.97	5.61	-1.25	0.09405	.	1.196990	0.05874	N	0.625197	T	0.72391	0.3454	N	0.14661	0.345	0.09310	N	1	B	0.30709	0.291	B	0.31191	0.125	T	0.60692	-0.7213	10	0.40728	T	0.16	0.149	7.6998	0.28617	0.3852:0.1342:0.4806:0.0	.	651	Q8NEN9	PDZD8_HUMAN	C	651	ENSP00000334642:F651C	ENSP00000334642:F651C	F	-	2	0	PDZD8	119034282	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	0.025000	0.13577	-0.063000	0.13065	0.482000	0.46254	TTT	.	.		0.448	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
OR5L1	219437	hgsc.bcm.edu	37	11	55579074	55579074	+	Silent	SNP	C	C	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr11:55579074C>A	ENST00000333973.2	+	1	221	c.132C>A	c.(130-132)ggC>ggA	p.G44G		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	44						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CCAACCTGGGCATGATTGCAC	0.483																																					p.G44G		Atlas-SNP	.											.	OR5L1	145	.	0			c.C132A						.						328.0	286.0	300.0					11																	55579074		2200	4296	6496	SO:0001819	synonymous_variant	219437	exon1			CCTGGGCATGATT	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.132C>A	chr11.hg19:g.55579074C>A		61.0	0.0		78.0	17.0	NM_001004738	B2RNK6|Q6IFD0	Silent	SNP	ENST00000333973.2	hg19	CCDS31509.1																																																																																			.	.		0.483	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
LTBP3	4054	hgsc.bcm.edu	37	11	65314273	65314273	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr11:65314273A>C	ENST00000301873.5	-	15	2494	c.2226T>G	c.(2224-2226)tgT>tgG	p.C742W	LTBP3_ENST00000529189.1_5'Flank|LTBP3_ENST00000536982.1_Missense_Mutation_p.C368W|LTBP3_ENST00000322147.4_Missense_Mutation_p.C742W|LTBP3_ENST00000530785.1_5'Flank|LTBP3_ENST00000532932.1_Missense_Mutation_p.C172W	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	742	Cys-rich.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						CCTCACCGCGACAGGCCCCGC	0.716																																					p.C742W		Atlas-SNP	.											LTBP3,NS,carcinoma,0,1	LTBP3	55	.	0			c.T2226G						.						18.0	22.0	21.0					11																	65314273		2188	4279	6467	SO:0001583	missense	4054	exon15			ACCGCGACAGGCC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.2226T>G	chr11.hg19:g.65314273A>C	ENSP00000301873:p.Cys742Trp	15.0	0.0		18.0	6.0	NM_001130144	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	ENST00000301873.5	hg19	CCDS44647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.50|19.50	3.838964|3.838964	0.71373|0.71373	.|.	.|.	ENSG00000168056|ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000532932;ENST00000536982;ENST00000530866;ENST00000527339|ENST00000526927	D;D;D;D;D;D|.	0.99445|.	-5.91;-5.91;-5.91;-5.91;-5.91;-5.91|.	4.85|4.85	-2.96|-2.96	0.05547|0.05547	EGF-like calcium-binding (2);|.	0.701264|.	0.15043|.	N|.	0.283773|.	T|T	0.69360|0.69360	0.3102|0.3102	M|M	0.86864|0.86864	2.845|2.845	0.80722|0.80722	D|D	1|1	P;D;D;D;D;D|.	0.65815|.	0.93;0.995;0.968;0.957;0.989;0.973|.	P;P;P;P;P;P|.	0.62491|.	0.547;0.844;0.794;0.601;0.878;0.903|.	T|T	0.68112|0.68112	-0.5495|-0.5495	10|5	0.72032|.	D|.	0.01|.	.|.	4.9009|4.9009	0.13773|0.13773	0.4993:0.0:0.3576:0.1431|0.4993:0.0:0.3576:0.1431	.|.	653;368;625;742;742;172|.	E9PKW1;F5GWC4;B9EG76;Q9NS15;Q9NS15-2;E9PJR2|.	.;.;.;LTBP3_HUMAN;.;.|.	W|A	742;742;172;368;653;82|393	ENSP00000326647:C742W;ENSP00000301873:C742W;ENSP00000435530:C172W;ENSP00000441912:C368W;ENSP00000435276:C653W;ENSP00000432121:C82W|.	ENSP00000301873:C742W|.	C|S	-|-	3|1	2|0	LTBP3|LTBP3	65070849|65070849	0.989000|0.989000	0.36119|0.36119	0.985000|0.985000	0.45067|0.45067	0.918000|0.918000	0.54935|0.54935	0.252000|0.252000	0.18278|0.18278	-0.476000|-0.476000	0.06842|0.06842	-0.486000|-0.486000	0.04755|0.04755	TGT|TCG	.	.		0.716	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
HTR3B	9177	hgsc.bcm.edu	37	11	113775680	113775680	+	Silent	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr11:113775680C>T	ENST00000260191.2	+	1	282	c.25C>T	c.(25-27)Ctg>Ttg	p.L9L		NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	9					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	AATGGCTCCCCTGTGGGCCTG	0.438																																					p.L9L		Atlas-SNP	.											.	HTR3B	50	.	0			c.C25T						.						118.0	105.0	110.0					11																	113775680		2201	4296	6497	SO:0001819	synonymous_variant	9177	exon1			GCTCCCCTGTGGG	AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.25C>T	chr11.hg19:g.113775680C>T		73.0	0.0		60.0	16.0	NM_006028	B0YJ23|Q0VJC3	Silent	SNP	ENST00000260191.2	hg19	CCDS8364.1																																																																																			.	.		0.438	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398842.1	NM_006028	
ARNTL2	56938	hgsc.bcm.edu	37	12	27521282	27521282	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr12:27521282C>G	ENST00000266503.5	+	2	137	c.119C>G	c.(118-120)tCt>tGt	p.S40C	ARNTL2_ENST00000261178.5_Missense_Mutation_p.S40C|ARNTL2_ENST00000395901.2_Missense_Mutation_p.S51C|ARNTL2_ENST00000544915.1_Missense_Mutation_p.S40C|ARNTL2_ENST00000311001.5_Missense_Mutation_p.S40C|ARNTL2_ENST00000539558.1_3'UTR|ARNTL2_ENST00000542388.1_Missense_Mutation_p.S3C|ARNTL2_ENST00000546179.1_Missense_Mutation_p.S51C			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	40					circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					GCTATGGGGTCTTTCAGCTCA	0.498																																					p.S51C		Atlas-SNP	.											.	ARNTL2	54	.	0			c.C152G						.						139.0	115.0	123.0					12																	27521282		2203	4300	6503	SO:0001583	missense	56938	exon2			TGGGGTCTTTCAG	AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.119C>G	chr12.hg19:g.27521282C>G	ENSP00000266503:p.Ser40Cys	125.0	0.0		663.0	549.0	NM_001248003	B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Missense_Mutation	SNP	ENST00000266503.5	hg19	CCDS8712.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.66|13.66	2.303931|2.303931	0.40795|0.40795	.|.	.|.	ENSG00000029153|ENSG00000029153	ENST00000457040|ENST00000544915;ENST00000395901;ENST00000546179;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388	.|T;T;T;T;T;T;T	.|0.10960	.|3.13;3.21;3.06;3.21;3.19;2.82;3.21	3.39|3.39	2.47|2.47	0.30058|0.30058	.|.	.|1.073310	.|0.07291	.|N	.|0.872413	T|T	0.20455|0.20455	0.0492|0.0492	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;0.999;0.998;0.998;0.995;1.0	.|D;D;D;D;P;D	.|0.76071	.|0.987;0.959;0.967;0.967;0.847;0.968	T|T	0.39502|0.39502	-0.9611|-0.9611	5|10	.|0.72032	.|D	.|0.01	.|.	10.4321|10.4321	0.44413|0.44413	0.0:0.7997:0.2003:0.0|0.0:0.7997:0.2003:0.0	.|.	.|51;40;51;40;40;40	.|F5H402;Q8WYA1-5;Q8WYA1-3;Q8WYA1-4;Q8WYA1-2;Q8WYA1	.|.;.;.;.;.;BMAL2_HUMAN	V|C	19|40;51;51;40;40;40;3	.|ENSP00000442438:S40C;ENSP00000379238:S51C;ENSP00000438545:S51C;ENSP00000312247:S40C;ENSP00000261178:S40C;ENSP00000266503:S40C;ENSP00000445836:S3C	.|ENSP00000261178:S40C	L|S	+|+	1|2	0|0	ARNTL2|ARNTL2	27412549|27412549	0.002000|0.002000	0.14202|0.14202	0.184000|0.184000	0.23157|0.23157	0.105000|0.105000	0.19272|0.19272	0.813000|0.813000	0.27225|0.27225	0.981000|0.981000	0.38548|0.38548	-0.479000|-0.479000	0.04858|0.04858	CTT|TCT	.	.		0.498	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403162.1	NM_020183	
SMCO2	341346	hgsc.bcm.edu	37	12	27648715	27648715	+	Missense_Mutation	SNP	G	G	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr12:27648715G>C	ENST00000535986.1	+	7	760	c.760G>C	c.(760-762)Gag>Cag	p.E254Q	SMCO2_ENST00000298876.4_Missense_Mutation_p.E204Q|SMCO2_ENST00000538647.1_3'UTR|SMCO2_ENST00000416383.1_Missense_Mutation_p.E254Q			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	254						integral component of membrane (GO:0016021)											AGATACGGAAGAGATGGAGGC	0.502																																					p.E254Q		Atlas-SNP	.											.	.	.	.	0			c.G760C						.						83.0	76.0	78.0					12																	27648715		682	1590	2272	SO:0001583	missense	0	exon8			ACGGAAGAGATGG		CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.760G>C	chr12.hg19:g.27648715G>C	ENSP00000441688:p.Glu254Gln	65.0	0.0		398.0	335.0	NM_001145010		Missense_Mutation	SNP	ENST00000535986.1	hg19	CCDS44852.1	.	.	.	.	.	.	.	.	.	.	G	10.92	1.488074	0.26686	.	.	ENSG00000165935	ENST00000298876;ENST00000416383;ENST00000535986	.	.	.	2.9	1.96	0.26148	.	0.767913	0.11142	N	0.595211	T	0.19287	0.0463	N	0.17082	0.46	0.09310	N	1	B	0.33318	0.408	B	0.28784	0.094	T	0.13737	-1.0498	9	0.29301	T	0.29	0.1751	7.5271	0.27662	0.0:0.2857:0.7143:0.0	.	254	A6NFE2	CL070_HUMAN	Q	204;254;254	.	ENSP00000298876:E204Q	E	+	1	0	C12orf70	27539982	0.002000	0.14202	0.001000	0.08648	0.005000	0.04900	0.763000	0.26517	0.748000	0.32831	0.655000	0.94253	GAG	.	.		0.502	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402867.1	NM_001145010	
KIAA1551	55196	hgsc.bcm.edu	37	12	32138704	32138704	+	Silent	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr12:32138704G>A	ENST00000312561.4	+	4	5229	c.4815G>A	c.(4813-4815)agG>agA	p.R1605R	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1605																	GTTCACCCAGGAAGCTTCATA	0.343																																					p.R1605R		Atlas-SNP	.											.	.	.	.	0			c.G4815A						.						63.0	69.0	67.0					12																	32138704		2203	4300	6503	SO:0001819	synonymous_variant	55196	exon4			ACCCAGGAAGCTT	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.4815G>A	chr12.hg19:g.32138704G>A		327.0	1.0		1406.0	1059.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	ENST00000312561.4	hg19	CCDS8725.2																																																																																			.	.		0.343	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
ACSS3	79611	hgsc.bcm.edu	37	12	81503455	81503455	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr12:81503455C>T	ENST00000548058.1	+	2	1338	c.428C>T	c.(427-429)aCc>aTc	p.T143I	ACSS3_ENST00000261206.3_Missense_Mutation_p.T142I|RP11-543H12.1_ENST00000547123.1_RNA			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	143						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						ACTAAAGCAACCTTTACCTAT	0.299																																					p.T143I		Atlas-SNP	.											ACSS3,NS,malignant_melanoma,0,1	ACSS3	118	.	0			c.C428T						.						95.0	94.0	94.0					12																	81503455		2203	4300	6503	SO:0001583	missense	79611	exon2			AAGCAACCTTTAC		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.428C>T	chr12.hg19:g.81503455C>T	ENSP00000449535:p.Thr143Ile	214.0	1.0		303.0	111.0	NM_024560	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	hg19	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948545	0.34377	.	.	ENSG00000111058	ENST00000549175;ENST00000548058;ENST00000261206	T;T;T	0.45276	0.9;0.9;0.9	6.07	3.1	0.35709	.	0.571636	0.19562	N	0.111320	T	0.32823	0.0842	L	0.45470	1.425	0.45452	D	0.998423	B	0.02656	0.0	B	0.01281	0.0	T	0.12268	-1.0554	10	0.44086	T	0.13	-5.1204	6.9619	0.24601	0.131:0.6726:0.1265:0.0699	.	143	Q9H6R3	ACSS3_HUMAN	I	35;143;142	ENSP00000447748:T35I;ENSP00000449535:T143I;ENSP00000261206:T142I	ENSP00000261206:T142I	T	+	2	0	ACSS3	80027586	0.993000	0.37304	0.993000	0.49108	0.969000	0.65631	1.781000	0.38644	0.874000	0.35823	0.655000	0.94253	ACC	.	.		0.299	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
SLC6A15	55117	hgsc.bcm.edu	37	12	85285776	85285776	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr12:85285776C>T	ENST00000266682.5	-	2	665	c.124G>A	c.(124-126)Gat>Aat	p.D42N	SLC6A15_ENST00000450363.3_Missense_Mutation_p.D42N|SLC6A15_ENST00000551388.1_Intron|SLC6A15_ENST00000552192.1_Intron	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	42					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						TCCTGGCCATCAACAATTAGT	0.393																																					p.D42N		Atlas-SNP	.											.	SLC6A15	159	.	0			c.G124A						.						235.0	214.0	221.0					12																	85285776		2203	4300	6503	SO:0001583	missense	55117	exon2			GGCCATCAACAAT	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.124G>A	chr12.hg19:g.85285776C>T	ENSP00000266682:p.Asp42Asn	100.0	0.0		115.0	42.0	NM_018057	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Missense_Mutation	SNP	ENST00000266682.5	hg19	CCDS9026.1	.	.	.	.	.	.	.	.	.	.	C	8.929	0.962924	0.18583	.	.	ENSG00000072041	ENST00000266682;ENST00000450363;ENST00000549540	T;T;T	0.73363	-0.74;-0.42;0.86	5.44	5.44	0.79542	.	0.312106	0.38548	N	0.001651	T	0.66867	0.2833	L	0.57536	1.79	0.30931	N	0.726914	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.60167	-0.7316	10	0.17369	T	0.5	.	10.1725	0.42920	0.0:0.8513:0.0:0.1487	.	42;42	Q9H9F5;Q9H2J7	.;S6A15_HUMAN	N	42	ENSP00000266682:D42N;ENSP00000390706:D42N;ENSP00000448308:D42N	ENSP00000266682:D42N	D	-	1	0	SLC6A15	83809907	0.985000	0.35326	0.996000	0.52242	0.285000	0.27093	1.482000	0.35486	2.702000	0.92279	0.591000	0.81541	GAT	.	.		0.393	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
TMEM132B	114795	hgsc.bcm.edu	37	12	125834194	125834194	+	Silent	SNP	T	T	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr12:125834194T>C	ENST00000299308.3	+	2	257	c.249T>C	c.(247-249)atT>atC	p.I83I	TMEM132B_ENST00000418253.2_3'UTR	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	83						integral component of membrane (GO:0016021)		p.I83I(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CACCCCCTATTATCAATGCCA	0.498																																					p.I83I		Atlas-SNP	.											TMEM132B,NS,carcinoma,0,1	TMEM132B	207	.	1	Substitution - coding silent(1)	kidney(1)	c.T249C						.						106.0	105.0	105.0					12																	125834194		1868	4104	5972	SO:0001819	synonymous_variant	114795	exon2			CCCTATTATCAAT	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.249T>C	chr12.hg19:g.125834194T>C		123.0	0.0		121.0	30.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	ENST00000299308.3	hg19	CCDS41859.1																																																																																			.	.		0.498	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
BCL11B	64919	hgsc.bcm.edu	37	14	99641663	99641663	+	Nonsense_Mutation	SNP	C	C	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr14:99641663C>A	ENST00000357195.3	-	4	1519	c.1510G>T	c.(1510-1512)Gag>Tag	p.E504*	BCL11B_ENST00000443726.2_Nonsense_Mutation_p.E310*|BCL11B_ENST00000345514.2_Nonsense_Mutation_p.E433*	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	504					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCCGCCAGCTCGCTGGTGCCG	0.736			T	TLX3	T-ALL																																p.E504X		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	108	.	0			c.G1510T						.						3.0	3.0	3.0					14																	99641663		1526	3256	4782	SO:0001587	stop_gained	64919	exon4			CCAGCTCGCTGGT	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1510G>T	chr14.hg19:g.99641663C>A	ENSP00000349723:p.Glu504*	30.0	0.0		19.0	4.0	NM_138576	Q9H162	Nonsense_Mutation	SNP	ENST00000357195.3	hg19	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	38	6.851263	0.97885	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	.	.	.	3.62	3.62	0.41486	.	0.188974	0.32952	N	0.005445	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-13.0736	15.6477	0.77068	0.0:1.0:0.0:0.0	.	.	.	.	X	504;433;310	.	ENSP00000280435:E433X	E	-	1	0	BCL11B	98711416	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.823000	0.75282	1.745000	0.51790	0.462000	0.41574	GAG	.	.		0.736	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
FES	2242	hgsc.bcm.edu	37	15	91430578	91430578	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr15:91430578C>T	ENST00000328850.3	+	5	788	c.646C>T	c.(646-648)Cac>Tac	p.H216Y	FES_ENST00000394302.1_Missense_Mutation_p.H158Y|FES_ENST00000414248.2_Missense_Mutation_p.H158Y|FES_ENST00000450438.2_Missense_Mutation_p.H158Y|FES_ENST00000444422.2_Missense_Mutation_p.H216Y|FES_ENST00000394300.3_Missense_Mutation_p.H158Y	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	216	Important for interaction with membranes containing phosphoinositides.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCAGGACCTGCACGAGGAGAT	0.687																																					p.H216Y		Atlas-SNP	.											.	FES	102	.	0			c.C646T						.						27.0	28.0	28.0					15																	91430578		2198	4296	6494	SO:0001583	missense	2242	exon4			GACCTGCACGAGG	X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.646C>T	chr15.hg19:g.91430578C>T	ENSP00000331504:p.His216Tyr	92.0	0.0		57.0	19.0	NM_001143784	B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Missense_Mutation	SNP	ENST00000328850.3	hg19	CCDS10365.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195079	0.58017	.	.	ENSG00000182511	ENST00000328850;ENST00000414248;ENST00000394302;ENST00000444422;ENST00000394300;ENST00000450438	T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58	3.87	3.87	0.44632	.	0.112232	0.64402	D	0.000007	T	0.20659	0.0497	L	0.54323	1.7	0.46954	D	0.999263	B;B;D;B;B;B	0.59357	0.0;0.045;0.985;0.004;0.115;0.0	B;B;P;B;B;B	0.47206	0.002;0.061;0.541;0.004;0.07;0.002	T	0.06285	-1.0835	10	0.87932	D	0	-37.5682	16.4539	0.84007	0.0:1.0:0.0:0.0	.	198;158;158;158;216;216	B4DUD9;P07332-2;E7ENM8;P07332-3;P07332-4;P07332	.;.;.;.;.;FES_HUMAN	Y	216;158;158;216;158;158	ENSP00000331504:H216Y;ENSP00000414629:H158Y;ENSP00000377839:H158Y;ENSP00000400868:H216Y;ENSP00000377837:H158Y;ENSP00000409915:H158Y	ENSP00000331504:H216Y	H	+	1	0	FES	89231582	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	5.363000	0.66104	2.194000	0.70268	0.555000	0.69702	CAC	.	.		0.687	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313497.1	NM_002005	
TRAF7	84231	hgsc.bcm.edu	37	16	2215890	2215890	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:2215890A>C	ENST00000326181.6	+	3	224	c.92A>C	c.(91-93)gAa>gCa	p.E31A		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	31					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						ACCAGAATGGAAACGACCTTC	0.602																																					p.E31A		Atlas-SNP	.											.	TRAF7	158	.	0			c.A92C						.						156.0	115.0	128.0					16																	2215890		2198	4300	6498	SO:0001583	missense	84231	exon3			GAATGGAAACGAC	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.92A>C	chr16.hg19:g.2215890A>C	ENSP00000318944:p.Glu31Ala	72.0	0.0		43.0	10.0	NM_032271	Q9H073	Missense_Mutation	SNP	ENST00000326181.6	hg19	CCDS10461.1	.	.	.	.	.	.	.	.	.	.	A	17.39	3.377927	0.61735	.	.	ENSG00000131653	ENST00000326181	D	0.86230	-2.09	5.17	5.17	0.71159	.	0.053109	0.85682	D	0.000000	T	0.80486	0.4632	L	0.34521	1.04	0.58432	D	0.999999	P	0.45348	0.856	B	0.37601	0.254	D	0.83375	0.0009	10	0.66056	D	0.02	-19.8128	14.1854	0.65603	1.0:0.0:0.0:0.0	.	31	Q6Q0C0	TRAF7_HUMAN	A	31	ENSP00000318944:E31A	ENSP00000318944:E31A	E	+	2	0	TRAF7	2155891	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	7.769000	0.85360	1.967000	0.57214	0.374000	0.22700	GAA	.	.		0.602	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250762.1	NM_032271	
NLRC3	197358	hgsc.bcm.edu	37	16	3613511	3613511	+	RNA	SNP	A	A	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:3613511A>T	ENST00000301749.7	-	0	1832				NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000419350.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAGAGGTCGAAGATGGCCCT	0.627																																					p.F476Y		Atlas-SNP	.											.	NLRC3	103	.	0			c.T1427A						.						26.0	28.0	28.0					16																	3613511		2042	4178	6220			197358	exon5			AGGTCGAAGATGG	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		chr16.hg19:g.3613511A>T		93.0	0.0		79.0	19.0	NM_178844	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	ENST00000301749.7	hg19		.	.	.	.	.	.	.	.	.	.	A	18.11	3.551124	0.65311	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023;ENST00000324659	D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.83613	0.5292	.	.	.	0.28132	N	0.93014	D	0.71674	0.998	D	0.76575	0.988	T	0.73043	-0.4107	9	0.05620	T	0.96	.	12.8296	0.57738	1.0:0.0:0.0:0.0	.	523	C9JLH9	.	Y	476;476;476;523;458	ENSP00000301749:F476Y;ENSP00000352039:F476Y;ENSP00000414415:F523Y;ENSP00000323897:F458Y	ENSP00000301749:F476Y	F	-	2	0	NLRC3	3553512	1.000000	0.71417	0.998000	0.56505	0.459000	0.32528	9.190000	0.94934	1.910000	0.55303	0.533000	0.62120	TTC	.	.		0.627	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	polymorphic_pseudogene		NM_178844	
SLX4	84464	hgsc.bcm.edu	37	16	3641076	3641076	+	Missense_Mutation	SNP	A	A	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:3641076A>C	ENST00000294008.3	-	12	3203	c.2563T>G	c.(2563-2565)Tat>Gat	p.Y855D		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	855	Glu-rich.|Interaction with PLK1 and TERF2-TERF2IP.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GCAAATTCATAAATTTCTTCC	0.507								Direct reversal of damage																													p.Y855D		Atlas-SNP	.											.	SLX4	173	.	0			c.T2563G						.						127.0	127.0	127.0					16																	3641076		2197	4300	6497	SO:0001583	missense	84464	exon12			ATTCATAAATTTC	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.2563T>G	chr16.hg19:g.3641076A>C	ENSP00000294008:p.Tyr855Asp	71.0	0.0		55.0	10.0	NM_032444	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	ENST00000294008.3	hg19	CCDS10506.2	.	.	.	.	.	.	.	.	.	.	A	24.0	4.479563	0.84747	.	.	ENSG00000188827	ENST00000294008	T	0.02280	4.36	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000009	T	0.11452	0.0279	M	0.65975	2.015	0.40284	D	0.978426	D	0.89917	1.0	D	0.87578	0.998	T	0.00465	-1.1723	10	0.72032	D	0.01	.	14.9117	0.70761	1.0:0.0:0.0:0.0	.	855	Q8IY92	SLX4_HUMAN	D	855	ENSP00000294008:Y855D	ENSP00000294008:Y855D	Y	-	1	0	SLX4	3581077	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.286000	0.78671	2.117000	0.64856	0.459000	0.35465	TAT	.	.		0.507	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
CBLN1	869	hgsc.bcm.edu	37	16	49315146	49315146	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:49315146C>G	ENST00000219197.6	-	1	596	c.231G>C	c.(229-231)atG>atC	p.M77I	CBLN1_ENST00000536749.1_Missense_Mutation_p.M77I	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	77	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Necessary for interaction with CBLN3, and homotrimerization. {ECO:0000250}.				cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				TGCGATTACTCATCTCGGACG	0.607																																					p.M77I		Atlas-SNP	.											.	CBLN1	26	.	0			c.G231C						.						72.0	74.0	73.0					16																	49315146		2200	4300	6500	SO:0001583	missense	869	exon1			ATTACTCATCTCG	M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.231G>C	chr16.hg19:g.49315146C>G	ENSP00000219197:p.Met77Ile	84.0	0.0		77.0	16.0	NM_004352	B2RAN9|P02682|Q52M09	Missense_Mutation	SNP	ENST00000219197.6	hg19	CCDS10736.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456052	0.63401	.	.	ENSG00000102924	ENST00000219197;ENST00000536749	T;T	0.36520	1.25;1.25	4.47	4.47	0.54385	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.083709	0.85682	D	0.000000	T	0.28764	0.0713	N	0.25201	0.72	0.80722	D	1	B	0.24186	0.099	B	0.25140	0.058	T	0.10894	-1.0610	10	0.51188	T	0.08	-20.4485	16.9081	0.86133	0.0:1.0:0.0:0.0	.	77	P23435	CBLN1_HUMAN	I	77	ENSP00000219197:M77I;ENSP00000444651:M77I	ENSP00000219197:M77I	M	-	3	0	CBLN1	47872647	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.270000	0.78493	2.314000	0.78098	0.462000	0.41574	ATG	.	.		0.607	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256845.4	NM_004352	
SMPD3	55512	hgsc.bcm.edu	37	16	68405459	68405459	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:68405459G>A	ENST00000219334.5	-	3	1229	c.626C>T	c.(625-627)tCt>tTt	p.S209F	SMPD3_ENST00000566009.1_5'Flank|SMPD3_ENST00000568373.1_Missense_Mutation_p.S209F|SMPD3_ENST00000563226.1_Missense_Mutation_p.S209F	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	209					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GTACTCCACAGAGGCTGTCCT	0.682																																					p.S209F		Atlas-SNP	.											.	SMPD3	52	.	0			c.C626T						.						17.0	21.0	20.0					16																	68405459		2194	4298	6492	SO:0001583	missense	55512	exon3			TCCACAGAGGCTG	AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.626C>T	chr16.hg19:g.68405459G>A	ENSP00000219334:p.Ser209Phe	13.0	0.0		23.0	7.0	NM_018667	B7ZL82|Q2M1S8	Missense_Mutation	SNP	ENST00000219334.5	hg19	CCDS10867.1	.	.	.	.	.	.	.	.	.	.	G	16.66	3.185210	0.57909	.	.	ENSG00000103056	ENST00000219334	.	.	.	4.74	4.74	0.60224	.	0.101538	0.64402	D	0.000001	T	0.63803	0.2542	L	0.29908	0.895	0.50171	D	0.999856	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.63597	0.916;0.916;0.916	T	0.68108	-0.5496	9	0.72032	D	0.01	-15.5338	15.5658	0.76290	0.0:0.0:1.0:0.0	.	209;209;209	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	F	209	.	ENSP00000219334:S209F	S	-	2	0	SMPD3	66962960	1.000000	0.71417	0.999000	0.59377	0.686000	0.39977	4.896000	0.63222	2.335000	0.79485	0.561000	0.74099	TCT	.	.		0.682	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268895.3	NM_018667	
AARS	16	hgsc.bcm.edu	37	16	70293021	70293021	+	Silent	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:70293021C>T	ENST00000261772.8	-	14	1997	c.1854G>A	c.(1852-1854)gtG>gtA	p.V618V	AARS_ENST00000564359.1_5'UTR	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		CTTCCCCAAGCACTGAGCGCA	0.562																																					p.V618V		Atlas-SNP	.											.	AARS	62	.	0			c.G1854A						.						178.0	160.0	166.0					16																	70293021		2198	4300	6498	SO:0001819	synonymous_variant	16	exon14			CCCAAGCACTGAG	D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.1854G>A	chr16.hg19:g.70293021C>T		95.0	0.0		63.0	14.0	NM_001605		Silent	SNP	ENST00000261772.8	hg19	CCDS32474.1																																																																																			.	.		0.562	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435021.2	NM_001605	
GAN	8139	hgsc.bcm.edu	37	16	81385202	81385202	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:81385202A>G	ENST00000568107.2	+	2	344	c.182A>G	c.(181-183)tAt>tGt	p.Y61C		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	61	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				AAGTTAAACTATAATCCTCCA	0.313																																					p.Y61C	GBM(106;1239 1507 7582 9741 33976)	Atlas-SNP	.											.	GAN	59	.	0			c.A182G						.						90.0	85.0	87.0					16																	81385202		2202	4300	6502	SO:0001583	missense	8139	exon2			TAAACTATAATCC	AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.182A>G	chr16.hg19:g.81385202A>G	ENSP00000476795:p.Tyr61Cys	60.0	0.0		58.0	12.0	NM_022041		Missense_Mutation	SNP	ENST00000568107.2	hg19	CCDS10935.1	.	.	.	.	.	.	.	.	.	.	A	18.94	3.729425	0.69074	.	.	ENSG00000127688	ENST00000248272	T	0.67171	-0.25	5.75	5.75	0.90469	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.139673	0.49916	D	0.000129	T	0.75049	0.3797	L	0.36672	1.1	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.77624	-0.2518	10	0.72032	D	0.01	.	16.0549	0.80794	1.0:0.0:0.0:0.0	.	61	Q9H2C0	GAN_HUMAN	C	61	ENSP00000248272:Y61C	ENSP00000248272:Y61C	Y	+	2	0	GAN	79942703	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.339000	0.96797	2.192000	0.70111	0.459000	0.35465	TAT	.	.		0.313	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269050.3		
RPL13	6137	hgsc.bcm.edu	37	16	89628070	89628070	+	Nonsense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr16:89628070C>T	ENST00000393099.3	+	3	580	c.331C>T	c.(331-333)Cag>Tag	p.Q111*	RPL13_ENST00000452368.3_Intron|RPL13_ENST00000567815.1_Nonsense_Mutation_p.Q111*|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000311528.5_Nonsense_Mutation_p.Q111*	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	111					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GGAGTCCCTGCAGGCCAACGT	0.612																																					p.Q111X		Atlas-SNP	.											.	RPL13	11	.	0			c.C331T						.						44.0	43.0	43.0					16																	89628070		2198	4299	6497	SO:0001587	stop_gained	6137	exon4			TCCCTGCAGGCCA	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.331C>T	chr16.hg19:g.89628070C>T	ENSP00000376811:p.Gln111*	209.0	0.0		160.0	42.0	NM_000977	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Nonsense_Mutation	SNP	ENST00000393099.3	hg19	CCDS10979.1	.	.	.	.	.	.	.	.	.	.	C	36	5.630997	0.96682	.	.	ENSG00000167526	ENST00000311528;ENST00000393099	.	.	.	4.29	4.29	0.51040	.	0.066901	0.64402	U	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.4789	17.1115	0.86676	0.0:1.0:0.0:0.0	.	.	.	.	X	111	.	ENSP00000307889:Q111X	Q	+	1	0	RPL13	88155571	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.622000	0.83099	2.106000	0.64143	0.462000	0.41574	CAG	.	.		0.612	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
TP53	7157	hgsc.bcm.edu	37	17	7578463	7578463	+	Missense_Mutation	SNP	C	C	G	rs371524413		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr17:7578463C>G	ENST00000269305.4	-	5	656	c.467G>C	c.(466-468)cGc>cCc	p.R156P	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R156P|TP53_ENST00000445888.2_Missense_Mutation_p.R156P|TP53_ENST00000420246.2_Missense_Mutation_p.R156P|TP53_ENST00000359597.4_Missense_Mutation_p.R156P|TP53_ENST00000455263.2_Missense_Mutation_p.R156P	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	156	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R156P(24)|p.R156H(10)|p.0?(8)|p.?(5)|p.R156L(3)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.T155_R156delTR(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156del(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*14(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.R156_V157del(1)|p.D148fs*23(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*25(1)|p.G154_R156delGTR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCGCGGACGCGGGTGCCGGG	0.612		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R156P	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,right_upper_lobe,carcinoma,0,5	TP53	33396	.	72	Substitution - Missense(37)|Deletion - In frame(11)|Deletion - Frameshift(10)|Whole gene deletion(8)|Unknown(5)|Insertion - Frameshift(1)	breast(9)|lung(8)|ovary(8)|stomach(7)|upper_aerodigestive_tract(6)|large_intestine(5)|skin(5)|bone(5)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|kidney(2)|liver(2)|oesophagus(2)|biliary_tract(1)|prostate(1)|pancreas(1)	c.G467C	GRCh37	CM984589	TP53	M		.						50.0	52.0	51.0					17																	7578463		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGGACGCGGGTGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.467G>C	chr17.hg19:g.7578463C>G	ENSP00000269305:p.Arg156Pro	139.0	0.0		80.0	29.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076061	0.36662	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99766	-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69;-6.69	5.47	3.45	0.39498	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.599272	0.17934	N	0.157074	D	0.99576	0.9847	M	0.73598	2.24	0.09310	N	1	D;D;D;D;D;D;D	0.89917	1.0;0.988;0.96;0.985;0.982;0.996;1.0	D;P;P;D;P;D;D	0.74674	0.984;0.887;0.614;0.924;0.902;0.953;0.958	D	0.99552	1.0966	10	0.54805	T	0.06	-1.0137	6.8349	0.23931	0.3112:0.607:0.0:0.0817	.	117;156;156;63;156;156;156	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	P	156;156;156;156;156;156;145;63;24;63;24;156	ENSP00000410739:R156P;ENSP00000352610:R156P;ENSP00000269305:R156P;ENSP00000398846:R156P;ENSP00000391127:R156P;ENSP00000391478:R156P;ENSP00000425104:R24P;ENSP00000423862:R63P;ENSP00000424104:R156P	ENSP00000269305:R156P	R	-	2	0	TP53	7519188	0.333000	0.24731	0.002000	0.10522	0.138000	0.21146	4.631000	0.61304	0.779000	0.33543	0.563000	0.77884	CGC	.	.		0.612	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SLFN12L	100506736	hgsc.bcm.edu	37	17	33802437	33802437	+	Silent	SNP	T	T	C			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr17:33802437T>C	ENST00000260908.7	-	4	1389	c.1272A>G	c.(1270-1272)ggA>ggG	p.G424G	RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000361112.4_Silent_p.G453G|SLFN12L_ENST00000449046.1_Silent_p.G455G	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	424						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)			breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						ATTGCTTAAGTCCTTCATGTT	0.393																																					p.G424G		Atlas-SNP	.											.	SLFN12L	140	.	0			c.A1272G						.						62.0	51.0	54.0					17																	33802437		692	1591	2283	SO:0001819	synonymous_variant	100506736	exon4			CTTAAGTCCTTCA	AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.1272A>G	chr17.hg19:g.33802437T>C		88.0	0.0		55.0	14.0	NM_001195790	F5H6G3	Silent	SNP	ENST00000260908.7	hg19	CCDS56026.1																																																																																			.	.		0.393	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395748.2	XM_496206	
GPR179	440435	hgsc.bcm.edu	37	17	36482914	36482914	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr17:36482914C>T	ENST00000342292.4	-	11	6558	c.6538G>A	c.(6538-6540)Gag>Aag	p.E2180K	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	2180					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CAGACTGCCTCCTGCTCTCTG	0.582																																					p.E2180K		Atlas-SNP	.											.	GPR179	170	.	0			c.G6538A						.						96.0	99.0	98.0					17																	36482914		2119	4231	6350	SO:0001583	missense	440435	exon11			CTGCCTCCTGCTC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.6538G>A	chr17.hg19:g.36482914C>T	ENSP00000345060:p.Glu2180Lys	63.0	0.0		38.0	6.0	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	hg19	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.291736	0.40594	.	.	ENSG00000188888	ENST00000342292	T	0.53640	0.61	3.24	3.24	0.37175	.	0.000000	0.40144	N	0.001173	T	0.41581	0.1165	L	0.55743	1.74	0.09310	N	1	B	0.28713	0.22	B	0.21708	0.036	T	0.39121	-0.9629	10	0.38643	T	0.18	-12.2637	14.4268	0.67220	0.0:1.0:0.0:0.0	.	2180	Q6PRD1	GP179_HUMAN	K	2180	ENSP00000345060:E2180K	ENSP00000345060:E2180K	E	-	1	0	GPR179	33736440	0.891000	0.30450	0.132000	0.22025	0.055000	0.15305	1.003000	0.29809	2.115000	0.64714	0.460000	0.39030	GAG	.	.		0.582	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
WDR18	57418	hgsc.bcm.edu	37	19	992023	992023	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr19:992023C>G	ENST00000251289.5	+	8	1023	c.1000C>G	c.(1000-1002)Ctg>Gtg	p.L334V	WDR18_ENST00000587001.2_Missense_Mutation_p.L334V	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	334					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGCCCAGCCTGCCGCTGCC	0.721																																					p.L334V		Atlas-SNP	.											.	WDR18	20	.	0			c.C1000G						.						10.0	11.0	11.0					19																	992023		2143	4187	6330	SO:0001583	missense	57418	exon8			CCCAGCCTGCCGC		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.1000C>G	chr19.hg19:g.992023C>G	ENSP00000251289:p.Leu334Val	63.0	0.0		58.0	17.0	NM_024100	O60390|Q9BWR2	Missense_Mutation	SNP	ENST00000251289.5	hg19	CCDS12051.1	.	.	.	.	.	.	.	.	.	.	C	8.908	0.958045	0.18507	.	.	ENSG00000065268	ENST00000251289	T	0.68331	-0.32	4.28	4.28	0.50868	.	0.162347	0.41097	D	0.000942	T	0.44307	0.1287	L	0.31207	0.915	0.32238	N	0.573086	B	0.14438	0.01	B	0.06405	0.002	T	0.43212	-0.9405	10	0.02654	T	1	.	6.0096	0.19567	0.0:0.7023:0.1947:0.103	.	334	Q9BV38	WDR18_HUMAN	V	334	ENSP00000251289:L334V	ENSP00000251289:L334V	L	+	1	2	WDR18	943023	0.999000	0.42202	1.000000	0.80357	0.981000	0.71138	1.101000	0.31037	2.227000	0.72691	0.491000	0.48974	CTG	.	.		0.721	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
ZNF728	388523	hgsc.bcm.edu	37	19	23159372	23159372	+	Missense_Mutation	SNP	T	T	C	rs565868137		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr19:23159372T>C	ENST00000594710.1	-	4	912	c.767A>G	c.(766-768)tAc>tGc	p.Y256C		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	256					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TTCACATTTGTAATGTTTCTC	0.403													.|||	1	0.000199681	0.0	0.0014	5008	,	,		20753	0.0		0.0	False		,,,				2504	0.0				p.Y256C		Atlas-SNP	.											.	.	.	.	0			c.A767G						.																																			SO:0001583	missense	388523	exon4			CATTTGTAATGTT	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.767A>G	chr19.hg19:g.23159372T>C	ENSP00000471593:p.Tyr256Cys	28.0	0.0		30.0	9.0	NM_001267716		Missense_Mutation	SNP	ENST00000594710.1	hg19	CCDS59370.1																																																																																			.	.		0.403	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465176.1	NM_001267716	
ATP4A	495	hgsc.bcm.edu	37	19	36047937	36047937	+	Missense_Mutation	SNP	C	C	T	rs200791532		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr19:36047937C>T	ENST00000262623.3	-	12	1775	c.1747G>A	c.(1747-1749)Gac>Aac	p.D583N		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	583					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.D583N(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GCCTCTACGTCGAAGGCATAG	0.582																																					p.D583N		Atlas-SNP	.											ATP4A,NS,carcinoma,0,1	ATP4A	123	.	1	Substitution - Missense(1)	prostate(1)	c.G1747A						.						78.0	73.0	75.0					19																	36047937		2203	4300	6503	SO:0001583	missense	495	exon12			CTACGTCGAAGGC		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1747G>A	chr19.hg19:g.36047937C>T	ENSP00000262623:p.Asp583Asn	93.0	0.0		86.0	23.0	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	hg19	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605498	0.28623	.	.	ENSG00000105675	ENST00000262623	T	0.80393	-1.37	5.14	2.91	0.33838	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.074877	0.48767	D	0.000176	T	0.66626	0.2808	N	0.20574	0.59	0.48511	D	0.999666	B	0.18310	0.027	B	0.29267	0.1	T	0.59778	-0.7390	10	0.28530	T	0.3	.	9.0288	0.36247	0.0:0.8056:0.0:0.1944	.	583	P20648	ATP4A_HUMAN	N	583	ENSP00000262623:D583N	ENSP00000262623:D583N	D	-	1	0	ATP4A	40739777	0.998000	0.40836	0.896000	0.35187	0.180000	0.23129	3.898000	0.56281	1.400000	0.46741	0.591000	0.81541	GAC	.	C|0.999;T|0.001		0.582	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
IZUMO1	284359	hgsc.bcm.edu	37	19	49244274	49244274	+	Missense_Mutation	SNP	C	C	T			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr19:49244274C>T	ENST00000332955.2	-	10	1491	c.944G>A	c.(943-945)cGa>cAa	p.R315Q	RASIP1_ENST00000594232.1_5'Flank|RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	315					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CACCTTCCTTCGACGAAATAT	0.547																																					p.R315Q		Atlas-SNP	.											.	IZUMO1	30	.	0			c.G944A						.						102.0	92.0	95.0					19																	49244274		2203	4300	6503	SO:0001583	missense	284359	exon10			TTCCTTCGACGAA	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.944G>A	chr19.hg19:g.49244274C>T	ENSP00000327786:p.Arg315Gln	55.0	0.0		51.0	9.0	NM_182575	Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	ENST00000332955.2	hg19	CCDS12732.1	.	.	.	.	.	.	.	.	.	.	C	12.87	2.066391	0.36470	.	.	ENSG00000182264	ENST00000332955	T	0.23552	1.9	4.39	-2.09	0.07232	.	2.702910	0.01922	N	0.040588	T	0.18045	0.0433	L	0.39898	1.24	0.09310	N	1	B	0.22276	0.067	B	0.11329	0.006	T	0.09618	-1.0666	10	0.22706	T	0.39	3.134	2.5771	0.04809	0.1022:0.2153:0.4382:0.2442	.	315	Q8IYV9	IZUM1_HUMAN	Q	315	ENSP00000327786:R315Q	ENSP00000327786:R315Q	R	-	2	0	IZUMO1	53936086	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.518000	0.06267	-0.183000	0.10585	-0.150000	0.13652	CGA	.	.		0.547	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	NM_182575	
PLCB1	23236	hgsc.bcm.edu	37	20	8769114	8769114	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr20:8769114G>A	ENST00000338037.6	+	28	3157	c.3130G>A	c.(3130-3132)Gat>Aat	p.D1044N	PLCB1_ENST00000378637.2_Missense_Mutation_p.D1044N|PLCB1_ENST00000378641.3_Missense_Mutation_p.D1044N|PLCB1_ENST00000494924.1_3'UTR	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	1044					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AAAGTTGACGGATGTCGCAGA	0.388																																					p.K1044K		Atlas-SNP	.											.	PLCB1	394	.	0			c.A3130A						.						73.0	70.0	71.0					20																	8769114		2203	4300	6503	SO:0001583	missense	23236	exon28			TTGACGGATGTCG	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.3130G>A	chr20.hg19:g.8769114G>A	ENSP00000338185:p.Asp1044Asn	169.0	0.0		177.0	49.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Silent	SNP	ENST00000338037.6	hg19	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.475396	0.63737	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.48522	0.81;0.81;0.81	5.28	5.28	0.74379	PLC-beta, C-terminal (1);	0.343372	0.33217	N	0.005146	T	0.44477	0.1295	L	0.40543	1.245	0.34571	D	0.713448	P;B	0.35124	0.485;0.336	B;B	0.35550	0.179;0.205	T	0.57539	-0.7794	10	0.49607	T	0.09	.	19.2861	0.94072	0.0:0.0:1.0:0.0	.	1044;1044	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	N	1044;1044;1044;964;964	ENSP00000367908:D1044N;ENSP00000338185:D1044N;ENSP00000367904:D1044N	ENSP00000338185:D1044N	D	+	1	0	PLCB1	8717114	1.000000	0.71417	0.994000	0.49952	0.972000	0.66771	4.005000	0.57075	2.640000	0.89533	0.563000	0.77884	GAT	.	.		0.388	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
SEC23B	10483	hgsc.bcm.edu	37	20	18491492	18491492	+	Missense_Mutation	SNP	C	C	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr20:18491492C>G	ENST00000336714.3	+	2	445	c.13C>G	c.(13-15)Ctg>Gtg	p.L5V	SEC23B_ENST00000377465.1_Missense_Mutation_p.L5V|SEC23B_ENST00000377475.3_Missense_Mutation_p.L5V|SEC23B_ENST00000262544.2_Missense_Mutation_p.L5V	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	5					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						GGCGACATACCTGGAGTTCAT	0.428																																					p.L5V		Atlas-SNP	.											.	SEC23B	70	.	0			c.C13G						.						122.0	112.0	115.0					20																	18491492		2203	4300	6503	SO:0001583	missense	10483	exon2			ACATACCTGGAGT	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.13C>G	chr20.hg19:g.18491492C>G	ENSP00000338844:p.Leu5Val	209.0	0.0		160.0	38.0	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	ENST00000336714.3	hg19	CCDS13137.1	.	.	.	.	.	.	.	.	.	.	C	13.50	2.254860	0.39896	.	.	ENSG00000101310	ENST00000450074;ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	D;D;D;D;D	0.86956	-1.6;-2.19;-2.19;-2.19;-2.19	5.08	3.15	0.36227	.	0.068699	0.64402	D	0.000014	T	0.77253	0.4103	L	0.27053	0.805	0.41804	D	0.989939	B;B	0.11235	0.004;0.004	B;B	0.09377	0.004;0.004	T	0.69881	-0.5025	10	0.46703	T	0.11	-7.8413	8.0822	0.30752	0.0:0.756:0.0:0.244	.	5;5	B4DJW8;Q15437	.;SC23B_HUMAN	V	5	ENSP00000403971:L5V;ENSP00000338844:L5V;ENSP00000262544:L5V;ENSP00000366695:L5V;ENSP00000366685:L5V	ENSP00000262544:L5V	L	+	1	2	SEC23B	18439492	0.982000	0.34865	0.999000	0.59377	0.989000	0.77384	1.255000	0.32909	0.738000	0.32606	0.655000	0.94253	CTG	.	.		0.428	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
TTC38	55020	hgsc.bcm.edu	37	22	46681166	46681166	+	Missense_Mutation	SNP	A	A	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr22:46681166A>G	ENST00000381031.3	+	9	900	c.824A>G	c.(823-825)tAc>tGc	p.Y275C	TTC38_ENST00000445282.2_Missense_Mutation_p.Y217C	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	275						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						CTGACCATCTACGATACCCAC	0.453																																					p.Y275C		Atlas-SNP	.											.	TTC38	40	.	0			c.A824G						.						137.0	128.0	131.0					22																	46681166		1953	4146	6099	SO:0001583	missense	55020	exon9			CCATCTACGATAC		CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.824A>G	chr22.hg19:g.46681166A>G	ENSP00000370419:p.Tyr275Cys	106.0	0.0		67.0	23.0	NM_017931	Q8WV27|Q9NWP8	Missense_Mutation	SNP	ENST00000381031.3	hg19	CCDS43030.1	.	.	.	.	.	.	.	.	.	.	A	8.490	0.861838	0.17178	.	.	ENSG00000075234	ENST00000381031;ENST00000445282	T;T	0.81415	1.29;-1.49	5.03	2.87	0.33458	Tetratricopeptide-like helical (1);	0.167804	0.53938	D	0.000044	D	0.89787	0.6816	M	0.88241	2.94	0.18873	N	0.999989	D;D	0.89917	0.995;1.0	D;D	0.74023	0.931;0.982	T	0.83056	-0.0150	10	0.72032	D	0.01	-1.4444	11.7344	0.51757	0.7644:0.0:0.0:0.2356	.	217;275	E7ES35;Q5R3I4	.;TTC38_HUMAN	C	275;217	ENSP00000370419:Y275C;ENSP00000393960:Y217C	ENSP00000370419:Y275C	Y	+	2	0	TTC38	45059830	0.969000	0.33509	0.000000	0.03702	0.001000	0.01503	1.755000	0.38379	0.015000	0.14971	-2.489000	0.00195	TAC	.	.		0.453	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000318469.1	NM_017931	
MT-CYB	4519	hgsc.bcm.edu	37	M	15005	15005	+	Missense_Mutation	SNP	G	G	A			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chrM:15005G>A	ENST00000361789.2	+	1	259	c.259G>A	c.(259-261)Gcc>Acc	p.A87T	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	87			A -> P. {ECO:0000269|PubMed:1757091}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACGCCAATGGCGCCTCAATAT	0.478																																					p.A87T		Atlas-SNP	.											.	.	.	.	0			c.G259A						.																																			SO:0001583	missense	0	exon1			AATGGCGCCTCAA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.259G>A	chrM.hg19:g.15005G>A	ENSP00000354554:p.Ala87Thr	41.0	0.0		47.0	34.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.478	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
HNRNPL	3191	hgsc.bcm.edu	37	19	39330868	39330869	+	Frame_Shift_Ins	INS	-	-	G			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr19:39330868_39330869insG	ENST00000221419.5	-	8	1466_1467	c.1100_1101insC	c.(1099-1101)ccafs	p.P367fs	HNRNPL_ENST00000600873.1_Frame_Shift_Ins_p.P234fs|AC104534.3_ENST00000594769.1_5'Flank	NM_001533.2	NP_001524.2	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	367	Pro-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription regulatory region DNA binding (GO:0044212)	p.P367P(1)|p.P234P(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GGGGAGGGGGTGGGGGGTGCCC	0.644																																					p.P367fs		Atlas-INDEL	.											HNRPL,right_upper_lobe,carcinoma,0,6	HNRNPL	67	.	2	Substitution - coding silent(2)	central_nervous_system(2)	c.1101_1102insC						.																																			SO:0001589	frameshift_variant	3191	exon8			.	X16135	CCDS33015.1, CCDS33016.1	19q13.2	2013-06-12		2007-08-16	ENSG00000104824	ENSG00000104824		"""RNA binding motif (RRM) containing"""	5045	protein-coding gene	gene with protein product		603083		HNRPL		2687284	Standard	NM_001533		Approved		uc021uuh.1	P14866	OTTHUMG00000182612	ENST00000221419.5:c.1101dupC	chr19.hg19:g.39330874_39330874dupG	ENSP00000221419:p.Pro367fs	91.0	0.0		88.0	25.0	NM_001533	A6ND69|A6NIT8|Q9H3P3	Frame_Shift_Ins	INS	ENST00000221419.5	hg19	CCDS33015.1																																																																																			.	.		0.644	HNRNPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462670.1		
NAT10	55226	hgsc.bcm.edu	37	11	34135326	34135326	+	Frame_Shift_Del	DEL	C	C	-			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr11:34135326delC	ENST00000257829.3	+	5	642	c.436delC	c.(436-438)ctafs	p.L146fs	NAT10_ENST00000531159.2_Frame_Shift_Del_p.L74fs|NAT10_ENST00000527971.1_Frame_Shift_Del_p.L146fs	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	146						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				AGGTGGTGGGCTAGTGGTCAT	0.463																																					p.G145fs		Atlas-INDEL	.											.	NAT10	78	.	0			c.435delG						.						139.0	123.0	128.0					11																	34135326		2202	4298	6500	SO:0001589	frameshift_variant	55226	exon5			.	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.436delC	chr11.hg19:g.34135326delC	ENSP00000257829:p.Leu146fs	143.0	0.0		128.0	39.0	NM_024662	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Frame_Shift_Del	DEL	ENST00000257829.3	hg19	CCDS7889.1																																																																																			.	.		0.463	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
INSR	3643	hgsc.bcm.edu	37	19	7174745	7174746	+	Intron	DEL	AA	AA	-	rs377686128		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr19:7174745_7174746delAA	ENST00000302850.5	-	4	1117				INSR_ENST00000341500.5_Intron	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor						activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	ACAGCAAGCTAAGGACGGAGCA	0.569																																					.		Atlas-INDEL	.											.	INSR	265	.	0			.						.																																			SO:0001627	intron_variant	3643	.			.	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.975-3TT>-	chr19.hg19:g.7174745_7174746delAA		60.0	0.0		53.0	10.0	.	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Splice_Site	DEL	ENST00000302850.5	hg19	CCDS12176.1																																																																																			.	.		0.569	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		
FREM2	341640	hgsc.bcm.edu	37	13	39263249	39263257	+	In_Frame_Del	DEL	GATTCAGAT	GATTCAGAT	-	rs368864300		TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	GATTCAGAT	GATTCAGAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr13:39263249_39263257delGATTCAGAT	ENST00000280481.7	+	1	1984_1992	c.1768_1776delGATTCAGAT	c.(1768-1776)gattcagatdel	p.DSD590del		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	590					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AACTGACATGGATTCAGATGATTCTCTGC	0.541																																					p.589_592del		Atlas-INDEL	.											.	FREM2	385	.	0			c.1767_1775del						.																																			SO:0001651	inframe_deletion	341640	exon1			.	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1768_1776delGATTCAGAT	chr13.hg19:g.39263249_39263257delGATTCAGAT	ENSP00000280481:p.Asp590_Asp592del	41.0	0.0		48.0	13.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	In_Frame_Del	DEL	ENST00000280481.7	hg19	CCDS31960.1																																																																																			.	.		0.541	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
ALB	213	hgsc.bcm.edu	37	4	74274379	74274380	+	Frame_Shift_Ins	INS	-	-	AGCA			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr4:74274379_74274380insAGCA	ENST00000295897.4	+	4	428_429	c.339_340insAGCA	c.(340-342)tgcfs	p.C114fs	ALB_ENST00000401494.3_Intron|ALB_ENST00000415165.2_Intron|ALB_ENST00000503124.1_Intron|ALB_ENST00000509063.1_Frame_Shift_Ins_p.C114fs|ALB_ENST00000505649.1_3'UTR	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAATGGCTGACTGCTGTGCAAA	0.441																																					p.D113fs		Atlas-INDEL	.											.	ALB	132	.	0			c.339_340insAGCA						.																																			SO:0001589	frameshift_variant	213	exon4			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	Exception_encountered	chr4.hg19:g.74274379_74274380insAGCA	ENSP00000295897:p.Cys114fs	118.0	0.0		95.0	19.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Ins	INS	ENST00000295897.4	hg19	CCDS3555.1																																																																																			.	.		0.441	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	
C8orf76	84933	hgsc.bcm.edu	37	8	124238821	124238821	+	Frame_Shift_Del	DEL	C	C	-			TCGA-K7-AAU7-01A-11D-A382-10	TCGA-K7-AAU7-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ad39f207-eb8e-4719-8887-cd482741dd5f	16cd1e7f-a4ad-474d-8aa1-d578f2f2db0c	g.chr8:124238821delC	ENST00000276704.4	-	5	918	c.867delG	c.(865-867)aggfs	p.R289fs	ZHX1-C8ORF76_ENST00000357082.4_Frame_Shift_Del_p.R257fs|C8orf76_ENST00000521310.1_5'UTR	NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	289										NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TCCTTAAGTTCCTCTCCAAAG	0.453																																					p.N290fs		Atlas-INDEL	.											.	C8orf76	26	.	0			c.868delA						.						86.0	81.0	83.0					8																	124238821		2203	4300	6503	SO:0001589	frameshift_variant	84933	exon5			.	AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.867delG	chr8.hg19:g.124238821delC	ENSP00000276704:p.Arg289fs	67.0	0.0		151.0	88.0	NM_032847	Q53HC1	Frame_Shift_Del	DEL	ENST00000276704.4	hg19	CCDS6341.1																																																																																			.	.		0.453	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381748.1	NM_032847	
