#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA0754	643314	hgsc.bcm.edu	37	1	39876450	39876450	+	Silent	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr1:39876450C>T	ENST00000530275.1	+	1	300	c.105C>T	c.(103-105)tcC>tcT	p.S35S	MACF1_ENST00000317713.7_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000545844.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	35	13 X 13 AA approximate tandem repeat of P-T-S-P-A-A-A-V-P-T-P-E-E.									central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGAAGGAGTCCAGTTCTGCAT	0.458																																					p.S171S		Atlas-SNP	.											.	KIAA0754	93	.	0			c.C513T						.						50.0	50.0	50.0					1																	39876450		1886	4108	5994	SO:0001819	synonymous_variant	643314	exon1			GGAGTCCAGTTCT			1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.105C>T	chr1.hg19:g.39876450C>T		241.0	1.0		159.0	109.0	NM_015038	E9PMC2|Q6ZSB2	Silent	SNP	ENST00000530275.1	hg19																																																																																				.	.		0.458	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000392100.1	NM_015038	
CEPT1	10390	hgsc.bcm.edu	37	1	111702018	111702018	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr1:111702018A>G	ENST00000545121.1	+	3	564	c.356A>G	c.(355-357)tAt>tGt	p.Y119C	CEPT1_ENST00000357172.4_Missense_Mutation_p.Y119C	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1	119					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	CTGTGGGCATATATTGCTTGT	0.408																																					p.Y119C		Atlas-SNP	.											.	CEPT1	25	.	0			c.A356G						.						181.0	182.0	181.0					1																	111702018		2203	4300	6503	SO:0001583	missense	10390	exon3			GGGCATATATTGC	AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.356A>G	chr1.hg19:g.111702018A>G	ENSP00000441980:p.Tyr119Cys	82.0	0.0		52.0	4.0	NM_006090	Q69YJ9|Q9P0Y8	Missense_Mutation	SNP	ENST00000545121.1	hg19	CCDS830.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.623556	0.66901	.	.	ENSG00000134255	ENST00000545121;ENST00000357172	T;T	0.43294	0.95;0.95	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.52338	0.1728	M	0.67625	2.065	0.80722	D	1	D;B	0.89917	1.0;0.238	D;B	0.79108	0.992;0.316	T	0.55842	-0.8077	10	0.49607	T	0.09	-38.8014	13.131	0.59382	1.0:0.0:0.0:0.0	.	119;119	Q9Y6K0;B3KN25	CEPT1_HUMAN;.	C	119	ENSP00000441980:Y119C;ENSP00000349696:Y119C	ENSP00000349696:Y119C	Y	+	2	0	CEPT1	111503541	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	5.944000	0.70219	1.983000	0.57843	0.533000	0.62120	TAT	.	.		0.408	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034462.2	NM_006090	
KCNN3	3782	hgsc.bcm.edu	37	1	154842253	154842253	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr1:154842253G>T	ENST00000271915.4	-	1	503	c.188C>A	c.(187-189)cCt>cAt	p.P63H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	63	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	aagctgcggaggctgaggctg	0.697																																					p.P63H		Atlas-SNP	.											.	KCNN3	141	.	0			c.C188A						.						6.0	4.0	5.0					1																	154842253		1984	3925	5909	SO:0001583	missense	3782	exon1			TGCGGAGGCTGAG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.188C>A	chr1.hg19:g.154842253G>T	ENSP00000271915:p.Pro63His	56.0	0.0		105.0	15.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	g	11.14	1.552427	0.27739	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.56275	0.47	5.07	3.18	0.36537	.	1.727610	0.03258	N	0.182822	T	0.18551	0.0445	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.11372	-1.0590	8	0.33141	T	0.24	-4.1487	6.4327	0.21807	0.0918:0.0:0.7284:0.1798	.	.	.	.	H	63;158	ENSP00000271915:P63H	ENSP00000271915:P63H	P	-	2	0	KCNN3	153108877	0.863000	0.29885	1.000000	0.80357	0.998000	0.95712	1.873000	0.39558	0.823000	0.34589	0.563000	0.77884	CCT	.	.		0.697	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
OBSCN	84033	hgsc.bcm.edu	37	1	228509374	228509374	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr1:228509374T>A	ENST00000422127.1	+	55	14876	c.14832T>A	c.(14830-14832)caT>caA	p.H4944Q	OBSCN_ENST00000366707.4_Missense_Mutation_p.H2578Q|OBSCN_ENST00000570156.2_Missense_Mutation_p.H5901Q|OBSCN_ENST00000284548.11_Missense_Mutation_p.H4944Q|OBSCN_ENST00000366709.4_Missense_Mutation_p.H2063Q	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4944	Ig-like 48.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCGGCACCATCACATCGACC	0.622																																					p.H5901Q		Atlas-SNP	.											.	OBSCN	2142	.	0			c.T17703A						.						57.0	61.0	59.0					1																	228509374		2176	4269	6445	SO:0001583	missense	84033	exon66			GCACCATCACATC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14832T>A	chr1.hg19:g.228509374T>A	ENSP00000409493:p.His4944Gln	80.0	0.0		114.0	36.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.195810	0.78902	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.34	2.44	0.29823	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.397790	0.25388	N	0.031021	T	0.66509	0.2796	L	0.39245	1.2	0.26246	N	0.978798	P;P	0.50819	0.939;0.925	P;P	0.55455	0.776;0.667	T	0.58589	-0.7610	10	0.56958	D	0.05	.	8.9103	0.35548	0.0:0.6285:0.0:0.3715	.	4944;4944	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	Q	4944;4944;2578;2063	ENSP00000284548:H4944Q;ENSP00000409493:H4944Q;ENSP00000355668:H2578Q;ENSP00000355670:H2063Q	ENSP00000284548:H4944Q	H	+	3	2	OBSCN	226575997	0.611000	0.26992	1.000000	0.80357	0.920000	0.55202	-0.192000	0.09587	0.244000	0.21351	-0.242000	0.12053	CAT	.	.		0.622	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
HS1BP3	64342	hgsc.bcm.edu	37	2	20838354	20838354	+	Silent	SNP	G	G	A	rs570622489		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:20838354G>A	ENST00000304031.3	-	4	490	c.465C>T	c.(463-465)ggC>ggT	p.G155G	HS1BP3_ENST00000402541.1_Silent_p.G155G	NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	155							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACTGTCTGTGCCATCCAGGA	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		20765	0.0		0.0	False		,,,				2504	0.001				p.G155G		Atlas-SNP	.											.	HS1BP3	33	.	0			c.C465T						.						116.0	109.0	111.0					2																	20838354		2203	4300	6503	SO:0001819	synonymous_variant	64342	exon4			GTCTGTGCCATCC		CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.465C>T	chr2.hg19:g.20838354G>A		62.0	0.0		69.0	30.0	NM_022460	B2RAW2|D6W529|Q86VC2|Q8N367	Silent	SNP	ENST00000304031.3	hg19	CCDS1700.1																																																																																			.	.		0.562	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242863.1	NM_022460	
TMEM214	54867	hgsc.bcm.edu	37	2	27257068	27257068	+	Silent	SNP	G	G	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:27257068G>A	ENST00000238788.9	+	2	347	c.285G>A	c.(283-285)gtG>gtA	p.V95V	TMEM214_ENST00000404032.3_Silent_p.V95V	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	95					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						CAAAGAAGGTGGCAACTCCTC	0.537																																					p.V95V		Atlas-SNP	.											.	TMEM214	41	.	0			c.G285A						.						57.0	60.0	59.0					2																	27257068		2016	4185	6201	SO:0001819	synonymous_variant	54867	exon2			GAAGGTGGCAACT		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.285G>A	chr2.hg19:g.27257068G>A		235.0	0.0		214.0	91.0	NM_017727	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Silent	SNP	ENST00000238788.9	hg19	CCDS42664.1																																																																																			.	.		0.537	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
TGOLN2	10618	hgsc.bcm.edu	37	2	85554487	85554487	+	Missense_Mutation	SNP	G	G	C	rs553348456		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:85554487G>C	ENST00000409232.3	-	2	429	c.368C>G	c.(367-369)aCt>aGt	p.T123S	TGOLN2_ENST00000377386.3_Missense_Mutation_p.T123S|TGOLN2_ENST00000444342.2_Missense_Mutation_p.T123S|TGOLN2_ENST00000282120.2_Intron|TGOLN2_ENST00000398263.2_Missense_Mutation_p.T123S|TGOLN2_ENST00000409015.1_Missense_Mutation_p.T123S			O43493	TGON2_HUMAN	trans-golgi network protein 2	123	14 X 14 AA tandem repeats.					Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)											CGACTTACTAGTGCTGTCTTT	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		16933	0.0		0.0	False		,,,				2504	0.001				p.T123S		Atlas-SNP	.											.	TGOLN2	32	.	0			c.C368G						.						367.0	365.0	365.0					2																	85554487		1990	4161	6151	SO:0001583	missense	10618	exon2			TTACTAGTGCTGT	AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.368C>G	chr2.hg19:g.85554487G>C	ENSP00000386443:p.Thr123Ser	132.0	0.0		170.0	66.0	NM_001206841	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Missense_Mutation	SNP	ENST00000409232.3	hg19	CCDS56126.1	.	.	.	.	.	.	.	.	.	.	G	8.262	0.811324	0.16537	.	.	ENSG00000152291	ENST00000377386;ENST00000398263;ENST00000409232;ENST00000409015;ENST00000444342	T;T;T;T;T	0.10573	2.95;2.86;3.05;2.95;2.98	3.32	2.38	0.29361	.	.	.	.	.	T	0.05777	0.0151	N	0.14661	0.345	0.25516	N	0.987417	B;B;B;B	0.16396	0.017;0.017;0.003;0.017	B;B;B;B	0.12837	0.008;0.008;0.001;0.008	T	0.42565	-0.9444	9	0.10111	T	0.7	1.1236	9.4191	0.38539	0.0:0.0:0.776:0.224	.	123;123;123;123	O43493;O43493-5;O43493-4;O43493-2	TGON2_HUMAN;.;.;.	S	123	ENSP00000366603:T123S;ENSP00000381312:T123S;ENSP00000386443:T123S;ENSP00000387035:T123S;ENSP00000391190:T123S	ENSP00000366603:T123S	T	-	2	0	TGOLN2	85407998	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	1.359000	0.34113	0.719000	0.32188	0.380000	0.24917	ACT	.	.		0.582	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329045.2	NM_006464	
POLR1A	25885	hgsc.bcm.edu	37	2	86260785	86260785	+	Splice_Site	SNP	C	C	G	rs78239085	byFrequency	TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:86260785C>G	ENST00000263857.6	-	28	4538	c.4160G>C	c.(4159-4161)cGg>cCg	p.R1387P	POLR1A_ENST00000409681.1_Splice_Site_p.R1387P			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1387					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						CTCACTCACCCGACTCCTCCC	0.557																																					p.R1387P		Atlas-SNP	.											.	POLR1A	137	.	0			c.G4160C						.						75.0	80.0	79.0					2																	86260785		1929	4126	6055	SO:0001630	splice_region_variant	25885	exon28			CTCACCCGACTCC	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4161+1G>C	chr2.hg19:g.86260785C>G		88.0	0.0		94.0	41.0	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	hg19	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	C	9.348	1.064764	0.20067	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.67698	-0.28;3.38	5.38	0.278	0.15673	RNA polymerase Rpb1, domain 5 (1);	0.752143	0.11949	N	0.513863	T	0.46249	0.1383	N	0.25647	0.755	0.29848	N	0.828664	B;B	0.11235	0.004;0.002	B;B	0.12837	0.008;0.005	T	0.32719	-0.9896	10	0.27785	T	0.31	-11.629	3.8346	0.08888	0.1601:0.4853:0.0:0.3546	.	753;1387	B7Z8X7;O95602	.;RPA1_HUMAN	P	1387	ENSP00000263857:R1387P;ENSP00000386300:R1387P	ENSP00000263857:R1387P	R	-	2	0	POLR1A	86114296	0.006000	0.16342	0.398000	0.26321	0.073000	0.16967	-0.714000	0.05002	-0.024000	0.13941	-0.258000	0.10820	CGG	.	C|0.978;T|0.022		0.557	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	Missense_Mutation
SCN9A	6335	hgsc.bcm.edu	37	2	167089924	167089924	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:167089924C>T	ENST00000409435.1	-	20	3849	c.3850G>A	c.(3850-3852)Ggc>Agc	p.G1284S	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.G1285S|SCN9A_ENST00000409672.1_Missense_Mutation_p.G1273S|SCN9A_ENST00000375387.4_Missense_Mutation_p.G1285S			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1284					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTAATGGGGCCAAGATCTGAG	0.338																																					p.G1273S		Atlas-SNP	.											.	SCN9A	296	.	0			c.G3817A						.						54.0	53.0	53.0					2																	167089924		1913	4159	6072	SO:0001583	missense	6335	exon21			TGGGGCCAAGATC	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.3850G>A	chr2.hg19:g.167089924C>T	ENSP00000386330:p.Gly1284Ser	75.0	0.0		97.0	25.0	NM_002977	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	ENST00000409435.1	hg19	CCDS46441.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402923	0.62288	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	5.72	4.85	0.62838	.	0.177237	0.40554	N	0.001070	D	0.96241	0.8774	L	0.45352	1.415	0.35497	D	0.79944	P	0.37824	0.609	P	0.46917	0.531	D	0.99731	1.1012	10	0.56958	D	0.05	.	14.7226	0.69317	0.0:0.9306:0.0:0.0694	.	1273	E7EUN6	.	S	1273;1285;1285;1284	ENSP00000386306:G1273S;ENSP00000364536:G1285S;ENSP00000304748:G1285S;ENSP00000386330:G1284S	ENSP00000304748:G1285S	G	-	1	0	SCN9A	166798170	0.013000	0.17824	0.982000	0.44146	0.978000	0.69477	0.726000	0.25984	1.422000	0.47177	0.650000	0.86243	GGC	.	.		0.338	SCN9A-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333639.1	NM_002977	
LRP2	4036	hgsc.bcm.edu	37	2	170058314	170058314	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:170058314C>A	ENST00000263816.3	-	44	8561	c.8276G>T	c.(8275-8277)cGc>cTc	p.R2759L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2759	LDL-receptor class A 17. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTAATCACAGCGGTAAGAGTA	0.498																																					p.R2759L		Atlas-SNP	.											.	LRP2	751	.	0			c.G8276T						.						153.0	131.0	138.0					2																	170058314		2203	4300	6503	SO:0001583	missense	4036	exon44			TCACAGCGGTAAG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8276G>T	chr2.hg19:g.170058314C>A	ENSP00000263816:p.Arg2759Leu	61.0	0.0		46.0	17.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022647	0.75275	.	.	ENSG00000081479	ENST00000263816	D	0.95622	-3.76	5.7	5.7	0.88788	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.95300	0.8475	N	0.25060	0.705	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91926	0.5551	10	0.08837	T	0.75	.	19.8429	0.96697	0.0:1.0:0.0:0.0	.	2759	P98164	LRP2_HUMAN	L	2759	ENSP00000263816:R2759L	ENSP00000263816:R2759L	R	-	2	0	LRP2	169766560	1.000000	0.71417	0.991000	0.47740	0.309000	0.27889	7.701000	0.84566	2.685000	0.91497	0.650000	0.86243	CGC	.	.		0.498	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
SLC4A3	6508	hgsc.bcm.edu	37	2	220500504	220500504	+	Silent	SNP	G	G	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:220500504G>T	ENST00000358055.3	+	14	2594	c.2082G>T	c.(2080-2082)ccG>ccT	p.P694P	SLC4A3_ENST00000317151.3_Silent_p.P694P|SLC4A3_ENST00000273063.6_Silent_p.P721P|SLC4A3_ENST00000373760.2_Silent_p.P694P|SLC4A3_ENST00000373762.3_Silent_p.P721P			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	694					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCCGGTACCCGCACTACCCCA	0.642																																					p.P721P		Atlas-SNP	.											.	SLC4A3	144	.	0			c.G2163T						.						35.0	35.0	35.0					2																	220500504		2203	4300	6503	SO:0001819	synonymous_variant	6508	exon14			GTACCCGCACTAC		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.2082G>T	chr2.hg19:g.220500504G>T		94.0	0.0		99.0	4.0	NM_201574	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Silent	SNP	ENST00000358055.3	hg19	CCDS2445.1																																																																																			.	.		0.642	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266105	41266105	+	Silent	SNP	A	A	G	rs121913416		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr3:41266105A>G	ENST00000349496.5	+	3	382	c.102A>G	c.(100-102)ggA>ggG	p.G34G	CTNNB1_ENST00000396185.3_Silent_p.G34G|CTNNB1_ENST00000405570.1_Silent_p.G34G|CTNNB1_ENST00000453024.1_Silent_p.G27G|CTNNB1_ENST00000396183.3_Silent_p.G34G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	34			G -> E (in PTR). {ECO:0000269|PubMed:10192393}.|G -> R (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|G -> V (in hepatoblastoma; dbSNP:rs28931589). {ECO:0000269|PubMed:9927029}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGACTCTGGAATCCATTCTG	0.493		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G34G	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1,1	CTNNB1	4904	.	133	Deletion - In frame(107)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(99)|large_intestine(19)|stomach(7)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|pancreas(1)	c.A102G						.						93.0	78.0	83.0					3																	41266105		2203	4300	6503	SO:0001819	synonymous_variant	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCTGGAATCCAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.102A>G	chr3.hg19:g.41266105A>G		154.0	1.0		33.0	15.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	ENST00000349496.5	hg19	CCDS2694.1																																																																																			.	.		0.493	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
PBRM1	55193	hgsc.bcm.edu	37	3	52598082	52598082	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr3:52598082C>T	ENST00000296302.7	-	23	3860	c.3859G>A	c.(3859-3861)Gaa>Aaa	p.E1287K	PBRM1_ENST00000410007.1_Missense_Mutation_p.E1262K|PBRM1_ENST00000409767.1_Missense_Mutation_p.E1302K|PBRM1_ENST00000337303.4_Missense_Mutation_p.E1287K|PBRM1_ENST00000409114.3_Missense_Mutation_p.E1302K|PBRM1_ENST00000409057.1_Missense_Mutation_p.E1287K|PBRM1_ENST00000394830.3_Missense_Mutation_p.E1262K|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000356770.4_Missense_Mutation_p.E1255K			Q86U86	PB1_HUMAN	polybromo 1	1287			E -> Q (found in a breast cancer cell line). {ECO:0000269|PubMed:21248752}.		chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TAGTAAATTTCATCATCTACC	0.358			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.E1262K		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	PBRM1_ENST00000296302,NS,carcinoma,+2,2	PBRM1	1252	.	0			c.G3784A						.						92.0	91.0	91.0					3																	52598082		2203	4300	6503	SO:0001583	missense	55193	exon24			AAATTTCATCATC	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3859G>A	chr3.hg19:g.52598082C>T	ENSP00000296302:p.Glu1287Lys	54.0	1.0		37.0	26.0	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	C	22.5	4.292169	0.80914	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351	T;T;T;T;T;T;T;T;T	0.59638	0.26;0.88;0.25;0.27;0.26;0.86;0.71;0.29;0.28	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.75664	0.3880	M	0.69358	2.11	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.998;0.99;0.998;0.996;0.999;0.999;0.998;0.996	D;D;D;D;D;D;D;D	0.81914	0.991;0.961;0.986;0.987;0.995;0.994;0.991;0.987	T	0.78102	-0.2335	10	0.87932	D	0	-15.2979	19.0144	0.92888	0.0:1.0:0.0:0.0	.	1262;1262;1287;1302;1302;1287;1255;1287	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	K	1255;1262;1287;1287;1287;1262;1302;1302;1286	ENSP00000349213:E1255K;ENSP00000378307:E1262K;ENSP00000296302:E1287K;ENSP00000338302:E1287K;ENSP00000386593:E1287K;ENSP00000386529:E1262K;ENSP00000386643:E1302K;ENSP00000386601:E1302K;ENSP00000387775:E1286K	ENSP00000296302:E1287K	E	-	1	0	PBRM1	52573122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.764000	0.85297	2.493000	0.84123	0.655000	0.94253	GAA	.	.		0.358	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
STPG2	285555	hgsc.bcm.edu	37	4	98902341	98902341	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr4:98902341G>C	ENST00000295268.3	-	6	830	c.741C>G	c.(739-741)ttC>ttG	p.F247L		NM_174952.2	NP_777612.1	Q8N412	STPG2_HUMAN	sperm-tail PG-rich repeat containing 2	247																	TGTCCTGTGTGAATCGAACAG	0.383																																					p.F247L		Atlas-SNP	.											.	.	.	.	0			c.C741G						.						193.0	190.0	191.0					4																	98902341		2203	4300	6503	SO:0001583	missense	285555	exon6			CTGTGTGAATCGA	BC036870	CCDS3645.1	4q22.3-q23	2013-10-11	2012-07-30	2012-07-30	ENSG00000163116	ENSG00000163116			28712	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 37"""	C4orf37		23031811	Standard	NM_174952		Approved	MGC46496	uc003htt.2	Q8N412	OTTHUMG00000131009	ENST00000295268.3:c.741C>G	chr4.hg19:g.98902341G>C	ENSP00000295268:p.Phe247Leu	78.0	0.0		39.0	6.0	NM_174952		Missense_Mutation	SNP	ENST00000295268.3	hg19	CCDS3645.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341323	0.60963	.	.	ENSG00000163116	ENST00000295268	T	0.19394	2.15	5.58	2.92	0.33932	.	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	M	0.78801	2.425	0.31353	N	0.682331	D	0.89917	1.0	D	0.87578	0.998	T	0.51148	-0.8742	10	0.87932	D	0	-19.3986	8.5742	0.33587	0.3068:0.0:0.6932:0.0	.	247	Q8N412	CD037_HUMAN	L	247	ENSP00000295268:F247L	ENSP00000295268:F247L	F	-	3	2	C4orf37	99121364	0.953000	0.32496	0.671000	0.29857	0.823000	0.46562	1.279000	0.33191	0.303000	0.22785	0.563000	0.77884	TTC	.	.		0.383	STPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253642.1	NM_174952	
SKIV2L2	23517	hgsc.bcm.edu	37	5	54693274	54693274	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr5:54693274G>T	ENST00000230640.5	+	20	2466	c.2212G>T	c.(2212-2214)Gct>Tct	p.A738S	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.A637S	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	738					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TCTCCTGTCTGCTATCAGCAG	0.363																																					p.A738S	Melanoma(2;92 134 23744 29976 33782)	Atlas-SNP	.											.	SKIV2L2	104	.	0			c.G2212T						.						164.0	155.0	158.0					5																	54693274		2203	4300	6503	SO:0001583	missense	23517	exon20			CTGTCTGCTATCA	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.2212G>T	chr5.hg19:g.54693274G>T	ENSP00000230640:p.Ala738Ser	82.0	0.0		83.0	4.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	hg19	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	G	10.28	1.306643	0.23736	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.29655	1.56;1.56	5.28	4.34	0.51931	.	0.161766	0.56097	D	0.000030	T	0.17492	0.0420	N	0.12961	0.28	0.52501	D	0.999956	B;B	0.12013	0.001;0.005	B;B	0.18871	0.006;0.023	T	0.05007	-1.0912	10	0.08179	T	0.78	-28.994	14.9965	0.71436	0.0:0.0:0.857:0.143	.	637;738	F5H7E2;P42285	.;SK2L2_HUMAN	S	738;637	ENSP00000230640:A738S;ENSP00000442583:A637S	ENSP00000230640:A738S	A	+	1	0	SKIV2L2	54729031	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.736000	0.62059	2.636000	0.89361	0.655000	0.94253	GCT	.	.		0.363	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
YTHDC2	64848	hgsc.bcm.edu	37	5	112891817	112891817	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr5:112891817A>G	ENST00000161863.4	+	17	2415	c.2202A>G	c.(2200-2202)atA>atG	p.I734M	YTHDC2_ENST00000515883.1_Missense_Mutation_p.I734M	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	734	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		CTAGTGCCATACAGCGGAAAG	0.289																																					p.I734M		Atlas-SNP	.											.	YTHDC2	118	.	0			c.A2202G						.						60.0	63.0	62.0					5																	112891817		2202	4287	6489	SO:0001583	missense	64848	exon17			TGCCATACAGCGG	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.2202A>G	chr5.hg19:g.112891817A>G	ENSP00000161863:p.Ile734Met	168.0	0.0		276.0	63.0	NM_022828	B2RP66	Missense_Mutation	SNP	ENST00000161863.4	hg19	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.032262	0.35893	.	.	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000511372	T;T	0.79454	-1.27;-1.27	4.89	2.55	0.30701	Helicase, C-terminal (3);	0.207171	0.42964	D	0.000630	T	0.61098	0.2320	N	0.26092	0.79	0.34411	D	0.696319	B	0.26876	0.162	B	0.25140	0.058	T	0.62383	-0.6866	10	0.51188	T	0.08	.	5.4887	0.16763	0.3278:0.4399:0.0:0.2322	.	734	Q9H6S0	YTDC2_HUMAN	M	734;734;644	ENSP00000161863:I734M;ENSP00000423101:I734M	ENSP00000161863:I734M	I	+	3	3	YTHDC2	112919716	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.357000	0.34090	0.706000	0.31912	0.524000	0.50904	ATA	.	.		0.289	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
RNF44	22838	hgsc.bcm.edu	37	5	175959076	175959076	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr5:175959076C>A	ENST00000274811.4	-	3	750	c.226G>T	c.(226-228)Gcc>Tcc	p.A76S	RNF44_ENST00000509404.1_5'Flank|RNF44_ENST00000537487.1_5'UTR	NM_014901.4	NP_055716.1	Q7L0R7	RNF44_HUMAN	ring finger protein 44	76	Pro-rich.						zinc ion binding (GO:0008270)			endometrium(2)|lung(3)|prostate(1)|skin(1)|stomach(1)	8	all_cancers(89;0.0029)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCCGCCGGCAGGAGCCGAG	0.706																																					p.A76S		Atlas-SNP	.											.	RNF44	33	.	0			c.G226T						.						18.0	26.0	23.0					5																	175959076		2195	4292	6487	SO:0001583	missense	22838	exon3			CGCCGGCAGGAGC	AB029023	CCDS4404.1	5q35.3	2013-01-09			ENSG00000146083	ENSG00000146083		"""RING-type (C3HC4) zinc fingers"""	19180	protein-coding gene	gene with protein product						10470851	Standard	NM_014901		Approved	KIAA1100	uc003mek.1	Q7L0R7	OTTHUMG00000130664	ENST00000274811.4:c.226G>T	chr5.hg19:g.175959076C>A	ENSP00000274811:p.Ala76Ser	219.0	0.0		276.0	83.0	NM_014901	B4DYE0|Q8ND05|Q9UPQ2	Missense_Mutation	SNP	ENST00000274811.4	hg19	CCDS4404.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.932413	0.52866	.	.	ENSG00000146083	ENST00000274811	T	0.29142	1.58	3.98	3.98	0.46160	.	0.133306	0.49305	D	0.000149	T	0.15003	0.0362	N	0.08118	0	0.80722	D	1	B	0.17268	0.021	B	0.14023	0.01	T	0.05338	-1.0891	10	0.52906	T	0.07	-17.2002	7.9028	0.29744	0.0:0.7483:0.163:0.0887	.	76	Q7L0R7	RNF44_HUMAN	S	76	ENSP00000274811:A76S	ENSP00000274811:A76S	A	-	1	0	RNF44	175891682	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.874000	0.28065	2.223000	0.72356	0.561000	0.74099	GCC	.	.		0.706	RNF44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253156.2		
MYLK4	340156	hgsc.bcm.edu	37	6	2678490	2678490	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr6:2678490T>G	ENST00000274643.7	-	10	1346	c.1004A>C	c.(1003-1005)aAg>aCg	p.K335T	MYLK4_ENST00000268446.5_Missense_Mutation_p.K335T	NM_001012418.3	NP_001012418.2	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4	335	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(2)|skin(1)	23	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				GATGAACTCCTTGGCCTCCTC	0.527																																					p.K335T		Atlas-SNP	.											.	MYLK4	74	.	0			c.A1004C						.						184.0	168.0	173.0					6																	2678490		2203	4300	6503	SO:0001583	missense	340156	exon10			AACTCCTTGGCCT		CCDS34330.1	6p25.2	2008-01-23			ENSG00000145949	ENSG00000145949			27972	protein-coding gene	gene with protein product	"""caMLCK like"""						Standard	NM_001012418		Approved	SgK085	uc003mty.4	Q86YV6	OTTHUMG00000014121	ENST00000274643.7:c.1004A>C	chr6.hg19:g.2678490T>G	ENSP00000274643:p.Lys335Thr	100.0	0.0		95.0	33.0	NM_001012418	A2RUC0|Q5TAW2	Missense_Mutation	SNP	ENST00000274643.7	hg19	CCDS34330.1	.	.	.	.	.	.	.	.	.	.	T	19.53	3.845492	0.71603	.	.	ENSG00000145949	ENST00000268446;ENST00000274643	T;T	0.68181	-0.31;-0.31	4.98	-1.76	0.08006	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.643019	0.13476	N	0.385077	T	0.69602	0.3129	M	0.70275	2.135	0.37270	D	0.907372	D	0.71674	0.998	D	0.77004	0.989	T	0.73107	-0.4087	10	0.87932	D	0	.	10.672	0.45764	0.0:0.2057:0.0:0.7943	.	335	Q86YV6	MYLK4_HUMAN	T	335	ENSP00000268446:K335T;ENSP00000274643:K335T	ENSP00000268446:K335T	K	-	2	0	MYLK4	2623489	1.000000	0.71417	0.840000	0.33206	0.899000	0.52679	2.185000	0.42584	-0.162000	0.10964	-0.290000	0.09829	AAG	.	.		0.527	MYLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039632.2	NM_001012418	
REV3L	5980	hgsc.bcm.edu	37	6	111714108	111714108	+	Silent	SNP	T	T	C			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr6:111714108T>C	ENST00000358835.3	-	6	1087	c.633A>G	c.(631-633)ttA>ttG	p.L211L	REV3L_ENST00000435970.1_Silent_p.L133L|REV3L_ENST00000368805.1_Silent_p.L211L|REV3L_ENST00000368802.3_Silent_p.L211L			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	211					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CCCACCGAAATAAAGTATCAG	0.328								DNA polymerases (catalytic subunits)																													p.L211L		Atlas-SNP	.											.	REV3L	386	.	0			c.A633G						.						71.0	71.0	71.0					6																	111714108		2203	4298	6501	SO:0001819	synonymous_variant	5980	exon5			CCGAAATAAAGTA	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.633A>G	chr6.hg19:g.111714108T>C		91.0	0.0		69.0	29.0	NM_002912	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	hg19	CCDS5091.2																																																																																			.	.		0.328	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
AMZ1	155185	hgsc.bcm.edu	37	7	2752261	2752261	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr7:2752261C>A	ENST00000312371.4	+	7	1614	c.1246C>A	c.(1246-1248)Cag>Aag	p.Q416K	AMZ1_ENST00000407112.1_3'UTR|AMZ1_ENST00000489665.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	416							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CATGTGCATCCAGGCCCTGCA	0.687																																					p.Q416K		Atlas-SNP	.											.	AMZ1	41	.	0			c.C1246A						.						41.0	38.0	39.0					7																	2752261		2203	4298	6501	SO:0001583	missense	155185	exon7			TGCATCCAGGCCC	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.1246C>A	chr7.hg19:g.2752261C>A	ENSP00000308149:p.Gln416Lys	80.0	0.0		142.0	47.0	NM_133463	B3KRS0|Q8TF51	Missense_Mutation	SNP	ENST00000312371.4	hg19	CCDS34589.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353370	0.24512	.	.	ENSG00000174945	ENST00000312371	T	0.21932	1.98	4.67	1.27	0.21489	.	0.963974	0.08503	N	0.936061	T	0.16769	0.0403	L	0.48642	1.525	0.80722	D	1	B	0.22003	0.063	B	0.19666	0.026	T	0.13656	-1.0501	10	0.13470	T	0.59	-27.5171	7.0815	0.25234	0.0:0.3477:0.5388:0.1135	.	416	Q400G9	AMZ1_HUMAN	K	416	ENSP00000308149:Q416K	ENSP00000308149:Q416K	Q	+	1	0	AMZ1	2718787	0.046000	0.20272	0.998000	0.56505	0.537000	0.34900	0.991000	0.29654	0.910000	0.36722	0.462000	0.41574	CAG	.	.		0.687	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325244.1	NM_133463	
NME8	51314	hgsc.bcm.edu	37	7	37903054	37903054	+	Silent	SNP	T	T	C			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr7:37903054T>C	ENST00000199447.4	+	8	816	c.444T>C	c.(442-444)tgT>tgC	p.C148C	NME8_ENST00000440017.1_Silent_p.C148C|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	148					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										AATCACCATGTGAAAGTGTTC	0.358																																					p.C148C		Atlas-SNP	.											.	.	.	.	0			c.T444C						.						105.0	110.0	108.0					7																	37903054		2203	4300	6503	SO:0001819	synonymous_variant	51314	exon8			ACCATGTGAAAGT	AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.444T>C	chr7.hg19:g.37903054T>C		63.0	0.0		55.0	25.0	NM_016616	Q9NZH1	Silent	SNP	ENST00000199447.4	hg19	CCDS5452.1																																																																																			.	.		0.358	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
HIPK2	28996	hgsc.bcm.edu	37	7	139281611	139281611	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr7:139281611A>T	ENST00000406875.3	-	12	2663	c.2569T>A	c.(2569-2571)Tgt>Agt	p.C857S	HIPK2_ENST00000428878.2_Missense_Mutation_p.C830S|HIPK2_ENST00000342645.6_Intron	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	857	Interaction with CTBP1. {ECO:0000250}.|Interaction with HMGA1. {ECO:0000250}.|Interaction with POU4F1. {ECO:0000250}.|Interaction with TP53 and TP73.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CCCCACCCACAGGTGACCGAG	0.652																																					p.C857S		Atlas-SNP	.											.	HIPK2	192	.	0			c.T2569A						.						54.0	61.0	59.0					7																	139281611		2176	4275	6451	SO:0001583	missense	28996	exon12			ACCCACAGGTGAC	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.2569T>A	chr7.hg19:g.139281611A>T	ENSP00000385571:p.Cys857Ser	55.0	0.0		58.0	30.0	NM_022740	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	hg19		.	.	.	.	.	.	.	.	.	.	A	7.417	0.635945	0.14386	.	.	ENSG00000064393	ENST00000406875;ENST00000428878	T;T	0.19394	2.15;2.15	5.49	5.49	0.81192	.	.	.	.	.	T	0.09686	0.0238	.	.	.	0.48632	D	0.999688	P;B	0.42827	0.791;0.218	B;B	0.29785	0.107;0.059	T	0.17561	-1.0365	8	0.07325	T	0.83	.	15.7597	0.78070	1.0:0.0:0.0:0.0	.	857;830	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	S	857;830	ENSP00000385571:C857S;ENSP00000413724:C830S	ENSP00000385571:C857S	C	-	1	0	HIPK2	138932151	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	5.350000	0.66016	2.304000	0.77564	0.528000	0.53228	TGT	.	.		0.652	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
ATP6V0E2	155066	hgsc.bcm.edu	37	7	149571165	149571165	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr7:149571165A>G	ENST00000425642.2	+	1	34	c.11A>G	c.(10-12)cAc>cGc	p.H4R	ATP6V0E2_ENST00000479613.1_Missense_Mutation_p.H4R|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2_ENST00000464662.1_Missense_Mutation_p.H4R|ATP6V0E2_ENST00000421974.2_Missense_Mutation_p.H53R|ATP6V0E2-AS1_ENST00000488315.1_RNA|ATP6V0E2_ENST00000606024.1_Missense_Mutation_p.H4R|ATP6V0E2_ENST00000456496.2_Missense_Mutation_p.H53R|ATP6V0E2-AS1_ENST00000464939.1_RNA			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2	4					ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			ATGACGGCGCACTCATTCGCC	0.711																																					p.H53R		Atlas-SNP	.											.	ATP6V0E2	12	.	0			c.A158G						.						7.0	10.0	9.0					7																	149571165		1721	3443	5164	SO:0001583	missense	155066	exon1			CGGCGCACTCATT	AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000425642.2:c.11A>G	chr7.hg19:g.149571165A>G	ENSP00000396148:p.His4Arg	105.0	0.0		105.0	46.0	NM_001100592	A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Missense_Mutation	SNP	ENST00000425642.2	hg19		.	.	.	.	.	.	.	.	.	.	A	26.7	4.762001	0.89932	.	.	ENSG00000171130	ENST00000421974;ENST00000456496;ENST00000425642;ENST00000479613	.	.	.	5.7	4.54	0.55810	.	.	.	.	.	T	0.54013	0.1832	N	0.19112	0.55	0.40088	D	0.976219	D;P;B	0.89917	1.0;0.748;0.17	D;P;B	0.69307	0.963;0.611;0.035	T	0.58423	-0.7639	8	0.72032	D	0.01	-5.9164	9.0551	0.36401	0.8362:0.0:0.0:0.1638	.	53;4;4	E9PAS2;Q8NHE4-3;Q8NHE4	.;.;VA0E2_HUMAN	R	53;53;4;4	.	ENSP00000411672:H53R	H	+	2	0	ATP6V0E2	149202098	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	3.626000	0.54245	0.970000	0.38263	0.460000	0.39030	CAC	.	.		0.711	ATP6V0E2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470874.1	NM_145230	
DLGAP2	9228	hgsc.bcm.edu	37	8	1616621	1616621	+	Missense_Mutation	SNP	G	G	A	rs200214556	byFrequency	TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr8:1616621G>A	ENST00000421627.2	+	6	1831	c.1697G>A	c.(1696-1698)cGc>cAc	p.R566H		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	645					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CAGGACAGCCGCGCACAGAGG	0.672													G|||	3	0.000599042	0.0008	0.0	5008	,	,		14006	0.0		0.0	False		,,,				2504	0.002				p.R566H		Atlas-SNP	.											.	DLGAP2	292	.	0			c.G1697A						.	G	HIS/ARG	12,4090		0,12,2039	13.0	18.0	16.0		1697	5.3	1.0	8		16	0,8366		0,0,4183	yes	missense	DLGAP2	NM_004745.3	29	0,12,6222	AA,AG,GG		0.0,0.2925,0.0962	probably-damaging	566/976	1616621	12,12456	2051	4183	6234	SO:0001583	missense	9228	exon6			ACAGCCGCGCACA	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1697G>A	chr8.hg19:g.1616621G>A	ENSP00000400258:p.Arg566His	217.0	0.0		138.0	6.0	NM_004745	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	ENST00000421627.2	hg19	CCDS47760.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.633499|4.633499	0.87660|0.87660	0.002925|0.002925	0.0|0.0	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|T	.|0.22539	.|1.95	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.43344|0.43344	0.1243|0.1243	L|L	0.60455|0.60455	1.87|1.87	0.43435|0.43435	D|D	0.995607|0.995607	.|D;D	.|0.71674	.|0.998;0.992	.|D;P	.|0.64595	.|0.927;0.799	T|T	0.21895|0.21895	-1.0232|-1.0232	5|10	.|0.52906	.|T	.|0.07	-7.4578|-7.4578	19.0005|19.0005	0.92832|0.92832	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|645;645	.|Q9P1A6-2;Q9P1A6	.|.;DLGP2_HUMAN	T|H	583|611;566	.|ENSP00000400258:R566H	.|ENSP00000348366:R611H	A|R	+|+	1|2	0|0	DLGAP2|DLGAP2	1604028|1604028	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.958000|0.958000	0.62258|0.62258	6.266000|6.266000	0.72540|0.72540	2.483000|2.483000	0.83821|0.83821	0.655000|0.655000	0.94253|0.94253	GCG|CGC	.	.		0.672	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374478.1	NM_004745	
HR	55806	hgsc.bcm.edu	37	8	21984727	21984727	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr8:21984727C>A	ENST00000381418.4	-	3	2708	c.1228G>T	c.(1228-1230)Gcc>Tcc	p.A410S	HR_ENST00000312841.8_Missense_Mutation_p.A410S	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	410					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		CTTTTGAGGGCCCGGAGCCGA	0.657																																					p.A410S		Atlas-SNP	.											.	HR	71	.	0			c.G1228T						.						52.0	63.0	60.0					8																	21984727		2202	4297	6499	SO:0001583	missense	55806	exon3			TGAGGGCCCGGAG	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.1228G>T	chr8.hg19:g.21984727C>A	ENSP00000370826:p.Ala410Ser	53.0	0.0		49.0	35.0	NM_018411	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	hg19	CCDS6022.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.755439	0.31046	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.73363	-0.73;-0.74	5.63	-0.0146	0.13980	.	0.607709	0.15479	N	0.260191	T	0.50137	0.1598	N	0.20986	0.625	0.18873	N	0.999983	B;B	0.20671	0.047;0.028	B;B	0.21360	0.034;0.015	T	0.21621	-1.0240	10	0.13470	T	0.59	-3.5287	2.275	0.04100	0.1411:0.487:0.1244:0.2475	.	410;410	O43593-2;O43593	.;HAIR_HUMAN	S	410	ENSP00000370826:A410S;ENSP00000326765:A410S	ENSP00000326765:A410S	A	-	1	0	HR	22040672	0.134000	0.22483	0.373000	0.26003	0.813000	0.45954	0.268000	0.18571	0.056000	0.16144	-0.244000	0.11960	GCC	.	.		0.657	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
JRK	8629	hgsc.bcm.edu	37	8	143746089	143746089	+	RNA	SNP	A	A	C	rs559317070|rs33951456		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr8:143746089A>C	ENST00000507178.2	-	0	1721							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				tctgaactccacacacaacct	0.682																																					.		Atlas-SNP	.											.	.	.	.	0			c.1388+1T>G						.						3.0	3.0	3.0					8																	143746089		1561	3375	4936			8629	exon3			AACTCCACACACA	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			chr8.hg19:g.143746089A>C		5.0	0.0		8.0	4.0	NM_001077527	O75565	Splice_Site	SNP	ENST00000507178.2	hg19																																																																																				.	.		0.682	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724	
CYP11B2	1585	hgsc.bcm.edu	37	8	143996509	143996509	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr8:143996509C>T	ENST00000323110.2	-	3	550	c.548G>A	c.(547-549)aGc>aAc	p.S183N		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	183					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CAGGGTCAGGCTCCCCCGGGC	0.642									Familial Hyperaldosteronism type I																												p.S183N		Atlas-SNP	.											.	CYP11B2	107	.	0			c.G548A						.						48.0	45.0	46.0					8																	143996509		2203	4296	6499	SO:0001583	missense	1585	exon3	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GTCAGGCTCCCCC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.548G>A	chr8.hg19:g.143996509C>T	ENSP00000325822:p.Ser183Asn	143.0	0.0		132.0	61.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	hg19	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	13.74	2.327623	0.41197	.	.	ENSG00000179142	ENST00000323110	T	0.69040	-0.37	3.44	2.46	0.29980	.	0.340584	0.25117	N	0.033015	T	0.62490	0.2432	M	0.69523	2.12	0.31950	N	0.609855	P	0.36837	0.571	B	0.38921	0.285	T	0.67883	-0.5555	10	0.35671	T	0.21	.	8.8722	0.35323	0.0:0.6266:0.3734:0.0	.	183	P19099	C11B2_HUMAN	N	183	ENSP00000325822:S183N	ENSP00000325822:S183N	S	-	2	0	CYP11B2	143993511	0.001000	0.12720	0.793000	0.32043	0.175000	0.22909	0.364000	0.20325	1.910000	0.55303	0.561000	0.74099	AGC	.	.		0.642	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
C5	727	hgsc.bcm.edu	37	9	123777539	123777539	+	Splice_Site	SNP	T	T	C			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr9:123777539T>C	ENST00000223642.1	-	16	2026	c.1997A>G	c.(1996-1998)gAt>gGt	p.D666G		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	666					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	ACAAGGTTCATCTGGTTTTTT	0.294																																					p.D666G		Atlas-SNP	.											.	C5	124	.	0			c.A1997G						.						111.0	105.0	107.0					9																	123777539		2202	4295	6497	SO:0001630	splice_region_variant	727	exon16			GGTTCATCTGGTT	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.1997-1A>G	chr9.hg19:g.123777539T>C		35.0	0.0		34.0	10.0	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	hg19	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	T	3.528	-0.096269	0.07010	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.34072	1.38	5.95	4.81	0.61882	.	1.003860	0.08008	N	0.989950	T	0.34135	0.0887	L	0.53780	1.695	0.35623	D	0.809571	B;B	0.15141	0.003;0.012	B;B	0.13407	0.001;0.009	T	0.21965	-1.0230	10	0.18276	T	0.48	.	8.5955	0.33712	0.0:0.0861:0.0:0.9139	.	737;666	Q59GS8;P01031	.;CO5_HUMAN	G	666;737	ENSP00000223642:D666G	ENSP00000223642:D666G	D	-	2	0	C5	122817360	0.997000	0.39634	0.985000	0.45067	0.040000	0.13550	2.446000	0.44908	1.078000	0.41014	0.460000	0.39030	GAT	.	.		0.294	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	Missense_Mutation
C9orf139	401563	hgsc.bcm.edu	37	9	139927656	139927656	+	Silent	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr9:139927656C>T	ENST00000314330.2	+	2	1655	c.141C>T	c.(139-141)gaC>gaT	p.D47D	FUT7_ENST00000314412.6_5'Flank	NM_207511.1	NP_997394.1	Q6ZV77	CI139_HUMAN	chromosome 9 open reading frame 139	47										cervix(1)|lung(2)	3	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.99e-05)|Epithelial(140;0.000493)		CGTGGCCAGACCCAGACGTCC	0.562																																					p.D47D		Atlas-SNP	.											.	C9orf139	12	.	0			c.C141T						.						137.0	116.0	123.0					9																	139927656		2203	4297	6500	SO:0001819	synonymous_variant	401563	exon2			GCCAGACCCAGAC		CCDS7023.1	9q34.3	2008-02-05			ENSG00000180539	ENSG00000180539			31426	protein-coding gene	gene with protein product							Standard	NM_207511		Approved	FLJ36268, FLJ42909	uc004ckp.1	Q6ZV77	OTTHUMG00000020959	ENST00000314330.2:c.141C>T	chr9.hg19:g.139927656C>T		88.0	0.0		80.0	31.0	NM_207511	A2RUA3|B9EGW2|Q5SPY0|Q8N224	Silent	SNP	ENST00000314330.2	hg19	CCDS7023.1																																																																																			.	.		0.562	C9orf139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055213.2	NM_207511	
CFAP70	118491	hgsc.bcm.edu	37	10	75071614	75071614	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr10:75071614A>T	ENST00000310715.3	-	12	1472	c.1352T>A	c.(1351-1353)cTa>cAa	p.L451Q	TTC18_ENST00000401621.2_Missense_Mutation_p.L451Q|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000340329.3_Intron|TTC18_ENST00000355577.3_5'UTR|TTC18_ENST00000394865.1_Missense_Mutation_p.L451Q	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		451						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					ATTGTGACTTAGAGGGGGTTC	0.373																																					p.L451Q		Atlas-SNP	.											.	TTC18	106	.	0			c.T1352A						.						160.0	172.0	168.0					10																	75071614		2203	4300	6503	SO:0001583	missense	118491	exon12			TGACTTAGAGGGG																												ENST00000310715.3:c.1352T>A	chr10.hg19:g.75071614A>T	ENSP00000310829:p.Leu451Gln	91.0	0.0		97.0	41.0	NM_145170	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	ENST00000310715.3	hg19	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	A	11.88	1.772145	0.31411	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000372928;ENST00000394865	D;D;D	0.93133	-3.17;-3.17;-3.17	4.72	2.35	0.29111	.	1.147620	0.06565	N	0.747447	D	0.90266	0.6956	L	0.28274	0.84	0.09310	N	1	P;P	0.47604	0.898;0.71	P;B	0.51355	0.667;0.372	T	0.79057	-0.1959	10	0.13853	T	0.58	-13.7468	6.2397	0.20783	0.7909:0.0:0.2091:0.0	.	451;451	Q5T0N1-2;Q5T0N1	.;TTC18_HUMAN	Q	451	ENSP00000310829:L451Q;ENSP00000384479:L451Q;ENSP00000378334:L451Q	ENSP00000310829:L451Q	L	-	2	0	TTC18	74741620	0.006000	0.16342	0.001000	0.08648	0.412000	0.31113	0.135000	0.15952	0.196000	0.20367	0.460000	0.39030	CTA	.	.		0.373	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ERC1	23085	hgsc.bcm.edu	37	12	1192720	1192720	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr12:1192720G>A	ENST00000397203.2	+	3	1466	c.1060G>A	c.(1060-1062)Gaa>Aaa	p.E354K	ERC1_ENST00000589028.1_Missense_Mutation_p.E354K|ERC1_ENST00000360905.4_Missense_Mutation_p.E354K|ERC1_ENST00000543086.3_Missense_Mutation_p.E354K|ERC1_ENST00000546231.2_Missense_Mutation_p.E354K|ERC1_ENST00000355446.5_Missense_Mutation_p.E354K			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	354					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GGAGCAGAAGGAAAAAGAGAA	0.418																																					p.E354K		Atlas-SNP	.											.	ERC1	95	.	0			c.G1060A						.						96.0	91.0	93.0					12																	1192720		2203	4300	6503	SO:0001583	missense	23085	exon3			CAGAAGGAAAAAG	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.1060G>A	chr12.hg19:g.1192720G>A	ENSP00000380386:p.Glu354Lys	80.0	0.0		82.0	32.0	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	hg19	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294827	0.81025	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000543086;ENST00000542302;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.56	5.56	0.83823	.	0.147026	0.64402	D	0.000009	T	0.58018	0.2093	L	0.52573	1.65	0.80722	D	1	P;B;P;P	0.45768	0.855;0.338;0.804;0.866	P;B;B;P	0.47430	0.547;0.115;0.229;0.489	T	0.54754	-0.8246	10	0.39692	T	0.17	-19.9041	19.8756	0.96869	0.0:0.0:1.0:0.0	.	130;354;354;354	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	K	354;354;354;354;354;354;354;354;354;354;130	ENSP00000340054:E354K;ENSP00000380386:E354K;ENSP00000438546:E354K;ENSP00000445336:E354K;ENSP00000442739:E354K;ENSP00000347621:E354K;ENSP00000354158:E354K;ENSP00000410064:E354K	ENSP00000340054:E354K	E	+	1	0	ERC1	1062981	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	9.810000	0.99221	2.768000	0.95171	0.655000	0.94253	GAA	.	.		0.418	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
KLRC4	8302	hgsc.bcm.edu	37	12	10560370	10560370	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr12:10560370C>T	ENST00000309384.1	-	4	540	c.359G>A	c.(358-360)tGt>tAt	p.C120Y	KLRC4-KLRK1_ENST00000539300.1_Silent_p.L111L	NM_013431.2	NP_038459.1	O43908	NKG2F_HUMAN	killer cell lectin-like receptor subfamily C, member 4	120					cellular defense response (GO:0006968)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						CTCCTCAGGACAATGGCCACA	0.323																																					p.C120Y		Atlas-SNP	.											.	KLRC4	23	.	0			c.G359A						.						146.0	146.0	146.0					12																	10560370		2203	4300	6503	SO:0001583	missense	8302	exon4			TCAGGACAATGGC	U96846	CCDS8624.1	12p13.2-p12.3	2008-08-05			ENSG00000183542	ENSG00000183542		"""Killer cell lectin-like receptors"""	6377	protein-coding gene	gene with protein product		602893				9598306	Standard	NM_013431		Approved	NKG2-F	uc001qye.3	O43908	OTTHUMG00000168575	ENST00000309384.1:c.359G>A	chr12.hg19:g.10560370C>T	ENSP00000310216:p.Cys120Tyr	232.0	0.0		181.0	75.0	NM_013431	O60851	Missense_Mutation	SNP	ENST00000309384.1	hg19	CCDS8624.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.669016	0.47677	.	.	ENSG00000183542	ENST00000309384	T	0.38887	1.11	4.1	4.1	0.47936	C-type lectin fold (1);C-type lectin-like (1);	0.124113	0.37623	N	0.002015	T	0.66127	0.2758	M	0.85041	2.73	0.36455	D	0.86631	D	0.89917	1.0	D	0.91635	0.999	T	0.76534	-0.2924	10	0.66056	D	0.02	.	12.5279	0.56098	0.0:1.0:0.0:0.0	.	120	O43908	NKG2F_HUMAN	Y	120	ENSP00000310216:C120Y	ENSP00000310216:C120Y	C	-	2	0	KLRC4	10451637	0.979000	0.34478	0.326000	0.25389	0.048000	0.14542	1.480000	0.35464	2.204000	0.70986	0.585000	0.79938	TGT	.	.		0.323	KLRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400108.1	NM_013431	
RERG	85004	hgsc.bcm.edu	37	12	15262379	15262379	+	Silent	SNP	G	G	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr12:15262379G>T	ENST00000256953.2	-	5	601	c.265C>A	c.(265-267)Cga>Aga	p.R89R	RERG_ENST00000546331.1_Silent_p.R70R|RERG_ENST00000538313.1_Silent_p.R89R|RERG_ENST00000536465.1_Silent_p.R89R|RERG-IT1_ENST00000539734.1_RNA	NM_032918.2	NP_116307.1	Q96A58	RERG_HUMAN	RAS-like, estrogen-regulated, growth inhibitor	89					negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to hormone (GO:0009725)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	estrogen receptor binding (GO:0030331)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R89R(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16						AAACTTCCTCGGTCAGTAATG	0.473																																					p.R89R		Atlas-SNP	.											.	RERG	30	.	1	Substitution - coding silent(1)	lung(1)	c.C265A						.						322.0	326.0	324.0					12																	15262379		2203	4300	6503	SO:0001819	synonymous_variant	85004	exon5			TTCCTCGGTCAGT	AF339750	CCDS8673.1, CCDS53753.1	12p13.1	2014-05-09			ENSG00000134533	ENSG00000134533			15980	protein-coding gene	gene with protein product		612664				11533059	Standard	NM_032918		Approved	MGC15754	uc001rct.3	Q96A58	OTTHUMG00000168745	ENST00000256953.2:c.265C>A	chr12.hg19:g.15262379G>T		130.0	0.0		113.0	5.0	NM_032918	B2R9R0|B4DI02	Silent	SNP	ENST00000256953.2	hg19	CCDS8673.1																																																																																			.	.		0.473	RERG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400882.1	NM_032918	
DCD	117159	hgsc.bcm.edu	37	12	55038527	55038527	+	Silent	SNP	G	G	A	rs373661792		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr12:55038527G>A	ENST00000293371.6	-	5	492	c.303C>T	c.(301-303)gaC>gaT	p.D101D	DCD_ENST00000456047.2_3'UTR	NM_053283.2	NP_444513.1	P81605	DCD_HUMAN	dermcidin	101					defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(1001;0.0255)				CGTCTTTAACGTCATGGACGG	0.468																																					p.D101D		Atlas-SNP	.											.	DCD	20	.	0			c.C303T						.	G		0,4406		0,0,2203	35.0	30.0	32.0		303	-3.1	0.0	12		32	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	DCD	NM_053283.2		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		101/111	55038527	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	117159	exon5			TTTAACGTCATGG	AF144011	CCDS8884.1, CCDS73478.1	12q13.1	2008-08-04				ENSG00000161634			14669	protein-coding gene	gene with protein product	"""proteolysis inducing factor"", ""preproteolysin"", ""diffusible survival/evasion peptide"", ""survival promoting peptide"""	606634				11694882	Standard	XM_005268627		Approved	AIDD, PIF, DSEP, HCAP, DCD-1	uc001sgj.3	P81605	OTTHUMG00000169937	ENST00000293371.6:c.303C>T	chr12.hg19:g.55038527G>A		448.0	1.0		373.0	159.0	NM_053283	A5JHP2|A5JHP3|P58461|Q53YJ2	Silent	SNP	ENST00000293371.6	hg19	CCDS8884.1																																																																																			.	.		0.468	DCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406617.1	NM_053283	
HECTD4	283450	hgsc.bcm.edu	37	12	112673432	112673432	+	Silent	SNP	G	G	A	rs373022791		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr12:112673432G>A	ENST00000430131.2	-	35	5480	c.4335C>T	c.(4333-4335)aaC>aaT	p.N1445N	HECTD4_ENST00000550722.1_Silent_p.N1721N|HECTD4_ENST00000377560.5_Silent_p.N1695N			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1445					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGAGCTCCACGTTTCCACAGT	0.587																																					p.N1733N		Atlas-SNP	.											.	.	.	.	0			c.C5199T						.	G		0,3928		0,0,1964	50.0	52.0	51.0		5085	-10.0	0.1	12		51	1,8321		0,1,4160	no	coding-synonymous	C12orf51	NM_001109662.2		0,1,6124	AA,AG,GG		0.012,0.0,0.0082		1695/4247	112673432	1,12249	1964	4161	6125	SO:0001819	synonymous_variant	283450	exon36			CTCCACGTTTCCA	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4335C>T	chr12.hg19:g.112673432G>A		110.0	0.0		115.0	43.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	hg19																																																																																				.	.		0.587	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
GALNT9	50614	hgsc.bcm.edu	37	12	132685703	132685703	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr12:132685703A>G	ENST00000328957.8	-	8	1366	c.1367T>C	c.(1366-1368)aTg>aCg	p.M456T	GALNT9_ENST00000535228.1_Missense_Mutation_p.M207T|GALNT9_ENST00000541995.1_Missense_Mutation_p.M90T|GALNT9_ENST00000397325.2_Missense_Mutation_p.M90T	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	456					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		GTAGACCCTCATCTCCGGGTA	0.622																																					p.M456T	Colon(186;2147 2752 13553 41466)	Atlas-SNP	.											.	GALNT9	74	.	0			c.T1367C						.						79.0	95.0	89.0					12																	132685703		2138	4246	6384	SO:0001583	missense	50614	exon8			ACCCTCATCTCCG	AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.1367T>C	chr12.hg19:g.132685703A>G	ENSP00000329846:p.Met456Thr	94.0	0.0		50.0	21.0	NM_001122636	Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	ENST00000328957.8	hg19		.	.	.	.	.	.	.	.	.	.	a	21.3	4.130097	0.77549	.	.	ENSG00000182870	ENST00000397325;ENST00000328957;ENST00000535228;ENST00000541995;ENST00000538356	T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56	4.39	4.39	0.52855	Ricin B-related lectin (1);	0.000000	0.85682	D	0.000000	T	0.80237	0.4586	M	0.63843	1.955	0.80722	D	1	D;D;D	0.63046	0.992;0.992;0.992	P;D;P	0.65573	0.882;0.936;0.882	T	0.81609	-0.0855	10	0.54805	T	0.06	.	13.5816	0.61907	1.0:0.0:0.0:0.0	.	207;456;313	B3KNR7;Q9HCQ5;B3KP58	.;GALT9_HUMAN;.	T	90;456;207;90;90	ENSP00000380488:M90T;ENSP00000329846:M456T;ENSP00000439745:M207T;ENSP00000440544:M90T;ENSP00000444709:M90T	ENSP00000329846:M456T	M	-	2	0	GALNT9	131251656	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.034000	0.93747	1.599000	0.50093	0.379000	0.24179	ATG	.	.		0.622	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000402967.1	NM_001122636	
NPAS3	64067	hgsc.bcm.edu	37	14	34269678	34269678	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr14:34269678A>T	ENST00000356141.4	+	12	2165	c.2165A>T	c.(2164-2166)gAc>gTc	p.D722V	NPAS3_ENST00000357798.5_Missense_Mutation_p.D709V|NPAS3_ENST00000551492.1_Missense_Mutation_p.D727V|NPAS3_ENST00000346562.2_Missense_Mutation_p.D690V|NPAS3_ENST00000548645.1_Missense_Mutation_p.D692V			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	722	Gly-rich.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		cccggcgccgacggcgcggcc	0.801																																					p.D722V		Atlas-SNP	.											.	NPAS3	266	.	0			c.A2165T						.						2.0	3.0	3.0					14																	34269678		915	2172	3087	SO:0001583	missense	64067	exon12			GCGCCGACGGCGC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2165A>T	chr14.hg19:g.34269678A>T	ENSP00000348460:p.Asp722Val	37.0	0.0		42.0	16.0	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	hg19	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	A	11.05	1.523546	0.27299	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.07216	3.47;3.35;3.35;3.35;3.35;3.21	4.74	4.74	0.60224	.	0.125026	0.51477	D	0.000092	T	0.06005	0.0156	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.17038	0.02;0.012;0.02;0.02	B;B;B;B	0.21360	0.034;0.015;0.034;0.034	T	0.25779	-1.0122	10	0.72032	D	0.01	.	10.5429	0.45043	0.838:0.162:0.0:0.0	.	692;722;690;709	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	V	696;727;690;692;722;709	ENSP00000448373:D696V;ENSP00000450392:D727V;ENSP00000319610:D690V;ENSP00000448916:D692V;ENSP00000348460:D722V;ENSP00000350446:D709V	ENSP00000319610:D690V	D	+	2	0	NPAS3	33339429	1.000000	0.71417	0.994000	0.49952	0.663000	0.39108	6.102000	0.71486	1.977000	0.57605	0.454000	0.30748	GAC	.	.		0.801	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
SPATA7	55812	hgsc.bcm.edu	37	14	88857757	88857757	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr14:88857757C>G	ENST00000393545.4	+	2	341	c.52C>G	c.(52-54)Cca>Gca	p.P18A	SPATA7_ENST00000045347.7_Missense_Mutation_p.P18A|SPATA7_ENST00000554102.1_3'UTR|SPATA7_ENST00000356583.5_Missense_Mutation_p.P18A|SPATA7_ENST00000556553.1_Missense_Mutation_p.P18A	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	18					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						CAGATATGGTCCACCGTGCCT	0.353																																					p.P18A		Atlas-SNP	.											.	SPATA7	58	.	0			c.C52G						.						87.0	79.0	82.0					14																	88857757		2203	4300	6503	SO:0001583	missense	55812	exon2			TATGGTCCACCGT	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.52C>G	chr14.hg19:g.88857757C>G	ENSP00000377176:p.Pro18Ala	72.0	0.0		69.0	28.0	NM_018418	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	ENST00000393545.4	hg19	CCDS9883.1	.	.	.	.	.	.	.	.	.	.	C	9.058	0.993818	0.19043	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583;ENST00000553885;ENST00000045347	T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17	4.97	1.03	0.20045	.	0.664046	0.14047	N	0.345003	T	0.12774	0.0310	L	0.38838	1.175	0.30610	N	0.759624	B;B	0.30281	0.129;0.275	B;B	0.26202	0.067;0.046	T	0.17048	-1.0382	10	0.45353	T	0.12	-1.7177	2.7024	0.05153	0.1501:0.5421:0.145:0.1628	.	18;18	Q9P0W8-2;Q9P0W8	.;SPAT7_HUMAN	A	18	ENSP00000451128:P18A;ENSP00000377176:P18A;ENSP00000348991:P18A;ENSP00000450606:P18A;ENSP00000045347:P18A	ENSP00000045347:P18A	P	+	1	0	SPATA7	87927510	0.999000	0.42202	0.298000	0.25002	0.956000	0.61745	0.795000	0.26972	-0.014000	0.14175	0.585000	0.79938	CCA	.	.		0.353	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
IL21R	50615	hgsc.bcm.edu	37	16	27460045	27460045	+	Missense_Mutation	SNP	C	C	T	rs550842554		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr16:27460045C>T	ENST00000337929.3	+	9	1531	c.1058C>T	c.(1057-1059)cCg>cTg	p.P353L	IL21R_ENST00000564089.1_Missense_Mutation_p.P353L|IL21R_ENST00000395754.4_Missense_Mutation_p.P353L|IL21R_ENST00000395755.1_Missense_Mutation_p.P353L|IL21R-AS1_ENST00000563191.1_RNA	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	353					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						AGCTTCTGGCCGACAGCCCAG	0.627			T	BCL6	NHL								C|||	1	0.000199681	0.0008	0.0	5008	,	,		19549	0.0		0.0	False		,,,				2504	0.0				p.P375L		Atlas-SNP	.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	95	.	0			c.C1124T						.						49.0	49.0	49.0					16																	27460045		2197	4300	6497	SO:0001583	missense	50615	exon10			TCTGGCCGACAGC	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1058C>T	chr16.hg19:g.27460045C>T	ENSP00000338010:p.Pro353Leu	167.0	0.0		133.0	10.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	hg19	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	C	8.579	0.881907	0.17467	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.34072	1.38;1.38;1.38	3.56	0.452	0.16634	.	2.565700	0.01028	N	0.004085	T	0.24736	0.0600	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.05699	-1.0869	10	0.10636	T	0.68	3.1814	1.662	0.02794	0.1526:0.346:0.3517:0.1497	.	353	Q9HBE5	IL21R_HUMAN	L	353	ENSP00000338010:P353L;ENSP00000379104:P353L;ENSP00000379103:P353L	ENSP00000338010:P353L	P	+	2	0	IL21R	27367546	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.039000	0.13884	0.137000	0.18759	0.561000	0.74099	CCG	.	.		0.627	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
PLEKHG4	25894	hgsc.bcm.edu	37	16	67319052	67319052	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr16:67319052G>A	ENST00000360461.5	+	12	4664	c.2129G>A	c.(2128-2130)gGt>gAt	p.G710D	PLEKHG4_ENST00000379344.3_Missense_Mutation_p.G710D|PLEKHG4_ENST00000450733.1_Missense_Mutation_p.G629D|PLEKHG4_ENST00000427155.2_Missense_Mutation_p.G710D	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	710							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		GCTGGAGGAGGTGCCCTGCCC	0.642																																					p.G710D		Atlas-SNP	.											.	PLEKHG4	94	.	0			c.G2129A						.						21.0	22.0	22.0					16																	67319052		2193	4292	6485	SO:0001583	missense	25894	exon13			GAGGAGGTGCCCT	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.2129G>A	chr16.hg19:g.67319052G>A	ENSP00000353646:p.Gly710Asp	39.0	0.0		55.0	21.0	NM_001129728	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	hg19	CCDS32466.1	.	.	.	.	.	.	.	.	.	.	G	9.051	0.992011	0.18966	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.10005	2.92;2.92;2.92;2.96	4.34	2.34	0.29019	.	0.000000	0.34002	N	0.004357	T	0.06371	0.0164	L	0.34521	1.04	0.09310	N	1	B;B	0.30281	0.275;0.079	B;B	0.26202	0.067;0.021	T	0.37454	-0.9705	10	0.10636	T	0.68	.	7.4781	0.27390	0.2075:0.0:0.7925:0.0	.	629;710	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	D	710;710;710;629	ENSP00000353646:G710D;ENSP00000401118:G710D;ENSP00000368649:G710D;ENSP00000398030:G629D	ENSP00000353646:G710D	G	+	2	0	PLEKHG4	65876553	0.008000	0.16893	0.894000	0.35097	0.212000	0.24457	0.951000	0.29135	0.957000	0.37930	-0.258000	0.10820	GGT	.	.		0.642	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
ZNF397	84307	hgsc.bcm.edu	37	18	32823230	32823230	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr18:32823230T>A	ENST00000330501.7	+	3	682	c.529T>A	c.(529-531)Tgg>Agg	p.W177R	ZNF397_ENST00000592264.1_Missense_Mutation_p.W177R|ZNF397_ENST00000589420.1_3'UTR|ZNF397_ENST00000355632.4_Missense_Mutation_p.W177R|ZNF397_ENST00000261333.6_Missense_Mutation_p.W177R|ZNF397_ENST00000591206.1_Missense_Mutation_p.W177R|ZNF397_ENST00000585800.1_Missense_Mutation_p.W177R	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	177					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						GCTGAAATCCTGGAAACCATG	0.458																																					p.W177R		Atlas-SNP	.											.	ZNF397	51	.	0			c.T529A						.						119.0	113.0	115.0					18																	32823230		2203	4300	6503	SO:0001583	missense	84307	exon3			AAATCCTGGAAAC	BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.529T>A	chr18.hg19:g.32823230T>A	ENSP00000331577:p.Trp177Arg	120.0	0.0		109.0	44.0	NM_032347	Q9BRM2	Missense_Mutation	SNP	ENST00000330501.7	hg19	CCDS45852.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.546111	0.27652	.	.	ENSG00000186812	ENST00000261333;ENST00000330501;ENST00000355632	T;T;T	0.06449	4.39;3.3;4.33	4.79	2.13	0.27403	.	.	.	.	.	T	0.04588	0.0125	L	0.34521	1.04	0.29832	N	0.829952	B;B;B;B	0.31459	0.014;0.001;0.324;0.324	B;B;B;B	0.31686	0.011;0.001;0.134;0.053	T	0.34079	-0.9843	9	0.17832	T	0.49	.	4.8934	0.13738	0.1884:0.0:0.1959:0.6157	.	177;177;177;177	Q96K65;Q8NF99;Q8NF99-2;Q8NF99-3	.;ZN397_HUMAN;.;.	R	177	ENSP00000261333:W177R;ENSP00000331577:W177R;ENSP00000347850:W177R	ENSP00000261333:W177R	W	+	1	0	ZNF397	31077228	0.992000	0.36948	0.998000	0.56505	0.976000	0.68499	0.959000	0.29240	0.887000	0.36136	0.477000	0.44152	TGG	.	.		0.458	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442398.1	NM_032347	
DNMT1	1786	hgsc.bcm.edu	37	19	10248604	10248604	+	Silent	SNP	T	T	G			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr19:10248604T>G	ENST00000340748.4	-	35	4384	c.4149A>C	c.(4147-4149)gcA>gcC	p.A1383A	DNMT1_ENST00000540357.1_Silent_p.A1383A|DNMT1_ENST00000359526.4_Silent_p.A1399A|DNMT1_ENST00000589538.1_5'Flank			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	1383	Catalytic.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	AGATCTCCAGTGCCGAGGCTC	0.617																																					p.A1399A		Atlas-SNP	.											.	DNMT1	148	.	0			c.A4197C						.						67.0	50.0	56.0					19																	10248604		2203	4300	6503	SO:0001819	synonymous_variant	1786	exon36			CTCCAGTGCCGAG	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.4149A>C	chr19.hg19:g.10248604T>G		56.0	0.0		99.0	39.0	NM_001130823	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	ENST00000340748.4	hg19	CCDS12228.1																																																																																			.	.		0.617	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	
IL12RB1	3594	hgsc.bcm.edu	37	19	18174687	18174687	+	Splice_Site	SNP	G	G	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr19:18174687G>A	ENST00000600835.2	-	14	1915	c.1617C>T	c.(1615-1617)atC>atT	p.I539I	IL12RB1_ENST00000593993.2_Splice_Site_p.I539I			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	539	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						TCCACTCACCGATGCTGAAGC	0.622																																					p.I539I		Atlas-SNP	.											IL12RB1_ENST00000430026,colon,carcinoma,0,1	IL12RB1	92	.	0			c.C1617T						.						28.0	31.0	30.0					19																	18174687		2092	4225	6317	SO:0001630	splice_region_variant	3594	exon13			CTCACCGATGCTG	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1618+1C>T	chr19.hg19:g.18174687G>A		60.0	0.0		61.0	20.0	NM_005535	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Silent	SNP	ENST00000600835.2	hg19	CCDS54232.1																																																																																			.	.		0.622	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		Silent
LGALS7B	653499	hgsc.bcm.edu	37	19	39281456	39281456	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr19:39281456C>T	ENST00000314980.4	+	3	239	c.223C>T	c.(223-225)Cgc>Tgc	p.R75C		NM_001042507.3	NP_001035972.1	P47929	LEG7_HUMAN	lectin, galactoside-binding, soluble, 7B	75	Beta-galactoside binding. {ECO:0000255}.|Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|heterophilic cell-cell adhesion (GO:0007157)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carbohydrate binding (GO:0030246)										CCGCGAGGAGCGCGGGCCGGG	0.677																																					p.R75C		Atlas-SNP	.											.	.	.	.	0			c.C223T						.						12.0	13.0	13.0					19																	39281456		2122	4201	6323	SO:0001583	missense	653499	exon3			GAGGAGCGCGGGC		CCDS42565.1	19q13.2	2011-08-04			ENSG00000178934	ENSG00000178934		"""Lectins, galactoside-binding"""	34447	protein-coding gene	gene with protein product	"""galectin 7B"""						Standard	NM_001042507		Approved	GAL7	uc002ojf.4	P47929		ENST00000314980.4:c.223C>T	chr19.hg19:g.39281456C>T	ENSP00000313571:p.Arg75Cys	358.0	0.0		381.0	122.0	NM_001042507	Q6IB87	Missense_Mutation	SNP	ENST00000314980.4	hg19	CCDS42565.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324151	0.81580	.	.	ENSG00000178934	ENST00000314980	T	0.10382	2.88	4.07	3.04	0.35103	.	0.233245	0.30565	N	0.009343	T	0.19846	0.0477	.	.	.	0.50813	D	0.999892	.	.	.	.	.	.	T	0.00710	-1.1599	7	0.87932	D	0	-32.4222	8.7313	0.34501	0.0:0.8902:0.0:0.1098	.	.	.	.	C	75	ENSP00000313571:R75C	ENSP00000313571:R75C	R	+	1	0	LGALS7B	43973296	0.998000	0.40836	0.956000	0.39512	0.416000	0.31233	1.793000	0.38764	0.931000	0.37242	0.556000	0.70494	CGC	.	.		0.677	LGALS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462638.1		
SPTBN4	57731	hgsc.bcm.edu	37	19	41078287	41078287	+	Splice_Site	SNP	G	G	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr19:41078287G>T	ENST00000352632.3	+	35	7622		c.e35+1		SPTBN4_ENST00000392025.1_Splice_Site|SPTBN4_ENST00000598249.1_Splice_Site|SPTBN4_ENST00000593816.1_3'UTR			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4						actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AAAAGATGAGGTGAGATCTGG	0.577																																					.		Atlas-SNP	.											.	SPTBN4	213	.	0			c.7536+1G>T						.						194.0	162.0	173.0					19																	41078287		2203	4300	6503	SO:0001630	splice_region_variant	57731	exon35			GATGAGGTGAGAT	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7536+1G>T	chr19.hg19:g.41078287G>T		74.0	0.0		79.0	20.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Splice_Site	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803551	0.90623	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000392025	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0785	0.86592	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPTBN4	45770127	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.570000	0.98174	2.636000	0.89361	0.563000	0.77884	.	.	.		0.577	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		Intron
NEFH	4744	hgsc.bcm.edu	37	22	29885570	29885570	+	Missense_Mutation	SNP	G	G	T	rs200634512	byFrequency	TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr22:29885570G>T	ENST00000310624.6	+	4	1974	c.1941G>T	c.(1939-1941)aaG>aaT	p.K647N		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	653	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGAAGCAAAGTCCCCTGAGA	0.572																																					p.K647N		Atlas-SNP	.											.	NEFH	178	.	0			c.G1941T						.						89.0	96.0	94.0					22																	29885570		2203	4300	6503	SO:0001583	missense	4744	exon4			AGCAAAGTCCCCT		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1941G>T	chr22.hg19:g.29885570G>T	ENSP00000311997:p.Lys647Asn	195.0	0.0		209.0	32.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	hg19	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.373873	0.24857	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.84730	-1.89	4.77	-0.296	0.12824	.	0.000000	0.56097	D	0.000031	D	0.87237	0.6127	M	0.68593	2.085	0.42351	D	0.992376	D	0.64830	0.994	P	0.56278	0.795	D	0.86272	0.1662	10	0.87932	D	0	.	10.9944	0.47567	0.2639:0.0:0.7361:0.0	.	653	P12036	NFH_HUMAN	N	647	ENSP00000311997:K647N	ENSP00000311997:K647N	K	+	3	2	NEFH	28215570	0.071000	0.21146	0.748000	0.31131	0.198000	0.23893	-0.402000	0.07223	-0.019000	0.14055	0.591000	0.81541	AAG	.	G|0.999;C|0.001		0.572	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu	37	22	29885588	29885588	+	Missense_Mutation	SNP	G	G	T	rs200984527|rs267607533		TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr22:29885588G>T	ENST00000310624.6	+	4	1992	c.1959G>T	c.(1957-1959)aaG>aaT	p.K653N		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	659	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGAAGGCCAAGTCCCCAGAGA	0.567																																					p.K653N		Atlas-SNP	.											.	NEFH	178	.	0			c.G1959T						.						85.0	93.0	90.0					22																	29885588		2203	4300	6503	SO:0001583	missense	4744	exon4			GGCCAAGTCCCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1959G>T	chr22.hg19:g.29885588G>T	ENSP00000311997:p.Lys653Asn	215.0	0.0		236.0	24.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	hg19	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	7.917	0.737766	0.15574	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.84298	-1.83	4.41	-0.067	0.13762	.	0.000000	0.56097	D	0.000032	D	0.89121	0.6625	M	0.72894	2.215	0.33402	D	0.577433	D	0.62365	0.991	D	0.79108	0.992	D	0.88893	0.3347	10	0.87932	D	0	.	8.2741	0.31862	0.4205:0.0:0.5795:0.0	.	659	P12036	NFH_HUMAN	N	653	ENSP00000311997:K653N	ENSP00000311997:K653N	K	+	3	2	NEFH	28215588	0.000000	0.05858	0.660000	0.29694	0.058000	0.15608	-0.114000	0.10757	0.208000	0.20626	-0.469000	0.05056	AAG	.	.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MYH9	4627	hgsc.bcm.edu	37	22	36702652	36702652	+	Splice_Site	SNP	C	C	T			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr22:36702652C>T	ENST00000216181.5	-	16	2075	c.1845G>A	c.(1843-1845)gtG>gtA	p.V615V		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	615	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TGATGCGGTCCACTGTGGAGA	0.642			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.V615V		Atlas-SNP	.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9	225	.	0			c.G1845A						.						30.0	28.0	28.0					22																	36702652		2203	4300	6503	SO:0001630	splice_region_variant	4627	exon16	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	GCGGTCCACTGTG		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1844-1G>A	chr22.hg19:g.36702652C>T		51.0	0.0		59.0	24.0	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	hg19	CCDS13927.1																																																																																			.	.		0.642	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	Silent
MT-ND2	4536	hgsc.bcm.edu	37	M	4482	4482	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chrM:4482G>A	ENST00000361453.3	+	1	13	c.13G>A	c.(13-15)Gcc>Acc	p.A5T	MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	5					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						TTAATCCCCTGGCCCAACCCG	0.468																																					p.A5T		Atlas-SNP	.											.	.	.	.	0			c.G13A						.																																			SO:0001583	missense	0	exon1			CCCCTGGCCCAAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.13G>A	chrM.hg19:g.4482G>A	ENSP00000355046:p.Ala5Thr	22.0	0.0		43.0	9.0	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	hg19																																																																																				.	.		0.468	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
MT-ND2	4536	hgsc.bcm.edu	37	M	4920	4920	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chrM:4920G>A	ENST00000361453.3	+	1	451	c.451G>A	c.(451-453)Gta>Ata	p.V151I	MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	151					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CCTCACTAAACGTAAGCCTTC	0.463																																					p.V151M		Atlas-SNP	.											.	.	.	.	0			c.G451A						.																																			SO:0001583	missense	0	exon1			CTAAACGTAAGCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.451G>A	chrM.hg19:g.4920G>A	ENSP00000355046:p.Val151Ile	30.0	0.0		36.0	25.0	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	hg19																																																																																				.	.		0.463	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
CFAP36	112942	hgsc.bcm.edu	37	2	55771427	55771427	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr2:55771427delG	ENST00000349456.4	+	9	997	c.849delG	c.(847-849)ttgfs	p.L283fs	CCDC104_ENST00000490934.1_3'UTR|CCDC104_ENST00000407816.3_Frame_Shift_Del_p.L254fs|CCDC104_ENST00000339012.3_Frame_Shift_Del_p.L308fs			Q96G28	CFA36_HUMAN		283										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GAGATAAGTTGATGTCCATGA	0.413																																					p.L283X		Atlas-INDEL	.											.	CCDC104	35	.	0			c.848delT						.						81.0	77.0	78.0					2																	55771427		2203	4299	6502	SO:0001589	frameshift_variant	112942	exon9			.																												ENST00000349456.4:c.849delG	chr2.hg19:g.55771427delG	ENSP00000295117:p.Leu283fs	337.0	0.0		302.0	110.0	NM_080667	Q53SF0|Q53ST9|Q6UY34	Frame_Shift_Del	DEL	ENST00000349456.4	hg19	CCDS1854.2																																																																																			.	.		0.413	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319610.2		
SYVN1	84447	hgsc.bcm.edu	37	11	64898172	64898173	+	In_Frame_Ins	INS	-	-	GGG			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr11:64898172_64898173insGGG	ENST00000377190.3	-	11	1158_1159	c.1064_1065insCCC	c.(1063-1065)cct>ccCCCt	p.355_355P>PP	SYVN1_ENST00000307289.6_In_Frame_Ins_p.304_304P>PP|SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000294256.8_In_Frame_Ins_p.355_355P>PP|SYVN1_ENST00000526060.1_In_Frame_Ins_p.355_355P>PP	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	355	Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GGTGGGGGGCAGGGGGTGGCCC	0.673																																					p.P355delinsPP		Atlas-INDEL	.											.	SYVN1	55	.	0			c.1065_1066insCCC						.																																			SO:0001652	inframe_insertion	84447	exon11			.	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.1062_1064dupCCC	chr11.hg19:g.64898173_64898175dupGGG	ENSP00000366395:p.Pro355dup	20.0	0.0		44.0	19.0	NM_032431	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	In_Frame_Ins	INS	ENST00000377190.3	hg19	CCDS31605.1																																																																																			.	.		0.673	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
ZNF687	57592	hgsc.bcm.edu	37	1	151259173	151259173	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr1:151259173delG	ENST00000368879.2	+	2	504	c.406delG	c.(406-408)ggafs	p.G136fs		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	136	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTCCCTCCCAGGAACTCCCCA	0.577																																					p.P135fs		Atlas-INDEL	.											.	ZNF687	94	.	0			c.405delA						.						73.0	77.0	75.0					1																	151259173		2203	4300	6503	SO:0001589	frameshift_variant	57592	exon2			.		CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.406delG	chr1.hg19:g.151259173delG	ENSP00000357874:p.Gly136fs	72.0	0.0		99.0	32.0	NM_020832	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Frame_Shift_Del	DEL	ENST00000368879.2	hg19																																																																																				.	.		0.577	ZNF687-201	KNOWN	basic	protein_coding	protein_coding		NM_020832	
SRSF5	6430	hgsc.bcm.edu	37	14	70238105	70238106	+	Frame_Shift_Ins	INS	-	-	GTCTCCAGCATCTGTGG			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr14:70238105_70238106insGTCTCCAGCATCTGTGG	ENST00000553521.1	+	9	2199_2200	c.746_747insGTCTCCAGCATCTGTGG	c.(745-750)aagtctfs	p.-250fs	SRSF5_ENST00000553635.1_Frame_Shift_Ins_p.-247fs|SRSF5_ENST00000556587.1_3'UTR|SRSF5_ENST00000557154.1_Frame_Shift_Ins_p.-250fs|SRSF5_ENST00000394366.2_Frame_Shift_Ins_p.-250fs			Q13243	SRSF5_HUMAN	serine/arginine-rich splicing factor 5						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of cell cycle (GO:0051726)|response to wounding (GO:0009611)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|liver(1)	2						AGTAGATCTAAGTCTCCAGCAT	0.54																																					p.K249fs		Atlas-INDEL	.											.	SRSF5	45	.	0			c.746_747insGTCTCCAGCATCTGTGG						.																																			SO:0001589	frameshift_variant	6430	exon8			.	AF020307	CCDS32109.1	14q24	2013-02-12	2010-06-22	2010-06-22	ENSG00000100650	ENSG00000100650		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10787	protein-coding gene	gene with protein product	"""SR splicing factor 5"""	600914	"""splicing factor, arginine/serine-rich 5"""	SFRS5		7686911, 20516191	Standard	XM_005267998		Approved	SRP40, HRS	uc001xlp.3	Q13243		ENST00000553521.1:c.747_763dupGTCTCCAGCATCTGTGG	chr14.hg19:g.70238105_70238106insGTCTCCAGCATCTGTGG	ENSP00000452123:p.Ser250fs	114.0	0.0		92.0	18.0	NM_001039465	O14797|Q16662|Q49AD6|Q6FGE0	Frame_Shift_Ins	INS	ENST00000553521.1	hg19	CCDS32109.1																																																																																			.	.		0.540	SRSF5-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412456.1	NM_001039465	
TERF2IP	54386	hgsc.bcm.edu	37	16	75681935	75681948	+	Frame_Shift_Del	DEL	CCGTGTGCCGAGTG	CCGTGTGCCGAGTG	-			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	CCGTGTGCCGAGTG	CCGTGTGCCGAGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr16:75681935_75681948delCCGTGTGCCGAGTG	ENST00000300086.4	+	1	252_265	c.155_168delCCGTGTGCCGAGTG	c.(154-168)accgtgtgccgagtgfs	p.TVCRV52fs	KARS_ENST00000568378.1_5'Flank|KARS_ENST00000319410.5_5'Flank|KARS_ENST00000302445.3_5'Flank	NM_018975.3	NP_061848.2	Q9NYB0	TE2IP_HUMAN	telomeric repeat binding factor 2, interacting protein	52					negative regulation of DNA recombination at telomere (GO:0048239)|negative regulation of telomere maintenance (GO:0032205)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of transcription, DNA-templated (GO:0006355)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear chromosome (GO:0000228)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5						GGCGGCGGCACCGTGTGCCGAGTGCAGGAGCCCG	0.696																																					p.52_56del		Atlas-INDEL	.											.	TERF2IP	17	.	0			c.154_167del						.																																			SO:0001589	frameshift_variant	54386	exon1			.	AK000669	CCDS32491.1	16q23.1	2012-10-03			ENSG00000166848	ENSG00000166848			19246	protein-coding gene	gene with protein product		605061				10850490	Standard	NM_018975		Approved	RAP1	uc002fet.2	Q9NYB0	OTTHUMG00000177136	ENST00000300086.4:c.155_168delCCGTGTGCCGAGTG	chr16.hg19:g.75681935_75681948delCCGTGTGCCGAGTG	ENSP00000300086:p.Thr52fs	66.0	0.0		63.0	23.0	NM_018975	B4DQN4|Q4W4Y2|Q8WYZ3|Q9NWR2	Frame_Shift_Del	DEL	ENST00000300086.4	hg19	CCDS32491.1																																																																																			.	.		0.696	TERF2IP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000435519.1	NM_018975	
ADAMTSL3	57188	hgsc.bcm.edu	37	15	84639347	84639347	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LG-A9QC-01A-11D-A36X-10	TCGA-LG-A9QC-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	80c45b60-c7e2-456d-aa46-4fb7269b9181	d9d44786-28b8-44ec-b915-1e0bbc537b27	g.chr15:84639347delG	ENST00000286744.5	+	20	2826	c.2602delG	c.(2602-2604)gggfs	p.G868fs	ADAMTSL3_ENST00000567716.1_3'UTR|ADAMTSL3_ENST00000567476.1_Frame_Shift_Del_p.G868fs	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	868	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGATCTACCAGGGCTCCCTCT	0.522																																					p.P867fs		Atlas-INDEL	.											.	ADAMTSL3	290	.	0			c.2601delA						.						182.0	159.0	167.0					15																	84639347		2203	4300	6503	SO:0001589	frameshift_variant	57188	exon20			.	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2602delG	chr15.hg19:g.84639347delG	ENSP00000286744:p.Gly868fs	90.0	0.0		82.0	31.0	NM_207517	A1A566|A1A567|Q9ULI7	Frame_Shift_Del	DEL	ENST00000286744.5	hg19	CCDS10326.1																																																																																			.	.		0.522	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
