#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RCAN3	11123	hgsc.bcm.edu	37	1	24859572	24859572	+	Splice_Site	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:24859572G>A	ENST00000374395.4	+	4	682		c.e4-1		RCAN3_ENST00000538532.1_Splice_Site|RCAN3_ENST00000374393.2_Intron|RCAN3_ENST00000436717.2_Intron|RCAN3_ENST00000412742.2_Intron	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3						anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		GCTCCCTGCAGGTGCAGATGT	0.527																																					.		Atlas-SNP	.											.	RCAN3	22	.	0			c.370-1G>A						.						48.0	42.0	44.0					1																	24859572		2203	4300	6503	SO:0001630	splice_region_variant	11123	exon4			CCTGCAGGTGCAG		CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.370-1G>A	chr1.hg19:g.24859572G>A		60.0	0.0		73.0	28.0	NM_001251979	A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Splice_Site	SNP	ENST00000374395.4	hg19	CCDS254.1	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025331	0.35701	.	.	ENSG00000117602	ENST00000374395;ENST00000538532	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.094	0.93242	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RCAN3	24732159	1.000000	0.71417	0.996000	0.52242	0.225000	0.24961	7.307000	0.78920	2.822000	0.97130	0.558000	0.71614	.	.	.		0.527	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009176.2		Intron
C1orf87	127795	hgsc.bcm.edu	37	1	60521079	60521079	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:60521079G>A	ENST00000371201.3	-	3	246	c.139C>T	c.(139-141)Caa>Taa	p.Q47*	C1orf87_ENST00000450089.2_Nonsense_Mutation_p.Q47*	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	47							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						TGCATTGTTTGGGTTTCTGTT	0.423																																					p.Q47X	NSCLC(75;811 1386 4923 13371 51772)	Atlas-SNP	.											.	C1orf87	55	.	0			c.C139T						.						266.0	223.0	237.0					1																	60521079		2203	4300	6503	SO:0001587	stop_gained	127795	exon3			TTGTTTGGGTTTC	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.139C>T	chr1.hg19:g.60521079G>A	ENSP00000360244:p.Gln47*	135.0	0.0		126.0	37.0	NM_152377	Q6ZU07|Q8IVS0	Nonsense_Mutation	SNP	ENST00000371201.3	hg19	CCDS614.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.390081	0.61956	.	.	ENSG00000162598	ENST00000371201;ENST00000450089	.	.	.	4.66	4.66	0.58398	.	0.000000	0.46145	D	0.000313	.	.	.	.	.	.	0.58432	D	0.99999	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-12.6373	13.2382	0.59982	0.0:0.0:1.0:0.0	.	.	.	.	X	47	.	ENSP00000360244:Q47X	Q	-	1	0	C1orf87	60293667	0.216000	0.23585	0.039000	0.18376	0.013000	0.08279	2.188000	0.42612	2.563000	0.86464	0.591000	0.81541	CAA	.	.		0.423	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377	
JAK1	3716	hgsc.bcm.edu	37	1	65305399	65305399	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:65305399A>G	ENST00000342505.4	-	20	2977	c.2729T>C	c.(2728-2730)cTg>cCg	p.L910P	JAK1_ENST00000465376.1_5'Flank	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	910	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CTCAGGCTTCAGAGATTTAAC	0.478			Mis		ALL																																p.L910P		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	JAK1,NS,carcinoma,0,2	JAK1	209	.	0			c.T2729C						.						150.0	138.0	142.0					1																	65305399		1917	4139	6056	SO:0001583	missense	3716	exon20			GGCTTCAGAGATT	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2729T>C	chr1.hg19:g.65305399A>G	ENSP00000343204:p.Leu910Pro	116.0	0.0		112.0	25.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.517041	0.85495	.	.	ENSG00000162434	ENST00000342505	D	0.91351	-2.83	5.13	5.13	0.70059	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.94525	0.8237	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95349	0.8445	9	0.87932	D	0	-3.8222	15.1086	0.72338	1.0:0.0:0.0:0.0	.	910	P23458	JAK1_HUMAN	P	910	ENSP00000343204:L910P	ENSP00000343204:L910P	L	-	2	0	JAK1	65077987	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.703000	0.91344	2.146000	0.66826	0.533000	0.62120	CTG	.	.		0.478	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
MCOLN3	55283	hgsc.bcm.edu	37	1	85510937	85510937	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:85510937T>C	ENST00000370589.2	-	2	159	c.107A>G	c.(106-108)gAc>gGc	p.D36G	MCOLN3_ENST00000341115.4_Missense_Mutation_p.D36G|MCOLN3_ENST00000370587.1_Missense_Mutation_p.D36G|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	36					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		CCTCATCTGGTCTTCTAATAG	0.413																																					p.D36G		Atlas-SNP	.											.	MCOLN3	74	.	0			c.A107G						.						72.0	71.0	71.0					1																	85510937		2203	4300	6503	SO:0001583	missense	55283	exon2			ATCTGGTCTTCTA	AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.107A>G	chr1.hg19:g.85510937T>C	ENSP00000359621:p.Asp36Gly	88.0	0.0		83.0	27.0	NM_001253693	Q5T4H5|Q5T4H6|Q9NV09	Missense_Mutation	SNP	ENST00000370589.2	hg19	CCDS701.1	.	.	.	.	.	.	.	.	.	.	T	17.41	3.381402	0.61845	.	.	ENSG00000055732	ENST00000370589;ENST00000302814;ENST00000370588;ENST00000341115;ENST00000370587	T;T;T	0.54479	0.57;0.57;0.57	5.55	5.55	0.83447	.	0.095153	0.64402	D	0.000001	T	0.46521	0.1397	M	0.74881	2.28	0.51233	D	0.999914	B;B;B	0.31174	0.311;0.122;0.043	B;B;B	0.34652	0.187;0.056;0.019	T	0.56177	-0.8022	10	0.72032	D	0.01	-5.9354	15.7034	0.77558	0.0:0.0:0.0:1.0	.	36;36;36	B1ANB7;Q8TDD5-2;Q8TDD5	.;.;MCLN3_HUMAN	G	36	ENSP00000359621:D36G;ENSP00000342698:D36G;ENSP00000359619:D36G	ENSP00000304843:D36G	D	-	2	0	MCOLN3	85283525	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.633000	0.61318	2.113000	0.64589	0.402000	0.26972	GAC	.	.		0.413	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027569.2	NM_018298	
CDC7	8317	hgsc.bcm.edu	37	1	91985781	91985781	+	Silent	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:91985781C>T	ENST00000428239.1	+	11	1534	c.1275C>T	c.(1273-1275)gcC>gcT	p.A425A	CDC7_ENST00000234626.6_Silent_p.A425A|CDC7_ENST00000430031.2_Silent_p.A397A	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	425	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		CTGCTTTGGCCCAAATTATGA	0.358																																					p.A425A		Atlas-SNP	.											.	CDC7	74	.	0			c.C1275T						.						112.0	111.0	111.0					1																	91985781		2203	4300	6503	SO:0001819	synonymous_variant	8317	exon11			TTTGGCCCAAATT	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.1275C>T	chr1.hg19:g.91985781C>T		193.0	0.0		157.0	30.0	NM_001134419	D3DT31|O00558|Q5T5U5	Silent	SNP	ENST00000428239.1	hg19	CCDS734.1																																																																																			.	.		0.358	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
LCE2D	353141	hgsc.bcm.edu	37	1	152636736	152636736	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:152636736C>G	ENST00000368784.1	+	2	210	c.155C>G	c.(154-156)tCt>tGt	p.S52C		NM_178430.2	NP_848517.1	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	52	Cys-rich.				keratinization (GO:0031424)					large_intestine(1)|lung(7)|prostate(2)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGTCCCAGCTCTGGGAGCTGC	0.647																																					p.S52C		Atlas-SNP	.											.	LCE2D	26	.	0			c.C155G						.						98.0	108.0	105.0					1																	152636736		2203	4300	6503	SO:0001583	missense	353141	exon2			CCAGCTCTGGGAG	BI670513	CCDS1018.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000187223	ENSG00000187223		"""Late cornified envelopes"""	16518	protein-coding gene	gene with protein product		612612	"""small proline rich-like (epidermal differentiation complex) 1A"""	SPRL1A		11698679	Standard	NM_178430		Approved	LEP12	uc001fag.4	Q5TA82	OTTHUMG00000014400	ENST00000368784.1:c.155C>G	chr1.hg19:g.152636736C>G	ENSP00000357773:p.Ser52Cys	191.0	0.0		166.0	43.0	NM_178430	A1L4M8	Missense_Mutation	SNP	ENST00000368784.1	hg19	CCDS1018.1	.	.	.	.	.	.	.	.	.	.	C	0.745	-0.774942	0.02951	.	.	ENSG00000187223	ENST00000368784	T	0.05925	3.37	2.4	2.4	0.29515	.	.	.	.	.	T	0.11452	0.0279	M	0.78637	2.42	0.23198	N	0.998138	D	0.71674	0.998	D	0.69824	0.966	T	0.05386	-1.0888	9	0.87932	D	0	.	7.9554	0.30040	0.0:1.0:0.0:0.0	.	52	Q5TA82	LCE2D_HUMAN	C	52	ENSP00000357773:S52C	ENSP00000357773:S52C	S	+	2	0	LCE2D	150903360	0.329000	0.24696	0.942000	0.38095	0.053000	0.15095	1.805000	0.38883	1.157000	0.42530	0.305000	0.20034	TCT	.	.		0.647	LCE2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040058.1	NM_178430	
S100A5	6276	hgsc.bcm.edu	37	1	153509857	153509857	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:153509857T>C	ENST00000368718.1	-	4	475	c.194A>G	c.(193-195)cAg>cGg	p.Q65R	BX470102.3_ENST00000420695.1_RNA|S100A6_ENST00000368720.2_5'Flank|S100A6_ENST00000496817.1_5'Flank|S100A6_ENST00000368719.4_5'Flank|S100A5_ENST00000359215.1_Missense_Mutation_p.Q83R|S100A5_ENST00000368717.2_Missense_Mutation_p.Q65R	NM_002962.1	NP_002953.2	P33763	S10A5_HUMAN	S100 calcium binding protein A5	65	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					neuronal cell body (GO:0043025)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(1)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	4	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCGATCTCCTGGTCGCTGTT	0.547																																					p.Q65R		Atlas-SNP	.											.	S100A5	10	.	0			c.A194G						.						277.0	222.0	241.0					1																	153509857		2203	4300	6503	SO:0001583	missense	6276	exon4			ATCTCCTGGTCGC	Z18954	CCDS1041.1, CCDS1041.2	1q21	2013-01-10	2001-11-28		ENSG00000196420	ENSG00000196420		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10495	protein-coding gene	gene with protein product		176991	"""S100 calcium-binding protein A5"""	S100D		8341667	Standard	NM_002962		Approved		uc001fbx.3	P33763	OTTHUMG00000013547	ENST00000368718.1:c.194A>G	chr1.hg19:g.153509857T>C	ENSP00000357707:p.Gln65Arg	154.0	0.0		123.0	28.0	NM_002962	Q52LE7|Q5RHS3	Missense_Mutation	SNP	ENST00000368718.1	hg19	CCDS1041.2	.	.	.	.	.	.	.	.	.	.	T	13.10	2.135153	0.37728	.	.	ENSG00000196420	ENST00000368718;ENST00000359215;ENST00000368717	T;T;T	0.06218	3.33;3.33;3.33	4.4	0.752	0.18398	.	0.411381	0.27294	N	0.020034	T	0.01156	0.0038	.	.	.	0.27890	N	0.939378	B	0.02656	0.0	B	0.04013	0.001	T	0.46162	-0.9211	9	0.41790	T	0.15	.	2.6464	0.04985	0.1948:0.2144:0.0:0.5908	.	83	Q52LE7	.	R	65;83;65	ENSP00000357707:Q65R;ENSP00000352148:Q83R;ENSP00000357706:Q65R	ENSP00000352148:Q83R	Q	-	2	0	S100A5	151776481	0.878000	0.30173	1.000000	0.80357	0.843000	0.47879	0.043000	0.13971	0.277000	0.22141	-0.288000	0.09946	CAG	.	.		0.547	S100A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037719.1	NM_002962	
TNN	63923	hgsc.bcm.edu	37	1	175046704	175046704	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:175046704G>A	ENST00000239462.4	+	2	263	c.150G>A	c.(148-150)gtG>gtA	p.V50V		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	50					axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		AGATCGATGTGCCCAAGTCTG	0.622																																					p.V50V		Atlas-SNP	.											.	TNN	297	.	0			c.G150A						.						90.0	63.0	72.0					1																	175046704		2203	4300	6503	SO:0001819	synonymous_variant	63923	exon2			CGATGTGCCCAAG	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.150G>A	chr1.hg19:g.175046704G>A		168.0	0.0		131.0	29.0	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	hg19	CCDS30943.1																																																																																			.	.		0.622	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
PTPRC	5788	hgsc.bcm.edu	37	1	198725152	198725152	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:198725152G>T	ENST00000367376.2	+	33	3928	c.3757G>T	c.(3757-3759)Gta>Tta	p.V1253L	PTPRC_ENST00000442510.2_Missense_Mutation_p.V1255L|PTPRC_ENST00000594404.1_Missense_Mutation_p.V1092L|PTPRC_ENST00000352140.3_Missense_Mutation_p.V1205L|PTPRC_ENST00000348564.6_Missense_Mutation_p.V1094L	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1253					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AGTGGACAAAGTAAAGCAGGA	0.428																																					p.V1255L		Atlas-SNP	.											.	PTPRC	229	.	0			c.G3763T						.						100.0	101.0	101.0					1																	198725152		2203	4300	6503	SO:0001583	missense	5788	exon33			GACAAAGTAAAGC	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3757G>T	chr1.hg19:g.198725152G>T	ENSP00000356346:p.Val1253Leu	374.0	0.0		340.0	99.0	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	hg19		.	.	.	.	.	.	.	.	.	.	G	4.452	0.083624	0.08533	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	T	0.02369	4.32	5.7	0.392	0.16288	.	1.195290	0.06278	N	0.696855	T	0.01661	0.0053	N	0.08118	0	0.09310	N	1	B;B;B	0.19445	0.036;0.002;0.007	B;B;B	0.18263	0.021;0.002;0.005	T	0.48885	-0.8995	10	0.28530	T	0.3	.	2.5572	0.04763	0.1986:0.2627:0.3789:0.1598	.	1094;1205;1253	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	L	1255;1205;1253;1092	ENSP00000193532:V1205L	ENSP00000306782:V1092L	V	+	1	0	PTPRC	196991775	0.000000	0.05858	0.005000	0.12908	0.087000	0.18053	-0.210000	0.09345	-0.164000	0.10927	0.557000	0.71058	GTA	.	.		0.428	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
IL24	11009	hgsc.bcm.edu	37	1	207073658	207073658	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:207073658A>T	ENST00000294984.2	+	4	533	c.259A>T	c.(259-261)Acg>Tcg	p.T87S	IL24_ENST00000391929.3_Missense_Mutation_p.T88S|IL24_ENST00000491169.1_3'UTR|IL24_ENST00000367093.3_Missense_Mutation_p.T88S	NM_001185156.1|NM_006850.3	NP_001172085.1|NP_006841.1	Q13007	IL24_HUMAN	interleukin 24	87					apoptotic process (GO:0006915)|cellular response to interleukin-4 (GO:0071353)|cellular response to lipopolysaccharide (GO:0071222)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|serine phosphorylation of STAT3 protein (GO:0033136)|wound healing (GO:0042060)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12	Breast(84;0.201)					GGATAACATCACGAGTGCCCG	0.547																																					p.T88S		Atlas-SNP	.											.	IL24	20	.	0			c.A262T						.						67.0	64.0	65.0					1																	207073658		2203	4300	6503	SO:0001583	missense	11009	exon4			AACATCACGAGTG	U16261	CCDS1471.1, CCDS53465.1, CCDS53466.1, CCDS73021.1	1q32	2011-07-15		2001-06-29	ENSG00000162892	ENSG00000162892		"""Interleukins and interleukin receptors"""	11346	protein-coding gene	gene with protein product	"""melanoma differentiation association protein 7"", ""suppression of tumorigenicity 16 (melanoma differentiation)"", ""IL-4-induced secreted protein"""	604136		ST16		8545104, 8799171	Standard	NM_001185156		Approved	mda-7, IL10B, Mob-5, C49A, FISP, IL-24	uc001heu.2	Q13007	OTTHUMG00000036459	ENST00000294984.2:c.259A>T	chr1.hg19:g.207073658A>T	ENSP00000294984:p.Thr87Ser	76.0	0.0		73.0	19.0	NM_001185156	Q2YHE5|Q53XZ7|Q5YLN8|Q96DB0|Q96KG4	Missense_Mutation	SNP	ENST00000294984.2	hg19	CCDS1471.1	.	.	.	.	.	.	.	.	.	.	A	7.035	0.561385	0.13498	.	.	ENSG00000162892	ENST00000391929;ENST00000294984;ENST00000367093	T;T;T	0.17528	2.27;2.27;2.27	4.3	4.3	0.51218	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.515737	0.20794	N	0.085568	T	0.08891	0.0220	.	.	.	0.09310	N	1	B;B;B	0.34329	0.361;0.449;0.184	B;B;B	0.34652	0.187;0.098;0.098	T	0.26744	-1.0094	9	0.09084	T	0.74	.	9.782	0.40653	1.0:0.0:0.0:0.0	.	88;88;87	Q2YHE5;Q53XZ7;Q13007	.;.;IL24_HUMAN	S	88;87;88	ENSP00000375795:T88S;ENSP00000294984:T87S;ENSP00000356060:T88S	ENSP00000294984:T87S	T	+	1	0	IL24	205140281	0.146000	0.22672	0.029000	0.17559	0.002000	0.02628	3.554000	0.53720	1.809000	0.52856	0.459000	0.35465	ACG	.	.		0.547	IL24-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088680.2	NM_006850	
ACTN2	88	hgsc.bcm.edu	37	1	236900515	236900515	+	Splice_Site	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:236900515G>T	ENST00000366578.4	+	9	1042		c.e9+1		ACTN2_ENST00000492634.1_Splice_Site|ACTN2_ENST00000546208.1_Intron|ACTN2_ENST00000542672.1_Splice_Site	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			AGCGAGTGAGGTAAAGGAAAC	0.468																																					.		Atlas-SNP	.											.	ACTN2	191	.	0			c.876+1G>T						.						105.0	92.0	97.0					1																	236900515		2203	4300	6503	SO:0001630	splice_region_variant	88	exon9			AGTGAGGTAAAGG	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.876+1G>T	chr1.hg19:g.236900515G>T		135.0	0.0		110.0	38.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Splice_Site	SNP	ENST00000366578.4	hg19	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646131	0.87958	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1768	0.98178	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACTN2	234967138	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.856000	0.99531	2.766000	0.95052	0.655000	0.94253	.	.	.		0.468	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	Intron
OR13G1	441933	hgsc.bcm.edu	37	1	247835685	247835685	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr1:247835685A>G	ENST00000359688.2	-	1	680	c.659T>C	c.(658-660)gTt>gCt	p.V220A	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GAGAATAGCAACAATGATAAA	0.443																																					p.V220A		Atlas-SNP	.											.	OR13G1	78	.	0			c.T659C						.						116.0	105.0	108.0					1																	247835685		2203	4300	6503	SO:0001583	missense	441933	exon1			ATAGCAACAATGA	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.659T>C	chr1.hg19:g.247835685A>G	ENSP00000352717:p.Val220Ala	155.0	0.0		131.0	32.0	NM_001005487	B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	ENST00000359688.2	hg19	CCDS31094.1	.	.	.	.	.	.	.	.	.	.	A	0.026	-1.372834	0.01214	.	.	ENSG00000197437	ENST00000359688	T	0.37584	1.19	4.2	-2.46	0.06461	GPCR, rhodopsin-like superfamily (1);	0.519636	0.16050	N	0.232004	T	0.11324	0.0276	N	0.03084	-0.415	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34502	-0.9826	10	0.07813	T	0.8	-0.256	7.1462	0.25585	0.3317:0.122:0.5463:0.0	.	220	Q8NGZ3	O13G1_HUMAN	A	220	ENSP00000352717:V220A	ENSP00000352717:V220A	V	-	2	0	OR13G1	245902308	0.000000	0.05858	0.000000	0.03702	0.253000	0.25986	-0.801000	0.04550	-0.326000	0.08564	-1.235000	0.01560	GTT	.	.		0.443	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096869.1	NM_001005487	
MCEE	84693	hgsc.bcm.edu	37	2	71351621	71351621	+	Silent	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:71351621T>C	ENST00000244217.5	-	2	110	c.93A>G	c.(91-93)acA>acG	p.T31T	AC007881.1_ENST00000578636.1_RNA	NM_032601.3	NP_115990.3	Q96PE7	MCEE_HUMAN	methylmalonyl CoA epimerase	31					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|L-methylmalonyl-CoA metabolic process (GO:0046491)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|methylmalonyl-CoA epimerase activity (GO:0004493)			kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9						AGGGCTGTGATGTGGAAGAAG	0.448																																					p.T31T		Atlas-SNP	.											.	MCEE	19	.	0			c.A93G						.						106.0	115.0	112.0					2																	71351621		2203	4300	6503	SO:0001819	synonymous_variant	84693	exon2			CTGTGATGTGGAA	AF364547	CCDS1915.1	2p13.3	2011-05-12			ENSG00000124370	ENSG00000124370	5.1.99.1		16732	protein-coding gene	gene with protein product	"""glyoxalase domain containing 2"""	608419				16697227, 16752391, 16843692	Standard	NM_032601		Approved	GLOD2	uc002shs.2	Q96PE7	OTTHUMG00000129709	ENST00000244217.5:c.93A>G	chr2.hg19:g.71351621T>C		94.0	0.0		80.0	14.0	NM_032601	Q53TP1|Q8WW63	Silent	SNP	ENST00000244217.5	hg19	CCDS1915.1																																																																																			.	.		0.448	MCEE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251917.3	NM_032601	
CLASP1	23332	hgsc.bcm.edu	37	2	122165165	122165165	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:122165165G>A	ENST00000263710.4	-	25	2940	c.2551C>T	c.(2551-2553)Ctg>Ttg	p.L851L	CLASP1_ENST00000397587.3_Silent_p.L831L|CLASP1_ENST00000409078.3_Silent_p.L823L|CLASP1_ENST00000545861.1_Silent_p.L598L|CLASP1_ENST00000541859.1_Silent_p.L584L|CLASP1_ENST00000541377.1_Silent_p.L829L|CLASP1_ENST00000455322.2_Silent_p.L823L	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	851					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					GTCTGCCGCAGATAATGGGGA	0.498																																					p.L851L		Atlas-SNP	.											.	CLASP1	135	.	0			c.C2551T						.						106.0	101.0	103.0					2																	122165165		1999	4174	6173	SO:0001819	synonymous_variant	23332	exon25			GCCGCAGATAATG	AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.2551C>T	chr2.hg19:g.122165165G>A		209.0	0.0		183.0	42.0	NM_015282	B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Silent	SNP	ENST00000263710.4	hg19																																																																																				.	.		0.498	CLASP1-201	KNOWN	basic	protein_coding	protein_coding		NM_015282	
TTN	7273	hgsc.bcm.edu	37	2	179595433	179595433	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:179595433C>T	ENST00000591111.1	-	59	17100	c.16876G>A	c.(16876-16878)Gct>Act	p.A5626T	TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.A5943T|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.A4699T|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12436	Ig-like 37.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGACCCAGCCACTATACAT	0.353																																					p.A5943T		Atlas-SNP	.											.	TTN	18412	.	0			c.G17827A						.						66.0	69.0	68.0					2																	179595433		1854	4109	5963	SO:0001583	missense	7273	exon61			ACCCAGCCACTAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16876G>A	chr2.hg19:g.179595433C>T	ENSP00000465570:p.Ala5626Thr	183.0	0.0		169.0	7.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	10.79	1.448667	0.26074	.	.	ENSG00000155657	ENST00000342992	T	0.65916	-0.18	5.86	4.98	0.66077	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55893	0.1949	N	0.19112	0.55	0.80722	D	1	P	0.46859	0.885	P	0.48770	0.589	T	0.62096	-0.6926	9	0.87932	D	0	.	13.2588	0.60093	0.4327:0.5673:0.0:0.0	.	5626	Q8WZ42	TITIN_HUMAN	T	4699	ENSP00000343764:A4699T	ENSP00000343764:A4699T	A	-	1	0	TTN	179303678	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.511000	0.60462	1.449000	0.47699	0.563000	0.77884	GCT	.	.		0.353	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179634550	179634550	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:179634550C>T	ENST00000591111.1	-	37	8982	c.8758G>A	c.(8758-8760)Gaa>Aaa	p.E2920K	TTN_ENST00000359218.5_Missense_Mutation_p.E2874K|TTN_ENST00000342175.6_Missense_Mutation_p.E2874K|TTN_ENST00000589042.1_Missense_Mutation_p.E2920K|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E2874K|TTN_ENST00000342992.6_Missense_Mutation_p.E2920K|TTN_ENST00000360870.5_Missense_Mutation_p.E2920K|TTN-AS1_ENST00000610005.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13250	Ig-like 16.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E2920K(2)|p.E2874K(2)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCTCAATTTCCACACCATTC	0.448																																					p.E2920K		Atlas-SNP	.											TTN_ENST00000360870,face,carcinoma,0,4	TTN	18412	.	4	Substitution - Missense(4)	skin(4)	c.G8758A						.						180.0	174.0	176.0					2																	179634550		2203	4300	6503	SO:0001583	missense	7273	exon37			CAATTTCCACACC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.8758G>A	chr2.hg19:g.179634550C>T	ENSP00000465570:p.Glu2920Lys	180.0	0.0		152.0	36.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	17.79	3.476683	0.63737	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	5.93	5.93	0.95920	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.82070	0.4957	M	0.67953	2.075	0.43902	D	0.99653	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.87578	0.996;0.996;0.996;0.996;0.998	T	0.82327	-0.0512	9	0.87932	D	0	.	20.3363	0.98740	0.0:1.0:0.0:0.0	.	2874;2874;2874;2920;2920	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	K	2920;2874;2874;2874;2874;2920	ENSP00000343764:E2920K;ENSP00000434586:E2874K;ENSP00000340554:E2874K;ENSP00000352154:E2874K;ENSP00000354117:E2920K	ENSP00000340554:E2874K	E	-	1	0	TTN	179342795	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.818000	0.86416	2.814000	0.96858	0.563000	0.77884	GAA	.	.		0.448	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
OSGEPL1	64172	hgsc.bcm.edu	37	2	190617705	190617705	+	Splice_Site	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:190617705C>A	ENST00000264151.5	-	6	1066	c.964G>T	c.(964-966)Gtt>Ttt	p.V322F	Y_RNA_ENST00000411317.1_RNA|OSGEPL1_ENST00000522700.1_Splice_Site_p.V322F|OSGEPL1_ENST00000519810.1_Splice_Site_p.V322F	NM_022353.2	NP_071748.2			O-sialoglycoprotein endopeptidase-like 1											large_intestine(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			CCAGATGCAACCTGAAGGAAT	0.373																																					p.V322F		Atlas-SNP	.											.	OSGEPL1	19	.	0			c.G964T						.						58.0	53.0	54.0					2																	190617705		1855	4091	5946	SO:0001630	splice_region_variant	64172	exon6			ATGCAACCTGAAG	AJ295148	CCDS46472.1	2q32	2011-08-12			ENSG00000128694	ENSG00000128694			23075	protein-coding gene	gene with protein product						19578062	Standard	NM_022353		Approved	Qri7	uc002uqz.1	Q9H4B0	OTTHUMG00000164096	ENST00000264151.5:c.964-1G>T	chr2.hg19:g.190617705C>A		342.0	0.0		278.0	73.0	NM_022353		Missense_Mutation	SNP	ENST00000264151.5	hg19	CCDS46472.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558937	0.86231	.	.	ENSG00000128694	ENST00000264151;ENST00000519810;ENST00000522700	T;T;T	0.23147	1.92;1.92;1.92	5.15	5.15	0.70609	Peptidase M22, glycoprotease (1);	0.057812	0.64402	D	0.000001	T	0.44201	0.1282	M	0.90309	3.105	0.80722	D	1	B	0.33477	0.413	B	0.36186	0.219	T	0.55309	-0.8161	10	0.87932	D	0	-27.5688	18.8073	0.92043	0.0:1.0:0.0:0.0	.	322	Q9H4B0	OSGP2_HUMAN	F	322	ENSP00000264151:V322F;ENSP00000428859:V322F;ENSP00000429697:V322F	ENSP00000264151:V322F	V	-	1	0	OSGEPL1	190325950	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.819000	0.69243	2.673000	0.90976	0.467000	0.42956	GTT	.	.		0.373	OSGEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377257.1	NM_022353	Missense_Mutation
CYP20A1	57404	hgsc.bcm.edu	37	2	204150447	204150447	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:204150447G>A	ENST00000356079.4	+	9	1086	c.963G>A	c.(961-963)gaG>gaA	p.E321E	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Silent_p.E329E	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	321						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						AGAAAATTGAGCAGCTCAGGT	0.313																																					p.E321E		Atlas-SNP	.											.	CYP20A1	40	.	0			c.G963A						.						47.0	52.0	50.0					2																	204150447		2202	4295	6497	SO:0001819	synonymous_variant	57404	exon9			AATTGAGCAGCTC	AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.963G>A	chr2.hg19:g.204150447G>A		661.0	1.0		594.0	140.0	NM_177538	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Silent	SNP	ENST00000356079.4	hg19	CCDS2357.1																																																																																			.	.		0.313	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	NM_020674	
MAP2	4133	hgsc.bcm.edu	37	2	210558225	210558225	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:210558225T>C	ENST00000360351.4	+	7	1837	c.1331T>C	c.(1330-1332)cTt>cCt	p.L444P	MAP2_ENST00000447185.1_Missense_Mutation_p.L440P|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	444					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GAGCTGAAGCTTGAAGAAAAA	0.433																																					p.L444P	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											.	MAP2	372	.	0			c.T1331C						.						67.0	69.0	68.0					2																	210558225		2203	4300	6503	SO:0001583	missense	4133	exon7			TGAAGCTTGAAGA		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.1331T>C	chr2.hg19:g.210558225T>C	ENSP00000353508:p.Leu444Pro	190.0	0.0		185.0	55.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	hg19	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	T	3.857	-0.030580	0.07543	.	.	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	T;T;T	0.28666	1.6;1.6;1.6	5.5	-0.0118	0.13991	MAP2/Tau projection (1);	0.696719	0.13130	N	0.411549	T	0.13457	0.0326	N	0.14661	0.345	0.19300	N	0.99998	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.25950	-1.0117	10	0.21540	T	0.41	-0.0403	3.4151	0.07373	0.5958:0.1331:0.0:0.2711	.	440;444	P11137-3;P11137	.;MAP2_HUMAN	P	444;526;440	ENSP00000353508:L444P;ENSP00000409969:L526P;ENSP00000392164:L440P	ENSP00000353508:L444P	L	+	2	0	MAP2	210266470	0.000000	0.05858	0.011000	0.14972	0.696000	0.40369	0.100000	0.15231	0.018000	0.15052	0.528000	0.53228	CTT	.	.		0.433	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
ZNF142	7701	hgsc.bcm.edu	37	2	219513983	219513983	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:219513983T>G	ENST00000449707.1	-	6	1069	c.648A>C	c.(646-648)gaA>gaC	p.E216D	ZNF142_ENST00000411696.2_Missense_Mutation_p.E216D	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	216					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		GGTGGGCCTTTTCACCCAGCT	0.552											OREG0015202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E216D	Colon(170;867 1942 8995 15834 18053)	Atlas-SNP	.											.	ZNF142	190	.	0			c.A648C						.						66.0	70.0	68.0					2																	219513983		2070	4206	6276	SO:0001583	missense	7701	exon6			GGCCTTTTCACCC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.648A>C	chr2.hg19:g.219513983T>G	ENSP00000408643:p.Glu216Asp	104.0	0.0	2259	82.0	20.0	NM_001105537	Q92510	Missense_Mutation	SNP	ENST00000449707.1	hg19	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	T	14.46	2.543170	0.45280	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.19806	2.12;2.12	5.22	3.41	0.39046	Zinc finger, C2H2 (1);	0.260739	0.43579	D	0.000555	T	0.19208	0.0461	L	0.46885	1.475	0.32133	N	0.586534	B;B	0.28971	0.229;0.073	B;B	0.26094	0.036;0.066	T	0.15954	-1.0419	10	0.62326	D	0.03	-1.2625	11.5163	0.50524	0.0:0.852:0.0:0.148	.	216;53	P52746;A8MWU9	ZN142_HUMAN;.	D	216	ENSP00000408643:E216D;ENSP00000398798:E216D	ENSP00000398798:E216D	E	-	3	2	ZNF142	219222227	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.864000	0.39469	0.875000	0.35847	-0.468000	0.05107	GAA	.	.		0.552	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
OBSL1	23363	hgsc.bcm.edu	37	2	220426656	220426656	+	Intron	SNP	G	G	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:220426656G>C	ENST00000404537.1	-	8	3010				OBSL1_ENST00000289656.3_Missense_Mutation_p.R597G|OBSL1_ENST00000265318.4_Intron|OBSL1_ENST00000265317.5_5'Flank|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000373876.1_Intron|OBSL1_ENST00000603926.1_Intron|OBSL1_ENST00000373873.4_Missense_Mutation_p.R1010G	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1						cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		gaccagagccgccgggtcttc	0.557																																					p.R1010G		Atlas-SNP	.											.	OBSL1	120	.	0			c.C3028G						.																																			SO:0001627	intron_variant	23363	exon9			AGAGCCGCCGGGT	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2953+467C>G	chr2.hg19:g.220426656G>C		164.0	0.0		109.0	5.0	NM_001173408	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	hg19	CCDS46520.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621252	0.46736	.	.	ENSG00000124006	ENST00000373873;ENST00000289656	T;T	0.62105	0.05;0.73	3.96	2.99	0.34606	.	.	.	.	.	T	0.40719	0.1128	N	0.08118	0	0.80722	D	1	B;B	0.15141	0.005;0.012	B;B	0.21708	0.003;0.036	T	0.43261	-0.9402	9	0.72032	D	0.01	.	8.9484	0.35773	0.0:0.228:0.772:0.0	.	597;1010	A8MSZ8;O75147-2	.;.	G	1010;597	ENSP00000362980:R1010G;ENSP00000289656:R597G	ENSP00000289656:R597G	R	-	1	2	OBSL1	220134900	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	1.746000	0.38288	2.217000	0.71921	0.650000	0.86243	CGG	.	.		0.557	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
COL4A4	1286	hgsc.bcm.edu	37	2	227942713	227942713	+	Silent	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:227942713C>T	ENST00000396625.3	-	25	2091	c.1884G>A	c.(1882-1884)ggG>ggA	p.G628G	COL4A4_ENST00000329662.7_Silent_p.G628G	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	628	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		GTCCTGGGGGCCCCACAGGTC	0.612																																					p.G628G		Atlas-SNP	.											.	COL4A4	215	.	0			c.G1884A						.						25.0	28.0	27.0					2																	227942713		1805	4071	5876	SO:0001819	synonymous_variant	1286	exon25			TGGGGGCCCCACA		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.1884G>A	chr2.hg19:g.227942713C>T		185.0	0.0		172.0	57.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	ENST00000396625.3	hg19	CCDS42828.1																																																																																			.	.		0.612	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266137	41266137	+	Missense_Mutation	SNP	C	C	T	rs121913409		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr3:41266137C>T	ENST00000349496.5	+	3	414	c.134C>T	c.(133-135)tCt>tTt	p.S45F	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGT	0.498	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45F	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1,2	CTNNB1	4904	.	601	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(4)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134T						.						84.0	74.0	77.0					3																	41266137		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.134C>T	chr3.hg19:g.41266137C>T	ENSP00000344456:p.Ser45Phe	171.0	0.0		152.0	49.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569754	0.86439	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68165	0.2971	M	0.65677	2.01	0.80722	D	1	D	0.67145	0.996	D	0.64687	0.928	T	0.68895	-0.5288	10	0.87932	D	0	-13.6823	20.2983	0.98569	0.0:1.0:0.0:0.0	.	45	P35222	CTNB1_HUMAN	F	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38F;ENSP00000385604:S45F;ENSP00000412219:S45F;ENSP00000379486:S45F;ENSP00000344456:S45F;ENSP00000411226:S38F;ENSP00000379488:S45F;ENSP00000409302:S45F;ENSP00000401599:S45F	ENSP00000344456:S45F	S	+	2	0	CTNNB1	41241141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LIMD1	8994	hgsc.bcm.edu	37	3	45636572	45636572	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr3:45636572G>T	ENST00000273317.4	+	1	222	c.201G>T	c.(199-201)gaG>gaT	p.E67D	AC099539.1_ENST00000516118.1_RNA|LIMD1_ENST00000465039.1_Intron|LIMD1_ENST00000440097.1_Missense_Mutation_p.E67D	NM_014240.2	NP_055055.1	Q9UGP4	LIMD1_HUMAN	LIM domains containing 1	67	Mediates nuclear export.				cell migration (GO:0016477)|cytoplasmic mRNA processing body assembly (GO:0033962)|cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of hippo signaling (GO:0035331)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|phosphorylation (GO:0016310)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|RISC complex (GO:0016442)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.011)|KIRC - Kidney renal clear cell carcinoma(197;0.0264)|Kidney(197;0.0315)		TCCTGCAGGAGGAGACTCTGC	0.627																																					p.E67D		Atlas-SNP	.											.	LIMD1	34	.	0			c.G201T						.						21.0	24.0	23.0					3																	45636572		2203	4294	6497	SO:0001583	missense	8994	exon1			GCAGGAGGAGACT	AJ132408	CCDS2729.1	3p21.31	2008-02-01			ENSG00000144791	ENSG00000144791			6612	protein-coding gene	gene with protein product		604543				10647888	Standard	NM_014240		Approved		uc003coq.3	Q9UGP4	OTTHUMG00000133453	ENST00000273317.4:c.201G>T	chr3.hg19:g.45636572G>T	ENSP00000273317:p.Glu67Asp	91.0	0.0		80.0	4.0	NM_014240	Q17RQ1|Q9BQQ9|Q9NQ47	Missense_Mutation	SNP	ENST00000273317.4	hg19	CCDS2729.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.329531	0.60743	.	.	ENSG00000144791	ENST00000440097;ENST00000273317	T;T	0.61158	0.13;0.35	4.22	2.41	0.29592	.	0.871395	0.09993	N	0.729440	T	0.53578	0.1805	L	0.32530	0.975	0.35838	D	0.825869	D	0.53885	0.963	P	0.50570	0.644	T	0.52601	-0.8554	10	0.39692	T	0.17	.	8.9299	0.35663	0.1521:0.0:0.8479:0.0	.	67	Q9UGP4	LIMD1_HUMAN	D	67	ENSP00000394537:E67D;ENSP00000273317:E67D	ENSP00000273317:E67D	E	+	3	2	LIMD1	45611576	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	1.830000	0.39131	0.264000	0.21851	0.462000	0.41574	GAG	.	.		0.627	LIMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257327.1	NM_014240	
PLCXD2	257068	hgsc.bcm.edu	37	3	111394161	111394161	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr3:111394161G>A	ENST00000477665.1	+	1	393	c.69G>A	c.(67-69)ggG>ggA	p.G23G	PLCXD2_ENST00000393934.3_Silent_p.G23G|PLCXD2-AS1_ENST00000493131.1_RNA	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	23					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						ACCCCAGCGGGACAAAGACAT	0.577																																					p.G23G		Atlas-SNP	.											.	PLCXD2	36	.	0			c.G69A						.						146.0	131.0	136.0					3																	111394161		2203	4300	6503	SO:0001819	synonymous_variant	257068	exon1			CAGCGGGACAAAG	AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.69G>A	chr3.hg19:g.111394161G>A		181.0	0.0		184.0	40.0	NM_001185106	Q96N12	Silent	SNP	ENST00000477665.1	hg19	CCDS54619.1																																																																																			.	.		0.577	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354322.1	NM_153268	
PLXNA1	5361	hgsc.bcm.edu	37	3	126726697	126726697	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr3:126726697G>A	ENST00000393409.2	+	8	2053	c.2053G>A	c.(2053-2055)Gtg>Atg	p.V685M	PLXNA1_ENST00000251772.4_Missense_Mutation_p.V662M	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	685					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)	p.V662M(1)		breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		ATACCGCCACGTGTGCACACA	0.627																																					p.V685M		Atlas-SNP	.											PLXNA1,NS,carcinoma,0,1	PLXNA1	185	.	1	Substitution - Missense(1)	lung(1)	c.G2053A						.						80.0	71.0	74.0					3																	126726697		2203	4299	6502	SO:0001583	missense	5361	exon8			CGCCACGTGTGCA	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2053G>A	chr3.hg19:g.126726697G>A	ENSP00000377061:p.Val685Met	71.0	0.0		71.0	12.0	NM_032242		Missense_Mutation	SNP	ENST00000393409.2	hg19	CCDS33847.2	.	.	.	.	.	.	.	.	.	.	G	9.487	1.099645	0.20552	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.17854	2.25;2.25	3.63	2.74	0.32292	.	0.277746	0.25436	N	0.030698	T	0.09905	0.0243	N	0.20685	0.6	0.37780	D	0.926974	B	0.27823	0.19	B	0.29663	0.105	T	0.13176	-1.0519	10	0.45353	T	0.12	.	6.1876	0.20506	0.2381:0.0:0.7619:0.0	.	685	Q9UIW2	PLXA1_HUMAN	M	685;662	ENSP00000377061:V685M;ENSP00000251772:V662M	ENSP00000251772:V662M	V	+	1	0	PLXNA1	128209387	0.996000	0.38824	0.909000	0.35828	0.586000	0.36452	2.516000	0.45520	2.025000	0.59659	0.467000	0.42956	GTG	.	.		0.627	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356451.1	NM_032242	
ALB	213	hgsc.bcm.edu	37	4	74282072	74282072	+	Splice_Site	SNP	T	T	G	rs77232890		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr4:74282072T>G	ENST00000503124.1	+	8	1046		c.e8+2		ALB_ENST00000509063.1_Splice_Site|ALB_ENST00000295897.4_Splice_Site|ALB_ENST00000505649.1_Splice_Site|ALB_ENST00000415165.2_Splice_Site|ALB_ENST00000401494.3_Splice_Site			Q8TES7	FBF1_HUMAN	albumin						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCAGAATGCGTAAGTAATTTT	0.294																																					.		Atlas-SNP	.											.	ALB	132	.	0			c.1289+2T>G						.						36.0	37.0	36.0					4																	74282072		2202	4298	6500	SO:0001630	splice_region_variant	213	exon10			AATGCGTAAGTAA	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.839+2T>G	chr4.hg19:g.74282072T>G		224.0	0.0		200.0	58.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Splice_Site	SNP	ENST00000503124.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.63	1.995730	0.35226	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202;ENST00000511370	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8657	0.70412	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALB	74500936	1.000000	0.71417	0.615000	0.29064	0.275000	0.26752	4.513000	0.60476	2.198000	0.70561	0.482000	0.46254	.	.	.		0.294	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	Intron
ARHGAP10	79658	hgsc.bcm.edu	37	4	148796299	148796299	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr4:148796299A>G	ENST00000336498.3	+	8	1069	c.830A>G	c.(829-831)aAa>aGa	p.K277R		NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		GTCCAGGAAAAAAGTAAGAGG	0.438																																					p.K277R		Atlas-SNP	.											.	ARHGAP10	92	.	0			c.A830G						.						67.0	65.0	66.0					4																	148796299		2203	4300	6503	SO:0001583	missense	79658	exon8			AGGAAAAAAGTAA	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.830A>G	chr4.hg19:g.148796299A>G	ENSP00000336923:p.Lys277Arg	698.0	0.0		558.0	162.0	NM_024605	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	hg19	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	A	14.85	2.657178	0.47467	.	.	ENSG00000071205	ENST00000336498	T	0.04654	3.58	4.54	3.35	0.38373	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.507731	0.23636	N	0.046075	T	0.16938	0.0407	M	0.78637	2.42	0.80722	D	1	D	0.67145	0.996	P	0.62740	0.906	T	0.00269	-1.1861	10	0.56958	D	0.05	.	9.8819	0.41238	0.9174:0.0:0.0826:0.0	.	277	A1A4S6	RHG10_HUMAN	R	277	ENSP00000336923:K277R	ENSP00000336923:K277R	K	+	2	0	ARHGAP10	149015749	1.000000	0.71417	0.995000	0.50966	0.009000	0.06853	8.365000	0.90108	0.701000	0.31803	-0.323000	0.08544	AAA	.	.		0.438	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605	
FBXO8	26269	hgsc.bcm.edu	37	4	175183929	175183929	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr4:175183929T>G	ENST00000393674.2	-	2	1177	c.315A>C	c.(313-315)gaA>gaC	p.E105D	FBXO8_ENST00000503293.1_Missense_Mutation_p.E64D	NM_012180.2	NP_036312.2	Q9NRD0	FBX8_HUMAN	F-box protein 8	105	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell junction (GO:0030054)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|urinary_tract(1)	14		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		GCCAGAGAAGTTCATCATTCG	0.383																																					p.E105D		Atlas-SNP	.											.	FBXO8	34	.	0			c.A315C						.						77.0	69.0	71.0					4																	175183929		2203	4300	6503	SO:0001583	missense	26269	exon2			GAGAAGTTCATCA	AF174596	CCDS3820.1	4q34.1	2008-02-05	2004-06-15			ENSG00000164117		"""F-boxes /  ""other"""""	13587	protein-coding gene	gene with protein product		605649	"""F-box only protein 8"""			10531035, 10531037	Standard	NM_012180		Approved	FBX8, FBS	uc003itp.3	Q9NRD0		ENST00000393674.2:c.315A>C	chr4.hg19:g.175183929T>G	ENSP00000377280:p.Glu105Asp	161.0	0.0		156.0	35.0	NM_012180	B2RB40|D3DP41|G5E9Z0|Q6UWN4|Q8IWE1|Q9NRP5|Q9UKC4	Missense_Mutation	SNP	ENST00000393674.2	hg19	CCDS3820.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.70|14.70	2.613258|2.613258	0.46631|0.46631	.|.	.|.	ENSG00000164117|ENSG00000164117	ENST00000393674;ENST00000503293;ENST00000513696|ENST00000296517	T;T;T|.	0.51817|.	0.69;0.69;0.69|.	5.63|5.63	-2.78|-2.78	0.05859|0.05859	F-box domain, cyclin-like (1);F-box domain, Skp2-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33673|0.33673	0.0871|0.0871	N|N	0.05177|0.05177	-0.1|-0.1	0.45205|0.45205	D|D	0.998218|0.998218	B;B|.	0.24920|.	0.079;0.114|.	B;B|.	0.28139|.	0.086;0.057|.	T|T	0.15122|0.15122	-1.0448|-1.0448	10|6	0.42905|0.35671	T|T	0.14|0.21	.|.	12.951|12.951	0.58401|0.58401	0.0:0.5958:0.0:0.4042|0.0:0.5958:0.0:0.4042	.|.	64;105|.	G5E9Z0;Q9NRD0|.	.;FBX8_HUMAN|.	D|T	105;64;105|19	ENSP00000377280:E105D;ENSP00000422905:E64D;ENSP00000427506:E105D|.	ENSP00000377280:E105D|ENSP00000296517:N19T	E|N	-|-	3|2	2|0	FBXO8|FBXO8	175420504|175420504	0.772000|0.772000	0.28567|0.28567	0.996000|0.996000	0.52242|0.52242	0.971000|0.971000	0.66376|0.66376	-0.126000|-0.126000	0.10563|0.10563	-0.206000|-0.206000	0.10203|0.10203	0.383000|0.383000	0.25322|0.25322	GAA|AAC	.	.		0.383	FBXO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362085.2	NM_012180	
ACTBL2	345651	hgsc.bcm.edu	37	5	56777436	56777436	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr5:56777436C>T	ENST00000423391.1	-	1	1200	c.1099G>A	c.(1099-1101)Ggt>Agt	p.G367S	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	367						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		ATAGGAGGACCAGCCTCATCA	0.468																																					p.G367S		Atlas-SNP	.											.	ACTBL2	65	.	0			c.G1099A						.						85.0	89.0	87.0					5																	56777436		2203	4300	6503	SO:0001583	missense	345651	exon1			GAGGACCAGCCTC		CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.1099G>A	chr5.hg19:g.56777436C>T	ENSP00000416706:p.Gly367Ser	139.0	0.0		92.0	19.0	NM_001017992	B2RPJ1|Q562R2|Q562S9|Q562X8	Missense_Mutation	SNP	ENST00000423391.1	hg19	CCDS34163.1	.	.	.	.	.	.	.	.	.	.	C	15.63	2.891235	0.52014	.	.	ENSG00000169067	ENST00000423391	T	0.63744	-0.06	4.98	4.11	0.48088	.	0.000000	0.64402	D	0.000004	D	0.86104	0.5853	H	0.98786	4.33	0.51767	D	0.999934	P	0.52577	0.954	D	0.68353	0.957	D	0.89781	0.3961	10	0.87932	D	0	.	11.5182	0.50536	0.0:0.912:0.0:0.088	.	367	Q562R1	ACTBL_HUMAN	S	367	ENSP00000416706:G367S	ENSP00000416706:G367S	G	-	1	0	ACTBL2	56813193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.878000	0.69682	1.319000	0.45190	0.655000	0.94253	GGT	.	.		0.468	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368579.1	NM_001017992	
PDE4D	5144	hgsc.bcm.edu	37	5	59284493	59284493	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr5:59284493C>T	ENST00000502484.2	-	3	317	c.94G>A	c.(94-96)Gga>Aga	p.G32R	PDE4D_ENST00000546160.1_Missense_Mutation_p.G32R	NM_001165899.1	NP_001159371.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	0					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GGTTCCATTCCGCGGAAAGGG	0.433																																					p.G32R		Atlas-SNP	.											.	PDE4D	345	.	0			c.G94A						.						144.0	134.0	137.0					5																	59284493		1568	3582	5150	SO:0001583	missense	5144	exon3			CCATTCCGCGGAA		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000502484.2:c.94G>A	chr5.hg19:g.59284493C>T	ENSP00000423094:p.Gly32Arg	1888.0	1.0		1507.0	439.0	NM_001165899	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000502484.2	hg19	CCDS54859.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.517810	0.44763	.	.	ENSG00000113448	ENST00000502484;ENST00000546160;ENST00000505507;ENST00000514552	T;T	0.68624	-0.34;-0.34	5.86	5.86	0.93980	.	.	.	.	.	D	0.82309	0.5009	.	.	.	0.32133	N	0.586447	D;P	0.89917	1.0;0.941	D;B	0.69479	0.964;0.232	T	0.83227	-0.0065	8	0.52906	T	0.07	.	20.1854	0.98212	0.0:1.0:0.0:0.0	.	32;32	D6RIG1;Q08499-11	.;.	R	32	ENSP00000423094:G32R;ENSP00000442734:G32R	ENSP00000423094:G32R	G	-	1	0	PDE4D	59320250	0.999000	0.42202	0.919000	0.36401	0.412000	0.31113	4.681000	0.61663	2.772000	0.95346	0.585000	0.79938	GGA	.	.		0.433	PDE4D-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368094.3		
PCDHGB3	56102	hgsc.bcm.edu	37	5	140751548	140751548	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr5:140751548G>A	ENST00000576222.1	+	1	1718	c.1587G>A	c.(1585-1587)gaG>gaA	p.E529E	PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_5'Flank|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	529	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCCTTCGAGCTCACTCTGC	0.692																																					p.E529E		Atlas-SNP	.											.	PCDHGB3	168	.	0			c.G1587A						.						34.0	41.0	39.0					5																	140751548		2132	4233	6365	SO:0001819	synonymous_variant	56102	exon1			CTTCGAGCTCACT	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.1587G>A	chr5.hg19:g.140751548G>A		110.0	0.0		90.0	25.0	NM_018924	A7E229|Q9Y5C7	Silent	SNP	ENST00000576222.1	hg19	CCDS58980.1																																																																																			.	.		0.692	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
DUSP1	1843	hgsc.bcm.edu	37	5	172196041	172196041	+	Silent	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr5:172196041A>G	ENST00000239223.3	-	4	1070	c.828T>C	c.(826-828)acT>acC	p.T276T	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	276	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		TGACTCGATTAGTCCTCATAA	0.527																																					p.T276T		Atlas-SNP	.											.	DUSP1	27	.	0			c.T828C						.						83.0	79.0	80.0					5																	172196041		2203	4300	6503	SO:0001819	synonymous_variant	1843	exon4			TCGATTAGTCCTC	X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.828T>C	chr5.hg19:g.172196041A>G		89.0	0.0		93.0	8.0	NM_004417	D3DQL9|Q2V508	Silent	SNP	ENST00000239223.3	hg19	CCDS4380.1																																																																																			.	.		0.527	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252943.3	NM_004417	
PXDC1	221749	hgsc.bcm.edu	37	6	3751735	3751735	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:3751735G>A	ENST00000380283.4	-	1	525	c.31C>T	c.(31-33)Ctc>Ttc	p.L11F	PXDC1_ENST00000477592.2_5'UTR|RP11-420L9.5_ENST00000603791.1_RNA	NM_183373.3	NP_899229.2	Q5TGL8	PXDC1_HUMAN	PX domain containing 1	11	PX.						phosphatidylinositol binding (GO:0035091)										ATGTTCACGAGCGACGTGCCC	0.721																																					p.L11F		Atlas-SNP	.											.	.	.	.	0			c.C31T						.						15.0	14.0	14.0					6																	3751735		2188	4279	6467	SO:0001583	missense	221749	exon1			TCACGAGCGACGT	AJ420534	CCDS4486.1	6p25.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000168994	ENSG00000168994			21361	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 145"""	C6orf145			Standard	NM_183373		Approved		uc003mvt.2	Q5TGL8	OTTHUMG00000014146	ENST00000380283.4:c.31C>T	chr6.hg19:g.3751735G>A	ENSP00000369636:p.Leu11Phe	154.0	0.0		106.0	30.0	NM_183373	A8K0N3|Q6PGP0|Q86XB7	Missense_Mutation	SNP	ENST00000380283.4	hg19	CCDS4486.1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408810	0.62399	.	.	ENSG00000168994	ENST00000380283	T	0.42513	0.97	3.33	2.42	0.29668	.	0.187054	0.36338	U	0.002649	T	0.30823	0.0777	M	0.63428	1.95	0.58432	D	0.999991	P	0.46395	0.877	P	0.45377	0.478	T	0.18903	-1.0322	10	0.66056	D	0.02	-5.6091	11.8787	0.52562	0.0:0.0:0.8235:0.1765	.	11	Q5TGL8	CF145_HUMAN	F	11	ENSP00000369636:L11F	ENSP00000369636:L11F	L	-	1	0	C6orf145	3696734	1.000000	0.71417	0.966000	0.40874	0.990000	0.78478	5.170000	0.64990	0.489000	0.27749	0.454000	0.30748	CTC	.	.		0.721	PXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039688.1	NM_183373	
COL12A1	1303	hgsc.bcm.edu	37	6	75902065	75902065	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:75902065G>A	ENST00000322507.8	-	4	506	c.197C>T	c.(196-198)cCt>cTt	p.P66L	COL12A1_ENST00000483888.2_Missense_Mutation_p.P66L|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Missense_Mutation_p.P66L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	66	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TTCTTTAGTAGGCCCATCTGG	0.323																																					p.P66L		Atlas-SNP	.											.	COL12A1	385	.	0			c.C197T						.						85.0	74.0	78.0					6																	75902065		1804	4070	5874	SO:0001583	missense	1303	exon4			TTAGTAGGCCCAT	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.197C>T	chr6.hg19:g.75902065G>A	ENSP00000325146:p.Pro66Leu	111.0	0.0		85.0	20.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780374	0.90195	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.56444	0.46;0.46;0.46	5.91	5.91	0.95273	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.62319	0.2418	L	0.50333	1.59	0.80722	D	1	D	0.71674	0.998	D	0.64877	0.93	T	0.60611	-0.7229	10	0.54805	T	0.06	.	20.3011	0.98612	0.0:0.0:1.0:0.0	.	66	Q99715	COCA1_HUMAN	L	66	ENSP00000325146:P66L;ENSP00000412864:P66L;ENSP00000421216:P66L	ENSP00000325146:P66L	P	-	2	0	COL12A1	75958785	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.647000	0.74354	2.804000	0.96469	0.650000	0.86243	CCT	.	.		0.323	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
FAM46A	55603	hgsc.bcm.edu	37	6	82459733	82459733	+	Silent	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:82459733C>T	ENST00000320172.6	-	3	1322	c.1008G>A	c.(1006-1008)ctG>ctA	p.L336L	FAM46A_ENST00000369756.3_Silent_p.L417L|FAM46A_ENST00000369754.3_Silent_p.L355L	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	336					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		AATAGGACTCCAGTTTTCTCT	0.463																																					p.L336L		Atlas-SNP	.											.	FAM46A	37	.	0			c.G1008A						.						99.0	93.0	95.0					6																	82459733		2203	4300	6503	SO:0001819	synonymous_variant	55603	exon3			GGACTCCAGTTTT	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.1008G>A	chr6.hg19:g.82459733C>T		147.0	0.0		114.0	32.0	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	hg19	CCDS34489.1																																																																																			.	.		0.463	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
ZNF292	23036	hgsc.bcm.edu	37	6	87943233	87943233	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:87943233G>T	ENST00000369577.3	+	5	772	c.729G>T	c.(727-729)aaG>aaT	p.K243N	ZNF292_ENST00000339907.4_Missense_Mutation_p.K238N	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	243						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CAAATGGAAAGTTAATCGAAG	0.313																																					p.K243N		Atlas-SNP	.											.	ZNF292	479	.	0			c.G729T						.						139.0	134.0	135.0					6																	87943233		1846	4087	5933	SO:0001583	missense	23036	exon5			TGGAAAGTTAATC	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.729G>T	chr6.hg19:g.87943233G>T	ENSP00000358590:p.Lys243Asn	199.0	0.0		175.0	39.0	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	hg19	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974420	0.53720	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.07327	3.2;3.21	5.23	4.35	0.52113	.	0.158347	0.56097	D	0.000021	T	0.03263	0.0095	N	0.22421	0.69	0.36852	D	0.887929	P	0.44627	0.839	B	0.41088	0.347	T	0.44892	-0.9298	10	0.54805	T	0.06	.	14.0139	0.64513	0.0734:0.0:0.9266:0.0	.	243	O60281	ZN292_HUMAN	N	243;238	ENSP00000358590:K243N;ENSP00000342847:K238N	ENSP00000342847:K238N	K	+	3	2	ZNF292	87999952	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	3.397000	0.52572	1.332000	0.45431	0.460000	0.39030	AAG	.	.		0.313	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
PNISR	25957	hgsc.bcm.edu	37	6	99849338	99849338	+	Missense_Mutation	SNP	T	T	C	rs544853512	byFrequency	TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:99849338T>C	ENST00000369239.5	-	12	1700	c.1496A>G	c.(1495-1497)cAt>cGt	p.H499R	PNISR_ENST00000438806.1_Missense_Mutation_p.H499R	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	499						cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TTTTTCTTTATGCTCTTTTTT	0.378													T|||	2	0.000399361	0.0015	0.0	5008	,	,		19327	0.0		0.0	False		,,,				2504	0.0				p.H499R		Atlas-SNP	.											.	PNISR	74	.	0			c.A1496G						.						99.0	99.0	99.0					6																	99849338		2203	4300	6503	SO:0001583	missense	25957	exon11			TCTTTATGCTCTT	AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.1496A>G	chr6.hg19:g.99849338T>C	ENSP00000358242:p.His499Arg	99.0	0.0		90.0	21.0	NM_015491	A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	ENST00000369239.5	hg19	CCDS5043.1	.	.	.	.	.	.	.	.	.	.	T	4.946	0.175777	0.09391	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	.	.	.	4.82	4.82	0.62117	.	0.343432	0.32120	N	0.006547	T	0.06325	0.0163	N	0.14661	0.345	0.28096	N	0.931621	B	0.19331	0.035	B	0.17098	0.017	T	0.22661	-1.0210	9	0.16420	T	0.52	.	3.9444	0.09343	0.1856:0.0999:0.0:0.7145	.	499	Q8TF01	PNISR_HUMAN	R	499	.	ENSP00000358242:H499R	H	-	2	0	PNISR	99956059	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.299000	0.43611	2.156000	0.67533	0.472000	0.43445	CAT	.	.		0.378	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041598.1	NM_032870	
TNFAIP3	7128	hgsc.bcm.edu	37	6	138202372	138202372	+	Silent	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:138202372G>T	ENST00000237289.4	+	9	2355	c.2289G>T	c.(2287-2289)cgG>cgT	p.R763R		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	763	Interaction with TNIP1. {ECO:0000250}.|Required for lysosomal localization and for TRAF2 lysosomal degradation.|Sufficient for inhibitory activity of TNF-induced NF-kappa-B activity. {ECO:0000250}.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		AGCGTTGCCGGGCCCCCGCCT	0.607			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																p.R763R	GBM(130;153 1739 22295 28918 47987)	Atlas-SNP	.		Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	.	TNFAIP3	340	.	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)	c.G2289T						.						53.0	61.0	58.0					6																	138202372		2202	4299	6501	SO:0001819	synonymous_variant	7128	exon9			TTGCCGGGCCCCC	M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.2289G>T	chr6.hg19:g.138202372G>T		166.0	0.0		143.0	40.0	NM_001270507	B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Silent	SNP	ENST00000237289.4	hg19	CCDS5187.1																																																																																			.	.		0.607	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042414.1		
REPS1	85021	hgsc.bcm.edu	37	6	139238740	139238740	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:139238740G>C	ENST00000450536.2	-	13	2127	c.1553C>G	c.(1552-1554)tCt>tGt	p.S518C	REPS1_ENST00000258062.5_Missense_Mutation_p.S517C|REPS1_ENST00000367663.4_Missense_Mutation_p.S491C|REPS1_ENST00000409812.2_Intron|REPS1_ENST00000415951.2_Missense_Mutation_p.S491C			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	518					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		AGAAGTAAAAGAGTCTGAACT	0.338																																					p.S517C		Atlas-SNP	.											.	REPS1	58	.	0			c.C1550G						.						127.0	117.0	121.0					6																	139238740		2203	4300	6503	SO:0001583	missense	85021	exon13			GTAAAAGAGTCTG		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1553C>G	chr6.hg19:g.139238740G>C	ENSP00000392065:p.Ser518Cys	76.0	0.0		77.0	19.0	NM_031922	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	ENST00000450536.2	hg19		.	.	.	.	.	.	.	.	.	.	G	25.8	4.673845	0.88445	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000529597;ENST00000258062;ENST00000415951;ENST00000367668	T;T;T;T;T	0.35605	1.31;1.3;1.3;1.31;1.31	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.50034	0.1592	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.997	D;D;D;P	0.85130	0.997;0.995;0.993;0.817	T	0.43294	-0.9400	10	0.62326	D	0.03	-18.0709	18.7754	0.91910	0.0:0.0:1.0:0.0	.	517;466;518;491	Q96D71-3;B2R7D3;Q96D71;E9PMG1	.;.;REPS1_HUMAN;.	C	518;491;476;517;491;466	ENSP00000392065:S518C;ENSP00000356635:S491C;ENSP00000434251:S476C;ENSP00000258062:S517C;ENSP00000397941:S491C	ENSP00000258062:S517C	S	-	2	0	REPS1	139280433	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.668000	0.74457	2.873000	0.98535	0.563000	0.77884	TCT	.	.		0.338	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3		
SCIN	85477	hgsc.bcm.edu	37	7	12617696	12617696	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr7:12617696G>A	ENST00000297029.5	+	2	308	c.207G>A	c.(205-207)gaG>gaA	p.E69E		NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	69	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TAGGAAAGGAGTGTTCCCAGG	0.408																																					p.E69E		Atlas-SNP	.											.	SCIN	105	.	0			c.G207A						.						90.0	74.0	79.0					7																	12617696		692	1591	2283	SO:0001819	synonymous_variant	85477	exon2			AAAGGAGTGTTCC	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.207G>A	chr7.hg19:g.12617696G>A		106.0	0.0		96.0	24.0	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Silent	SNP	ENST00000297029.5	hg19	CCDS47545.1																																																																																			.	.		0.408	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
PLXNA4	91584	hgsc.bcm.edu	37	7	131883359	131883359	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr7:131883359T>C	ENST00000359827.3	-	13	3585	c.2623A>G	c.(2623-2625)Aag>Gag	p.K875E	PLXNA4_ENST00000321063.4_Missense_Mutation_p.K875E			Q9HCM2	PLXA4_HUMAN	plexin A4	875	IPT/TIG 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ATAGTGACCTTGGTGCCCCCT	0.552																																					p.K875E		Atlas-SNP	.											.	PLXNA4	873	.	0			c.A2623G						.						68.0	70.0	69.0					7																	131883359		1885	4104	5989	SO:0001583	missense	91584	exon13			TGACCTTGGTGCC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2623A>G	chr7.hg19:g.131883359T>C	ENSP00000352882:p.Lys875Glu	73.0	0.0		68.0	18.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	T	17.53	3.412286	0.62511	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.76316	-1.01;-1.01	5.94	5.94	0.96194	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.109437	0.64402	D	0.000007	T	0.63390	0.2507	L	0.27053	0.805	0.38548	D	0.949382	B	0.26547	0.152	B	0.29440	0.102	T	0.59974	-0.7353	10	0.02654	T	1	.	12.8606	0.57911	0.0:0.0:0.1357:0.8643	.	875	Q9HCM2	PLXA4_HUMAN	E	875	ENSP00000323194:K875E;ENSP00000352882:K875E	ENSP00000323194:K875E	K	-	1	0	PLXNA4	131533899	0.893000	0.30496	1.000000	0.80357	0.999000	0.98932	2.260000	0.43267	2.275000	0.75901	0.528000	0.53228	AAG	.	.		0.552	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
GALNTL5	168391	hgsc.bcm.edu	37	7	151704964	151704964	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr7:151704964G>T	ENST00000392800.2	+	7	1215	c.961G>T	c.(961-963)Gaa>Taa	p.E321*	GALNTL5_ENST00000483959.1_3'UTR|GALNTL5_ENST00000431418.2_Nonsense_Mutation_p.E321*	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	321	Catalytic subdomain B.				spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TTATTTTAATGAAATTGGACA	0.328																																					p.E321X		Atlas-SNP	.											GALNTL5,colon,carcinoma,0,1	GALNTL5	87	.	0			c.G961T						.						116.0	119.0	118.0					7																	151704964		2203	4300	6503	SO:0001587	stop_gained	168391	exon7			TTTAATGAAATTG	AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.961G>T	chr7.hg19:g.151704964G>T	ENSP00000376548:p.Glu321*	248.0	0.0		191.0	51.0	NM_145292	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Nonsense_Mutation	SNP	ENST00000392800.2	hg19	CCDS5929.1	.	.	.	.	.	.	.	.	.	.	G	36	5.943700	0.97128	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	.	.	.	4.68	3.8	0.43715	.	0.788243	0.10557	N	0.660721	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	11.9562	0.52983	0.084:0.0:0.916:0.0	.	.	.	.	X	321	.	ENSP00000376548:E321X	E	+	1	0	GALNTL5	151335897	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	3.739000	0.55075	1.194000	0.43101	0.632000	0.83419	GAA	.	.		0.328	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348395.1	NM_145292	
KMT2C	58508	hgsc.bcm.edu	37	7	151944994	151944994	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr7:151944994G>T	ENST00000262189.6	-	14	2743	c.2525C>A	c.(2524-2526)tCc>tAc	p.S842Y	KMT2C_ENST00000355193.2_Missense_Mutation_p.S842Y	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	842					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TACCTGTTTGGACCGAGGTCT	0.378																																					p.S842Y		Atlas-SNP	.											.	MLL3	1564	.	0			c.C2525A						.						114.0	104.0	107.0					7																	151944994		2203	4297	6500	SO:0001583	missense	58508	exon14			TGTTTGGACCGAG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2525C>A	chr7.hg19:g.151944994G>T	ENSP00000262189:p.Ser842Tyr	332.0	0.0		299.0	21.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026519	0.54683	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.84070	-1.8;-1.8	5.67	5.67	0.87782	.	0.000000	0.44285	D	0.000478	D	0.85318	0.5669	N	0.22421	0.69	0.80722	D	1	D	0.71674	0.998	D	0.63488	0.915	D	0.85809	0.1378	10	0.48119	T	0.1	.	19.7692	0.96356	0.0:0.0:1.0:0.0	.	842	Q8NEZ4	MLL3_HUMAN	Y	842	ENSP00000262189:S842Y;ENSP00000347325:S842Y	ENSP00000262189:S842Y	S	-	2	0	MLL3	151575927	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.939000	0.75911	2.658000	0.90341	0.650000	0.86243	TCC	.	.		0.378	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
TTI2	80185	hgsc.bcm.edu	37	8	33360968	33360968	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr8:33360968A>C	ENST00000431156.2	-	6	1856	c.1238T>G	c.(1237-1239)cTc>cGc	p.L413R	TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000520636.1_Missense_Mutation_p.L382R|TTI2_ENST00000360742.5_Missense_Mutation_p.L413R	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	413																	ATGTTGCATGAGAAGTTTTAG	0.418																																					p.L413R		Atlas-SNP	.											.	.	.	.	0			c.T1238G						.						132.0	131.0	131.0					8																	33360968		2203	4300	6503	SO:0001583	missense	80185	exon6			TGCATGAGAAGTT	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1238T>G	chr8.hg19:g.33360968A>C	ENSP00000411169:p.Leu413Arg	130.0	0.0		77.0	31.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.378128	0.82682	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636	T;T;T	0.74421	-0.74;-0.74;-0.84	6.17	5.04	0.67666	.	0.437819	0.20832	N	0.084870	T	0.69593	0.3128	L	0.51422	1.61	0.80722	D	1	P;P	0.49961	0.93;0.93	P;P	0.48030	0.564;0.564	T	0.72633	-0.4234	10	0.66056	D	0.02	-5.7749	3.7509	0.08566	0.7161:0.0:0.2839:0.0	.	413;382	Q6NXR4;E5RIH5	TTI2_HUMAN;.	R	413;413;402;382	ENSP00000353971:L413R;ENSP00000411169:L413R;ENSP00000428401:L382R	ENSP00000353971:L413R	L	-	2	0	C8orf41	33480510	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	5.064000	0.64338	2.371000	0.80710	0.533000	0.62120	CTC	.	.		0.418	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
MTFR1	9650	hgsc.bcm.edu	37	8	66617100	66617100	+	Silent	SNP	T	T	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr8:66617100T>G	ENST00000262146.4	+	5	579	c.453T>G	c.(451-453)ctT>ctG	p.L151L	MTFR1_ENST00000517944.1_3'UTR|MTFR1_ENST00000458689.2_Silent_p.L118L	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	151					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AAAATGAACTTGCTGCTCTCA	0.468																																					p.L151L		Atlas-SNP	.											.	MTFR1	26	.	0			c.T453G						.						34.0	35.0	34.0					8																	66617100		2203	4300	6503	SO:0001819	synonymous_variant	9650	exon5			TGAACTTGCTGCT		CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.453T>G	chr8.hg19:g.66617100T>G		213.0	0.0		339.0	200.0	NM_014637	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Silent	SNP	ENST00000262146.4	hg19	CCDS6182.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.387408	0.25031	.	.	ENSG00000066855	ENST00000518800	T	0.72835	-0.69	5.39	-1.92	0.07618	.	0.000000	0.85682	D	0.000000	T	0.67325	0.2881	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63492	-0.6625	7	0.87932	D	0	1.5451	2.8746	0.05627	0.1152:0.3252:0.1069:0.4528	.	.	.	.	W	109	ENSP00000430621:L109W	ENSP00000430621:L109W	L	+	2	0	MTFR1	66779654	0.030000	0.19436	0.999000	0.59377	0.990000	0.78478	-1.119000	0.03276	0.051000	0.15978	0.460000	0.39030	TTG	.	.		0.468	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378894.1	NM_014637	
PRDM14	63978	hgsc.bcm.edu	37	8	70981937	70981937	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr8:70981937G>A	ENST00000276594.2	-	2	360	c.159C>T	c.(157-159)ttC>ttT	p.F53F		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	53					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			CCAGCTGCCGGAAAGGTTGGA	0.662																																					p.F53F	NSCLC(129;99 1813 5906 40656 46114)	Atlas-SNP	.											.	PRDM14	102	.	0			c.C159T						.						11.0	11.0	11.0					8																	70981937		2185	4277	6462	SO:0001819	synonymous_variant	63978	exon2			CTGCCGGAAAGGT	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.159C>T	chr8.hg19:g.70981937G>A		84.0	0.0		135.0	22.0	NM_024504	Q86UX9	Silent	SNP	ENST00000276594.2	hg19	CCDS6206.1																																																																																			.	.		0.662	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
VPS13B	157680	hgsc.bcm.edu	37	8	100147862	100147862	+	Silent	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr8:100147862G>T	ENST00000358544.2	+	11	1575	c.1464G>T	c.(1462-1464)acG>acT	p.T488T	VPS13B_ENST00000355155.1_Silent_p.T488T|VPS13B_ENST00000357162.2_Silent_p.T488T|VPS13B_ENST00000395996.1_Silent_p.T488T	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	488					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ATTTGAGTACGAAAGGTTTCA	0.338																																					p.T488T	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											VPS13B_ENST00000357162,NS,carcinoma,0,2	VPS13B	811	.	0			c.G1464T						.						144.0	128.0	134.0					8																	100147862		2202	4299	6501	SO:0001819	synonymous_variant	157680	exon11			GAGTACGAAAGGT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1464G>T	chr8.hg19:g.100147862G>T		149.0	1.0		227.0	142.0	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	ENST00000358544.2	hg19	CCDS6280.1																																																																																			.	.		0.338	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
RSPO2	340419	hgsc.bcm.edu	37	8	108970401	108970401	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr8:108970401G>A	ENST00000276659.5	-	5	1143	c.523C>T	c.(523-525)Caa>Taa	p.Q175*	RSPO2_ENST00000517781.1_Nonsense_Mutation_p.Q111*|RSPO2_ENST00000517939.1_Nonsense_Mutation_p.Q108*|RSPO2_ENST00000378439.2_Nonsense_Mutation_p.Q111*	NM_178565.4	NP_848660.3	Q6UXX9	RSPO2_HUMAN	R-spondin 2	175	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				bone mineralization (GO:0030282)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|lung growth (GO:0060437)|osteoblast differentiation (GO:0001649)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|receptor binding (GO:0005102)		EIF3E/RSPO2(6)	haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	28			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			TTAACAATTTGCCGTGTTCTG	0.443																																					p.Q175X		Atlas-SNP	.											.	RSPO2	65	.	0			c.C523T						.						250.0	229.0	236.0					8																	108970401		2203	4300	6503	SO:0001587	stop_gained	340419	exon5			CAATTTGCCGTGT	AK123023	CCDS6307.1, CCDS64953.1	8q23.1	2014-01-30	2011-06-29		ENSG00000147655	ENSG00000147655		"""Endogenous ligands"""	28583	protein-coding gene	gene with protein product		610575	"""R-spondin 2 homolog (Xenopus laevis)"""			15469841	Standard	NM_178565		Approved	MGC35555	uc003yms.3	Q6UXX9	OTTHUMG00000164893	ENST00000276659.5:c.523C>T	chr8.hg19:g.108970401G>A	ENSP00000276659:p.Gln175*	183.0	0.0		230.0	118.0	NM_178565	B3KVP0|Q4G0U4|Q8N6X6	Nonsense_Mutation	SNP	ENST00000276659.5	hg19	CCDS6307.1	.	.	.	.	.	.	.	.	.	.	G	41	8.907511	0.98998	.	.	ENSG00000147655	ENST00000517939;ENST00000517781;ENST00000378439;ENST00000276659;ENST00000521502	.	.	.	5.9	5.9	0.94986	.	0.049429	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-5.2068	20.2723	0.98479	0.0:0.0:1.0:0.0	.	.	.	.	X	108;111;111;175;108	.	ENSP00000276659:Q175X	Q	-	1	0	RSPO2	109039577	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.444000	0.97578	2.793000	0.96121	0.563000	0.77884	CAA	.	.		0.443	RSPO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380830.1	NM_178565	
ATAD2	29028	hgsc.bcm.edu	37	8	124373808	124373808	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr8:124373808C>G	ENST00000287394.5	-	9	1235	c.1128G>C	c.(1126-1128)agG>agC	p.R376S	ATAD2_ENST00000534257.1_5'UTR|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	376					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			GACTCCTTTTCCTCCGCCTCT	0.383																																					p.R376S		Atlas-SNP	.											.	ATAD2	160	.	0			c.G1128C						.						145.0	144.0	144.0					8																	124373808		2203	4300	6503	SO:0001583	missense	29028	exon9			CCTTTTCCTCCGC	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1128G>C	chr8.hg19:g.124373808C>G	ENSP00000287394:p.Arg376Ser	87.0	0.0		130.0	6.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	hg19	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772672	0.49680	.	.	ENSG00000156802	ENST00000287394	D	0.92048	-2.96	5.59	-1.02	0.10135	.	0.276047	0.45606	D	0.000359	D	0.86535	0.5956	L	0.43923	1.385	0.80722	D	1	B;B	0.34264	0.382;0.446	B;B	0.35727	0.209;0.15	T	0.77186	-0.2680	10	0.22109	T	0.4	-12.1846	12.6492	0.56751	0.0:0.7707:0.0:0.2293	.	206;376	Q6PL18-2;Q6PL18	.;ATAD2_HUMAN	S	376	ENSP00000287394:R376S	ENSP00000287394:R376S	R	-	3	2	ATAD2	124442989	0.794000	0.28838	0.961000	0.40146	0.978000	0.69477	-0.016000	0.12613	-0.145000	0.11294	-0.290000	0.09829	AGG	.	.		0.383	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	
TLN1	7094	hgsc.bcm.edu	37	9	35707195	35707195	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr9:35707195G>T	ENST00000314888.9	-	37	5182	c.4829C>A	c.(4828-4830)gCc>gAc	p.A1610D	TLN1_ENST00000540444.1_Missense_Mutation_p.A1610D|TLN1_ENST00000464379.1_Intron	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1610	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GAGTCCCCCGGCACTCTCTAA	0.647																																					p.A1610D		Atlas-SNP	.											.	TLN1	185	.	0			c.C4829A						.						43.0	51.0	48.0					9																	35707195		2203	4300	6503	SO:0001583	missense	7094	exon37			CCCCCGGCACTCT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4829C>A	chr9.hg19:g.35707195G>T	ENSP00000316029:p.Ala1610Asp	53.0	0.0		45.0	9.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190975	0.78789	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.16196	2.36;2.36	5.69	5.69	0.88448	.	0.111909	0.64402	D	0.000007	T	0.21718	0.0523	N	0.24115	0.695	0.58432	D	0.999998	B	0.27264	0.173	B	0.40134	0.32	T	0.11251	-1.0595	10	0.66056	D	0.02	-10.7986	19.7999	0.96502	0.0:0.0:1.0:0.0	.	1610	Q9Y490	TLN1_HUMAN	D	1610	ENSP00000316029:A1610D;ENSP00000442981:A1610D	ENSP00000316029:A1610D	A	-	2	0	TLN1	35697195	1.000000	0.71417	0.989000	0.46669	0.951000	0.60555	9.754000	0.98908	2.691000	0.91804	0.561000	0.74099	GCC	.	.		0.647	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
LMX1B	4010	hgsc.bcm.edu	37	9	129376817	129376817	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr9:129376817T>C	ENST00000373474.4	+	1	96	c.89T>C	c.(88-90)aTg>aCg	p.M30T	RP11-123K19.1_ENST00000432418.1_RNA|LMX1B_ENST00000561065.1_Missense_Mutation_p.M7T|LMX1B_ENST00000526117.1_Missense_Mutation_p.M30T|RP11-123K19.1_ENST00000451449.2_RNA|RP11-123K19.1_ENST00000425370.1_RNA|LMX1B_ENST00000355497.5_Missense_Mutation_p.M30T|LMX1B_ENST00000425646.2_Missense_Mutation_p.M7T			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	30					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						GGCATCAAGATGGAGGAGCAC	0.697									Nail-Patella Syndrome																												p.M30T	Pancreas(110;1796 2278 18357 20466)	Atlas-SNP	.											.	LMX1B	86	.	0			c.T89C						.						20.0	19.0	19.0					9																	129376817		2197	4296	6493	SO:0001583	missense	4010	exon1	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	TCAAGATGGAGGA	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.89T>C	chr9.hg19:g.129376817T>C	ENSP00000362573:p.Met30Thr	111.0	0.0		83.0	20.0	NM_001174146	F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	hg19	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	t	14.60	2.585038	0.46110	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	D;D;D;D	0.85556	-1.85;-1.83;-2.0;-1.91	3.04	3.04	0.35103	.	0.167683	0.51477	U	0.000092	T	0.75236	0.3822	L	0.29908	0.895	0.36961	D	0.893359	B;B;B	0.27679	0.116;0.116;0.185	B;B;B	0.29862	0.055;0.046;0.108	T	0.71856	-0.4466	10	0.23302	T	0.38	.	10.2391	0.43301	0.0:0.0:0.0:1.0	.	7;7;30	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	T	30;30;30;7	ENSP00000436930:M30T;ENSP00000362573:M30T;ENSP00000347684:M30T;ENSP00000390923:M7T	ENSP00000347684:M30T	M	+	2	0	LMX1B	128416638	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.751000	0.62169	1.284000	0.44531	0.319000	0.21371	ATG	.	.		0.697	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
WDR37	22884	hgsc.bcm.edu	37	10	1094891	1094891	+	5'Flank	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr10:1094891C>A	ENST00000358220.1	+	0	0				IDI1_ENST00000381344.3_Missense_Mutation_p.R18L|IDI1_ENST00000491735.1_5'UTR			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37											breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		CCACTggccccgcccccgggc	0.716																																					p.R18L		Atlas-SNP	.											.	IDI1	22	.	0			c.G53T						.						6.0	7.0	6.0					10																	1094891		2081	4102	6183	SO:0001631	upstream_gene_variant	3422	exon1			TGGCCCCGCCCCC	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540		chr10.hg19:g.1094891C>A	Exception_encountered	111.0	0.0		74.0	20.0	NM_004508	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	hg19	CCDS7057.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162470	0.57368	.	.	ENSG00000067064	ENST00000381344	.	.	.	1.67	1.67	0.24075	.	0.429373	0.14188	U	0.335564	T	0.16428	0.0395	.	.	.	0.09310	N	1	B	0.26081	0.141	B	0.13407	0.009	T	0.19549	-1.0302	8	0.13108	T	0.6	.	6.9709	0.24648	0.0:1.0:0.0:0.0	.	18	Q13907-2	.	L	18	.	ENSP00000370748:R18L	R	-	2	0	IDI1	1084891	0.013000	0.17824	0.074000	0.20217	0.019000	0.09904	0.778000	0.26732	1.288000	0.44600	0.472000	0.43445	CGG	.	.		0.716	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
IL2RA	3559	hgsc.bcm.edu	37	10	6061870	6061870	+	Silent	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr10:6061870A>G	ENST00000379959.3	-	5	791	c.618T>C	c.(616-618)cgT>cgC	p.R206R	IL2RA_ENST00000379954.1_Silent_p.R134R|IL2RA_ENST00000256876.6_Silent_p.R197R|SNORA14_ENST00000516113.1_RNA	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	206					activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)			endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CACTCTCAGGACGGCCTTCGG	0.592																																					p.R206R		Atlas-SNP	.											.	IL2RA	37	.	0			c.T618C						.						125.0	110.0	115.0					10																	6061870		2203	4300	6503	SO:0001819	synonymous_variant	3559	exon5			CTCAGGACGGCCT	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.618T>C	chr10.hg19:g.6061870A>G		60.0	0.0		65.0	16.0	NM_000417	Q5W007	Silent	SNP	ENST00000379959.3	hg19	CCDS7076.1																																																																																			.	.		0.592	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046627.1	NM_000417	
KAT6B	23522	hgsc.bcm.edu	37	10	76789928	76789928	+	Silent	SNP	T	T	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr10:76789928T>A	ENST00000287239.4	+	18	5835	c.5346T>A	c.(5344-5346)gcT>gcA	p.A1782A	KAT6B_ENST00000372714.1_Silent_p.A1490A|KAT6B_ENST00000372724.1_Silent_p.A1490A|KAT6B_ENST00000372711.1_Silent_p.A1599A|KAT6B_ENST00000372725.1_Silent_p.A1490A	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1782	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TGCAGCTGGCTGAAATCCCCG	0.592																																					p.A1782A		Atlas-SNP	.											.	.	.	.	0			c.T5346A						.						50.0	49.0	50.0					10																	76789928		2203	4300	6503	SO:0001819	synonymous_variant	23522	exon18			GCTGGCTGAAATC	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5346T>A	chr10.hg19:g.76789928T>A		74.0	0.0		63.0	25.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	ENST00000287239.4	hg19	CCDS7345.1																																																																																			.	.		0.592	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
CDHR1	92211	hgsc.bcm.edu	37	10	85970828	85970828	+	Silent	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr10:85970828C>T	ENST00000372117.3	+	13	1495	c.1392C>T	c.(1390-1392)gaC>gaT	p.D464D	CDHR1_ENST00000440770.2_Intron|CDHR1_ENST00000332904.3_Silent_p.D464D	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	464	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						AGCTCCTGGACACCAATGACA	0.567																																					p.D464D		Atlas-SNP	.											.	CDHR1	122	.	0			c.C1392T						.						130.0	125.0	127.0					10																	85970828		2203	4300	6503	SO:0001819	synonymous_variant	92211	exon13			CCTGGACACCAAT	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1392C>T	chr10.hg19:g.85970828C>T		155.0	0.0		132.0	33.0	NM_001171971	Q69YZ8|Q8IXY5	Silent	SNP	ENST00000372117.3	hg19	CCDS7372.1																																																																																			.	.		0.567	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
SLIT1	6585	hgsc.bcm.edu	37	10	98766260	98766260	+	Missense_Mutation	SNP	G	G	A	rs546232285		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr10:98766260G>A	ENST00000266058.4	-	32	3804	c.3559C>T	c.(3559-3561)Cgg>Tgg	p.R1187W	SLIT1_ENST00000371070.4_Missense_Mutation_p.R1187W|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1187	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		ATGTTGGCCCGTGGCCAGTTT	0.592																																					p.R1187W		Atlas-SNP	.											SLIT1,colon,carcinoma,0,1	SLIT1	154	.	0			c.C3559T						.						61.0	45.0	51.0					10																	98766260		2203	4300	6503	SO:0001583	missense	6585	exon32			TGGCCCGTGGCCA	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.3559C>T	chr10.hg19:g.98766260G>A	ENSP00000266058:p.Arg1187Trp	193.0	0.0		135.0	6.0	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	hg19	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620157	0.66787	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	T;T	0.69926	-0.44;-0.44	4.93	1.92	0.25849	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.059637	0.64402	D	0.000001	T	0.69557	0.3124	L	0.61036	1.89	0.80722	D	1	D	0.67145	0.996	P	0.49999	0.628	T	0.73069	-0.4099	10	0.87932	D	0	.	13.9426	0.64064	0.0:0.0:0.4775:0.5225	.	1187	O75093	SLIT1_HUMAN	W	1187	ENSP00000266058:R1187W;ENSP00000360109:R1187W	ENSP00000266058:R1187W	R	-	1	2	SLIT1	98756250	1.000000	0.71417	0.286000	0.24833	0.987000	0.75469	3.682000	0.54656	0.220000	0.20860	0.655000	0.94253	CGG	.	.		0.592	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
OR51A7	119687	hgsc.bcm.edu	37	11	4929013	4929013	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:4929013C>A	ENST00000359350.4	+	1	414	c.414C>A	c.(412-414)agC>agA	p.S138R	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCCTCACTAGCAACAGGGTTG	0.378																																					p.S138R		Atlas-SNP	.											.	OR51A7	86	.	0			c.C414A						.						95.0	94.0	95.0					11																	4929013		2201	4298	6499	SO:0001583	missense	119687	exon1			CACTAGCAACAGG	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.414C>A	chr11.hg19:g.4929013C>A	ENSP00000352305:p.Ser138Arg	80.0	0.0		90.0	31.0	NM_001004749	Q6IFH8	Missense_Mutation	SNP	ENST00000359350.4	hg19	CCDS31364.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948442	0.34377	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.71222	-0.55	5.02	1.96	0.26148	GPCR, rhodopsin-like superfamily (1);	0.366598	0.23690	N	0.045532	T	0.59972	0.2233	L	0.37750	1.13	0.09310	N	1	P	0.46064	0.872	P	0.45794	0.493	T	0.53528	-0.8426	10	0.62326	D	0.03	.	5.4416	0.16511	0.0:0.5314:0.0:0.4686	.	138	Q8NH64	O51A7_HUMAN	R	138;138;127	ENSP00000352305:S138R	ENSP00000352305:S138R	S	+	3	2	OR51A7	4885589	0.000000	0.05858	0.112000	0.21494	0.814000	0.46013	-2.149000	0.01291	0.712000	0.32039	0.655000	0.94253	AGC	.	.		0.378	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
CKAP5	9793	hgsc.bcm.edu	37	11	46817191	46817191	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:46817191T>C	ENST00000529230.1	-	13	1649	c.1603A>G	c.(1603-1605)Att>Gtt	p.I535V	CKAP5_ENST00000415402.1_Missense_Mutation_p.I535V|CKAP5_ENST00000532321.1_5'Flank|CKAP5_ENST00000354558.3_Missense_Mutation_p.I535V|CKAP5_ENST00000312055.5_Missense_Mutation_p.I535V			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	535					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GGTGCAGAAATGTCCTTTGTG	0.448																																					p.I535V	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											.	CKAP5	134	.	0			c.A1603G						.						174.0	157.0	163.0					11																	46817191		2201	4299	6500	SO:0001583	missense	9793	exon13			CAGAAATGTCCTT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1603A>G	chr11.hg19:g.46817191T>C	ENSP00000432768:p.Ile535Val	151.0	0.0		112.0	30.0	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	hg19	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	T	3.908	-0.020759	0.07634	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.39056	1.1;1.11;1.1;1.1	5.32	-4.25	0.03766	.	1.260260	0.04970	N	0.463727	T	0.14787	0.0357	N	0.00729	-1.24	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.34104	-0.9842	10	0.12430	T	0.62	-19.6773	15.0038	0.71495	0.0:0.5931:0.0:0.4069	.	535;535;535	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	V	535	ENSP00000432768:I535V;ENSP00000395302:I535V;ENSP00000310227:I535V;ENSP00000346566:I535V	ENSP00000310227:I535V	I	-	1	0	CKAP5	46773767	0.000000	0.05858	0.001000	0.08648	0.787000	0.44495	-0.585000	0.05794	-0.802000	0.04421	0.379000	0.24179	ATT	.	.		0.448	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
OR8H2	390151	hgsc.bcm.edu	37	11	55872871	55872871	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:55872871T>A	ENST00000313503.1	+	1	353	c.353T>A	c.(352-354)aTg>aAg	p.M118K		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CTCTCCTCAATGGCCCATGAT	0.458										HNSCC(53;0.14)																											p.M118K		Atlas-SNP	.											.	OR8H2	117	.	0			c.T353A						.						201.0	205.0	204.0					11																	55872871		2201	4296	6497	SO:0001583	missense	390151	exon1			CCTCAATGGCCCA	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.353T>A	chr11.hg19:g.55872871T>A	ENSP00000323982:p.Met118Lys	97.0	0.0		111.0	31.0	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	hg19	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	t	13.17	2.157926	0.38119	.	.	ENSG00000181767	ENST00000313503	T	0.01159	5.25	3.58	2.43	0.29744	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.06872	0.0175	H	0.99454	4.575	0.39127	D	0.961784	P	0.49358	0.923	P	0.45794	0.493	T	0.04946	-1.0916	10	0.87932	D	0	.	9.1009	0.36667	0.0:0.0912:0.0:0.9088	.	118	Q8N162	OR8H2_HUMAN	K	118	ENSP00000323982:M118K	ENSP00000323982:M118K	M	+	2	0	OR8H2	55629447	1.000000	0.71417	0.741000	0.31004	0.011000	0.07611	5.802000	0.69122	0.535000	0.28714	-0.503000	0.04515	ATG	.	.		0.458	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
TIGD3	220359	hgsc.bcm.edu	37	11	65124368	65124368	+	Silent	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:65124368A>G	ENST00000309880.5	+	2	1296	c.1089A>G	c.(1087-1089)gaA>gaG	p.E363E		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	363						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						TCATTCAAGAAGGGCTGGCTC	0.647																																					p.E363E		Atlas-SNP	.											.	TIGD3	32	.	0			c.A1089G						.						45.0	51.0	49.0					11																	65124368		2201	4296	6497	SO:0001819	synonymous_variant	220359	exon2			TCAAGAAGGGCTG		CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.1089A>G	chr11.hg19:g.65124368A>G		127.0	0.0		93.0	6.0	NM_145719		Silent	SNP	ENST00000309880.5	hg19	CCDS8101.1																																																																																			.	.		0.647	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387310.1	NM_145719	
KIAA1731	85459	hgsc.bcm.edu	37	11	93461979	93461979	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:93461979T>G	ENST00000325212.6	+	25	7456	c.7294T>G	c.(7294-7296)Ttc>Gtc	p.F2432V	SNORA32_ENST00000384072.1_RNA|SNORA25_ENST00000384384.1_RNA|KIAA1731_ENST00000411936.1_Missense_Mutation_p.F2432V|KIAA1731_ENST00000344196.4_Missense_Mutation_p.F612V|KIAA1731_ENST00000531700.1_Missense_Mutation_p.F612V|TAF1D_ENST00000546088.1_5'Flank|SNORD6_ENST00000365444.1_RNA			Q9C0D2	K1731_HUMAN	KIAA1731	2432						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AGCAAAATGCTTCTTTCAGGT	0.348																																					p.F2432V		Atlas-SNP	.											.	KIAA1731	173	.	0			c.T7294G						.						88.0	78.0	81.0					11																	93461979		692	1591	2283	SO:0001583	missense	85459	exon25			AAATGCTTCTTTC	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.7294T>G	chr11.hg19:g.93461979T>G	ENSP00000316681:p.Phe2432Val	70.0	0.0		52.0	18.0	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	ENST00000325212.6	hg19	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	T	0.876	-0.730393	0.03135	.	.	ENSG00000166004	ENST00000325212;ENST00000411936;ENST00000344196;ENST00000531700;ENST00000531404	T;T	0.08896	3.04;3.04	5.33	-4.27	0.03744	.	.	.	.	.	T	0.03827	0.0108	N	0.14661	0.345	0.09310	N	1	B;B;B	0.18310	0.027;0.001;0.001	B;B;B	0.14023	0.01;0.004;0.004	T	0.47071	-0.9145	9	0.16896	T	0.51	.	6.9768	0.24679	0.5411:0.0736:0.0:0.3853	.	2432;2432;612	Q9C0D2;Q9C0D2-3;Q9C0D2-2	K1731_HUMAN;.;.	V	2432;2432;612;612;444	ENSP00000316681:F2432V;ENSP00000406505:F2432V	ENSP00000316681:F2432V	F	+	1	0	KIAA1731	93101627	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.320000	0.02700	-0.708000	0.05015	-2.195000	0.00310	TTC	.	.		0.348	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
CEP57	9702	hgsc.bcm.edu	37	11	95564320	95564320	+	Missense_Mutation	SNP	T	T	G	rs146538238		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:95564320T>G	ENST00000325542.5	+	11	1641	c.1403T>G	c.(1402-1404)cTg>cGg	p.L468R	CEP57_ENST00000537677.1_Missense_Mutation_p.L441R|CEP57_ENST00000325486.5_Missense_Mutation_p.L442R|CEP57_ENST00000541150.1_Missense_Mutation_p.L459R	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	468	Mediates interaction with microtubules. {ECO:0000250}.			L -> Q (in Ref. 3; BAA07654). {ECO:0000305}.	fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTTATGAAACTGAGACCTGGA	0.363									Mosaic Variegated Aneuploidy Syndrome																												p.L468R		Atlas-SNP	.											.	CEP57	40	.	0			c.T1403G						.						69.0	70.0	70.0					11																	95564320		2201	4297	6498	SO:0001583	missense	9702	exon11	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	TGAAACTGAGACC	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.1403T>G	chr11.hg19:g.95564320T>G	ENSP00000317902:p.Leu468Arg	507.0	1.0		404.0	110.0	NM_014679	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	hg19	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	T	0.052	-1.246817	0.01481	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000541150	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.65	-1.99	0.07457	.	1.376700	0.04812	N	0.435324	T	0.14270	0.0345	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.28554	-1.0040	10	0.87932	D	0	-16.6978	1.8248	0.03118	0.2623:0.1504:0.0955:0.4918	.	459;442;468	F5H5F7;Q86XR8-2;Q86XR8	.;.;CEP57_HUMAN	R	441;468;442;459	ENSP00000441392:L441R;ENSP00000317902:L468R;ENSP00000317487:L442R;ENSP00000443436:L459R	ENSP00000317487:L442R	L	+	2	0	CEP57	95203968	0.558000	0.26554	0.821000	0.32701	0.006000	0.05464	-0.192000	0.09587	-0.170000	0.10816	-0.263000	0.10527	CTG	.	T|1.000;A|0.000		0.363	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395983.1	NM_014679	
NPAT	4863	hgsc.bcm.edu	37	11	108047094	108047094	+	Silent	SNP	T	T	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:108047094T>A	ENST00000278612.8	-	12	1116	c.1011A>T	c.(1009-1011)acA>acT	p.T337T	NPAT_ENST00000610253.1_5'UTR	NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	337	Mediates transcriptional activation.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		TATTATTCTTTGTTTTGCCTG	0.294																																					p.T337T		Atlas-SNP	.											.	NPAT	124	.	0			c.A1011T						.						48.0	48.0	48.0					11																	108047094		1782	4045	5827	SO:0001819	synonymous_variant	4863	exon12			ATTCTTTGTTTTG	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.1011A>T	chr11.hg19:g.108047094T>A		65.0	0.0		57.0	14.0	NM_002519	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Silent	SNP	ENST00000278612.8	hg19	CCDS41710.1																																																																																			.	.		0.294	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389506.2	NM_002519	
CCDC84	338657	hgsc.bcm.edu	37	11	118868995	118868995	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:118868995C>G	ENST00000334418.1	+	1	144	c.88C>G	c.(88-90)Ctg>Gtg	p.L30V	RP11-110I1.12_ENST00000526453.1_lincRNA	NM_198489.1	NP_940891.1	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84	30										breast(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CCAGCGGCAGCTGAAGGAGGC	0.672																																					p.L30V		Atlas-SNP	.											.	CCDC84	21	.	0			c.C88G						.						11.0	14.0	13.0					11																	118868995		2186	4278	6464	SO:0001583	missense	338657	exon1			CGGCAGCTGAAGG	AB094093	CCDS8405.1	11q23.3	2006-03-13			ENSG00000186166	ENSG00000186166			30460	protein-coding gene	gene with protein product							Standard	NM_198489		Approved	DLNB14	uc001pul.3	Q86UT8	OTTHUMG00000166348	ENST00000334418.1:c.88C>G	chr11.hg19:g.118868995C>G	ENSP00000334767:p.Leu30Val	178.0	0.0		148.0	48.0	NM_198489		Missense_Mutation	SNP	ENST00000334418.1	hg19	CCDS8405.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.212494	0.79240	.	.	ENSG00000186166	ENST00000334418	T	0.61510	0.1	5.12	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.66982	0.2845	L	0.52573	1.65	0.40548	D	0.981098	D	0.67145	0.996	D	0.80764	0.994	T	0.68591	-0.5368	10	0.72032	D	0.01	-13.3111	8.5707	0.33567	0.0:0.8579:0.0:0.1421	.	30	Q86UT8	CCD84_HUMAN	V	30	ENSP00000334767:L30V	ENSP00000334767:L30V	L	+	1	2	CCDC84	118374205	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	0.330000	0.19715	1.054000	0.40438	0.650000	0.86243	CTG	.	.		0.672	CCDC84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389315.1	NM_198489	
DPAGT1	1798	hgsc.bcm.edu	37	11	118978593	118978593	+	5'UTR	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:118978593C>T	ENST00000409993.2	-	0	448				C2CD2L_ENST00000336702.3_Missense_Mutation_p.P48S			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)						cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		ggaccggggcccgggACCCGC	0.756																																					p.P48S		Atlas-SNP	.											.	C2CD2L	39	.	0			c.C142T						.						3.0	3.0	3.0					11																	118978593		1715	3431	5146	SO:0001623	5_prime_UTR_variant	9854	exon1			CGGGGCCCGGGAC	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.-1104G>A	chr11.hg19:g.118978593C>T		93.0	0.0		57.0	9.0	NM_014807	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	hg19	CCDS8411.1	.	.	.	.	.	.	.	.	.	.	C	0.634	-0.815992	0.02776	.	.	ENSG00000172375	ENST00000336702	T	0.21191	2.02	4.46	-0.945	0.10388	.	0.910045	0.09321	N	0.818196	T	0.07143	0.0181	N	0.03608	-0.345	0.33311	D	0.566073	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44375	-0.9332	10	0.15066	T	0.55	-35.3607	4.1447	0.10210	0.0:0.4086:0.1727:0.4187	.	48;48	O14523;O14523-2	C2C2L_HUMAN;.	S	48	ENSP00000338885:P48S	ENSP00000338885:P48S	P	+	1	0	C2CD2L	118483803	0.000000	0.05858	0.017000	0.16124	0.105000	0.19272	-0.235000	0.09016	-0.384000	0.07845	-0.229000	0.12294	CCG	.	.		0.756	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382	
SORL1	6653	hgsc.bcm.edu	37	11	121492888	121492888	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr11:121492888G>A	ENST00000260197.7	+	45	6211	c.6082G>A	c.(6082-6084)Gat>Aat	p.D2028N	SORL1_ENST00000532694.1_Missense_Mutation_p.D874N|SORL1_ENST00000525532.1_Missense_Mutation_p.D972N|SORL1_ENST00000527934.1_Missense_Mutation_p.D643N|SORL1_ENST00000534286.1_Missense_Mutation_p.D938N	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	2028	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		ATCAGCACCTGATGCCTTAAA	0.333																																					p.D2028N		Atlas-SNP	.											.	SORL1	218	.	0			c.G6082A						.						119.0	118.0	118.0					11																	121492888		2201	4299	6500	SO:0001583	missense	6653	exon45			GCACCTGATGCCT	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.6082G>A	chr11.hg19:g.121492888G>A	ENSP00000260197:p.Asp2028Asn	82.0	0.0		88.0	18.0	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	hg19	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180314	0.78677	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	5.6	5.6	0.85130	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.421091	0.24590	N	0.037236	T	0.41003	0.1140	N	0.14661	0.345	0.54753	D	0.999983	P;P	0.46395	0.877;0.651	P;B	0.45829	0.494;0.115	T	0.35025	-0.9805	10	0.44086	T	0.13	.	19.578	0.95452	0.0:0.0:1.0:0.0	.	643;2028	E9PKB0;Q92673	.;SORL_HUMAN	N	2028;972;874;938;643	ENSP00000260197:D2028N;ENSP00000434634:D972N;ENSP00000432131:D874N;ENSP00000436447:D938N;ENSP00000435405:D643N	ENSP00000260197:D2028N	D	+	1	0	SORL1	120998098	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.299000	0.78831	2.633000	0.89246	0.655000	0.94253	GAT	.	.		0.333	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
C2CD5	9847	hgsc.bcm.edu	37	12	22677545	22677545	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr12:22677545T>G	ENST00000333957.4	-	6	717	c.462A>C	c.(460-462)aaA>aaC	p.K154N	C2CD5_ENST00000396028.2_Missense_Mutation_p.K154N|C2CD5_ENST00000544930.1_5'UTR|C2CD5_ENST00000545552.1_Missense_Mutation_p.K154N|C2CD5_ENST00000542676.1_Missense_Mutation_p.K154N|C2CD5_ENST00000446597.1_Missense_Mutation_p.K154N|C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000536386.1_Missense_Mutation_p.K154N	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	154					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CTCTATAGCATTTTGGAATAG	0.333																																					p.K154N		Atlas-SNP	.											.	.	.	.	0			c.A462C						.						101.0	93.0	96.0					12																	22677545		2203	4300	6503	SO:0001583	missense	9847	exon6			ATAGCATTTTGGA	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.462A>C	chr12.hg19:g.22677545T>G	ENSP00000334229:p.Lys154Asn	105.0	0.0		96.0	32.0	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	ENST00000333957.4	hg19	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.597367	0.28445	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552	T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69	4.95	1.04	0.20106	.	0.059399	0.64402	D	0.000005	T	0.28797	0.0714	N	0.17474	0.49	0.80722	D	1	B;B;B;P;B	0.47762	0.356;0.032;0.029;0.9;0.017	B;B;B;B;B	0.42771	0.185;0.016;0.017;0.397;0.016	T	0.02539	-1.1144	10	0.25106	T	0.35	-17.8418	9.5055	0.39044	0.0:0.5872:0.0:0.4128	.	154;154;154;154;154	F5H2A1;B4DRN7;B7ZLL0;Q86YS7-2;Q86YS7	.;.;.;.;K0528_HUMAN	N	154	ENSP00000334229:K154N;ENSP00000388756:K154N;ENSP00000439392:K154N;ENSP00000379345:K154N;ENSP00000441951:K154N;ENSP00000443204:K154N	ENSP00000334229:K154N	K	-	3	2	KIAA0528	22568812	0.979000	0.34478	0.998000	0.56505	0.979000	0.70002	0.264000	0.18497	-0.052000	0.13311	-0.962000	0.02626	AAA	.	.		0.333	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
ERBB3	2065	hgsc.bcm.edu	37	12	56474108	56474108	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr12:56474108G>A	ENST00000267101.3	+	1	464	c.24G>A	c.(22-24)caG>caA	p.Q8Q	ERBB3_ENST00000415288.2_5'Flank|ERBB3_ENST00000450146.2_De_novo_Start_OutOfFrame|ERBB3_ENST00000411731.2_Silent_p.Q8Q	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	8					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ACGCTCTGCAGGTGCTGGGCT	0.687																																					p.Q8Q		Atlas-SNP	.											.	ERBB3	350	.	0			c.G24A						.						40.0	33.0	36.0					12																	56474108		2197	4285	6482	SO:0001819	synonymous_variant	2065	exon1			TCTGCAGGTGCTG	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.24G>A	chr12.hg19:g.56474108G>A		138.0	0.0		136.0	54.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	ENST00000267101.3	hg19	CCDS31833.1																																																																																			.	.		0.687	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
IL31	386653	hgsc.bcm.edu	37	12	122657230	122657230	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr12:122657230G>A	ENST00000377035.1	-	3	250	c.224C>T	c.(223-225)cCt>cTt	p.P75L		NM_001014336.1	NP_001014358.1	Q6EBC2	IL31_HUMAN	interleukin 31	75					immune system process (GO:0002376)	extracellular space (GO:0005615)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;6.93e-05)|Breast(359;0.0544)		OV - Ovarian serous cystadenocarcinoma(86;3.27e-29)|Epithelial(86;4.86e-27)|BRCA - Breast invasive adenocarcinoma(302;0.223)		CTGGGCGTCAGGGCTGAGACA	0.512																																					p.P75L		Atlas-SNP	.											.	IL31	23	.	0			c.C224T						.						151.0	114.0	127.0					12																	122657230		2203	4300	6503	SO:0001583	missense	386653	exon3			GCGTCAGGGCTGA	AY499343	CCDS31919.1	12q24.31	2011-07-21			ENSG00000204671	ENSG00000204671		"""Interleukins and interleukin receptors"""	19372	protein-coding gene	gene with protein product		609509				15184896	Standard	NM_001014336		Approved	IL-31	uc001ubv.3	Q6EBC2	OTTHUMG00000168916	ENST00000377035.1:c.224C>T	chr12.hg19:g.122657230G>A	ENSP00000366234:p.Pro75Leu	154.0	0.0		130.0	40.0	NM_001014336	A2RUQ1	Missense_Mutation	SNP	ENST00000377035.1	hg19	CCDS31919.1	.	.	.	.	.	.	.	.	.	.	G	0.244	-1.011125	0.02095	.	.	ENSG00000204671	ENST00000377035	.	.	.	4.18	-1.03	0.10102	.	0.722199	0.12041	N	0.505035	T	0.12774	0.0310	N	0.04508	-0.205	0.09310	N	1	B	0.16603	0.018	B	0.14023	0.01	T	0.29305	-1.0016	9	0.15952	T	0.53	-1.3094	4.0412	0.09751	0.4512:0.1816:0.3672:0.0	.	75	Q6EBC2	IL31_HUMAN	L	75	.	ENSP00000366234:P75L	P	-	2	0	IL31	121223183	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.164000	0.16542	-0.185000	0.10550	0.563000	0.77884	CCT	.	.		0.512	IL31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401594.1	NM_001014336	
UBC	7316	hgsc.bcm.edu	37	12	125397157	125397157	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr12:125397157G>A	ENST00000536769.1	-	1	2737	c.1161C>T	c.(1159-1161)acC>acT	p.T387T	UBC_ENST00000339647.5_Silent_p.T387T|UBC_ENST00000538617.1_Intron|UBC_ENST00000536661.1_5'Flank|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Silent_p.T311T			P0CG48	UBC_HUMAN	ubiquitin C	387	Ubiquitin-like 6. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		TACCAGTCAGGGTCTTCACGA	0.532																																					p.T387T		Atlas-SNP	.											.	UBC	79	.	0			c.C1161T						.						216.0	199.0	205.0					12																	125397157		2203	4296	6499	SO:0001819	synonymous_variant	7316	exon2			AGTCAGGGTCTTC		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.1161C>T	chr12.hg19:g.125397157G>A		353.0	0.0		267.0	63.0	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000536769.1	hg19	CCDS9260.1																																																																																			.	.		0.532	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009	
DGKH	160851	hgsc.bcm.edu	37	13	42733407	42733407	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr13:42733407A>G	ENST00000337343.4	+	6	649	c.628A>G	c.(628-630)Aaa>Gaa	p.K210E	DGKH_ENST00000261491.5_Missense_Mutation_p.K210E|DGKH_ENST00000538674.1_Intron|DGKH_ENST00000379274.2_Missense_Mutation_p.K74E|DGKH_ENST00000536612.1_Missense_Mutation_p.K74E|DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000540693.1_Missense_Mutation_p.K210E	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	210					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		TTTAGTGTGTAAATTCAAGGC	0.343																																					p.K210E		Atlas-SNP	.											.	DGKH	106	.	0			c.A628G						.						48.0	43.0	45.0					13																	42733407		2203	4300	6503	SO:0001583	missense	160851	exon7			GTGTGTAAATTCA	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.628A>G	chr13.hg19:g.42733407A>G	ENSP00000337572:p.Lys210Glu	68.0	0.0		39.0	12.0	NM_001204504	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	hg19	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.398354	0.83120	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612	D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22	5.45	5.45	0.79879	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.000000	0.85682	D	0.000000	D	0.96463	0.8846	M	0.78344	2.41	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.998	D;D;D	0.80764	0.945;0.994;0.98	D	0.97039	0.9756	10	0.87932	D	0	.	15.5191	0.75851	1.0:0.0:0.0:0.0	.	74;210;210	Q86XP1-3;Q86XP1-2;Q86XP1	.;.;DGKH_HUMAN	E	210;210;210;74;74	ENSP00000440823:K210E;ENSP00000337572:K210E;ENSP00000261491:K210E;ENSP00000368576:K74E;ENSP00000445114:K74E	ENSP00000261491:K210E	K	+	1	0	DGKH	41631407	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	8.905000	0.92613	2.056000	0.61249	0.533000	0.62120	AAA	.	.		0.343	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
OR10G2	26534	hgsc.bcm.edu	37	14	22102423	22102423	+	Silent	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr14:22102423C>T	ENST00000542433.1	-	1	673	c.576G>A	c.(574-576)ctG>ctA	p.L192L		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		CAGCACAGGCCAGTCTCAATA	0.527																																					p.L192L		Atlas-SNP	.											.	OR10G2	35	.	0			c.G576A						.						88.0	96.0	94.0					14																	22102423		2203	4300	6503	SO:0001819	synonymous_variant	26534	exon1			ACAGGCCAGTCTC		CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.576G>A	chr14.hg19:g.22102423C>T		314.0	0.0		275.0	73.0	NM_001005466	B2RPD0	Silent	SNP	ENST00000542433.1	hg19	CCDS32047.1																																																																																			.	.		0.527	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1		
DHRS1	115817	hgsc.bcm.edu	37	14	24760356	24760356	+	Missense_Mutation	SNP	C	C	G	rs148282342		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr14:24760356C>G	ENST00000288111.7	-	8	1070	c.794G>C	c.(793-795)cGg>cCg	p.R265P	DHRS1_ENST00000559088.1_5'UTR|DHRS1_ENST00000396813.1_Missense_Mutation_p.R265P	NM_001136050.2	NP_001129522.1	Q96LJ7	DHRS1_HUMAN	dehydrogenase/reductase (SDR family) member 1	265						endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6				GBM - Glioblastoma multiforme(265;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(311;0.0442)		GTCCACATCCCGAAGGCCATA	0.607																																					p.R265P		Atlas-SNP	.											.	DHRS1	21	.	0			c.G794C						.						105.0	86.0	92.0					14																	24760356		2203	4300	6503	SO:0001583	missense	115817	exon8			ACATCCCGAAGGC	AK058159	CCDS9623.1	14q11.2	2011-09-14			ENSG00000157379	ENSG00000157379	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16445	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 19C, member 1"""	610410				12153138, 19027726	Standard	NM_138452		Approved	FLJ25430, MGC20204, SDR19C1	uc001wok.3	Q96LJ7	OTTHUMG00000029333	ENST00000288111.7:c.794G>C	chr14.hg19:g.24760356C>G	ENSP00000288111:p.Arg265Pro	94.0	0.0		91.0	34.0	NM_138452	D3DS71|Q8NDG3|Q96B59|Q96CQ5	Missense_Mutation	SNP	ENST00000288111.7	hg19	CCDS9623.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566485	0.27915	.	.	ENSG00000157379	ENST00000288111;ENST00000396813	D;D	0.83591	-1.74;-1.74	5.24	-2.93	0.05598	.	0.768976	0.11801	N	0.528116	T	0.76357	0.3976	L	0.46157	1.445	0.19300	N	0.999973	B	0.32128	0.357	B	0.35607	0.206	T	0.65516	-0.6149	10	0.41790	T	0.15	-8.6692	11.3601	0.49638	0.0:0.2689:0.0:0.7311	.	265	Q96LJ7	DHRS1_HUMAN	P	265	ENSP00000288111:R265P;ENSP00000380027:R265P	ENSP00000288111:R265P	R	-	2	0	DHRS1	23830196	0.008000	0.16893	0.493000	0.27502	0.931000	0.56810	-0.361000	0.07612	-0.425000	0.07371	0.467000	0.42956	CGG	.	C|1.000;T|0.000		0.607	DHRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073168.4	NM_138452	
SEL1L	6400	hgsc.bcm.edu	37	14	81943498	81943498	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr14:81943498T>C	ENST00000336735.4	-	21	2319	c.2203A>G	c.(2203-2205)Atg>Gtg	p.M735V		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	735	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		AGCTGGTCCATATCAAGTTGG	0.423																																					p.M735V		Atlas-SNP	.											.	SEL1L	67	.	0			c.A2203G						.						107.0	99.0	102.0					14																	81943498		2203	4300	6503	SO:0001583	missense	6400	exon21			GGTCCATATCAAG		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.2203A>G	chr14.hg19:g.81943498T>C	ENSP00000337053:p.Met735Val	136.0	0.0		134.0	41.0	NM_005065	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	hg19	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.083609	0.36758	.	.	ENSG00000071537	ENST00000336735	T	0.25912	1.77	6.17	5.01	0.66863	.	0.121175	0.85682	D	0.000000	T	0.25606	0.0623	L	0.58101	1.795	0.80722	D	1	B	0.18610	0.029	B	0.12837	0.008	T	0.04347	-1.0958	10	0.16896	T	0.51	.	13.556	0.61759	0.0:0.0:0.1299:0.8701	.	735	Q9UBV2	SE1L1_HUMAN	V	735	ENSP00000337053:M735V	ENSP00000337053:M735V	M	-	1	0	SEL1L	81013251	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	3.196000	0.51020	1.120000	0.41904	0.533000	0.62120	ATG	.	.		0.423	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
GABRG3	2567	hgsc.bcm.edu	37	15	27778000	27778000	+	Silent	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr15:27778000C>A	ENST00000333743.6	+	10	1631	c.1377C>A	c.(1375-1377)gtC>gtA	p.V459V	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	459					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTAACCTGGTCTACTGGGTTG	0.502																																					p.V459V	NSCLC(114;800 1656 7410 37729 45293)	Atlas-SNP	.											.	GABRG3	115	.	0			c.C1377A						.						54.0	54.0	54.0					15																	27778000		1941	4134	6075	SO:0001819	synonymous_variant	2567	exon10			CCTGGTCTACTGG		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1377C>A	chr15.hg19:g.27778000C>A		108.0	0.0		92.0	31.0	NM_033223	G3V594|Q9HD46|Q9NYT2	Silent	SNP	ENST00000333743.6	hg19	CCDS45195.1																																																																																			.	.		0.502	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
CA12	771	hgsc.bcm.edu	37	15	63632640	63632640	+	Silent	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr15:63632640C>T	ENST00000178638.3	-	7	1034	c.594G>A	c.(592-594)caG>caA	p.Q198Q	CA12_ENST00000344366.3_Silent_p.Q198Q|CA12_ENST00000422263.2_Silent_p.Q138Q	NM_001218.3	NP_001209.1	O43570	CAH12_HUMAN	carbonic anhydrase XII	198					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	16					Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	CGAATGCTTCCTGGCCTAGAG	0.552																																					p.Q198Q		Atlas-SNP	.											.	CA12	33	.	0			c.G594A						.						81.0	70.0	74.0					15																	63632640		2203	4300	6503	SO:0001819	synonymous_variant	771	exon7			TGCTTCCTGGCCT	AF051882	CCDS10185.1, CCDS10186.1	15q22	2004-01-19			ENSG00000074410	ENSG00000074410		"""Carbonic anhydrases"""	1371	protein-coding gene	gene with protein product		603263				9636197	Standard	NM_001218		Approved	HsT18816	uc002amc.3	O43570	OTTHUMG00000132881	ENST00000178638.3:c.594G>A	chr15.hg19:g.63632640C>T		135.0	0.0		122.0	33.0	NM_206925	B2RE24|Q53YE5|Q9BWG2	Silent	SNP	ENST00000178638.3	hg19	CCDS10185.1																																																																																			.	.		0.552	CA12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256370.1	NM_001218	
LOXL1	4016	hgsc.bcm.edu	37	15	74219803	74219803	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr15:74219803C>T	ENST00000261921.7	+	1	1005	c.679C>T	c.(679-681)Ccc>Tcc	p.P227S	LOXL1-AS1_ENST00000566675.1_RNA|LOXL1-AS1_ENST00000562965.1_RNA|LOXL1-AS1_ENST00000565756.1_RNA|LOXL1-AS1_ENST00000564194.1_RNA|LOXL1-AS1_ENST00000568229.1_RNA|LOXL1-AS1_ENST00000565416.1_RNA|LOXL1-AS1_ENST00000564963.1_RNA|LOXL1-AS1_ENST00000562130.1_RNA|LOXL1-AS1_ENST00000562739.1_RNA|LOXL1-AS1_ENST00000567257.1_RNA|LOXL1-AS1_ENST00000567644.1_RNA|LOXL1-AS1_ENST00000568087.1_RNA	NM_005576.2	NP_005567.2	Q08397	LOXL1_HUMAN	lysyl oxidase-like 1	227					extracellular matrix organization (GO:0030198)|oxidation-reduction process (GO:0055114)|protein deamination (GO:0018277)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on the CH-NH2 group of donors, oxygen as acceptor (GO:0016641)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10						ggTCATCTACCCCTACCAGCC	0.756																																					p.P227S		Atlas-SNP	.											.	LOXL1	25	.	0			c.C679T						.						2.0	3.0	2.0					15																	74219803		1032	2132	3164	SO:0001583	missense	4016	exon1			ATCTACCCCTACC	L21186	CCDS10253.1	15q24-q25	2008-07-18			ENSG00000129038	ENSG00000129038			6665	protein-coding gene	gene with protein product		153456				7689553	Standard	NM_005576		Approved	LOXL, LOL	uc002awc.1	Q08397	OTTHUMG00000137595	ENST00000261921.7:c.679C>T	chr15.hg19:g.74219803C>T	ENSP00000261921:p.Pro227Ser	109.0	0.0		79.0	14.0	NM_005576	Q6NUL3|Q96BW7	Missense_Mutation	SNP	ENST00000261921.7	hg19	CCDS10253.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.064728	0.36470	.	.	ENSG00000129038	ENST00000261921;ENST00000395162	T	0.27720	1.65	3.72	3.72	0.42706	.	1.163260	0.06428	N	0.723550	T	0.44030	0.1274	L	0.27053	0.805	0.27156	N	0.961285	D	0.89917	1.0	D	0.79108	0.992	T	0.40608	-0.9554	10	0.51188	T	0.08	.	10.9987	0.47591	0.0:1.0:0.0:0.0	.	227	Q08397	LOXL1_HUMAN	S	227;89	ENSP00000261921:P227S	ENSP00000261921:P227S	P	+	1	0	LOXL1	72006856	0.202000	0.23423	0.995000	0.50966	0.630000	0.37929	2.692000	0.47018	1.602000	0.50124	0.297000	0.19635	CCC	.	.		0.756	LOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268995.2	NM_005576	
ULK3	25989	hgsc.bcm.edu	37	15	75130667	75130667	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr15:75130667C>A	ENST00000440863.2	-	12	1277	c.1186G>T	c.(1186-1188)Gag>Tag	p.E396*	ULK3_ENST00000569437.1_Nonsense_Mutation_p.E396*|ULK3_ENST00000568667.1_Nonsense_Mutation_p.E407*	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	396	MIT 2.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						GCATCCTGCTCCCCGCCGGCG	0.687																																					p.E396X		Atlas-SNP	.											.	ULK3	30	.	0			c.G1186T						.						12.0	17.0	16.0					15																	75130667		1980	4120	6100	SO:0001587	stop_gained	25989	exon12			CCTGCTCCCCGCC	BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.1186G>T	chr15.hg19:g.75130667C>A	ENSP00000400312:p.Glu396*	208.0	0.0		142.0	36.0	NM_001099436	B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Nonsense_Mutation	SNP	ENST00000440863.2	hg19	CCDS45305.1	.	.	.	.	.	.	.	.	.	.	C	34	5.300836	0.95601	.	.	ENSG00000140474	ENST00000440863;ENST00000418051	.	.	.	5.35	3.4	0.38934	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-15.3133	8.1686	0.31241	0.0:0.614:0.3032:0.0828	.	.	.	.	X	396;407	.	ENSP00000393658:E407X	E	-	1	0	ULK3	72917720	0.944000	0.32072	0.935000	0.37517	0.567000	0.35839	2.239000	0.43079	1.210000	0.43336	0.555000	0.69702	GAG	.	.		0.687	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421734.4	NM_015518	
TMEM8A	58986	hgsc.bcm.edu	37	16	422023	422023	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr16:422023G>A	ENST00000431232.2	-	13	2440	c.2280C>T	c.(2278-2280)tgC>tgT	p.C760C	MRPL28_ENST00000199706.8_5'Flank|MRPL28_ENST00000389675.2_5'Flank|TMEM8A_ENST00000250930.3_Silent_p.C567C|MRPL28_ENST00000429738.1_5'Flank	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	760					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						GATCGTTCTTGCAGATCTGAT	0.637																																					p.C760C		Atlas-SNP	.											.	TMEM8A	49	.	0			c.C2280T						.						75.0	78.0	77.0					16																	422023		2202	4300	6502	SO:0001819	synonymous_variant	58986	exon13			GTTCTTGCAGATC	AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.2280C>T	chr16.hg19:g.422023G>A		93.0	0.0		49.0	12.0	NM_021259	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Silent	SNP	ENST00000431232.2	hg19	CCDS10407.1	.	.	.	.	.	.	.	.	.	.	G	0.228	-1.023102	0.02061	.	.	ENSG00000129925	ENST00000424078	.	.	.	4.3	-1.8	0.07907	.	.	.	.	.	T	0.58566	0.2131	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55866	-0.8073	4	.	.	.	-0.2607	12.5035	0.55968	0.3895:0.0:0.6105:0.0	.	.	.	.	V	228	.	.	A	-	2	0	TMEM8A	362024	0.969000	0.33509	0.173000	0.22940	0.076000	0.17211	1.171000	0.31896	-0.422000	0.07405	-1.644000	0.00765	GCA	.	.		0.637	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000109257.2	NM_021259	
TMEM8A	58986	hgsc.bcm.edu	37	16	422038	422038	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr16:422038G>T	ENST00000431232.2	-	13	2425	c.2265C>A	c.(2263-2265)tgC>tgA	p.C755*	MRPL28_ENST00000199706.8_5'Flank|MRPL28_ENST00000389675.2_5'Flank|TMEM8A_ENST00000250930.3_Nonsense_Mutation_p.C562*|MRPL28_ENST00000429738.1_5'Flank	NM_021259.2	NP_067082.2	Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A	755					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						TCTGATAGTGGCAGGGGAATT	0.632																																					p.C755X		Atlas-SNP	.											.	TMEM8A	49	.	0			c.C2265A						.						70.0	74.0	73.0					16																	422038		2202	4299	6501	SO:0001587	stop_gained	58986	exon13			ATAGTGGCAGGGG	AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000431232.2:c.2265C>A	chr16.hg19:g.422038G>T	ENSP00000401338:p.Cys755*	87.0	0.0		49.0	14.0	NM_021259	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	Nonsense_Mutation	SNP	ENST00000431232.2	hg19	CCDS10407.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.878713|7.878713	0.98539|0.98539	.|.	.|.	ENSG00000129925|ENSG00000129925	ENST00000424078|ENST00000431232;ENST00000250930;ENST00000382942	.|.	.|.	.|.	4.3|4.3	3.03|3.03	0.35002|0.35002	.|.	.|0.000000	.|0.64402	.|D	.|0.000004	T|.	0.26774|.	0.0655|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.14896|.	-1.0456|.	4|.	.|0.02654	.|T	.|1	-0.0764|-0.0764	6.6382|6.6382	0.22895|0.22895	0.3879:0.0:0.6121:0.0|0.3879:0.0:0.6121:0.0	.|.	.|.	.|.	.|.	D|X	223|755;562;243	.|.	.|ENSP00000250930:C562X	A|C	-|-	2|3	0|2	TMEM8A|TMEM8A	362039|362039	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.560000|0.560000	0.35617|0.35617	1.619000|1.619000	0.36965|0.36965	0.710000|0.710000	0.31997|0.31997	0.455000|0.455000	0.32223|0.32223	GCC|TGC	.	.		0.632	TMEM8A-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000109257.2	NM_021259	
COQ7	10229	hgsc.bcm.edu	37	16	19083318	19083318	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr16:19083318G>A	ENST00000321998.5	+	2	208	c.142G>A	c.(142-144)Gct>Act	p.A48T	COQ7_ENST00000544894.2_Missense_Mutation_p.A10T|COQ7_ENST00000569127.1_Missense_Mutation_p.A25T|COQ7_ENST00000568985.1_Missense_Mutation_p.A48T	NM_016138.4	NP_057222.2	Q99807	COQ7_HUMAN	coenzyme Q7 homolog, ubiquinone (yeast)	48	2 X approximate tandem repeats.				age-dependent response to oxidative stress (GO:0001306)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|in utero embryonic development (GO:0001701)|mitochondrial ATP synthesis coupled electron transport (GO:0042775)|mitochondrion morphogenesis (GO:0070584)|neural tube formation (GO:0001841)|neurogenesis (GO:0022008)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|large_intestine(1)|lung(3)|prostate(1)|skin(3)|urinary_tract(1)	10						CAGTCGGGCAGCTGTGGATCG	0.498											OREG0023656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A48T		Atlas-SNP	.											.	COQ7	16	.	0			c.G142A						.						153.0	143.0	147.0					16																	19083318		2197	4300	6497	SO:0001583	missense	10229	exon2			CGGGCAGCTGTGG	U81276	CCDS10574.1, CCDS53993.1	16p12.3	2008-05-14	2001-11-28		ENSG00000167186	ENSG00000167186			2244	protein-coding gene	gene with protein product		601683	"""coenzyme Q, 7 (rat, yeast) homolog"""			9020081, 10373325	Standard	NM_016138		Approved	CLK-1, CAT5	uc002dfr.3	Q99807	OTTHUMG00000131455	ENST00000321998.5:c.142G>A	chr16.hg19:g.19083318G>A	ENSP00000322316:p.Ala48Thr	227.0	0.0	730	141.0	33.0	NM_016138	B2RDA9|Q9BTT7|Q9H0T5|Q9UEW5|Q9UNR5	Missense_Mutation	SNP	ENST00000321998.5	hg19	CCDS10574.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.664461	0.29604	.	.	ENSG00000167186	ENST00000321998;ENST00000544894	T;T	0.42513	0.97;0.97	5.74	1.19	0.21007	Ferritin/ribonucleotide reductase-like (1);	0.382154	0.34178	N	0.004190	T	0.19927	0.0479	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.002	T	0.19031	-1.0318	10	0.22706	T	0.39	-14.8787	10.3683	0.44038	0.3515:0.0:0.6485:0.0	.	25;48	Q49A71;Q99807	.;COQ7_HUMAN	T	48;10	ENSP00000322316:A48T;ENSP00000442923:A10T	ENSP00000322316:A48T	A	+	1	0	COQ7	18990819	0.000000	0.05858	0.006000	0.13384	0.787000	0.44495	-0.031000	0.12287	0.364000	0.24374	0.655000	0.94253	GCT	.	.		0.498	COQ7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254275.3	NM_016138	
SRCAP	10847	hgsc.bcm.edu	37	16	30745076	30745076	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr16:30745076C>T	ENST00000262518.4	+	29	6836	c.6451C>T	c.(6451-6453)Cgc>Tgc	p.R2151C	SRCAP_ENST00000344771.4_Missense_Mutation_p.R1993C|SRCAP_ENST00000395059.2_Missense_Mutation_p.R2089C	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2151	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGCCCAGGACCGCTGTCACCG	0.527																																					p.R2151C		Atlas-SNP	.											.	SRCAP	298	.	0			c.C6451T						.						117.0	119.0	118.0					16																	30745076		2197	4300	6497	SO:0001583	missense	10847	exon29			CAGGACCGCTGTC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6451C>T	chr16.hg19:g.30745076C>T	ENSP00000262518:p.Arg2151Cys	125.0	0.0		99.0	30.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601669	0.46423	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.99150	-5.49;-5.49;-5.49	4.82	4.82	0.62117	Helicase, C-terminal (3);	0.000000	0.46145	D	0.000319	D	0.99625	0.9863	H	0.98901	4.365	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97391	0.9989	10	0.87932	D	0	-7.7206	16.8447	0.85977	0.0:1.0:0.0:0.0	.	2089;2151	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	C	2151;2089;1993	ENSP00000262518:R2151C;ENSP00000378499:R2089C;ENSP00000343042:R1993C	ENSP00000262518:R2151C	R	+	1	0	SRCAP	30652577	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.184000	0.50926	2.485000	0.83878	0.563000	0.77884	CGC	.	.		0.527	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ITGAE	3682	hgsc.bcm.edu	37	17	3664397	3664397	+	Missense_Mutation	SNP	C	C	T	rs184355144		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr17:3664397C>T	ENST00000263087.4	-	6	606	c.508G>A	c.(508-510)Gat>Aat	p.D170N		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	170	X-domain (extra domain).				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		GTGTTCACATCGTCTTCTCCA	0.542																																					p.D170N	NSCLC(182;635 2928 8995 38788)	Atlas-SNP	.											.	ITGAE	96	.	0			c.G508A						.						193.0	187.0	189.0					17																	3664397		2203	4300	6503	SO:0001583	missense	3682	exon6			TCACATCGTCTTC	L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.508G>A	chr17.hg19:g.3664397C>T	ENSP00000263087:p.Asp170Asn	54.0	0.0		30.0	12.0	NM_002208	Q17RS6|Q9NZU9	Missense_Mutation	SNP	ENST00000263087.4	hg19	CCDS32531.1	.	.	.	.	.	.	.	.	.	.	C	5.593	0.294218	0.10567	.	.	ENSG00000083457	ENST00000263087	T	0.59502	0.26	2.63	-5.27	0.02763	.	.	.	.	.	T	0.35566	0.0936	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15983	-1.0418	9	0.48119	T	0.1	.	5.4287	0.16440	0.0:0.5046:0.1682:0.3272	.	170	P38570	ITAE_HUMAN	N	170	ENSP00000263087:D170N	ENSP00000263087:D170N	D	-	1	0	ITGAE	3611146	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.556000	0.05992	-1.510000	0.01796	-0.693000	0.03709	GAT	.	C|1.000;G|0.000		0.542	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438169.1	NM_002208	
KCNJ16	3773	hgsc.bcm.edu	37	17	68129150	68129150	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr17:68129150C>T	ENST00000589377.1	+	2	1085	c.922C>T	c.(922-924)Cat>Tat	p.H308Y	KCNJ16_ENST00000392671.1_Missense_Mutation_p.H308Y|KCNJ16_ENST00000586462.1_Missense_Mutation_p.H347Y|KCNJ16_ENST00000283936.1_Missense_Mutation_p.H308Y|KCNJ16_ENST00000585558.1_Missense_Mutation_p.H343Y|KCNJ16_ENST00000392670.1_Missense_Mutation_p.H308Y	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	308					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					TCTCTGGGGCCATAGGTTTAA	0.408																																					p.H308Y		Atlas-SNP	.											.	KCNJ16	72	.	0			c.C922T						.						72.0	76.0	75.0					17																	68129150		2203	4300	6503	SO:0001583	missense	3773	exon6			TGGGGCCATAGGT	AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.922C>T	chr17.hg19:g.68129150C>T	ENSP00000465967:p.His308Tyr	135.0	0.0		136.0	29.0	NM_001270422		Missense_Mutation	SNP	ENST00000589377.1	hg19	CCDS11687.1	.	.	.	.	.	.	.	.	.	.	C	8.427	0.847662	0.17034	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.94138	-3.36;-3.36;-3.36	5.78	5.78	0.91487	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.267267	0.43747	D	0.000525	D	0.84220	0.5424	N	0.11201	0.11	0.35913	D	0.831217	B;B	0.18968	0.032;0.006	B;B	0.18871	0.023;0.006	T	0.81223	-0.1030	9	.	.	.	.	10.4714	0.44640	0.0:0.8545:0.0:0.1455	.	308;308	A8K434;Q9NPI9	.;IRK16_HUMAN	Y	308	ENSP00000283936:H308Y;ENSP00000376439:H308Y;ENSP00000376438:H308Y	.	H	+	1	0	KCNJ16	65640745	0.999000	0.42202	0.377000	0.26055	0.102000	0.19082	3.957000	0.56730	2.722000	0.93159	0.650000	0.86243	CAT	.	.		0.408	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450880.1	NM_018658	
NOL4	8715	hgsc.bcm.edu	37	18	31432918	31432918	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr18:31432918C>T	ENST00000261592.5	-	11	2102	c.1805G>A	c.(1804-1806)aGt>aAt	p.S602N	NOL4_ENST00000535475.1_Missense_Mutation_p.S383N|NOL4_ENST00000269185.4_Missense_Mutation_p.S386N|NOL4_ENST00000535384.1_Missense_Mutation_p.S317N|NOL4_ENST00000589544.1_Missense_Mutation_p.S500N|NOL4_ENST00000538587.1_Missense_Mutation_p.S528N	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	602						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TTCAGTTGGACTCAGCTGGGG	0.453																																					p.S602N		Atlas-SNP	.											.	NOL4	139	.	0			c.G1805A						.						110.0	97.0	102.0					18																	31432918		2203	4300	6503	SO:0001583	missense	8715	exon11			GTTGGACTCAGCT	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1805G>A	chr18.hg19:g.31432918C>T	ENSP00000261592:p.Ser602Asn	68.0	0.0		82.0	24.0	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	hg19	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	10.84	1.464650	0.26335	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000535384;ENST00000535475;ENST00000538587	.	.	.	5.96	5.96	0.96718	.	0.058662	0.64402	D	0.000001	T	0.51753	0.1693	N	0.17312	0.475	0.45452	D	0.998421	B;B;B;B;P;B	0.44281	0.011;0.006;0.001;0.011;0.831;0.008	B;B;B;B;P;B	0.60541	0.017;0.007;0.008;0.017;0.876;0.028	T	0.44682	-0.9312	9	0.23302	T	0.38	-12.8717	10.7143	0.46002	0.0:0.8591:0.0:0.1409	.	317;528;602;317;500;383	B7Z3Z7;B4DSQ0;O94818;F5H1E3;O94818-2;B3KRF4	.;.;NOL4_HUMAN;.;.;.	N	602;386;317;383;528	.	ENSP00000261592:S602N	S	-	2	0	NOL4	29686916	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.721000	0.54941	2.814000	0.96858	0.655000	0.94253	AGT	.	.		0.453	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
EPG5	57724	hgsc.bcm.edu	37	18	43496496	43496496	+	Silent	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr18:43496496C>T	ENST00000282041.5	-	18	3325	c.3291G>A	c.(3289-3291)caG>caA	p.Q1097Q	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1097					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GTGTGACACCCTGAGGGACAC	0.547																																					p.Q1097Q		Atlas-SNP	.											.	EPG5	199	.	0			c.G3291A						.						68.0	71.0	70.0					18																	43496496		2082	4212	6294	SO:0001819	synonymous_variant	57724	exon18			GACACCCTGAGGG	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.3291G>A	chr18.hg19:g.43496496C>T		106.0	0.0		52.0	18.0	NM_020964	A2BDF3|Q9H8C8	Silent	SNP	ENST00000282041.5	hg19	CCDS11926.2																																																																																			.	.		0.547	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
DCC	1630	hgsc.bcm.edu	37	18	50278724	50278724	+	Missense_Mutation	SNP	C	C	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr18:50278724C>G	ENST00000442544.2	+	2	1008	c.392C>G	c.(391-393)aCa>aGa	p.T131R	DCC_ENST00000412726.1_5'UTR	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	131	Ig-like C2-type 1.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATTAGTCGGACAGCAAAAGTT	0.413																																					p.T131R		Atlas-SNP	.											.	DCC	360	.	0			c.C392G						.						108.0	101.0	103.0					18																	50278724		2203	4300	6503	SO:0001583	missense	1630	exon2			GTCGGACAGCAAA	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.392C>G	chr18.hg19:g.50278724C>G	ENSP00000389140:p.Thr131Arg	173.0	0.0		128.0	33.0	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	hg19	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.907100	0.33628	.	.	ENSG00000187323	ENST00000442544;ENST00000304775	T	0.13196	2.61	5.06	5.06	0.68205	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.234953	0.33217	N	0.005159	T	0.30293	0.0760	L	0.48218	1.51	0.80722	D	1	D	0.67145	0.996	D	0.65443	0.935	T	0.01056	-1.1466	10	0.51188	T	0.08	.	17.2004	0.86904	0.0:1.0:0.0:0.0	.	131	P43146	DCC_HUMAN	R	131;64	ENSP00000389140:T131R	ENSP00000304146:T64R	T	+	2	0	DCC	48532722	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.738000	0.55067	2.354000	0.79902	0.655000	0.94253	ACA	.	.		0.413	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
CNN2	1265	hgsc.bcm.edu	37	19	1036446	1036446	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:1036446G>A	ENST00000263097.4	+	6	902	c.539G>A	c.(538-540)gGc>gAc	p.G180D	CNN2_ENST00000565096.2_Missense_Mutation_p.G169D|AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000348419.3_Missense_Mutation_p.G141D|CNN2_ENST00000606983.1_3'UTR|CNN2_ENST00000562958.2_Missense_Mutation_p.G201D	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2	180					actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCAGTCGGGCATGACTGCC	0.592																																					p.G180D		Atlas-SNP	.											.	CNN2	26	.	0			c.G539A						.						66.0	62.0	63.0					19																	1036446		2203	4300	6503	SO:0001583	missense	1265	exon6			AGTCGGGCATGAC	D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.539G>A	chr19.hg19:g.1036446G>A	ENSP00000263097:p.Gly180Asp	171.0	0.0		91.0	29.0	NM_004368	A5D8U8|A6NFI4|D6W5X9|Q92578	Missense_Mutation	SNP	ENST00000263097.4	hg19	CCDS12053.1	.	.	.	.	.	.	.	.	.	.	g	23.9	4.473857	0.84640	.	.	ENSG00000064666	ENST00000263097;ENST00000348419;ENST00000442531	D;D	0.95307	-3.67;-3.67	4.18	4.18	0.49190	Calponin homology domain (1);	0.000000	0.85682	U	0.000000	D	0.98096	0.9372	H	0.96720	3.87	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.993;0.997;0.998;0.992;0.989;0.992	D	0.99044	1.0825	10	0.87932	D	0	.	14.027	0.64592	0.0:0.0:1.0:0.0	.	201;169;155;141;180;180	B4DUT8;B4DDF4;B4DHU5;A6NFI4;Q99439;Q6FHE4	.;.;.;.;CNN2_HUMAN;.	D	180;141;159	ENSP00000263097:G180D;ENSP00000340129:G141D	ENSP00000263097:G180D	G	+	2	0	CNN2	987446	1.000000	0.71417	0.947000	0.38551	0.932000	0.56968	8.947000	0.93000	2.173000	0.68751	0.556000	0.70494	GGC	.	.		0.592	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420293.3	NM_004368	
SLC1A6	6511	hgsc.bcm.edu	37	19	15064996	15064996	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:15064996C>A	ENST00000221742.3	-	7	1322	c.1315G>T	c.(1315-1317)Gct>Tct	p.A439S	SLC1A6_ENST00000430939.2_Missense_Mutation_p.A375S|SLC1A6_ENST00000600144.1_Missense_Mutation_p.A361S	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	439					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						TTAACTTGAGCAATGAAGATG	0.597																																					p.A439S		Atlas-SNP	.											.	SLC1A6	111	.	0			c.G1315T						.						89.0	79.0	82.0					19																	15064996		2203	4300	6503	SO:0001583	missense	6511	exon7			CTTGAGCAATGAA		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1315G>T	chr19.hg19:g.15064996C>A	ENSP00000221742:p.Ala439Ser	112.0	0.0		98.0	26.0	NM_005071	Q8N753	Missense_Mutation	SNP	ENST00000221742.3	hg19	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	c	24.6	4.545485	0.86022	.	.	ENSG00000105143	ENST00000430939;ENST00000221742	T;T	0.66638	0.31;-0.22	4.46	4.46	0.54185	Sodium:dicarboxylate symporter, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.81297	0.4793	M	0.80332	2.49	0.80722	D	1	D;D	0.71674	0.99;0.998	D;D	0.69307	0.963;0.913	D	0.84307	0.0508	10	0.87932	D	0	-21.0269	14.9867	0.71353	0.0:1.0:0.0:0.0	.	375;439	E7EV13;P48664	.;EAA4_HUMAN	S	375;439	ENSP00000409386:A375S;ENSP00000221742:A439S	ENSP00000221742:A439S	A	-	1	0	SLC1A6	14925996	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.472000	0.80996	2.482000	0.83794	0.546000	0.68486	GCT	.	.		0.597	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
ZNF254	9534	hgsc.bcm.edu	37	19	24270141	24270141	+	Splice_Site	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:24270141T>C	ENST00000357002.4	+	1	145		c.e1+2		ZNF254_ENST00000339642.6_Splice_Site|ZNF254_ENST00000342944.6_Intron	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				CTAGAAATGGTGAGAATGCCA	0.617																																					.		Atlas-SNP	.											.	ZNF254	88	.	0			c.30+2T>C						.						72.0	70.0	70.0					19																	24270141		2203	4300	6503	SO:0001630	splice_region_variant	9534	exon1			AAATGGTGAGAAT	AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.30+2T>C	chr19.hg19:g.24270141T>C		98.0	0.0		94.0	7.0	NM_203282	A4QPC0|Q86XL7	Splice_Site	SNP	ENST00000357002.4	hg19	CCDS32983.1	.	.	.	.	.	.	.	.	.	.	t	2.852	-0.238097	0.05944	.	.	ENSG00000213096	ENST00000357002;ENST00000392281;ENST00000339642	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF254	24061981	0.023000	0.18921	0.013000	0.15412	0.013000	0.08279	0.304000	0.19228	0.257000	0.21650	0.254000	0.18369	.	.	.		0.617	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466453.1	NM_004876	Intron
URI1	8725	hgsc.bcm.edu	37	19	30505901	30505901	+	Silent	SNP	T	T	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:30505901T>G	ENST00000542441.2	+	11	1830	c.1533T>G	c.(1531-1533)gtT>gtG	p.V511V	URI1_ENST00000392271.1_Silent_p.V435V|URI1_ENST00000360605.4_Intron|URI1_ENST00000312051.6_Silent_p.V471V			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	511					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										GAAAGGAAGTTCTGTTGGAAG	0.433																																					p.V511V		Atlas-SNP	.											.	.	.	.	0			c.T1533G						.						119.0	119.0	119.0					19																	30505901		2203	4300	6503	SO:0001819	synonymous_variant	8725	exon11			GGAAGTTCTGTTG	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.1533T>G	chr19.hg19:g.30505901T>G		193.0	0.0		145.0	38.0	NM_003796	A8K805|H7BY42|Q8TC23|Q9UNU3	Silent	SNP	ENST00000542441.2	hg19	CCDS12420.1																																																																																			.	.		0.433	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
ZNF536	9745	hgsc.bcm.edu	37	19	30936438	30936438	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:30936438C>A	ENST00000355537.3	+	2	2116	c.1969C>A	c.(1969-1971)Cgc>Agc	p.R657S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	657					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CAAGCGGGACCGCAAGGGCGA	0.687																																					p.R657S		Atlas-SNP	.											.	ZNF536	424	.	0			c.C1969A						.						54.0	61.0	59.0					19																	30936438		2203	4300	6503	SO:0001583	missense	9745	exon2			CGGGACCGCAAGG		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1969C>A	chr19.hg19:g.30936438C>A	ENSP00000347730:p.Arg657Ser	146.0	0.0		122.0	40.0	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	hg19	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	C	14.12	2.441497	0.43326	.	.	ENSG00000198597	ENST00000355537	T	0.10573	2.86	5.42	4.31	0.51392	Zinc finger, C2H2 (1);	0.053940	0.64402	D	0.000003	T	0.16300	0.0392	N	0.24115	0.695	0.45822	D	0.998695	D;D	0.61697	0.99;0.99	P;P	0.59357	0.856;0.856	T	0.01212	-1.1417	10	0.87932	D	0	-41.0082	12.9214	0.58234	0.2828:0.7172:0.0:0.0	.	657;657	A7E228;O15090	.;ZN536_HUMAN	S	657	ENSP00000347730:R657S	ENSP00000347730:R657S	R	+	1	0	ZNF536	35628278	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	2.426000	0.44731	2.509000	0.84616	0.655000	0.94253	CGC	.	.		0.687	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
TSHZ3	57616	hgsc.bcm.edu	37	19	31770240	31770240	+	Silent	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:31770240G>A	ENST00000240587.4	-	2	786	c.459C>T	c.(457-459)agC>agT	p.S153S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	153	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					tgctgctactgctgctgctgc	0.612																																					p.S153S		Atlas-SNP	.											.	TSHZ3	549	.	0			c.C459T						.						39.0	44.0	42.0					19																	31770240		2183	4296	6479	SO:0001819	synonymous_variant	57616	exon2			GCTACTGCTGCTG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.459C>T	chr19.hg19:g.31770240G>A		153.0	0.0		148.0	6.0	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	hg19	CCDS12421.2																																																																																			.	.		0.612	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
NUDT19	390916	hgsc.bcm.edu	37	19	33200280	33200280	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:33200280A>G	ENST00000397061.3	+	2	904	c.904A>G	c.(904-906)Atg>Gtg	p.M302V		NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	302						mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					TGCTGATGGGATGGTCCATCT	0.468																																					p.M302V		Atlas-SNP	.											.	NUDT19	15	.	0			c.A904G						.						139.0	126.0	130.0					19																	33200280		1965	4146	6111	SO:0001583	missense	390916	exon2			GATGGGATGGTCC		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.904A>G	chr19.hg19:g.33200280A>G	ENSP00000380251:p.Met302Val	62.0	0.0		56.0	20.0	NM_001105570		Missense_Mutation	SNP	ENST00000397061.3	hg19	CCDS42543.1	.	.	.	.	.	.	.	.	.	.	A	2.187	-0.386224	0.04966	.	.	ENSG00000213965	ENST00000397061	T	0.39592	1.07	4.77	-3.36	0.04913	.	1.353990	0.05265	U	0.516445	T	0.25344	0.0616	L	0.36672	1.1	0.09310	N	1	B	0.16802	0.019	B	0.11329	0.006	T	0.12553	-1.0543	10	0.16420	T	0.52	-28.0466	1.0964	0.01674	0.3281:0.2809:0.2545:0.1365	.	302	A8MXV4	NUD19_HUMAN	V	302	ENSP00000380251:M302V	ENSP00000380251:M302V	M	+	1	0	NUDT19	37892120	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-2.281000	0.01157	-1.162000	0.02797	0.482000	0.46254	ATG	.	.		0.468	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000450338.3	XM_372723	
ATP4A	495	hgsc.bcm.edu	37	19	36042385	36042385	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:36042385G>T	ENST00000262623.3	-	19	2877	c.2849C>A	c.(2848-2850)aCg>aAg	p.T950K		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	950					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)	p.T950K(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GAGACGGCGCGTCTTGCGGAT	0.597																																					p.T950K		Atlas-SNP	.											ATP4A,NS,carcinoma,0,1	ATP4A	123	.	1	Substitution - Missense(1)	lung(1)	c.C2849A						.						114.0	84.0	94.0					19																	36042385		2203	4300	6503	SO:0001583	missense	495	exon19			CGGCGCGTCTTGC		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.2849C>A	chr19.hg19:g.36042385G>T	ENSP00000262623:p.Thr950Lys	102.0	0.0		69.0	5.0	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	hg19	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207834	0.79240	.	.	ENSG00000105675	ENST00000262623	D	0.96073	-3.9	5.02	5.02	0.67125	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.64402	D	0.000002	D	0.98327	0.9445	H	0.95004	3.61	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99257	1.0889	10	0.87932	D	0	.	15.8627	0.79038	0.0:0.0:1.0:0.0	.	950	P20648	ATP4A_HUMAN	K	950	ENSP00000262623:T950K	ENSP00000262623:T950K	T	-	2	0	ATP4A	40734225	1.000000	0.71417	0.987000	0.45799	0.494000	0.33585	9.647000	0.98478	2.614000	0.88457	0.297000	0.19635	ACG	.	.		0.597	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
TMEM239	100288797	hgsc.bcm.edu	37	20	2797440	2797440	+	Silent	SNP	A	A	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr20:2797440A>T	ENST00000361033.1	+	2	402	c.369A>T	c.(367-369)gcA>gcT	p.A123A	TMEM239_ENST00000380593.4_Missense_Mutation_p.T171S|TMEM239_ENST00000554164.1_Missense_Mutation_p.T171S|TMEM239_ENST00000380585.1_Silent_p.A80A			Q8WW34	TM239_HUMAN	transmembrane protein 239	123	Leu-rich.					integral component of membrane (GO:0016021)											TGTGCCATGCACTCTTCACCA	0.647																																					p.A80A		Atlas-SNP	.											.	.	.	.	0			c.A240T						.						148.0	135.0	139.0					20																	2797440		692	1591	2283	SO:0001819	synonymous_variant	100288797	exon2			CCATGCACTCTTC		CCDS54444.1	20p13	2012-10-08				ENSG00000198326			40044	protein-coding gene	gene with protein product							Standard	NM_001167670		Approved		uc002wgx.2	Q8WW34	OTTHUMG00000031713	ENST00000361033.1:c.369A>T	chr20.hg19:g.2797440A>T		52.0	0.0		31.0	6.0	NM_001167670	Q5JY54|Q6ZU23	Silent	SNP	ENST00000361033.1	hg19		.	.	.	.	.	.	.	.	.	.	a	7.457	0.643831	0.14451	.	.	ENSG00000198326;ENSG00000241690	ENST00000554164;ENST00000380593	.	.	.	4.69	-9.38	0.00623	.	2.945040	0.01378	N	0.012816	T	0.37999	0.1024	.	.	.	0.47778	D	0.999512	B	0.10296	0.003	B	0.15484	0.013	T	0.27365	-1.0076	8	0.87932	D	0	5.1672	0.8427	0.01154	0.3796:0.1869:0.2459:0.1877	.	171	Q6ZPB1	.	S	171	.	ENSP00000369967:T171S	T	+	1	0	C20orf141;RP5-860F19.6	2745440	0.001000	0.12720	0.438000	0.26821	0.255000	0.26057	-3.091000	0.00609	-1.553000	0.01702	-2.180000	0.00316	ACT	.	.		0.647	TMEM239-002	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000367615.2		
SLC23A2	9962	hgsc.bcm.edu	37	20	4842648	4842648	+	Missense_Mutation	SNP	T	T	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr20:4842648T>G	ENST00000379333.1	-	15	1962	c.1570A>C	c.(1570-1572)Atc>Ctc	p.I524L	SLC23A2_ENST00000338244.1_Missense_Mutation_p.I524L|SLC23A2_ENST00000424750.2_Missense_Mutation_p.I410L	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	524					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CCAAAGAAGATCGAAAATCCA	0.473																																					p.I524L		Atlas-SNP	.											.	SLC23A2	62	.	0			c.A1570C						.						101.0	101.0	101.0					20																	4842648		2203	4300	6503	SO:0001583	missense	9962	exon15			AGAAGATCGAAAA	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1570A>C	chr20.hg19:g.4842648T>G	ENSP00000368637:p.Ile524Leu	210.0	0.0		169.0	38.0	NM_203327	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Missense_Mutation	SNP	ENST00000379333.1	hg19	CCDS13085.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.114|8.114	0.779391|0.779391	0.16120|0.16120	.|.	.|.	ENSG00000089057|ENSG00000089057	ENST00000423430|ENST00000379333;ENST00000338244;ENST00000424750	.|T;T;T	.|0.12984	.|2.63;2.63;2.63	5.35|5.35	4.25|4.25	0.50352|0.50352	.|.	.|0.046508	.|0.85682	.|N	.|0.000000	T|T	0.06508|0.06508	0.0167|0.0167	N|N	0.04820|0.04820	-0.15|-0.15	0.52099|0.52099	D|D	0.999948|0.999948	.|B;B	.|0.25351	.|0.124;0.002	.|B;B	.|0.25614	.|0.062;0.01	T|T	0.36648|0.36648	-0.9739|-0.9739	5|10	.|0.18710	.|T	.|0.47	-21.4032|-21.4032	10.1054|10.1054	0.42530|0.42530	0.0:0.08:0.0:0.92|0.0:0.08:0.0:0.92	.|.	.|410;524	.|B4DJZ1;Q9UGH3	.|.;S23A2_HUMAN	A|L	280|524;524;410	.|ENSP00000368637:I524L;ENSP00000344322:I524L;ENSP00000406601:I410L	.|ENSP00000344322:I524L	D|I	-|-	2|1	0|0	SLC23A2|SLC23A2	4790648|4790648	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.986000|0.986000	0.74619|0.74619	7.698000|7.698000	0.84413|0.84413	0.975000|0.975000	0.38392|0.38392	0.379000|0.379000	0.24179|0.24179	GAT|ATC	.	.		0.473	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
BPI	671	hgsc.bcm.edu	37	20	36954702	36954702	+	Silent	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr20:36954702C>A	ENST00000262865.4	+	10	1130	c.1041C>A	c.(1039-1041)atC>atA	p.I347I	BPI_ENST00000489102.1_3'UTR|CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	347					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)			kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				AGATACAGATCCATGTCTCAG	0.542																																					p.I347I		Atlas-SNP	.											BPI,colon,carcinoma,0,1	BPI	67	.	0			c.C1041A						.						90.0	73.0	79.0					20																	36954702		2203	4300	6503	SO:0001819	synonymous_variant	671	exon10			ACAGATCCATGTC	J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.1041C>A	chr20.hg19:g.36954702C>A		88.0	1.0		53.0	20.0	NM_001725	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Silent	SNP	ENST00000262865.4	hg19	CCDS13303.1	.	.	.	.	.	.	.	.	.	.	C	3.822	-0.037596	0.07497	.	.	ENSG00000101425	ENST00000417318	.	.	.	4.52	-4.15	0.03881	.	.	.	.	.	T	0.19846	0.0477	.	.	.	0.20764	N	0.99986	.	.	.	.	.	.	T	0.27502	-1.0072	4	.	.	.	-7.9026	3.5502	0.07843	0.1146:0.2877:0.4408:0.1569	.	.	.	.	Y	173	.	.	S	+	2	0	BPI	36388116	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.164000	0.03135	-0.859000	0.04105	-0.312000	0.09012	TCC	.	.		0.542	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079157.2	NM_001725	
PLTP	5360	hgsc.bcm.edu	37	20	44531117	44531117	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr20:44531117G>T	ENST00000477313.1	-	10	1663	c.1069C>A	c.(1069-1071)Cca>Aca	p.P357T	PLTP_ENST00000420868.2_Missense_Mutation_p.P262T|PLTP_ENST00000372420.1_Missense_Mutation_p.P269T|PLTP_ENST00000354050.4_Missense_Mutation_p.P305T|PLTP_ENST00000542937.1_Missense_Mutation_p.P377T|PLTP_ENST00000372431.3_Missense_Mutation_p.P357T			P55058	PLTP_HUMAN	phospholipid transfer protein	357					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GGCTGGTCTGGTGGGACCAGG	0.632																																					p.P357T		Atlas-SNP	.											.	PLTP	49	.	0			c.C1069A						.						79.0	78.0	78.0					20																	44531117		2203	4300	6503	SO:0001583	missense	5360	exon11			GGTCTGGTGGGAC	L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.1069C>A	chr20.hg19:g.44531117G>T	ENSP00000417138:p.Pro357Thr	145.0	0.0		104.0	26.0	NM_006227	A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	ENST00000477313.1	hg19	CCDS13386.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.803397	0.31869	.	.	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000354050;ENST00000477313;ENST00000542937;ENST00000420868	T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98	5.28	2.15	0.27550	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.499266	0.23549	N	0.046984	T	0.13798	0.0334	N	0.22421	0.69	0.09310	N	1	P;P;P;P;P;P;P	0.40534	0.72;0.72;0.58;0.72;0.673;0.72;0.72	B;B;B;B;B;B;B	0.43867	0.342;0.342;0.363;0.342;0.178;0.342;0.434	T	0.09707	-1.0662	10	0.72032	D	0.01	-24.1366	2.5856	0.04829	0.2237:0.1228:0.5274:0.1261	.	262;262;269;357;305;357;377	E7EV16;B4DRB4;B4DDD5;Q53H91;P55058-2;P55058;B3KUE5	.;.;.;.;.;PLTP_HUMAN;.	T	269;357;305;357;377;262	ENSP00000361497:P269T;ENSP00000361508:P357T;ENSP00000335290:P305T;ENSP00000417138:P357T;ENSP00000440296:P377T;ENSP00000411671:P262T	ENSP00000335290:P305T	P	-	1	0	PLTP	43964524	0.026000	0.19158	0.006000	0.13384	0.699000	0.40488	0.629000	0.24538	0.752000	0.32923	0.655000	0.94253	CCA	.	.		0.632	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354633.1	NM_006227	
DIDO1	11083	hgsc.bcm.edu	37	20	61525146	61525146	+	Missense_Mutation	SNP	C	C	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr20:61525146C>T	ENST00000266070.4	-	12	3298	c.2973G>A	c.(2971-2973)atG>atA	p.M991I	DIDO1_ENST00000395343.1_Missense_Mutation_p.M991I|DIDO1_ENST00000395335.2_Missense_Mutation_p.M991I|DIDO1_ENST00000395340.1_Missense_Mutation_p.M991I	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	991					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TGGCTTCCACCATGTGGGTGC	0.602																																					p.M991I	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.G2973A						.						108.0	92.0	98.0					20																	61525146		2203	4300	6503	SO:0001583	missense	11083	exon12			TTCCACCATGTGG	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2973G>A	chr20.hg19:g.61525146C>T	ENSP00000266070:p.Met991Ile	84.0	0.0		72.0	30.0	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	10.64	1.408173	0.25378	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.11063	3.2;3.2;2.81;2.81	5.67	-11.3	0.00108	.	7.102440	0.01069	N	0.004784	T	0.04363	0.0120	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21109	-1.0255	10	0.26408	T	0.33	0.4447	7.0578	0.25109	0.3842:0.228:0.0:0.3877	.	991;991	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	I	991	ENSP00000266070:M991I;ENSP00000378752:M991I;ENSP00000378749:M991I;ENSP00000378744:M991I	ENSP00000266070:M991I	M	-	3	0	DIDO1	60995591	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.473000	0.00988	-2.432000	0.00556	-0.961000	0.02630	ATG	.	.		0.602	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
KRTAP6-1	337966	hgsc.bcm.edu	37	21	31986189	31986189	+	Missense_Mutation	SNP	G	G	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr21:31986189G>A	ENST00000329122.2	-	1	60	c.35C>T	c.(34-36)aCc>aTc	p.T12I	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	12						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						ATAGCCAGGGGTGCCATAGTA	0.562																																					p.T12I		Atlas-SNP	.											.	KRTAP6-1	21	.	0			c.C35T						.						203.0	195.0	198.0					21																	31986189		2203	4300	6503	SO:0001583	missense	337966	exon1			CCAGGGGTGCCAT	AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.35C>T	chr21.hg19:g.31986189G>A	ENSP00000332690:p.Thr12Ile	127.0	0.0		118.0	34.0	NM_181602		Missense_Mutation	SNP	ENST00000329122.2	hg19	CCDS13602.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.172|3.172	-0.169742|-0.169742	0.06461|0.06461	.|.	.|.	ENSG00000184724|ENSG00000184724	ENST00000399871|ENST00000329122	.|T	.|0.18338	.|2.22	5.03|5.03	0.972|0.972	0.19704|0.19704	.|.	.|0.813174	.|0.10260	.|U	.|0.696055	.|T	.|0.11922	.|0.0290	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.19817	.|0.039	.|B	.|0.19391	.|0.025	.|T	.|0.33599	.|-0.9862	.|9	.|0.87932	.|D	.|0	.|.	3.3924|3.3924	0.07294|0.07294	0.1369:0.5621:0.1376:0.1633|0.1369:0.5621:0.1376:0.1633	.|.	.|12	.|Q3LI64	.|KRA61_HUMAN	.|I	-1|12	.|ENSP00000332690:T12I	.|ENSP00000332690:T12I	.|T	-|-	.|2	.|0	KRTAP6-1|KRTAP6-1	30908060|30908060	0.012000|0.012000	0.17670|0.17670	0.016000|0.016000	0.15963|0.15963	0.319000|0.319000	0.28217|0.28217	0.082000|0.082000	0.14847|0.14847	0.411000|0.411000	0.25702|0.25702	-0.159000|-0.159000	0.13428|0.13428	.|ACC	.	.		0.562	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128240.2	NM_181602	
KCNJ6	3763	hgsc.bcm.edu	37	21	38997477	38997477	+	Missense_Mutation	SNP	T	T	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr21:38997477T>C	ENST00000609713.1	-	4	1845	c.1256A>G	c.(1255-1257)aAt>aGt	p.N419S	KCNJ6_ENST00000288309.6_Missense_Mutation_p.N419S	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	419					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	TTTGGATTCATTCTCCAGGTT	0.443																																					p.N419S	Pancreas(48;379 1118 2936 19024 28214)	Atlas-SNP	.											.	KCNJ6	58	.	0			c.A1256G						.						207.0	197.0	200.0					21																	38997477		1892	4120	6012	SO:0001583	missense	3763	exon4			GATTCATTCTCCA	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.1256A>G	chr21.hg19:g.38997477T>C	ENSP00000477437:p.Asn419Ser	68.0	0.0		46.0	11.0	NM_002240	Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	hg19	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	T	4.367	0.067684	0.08436	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.86956	-2.19;-2.19	5.77	3.44	0.39384	.	0.143577	0.64402	N	0.000007	T	0.64886	0.2639	N	0.02539	-0.55	0.38575	D	0.950038	B	0.06786	0.001	B	0.04013	0.001	T	0.54866	-0.8229	10	0.07990	T	0.79	.	8.1399	0.31078	0.0:0.2153:0.0:0.7847	.	419	P48051	IRK6_HUMAN	S	419	ENSP00000383330:N419S;ENSP00000288309:N419S	ENSP00000288309:N419S	N	-	2	0	KCNJ6	37919347	0.989000	0.36119	0.972000	0.41901	0.904000	0.53231	1.601000	0.36773	0.474000	0.27392	0.533000	0.62120	AAT	.	.		0.443	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
MYO18B	84700	hgsc.bcm.edu	37	22	26164310	26164310	+	Missense_Mutation	SNP	C	C	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr22:26164310C>A	ENST00000407587.2	+	4	596	c.427C>A	c.(427-429)Ccc>Acc	p.P143T	MYO18B_ENST00000536101.1_Missense_Mutation_p.P143T|MYO18B_ENST00000335473.7_Missense_Mutation_p.P143T			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	143						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AAAGACTGTCCCCTTCAAGAG	0.612																																					p.P143T		Atlas-SNP	.											.	MYO18B	322	.	0			c.C427A						.						35.0	40.0	38.0					22																	26164310		2032	4178	6210	SO:0001583	missense	84700	exon4			ACTGTCCCCTTCA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.427C>A	chr22.hg19:g.26164310C>A	ENSP00000386096:p.Pro143Thr	231.0	0.0		172.0	47.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	14.08	2.428961	0.43122	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.93247	-3.16;-3.16;-3.19	4.9	3.81	0.43845	.	0.000000	0.36234	N	0.002707	D	0.95497	0.8537	M	0.65975	2.015	0.30538	N	0.766746	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	D	0.92534	0.6036	10	0.87932	D	0	.	11.7218	0.51688	0.0:0.8213:0.1787:0.0	.	143;143;143	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	T	143	ENSP00000441229:P143T;ENSP00000334563:P143T;ENSP00000386096:P143T	ENSP00000334563:P143T	P	+	1	0	MYO18B	24494310	0.853000	0.29707	0.625000	0.29200	0.280000	0.26924	1.114000	0.31196	2.272000	0.75746	0.484000	0.47621	CCC	.	.		0.612	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
GGA1	26088	hgsc.bcm.edu	37	22	38012994	38012994	+	Missense_Mutation	SNP	A	A	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr22:38012994A>T	ENST00000343632.4	+	3	580	c.194A>T	c.(193-195)cAg>cTg	p.Q65L	GGA1_ENST00000337437.4_Missense_Mutation_p.Q65L|GGA1_ENST00000414350.3_Missense_Mutation_p.Q65L|GGA1_ENST00000405147.3_Missense_Mutation_p.Q65L|GGA1_ENST00000381756.5_Missense_Mutation_p.Q65L|GGA1_ENST00000406772.1_De_novo_Start_OutOfFrame|GGA1_ENST00000325180.8_Missense_Mutation_p.Q65L	NM_001172687.1|NM_013365.4	NP_001166158.1|NP_037497.1	Q9UJY5	GGA1_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 1	65	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	10	Melanoma(58;0.0574)					GAGGCGATCCAGGCCTTGACG	0.642																																					p.Q65L		Atlas-SNP	.											.	GGA1	39	.	0			c.A194T						.						60.0	53.0	55.0					22																	38012994		2200	4297	6497	SO:0001583	missense	26088	exon3			CGATCCAGGCCTT	AF190862	CCDS13951.1, CCDS33643.1, CCDS54526.1	22q13.31	2010-02-12	2010-02-12		ENSG00000100083	ENSG00000100083			17842	protein-coding gene	gene with protein product		606004				10747088, 10747089, 16407204	Standard	NM_013365		Approved		uc003atc.3	Q9UJY5	OTTHUMG00000030985	ENST00000343632.4:c.194A>T	chr22.hg19:g.38012994A>T	ENSP00000341344:p.Gln65Leu	138.0	0.0		101.0	21.0	NM_001001560	A8K3D3|B0QYR7|Q5TG07|Q86YA9|Q8NCS6|Q9BW94|Q9UG00|Q9UGW0|Q9UGW1	Missense_Mutation	SNP	ENST00000343632.4	hg19	CCDS13951.1	.	.	.	.	.	.	.	.	.	.	A	33	5.203471	0.95033	.	.	ENSG00000100083	ENST00000414350;ENST00000343632;ENST00000381756;ENST00000405147;ENST00000325180;ENST00000337437;ENST00000449944	T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13	5.43	5.43	0.79202	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.85682	D	0.000000	T	0.36744	0.0978	L	0.56124	1.755	0.80722	D	1	D;D;B;D	0.89917	1.0;0.999;0.273;0.997	D;D;P;D	0.91635	0.999;0.995;0.457;0.996	T	0.18618	-1.0331	10	0.02654	T	1	-24.696	15.4889	0.75590	1.0:0.0:0.0:0.0	.	65;65;65;65	Q6IC75;Q86YA9;Q9UJY5;Q8NCS6	.;.;GGA1_HUMAN;.	L	65;65;65;65;65;65;57	ENSP00000414387:Q65L;ENSP00000341344:Q65L;ENSP00000371175:Q65L;ENSP00000384030:Q65L;ENSP00000321288:Q65L;ENSP00000338647:Q65L;ENSP00000390416:Q57L	ENSP00000321288:Q65L	Q	+	2	0	GGA1	36342940	1.000000	0.71417	0.996000	0.52242	0.961000	0.63080	9.070000	0.93974	2.062000	0.61559	0.528000	0.53228	CAG	.	.		0.642	GGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075873.3	NM_013365	
NCAPH2	29781	hgsc.bcm.edu	37	22	50961535	50961535	+	Missense_Mutation	SNP	G	G	T			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr22:50961535G>T	ENST00000420993.2	+	19	1739	c.1617G>T	c.(1615-1617)gaG>gaT	p.E539D	CTA-384D8.36_ENST00000608319.1_RNA|NCAPH2_ENST00000299821.11_Missense_Mutation_p.E540D|NCAPH2_ENST00000395701.3_Missense_Mutation_p.E539D	NM_001185011.1|NM_152299.3	NP_001171940.1|NP_689512.2	Q6IBW4	CNDH2_HUMAN	non-SMC condensin II complex, subunit H2	539					chromosome condensation (GO:0030261)|mitotic cell cycle (GO:0000278)	chromosome (GO:0005694)|membrane (GO:0016020)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|lung(10)|ovary(1)|prostate(2)|skin(3)|stomach(1)	24		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		CCTTTGCGGAGCTGGTGGCTG	0.642																																					p.E540D		Atlas-SNP	.											.	NCAPH2	69	.	0			c.G1620T						.						58.0	45.0	49.0					22																	50961535		2202	4300	6502	SO:0001583	missense	29781	exon19			TGCGGAGCTGGTG	BC001937	CCDS14094.2, CCDS43038.1, CCDS54546.1	22q13.33	2008-02-04			ENSG00000025770	ENSG00000025770			25071	protein-coding gene	gene with protein product	"""kleisin beta"", ""CAP-H2 subunit of the condensin II complex"""	611230				10493829	Standard	NM_014551		Approved	384D8-2, hCAP-H2, CAP-H2	uc003blx.4	Q6IBW4	OTTHUMG00000150205	ENST00000420993.2:c.1617G>T	chr22.hg19:g.50961535G>T	ENSP00000410088:p.Glu539Asp	82.0	0.0		80.0	33.0	NM_001185011	B7WPH1|O43788|Q13391|Q96C14|Q96GJ0|Q9BQ71|Q9BUT3|Q9BVD1	Missense_Mutation	SNP	ENST00000420993.2	hg19	CCDS14094.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.95|11.95	1.791062|1.791062	0.31685|0.31685	.|.	.|.	ENSG00000025770|ENSG00000025770	ENST00000420993;ENST00000395701;ENST00000299821|ENST00000522304	.|.	.|.	.|.	4.79|4.79	-2.97|-2.97	0.05530|0.05530	.|.	0.979822|.	0.08392|.	N|.	0.952796|.	T|T	0.23965|0.23965	0.0580|0.0580	L|L	0.41824|0.41824	1.3|1.3	0.09310|0.09310	N|N	0.999991|0.999991	P;P;P|.	0.43938|.	0.787;0.787;0.822|.	B;B;B|.	0.40285|.	0.218;0.258;0.325|.	T|T	0.32955|0.32955	-0.9887|-0.9887	9|5	0.19147|.	T|.	0.46|.	-5.3658|-5.3658	0.6416|0.6416	0.00811|0.00811	0.2612:0.3148:0.2089:0.2151|0.2612:0.3148:0.2089:0.2151	.|.	540;517;539|.	Q6IBW4-4;Q6IBW4-2;Q6IBW4|.	.;.;CNDH2_HUMAN|.	D|I	539;539;540|75	.|.	ENSP00000299821:E540D|.	E|S	+|+	3|2	2|0	NCAPH2|NCAPH2	49308401|49308401	0.011000|0.011000	0.17503|0.17503	0.174000|0.174000	0.22961|0.22961	0.921000|0.921000	0.55340|0.55340	0.149000|0.149000	0.16243|0.16243	-0.054000|-0.054000	0.13266|0.13266	0.561000|0.561000	0.74099|0.74099	GAG|AGC	.	.		0.642	NCAPH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317012.1	NM_152299	
RBM10	8241	hgsc.bcm.edu	37	X	47028882	47028882	+	Missense_Mutation	SNP	G	G	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chrX:47028882G>C	ENST00000377604.3	+	3	928	c.186G>C	c.(184-186)gaG>gaC	p.E62D	RBM10_ENST00000329236.7_Missense_Mutation_p.E62D|RBM10_ENST00000345781.6_Missense_Mutation_p.E62D	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	62					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						ACTCATCTGAGGAGCAGAGTG	0.647																																					p.E127D	Melanoma(171;120 2705 19495 39241)	Atlas-SNP	.											.	RBM10	117	.	0			c.G381C						.						63.0	41.0	49.0					X																	47028882		2203	4300	6503	SO:0001583	missense	8241	exon3			ATCTGAGGAGCAG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.186G>C	chrX.hg19:g.47028882G>C	ENSP00000366829:p.Glu62Asp	68.0	0.0		41.0	26.0	NM_001204468	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	hg19	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680497	0.29872	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.40476	1.03;2.15;2.39	4.65	-0.338	0.12651	.	0.260506	0.30714	N	0.009034	T	0.33206	0.0855	N	0.11560	0.145	0.30912	N	0.728979	B;D;D;B;D	0.61697	0.004;0.983;0.99;0.008;0.984	B;P;P;B;D	0.68192	0.009;0.621;0.789;0.009;0.956	T	0.39333	-0.9619	10	0.11485	T	0.65	-19.8756	7.7473	0.28877	0.5277:0.0:0.4723:0.0	.	62;127;62;62;62	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	D	62	ENSP00000366829:E62D;ENSP00000328848:E62D;ENSP00000329659:E62D	ENSP00000328848:E62D	E	+	3	2	RBM10	46913826	0.849000	0.29639	0.759000	0.31340	0.912000	0.54170	-0.155000	0.10115	-0.497000	0.06641	-0.322000	0.08575	GAG	.	.		0.647	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
DLG3	1741	hgsc.bcm.edu	37	X	69669569	69669569	+	Missense_Mutation	SNP	A	A	C			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chrX:69669569A>C	ENST00000374360.3	+	4	796	c.563A>C	c.(562-564)gAg>gCg	p.E188A	DLG3_ENST00000194900.4_Missense_Mutation_p.E206A|DLG3_ENST00000374355.3_5'Flank|RNU4-81P_ENST00000363561.1_RNA	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	188	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)			endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					CGGGTGAATGAGGTGGACGTG	0.662																																					p.E188A		Atlas-SNP	.											.	DLG3	100	.	0			c.A563C						.						73.0	48.0	56.0					X																	69669569		2203	4300	6503	SO:0001583	missense	1741	exon4			TGAATGAGGTGGA	U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.563A>C	chrX.hg19:g.69669569A>C	ENSP00000363480:p.Glu188Ala	50.0	0.0		33.0	17.0	NM_021120	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Missense_Mutation	SNP	ENST00000374360.3	hg19	CCDS14403.1	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680362	0.68042	.	.	ENSG00000082458	ENST00000194900;ENST00000374360	T;T	0.27256	2.28;1.68	4.48	4.48	0.54585	PDZ/DHR/GLGF (4);	0.135579	0.47852	D	0.000204	T	0.28699	0.0711	L	0.31578	0.945	0.80722	D	1	P	0.37122	0.583	P	0.49332	0.607	T	0.05338	-1.0891	9	.	.	.	.	11.7928	0.52080	1.0:0.0:0.0:0.0	.	188	Q92796	DLG3_HUMAN	A	206;188	ENSP00000194900:E206A;ENSP00000363480:E188A	.	E	+	2	0	DLG3	69586294	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.618000	0.90932	1.658000	0.50742	0.356000	0.21956	GAG	.	.		0.662	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120	
OR13H1	347468	hgsc.bcm.edu	37	X	130678861	130678861	+	Missense_Mutation	SNP	T	T	A			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chrX:130678861T>A	ENST00000338616.3	+	1	912	c.814T>A	c.(814-816)Ttt>Att	p.F272I		NM_001004486.1	NP_001004486.1	Q8NG92	O13H1_HUMAN	olfactory receptor, family 13, subfamily H, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15	Acute lymphoblastic leukemia(192;0.000636)					CCAGGACAAGTTTATCTCAGT	0.433																																					p.F272I		Atlas-SNP	.											.	OR13H1	41	.	0			c.T814A						.						112.0	105.0	107.0					X																	130678861		2203	4300	6503	SO:0001583	missense	347468	exon1			GACAAGTTTATCT		CCDS35396.1	Xq26.2	2012-08-23			ENSG00000171054	ENSG00000171054		"""GPCR / Class A : Olfactory receptors"""	14755	protein-coding gene	gene with protein product							Standard	NM_001004486		Approved		uc011muw.2	Q8NG92	OTTHUMG00000022411	ENST00000338616.3:c.814T>A	chrX.hg19:g.130678861T>A	ENSP00000340748:p.Phe272Ile	281.0	1.0		246.0	134.0	NM_001004486	B2RNQ3|Q6IET8|Q96R12	Missense_Mutation	SNP	ENST00000338616.3	hg19	CCDS35396.1	.	.	.	.	.	.	.	.	.	.	T	3.841	-0.033882	0.07543	.	.	ENSG00000171054	ENST00000338616	T	0.00048	8.82	4.87	2.38	0.29361	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40640	U	0.001046	T	0.00039	0.0001	N	0.02213	-0.635	0.19300	N	0.999971	B	0.18863	0.031	B	0.13407	0.009	T	0.06162	-1.0842	10	0.20519	T	0.43	.	3.3027	0.06989	0.3731:0.0994:0.0:0.5275	.	272	Q8NG92	O13H1_HUMAN	I	272	ENSP00000340748:F272I	ENSP00000340748:F272I	F	+	1	0	OR13H1	130506542	0.000000	0.05858	0.379000	0.26080	0.911000	0.54048	-0.545000	0.06069	0.189000	0.20188	0.481000	0.45027	TTT	.	.		0.433	OR13H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058297.1		
IDS	3423	hgsc.bcm.edu	37	X	148564324	148564324	+	Missense_Mutation	SNP	A	A	G			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chrX:148564324A>G	ENST00000340855.6	-	9	1815	c.1606T>C	c.(1606-1608)Tat>Cat	p.Y536H	IDS_ENST00000422081.2_Missense_Mutation_p.Y325H|IDS_ENST00000541269.1_Missense_Mutation_p.Y325H|IDS_ENST00000537071.1_Missense_Mutation_p.Y139H	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	536					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GAATCATTATACATATTGTGA	0.438																																					p.Y536H		Atlas-SNP	.											.	IDS	46	.	0			c.T1606C						.						86.0	74.0	78.0					X																	148564324		2203	4300	6503	SO:0001583	missense	3423	exon9			CATTATACATATT	M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.1606T>C	chrX.hg19:g.148564324A>G	ENSP00000339801:p.Tyr536His	95.0	0.0		64.0	41.0	NM_000202	D3DWT4|Q14604|Q9BRM3	Missense_Mutation	SNP	ENST00000340855.6	hg19	CCDS14685.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.261526	0.39995	.	.	ENSG00000010404	ENST00000340855;ENST00000537071;ENST00000541269	D;D;D	0.99896	-7.6;-3.27;-7.6	5.77	4.62	0.57501	.	0.063724	0.64402	D	0.000004	D	0.99435	0.9800	M	0.69823	2.125	0.80722	D	1	B;B	0.28378	0.209;0.209	B;B	0.23419	0.046;0.046	D	0.99990	1.4245	10	0.17832	T	0.49	.	10.7906	0.46429	0.9254:0.0:0.0746:0.0	.	446;536	B4DGD7;P22304	.;IDS_HUMAN	H	536;139;325	ENSP00000339801:Y536H;ENSP00000440324:Y139H;ENSP00000441261:Y325H	ENSP00000339801:Y536H	Y	-	1	0	IDS	148372229	1.000000	0.71417	0.345000	0.25642	0.913000	0.54294	8.176000	0.89686	0.821000	0.34540	0.441000	0.28932	TAT	.	.		0.438	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058677.3		
IFI30	10437	hgsc.bcm.edu	37	19	18288521	18288521	+	Splice_Site	DEL	A	A	-	rs202043324		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr19:18288521delA	ENST00000407280.3	+	6	812	c.637delA	c.(637-639)aaa>aa	p.K213fs	PIK3R2_ENST00000593731.1_3'UTR	NM_006332.3	NP_006323.2	P13284	GILT_HUMAN	interferon, gamma-inducible protein 30	213					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of fibroblast proliferation (GO:0048147)|protein stabilization (GO:0050821)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	oxidoreductase activity, acting on a sulfur group of donors (GO:0016667)			endometrium(1)|kidney(2)|large_intestine(1)|stomach(1)	5						CTTTGTGCAGAAACCCTTGGA	0.572																																					.		Atlas-INDEL	.											.	IFI30	12	.	0			c.637-1A>-						.						72.0	70.0	71.0					19																	18288521		1952	4129	6081	SO:0001630	splice_region_variant	10437	exon6			.	J03909	CCDS46015.1	19p13.1	2008-07-16				ENSG00000216490			5398	protein-coding gene	gene with protein product	"""gamma-interferon-inducible lysosomal thiol reductase"", ""interferon gamma-inducible protein 30 preproprotein"""	604664				3136170, 10639150	Standard	NM_006332		Approved	IFI-30, GILT, IP30, MGC32056	uc002nic.1	P13284		ENST00000407280.3:c.637-1A>-	chr19.hg19:g.18288521delA		120.0	0.0		107.0	27.0	NM_006332	Q76MF9|Q8NEI4|Q8WU77|Q9UL08	Splice_Site	DEL	ENST00000407280.3	hg19	CCDS46015.1																																																																																			.	.		0.572	IFI30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466396.3	NM_006332	Frame_Shift_Del
APOB	338	hgsc.bcm.edu	37	2	21229990	21230013	+	In_Frame_Del	DEL	TCCAGGAATTTGAAAGGTCCTGGG	TCCAGGAATTTGAAAGGTCCTGGG	-	rs372260836|rs368703055		TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	TCCAGGAATTTGAAAGGTCCTGGG	TCCAGGAATTTGAAAGGTCCTGGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:21229990_21230013delTCCAGGAATTTGAAAGGTCCTGGG	ENST00000233242.1	-	26	9854_9877	c.9727_9750delCCCAGGACCTTTCAAATTCCTGGA	c.(9727-9750)cccaggacctttcaaattcctggadel	p.PRTFQIPG3243del		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3243					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAACAGTGTATCCAGGAATTTGAAAGGTCCTGGGGAGCTCGTCG	0.388																																					p.3243_3251del		Atlas-INDEL	.											.	APOB	761	.	0			c.9728_9751del						.																																			SO:0001651	inframe_deletion	338	exon26			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9727_9750delCCCAGGACCTTTCAAATTCCTGGA	chr2.hg19:g.21229990_21230013delTCCAGGAATTTGAAAGGTCCTGGG	ENSP00000233242:p.Pro3243_Gly3250del	180.0	0.0		99.0	13.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	In_Frame_Del	DEL	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.388	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOB	338	hgsc.bcm.edu	37	2	21230017	21230017	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr2:21230017delC	ENST00000233242.1	-	26	9850	c.9723delG	c.(9721-9723)gagfs	p.E3241fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3241					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCTGGGGAGCTCGTCGTGAG	0.378																																					p.L3242fs		Atlas-INDEL	.											.	APOB	761	.	0			c.9724delC						.						52.0	52.0	52.0					2																	21230017		2203	4300	6503	SO:0001589	frameshift_variant	338	exon26			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9723delG	chr2.hg19:g.21230017delC	ENSP00000233242:p.Glu3241fs	170.0	0.0		99.0	13.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.378	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
BEND3	57673	hgsc.bcm.edu	37	6	107390291	107390303	+	Frame_Shift_Del	DEL	GGATCTTGCAAAA	GGATCTTGCAAAA	-			TCGA-LG-A9QD-01A-11D-A382-10	TCGA-LG-A9QD-10A-01D-A385-10	GGATCTTGCAAAA	GGATCTTGCAAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5fcdf560-e18b-49e8-8a70-aad63a200d43	76fbd0ec-29e4-48fe-bfa2-438285845c0e	g.chr6:107390291_107390303delGGATCTTGCAAAA	ENST00000369042.1	-	4	2282_2294	c.2092_2104delTTTTGCAAGATCC	c.(2092-2106)ttttgcaagatccccfs	p.FCKIP698fs	BEND3_ENST00000429433.2_Frame_Shift_Del_p.FCKIP698fs			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	698										central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						TCGTCCAAGGGGATCTTGCAAAAGTCCTTGCTG	0.615																																					p.698_702del		Atlas-INDEL	.											.	BEND3	70	.	0			c.2093_2105del						.																																			SO:0001589	frameshift_variant	57673	exon5			.	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.2092_2104delTTTTGCAAGATCC	chr6.hg19:g.107390291_107390303delGGATCTTGCAAAA	ENSP00000358038:p.Phe698fs	246.0	0.0		157.0	29.0	NM_001080450	A2RRH2|Q9HCL9	Frame_Shift_Del	DEL	ENST00000369042.1	hg19	CCDS34507.1																																																																																			.	.		0.615	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041686.1	NM_020913	
