#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RNF220	55182	hgsc.bcm.edu	37	1	45111132	45111132	+	Missense_Mutation	SNP	A	A	G			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr1:45111132A>G	ENST00000355387.2	+	12	1867	c.1417A>G	c.(1417-1419)Aag>Gag	p.K473E	RNF220_ENST00000361799.2_Missense_Mutation_p.K473E|RNF220_ENST00000372247.2_Missense_Mutation_p.K473E|TMEM53_ENST00000372243.3_Missense_Mutation_p.F63S|TMEM53_ENST00000372242.3_Missense_Mutation_p.F153S|TMEM53_ENST00000372244.3_Silent_p.L22L|RNF220_ENST00000443020.2_Missense_Mutation_p.K260E|RNF220_ENST00000480686.1_3'UTR			Q5VTB9	RN220_HUMAN	ring finger protein 220	473					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						GGCCATGCAGAAGACCTGCAA	0.587																																					p.K473E		Atlas-SNP	.											.	RNF220	56	.	0			c.A1417G						.						111.0	94.0	100.0					1																	45111132		2203	4300	6503	SO:0001583	missense	55182	exon12			ATGCAGAAGACCT	AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.1417A>G	chr1.hg19:g.45111132A>G	ENSP00000347548:p.Lys473Glu	144.0	0.0		126.0	31.0	NM_018150	B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Missense_Mutation	SNP	ENST00000355387.2	hg19	CCDS510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.47|14.47	2.545819|2.545819	0.45280|0.45280	.|.	.|.	ENSG00000126106|ENSG00000187147	ENST00000372243;ENST00000372242|ENST00000355387;ENST00000361799;ENST00000453887;ENST00000372247;ENST00000443020;ENST00000440132;ENST00000335497;ENST00000372248	.|D;D;D;D;D;D	.|0.88124	.|-2.34;-2.34;-2.34;-2.34;-2.34;-2.34	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	.|0.058799	.|0.64402	.|D	.|0.000003	T|T	0.71643|0.71643	0.3364|0.3364	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	D|P;P;B;P;B	0.62365|0.36315	0.991|0.547;0.547;0.172;0.483;0.034	P|B;B;B;B;B	0.62089|0.30316	0.898|0.114;0.114;0.039;0.058;0.017	T|T	0.73930|0.73930	-0.3827|-0.3827	8|10	0.14656|0.07990	T|T	0.56|0.79	.|.	16.2163|16.2163	0.82224|0.82224	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	63|215;260;152;190;473	Q5TDE6|B4DJE2;B4DLZ9;D3DPZ1;C9JJY2;Q5VTB9	.|.;.;.;.;RN220_HUMAN	S|E	63;153|473;473;473;473;260;189;215;216	.|ENSP00000347548:K473E;ENSP00000354872:K473E;ENSP00000361321:K473E;ENSP00000414640:K260E;ENSP00000388533:K189E;ENSP00000335580:K215E	ENSP00000361316:F153S|ENSP00000335580:K215E	F|K	-|+	2|1	0|0	TMEM53|RNF220	44883719|44883719	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	6.336000|6.336000	0.72954|0.72954	2.235000|2.235000	0.73313|0.73313	0.459000|0.459000	0.35465|0.35465	TTC|AAG	.	.		0.587	RNF220-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000020683.4	NM_018150	
PCSK9	255738	hgsc.bcm.edu	37	1	55521763	55521763	+	Silent	SNP	C	C	T			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr1:55521763C>T	ENST00000302118.5	+	6	1187	c.897C>T	c.(895-897)gcC>gcT	p.A299A	PCSK9_ENST00000543384.1_Silent_p.A99A|PCSK9_ENST00000490692.1_3'UTR	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	299	Peptidase S8.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.A299A(1)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						TCCTCAACGCCGCCTGCCAGC	0.692																																					p.A299A	Pancreas(137;1454 1827 5886 22361 42375)	Atlas-SNP	.											PCSK9,NS,carcinoma,0,1	PCSK9	76	.	1	Substitution - coding silent(1)	prostate(1)	c.C897T						.						13.0	15.0	14.0					1																	55521763		2192	4288	6480	SO:0001819	synonymous_variant	255738	exon6			CAACGCCGCCTGC	AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.897C>T	chr1.hg19:g.55521763C>T		156.0	0.0		151.0	7.0	NM_174936	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Silent	SNP	ENST00000302118.5	hg19	CCDS603.1																																																																																			.	.		0.692	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022280.1	NM_174936	
ATP1A1	476	hgsc.bcm.edu	37	1	116940569	116940569	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr1:116940569T>C	ENST00000295598.5	+	15	2285	c.2033T>C	c.(2032-2034)cTg>cCg	p.L678P	ATP1A1_ENST00000369496.4_Missense_Mutation_p.L647P|ATP1A1_ENST00000537345.1_Missense_Mutation_p.L678P	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	678					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	TCCGAGCAGCTGGATGACATT	0.483																																					p.L678P		Atlas-SNP	.											.	ATP1A1	87	.	0			c.T2033C						.						159.0	139.0	146.0					1																	116940569		2203	4300	6503	SO:0001583	missense	476	exon15			AGCAGCTGGATGA	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2033T>C	chr1.hg19:g.116940569T>C	ENSP00000295598:p.Leu678Pro	80.0	0.0		56.0	10.0	NM_001160233	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	hg19	CCDS887.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.495271	0.85069	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.96396	-4.0;-4.0;-4.0	5.15	5.15	0.70609	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.156884	0.44902	D	0.000412	D	0.98535	0.9511	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	D	0.99808	1.1039	10	0.87932	D	0	.	15.1447	0.72641	0.0:0.0:0.0:1.0	.	678;678	F5H3A1;P05023	.;AT1A1_HUMAN	P	678;678;647	ENSP00000295598:L678P;ENSP00000445306:L678P;ENSP00000358508:L647P	ENSP00000295598:L678P	L	+	2	0	ATP1A1	116742092	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.868000	0.87116	2.159000	0.67721	0.533000	0.62120	CTG	.	.		0.483	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
TBX19	9095	hgsc.bcm.edu	37	1	168274288	168274288	+	Missense_Mutation	SNP	C	C	T			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr1:168274288C>T	ENST00000367821.3	+	6	821	c.770C>T	c.(769-771)gCa>gTa	p.A257V		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	257					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					GTGTGCACAGCAGGAAACTCC	0.527																																					p.A257V		Atlas-SNP	.											.	TBX19	68	.	0			c.C770T						.						162.0	147.0	152.0					1																	168274288		2203	4300	6503	SO:0001583	missense	9095	exon6			GCACAGCAGGAAA	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.770C>T	chr1.hg19:g.168274288C>T	ENSP00000356795:p.Ala257Val	68.0	0.0		71.0	12.0	NM_005149	Q52M53	Missense_Mutation	SNP	ENST00000367821.3	hg19	CCDS1272.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403448	0.42613	.	.	ENSG00000143178	ENST00000367821	D	0.83419	-1.72	5.84	5.84	0.93424	.	0.467241	0.20894	N	0.083775	T	0.72495	0.3467	L	0.50333	1.59	0.33927	D	0.641639	B	0.26081	0.141	B	0.25759	0.063	T	0.68769	-0.5321	9	0.30854	T	0.27	.	17.9282	0.88990	0.0:1.0:0.0:0.0	.	257	O60806	TBX19_HUMAN	V	257	ENSP00000356795:A257V	ENSP00000356795:A257V	A	+	2	0	TBX19	166540912	0.391000	0.25221	0.112000	0.21494	0.113000	0.19764	4.102000	0.57776	2.760000	0.94817	0.655000	0.94253	GCA	.	.		0.527	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083825.1	NM_005149	
ZRANB3	84083	hgsc.bcm.edu	37	2	136071142	136071142	+	Missense_Mutation	SNP	T	T	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr2:136071142T>A	ENST00000264159.6	-	8	999	c.883A>T	c.(883-885)Ata>Tta	p.I295L	ZRANB3_ENST00000536680.1_Missense_Mutation_p.I295L|ZRANB3_ENST00000401392.1_Missense_Mutation_p.I295L	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	295	DNA annealing helicase activity.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GTTCTCATTATTTTTTCCCAC	0.378																																					p.I295L		Atlas-SNP	.											.	ZRANB3	109	.	0			c.A883T						.						142.0	133.0	136.0					2																	136071142		1850	4087	5937	SO:0001583	missense	84083	exon8			TCATTATTTTTTC	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.883A>T	chr2.hg19:g.136071142T>A	ENSP00000264159:p.Ile295Leu	87.0	0.0		86.0	21.0	NM_032143	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	hg19	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	T	1.552	-0.538912	0.04053	.	.	ENSG00000121988	ENST00000401392;ENST00000264159;ENST00000536680;ENST00000397448	D;D;D	0.90324	-2.65;-2.65;-2.63	5.56	3.06	0.35304	SNF2-related (1);	0.079119	0.51477	N	0.000081	T	0.66257	0.2771	N	0.00894	-1.105	0.28753	N	0.901347	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.60535	-0.7244	10	0.02654	T	1	-17.3694	5.3255	0.15905	0.7272:0.0:0.1406:0.1322	.	235;295;295	E9PBP0;Q5FWF4;Q5FWF4-3	.;ZRAB3_HUMAN;.	L	295;295;295;235	ENSP00000383979:I295L;ENSP00000264159:I295L;ENSP00000441320:I295L	ENSP00000264159:I295L	I	-	1	0	ZRANB3	135787612	1.000000	0.71417	1.000000	0.80357	0.556000	0.35491	2.420000	0.44679	0.365000	0.24400	-0.878000	0.02970	ATA	.	.		0.378	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
STAB1	23166	hgsc.bcm.edu	37	3	52550761	52550761	+	Missense_Mutation	SNP	C	C	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr3:52550761C>A	ENST00000321725.6	+	41	4416	c.4340C>A	c.(4339-4341)tCc>tAc	p.S1447Y		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1447	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCGGGATACTCCGGCAATGGC	0.642																																					p.S1447Y		Atlas-SNP	.											.	STAB1	178	.	0			c.C4340A						.						22.0	25.0	24.0					3																	52550761		2201	4300	6501	SO:0001583	missense	23166	exon41			GATACTCCGGCAA	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.4340C>A	chr3.hg19:g.52550761C>A	ENSP00000312946:p.Ser1447Tyr	154.0	0.0		164.0	34.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	hg19	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	C	12.78	2.040206	0.35989	.	.	ENSG00000010327	ENST00000321725	D	0.85773	-2.03	4.51	3.62	0.41486	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.512387	0.19202	N	0.120170	D	0.87168	0.6110	L	0.58583	1.82	0.09310	N	1	D	0.69078	0.997	P	0.59221	0.854	T	0.78119	-0.2328	10	0.66056	D	0.02	.	7.7906	0.29119	0.0:0.8864:0.0:0.1136	.	1447	Q9NY15	STAB1_HUMAN	Y	1447	ENSP00000312946:S1447Y	ENSP00000312946:S1447Y	S	+	2	0	STAB1	52525801	0.017000	0.18338	0.334000	0.25495	0.024000	0.10985	1.264000	0.33015	2.222000	0.72286	0.462000	0.41574	TCC	.	.		0.642	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
N4BP2	55728	hgsc.bcm.edu	37	4	40098980	40098980	+	Missense_Mutation	SNP	A	A	G			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr4:40098980A>G	ENST00000261435.6	+	3	436	c.20A>G	c.(19-21)aAt>aGt	p.N7S		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	7					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						AGAAGGAAAAATCTTGGGGGA	0.398																																					p.N7S		Atlas-SNP	.											.	N4BP2	166	.	0			c.A20G						.						102.0	103.0	102.0					4																	40098980		2203	4300	6503	SO:0001583	missense	55728	exon3			GGAAAAATCTTGG	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.20A>G	chr4.hg19:g.40098980A>G	ENSP00000261435:p.Asn7Ser	114.0	0.0		73.0	9.0	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	hg19	CCDS3457.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.238601	0.39598	.	.	ENSG00000078177	ENST00000261435	T	0.20332	2.08	4.96	4.96	0.65561	.	0.351137	0.20830	N	0.084909	T	0.20170	0.0485	N	0.08118	0	0.29253	N	0.871855	D	0.56968	0.978	P	0.58210	0.835	T	0.04440	-1.0951	10	0.52906	T	0.07	.	9.8828	0.41245	0.8282:0.1718:0.0:0.0	.	7	Q86UW6	N4BP2_HUMAN	S	7	ENSP00000261435:N7S	ENSP00000261435:N7S	N	+	2	0	N4BP2	39775375	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.214000	0.42853	1.851000	0.53745	0.460000	0.39030	AAT	.	.		0.398	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
REST	5978	hgsc.bcm.edu	37	4	57797085	57797085	+	Silent	SNP	G	G	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr4:57797085G>A	ENST00000309042.7	+	4	2375	c.2061G>A	c.(2059-2061)ctG>ctA	p.L687L		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	687	Pro-rich.				cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					ACATGGAGCTGCCTCCTCCCA	0.602																																					p.L687L		Atlas-SNP	.											.	REST	104	.	0			c.G2061A						.						78.0	80.0	79.0					4																	57797085		2203	4300	6503	SO:0001819	synonymous_variant	5978	exon4			GGAGCTGCCTCCT	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.2061G>A	chr4.hg19:g.57797085G>A		108.0	0.0		92.0	4.0	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Silent	SNP	ENST00000309042.7	hg19	CCDS3509.1																																																																																			.	.		0.602	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
FGA	2243	hgsc.bcm.edu	37	4	155507560	155507560	+	Missense_Mutation	SNP	T	T	G			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr4:155507560T>G	ENST00000302053.3	-	5	1099	c.1021A>C	c.(1021-1023)Act>Cct	p.T341P	FGA_ENST00000403106.3_Missense_Mutation_p.T341P	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	341					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	GTACTTCCAGTTCCAGAGCTC	0.587																																					p.T341P	NSCLC(143;340 1922 20892 22370 48145)	Atlas-SNP	.											.	FGA	179	.	0			c.A1021C						.						89.0	94.0	92.0					4																	155507560		2203	4300	6503	SO:0001583	missense	2243	exon5			TTCCAGTTCCAGA		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1021A>C	chr4.hg19:g.155507560T>G	ENSP00000306361:p.Thr341Pro	155.0	0.0		101.0	6.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	hg19	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	T	1.216	-0.628422	0.03610	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.79940	-1.32;-1.32	5.0	-9.99	0.00435	.	3.070920	0.01435	N	0.014886	T	0.40222	0.1108	N	0.00260	-1.75	0.09310	N	1	B;B	0.12630	0.0;0.006	B;B	0.08055	0.0;0.003	T	0.53592	-0.8417	10	0.31617	T	0.26	.	3.293	0.06956	0.5603:0.171:0.0957:0.173	.	341;341	P02671-2;P02671	.;FIBA_HUMAN	P	341	ENSP00000306361:T341P;ENSP00000385981:T341P	ENSP00000306361:T341P	T	-	1	0	FGA	155727010	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.587000	0.00422	-2.390000	0.00586	-1.626000	0.00786	ACT	.	.		0.587	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
SPINK5	11005	hgsc.bcm.edu	37	5	147477477	147477477	+	Missense_Mutation	SNP	C	C	G			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr5:147477477C>G	ENST00000256084.7	+	11	972	c.930C>G	c.(928-930)ttC>ttG	p.F310L	SPINK5_ENST00000476608.1_3'UTR|SPINK5_ENST00000359874.3_Missense_Mutation_p.F310L|SPINK5_ENST00000398454.1_Missense_Mutation_p.F310L	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	310	Kazal-like 5. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAATACTTTTCTGTACCAGAG	0.353																																					p.F310L		Atlas-SNP	.											.	SPINK5	245	.	0			c.C930G						.						114.0	102.0	106.0					5																	147477477		1834	4094	5928	SO:0001583	missense	11005	exon11			ACTTTTCTGTACC	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.930C>G	chr5.hg19:g.147477477C>G	ENSP00000256084:p.Phe310Leu	92.0	0.0		95.0	14.0	NM_001127699	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	hg19	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900516	0.52227	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.06068	3.35;3.35;3.35;3.35	5.58	4.71	0.59529	Proteinase inhibitor I1, Kazal (1);	0.273097	0.26499	N	0.024030	T	0.16981	0.0408	M	0.67700	2.07	0.29827	N	0.830321	P;P;P;D	0.53885	0.919;0.951;0.919;0.963	P;P;P;P	0.60886	0.489;0.82;0.665;0.88	T	0.03287	-1.1052	10	0.23891	T	0.37	-1.7647	10.4951	0.44772	0.0:0.9105:0.0:0.0895	.	291;310;310;310	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	L	310;310;291;310	ENSP00000381472:F310L;ENSP00000352936:F310L;ENSP00000421519:F291L;ENSP00000256084:F310L	ENSP00000256084:F310L	F	+	3	2	SPINK5	147457670	0.995000	0.38212	0.989000	0.46669	0.202000	0.24057	1.383000	0.34385	1.503000	0.48686	0.655000	0.94253	TTC	.	.		0.353	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
GABBR1	2550	hgsc.bcm.edu	37	6	29599274	29599274	+	Missense_Mutation	SNP	A	A	T			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr6:29599274A>T	ENST00000377034.4	-	3	523	c.188T>A	c.(187-189)aTt>aAt	p.I63N	GABBR1_ENST00000377016.4_Missense_Mutation_p.I63N|GABBR1_ENST00000376977.3_Missense_Mutation_p.I63N	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	63	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CACATACTCAATCTCATAGTC	0.627																																					p.I63N		Atlas-SNP	.											.	GABBR1	95	.	0			c.T188A						.						95.0	101.0	99.0					6																	29599274		2203	4300	6503	SO:0001583	missense	2550	exon3			TACTCAATCTCAT	Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.188T>A	chr6.hg19:g.29599274A>T	ENSP00000366233:p.Ile63Asn	107.0	0.0		105.0	9.0	NM_021904	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	ENST00000377034.4	hg19	CCDS4663.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.713704	0.89112	.	.	ENSG00000204681	ENST00000376977;ENST00000377016;ENST00000377034;ENST00000462632;ENST00000476670	T;D;T;T;T	0.88277	-0.35;-2.36;-0.35;-0.35;-0.35	4.49	4.49	0.54785	Complement control module (2);Sushi/SCR/CCP (2);	0.137056	0.46442	D	0.000296	D	0.86527	0.5954	N	0.19112	0.55	0.53688	D	0.999973	D;D;D	0.76494	0.997;0.995;0.999	D;D;D	0.83275	0.994;0.989;0.996	D	0.89538	0.3790	10	0.87932	D	0	-43.0741	11.8141	0.52199	1.0:0.0:0.0:0.0	.	63;63;63	Q9UBS5-5;Q9UBS5-3;Q9UBS5	.;.;GABR1_HUMAN	N	63;63;63;63;68	ENSP00000366176:I63N;ENSP00000366215:I63N;ENSP00000366233:I63N;ENSP00000419755:I63N;ENSP00000417332:I68N	ENSP00000366176:I63N	I	-	2	0	GABBR1	29707253	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.499000	0.90494	1.680000	0.50976	0.374000	0.22700	ATT	.	.		0.627	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076141.3		
ELOVL5	60481	hgsc.bcm.edu	37	6	53134002	53134003	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr6:53134002_53134003CC>AA	ENST00000542638.1	-	8	1269_1270	c.822_823GG>TT	c.(820-825)atGGct>atTTct	p.274_275MA>IS	ELOVL5_ENST00000541407.1_Missense_Mutation_p.301_302MA>IS|ELOVL5_ENST00000304434.6_Missense_Mutation_p.274_275MA>IS|ELOVL5_ENST00000370918.4_Missense_Mutation_p.264_265MA>IS			Q9NYP7	ELOV5_HUMAN	ELOVL fatty acid elongase 5	274					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|linoleic acid metabolic process (GO:0043651)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	fatty acid elongase activity (GO:0009922)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7	Lung NSC(77;0.116)					TTCACAGCAGCCATGGACCCAT	0.485																																					p.A302S|p.M301I		Atlas-SNP	.											.	ELOVL5	25	.	0			c.G904T|c.G903T						.																																			SO:0001583	missense	60481	exon9			CAGCAGCCATGGA|AGCAGCCATGGAC	AF052129	CCDS4951.1, CCDS56433.1, CCDS56434.1, CCDS75470.1	6p21.1-p12.1	2014-07-30	2011-05-25		ENSG00000012660	ENSG00000012660			21308	protein-coding gene	gene with protein product		611805	"""ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"", ""spinocerebellar ataxia 38"""	SCA38		10970790, 25065913	Standard	NM_021814		Approved	HELO1, dJ483K16.1	uc011dwx.2	Q9NYP7	OTTHUMG00000016249	ENST00000542638.1:c.822_823delinsAA	chr6.hg19:g.53134002_53134003delinsAA	ENSP00000440728:p.M274_A275delinsIS	116.0|115.0	0.0		99.0	5.0	NM_001242828	B4DZJ2|F6SH78|Q59EL3|Q5TGH5|Q6NXE7|Q7L2S5|Q8NCG4|Q9UI22	Missense_Mutation	SNP	ENST00000542638.1	hg19	CCDS4951.1																																																																																			.	.		0.485	ELOVL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043566.1	NM_021814	
CEP41	95681	hgsc.bcm.edu	37	7	130067812	130067812	+	Silent	SNP	T	T	C			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr7:130067812T>C	ENST00000223208.5	-	2	351	c.81A>G	c.(79-81)aaA>aaG	p.K27K	CEP41_ENST00000489512.1_Silent_p.K27K|CEP41_ENST00000343969.5_Silent_p.K27K|CEP41_ENST00000495702.1_5'UTR|CEP41_ENST00000541543.1_Silent_p.K27K	NM_001257158.1|NM_018718.2	NP_001244087.1|NP_061188.1	Q9BYV8	CEP41_HUMAN	centrosomal protein 41kDa	27					cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein polyglutamylation (GO:0018095)|protein transport (GO:0015031)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|primary cilium (GO:0072372)											CCAGTCTTGATTTGATATGCT	0.303																																					p.K27K		Atlas-SNP	.											.	.	.	.	0			c.A81G						.						85.0	84.0	84.0					7																	130067812		2203	4300	6503	SO:0001819	synonymous_variant	95681	exon2			TCTTGATTTGATA	AJ278890	CCDS5821.1, CCDS59078.1, CCDS59079.1, CCDS59080.1	7q32	2014-02-20	2011-10-04	2011-10-04	ENSG00000106477	ENSG00000106477			12370	protein-coding gene	gene with protein product		610523	"""testis specific, 14"""	TSGA14		14654843, 22246503	Standard	NM_018718		Approved	DKFZp762H1311, FLJ22445, JBTS15	uc003vpz.4	Q9BYV8	OTTHUMG00000157823	ENST00000223208.5:c.81A>G	chr7.hg19:g.130067812T>C		55.0	0.0		41.0	9.0	NM_001257159	A4D1M0|B4DQ35|F5H0V6|Q7Z496|Q86TM1|Q8NFU8|Q9H6A3|Q9NPV3	Silent	SNP	ENST00000223208.5	hg19	CCDS5821.1																																																																																			.	.		0.303	CEP41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349702.2	NM_018718	
DPP6	1804	hgsc.bcm.edu	37	7	154667656	154667656	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr7:154667656G>A	ENST00000377770.3	+	20	2065	c.1924G>A	c.(1924-1926)Gag>Aag	p.E642K	DPP6_ENST00000332007.3_Missense_Mutation_p.E580K|DPP6_ENST00000404039.1_Missense_Mutation_p.E578K|DPP6_ENST00000427557.1_Missense_Mutation_p.E535K			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	642					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TGAGAAGTTCGAGGTGAGCTG	0.652																																					p.E642K	NSCLC(125;1384 1783 2490 7422 34254)	Atlas-SNP	.											.	DPP6	383	.	0			c.G1924A						.						29.0	36.0	34.0					7																	154667656		2085	4202	6287	SO:0001583	missense	1804	exon20			AAGTTCGAGGTGA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1924G>A	chr7.hg19:g.154667656G>A	ENSP00000367001:p.Glu642Lys	95.0	0.0		88.0	26.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	hg19		.	.	.	.	.	.	.	.	.	.	G	7.357	0.624011	0.14193	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	4.92	0.591	0.17465	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.379656	0.30235	N	0.010097	T	0.12050	0.0293	N	0.04090	-0.28	0.37317	D	0.909407	B;B;B;B	0.26635	0.042;0.027;0.155;0.033	B;B;B;B	0.21360	0.017;0.005;0.034;0.014	T	0.19844	-1.0293	10	0.18710	T	0.47	-10.5252	10.8215	0.46608	0.0744:0.5189:0.4066:0.0	.	535;580;642;578	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	K	578;642;580;535	ENSP00000385578:E578K;ENSP00000367001:E642K;ENSP00000328226:E580K;ENSP00000397303:E535K	ENSP00000328226:E580K	E	+	1	0	DPP6	154298589	0.622000	0.27085	0.883000	0.34634	0.448000	0.32197	1.592000	0.36676	0.092000	0.17331	-0.450000	0.05554	GAG	.	.		0.652	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
DPP6	1804	hgsc.bcm.edu	37	7	154677362	154677362	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr7:154677362G>A	ENST00000377770.3	+	22	2294	c.2153G>A	c.(2152-2154)aGc>aAc	p.S718N	DPP6_ENST00000332007.3_Missense_Mutation_p.S656N|DPP6_ENST00000404039.1_Missense_Mutation_p.S654N|DPP6_ENST00000427557.1_Missense_Mutation_p.S611N			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	718					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GGCTACCTGAGCACCTACATC	0.522																																					p.S718N	NSCLC(125;1384 1783 2490 7422 34254)	Atlas-SNP	.											.	DPP6	383	.	0			c.G2153A						.						52.0	57.0	55.0					7																	154677362		2051	4195	6246	SO:0001583	missense	1804	exon22			ACCTGAGCACCTA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.2153G>A	chr7.hg19:g.154677362G>A	ENSP00000367001:p.Ser718Asn	96.0	0.0		95.0	24.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	hg19		.	.	.	.	.	.	.	.	.	.	G	16.23	3.064730	0.55432	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.42	5.42	0.78866	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.131587	0.64402	D	0.000001	T	0.70202	0.3197	M	0.86028	2.79	0.52501	D	0.999951	P;P;D;D	0.57571	0.891;0.952;0.98;0.961	P;P;P;P	0.58660	0.83;0.756;0.843;0.843	T	0.75625	-0.3253	10	0.72032	D	0.01	-33.19	19.2472	0.93906	0.0:0.0:1.0:0.0	.	611;656;718;654	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	N	654;718;656;611	ENSP00000385578:S654N;ENSP00000367001:S718N;ENSP00000328226:S656N;ENSP00000397303:S611N	ENSP00000328226:S656N	S	+	2	0	DPP6	154308295	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	5.875000	0.69660	2.543000	0.85770	0.585000	0.79938	AGC	.	.		0.522	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
COL5A1	1289	hgsc.bcm.edu	37	9	137696861	137696861	+	Missense_Mutation	SNP	C	C	T	rs377125301		TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr9:137696861C>T	ENST00000371817.3	+	40	3569	c.3155C>T	c.(3154-3156)cCt>cTt	p.P1052L		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1052	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		AAAGATGGCCCTCCAGGATTA	0.617																																					p.P1052L		Atlas-SNP	.											.	COL5A1	323	.	0			c.C3155T						.	C	LEU/PRO	0,4406		0,0,2203	57.0	52.0	54.0		3155	5.1	0.8	9		54	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL5A1	NM_000093.3	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1052/1839	137696861	1,13005	2203	4300	6503	SO:0001583	missense	1289	exon40			ATGGCCCTCCAGG	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.3155C>T	chr9.hg19:g.137696861C>T	ENSP00000360882:p.Pro1052Leu	90.0	0.0		80.0	13.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142536	0.77888	0.0	1.16E-4	ENSG00000130635	ENST00000371817	D	0.96685	-4.09	5.12	5.12	0.69794	.	0.070617	0.64402	U	0.000017	D	0.96867	0.8977	L	0.35341	1.055	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98074	1.0400	10	0.87932	D	0	.	18.5537	0.91075	0.0:1.0:0.0:0.0	.	1052	P20908	CO5A1_HUMAN	L	1052	ENSP00000360882:P1052L	ENSP00000360882:P1052L	P	+	2	0	COL5A1	136836682	1.000000	0.71417	0.780000	0.31762	0.982000	0.71751	7.683000	0.84093	2.390000	0.81377	0.446000	0.29264	CCT	.	.		0.617	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
OR5M8	219484	hgsc.bcm.edu	37	11	56257944	56257944	+	Missense_Mutation	SNP	G	G	C			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr11:56257944G>C	ENST00000327216.2	-	1	927	c.903C>G	c.(901-903)atC>atG	p.I301M		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					ACAGCTCTTTGATTAATGCTT	0.303																																					p.I301M		Atlas-SNP	.											.	OR5M8	74	.	0			c.C903G						.						33.0	36.0	35.0					11																	56257944		2195	4290	6485	SO:0001583	missense	219484	exon1			CTCTTTGATTAAT	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.903C>G	chr11.hg19:g.56257944G>C	ENSP00000323354:p.Ile301Met	168.0	0.0		113.0	7.0	NM_001005282	B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	ENST00000327216.2	hg19	CCDS31533.1	.	.	.	.	.	.	.	.	.	.	G	7.597	0.671886	0.14776	.	.	ENSG00000181371	ENST00000327216	T	0.37752	1.18	4.13	1.99	0.26369	.	0.979946	0.08257	U	0.973645	T	0.23688	0.0573	N	0.11756	0.17	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.26258	-1.0108	10	0.56958	D	0.05	-0.9483	11.4296	0.50032	0.0:0.5168:0.4832:0.0	.	301	Q8NGP6	OR5M8_HUMAN	M	301	ENSP00000323354:I301M	ENSP00000323354:I301M	I	-	3	3	OR5M8	56014520	0.000000	0.05858	0.011000	0.14972	0.031000	0.12232	-0.551000	0.06027	0.846000	0.35142	0.632000	0.83419	ATC	.	.		0.303	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391641.1	NM_001005282	
SMTNL1	219537	hgsc.bcm.edu	37	11	57310235	57310235	+	Silent	SNP	G	G	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr11:57310235G>A	ENST00000399154.2	+	1	120	c.120G>A	c.(118-120)aaG>aaA	p.K40K	SMTNL1_ENST00000457912.1_Silent_p.K58K|SMTNL1_ENST00000527972.1_Silent_p.K40K			A8MU46	SMTL1_HUMAN	smoothelin-like 1	40					negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						CAGCTGGAAAGGCCATCAATG	0.592																																					p.K40K		Atlas-SNP	.											.	SMTNL1	68	.	0			c.G120A						.						39.0	45.0	43.0					11																	57310235		1999	4160	6159	SO:0001819	synonymous_variant	219537	exon1			TGGAAAGGCCATC	BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.120G>A	chr11.hg19:g.57310235G>A		251.0	0.0		178.0	28.0	NM_001105565		Silent	SNP	ENST00000399154.2	hg19																																																																																				.	.		0.592	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_166203	
OSBP	5007	hgsc.bcm.edu	37	11	59369293	59369293	+	Missense_Mutation	SNP	T	T	C	rs370601390		TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr11:59369293T>C	ENST00000263847.1	-	4	1320	c.841A>G	c.(841-843)Atg>Gtg	p.M281V		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	281					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TGGGCTAACATGAGGAAATCT	0.488																																					p.M281V		Atlas-SNP	.											.	OSBP	57	.	0			c.A841G						.						87.0	84.0	85.0					11																	59369293		2201	4295	6496	SO:0001583	missense	5007	exon4			CTAACATGAGGAA	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.841A>G	chr11.hg19:g.59369293T>C	ENSP00000263847:p.Met281Val	121.0	0.0		85.0	15.0	NM_002556	Q6P524	Missense_Mutation	SNP	ENST00000263847.1	hg19	CCDS7974.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.651694	0.29336	.	.	ENSG00000110048	ENST00000263847	D	0.86297	-2.1	6.07	-0.197	0.13228	.	0.591766	0.20846	N	0.084603	T	0.72078	0.3416	N	0.22421	0.69	0.22675	N	0.998868	B	0.02656	0.0	B	0.04013	0.001	T	0.56486	-0.7971	10	0.34782	T	0.22	-5.2994	2.9018	0.05708	0.1138:0.3481:0.1173:0.4208	.	281	P22059	OSBP1_HUMAN	V	281	ENSP00000263847:M281V	ENSP00000263847:M281V	M	-	1	0	OSBP	59125869	0.000000	0.05858	0.988000	0.46212	0.998000	0.95712	-1.489000	0.02306	-0.052000	0.13311	0.533000	0.62120	ATG	.	.		0.488	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
CCND2	894	hgsc.bcm.edu	37	12	4385334	4385334	+	Missense_Mutation	SNP	C	C	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr12:4385334C>A	ENST00000261254.3	+	2	628	c.359C>A	c.(358-360)gCg>gAg	p.A120E	RP11-264F23.4_ENST00000537370.1_RNA|RP11-264F23.3_ENST00000539135.1_RNA	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	120	Cyclin N-terminal.				cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			CCGCTGACCGCGGAGAAGCTG	0.582			T	IGL@	"""NHL,CLL"""																																p.A120E		Atlas-SNP	.		Dom	yes		12	12p13	894	cyclin D2		L	.	CCND2	50	.	0			c.C359A						.						65.0	55.0	59.0					12																	4385334		2203	4300	6503	SO:0001583	missense	894	exon2			TGACCGCGGAGAA	AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.359C>A	chr12.hg19:g.4385334C>A	ENSP00000261254:p.Ala120Glu	78.0	0.0		67.0	7.0	NM_001759	A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	hg19	CCDS8524.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984438	0.93044	.	.	ENSG00000118971	ENST00000261254	T	0.11821	2.74	5.15	5.15	0.70609	Cyclin, N-terminal (1);Cyclin-like (3);	0.049681	0.85682	D	0.000000	T	0.48822	0.1521	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61662	-0.7017	10	0.66056	D	0.02	.	17.6727	0.88223	0.0:1.0:0.0:0.0	.	120	P30279	CCND2_HUMAN	E	120	ENSP00000261254:A120E	ENSP00000261254:A120E	A	+	2	0	CCND2	4255595	1.000000	0.71417	0.119000	0.21687	0.967000	0.64934	6.018000	0.70811	2.432000	0.82394	0.555000	0.69702	GCG	.	.		0.582	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	NM_001759	
STARD13	90627	hgsc.bcm.edu	37	13	33704163	33704163	+	Silent	SNP	T	T	C			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr13:33704163T>C	ENST00000336934.5	-	5	767	c.651A>G	c.(649-651)acA>acG	p.T217T	STARD13_ENST00000255486.4_Silent_p.T209T|STARD13_ENST00000399365.3_Silent_p.T99T	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	217					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		CCGGGTTGTCTGTACAGCACT	0.622																																					p.T217T		Atlas-SNP	.											.	STARD13	100	.	0			c.A651G						.						41.0	44.0	43.0					13																	33704163		2203	4300	6503	SO:0001819	synonymous_variant	90627	exon5			GTTGTCTGTACAG	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.651A>G	chr13.hg19:g.33704163T>C		52.0	0.0		40.0	8.0	NM_178006	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Silent	SNP	ENST00000336934.5	hg19	CCDS9348.1																																																																																			.	.		0.622	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	
THBS1	7057	hgsc.bcm.edu	37	15	39874936	39874936	+	Missense_Mutation	SNP	G	G	A			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr15:39874936G>A	ENST00000260356.5	+	3	775	c.610G>A	c.(610-612)Gtc>Atc	p.V204I		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	204	Laminin G-like.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		AAAGGGGGGCGTCAATGACAA	0.562																																					p.V204I		Atlas-SNP	.											.	THBS1	106	.	0			c.G610A						.						37.0	35.0	36.0					15																	39874936		2200	4296	6496	SO:0001583	missense	7057	exon3			GGGGGCGTCAATG		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.610G>A	chr15.hg19:g.39874936G>A	ENSP00000260356:p.Val204Ile	39.0	0.0		34.0	5.0	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	hg19	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494400	0.44352	.	.	ENSG00000137801	ENST00000260356	T	0.02177	4.41	5.56	4.62	0.57501	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.32802	N	0.005635	T	0.02571	0.0078	L	0.34521	1.04	0.43667	D	0.996095	B	0.20887	0.049	B	0.10450	0.005	T	0.54523	-0.8281	10	0.20046	T	0.44	-19.6668	15.5318	0.75970	0.0:0.1384:0.8616:0.0	.	204	P07996	TSP1_HUMAN	I	204	ENSP00000260356:V204I	ENSP00000260356:V204I	V	+	1	0	THBS1	37662228	1.000000	0.71417	0.936000	0.37596	0.986000	0.74619	5.330000	0.65899	1.533000	0.49186	0.655000	0.94253	GTC	.	.		0.562	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
ARL6IP1	23204	hgsc.bcm.edu	37	16	18804626	18804626	+	Missense_Mutation	SNP	G	G	T			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr16:18804626G>T	ENST00000304414.7	-	6	771	c.560C>A	c.(559-561)gCc>gAc	p.A187D	RPS15A_ENST00000322989.4_5'Flank|ARL6IP1_ENST00000546206.2_Missense_Mutation_p.A158D|ARL6IP1_ENST00000562819.1_Missense_Mutation_p.A72D|RP11-1035H13.3_ENST00000567078.2_Intron|RPS15A_ENST00000563390.1_5'Flank	NM_015161.1	NP_055976.1	Q15041	AR6P1_HUMAN	ADP-ribosylation factor-like 6 interacting protein 1	187					cell death (GO:0008219)|cotranslational protein targeting to membrane (GO:0006613)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|Sec61 translocon complex (GO:0005784)				breast(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(1)	11						CTCCCTCTTGGCCATTCCAAT	0.373																																					p.A187D		Atlas-SNP	.											.	ARL6IP1	23	.	0			c.C560A						.						82.0	80.0	80.0					16																	18804626		2197	4300	6497	SO:0001583	missense	23204	exon6			CTCTTGGCCATTC	BC010281	CCDS10572.1	16p12-p11.2	2014-03-12	2006-09-26	2006-09-26	ENSG00000170540	ENSG00000170540			697	protein-coding gene	gene with protein product		607669	"""ADP-ribosylation factor-like 6 interacting protein"""	ARL6IP		24482476	Standard	NM_015161		Approved	AIP1, ARMER, KIAA0069, SPG61	uc002dfl.1	Q15041	OTTHUMG00000131367	ENST00000304414.7:c.560C>A	chr16.hg19:g.18804626G>T	ENSP00000306788:p.Ala187Asp	169.0	0.0		139.0	6.0	NM_015161		Missense_Mutation	SNP	ENST00000304414.7	hg19	CCDS10572.1	.	.	.	.	.	.	.	.	.	.	N	17.82	3.483534	0.63962	.	.	ENSG00000170540	ENST00000304414;ENST00000545430;ENST00000546206	T;T	0.54479	0.57;0.57	5.36	5.36	0.76844	.	0.051556	0.85682	D	0.000000	T	0.54838	0.1883	M	0.62723	1.935	0.44539	D	0.997494	P	0.44946	0.846	B	0.43623	0.425	T	0.61078	-0.7135	10	0.72032	D	0.01	-8.532	14.6457	0.68759	0.0:0.1455:0.8545:0.0	.	187	Q15041	AR6P1_HUMAN	D	187;139;158	ENSP00000306788:A187D;ENSP00000440048:A158D	ENSP00000306788:A187D	A	-	2	0	ARL6IP1	18712127	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.826000	0.86716	2.669000	0.90835	0.591000	0.81541	GCC	.	.		0.373	ARL6IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254156.2	NM_015161	
PPM1D	8493	hgsc.bcm.edu	37	17	58740434	58740434	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr17:58740434G>T	ENST00000305921.3	+	6	1571	c.1339G>T	c.(1339-1341)Gag>Tag	p.E447*	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	447					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.E447K(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TGCCTTCTCAGAGAATTTTTT	0.433											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.E447X		Atlas-SNP	.											PPM1D,scalp,carcinoma,0,1	PPM1D	50	.	1	Substitution - Missense(1)	skin(1)	c.G1339T						.						100.0	100.0	100.0					17																	58740434		2203	4300	6503	SO:0001587	stop_gained	8493	exon6			TTCTCAGAGAATT	U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1339G>T	chr17.hg19:g.58740434G>T	ENSP00000306682:p.Glu447*	122.0	0.0	1033	102.0	18.0	NM_003620	Q53XP4|Q6P991|Q8IVR6	Nonsense_Mutation	SNP	ENST00000305921.3	hg19	CCDS11625.1	.	.	.	.	.	.	.	.	.	.	G	39	7.352756	0.98231	.	.	ENSG00000170836	ENST00000305921	.	.	.	6.08	6.08	0.98989	.	0.219106	0.48286	D	0.000199	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-23.029	9.6637	0.39972	0.0698:0.0:0.7885:0.1417	.	.	.	.	X	447	.	ENSP00000306682:E447X	E	+	1	0	PPM1D	56095216	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.741000	0.62095	2.894000	0.99253	0.591000	0.81541	GAG	.	.		0.433	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449474.1	NM_003620	
MED13	9969	hgsc.bcm.edu	37	17	60059776	60059777	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr17:60059776_60059777GC>TT	ENST00000397786.2	-	16	3663_3664	c.3587_3588GC>AA	c.(3586-3588)tGC>tAA	p.C1196*		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1196					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATAAATTAGTGCACTGATCTTG	0.391																																					p.C1196X|p.C1196Y		Atlas-SNP	.											.	MED13	181	.	0			c.C3588A|c.G3587A						.																																			SO:0001587	stop_gained	9969	exon16			ATTAGTGCACTGA|TTAGTGCACTGAT	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.3587_3588delinsTT	chr17.hg19:g.60059776_60059777delinsTT	ENSP00000380888:p.Cys1196*	151.0|150.0	0.0		104.0|102.0	11.0	NM_005121	B2RU05|O60334	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000397786.2	hg19	CCDS42366.1																																																																																			.	.		0.391	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
ZFP28	140612	hgsc.bcm.edu	37	19	57065959	57065959	+	Missense_Mutation	SNP	T	T	C			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr19:57065959T>C	ENST00000301318.3	+	8	1876	c.1805T>C	c.(1804-1806)aTa>aCa	p.I602T	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	602					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		AGGCAGAATATACACCTTGCC	0.433																																					p.I602T	Ovarian(124;554 1662 19430 21141 52494)	Atlas-SNP	.											.	ZFP28	99	.	0			c.T1805C						.						94.0	103.0	100.0					19																	57065959		2203	4300	6503	SO:0001583	missense	140612	exon8			AGAATATACACCT		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.1805T>C	chr19.hg19:g.57065959T>C	ENSP00000301318:p.Ile602Thr	174.0	0.0		148.0	25.0	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	hg19	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	T	6.026	0.373232	0.11409	.	.	ENSG00000196867	ENST00000301318	T	0.07216	3.21	4.12	3.1	0.35709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.130039	0.34435	N	0.003971	T	0.02047	0.0064	N	0.01800	-0.715	0.09310	N	1	P	0.36027	0.533	B	0.27076	0.076	T	0.34354	-0.9832	10	0.41790	T	0.15	.	1.1688	0.01821	0.1839:0.1052:0.1917:0.5192	.	602	Q8NHY6	ZFP28_HUMAN	T	602	ENSP00000301318:I602T	ENSP00000301318:I602T	I	+	2	0	ZFP28	61757771	0.000000	0.05858	0.948000	0.38648	0.783000	0.44284	-1.213000	0.02991	1.852000	0.53769	0.454000	0.30748	ATA	.	.		0.433	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
CHRNA4	1137	hgsc.bcm.edu	37	20	61981058	61981058	+	Missense_Mutation	SNP	C	C	T			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr20:61981058C>T	ENST00000370263.4	-	5	1926	c.1705G>A	c.(1705-1707)Gag>Aag	p.E569K	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	569					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TGGACGCCCTCCACCGCCCGG	0.682																																					p.E569K		Atlas-SNP	.											.	CHRNA4	98	.	0			c.G1705A						.						43.0	51.0	48.0					20																	61981058		2201	4300	6501	SO:0001583	missense	1137	exon5			CGCCCTCCACCGC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1705G>A	chr20.hg19:g.61981058C>T	ENSP00000359285:p.Glu569Lys	132.0	0.0		106.0	10.0	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	hg19	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861238	0.71949	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.71341	-0.56	4.72	4.72	0.59763	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.350601	0.32671	N	0.005785	T	0.80199	0.4579	M	0.66378	2.025	0.80722	D	1	P;D	0.56746	0.949;0.977	P;P	0.57425	0.777;0.82	T	0.81951	-0.0698	10	0.51188	T	0.08	.	17.668	0.88208	0.0:1.0:0.0:0.0	.	498;569	Q4VAQ5;P43681	.;ACHA4_HUMAN	K	475;569;498	ENSP00000359285:E569K	ENSP00000359280:E475K	E	-	1	0	CHRNA4	61451502	1.000000	0.71417	0.914000	0.36105	0.249000	0.25844	5.770000	0.68873	2.176000	0.68965	0.491000	0.48974	GAG	.	.		0.682	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
BAHD1	22893	hgsc.bcm.edu	37	15	40758269	40758270	+	Frame_Shift_Ins	INS	-	-	T			TCGA-MR-A8JO-01A-12D-A35Z-10	TCGA-MR-A8JO-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66a02e7c-ba44-4552-b8c9-3161a5b2c0e0	de1fdde4-5d17-43bb-a055-456bace72e84	g.chr15:40758269_40758270insT	ENST00000416165.1	+	7	2354_2355	c.2283_2284insT	c.(2284-2286)ttcfs	p.F762fs	RP11-64K12.8_ENST00000559730.1_RNA|BAHD1_ENST00000560846.1_Frame_Shift_Ins_p.F759fs|BAHD1_ENST00000561234.1_Frame_Shift_Ins_p.F761fs	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	762	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CTGAGCTGGTGTTCCTTTGCCG	0.624																																					p.V761fs		Atlas-INDEL	.											.	BAHD1	68	.	0			c.2283_2284insT						.																																			SO:0001589	frameshift_variant	22893	exon7			.	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.2285dupT	chr15.hg19:g.40758271_40758271dupT	ENSP00000396976:p.Phe762fs	162.0	0.0		142.0	34.0	NM_014952	Q8NDF7|Q9Y2F4	Frame_Shift_Ins	INS	ENST00000416165.1	hg19	CCDS10058.1																																																																																			.	.		0.624	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952	
