#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF8	943	hgsc.bcm.edu	37	1	12175637	12175637	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:12175637A>C	ENST00000263932.2	+	8	1019	c.797A>C	c.(796-798)gAc>gCc	p.D266A	TNFRSF8_ENST00000417814.2_Missense_Mutation_p.D155A	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	266					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CCCTTAGATGACCTTGTGGAG	0.577																																					p.D266A		Atlas-SNP	.											.	TNFRSF8	70	.	0			c.A797C						.						157.0	134.0	141.0					1																	12175637		2203	4300	6503	SO:0001583	missense	943	exon8			TAGATGACCTTGT	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.797A>C	chr1.hg19:g.12175637A>C	ENSP00000263932:p.Asp266Ala	100.0	0.0		103.0	34.0	NM_001243	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Missense_Mutation	SNP	ENST00000263932.2	hg19	CCDS144.1	.	.	.	.	.	.	.	.	.	.	A	8.631	0.893756	0.17613	.	.	ENSG00000120949	ENST00000263932;ENST00000417814	D;D	0.91351	-2.83;-2.83	3.83	1.51	0.23008	TNFR/CD27/30/40/95 cysteine-rich region (3);	4.245900	0.00520	N	0.000187	D	0.92341	0.7570	M	0.63843	1.955	0.25715	N	0.98543	P;P	0.52316	0.916;0.952	P;P	0.56127	0.491;0.792	T	0.76143	-0.3067	10	0.29301	T	0.29	-10.2473	5.0616	0.14560	0.738:0.0:0.262:0.0	.	155;266	D3YTD8;P28908	.;TNR8_HUMAN	A	266;155	ENSP00000263932:D266A;ENSP00000390650:D155A	ENSP00000263932:D266A	D	+	2	0	TNFRSF8	12098224	1.000000	0.71417	0.836000	0.33094	0.025000	0.11179	2.222000	0.42926	0.206000	0.20587	0.383000	0.25322	GAC	.	.		0.577	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
LRP8	7804	hgsc.bcm.edu	37	1	53727742	53727742	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:53727742C>G	ENST00000306052.6	-	12	2013	c.1912G>C	c.(1912-1914)Gag>Cag	p.E638Q	LRP8_ENST00000347547.2_Missense_Mutation_p.E468Q|LRP8_ENST00000354412.3_Missense_Mutation_p.E509Q|LRP8_ENST00000465675.1_Missense_Mutation_p.E191Q|LRP8_ENST00000460214.1_5'UTR|LRP8_ENST00000371454.2_Missense_Mutation_p.E638Q	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	638					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						GGACTCACCTCAAACACAGCT	0.488																																					p.E638Q		Atlas-SNP	.											.	LRP8	58	.	0			c.G1912C						.						85.0	77.0	80.0					1																	53727742		2203	4300	6503	SO:0001583	missense	7804	exon12			TCACCTCAAACAC	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.1912G>C	chr1.hg19:g.53727742C>G	ENSP00000303634:p.Glu638Gln	205.0	0.0		211.0	76.0	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	hg19	CCDS578.1	.	.	.	.	.	.	.	.	.	.	C	33	5.239332	0.95240	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91	6.16	6.16	0.99307	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	.	.	.	.	D	0.96728	0.8932	M	0.84773	2.715	0.80722	D	1	D;D;D;D;D;D	0.76494	0.995;0.997;0.991;0.999;0.997;0.995	D;D;D;D;D;D	0.80764	0.911;0.987;0.97;0.994;0.973;0.911	D	0.96343	0.9252	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	191;509;468;638;638;191	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	Q	638;638;191;509;468	ENSP00000303634:E638Q;ENSP00000360509:E638Q;ENSP00000437009:E191Q;ENSP00000346391:E509Q;ENSP00000334522:E468Q	ENSP00000303634:E638Q	E	-	1	0	LRP8	53500330	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	7.745000	0.85046	2.937000	0.99478	0.650000	0.86243	GAG	.	.		0.488	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
IL12RB2	3595	hgsc.bcm.edu	37	1	67833556	67833556	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:67833556A>G	ENST00000262345.1	+	10	1947	c.1307A>G	c.(1306-1308)aAc>aGc	p.N436S	IL12RB2_ENST00000541374.1_Missense_Mutation_p.N436S|IL12RB2_ENST00000371000.1_Missense_Mutation_p.N436S|IL12RB2_ENST00000544434.1_Missense_Mutation_p.N436S	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	436	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						GGCATGGACAACATTCTGGTG	0.517																																					p.N436S		Atlas-SNP	.											.	IL12RB2	94	.	0			c.A1307G						.						130.0	121.0	124.0					1																	67833556		2203	4300	6503	SO:0001583	missense	3595	exon10			TGGACAACATTCT	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1307A>G	chr1.hg19:g.67833556A>G	ENSP00000262345:p.Asn436Ser	140.0	0.0		159.0	39.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	hg19	CCDS638.1	.	.	.	.	.	.	.	.	.	.	A	3.044	-0.196926	0.06259	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.02	-9.72	0.00515	Long hematopoietin receptor, Gp130 family 2, conserved site (1);Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.498590	0.03717	N	0.251221	T	0.06096	0.0158	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.004;0.001;0.003;0.003	T	0.17684	-1.0361	10	0.02654	T	1	0.1314	14.3573	0.66745	0.6539:0.0:0.3461:0.0	.	436;436;436;436	B4DGA4;F5H7L6;Q99665-2;Q99665	.;.;.;I12R2_HUMAN	S	436	ENSP00000262345:N436S;ENSP00000360039:N436S;ENSP00000445276:N436S;ENSP00000442443:N436S	ENSP00000262345:N436S	N	+	2	0	IL12RB2	67606144	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.742000	0.01835	-2.245000	0.00705	-0.798000	0.03219	AAC	.	.		0.517	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
CTSK	1513	hgsc.bcm.edu	37	1	150778408	150778408	+	Nonsense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:150778408C>A	ENST00000271651.3	-	4	438	c.328G>T	c.(328-330)Gaa>Taa	p.E110*	CTSK_ENST00000480670.1_5'UTR	NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K	110					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCTTCCCATTCTGGGATATAA	0.448																																					p.E110X		Atlas-SNP	.											.	CTSK	27	.	0			c.G328T						.						122.0	117.0	119.0					1																	150778408		2203	4300	6503	SO:0001587	stop_gained	1513	exon4			CCCATTCTGGGAT	BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.328G>T	chr1.hg19:g.150778408C>A	ENSP00000271651:p.Glu110*	204.0	0.0		134.0	59.0	NM_000396	Q6FHS6	Nonsense_Mutation	SNP	ENST00000271651.3	hg19	CCDS969.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590290	0.46214	.	.	ENSG00000143387	ENST00000271651;ENST00000443913	.	.	.	5.52	4.59	0.56863	.	0.251846	0.44285	D	0.000478	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	13.7444	0.62865	0.1551:0.8449:0.0:0.0	.	.	.	.	X	110;169	.	ENSP00000271651:E110X	E	-	1	0	CTSK	149045032	0.874000	0.30092	0.980000	0.43619	0.023000	0.10783	1.766000	0.38491	1.440000	0.47531	0.655000	0.94253	GAA	.	.		0.448	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084732.1	NM_000396	
CHRNB2	1141	hgsc.bcm.edu	37	1	154543798	154543798	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:154543798C>A	ENST00000368476.3	+	5	763	c.499C>A	c.(499-501)Cag>Aag	p.Q167K		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	167					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	ATTTGACCAGCAGAACTGCAC	0.542																																					p.Q167K		Atlas-SNP	.											.	CHRNB2	74	.	0			c.C499A						.						133.0	109.0	117.0					1																	154543798		2203	4300	6503	SO:0001583	missense	1141	exon5			GACCAGCAGAACT	U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.499C>A	chr1.hg19:g.154543798C>A	ENSP00000357461:p.Gln167Lys	274.0	0.0		278.0	16.0	NM_000748	Q9UEH9	Missense_Mutation	SNP	ENST00000368476.3	hg19	CCDS1070.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631225	0.87660	.	.	ENSG00000160716	ENST00000368476	D	0.84660	-1.88	4.38	4.38	0.52667	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94857	0.8338	H	0.97918	4.105	0.80722	D	1	D	0.65815	0.995	D	0.70227	0.968	D	0.96834	0.9613	10	0.87932	D	0	.	16.7273	0.85426	0.0:1.0:0.0:0.0	.	167	P17787	ACHB2_HUMAN	K	167	ENSP00000357461:Q167K	ENSP00000357461:Q167K	Q	+	1	0	CHRNB2	152810422	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.616000	0.83018	2.238000	0.73509	0.563000	0.77884	CAG	.	.		0.542	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090697.1	NM_000748	
RUSC1	23623	hgsc.bcm.edu	37	1	155295430	155295430	+	Missense_Mutation	SNP	G	G	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:155295430G>C	ENST00000368352.5	+	6	1932	c.1781G>C	c.(1780-1782)aGc>aCc	p.S594T	RUSC1_ENST00000462780.1_3'UTR|RUSC1_ENST00000368354.3_Missense_Mutation_p.S594T|RUSC1_ENST00000368349.4_Missense_Mutation_p.S125T|RUSC1_ENST00000368347.4_Missense_Mutation_p.S184T|RUSC1_ENST00000292254.4_Missense_Mutation_p.S125T|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	594	Interaction with TRAF6.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			AGCAGCCGTAGCCGCTTCCAT	0.622											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S594T		Atlas-SNP	.											.	RUSC1	85	.	0			c.G1781C						.						57.0	59.0	58.0					1																	155295430		2203	4300	6503	SO:0001583	missense	23623	exon6			GCCGTAGCCGCTT	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1781G>C	chr1.hg19:g.155295430G>C	ENSP00000357336:p.Ser594Thr	110.0	0.0	1769	118.0	37.0	NM_001105203	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	hg19	CCDS41410.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991347	0.54041	.	.	ENSG00000160753	ENST00000368354;ENST00000368352;ENST00000368347;ENST00000368349;ENST00000292254	T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77	4.34	4.34	0.51931	RUN (2);	0.218004	0.34435	N	0.003961	T	0.03178	0.0093	N	0.03608	-0.345	0.09310	N	0.999998	P;P;B;P;D;P	0.53885	0.89;0.55;0.369;0.605;0.963;0.823	P;B;B;B;P;P	0.54401	0.707;0.254;0.237;0.37;0.751;0.564	T	0.40308	-0.9570	10	0.26408	T	0.33	-24.7239	9.096	0.36640	0.1409:0.0:0.8591:0.0	.	92;125;125;184;199;594	B4DQB8;Q9BVN2-2;B3KWM9;Q5T9V0;Q9BT86;Q9BVN2	.;.;.;.;.;RUSC1_HUMAN	T	594;594;184;125;125	ENSP00000357338:S594T;ENSP00000357336:S594T;ENSP00000357331:S184T;ENSP00000357333:S125T;ENSP00000292254:S125T	ENSP00000292254:S125T	S	+	2	0	RUSC1	153562054	1.000000	0.71417	0.775000	0.31657	0.774000	0.43823	2.703000	0.47110	2.393000	0.81446	0.655000	0.94253	AGC	.	.		0.622	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
CACNA1E	777	hgsc.bcm.edu	37	1	181452992	181452992	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:181452992G>T	ENST00000367573.2	+	1	112	c.112G>T	c.(112-114)Gcc>Tcc	p.A38S	CACNA1E_ENST00000526775.1_Missense_Mutation_p.A38S|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000357570.5_5'UTR|CACNA1E_ENST00000360108.3_Missense_Mutation_p.A38S|CACNA1E_ENST00000367570.1_Missense_Mutation_p.A38S|CACNA1E_ENST00000358338.5_5'UTR	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	38					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCAGGCGGCCGCCTACAAGCA	0.652																																					p.A38S		Atlas-SNP	.											CACNA1E_ENST00000367573,colon,carcinoma,0,2	CACNA1E	778	.	0			c.G112T						.						51.0	59.0	56.0					1																	181452992		1883	4084	5967	SO:0001583	missense	777	exon1			GCGGCCGCCTACA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.112G>T	chr1.hg19:g.181452992G>T	ENSP00000356545:p.Ala38Ser	202.0	1.0		198.0	79.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687429	0.68157	.	.	ENSG00000198216	ENST00000524607;ENST00000367570;ENST00000526775;ENST00000360108;ENST00000367573	D;D;D;D;D	0.97186	-4.28;-3.93;-3.9;-3.9;-3.93	5.67	4.76	0.60689	.	0.000000	0.64402	D	0.000002	D	0.92561	0.7637	N	0.17082	0.46	0.80722	D	1	B	0.15473	0.013	B	0.17098	0.017	D	0.88852	0.3320	10	0.35671	T	0.21	.	12.6171	0.56584	0.0805:0.0:0.9195:0.0	.	38	Q15878-3	.	S	38	ENSP00000432038:A38S;ENSP00000356542:A38S;ENSP00000434814:A38S;ENSP00000353222:A38S;ENSP00000356545:A38S	ENSP00000353222:A38S	A	+	1	0	CACNA1E	179719615	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	3.071000	0.50041	1.393000	0.46605	0.561000	0.74099	GCC	.	.		0.652	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
TRAF5	7188	hgsc.bcm.edu	37	1	211545809	211545809	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:211545809A>G	ENST00000261464.5	+	11	1493	c.1439A>G	c.(1438-1440)cAg>cGg	p.Q480R	TRAF5_ENST00000427925.2_Missense_Mutation_p.Q374R|TRAF5_ENST00000336184.2_Missense_Mutation_p.Q480R|TRAF5_ENST00000367004.3_Missense_Mutation_p.Q480R	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	480	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		CCATTCAGGCAGAGGGTGACC	0.517																																					p.Q480R		Atlas-SNP	.											.	TRAF5	64	.	0			c.A1439G						.						103.0	92.0	95.0					1																	211545809		2203	4300	6503	SO:0001583	missense	7188	exon11			TCAGGCAGAGGGT	AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.1439A>G	chr1.hg19:g.211545809A>G	ENSP00000261464:p.Gln480Arg	74.0	0.0		81.0	25.0	NM_004619	B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	ENST00000261464.5	hg19	CCDS1497.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.638128	0.87760	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.51	5.51	0.81932	TRAF-type (1);TRAF-like (1);MATH (3);	0.000000	0.85682	D	0.000000	T	0.58750	0.2144	L	0.56280	1.765	0.58432	D	0.999992	D;D;D	0.89917	0.994;1.0;0.997	D;D;D	0.91635	0.988;0.999;0.995	T	0.53136	-0.8481	10	0.23891	T	0.37	-23.8815	15.907	0.79439	1.0:0.0:0.0:0.0	.	374;491;480	F5H1P7;B4E0A2;O00463	.;.;TRAF5_HUMAN	R	480;374;480;480	ENSP00000336825:Q480R;ENSP00000389891:Q374R;ENSP00000261464:Q480R;ENSP00000355971:Q480R	ENSP00000261464:Q480R	Q	+	2	0	TRAF5	209612432	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.946000	0.92992	2.210000	0.71456	0.528000	0.53228	CAG	.	.		0.517	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089825.1	NM_004619	
EPRS	2058	hgsc.bcm.edu	37	1	220193425	220193425	+	Silent	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr1:220193425T>C	ENST00000366923.3	-	10	1523	c.1254A>G	c.(1252-1254)ccA>ccG	p.P418P		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	418	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CCCAAATATATGGTTTTCTTA	0.388																																					p.P418P		Atlas-SNP	.											.	EPRS	140	.	0			c.A1254G						.						166.0	160.0	162.0					1																	220193425		2203	4300	6503	SO:0001819	synonymous_variant	2058	exon10			AATATATGGTTTT	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.1254A>G	chr1.hg19:g.220193425T>C		140.0	0.0		102.0	23.0	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	ENST00000366923.3	hg19	CCDS31027.1																																																																																			.	.		0.388	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
WDR43	23160	hgsc.bcm.edu	37	2	29129433	29129433	+	Silent	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:29129433A>G	ENST00000407426.3	+	3	527	c.471A>G	c.(469-471)acA>acG	p.T157T		NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	157						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					ACGTACAGACATGCAAAGTAA	0.388																																					p.T157T		Atlas-SNP	.											.	WDR43	38	.	0			c.A471G						.						94.0	91.0	92.0					2																	29129433		1998	4178	6176	SO:0001819	synonymous_variant	23160	exon3			ACAGACATGCAAA	D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.471A>G	chr2.hg19:g.29129433A>G		98.0	0.0		85.0	24.0	NM_015131	Q15395|Q92577	Silent	SNP	ENST00000407426.3	hg19	CCDS46251.1																																																																																			.	.		0.388	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324865.1	XM_087089	
PEX13	5194	hgsc.bcm.edu	37	2	61258823	61258823	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:61258823A>C	ENST00000295030.5	+	2	400	c.362A>C	c.(361-363)cAa>cCa	p.Q121P	PEX13_ENST00000472678.1_3'UTR	NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	121					cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			TTTGTTCAGCAAGCTGAAGAA	0.443																																					p.Q121P		Atlas-SNP	.											.	PEX13	27	.	0			c.A362C						.						142.0	136.0	138.0					2																	61258823		2203	4300	6503	SO:0001583	missense	5194	exon2			TTCAGCAAGCTGA	U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.362A>C	chr2.hg19:g.61258823A>C	ENSP00000295030:p.Gln121Pro	94.0	0.0		138.0	36.0	NM_002618	B2RCS1	Missense_Mutation	SNP	ENST00000295030.5	hg19	CCDS1866.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056146	0.76074	.	.	ENSG00000162928	ENST00000295030	T	0.78126	-1.15	5.85	5.85	0.93711	Peroxin 13, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85146	0.5630	L	0.60455	1.87	0.80722	D	1	D	0.71674	0.998	D	0.68621	0.959	D	0.83751	0.0209	10	0.33940	T	0.23	-10.22	16.2375	0.82384	1.0:0.0:0.0:0.0	.	121	Q92968	PEX13_HUMAN	P	121	ENSP00000295030:Q121P	ENSP00000295030:Q121P	Q	+	2	0	PEX13	61112327	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.865000	0.69583	2.222000	0.72286	0.533000	0.62120	CAA	.	.		0.443	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251581.3	NM_002618	
OTX1	5013	hgsc.bcm.edu	37	2	63283430	63283430	+	Silent	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:63283430A>T	ENST00000282549.2	+	5	1320	c.1044A>T	c.(1042-1044)tcA>tcT	p.S348S	OTX1_ENST00000366671.3_Silent_p.S348S	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	348					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					ACCAAGCCTCATGGCGGTTCC	0.582																																					p.S348S		Atlas-SNP	.											.	OTX1	49	.	0			c.A1044T						.						44.0	46.0	46.0					2																	63283430		2203	4300	6503	SO:0001819	synonymous_variant	5013	exon5			AGCCTCATGGCGG		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.1044A>T	chr2.hg19:g.63283430A>T		153.0	0.0		157.0	54.0	NM_014562	A6NHA2|B3KTJ4|Q53TG6	Silent	SNP	ENST00000282549.2	hg19	CCDS1873.1																																																																																			.	.		0.582	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
MRPL53	116540	hgsc.bcm.edu	37	2	74699251	74699251	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:74699251G>A	ENST00000258105.7	-	3	995	c.334C>T	c.(334-336)Cgc>Tgc	p.R112C	MRPL53_ENST00000409710.1_3'UTR	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	112						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						CGCTGTCAGCGACCAGTATCA	0.552																																					p.R112C		Atlas-SNP	.											.	MRPL53	13	.	0			c.C334T						.						45.0	51.0	49.0					2																	74699251		2196	4298	6494	SO:0001583	missense	116540	exon3			GTCAGCGACCAGT	BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.334C>T	chr2.hg19:g.74699251G>A	ENSP00000258105:p.Arg112Cys	138.0	0.0		120.0	10.0	NM_053050		Missense_Mutation	SNP	ENST00000258105.7	hg19	CCDS1944.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193251	0.58017	.	.	ENSG00000204822	ENST00000258105	T	0.53640	0.61	4.13	-1.01	0.10169	.	0.000000	0.50627	D	0.000115	T	0.26340	0.0643	L	0.29908	0.895	0.09310	N	0.999992	B	0.09022	0.002	B	0.04013	0.001	T	0.13575	-1.0504	10	0.87932	D	0	.	0.8064	0.01084	0.2903:0.1616:0.3822:0.1658	.	112	Q96EL3	RM53_HUMAN	C	112	ENSP00000258105:R112C	ENSP00000258105:R112C	R	-	1	0	MRPL53	74552759	0.510000	0.26171	0.000000	0.03702	0.007000	0.05969	2.273000	0.43381	-0.198000	0.10333	-0.149000	0.13747	CGC	.	.		0.552	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252225.2	NM_053050	
NCKAP5	344148	hgsc.bcm.edu	37	2	133489528	133489528	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:133489528G>T	ENST00000409261.1	-	17	5598	c.5225C>A	c.(5224-5226)cCa>cAa	p.P1742Q	NCKAP5_ENST00000405974.3_Missense_Mutation_p.P423Q|NCKAP5_ENST00000473859.1_5'UTR|NCKAP5_ENST00000409213.1_Missense_Mutation_p.P423Q|NCKAP5_ENST00000317721.6_Missense_Mutation_p.P1742Q	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1742										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TGGGGAGTCTGGCTGGCATAG	0.557																																					p.P1742Q		Atlas-SNP	.											.	NCKAP5	322	.	0			c.C5225A						.						84.0	93.0	90.0					2																	133489528		2079	4212	6291	SO:0001583	missense	344148	exon17			GAGTCTGGCTGGC	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5225C>A	chr2.hg19:g.133489528G>T	ENSP00000387128:p.Pro1742Gln	236.0	0.0		220.0	72.0	NM_207363	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	ENST00000409261.1	hg19	CCDS46418.1	.	.	.	.	.	.	.	.	.	.	G	4.664	0.123478	0.08931	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.44083	2.98;0.93;2.98;0.93	5.2	3.35	0.38373	.	0.641465	0.11643	N	0.543605	T	0.19644	0.0472	N	0.04880	-0.145	0.20926	N	0.999821	B;B	0.20052	0.006;0.041	B;B	0.20384	0.004;0.029	T	0.29058	-1.0024	10	0.14252	T	0.57	.	6.5747	0.22560	0.0859:0.0:0.5052:0.4089	.	423;1742	O14513-2;O14513	.;NCKP5_HUMAN	Q	1742;423;1742;423;423	ENSP00000387128:P1742Q;ENSP00000386952:P423Q;ENSP00000380603:P1742Q;ENSP00000385692:P423Q	ENSP00000380603:P1742Q	P	-	2	0	NCKAP5	133205998	1.000000	0.71417	0.217000	0.23759	0.340000	0.28889	2.882000	0.48546	0.733000	0.32492	0.655000	0.94253	CCA	.	.		0.557	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331663.1	NM_207481	
LRP2	4036	hgsc.bcm.edu	37	2	170055351	170055351	+	Silent	SNP	C	C	T	rs80338749		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:170055351C>T	ENST00000263816.3	-	45	8808	c.8523G>A	c.(8521-8523)ttG>ttA	p.L2841L		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2841	LDL-receptor class A 19. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTCCGTCACACAAATAAACGC	0.373																																					p.L2841L		Atlas-SNP	.											.	LRP2	751	.	0			c.G8523A						.						128.0	121.0	123.0					2																	170055351		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon45			GTCACACAAATAA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8523G>A	chr2.hg19:g.170055351C>T		89.0	0.0		94.0	27.0	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.		0.373	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
MYO3B	140469	hgsc.bcm.edu	37	2	171260757	171260757	+	Splice_Site	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:171260757A>T	ENST00000408978.4	+	20	2421	c.2278A>T	c.(2278-2280)Atg>Ttg	p.M760L	MYO3B_ENST00000409044.3_Splice_Site_p.M760L|MYO3B_ENST00000334231.6_Splice_Site_p.M769L|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	760	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TTCCCTCCAGATGGAATATCA	0.498																																					p.M760L		Atlas-SNP	.											.	MYO3B	320	.	0			c.A2278T						.						161.0	152.0	155.0					2																	171260757		1903	4118	6021	SO:0001630	splice_region_variant	140469	exon20			CTCCAGATGGAAT		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2278-1A>T	chr2.hg19:g.171260757A>T		94.0	0.0		88.0	28.0	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	hg19	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.902040	0.33628	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.47	1.64	0.23874	Myosin head, motor domain (2);	0.194685	0.64402	D	0.000003	T	0.45677	0.1354	N	0.08118	0	0.40675	D	0.982253	B;B;B	0.16603	0.007;0.007;0.018	B;B;B	0.19946	0.015;0.016;0.027	T	0.13442	-1.0509	9	.	.	.	.	9.7715	0.40591	0.7998:0.0:0.2002:0.0	.	760;760;760	Q8WXR4-5;Q8WXR4-4;Q8WXR4	.;.;MYO3B_HUMAN	L	760;760;759;769;769	ENSP00000386497:M760L;ENSP00000386213:M760L;ENSP00000446237:M769L;ENSP00000335100:M769L	.	M	+	1	0	MYO3B	170969003	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.201000	0.42734	0.097000	0.17492	0.533000	0.62120	ATG	.	.		0.498	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		Missense_Mutation
HNRNPA3	220988	hgsc.bcm.edu	37	2	178081416	178081416	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:178081416G>T	ENST00000392524.2	+	6	893	c.656G>T	c.(655-657)gGa>gTa	p.G219V	HNRNPA3_ENST00000411529.2_Missense_Mutation_p.G197V|HNRNPA3_ENST00000435711.1_Missense_Mutation_p.G219V			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	219	Gly-rich.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						CGTGGAGGTGGATCTGGCAAT	0.463																																					p.G219V		Atlas-SNP	.											.	HNRNPA3	42	.	0			c.G656T						.						140.0	143.0	142.0					2																	178081416		2203	4300	6503	SO:0001583	missense	220988	exon6			GAGGTGGATCTGG	AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.656G>T	chr2.hg19:g.178081416G>T	ENSP00000376309:p.Gly219Val	148.0	0.0		111.0	31.0	NM_194247	D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	ENST00000392524.2	hg19	CCDS2273.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257085	0.59321	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711;ENST00000432457	D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72	4.42	4.42	0.53409	.	0.000000	0.46442	D	0.000296	D	0.91818	0.7411	M	0.91249	3.19	0.80722	D	1	B;B	0.34015	0.232;0.435	B;B	0.27170	0.077;0.077	D	0.92471	0.5985	10	0.45353	T	0.12	.	17.3931	0.87437	0.0:0.0:1.0:0.0	.	197;219	B4DDB6;P51991	.;ROA3_HUMAN	V	219;197;197;197;219;27	ENSP00000376309:G219V;ENSP00000408487:G197V;ENSP00000416340:G219V;ENSP00000400688:G27V	ENSP00000376309:G219V	G	+	2	0	HNRNPA3	177789662	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.215000	0.77966	2.197000	0.70478	0.551000	0.68910	GGA	.	.		0.463	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255729.3	NM_194247	
OSBPL6	114880	hgsc.bcm.edu	37	2	179201097	179201097	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:179201097A>G	ENST00000190611.4	+	9	1103	c.727A>G	c.(727-729)Act>Gct	p.T243A	OSBPL6_ENST00000359685.3_Missense_Mutation_p.T243A|OSBPL6_ENST00000357080.4_Missense_Mutation_p.T243A|OSBPL6_ENST00000409045.3_Missense_Mutation_p.T243A|OSBPL6_ENST00000409631.1_Missense_Mutation_p.T243A|OSBPL6_ENST00000392505.2_Missense_Mutation_p.T243A|OSBPL6_ENST00000315022.2_Missense_Mutation_p.T222A	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	243					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AACGTGCACAACTGGCCAGAG	0.507																																					p.T243A		Atlas-SNP	.											.	OSBPL6	178	.	0			c.A727G						.						185.0	182.0	183.0					2																	179201097		2203	4300	6503	SO:0001583	missense	114880	exon9			TGCACAACTGGCC	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.727A>G	chr2.hg19:g.179201097A>G	ENSP00000190611:p.Thr243Ala	136.0	0.0		112.0	39.0	NM_001201482	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	hg19	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	A	10.69	1.421029	0.25639	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000361154;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T;T	0.11277	2.81;2.81;2.79;2.81;2.8;2.81;2.81	5.57	4.34	0.51931	.	0.161156	0.56097	D	0.000034	T	0.06645	0.0170	N	0.22421	0.69	0.33897	D	0.638003	B;B;B;B;B;B	0.24721	0.0;0.023;0.008;0.11;0.055;0.038	B;B;B;B;B;B	0.22880	0.002;0.042;0.009;0.041;0.012;0.02	T	0.12578	-1.0542	10	0.07175	T	0.84	-13.5516	11.7903	0.52065	0.8686:0.0:0.0:0.1314	.	243;222;243;243;243;243	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;.;OSBL6_HUMAN;.	A	243;243;28;243;243;243;243;222	ENSP00000376293:T243A;ENSP00000352713:T243A;ENSP00000349591:T243A;ENSP00000387248:T243A;ENSP00000190611:T243A;ENSP00000386885:T243A;ENSP00000318723:T222A	ENSP00000190611:T243A	T	+	1	0	OSBPL6	178909343	0.998000	0.40836	0.056000	0.19401	0.308000	0.27856	6.532000	0.73825	2.244000	0.73946	0.533000	0.62120	ACT	.	.		0.507	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
TTN	7273	hgsc.bcm.edu	37	2	179579150	179579150	+	Nonsense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:179579150C>T	ENST00000591111.1	-	89	25624	c.25400G>A	c.(25399-25401)tGg>tAg	p.W8467*	TTN_ENST00000342992.6_Nonsense_Mutation_p.W7540*|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Nonsense_Mutation_p.W8784*|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12635	Ig-like 67.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAAGAAATCCATATGTTGTC	0.408																																					p.W8784X		Atlas-SNP	.											.	TTN	18412	.	0			c.G26351A						.						88.0	83.0	85.0					2																	179579150		1854	4093	5947	SO:0001587	stop_gained	7273	exon91			GAAATCCATATGT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25400G>A	chr2.hg19:g.179579150C>T	ENSP00000465570:p.Trp8467*	61.0	0.0		70.0	11.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	59	36.689866	0.99983	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	.	.	.	X	7540	.	ENSP00000343764:W7540X	W	-	2	0	TTN	179287395	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.253000	0.32886	2.832000	0.97577	0.655000	0.94253	TGG	.	.		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
METTL21A	151194	hgsc.bcm.edu	37	2	208478154	208478154	+	Silent	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:208478154A>T	ENST00000411432.1	-	4	489	c.273T>A	c.(271-273)acT>acA	p.T91T	METTL21A_ENST00000426075.1_Silent_p.T91T|METTL21A_ENST00000432416.1_Intron|METTL21A_ENST00000458426.1_Intron|METTL21A_ENST00000448007.2_Silent_p.T91T|METTL21A_ENST00000272839.3_Silent_p.T109T|METTL21A_ENST00000425132.1_Intron|METTL21A_ENST00000477919.1_5'Flank|METTL21A_ENST00000406927.2_Silent_p.T91T|METTL21A_ENST00000448823.2_3'UTR|METTL21A_ENST00000442521.1_Silent_p.T91T	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	91					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						GATCCGTGATAGTCACATGAG	0.378																																					p.T91T		Atlas-SNP	.											.	METTL21A	24	.	0			c.T273A						.						68.0	61.0	63.0					2																	208478154		2203	4300	6503	SO:0001819	synonymous_variant	151194	exon4			CGTGATAGTCACA	AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.273T>A	chr2.hg19:g.208478154A>T		26.0	0.0		19.0	5.0	NM_145280	Q53RV0|Q8N1Z9|Q96GH6	Silent	SNP	ENST00000411432.1	hg19	CCDS2376.1																																																																																			.	.		0.378	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337044.1	NM_145280	
TRPM8	79054	hgsc.bcm.edu	37	2	234894478	234894478	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:234894478C>T	ENST00000324695.4	+	21	2948	c.2908C>T	c.(2908-2910)Ctg>Ttg	p.L970L	TRPM8_ENST00000433712.2_Silent_p.L548L	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	970					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CACCAACATCCTGCTGGTCAA	0.577																																					p.L970L		Atlas-SNP	.											.	TRPM8	146	.	0			c.C2908T						.						129.0	87.0	101.0					2																	234894478		2203	4300	6503	SO:0001819	synonymous_variant	79054	exon21			AACATCCTGCTGG	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2908C>T	chr2.hg19:g.234894478C>T		251.0	0.0		208.0	84.0	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Silent	SNP	ENST00000324695.4	hg19	CCDS33407.1																																																																																			.	.		0.577	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	
TOP2B	7155	hgsc.bcm.edu	37	3	25668275	25668275	+	Missense_Mutation	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:25668275A>T	ENST00000264331.4	-	17	2096	c.2097T>A	c.(2095-2097)caT>caA	p.H699Q	TOP2B_ENST00000435706.2_Missense_Mutation_p.H694Q	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	699					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	CTGGTAAGCCATGTAGCCTAC	0.383																																					p.H694Q		Atlas-SNP	.											.	TOP2B	98	.	0			c.T2082A						.						69.0	70.0	70.0					3																	25668275		2203	4299	6502	SO:0001583	missense	7155	exon17			TAAGCCATGTAGC	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.2097T>A	chr3.hg19:g.25668275A>T	ENSP00000264331:p.His699Gln	66.0	0.0		74.0	4.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	ENST00000264331.4	hg19		.	.	.	.	.	.	.	.	.	.	A	10.34	1.324066	0.24080	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.42131	0.98;0.98	5.4	3.0	0.34707	.	0.000000	0.85682	D	0.000000	T	0.23451	0.0567	N	0.16656	0.425	0.80722	D	1	B	0.21688	0.059	B	0.17433	0.018	T	0.04664	-1.0935	10	0.21014	T	0.42	.	8.7808	0.34789	0.7131:0.0:0.2869:0.0	.	694	Q02880-2	.	Q	694;699;694	ENSP00000396704:H694Q;ENSP00000264331:H699Q	ENSP00000264331:H699Q	H	-	3	2	TOP2B	25643279	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.018000	0.40991	0.433000	0.26313	-0.379000	0.06801	CAT	.	.		0.383	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
RNF123	63891	hgsc.bcm.edu	37	3	49724207	49724207	+	5'Flank	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:49724207A>G	ENST00000327697.6	+	0	0				MST1_ENST00000545762.1_3'UTR|AC099668.5_ENST00000563780.1_RNA|RNF123_ENST00000432042.1_5'Flank|MST1_ENST00000383728.3_Missense_Mutation_p.Y178H|MST1_ENST00000494828.2_5'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.Y253H	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		TTCCGGCAATAGTTGTCGTCC	0.627																																					p.Y253H		Atlas-SNP	.											.	MST1	84	.	0			c.T757C						.						9.0	11.0	11.0					3																	49724207		2139	4203	6342	SO:0001631	upstream_gene_variant	4485	exon7			GGCAATAGTTGTC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		chr3.hg19:g.49724207A>G	Exception_encountered	425.0	0.0		436.0	74.0	NM_020998	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	hg19	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	A	35	5.430667	0.96150	.	.	ENSG00000173531	ENST00000449682;ENST00000383728	T;T	0.75704	-0.96;-0.96	5.75	5.75	0.90469	Kringle (5);Kringle-like fold (1);Kringle, conserved site (1);	0.478958	0.15547	N	0.256612	D	0.89979	0.6872	M	0.93420	3.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.994	D	0.91709	0.5380	10	0.87932	D	0	.	16.0663	0.80878	1.0:0.0:0.0:0.0	.	239;253	P26927;G3XAK1	HGFL_HUMAN;.	H	253;178	ENSP00000414287:Y253H;ENSP00000373234:Y178H	ENSP00000373234:Y178H	Y	-	1	0	MST1	49699211	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.046000	0.93817	2.201000	0.70794	0.533000	0.62120	TAT	.	.		0.627	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
GNAI2	2771	hgsc.bcm.edu	37	3	50273847	50273847	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:50273847G>T	ENST00000313601.6	+	1	464	c.80G>T	c.(79-81)gGa>gTa	p.G27V	GNAI2_ENST00000440628.1_5'Flank|GNAI2_ENST00000491100.1_Intron|GNAI2_ENST00000536647.1_5'UTR|GNAI2_ENST00000422163.1_Intron	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	27					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		CGGGAGGACGGAGAGAAGGCG	0.667																																					p.G27V		Atlas-SNP	.											.	GNAI2	42	.	0			c.G80T						.						86.0	87.0	87.0					3																	50273847		2202	4300	6502	SO:0001583	missense	2771	exon1			AGGACGGAGAGAA	X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.80G>T	chr3.hg19:g.50273847G>T	ENSP00000312999:p.Gly27Val	99.0	0.0		118.0	41.0	NM_002070	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	ENST00000313601.6	hg19	CCDS2813.1	.	.	.	.	.	.	.	.	.	.	G	35	5.591748	0.96590	.	.	ENSG00000114353	ENST00000313601;ENST00000540560	D	0.88277	-2.36	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.93530	0.7935	M	0.89478	3.035	0.80722	D	1	P	0.43542	0.81	P	0.50825	0.651	D	0.94677	0.7862	10	0.87932	D	0	.	16.2417	0.82411	0.0:0.0:1.0:0.0	.	27	P04899	GNAI2_HUMAN	V	27	ENSP00000312999:G27V	ENSP00000312999:G27V	G	+	2	0	GNAI2	50248851	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.227000	0.95236	2.413000	0.81919	0.650000	0.86243	GGA	.	.		0.667	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346688.1	NM_002070	
CACNA2D2	9254	hgsc.bcm.edu	37	3	50415488	50415488	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:50415488C>T	ENST00000479441.1	-	15	1429	c.1430G>A	c.(1429-1431)gGc>gAc	p.G477D	CACNA2D2_ENST00000424201.2_Missense_Mutation_p.G477D|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.G477D|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.G477D|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.G477D|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.G477D|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.G477D|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.G408D			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	477					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GGCCTCCTTGCCTGCCAGCAC	0.612																																					p.G477D		Atlas-SNP	.											.	CACNA2D2	82	.	0			c.G1430A						.						106.0	93.0	98.0					3																	50415488		2203	4300	6503	SO:0001583	missense	9254	exon15			TCCTTGCCTGCCA	AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.1430G>A	chr3.hg19:g.50415488C>T	ENSP00000418081:p.Gly477Asp	113.0	0.0		134.0	32.0	NM_001174051	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	ENST00000479441.1	hg19	CCDS54588.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627259	0.66901	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.06687	3.28;3.27;3.27;3.28;3.28;3.27;3.27;3.28	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.12902	0.0313	L	0.36672	1.1	0.52501	D	0.999955	B;B	0.27013	0.051;0.166	B;B	0.37943	0.042;0.261	T	0.13176	-1.0519	10	0.40728	T	0.16	-21.7662	19.0208	0.92915	0.0:1.0:0.0:0.0	.	477;477	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	D	477;477;477;408;477;477;477;477	ENSP00000407393:G477D;ENSP00000404631:G477D;ENSP00000266039:G477D;ENSP00000354228:G408D;ENSP00000390526:G477D;ENSP00000378519:G477D;ENSP00000390329:G477D;ENSP00000418081:G477D	ENSP00000266039:G477D	G	-	2	0	CACNA2D2	50390492	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.002000	0.70693	2.492000	0.84095	0.585000	0.79938	GGC	.	.		0.612	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346457.1	NM_006030	
TMPRSS7	344805	hgsc.bcm.edu	37	3	111785275	111785275	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:111785275G>A	ENST00000452346.2	+	13	1595	c.1592G>A	c.(1591-1593)aGg>aAg	p.R531K	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.R405K			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	531	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGCTCCTTCAGGCAGCATGGC	0.512																																					p.R405K		Atlas-SNP	.											.	TMPRSS7	126	.	0			c.G1214A						.						104.0	104.0	104.0					3																	111785275		1968	4164	6132	SO:0001583	missense	344805	exon11			CCTTCAGGCAGCA	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1592G>A	chr3.hg19:g.111785275G>A	ENSP00000398236:p.Arg531Lys	79.0	0.0		80.0	36.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	hg19		.	.	.	.	.	.	.	.	.	.	G	3.696	-0.062452	0.07273	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	T;T	0.58652	0.32;0.32	5.67	3.81	0.43845	.	0.698068	0.14485	N	0.316738	T	0.35885	0.0947	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24977	-1.0145	10	0.06099	T	0.92	.	7.6679	0.28443	0.0868:0.0:0.7474:0.1658	.	531;405	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	K	531;519;505;405	ENSP00000398236:R531K;ENSP00000411645:R405K	ENSP00000411645:R405K	R	+	2	0	TMPRSS7	113267965	0.126000	0.22350	0.809000	0.32408	0.867000	0.49689	0.872000	0.28037	1.484000	0.48361	0.655000	0.94253	AGG	.	.		0.512	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
NR1I2	8856	hgsc.bcm.edu	37	3	119526207	119526207	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:119526207G>T	ENST00000337940.4	+	2	275	c.227G>T	c.(226-228)gGt>gTt	p.G76V	NR1I2_ENST00000393716.2_Missense_Mutation_p.G37V|NR1I2_ENST00000466380.1_Missense_Mutation_p.G37V	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	37					drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	GAAGTCGGAGGTCCCCAAATC	0.502																																					p.G76V		Atlas-SNP	.											.	NR1I2	44	.	0			c.G227T						.						152.0	141.0	145.0					3																	119526207		2203	4300	6503	SO:0001583	missense	8856	exon2			TCGGAGGTCCCCA	AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	ENST00000337940.4:c.227G>T	chr3.hg19:g.119526207G>T	ENSP00000336528:p.Gly76Val	166.0	0.0		171.0	50.0	NM_022002	Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Missense_Mutation	SNP	ENST00000337940.4	hg19	CCDS2995.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.834346	0.32421	.	.	ENSG00000144852	ENST00000393716;ENST00000466380;ENST00000337940	D;D;D	0.91843	-2.89;-2.8;-2.92	4.21	3.24	0.37175	.	0.513929	0.17668	N	0.166070	T	0.81950	0.4931	N	0.19112	0.55	0.51233	D	0.999918	B;B	0.19445	0.015;0.036	B;B	0.16289	0.011;0.015	T	0.74856	-0.3522	10	0.25106	T	0.35	.	4.908	0.13807	0.2439:0.0:0.7561:0.0	.	76;60	F1D8P9;O75469-6	.;.	V	37;37;76	ENSP00000377319:G37V;ENSP00000420297:G37V;ENSP00000336528:G76V	ENSP00000336528:G76V	G	+	2	0	NR1I2	121008897	0.699000	0.27786	0.529000	0.27951	0.304000	0.27724	1.042000	0.30303	2.167000	0.68274	0.591000	0.81541	GGT	.	.		0.502	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355126.1		
KCNMB3	27094	hgsc.bcm.edu	37	3	178968887	178968887	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:178968887T>C	ENST00000314235.5	-	1	516	c.5A>G	c.(4-6)gAc>gGc	p.D2G	KCNMB3_ENST00000485523.1_Intron|KCNMB3_ENST00000497599.1_Intron|KCNMB3_ENST00000392685.2_5'UTR|KCNMB3_ENST00000349697.2_Intron	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	2					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	TGGTGAAAAGTCCATCTAAAT	0.398																																					p.D2G		Atlas-SNP	.											.	KCNMB3	46	.	0			c.A5G						.						117.0	115.0	116.0					3																	178968887		2203	4300	6503	SO:0001583	missense	27094	exon1			GAAAAGTCCATCT	AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.5A>G	chr3.hg19:g.178968887T>C	ENSP00000319370:p.Asp2Gly	122.0	0.0		101.0	26.0	NM_014407	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	ENST00000314235.5	hg19	CCDS3226.1	.	.	.	.	.	.	.	.	.	.	T	17.52	3.408948	0.62399	.	.	ENSG00000171121	ENST00000314235	T	0.11821	2.74	4.68	-0.481	0.12082	.	3.420860	0.01121	N	0.005798	T	0.07863	0.0197	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.35251	-0.9796	10	0.87932	D	0	.	4.1753	0.10349	0.0:0.2055:0.3848:0.4097	.	2	Q9NPA1	KCMB3_HUMAN	G	2	ENSP00000319370:D2G	ENSP00000319370:D2G	D	-	2	0	KCNMB3	180451581	0.001000	0.12720	0.001000	0.08648	0.058000	0.15608	-0.070000	0.11523	0.050000	0.15949	0.533000	0.62120	GAC	.	.		0.398	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348484.1		
PEX5L	51555	hgsc.bcm.edu	37	3	179537706	179537706	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr3:179537706T>A	ENST00000467460.1	-	9	1211	c.881A>T	c.(880-882)aAc>aTc	p.N294I	PEX5L_ENST00000465751.1_Missense_Mutation_p.N270I|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000468741.1_Missense_Mutation_p.N102I|PEX5L_ENST00000392649.3_Missense_Mutation_p.N186I|PEX5L_ENST00000476138.1_Missense_Mutation_p.N251I|PEX5L_ENST00000485199.1_Missense_Mutation_p.N259I|PEX5L_ENST00000263962.8_Missense_Mutation_p.N292I|PEX5L_ENST00000472994.1_Missense_Mutation_p.N235I|PEX5L_ENST00000464614.1_Missense_Mutation_p.N186I	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	294					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			AGATATCCAGTTCCTCCGAGC	0.428																																					p.N294I		Atlas-SNP	.											.	PEX5L	104	.	0			c.A881T						.						236.0	207.0	217.0					3																	179537706		2203	4300	6503	SO:0001583	missense	51555	exon9			ATCCAGTTCCTCC	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.881A>T	chr3.hg19:g.179537706T>A	ENSP00000419975:p.Asn294Ile	188.0	0.0		182.0	57.0	NM_016559	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	ENST00000467460.1	hg19	CCDS3236.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.642853	0.87859	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	D;D;D;D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.39;-2.35;-2.36;-2.4;-2.4;-2.35;-2.4	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.93106	0.7805	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.998;0.982;1.0;0.999;0.999	D;D;P;D;D;D	0.91635	0.991;0.987;0.776;0.999;0.998;0.997	D	0.93820	0.7118	10	0.87932	D	0	-23.8923	15.2627	0.73637	0.0:0.0:0.0:1.0	.	235;270;186;292;259;294	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	I	294;292;259;292;186;102;251;182;235;186;270	ENSP00000419975:N294I;ENSP00000263962:N292I;ENSP00000418440:N259I;ENSP00000376420:N186I;ENSP00000418665:N102I;ENSP00000420555:N251I;ENSP00000418054:N235I;ENSP00000417270:N186I;ENSP00000419348:N270I	ENSP00000263962:N292I	N	-	2	0	PEX5L	181020400	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.684000	0.68197	2.096000	0.63516	0.533000	0.62120	AAC	.	.		0.428	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348577.1	NM_016559	
TLR1	7096	hgsc.bcm.edu	37	4	38799346	38799346	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:38799346C>T	ENST00000502213.2	-	3	1336	c.1107G>A	c.(1105-1107)ggG>ggA	p.G369G	TLR1_ENST00000308979.2_Silent_p.G369G			Q15399	TLR1_HUMAN	toll-like receptor 1	369					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						CAGTAAGGTGCCCACAATTTT	0.373																																					p.G369G	GBM(5;216 373 40795 46382)	Atlas-SNP	.											.	TLR1	70	.	0			c.G1107A						.						44.0	46.0	45.0					4																	38799346		2203	4300	6503	SO:0001819	synonymous_variant	7096	exon4			AAGGTGCCCACAA	U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1107G>A	chr4.hg19:g.38799346C>T		38.0	0.0		32.0	5.0	NM_003263	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Silent	SNP	ENST00000502213.2	hg19	CCDS33973.1																																																																																			.	.		0.373	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360510.3		
IBSP	3381	hgsc.bcm.edu	37	4	88732684	88732684	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:88732684C>T	ENST00000226284.5	+	7	643	c.576C>T	c.(574-576)agC>agT	p.S192S		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	192					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		GCAACGGCAGCAGCGGAGGAG	0.522																																					p.S192S		Atlas-SNP	.											.	IBSP	53	.	0			c.C576T						.						146.0	133.0	137.0					4																	88732684		2203	4300	6503	SO:0001819	synonymous_variant	3381	exon7			CGGCAGCAGCGGA		CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.576C>T	chr4.hg19:g.88732684C>T		240.0	0.0		238.0	79.0	NM_004967		Silent	SNP	ENST00000226284.5	hg19	CCDS3624.1																																																																																			.	.		0.522	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
TBC1D9	23158	hgsc.bcm.edu	37	4	141543975	141543975	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:141543975G>A	ENST00000442267.2	-	21	3249	c.3175C>T	c.(3175-3177)Ctc>Ttc	p.L1059F		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	1059							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TCCAGCAGGAGGCTGGTCACT	0.602																																					p.L1059F		Atlas-SNP	.											.	TBC1D9	198	.	0			c.C3175T						.						27.0	28.0	27.0					4																	141543975		2047	4197	6244	SO:0001583	missense	23158	exon21			GCAGGAGGCTGGT	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.3175C>T	chr4.hg19:g.141543975G>A	ENSP00000411197:p.Leu1059Phe	38.0	0.0		43.0	26.0	NM_015130	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	hg19	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637256	0.67130	.	.	ENSG00000109436	ENST00000442267	T	0.65916	-0.18	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.74846	0.3770	M	0.76574	2.34	0.58432	D	0.999998	D	0.89917	1.0	D	0.80764	0.994	T	0.77319	-0.2632	10	0.87932	D	0	.	6.8792	0.24163	0.2146:0.0:0.7854:0.0	.	1059	Q6ZT07	TBCD9_HUMAN	F	1059	ENSP00000411197:L1059F	ENSP00000411197:L1059F	L	-	1	0	TBC1D9	141763425	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.690000	0.61731	2.461000	0.83175	0.655000	0.94253	CTC	.	.		0.602	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
ARFIP1	27236	hgsc.bcm.edu	37	4	153750843	153750843	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr4:153750843G>A	ENST00000451320.2	+	2	222	c.58G>A	c.(58-60)Gaa>Aaa	p.E20K	ARFIP1_ENST00000356064.3_Missense_Mutation_p.E20K|ARFIP1_ENST00000429148.2_Missense_Mutation_p.E20K|ARFIP1_ENST00000353617.2_Missense_Mutation_p.E20K|ARFIP1_ENST00000405727.2_Missense_Mutation_p.E20K			P53367	ARFP1_HUMAN	ADP-ribosylation factor interacting protein 1	20					intracellular protein transport (GO:0006886)|regulation of protein secretion (GO:0050708)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)			ARFIP1/FHDC1(2)	cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(180;0.093)					TAGTAATGGAGAAGTTGATGA	0.358																																					p.E20K		Atlas-SNP	.											ARFIP1_ENST00000451320,NS,carcinoma,0,2	ARFIP1	69	.	0			c.G58A						.						138.0	147.0	144.0					4																	153750843		2203	4300	6503	SO:0001583	missense	27236	exon2			AATGGAGAAGTTG	U52521	CCDS3780.1, CCDS34080.1	4q31.3	2008-08-01	2008-08-01			ENSG00000164144			21496	protein-coding gene	gene with protein product	"""arfaptin 1"""	605928				9038142, 10413101	Standard	NM_001025595		Approved	HSU52521	uc003imz.3	P53367		ENST00000451320.2:c.58G>A	chr4.hg19:g.153750843G>A	ENSP00000395083:p.Glu20Lys	77.0	0.0		40.0	11.0	NM_001025593	Q2M2X4|Q3SYL4|Q9Y2X6	Missense_Mutation	SNP	ENST00000451320.2	hg19	CCDS34080.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016254	0.75161	.	.	ENSG00000164144	ENST00000451320;ENST00000429148;ENST00000353617;ENST00000405727;ENST00000356064	T;T;T;T	0.79653	-1.27;-1.27;-1.29;-1.29	5.65	5.65	0.86999	.	0.101764	0.64402	D	0.000003	D	0.85911	0.5807	L	0.46157	1.445	0.48762	D	0.999702	P;B;B	0.51057	0.941;0.026;0.191	P;B;B	0.60415	0.874;0.04;0.073	D	0.86316	0.1689	10	0.62326	D	0.03	-17.8338	18.4954	0.90863	0.0:0.0:1.0:0.0	.	20;20;20	B4DS69;Q2M2X4;P53367	.;.;ARFP1_HUMAN	K	20	ENSP00000395083:E20K;ENSP00000296557:E20K;ENSP00000384189:E20K;ENSP00000348360:E20K	ENSP00000296557:E20K	E	+	1	0	ARFIP1	153970293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.222000	0.58580	2.654000	0.90174	0.557000	0.71058	GAA	.	.		0.358	ARFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365032.1	NM_014447	
CHD1	1105	hgsc.bcm.edu	37	5	98229286	98229286	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:98229286C>A	ENST00000284049.3	-	13	1974	c.1825G>T	c.(1825-1827)Gca>Tca	p.A609S		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	609	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	CCTATAAATGCCCAATTTAGA	0.328																																					p.A609S		Atlas-SNP	.											.	CHD1	137	.	0			c.G1825T						.						82.0	92.0	88.0					5																	98229286		2203	4300	6503	SO:0001583	missense	1105	exon13			TAAATGCCCAATT	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.1825G>T	chr5.hg19:g.98229286C>A	ENSP00000284049:p.Ala609Ser	107.0	0.0		71.0	4.0	NM_001270	Q17RZ3	Missense_Mutation	SNP	ENST00000284049.3	hg19	CCDS34204.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025195	0.93518	.	.	ENSG00000153922	ENST00000284049	D	0.92858	-3.12	5.41	5.41	0.78517	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.33346	U	0.005016	D	0.89476	0.6726	N	0.11870	0.19	0.80722	D	1	P	0.42123	0.771	P	0.48488	0.579	D	0.91279	0.5050	10	0.72032	D	0.01	.	19.1964	0.93690	0.0:1.0:0.0:0.0	.	609	O14646	CHD1_HUMAN	S	609	ENSP00000284049:A609S	ENSP00000284049:A609S	A	-	1	0	CHD1	98257186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.792000	0.85828	2.547000	0.85894	0.555000	0.69702	GCA	.	.		0.328	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370295.1	NM_001270	
PPIP5K2	23262	hgsc.bcm.edu	37	5	102469329	102469329	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:102469329G>T	ENST00000358359.3	+	3	796	c.287G>T	c.(286-288)tGt>tTt	p.C96F	PPIP5K2_ENST00000321521.9_Missense_Mutation_p.C96F|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.C96F|PPIP5K2_ENST00000513500.1_3'UTR	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	96					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTATGTGATTGTCTTATTTCT	0.328																																					p.C96F		Atlas-SNP	.											.	PPIP5K2	98	.	0			c.G287T						.						90.0	94.0	92.0					5																	102469329		2202	4300	6502	SO:0001583	missense	23262	exon2			GTGATTGTCTTAT	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.287G>T	chr5.hg19:g.102469329G>T	ENSP00000351126:p.Cys96Phe	61.0	0.0		40.0	14.0	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	hg19		.	.	.	.	.	.	.	.	.	.	G	17.19	3.327354	0.60743	.	.	ENSG00000145725	ENST00000321521;ENST00000358359;ENST00000451606;ENST00000414217;ENST00000507310	T;T;T	0.15139	2.46;2.45;2.46	5.17	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.33876	0.0878	L	0.49350	1.555	0.80722	D	1	P;D	0.89917	0.93;1.0	P;D	0.65987	0.452;0.94	T	0.08391	-1.0724	10	0.87932	D	0	.	13.9491	0.64104	0.0738:0.0:0.9262:0.0	.	96;96	O43314-2;O43314	.;VIP2_HUMAN	F	96;96;96;96;26	ENSP00000313070:C96F;ENSP00000351126:C96F;ENSP00000416016:C96F	ENSP00000313070:C96F	C	+	2	0	PPIP5K2	102497228	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.420000	0.97426	1.322000	0.45245	0.491000	0.48974	TGT	.	.		0.328	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
PCDHB11	56125	hgsc.bcm.edu	37	5	140579644	140579644	+	Silent	SNP	C	C	T	rs377046428		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:140579644C>T	ENST00000354757.3	+	1	297	c.297C>T	c.(295-297)atC>atT	p.I99I	PCDHB11_ENST00000536699.1_Intron	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	99	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.I99I(1)		NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCGGTTCCATCGAGCCTTGCG	0.453																																					p.I99I		Atlas-SNP	.											PCDHB11,colon,carcinoma,0,1	PCDHB11	162	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C297T						.	C		0,4406		0,0,2203	120.0	131.0	127.0		297	-5.6	0.0	5		127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PCDHB11	NM_018931.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		99/798	140579644	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	56125	exon1			TTCCATCGAGCCT	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.297C>T	chr5.hg19:g.140579644C>T		109.0	0.0		96.0	5.0	NM_018931	B4DSF7|Q2M223	Silent	SNP	ENST00000354757.3	hg19	CCDS4253.1																																																																																			.	.		0.453	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
C1QTNF2	114898	hgsc.bcm.edu	37	5	159781851	159781851	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:159781851C>T	ENST00000393975.3	-	2	306	c.303G>A	c.(301-303)atG>atA	p.M101I		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	56	Collagen-like.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTCGTCCCATCATTCCTGAGG	0.667																																					p.M101I		Atlas-SNP	.											.	C1QTNF2	33	.	0			c.G303A						.						25.0	22.0	23.0					5																	159781851		2203	4299	6502	SO:0001583	missense	114898	exon2			TCCCATCATTCCT	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.303G>A	chr5.hg19:g.159781851C>T	ENSP00000377545:p.Met101Ile	66.0	0.0		80.0	29.0	NM_031908		Missense_Mutation	SNP	ENST00000393975.3	hg19	CCDS4351.2	.	.	.	.	.	.	.	.	.	.	C	11.71	1.719452	0.30503	.	.	ENSG00000145861	ENST00000393975	D	0.91295	-2.82	5.16	4.29	0.51040	.	0.553935	0.20174	N	0.097675	T	0.80924	0.4717	N	0.20881	0.62	0.22127	N	0.999342	B	0.11235	0.004	B	0.15870	0.014	T	0.65372	-0.6184	10	0.25751	T	0.34	.	4.9414	0.13967	0.1702:0.6538:0.0:0.176	.	56	Q9BXJ5	C1QT2_HUMAN	I	101	ENSP00000377545:M101I	ENSP00000377545:M101I	M	-	3	0	C1QTNF2	159714429	0.685000	0.27652	1.000000	0.80357	0.962000	0.63368	-0.038000	0.12144	1.157000	0.42530	0.313000	0.20887	ATG	.	.		0.667	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
AGPAT1	10554	hgsc.bcm.edu	37	6	32138303	32138303	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:32138303G>A	ENST00000395499.1	-	4	988	c.409C>T	c.(409-411)Ctg>Ttg	p.L137L	AGPAT1_ENST00000336984.6_Silent_p.L137L|AGPAT1_ENST00000412465.2_Silent_p.L25L|PPT2-EGFL8_ENST00000422437.1_3'UTR|AGPAT1_ENST00000490711.1_Intron|AGPAT1_ENST00000395496.1_Silent_p.L137L|AGPAT1_ENST00000395497.1_Silent_p.L137L|AGPAT1_ENST00000375104.2_Silent_p.L137L|AGPAT1_ENST00000375107.3_Silent_p.L137L			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	137					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						CAGCAGGCCAGCCCGGCAGAG	0.652																																					p.L137L		Atlas-SNP	.											.	AGPAT1	22	.	0			c.C409T						.						70.0	77.0	75.0					6																	32138303		1510	2708	4218	SO:0001819	synonymous_variant	10554	exon4			AGGCCAGCCCGGC	U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.409C>T	chr6.hg19:g.32138303G>A		114.0	0.0		124.0	36.0	NM_006411	A2BFI5|Q5BL03	Silent	SNP	ENST00000395499.1	hg19	CCDS4744.1																																																																																			.	.		0.652	AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411	
FOXP4	116113	hgsc.bcm.edu	37	6	41566660	41566660	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:41566660G>A	ENST00000307972.4	+	16	2041	c.2029G>A	c.(2029-2031)Gaa>Aaa	p.E677K	FOXP4_ENST00000373063.3_Missense_Mutation_p.E664K|FOXP4_ENST00000373057.3_Missense_Mutation_p.E675K|MIR4641_ENST00000578353.1_RNA|FOXP4_ENST00000373060.1_Missense_Mutation_p.E677K|FOXP4_ENST00000409208.1_Missense_Mutation_p.E665K			Q8IVH2	FOXP4_HUMAN	forkhead box P4	677					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GCTGCCGGGAGAAGAACTGTC	0.692																																					p.E677K		Atlas-SNP	.											.	FOXP4	83	.	0			c.G2029A						.						25.0	30.0	28.0					6																	41566660		2203	4298	6501	SO:0001583	missense	116113	exon17			CCGGGAGAAGAAC	AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.2029G>A	chr6.hg19:g.41566660G>A	ENSP00000309823:p.Glu677Lys	275.0	0.0		258.0	89.0	NM_001012426	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Missense_Mutation	SNP	ENST00000307972.4	hg19	CCDS34447.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271378	0.80469	.	.	ENSG00000137166	ENST00000373060;ENST00000373063;ENST00000409208;ENST00000373057;ENST00000307972	D;D;D;D;D	0.91945	-2.92;-2.93;-2.94;-2.92;-2.92	4.36	4.36	0.52297	.	0.135315	0.46442	D	0.000292	D	0.93822	0.8024	L	0.60455	1.87	0.58432	D	0.999999	D;D;D	0.63880	0.993;0.993;0.993	D;D;D	0.68192	0.956;0.956;0.956	D	0.94431	0.7649	10	0.87932	D	0	.	15.206	0.73180	0.0:0.0:1.0:0.0	.	664;675;677	Q8IW55;Q7Z7F8;Q8IVH2	.;.;FOXP4_HUMAN	K	677;664;665;675;677	ENSP00000362151:E677K;ENSP00000362154:E664K;ENSP00000386958:E665K;ENSP00000362148:E675K;ENSP00000309823:E677K	ENSP00000309823:E677K	E	+	1	0	FOXP4	41674638	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.578000	0.74032	2.435000	0.82474	0.462000	0.41574	GAA	.	.		0.692	FOXP4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106767.1	NM_138457	
LGSN	51557	hgsc.bcm.edu	37	6	63990465	63990465	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:63990465T>C	ENST00000370657.4	-	4	1024	c.991A>G	c.(991-993)Act>Gct	p.T331A	LGSN_ENST00000370658.5_Silent_p.A190A			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	331					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GTTCCAGAAGTGCTGCAGAAC	0.473																																					p.T331A		Atlas-SNP	.											.	LGSN	82	.	0			c.A991G						.						87.0	88.0	88.0					6																	63990465		2203	4300	6503	SO:0001583	missense	51557	exon4			CAGAAGTGCTGCA	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.991A>G	chr6.hg19:g.63990465T>C	ENSP00000359691:p.Thr331Ala	67.0	0.0		51.0	25.0	NM_016571	A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	ENST00000370657.4	hg19	CCDS4964.1	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.487866	0.01018	.	.	ENSG00000146166	ENST00000370657	D	0.85171	-1.95	5.62	-0.412	0.12367	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.452483	0.29616	N	0.011657	T	0.59224	0.2178	.	.	.	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.55661	-0.8106	9	0.38643	T	0.18	-6.7024	10.7564	0.46239	0.0:0.7178:0.0:0.2822	.	331	Q5TDP6	LGSN_HUMAN	A	331	ENSP00000359691:T331A	ENSP00000359691:T331A	T	-	1	0	LGSN	64048424	0.367000	0.25023	0.007000	0.13788	0.001000	0.01503	1.721000	0.38032	-0.030000	0.13804	-0.250000	0.11733	ACT	.	.		0.473	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	NM_016571	
PGM3	5238	hgsc.bcm.edu	37	6	83888466	83888466	+	Missense_Mutation	SNP	T	T	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:83888466T>G	ENST00000283977.4	-	7	838	c.712A>C	c.(712-714)Agt>Cgt	p.S238R	PGM3_ENST00000513973.1_Missense_Mutation_p.S319R|PGM3_ENST00000512866.1_Missense_Mutation_p.S319R|PGM3_ENST00000506587.1_Missense_Mutation_p.S347R					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		ATATTCAAACTTTCTCCAATC	0.318																																					p.S347R		Atlas-SNP	.											.	PGM3	39	.	0			c.A1039C						.						109.0	97.0	101.0					6																	83888466		2203	4299	6502	SO:0001583	missense	5238	exon9			TCAAACTTTCTCC	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.712A>C	chr6.hg19:g.83888466T>G	ENSP00000283977:p.Ser238Arg	109.0	0.0		85.0	32.0	NM_001199917		Missense_Mutation	SNP	ENST00000283977.4	hg19		.	.	.	.	.	.	.	.	.	.	T	11.77	1.737001	0.30774	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000283977;ENST00000506587	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.87	3.51	0.40186	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.488846	0.26387	N	0.024664	T	0.10594	0.0259	N	0.20357	0.565	0.40017	D	0.975362	B;B;B	0.26935	0.164;0.002;0.072	B;B;B	0.24269	0.052;0.007;0.032	T	0.09100	-1.0690	10	0.16420	T	0.52	-53.103	9.8444	0.41017	0.0:0.139:0.0:0.861	.	347;347;319	E9PF86;B4DX94;O95394	.;.;AGM1_HUMAN	R	319;319;238;347	ENSP00000424874:S319R;ENSP00000421565:S319R;ENSP00000283977:S238R;ENSP00000425809:S347R	ENSP00000283977:S238R	S	-	1	0	PGM3	83945185	0.213000	0.23551	0.510000	0.27712	0.861000	0.49209	0.526000	0.22971	0.492000	0.27815	0.528000	0.53228	AGT	.	.		0.318	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
KIAA0408	9729	hgsc.bcm.edu	37	6	127768213	127768213	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr6:127768213C>T	ENST00000483725.3	-	5	1587	c.1251G>A	c.(1249-1251)gaG>gaA	p.E417E	SOGA3_ENST00000481848.2_3'UTR|SOGA3_ENST00000556132.1_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	417										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		GGCTACTGCTCTCTGCTACTG	0.413																																					p.E417E		Atlas-SNP	.											.	KIAA0408	61	.	0			c.G1251A						.						67.0	69.0	68.0					6																	127768213		2202	4300	6502	SO:0001819	synonymous_variant	9729	exon5			ACTGCTCTCTGCT	AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.1251G>A	chr6.hg19:g.127768213C>T		66.0	0.0		36.0	5.0	NM_014702	B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Silent	SNP	ENST00000483725.3	hg19	CCDS34531.1																																																																																			.	.		0.413	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042145.3	NM_014702	
PLXNA4	91584	hgsc.bcm.edu	37	7	131833385	131833385	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:131833385C>T	ENST00000359827.3	-	26	5643	c.4681G>A	c.(4681-4683)Gca>Aca	p.A1561T	PLXNA4_ENST00000321063.4_Missense_Mutation_p.A1561T			Q9HCM2	PLXA4_HUMAN	plexin A4	1561					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ATCATCCTTGCCCCACTTCCT	0.537																																					p.A1561T		Atlas-SNP	.											PLXNA4_ENST00000359827,right_upper_lobe,carcinoma,0,2	PLXNA4	873	.	0			c.G4681A						.						133.0	131.0	132.0					7																	131833385		2156	4288	6444	SO:0001583	missense	91584	exon26			TCCTTGCCCCACT	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4681G>A	chr7.hg19:g.131833385C>T	ENSP00000352882:p.Ala1561Thr	109.0	0.0		151.0	49.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.516951	0.64634	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.11712	2.75;2.75	4.62	4.62	0.57501	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.286062	0.38959	N	0.001516	T	0.11750	0.0286	L	0.33753	1.03	0.41275	D	0.986873	P	0.39665	0.682	B	0.39503	0.301	T	0.08249	-1.0731	10	0.49607	T	0.09	.	17.6545	0.88174	0.0:1.0:0.0:0.0	.	1561	Q9HCM2	PLXA4_HUMAN	T	1561	ENSP00000323194:A1561T;ENSP00000352882:A1561T	ENSP00000323194:A1561T	A	-	1	0	PLXNA4	131483925	0.998000	0.40836	0.963000	0.40424	0.940000	0.58332	3.815000	0.55651	2.401000	0.81631	0.561000	0.74099	GCA	.	.		0.537	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
NRG1	3084	hgsc.bcm.edu	37	8	32621590	32621590	+	Silent	SNP	C	C	T	rs576124928		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr8:32621590C>T	ENST00000405005.3	+	12	1593	c.1593C>T	c.(1591-1593)taC>taT	p.Y531Y	NRG1_ENST00000519301.1_Silent_p.Y481Y|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000539990.1_Silent_p.Y374Y|NRG1_ENST00000287842.3_Silent_p.Y528Y|NRG1_ENST00000287845.5_Silent_p.Y502Y|NRG1_ENST00000338921.4_Silent_p.Y539Y|NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000356819.4_Silent_p.Y536Y			Q02297	NRG1_HUMAN	neuregulin 1	531					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCCAAGAGTACGAGCCAGCCC	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16851	0.0		0.0	False		,,,				2504	0.0				p.Y536Y		Atlas-SNP	.											.	NRG1	260	.	0			c.C1608T						.						59.0	54.0	56.0					8																	32621590		2203	4300	6503	SO:0001819	synonymous_variant	3084	exon13			AGAGTACGAGCCA	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1593C>T	chr8.hg19:g.32621590C>T		114.0	0.0		106.0	29.0	NM_013956	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	ENST00000405005.3	hg19	CCDS6085.1																																																																																			.	.		0.547	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000472504.1		
PRDM14	63978	hgsc.bcm.edu	37	8	70981670	70981670	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr8:70981670C>T	ENST00000276594.2	-	2	627	c.426G>A	c.(424-426)ccG>ccA	p.P142P		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	142					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GTCCACAACACGGGCCACTCT	0.592																																					p.P142P	NSCLC(129;99 1813 5906 40656 46114)	Atlas-SNP	.											.	PRDM14	102	.	0			c.G426A						.						54.0	51.0	52.0					8																	70981670		2203	4300	6503	SO:0001819	synonymous_variant	63978	exon2			ACAACACGGGCCA	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.426G>A	chr8.hg19:g.70981670C>T		150.0	0.0		147.0	12.0	NM_024504	Q86UX9	Silent	SNP	ENST00000276594.2	hg19	CCDS6206.1																																																																																			.	.		0.592	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
CNTLN	54875	hgsc.bcm.edu	37	9	17394764	17394764	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:17394764T>C	ENST00000380647.3	+	15	2396	c.2312T>C	c.(2311-2313)gTc>gCc	p.V771A	CNTLN_ENST00000425824.1_Missense_Mutation_p.V771A|CNTLN_ENST00000262360.5_Missense_Mutation_p.V771A			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	771					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GAGACAGAAGTCACTTCCCTG	0.398																																					p.V771A		Atlas-SNP	.											.	CNTLN	128	.	0			c.T2312C						.						84.0	84.0	84.0					9																	17394764		1933	4150	6083	SO:0001583	missense	54875	exon15			CAGAAGTCACTTC	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.2312T>C	chr9.hg19:g.17394764T>C	ENSP00000370021:p.Val771Ala	142.0	0.0		96.0	33.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	hg19	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	T	8.423	0.846840	0.17034	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.20200	2.09;2.09;2.35	5.77	5.77	0.91146	.	.	.	.	.	T	0.15522	0.0374	L	0.34521	1.04	0.30276	N	0.791744	P;P;P	0.46784	0.607;0.884;0.884	B;B;B	0.39503	0.224;0.301;0.301	T	0.04811	-1.0925	9	0.18710	T	0.47	.	11.1671	0.48550	0.0:0.0734:0.0:0.9266	.	771;771;771	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	A	771	ENSP00000370021:V771A;ENSP00000392798:V771A;ENSP00000262360:V771A	ENSP00000262360:V771A	V	+	2	0	CNTLN	17384764	1.000000	0.71417	1.000000	0.80357	0.381000	0.30169	3.291000	0.51764	2.201000	0.70794	0.528000	0.53228	GTC	.	.		0.398	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
FRMD3	257019	hgsc.bcm.edu	37	9	85863364	85863364	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:85863364G>A	ENST00000304195.3	-	14	1469	c.1263C>T	c.(1261-1263)gcC>gcT	p.A421A	FRMD3_ENST00000328788.1_Silent_p.A78A|FRMD3_ENST00000376434.1_Silent_p.A227A|FRMD3_ENST00000465485.1_5'UTR|FRMD3_ENST00000376438.1_Silent_p.A421A	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	421						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						CATACTCCCGGGCTGCCTTCA	0.433																																					p.A421A		Atlas-SNP	.											.	FRMD3	96	.	0			c.C1263T						.						71.0	71.0	71.0					9																	85863364		1845	4102	5947	SO:0001819	synonymous_variant	257019	exon14			CTCCCGGGCTGCC	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1263C>T	chr9.hg19:g.85863364G>A		36.0	0.0		40.0	14.0	NM_174938	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Silent	SNP	ENST00000304195.3	hg19	CCDS43840.1																																																																																			.	.		0.433	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157355.1	NM_174938	
CCDC180	100499483	hgsc.bcm.edu	37	9	100105674	100105674	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:100105674C>G	ENST00000357054.1	+	33	3811	c.2876C>G	c.(2875-2877)tCc>tGc	p.S959C	CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000529487.1_Missense_Mutation_p.S820C|CCDC180_ENST00000460482.2_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.S820C|CCDC180_ENST00000411667.2_Missense_Mutation_p.S817C			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	959						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GACATGGAGTCCTTCACAATC	0.423																																					p.S820C		Atlas-SNP	.											.	.	.	.	0			c.C2459G						.						141.0	124.0	130.0					9																	100105674		2203	4300	6503	SO:0001583	missense	0	exon19			TGGAGTCCTTCAC	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2876C>G	chr9.hg19:g.100105674C>G	ENSP00000349562:p.Ser959Cys	83.0	0.0		108.0	6.0	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	ENST00000357054.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.48	3.135348	0.56828	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.13089	2.99;3.0;2.62;3.0	5.49	-0.913	0.10500	.	0.874303	0.09928	N	0.737591	T	0.15696	0.0378	N	0.19112	0.55	0.24518	N	0.994177	D;D;D	0.67145	0.995;0.996;0.995	P;P;P	0.61592	0.847;0.891;0.847	T	0.22836	-1.0205	10	0.56958	D	0.05	-2.8289	5.534	0.17001	0.0:0.3408:0.1489:0.5103	.	843;959;959	Q86Y65;B7ZMG3;Q9P1Z9	.;.;CI174_HUMAN	C	959;820;817;843;820	ENSP00000349562:S959C;ENSP00000364348:S820C;ENSP00000414000:S817C;ENSP00000434727:S820C	ENSP00000349562:S959C	S	+	2	0	C9orf174	99145495	0.797000	0.28877	0.994000	0.49952	0.776000	0.43924	-0.341000	0.07811	-0.129000	0.11620	-0.140000	0.14226	TCC	.	.		0.423	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
TGFBR1	7046	hgsc.bcm.edu	37	9	101908774	101908774	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:101908774G>A	ENST00000374994.4	+	7	1255	c.1138G>A	c.(1138-1140)Gcc>Acc	p.A380T	TGFBR1_ENST00000550253.1_Missense_Mutation_p.A311T|RNA5SP290_ENST00000517133.1_RNA|TGFBR1_ENST00000374990.2_Missense_Mutation_p.A303T|TGFBR1_ENST00000552516.1_Missense_Mutation_p.A384T	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	380	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TAGGTACATGGCCCCTGAAGT	0.363																																					p.A380T		Atlas-SNP	.											.	TGFBR1	70	.	0			c.G1138A						.						172.0	175.0	174.0					9																	101908774		2203	4300	6503	SO:0001583	missense	7046	exon7			TACATGGCCCCTG		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.1138G>A	chr9.hg19:g.101908774G>A	ENSP00000364133:p.Ala380Thr	77.0	0.0		45.0	9.0	NM_004612	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	ENST00000374994.4	hg19	CCDS6738.1	.	.	.	.	.	.	.	.	.	.	G	34	5.352851	0.95830	.	.	ENSG00000106799	ENST00000374994;ENST00000540092;ENST00000374990;ENST00000552516;ENST00000550253	D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99187	0.9718	H	0.98314	4.2	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.984;0.999	D	0.98883	1.0770	10	0.87932	D	0	.	18.3871	0.90470	0.0:0.0:1.0:0.0	.	303;380	P36897-3;P36897	.;TGFR1_HUMAN	T	380;342;303;384;311	ENSP00000364133:A380T;ENSP00000364129:A303T;ENSP00000447297:A384T;ENSP00000450052:A311T	ENSP00000364129:A303T	A	+	1	0	TGFBR1	100948595	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.810000	0.99221	2.708000	0.92522	0.467000	0.42956	GCC	.	.		0.363	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053390.3		
EXD3	54932	hgsc.bcm.edu	37	9	140247082	140247082	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr9:140247082G>T	ENST00000340951.4	-	11	1222	c.1027C>A	c.(1027-1029)Ctc>Atc	p.L343I	EXD3_ENST00000342129.4_Missense_Mutation_p.L23I	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						CTCCCCTGGAGCCTGAACCGG	0.701																																					p.L343I		Atlas-SNP	.											.	EXD3	86	.	0			c.C1027A						.						4.0	6.0	6.0					9																	140247082		1738	3751	5489	SO:0001583	missense	54932	exon11			CCTGGAGCCTGAA		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.1027C>A	chr9.hg19:g.140247082G>T	ENSP00000340474:p.Leu343Ile	53.0	0.0		65.0	4.0	NM_017820	Q6P1M1|Q8IXT8	Missense_Mutation	SNP	ENST00000340951.4	hg19	CCDS48066.1	.	.	.	.	.	.	.	.	.	.	G	7.327	0.618228	0.14129	.	.	ENSG00000187609	ENST00000342129;ENST00000340951	T;T	0.66460	-0.21;0.59	3.69	0.263	0.15602	.	0.735839	0.12406	N	0.471684	T	0.51024	0.1650	L	0.53249	1.67	0.09310	N	1	P;B	0.35745	0.518;0.158	B;B	0.32533	0.147;0.018	T	0.37478	-0.9704	10	0.30854	T	0.27	.	1.741	0.02952	0.1129:0.1746:0.3572:0.3554	.	23;343	Q8N9H8-3;Q8N9H8	.;MUT7_HUMAN	I	23;343	ENSP00000343705:L23I;ENSP00000340474:L343I	ENSP00000340474:L343I	L	-	1	0	EXD3	139366903	0.003000	0.15002	0.009000	0.14445	0.001000	0.01503	-0.126000	0.10563	0.163000	0.19507	-0.350000	0.07774	CTC	.	.		0.701	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343182.1	NM_017820	
AKR1E2	83592	hgsc.bcm.edu	37	10	4879675	4879675	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr10:4879675G>A	ENST00000298375.7	+	5	555	c.484G>A	c.(484-486)Ggg>Agg	p.G162R	AKR1E2_ENST00000525281.1_3'UTR|AKR1E2_ENST00000532248.1_Missense_Mutation_p.G162R|AKR1E2_ENST00000334019.4_Missense_Mutation_p.G162R|AKR1E2_ENST00000345253.5_Intron	NM_001040177.2	NP_001035267.1	Q96JD6	AKCL2_HUMAN	aldo-keto reductase family 1, member E2	162						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	1,5-anhydro-D-fructose reductase activity (GO:0050571)			NS(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)	15						GGTGATCACCGGGCTGGTGAA	0.507																																					p.G162R	NSCLC(43;343 1097 20371 28813 45509)	Atlas-SNP	.											.	AKR1E2	30	.	0			c.G484A						.						101.0	95.0	97.0					10																	4879675		2203	4300	6503	SO:0001583	missense	83592	exon5			ATCACCGGGCTGG	AB040820	CCDS31134.1, CCDS59210.1, CCDS59209.1	10p15.2	2009-09-09	2009-09-09	2009-09-09	ENSG00000165568	ENSG00000165568		"""Aldo-keto reductases"""	23437	protein-coding gene	gene with protein product			"""aldo-keto reductase family 1, member C-like 2"""	AKRDC1, AKR1CL2			Standard	NM_001271021		Approved	MGC10612	uc001ihi.4	Q96JD6	OTTHUMG00000017577	ENST00000298375.7:c.484G>A	chr10.hg19:g.4879675G>A	ENSP00000298375:p.Gly162Arg	92.0	0.0		108.0	41.0	NM_001040177	Q86Z16|Q86Z17|Q86Z18|Q9BU71	Missense_Mutation	SNP	ENST00000298375.7	hg19	CCDS31134.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.513869	0.44763	.	.	ENSG00000165568	ENST00000462718;ENST00000533295;ENST00000298375;ENST00000532248;ENST00000334019	D;T;T;T	0.87809	-2.3;-0.72;-0.72;-0.72	4.2	3.27	0.37495	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	D	0.94578	0.8253	H	0.94222	3.51	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95052	0.8188	10	0.72032	D	0.01	.	11.5482	0.50706	0.0:0.0:0.8199:0.1801	.	123;162;162;162	B7Z7K2;Q96JD6-2;Q96JD6;Q96JD6-3	.;.;AKCL2_HUMAN;.	R	58;166;162;162;162	ENSP00000435436:G166R;ENSP00000298375:G162R;ENSP00000432947:G162R;ENSP00000335034:G162R	ENSP00000298375:G162R	G	+	1	0	AKR1E2	4869675	1.000000	0.71417	0.557000	0.28306	0.012000	0.07955	6.848000	0.75409	1.314000	0.45095	0.455000	0.32223	GGG	.	.		0.507	AKR1E2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046520.4	NM_031436	
ADAM12	8038	hgsc.bcm.edu	37	10	127760045	127760046	+	Splice_Site	DNP	CC	CC	AA			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr10:127760045_127760046CC>AA	ENST00000368679.4	-	12	1641_1642	c.1332_1333GG>TT	c.(1330-1335)gaGGaa>gaTTaa	p.444_445EE>D*	ADAM12_ENST00000467145.1_5'Flank|ADAM12_ENST00000368676.4_Splice_Site_p.444_445EE>D*	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	444	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		ATGGTTCTTACCTCTGGCTCCC	0.5																																					.|p.E444D		Atlas-SNP	.											.	ADAM12	388	.	0			c.1332+1G>T|c.G1332T						.																																			SO:0001630	splice_region_variant	8038	exon13|exon12			TTCTTACCTCTGG|TCTTACCTCTGGC	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1332_1333delinsAA	chr10.hg19:g.127760045_127760046delinsAA		210.0|211.0	0.0		95.0|96.0	47.0	NM_003474|NM_021641	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Splice_Site|Missense_Mutation	SNP	ENST00000368679.4	hg19	CCDS7653.1																																																																																			.	.		0.500	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050961.1		Nonsense_Mutation
MUC2	4583	hgsc.bcm.edu	37	11	1095258	1095258	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:1095258G>A	ENST00000441003.2	+	32	6105	c.6078G>A	c.(6076-6078)aaG>aaA	p.K2026K	MUC2_ENST00000333592.6_3'UTR|MUC2_ENST00000361558.6_Silent_p.K164K	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4388					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CGCCCTCCAAGTCGACGCCCA	0.612																																					p.K2022K		Atlas-SNP	.											.	MUC2	614	.	0			c.G6066A						.						77.0	99.0	92.0					11																	1095258		2130	4223	6353	SO:0001819	synonymous_variant	4583	exon33			CTCCAAGTCGACG	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6078G>A	chr11.hg19:g.1095258G>A		153.0	0.0		169.0	19.0	NM_002457	Q14878	Silent	SNP	ENST00000441003.2	hg19																																																																																				.	.		0.612	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
NUP98	4928	hgsc.bcm.edu	37	11	3707425	3707425	+	Splice_Site	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:3707425C>G	ENST00000324932.7	-	29	4875		c.e29-1		NUP98_ENST00000355260.3_Intron|NUP98_ENST00000359171.4_Intron	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		ATCATAATGTCTGCAAAGAAC	0.483			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																.		Atlas-SNP	.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	149	.	0			c.4455-1G>C						.						79.0	67.0	71.0					11																	3707425		2201	4298	6499	SO:0001630	splice_region_variant	4928	exon30			TAATGTCTGCAAA	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4455-1G>C	chr11.hg19:g.3707425C>G		110.0	0.0		109.0	38.0	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Splice_Site	SNP	ENST00000324932.7	hg19	CCDS7746.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.472871	0.84640	.	.	ENSG00000110713	ENST00000324932;ENST00000429801	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9921	0.92796	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUP98	3664001	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.575000	0.82447	2.805000	0.96524	0.650000	0.86243	.	.	.		0.483	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	Intron
IPO7	10527	hgsc.bcm.edu	37	11	9450696	9450696	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:9450696T>A	ENST00000379719.3	+	14	1686	c.1544T>A	c.(1543-1545)gTg>gAg	p.V515E	CTD-2371O3.2_ENST00000531111.1_RNA|SNORA23_ENST00000365128.1_RNA	NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	515					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CCTGTGAAAGTGGAAGCTGCC	0.388																																					p.V515E		Atlas-SNP	.											.	IPO7	72	.	0			c.T1544A						.						85.0	82.0	83.0					11																	9450696		2201	4293	6494	SO:0001583	missense	10527	exon14			TGAAAGTGGAAGC	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1544T>A	chr11.hg19:g.9450696T>A	ENSP00000369042:p.Val515Glu	156.0	0.0		119.0	31.0	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	hg19	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.941537	0.92526	.	.	ENSG00000205339	ENST00000379719	T	0.65549	-0.16	5.95	5.95	0.96441	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82226	0.4991	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85406	0.1134	10	0.87932	D	0	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	515	O95373	IPO7_HUMAN	E	515	ENSP00000369042:V515E	ENSP00000369042:V515E	V	+	2	0	IPO7	9407272	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	GTG	.	.		0.388	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
CTR9	9646	hgsc.bcm.edu	37	11	10796824	10796824	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:10796824C>A	ENST00000361367.2	+	23	3382	c.2956C>A	c.(2956-2958)Cca>Aca	p.P986T		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	986	Lys-rich.				cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AAAACGACGTCCACCAAAAGC	0.383																																					p.P986T		Atlas-SNP	.											.	CTR9	94	.	0			c.C2956A						.						110.0	103.0	106.0					11																	10796824		2201	4294	6495	SO:0001583	missense	9646	exon23			CGACGTCCACCAA	D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2956C>A	chr11.hg19:g.10796824C>A	ENSP00000355013:p.Pro986Thr	66.0	0.0		46.0	20.0	NM_014633	D3DQV8|Q15015	Missense_Mutation	SNP	ENST00000361367.2	hg19	CCDS7805.1	.	.	.	.	.	.	.	.	.	.	C	1.046	-0.677318	0.03378	.	.	ENSG00000198730	ENST00000361367	T	0.40476	1.03	5.55	1.37	0.22104	.	0.267927	0.43747	N	0.000540	T	0.22437	0.0541	N	0.14661	0.345	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.16719	-1.0393	10	0.25751	T	0.34	-0.1623	9.6251	0.39746	0.3591:0.5773:0.0:0.0636	.	986	Q6PD62	CTR9_HUMAN	T	986	ENSP00000355013:P986T	ENSP00000355013:P986T	P	+	1	0	CTR9	10753400	0.027000	0.19231	0.339000	0.25562	0.025000	0.11179	0.815000	0.27253	0.276000	0.22118	-0.244000	0.11960	CCA	.	.		0.383	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386215.1	NM_014633	
ARHGAP20	57569	hgsc.bcm.edu	37	11	110477435	110477435	+	Nonsense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:110477435G>A	ENST00000260283.4	-	10	1098	c.814C>T	c.(814-816)Cga>Tga	p.R272*	ARHGAP20_ENST00000527598.1_Nonsense_Mutation_p.R236*|ARHGAP20_ENST00000524756.1_Nonsense_Mutation_p.R249*|ARHGAP20_ENST00000528829.1_Nonsense_Mutation_p.R236*|ARHGAP20_ENST00000357139.3_Nonsense_Mutation_p.R246*|ARHGAP20_ENST00000533353.1_Nonsense_Mutation_p.R246*	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	272	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GCAGAGTCTCGAAGATGGCTC	0.483																																					p.R272X		Atlas-SNP	.											.	ARHGAP20	150	.	0			c.C814T						.						154.0	156.0	155.0					11																	110477435		2201	4298	6499	SO:0001587	stop_gained	57569	exon10			AGTCTCGAAGATG	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.814C>T	chr11.hg19:g.110477435G>A	ENSP00000260283:p.Arg272*	72.0	0.0		55.0	12.0	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Nonsense_Mutation	SNP	ENST00000260283.4	hg19	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	G	38	7.177823	0.98114	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	.	.	.	5.41	4.48	0.54585	.	0.058925	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3081	0.82856	0.0:0.1326:0.8673:0.0	.	.	.	.	X	272;246;249;236;246;236	.	ENSP00000260283:R272X	R	-	1	2	ARHGAP20	109982645	1.000000	0.71417	0.997000	0.53966	0.642000	0.38348	4.177000	0.58276	1.367000	0.46095	0.650000	0.86243	CGA	.	.		0.483	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
BCO2	83875	hgsc.bcm.edu	37	11	112064703	112064703	+	Nonsense_Mutation	SNP	G	G	T	rs556041453		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:112064703G>T	ENST00000357685.5	+	4	754	c.619G>T	c.(619-621)Gaa>Taa	p.E207*	BCO2_ENST00000526088.1_Nonsense_Mutation_p.E173*|BCO2_ENST00000532593.1_Nonsense_Mutation_p.E102*|AP002884.3_ENST00000532612.1_Intron|BCO2_ENST00000393032.2_Nonsense_Mutation_p.E173*|BCO2_ENST00000531169.1_Nonsense_Mutation_p.E173*|BCO2_ENST00000438022.1_Nonsense_Mutation_p.E173*|BCO2_ENST00000361053.4_Intron			Q9BYV7	BCDO2_HUMAN	beta-carotene oxygenase 2	207					carotene catabolic process (GO:0016121)|carotene metabolic process (GO:0016119)|carotenoid metabolic process (GO:0016116)|oxidation-reduction process (GO:0055114)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			NS(1)|breast(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)	16						TGAAACTCTGGAAAAAACAGA	0.318																																					p.E207X	GBM(177;1916 2099 21049 29541 39946)	Atlas-SNP	.											.	BCO2	44	.	0			c.G619T						.						74.0	71.0	72.0					11																	112064703		2201	4297	6498	SO:0001587	stop_gained	83875	exon4			ACTCTGGAAAAAA	AJ290393	CCDS8358.2, CCDS41716.1, CCDS58181.1, CCDS58182.1, CCDS58183.1	11q23.1	2014-05-12	2008-04-15	2008-04-15	ENSG00000197580	ENSG00000197580	1.13.11.71		18503	protein-coding gene	gene with protein product	"""beta-carotene 9',10' oxygenase"", ""carotenoid-9',10'-cleaving dioxygenase"""	611740	"""beta-carotene dioxygenase 2"""	BCDO2		11278918, 15983114, 15949678	Standard	NM_031938		Approved	FLJ34464, B-DIOX-II	uc001pnf.3	Q9BYV7	OTTHUMG00000167155	ENST00000357685.5:c.619G>T	chr11.hg19:g.112064703G>T	ENSP00000350314:p.Glu207*	71.0	0.0		68.0	16.0	NM_031938	B0YIX5|B4DNC3|E9PBI8|E9PJJ1|Q8IUS0|Q96JC8|Q96JY5	Nonsense_Mutation	SNP	ENST00000357685.5	hg19	CCDS8358.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.372167|5.372167	0.95923|0.95923	.|.	.|.	ENSG00000197580|ENSG00000197580	ENST00000357685;ENST00000393032;ENST00000438022;ENST00000526088;ENST00000532593;ENST00000531169|ENST00000530677	.|.	.|.	.|.	5.07|5.07	4.15|4.15	0.48705|0.48705	.|.	0.217660|.	0.46758|.	D|.	0.000269|.	.|T	.|0.66396	.|0.2785	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71873	.|-0.4461	.|3	0.72032|.	D|.	0.01|.	-14.2432|-14.2432	15.3094|15.3094	0.74019|0.74019	0.0:0.1493:0.8507:0.0|0.0:0.1493:0.8507:0.0	.|.	.|.	.|.	.|.	X|V	207;173;173;173;102;173|105	.|.	ENSP00000350314:E207X|.	E|G	+|+	1|2	0|0	BCO2|BCO2	111569913|111569913	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.940000|0.940000	0.58332|0.58332	4.305000|4.305000	0.59110|0.59110	1.106000|1.106000	0.41623|0.41623	0.563000|0.563000	0.77884|0.77884	GAA|GGA	.	.		0.318	BCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256570.3	NM_001037290	
USP2	9099	hgsc.bcm.edu	37	11	119228275	119228275	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr11:119228275C>T	ENST00000260187.2	-	11	1821	c.1527G>A	c.(1525-1527)agG>agA	p.R509R	USP2_ENST00000455332.2_Silent_p.R266R|USP2_ENST00000525735.1_Silent_p.R300R	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	509	USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		tggttcggatcctggattctg	0.463																																					p.R509R		Atlas-SNP	.											.	USP2	71	.	0			c.G1527A						.						79.0	80.0	80.0					11																	119228275		2199	4295	6494	SO:0001819	synonymous_variant	9099	exon11			TCGGATCCTGGAT	AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.1527G>A	chr11.hg19:g.119228275C>T		115.0	0.0		132.0	50.0	NM_004205	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Silent	SNP	ENST00000260187.2	hg19	CCDS8422.1																																																																																			.	.		0.463	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388361.2	NM_171997	
NANOG	79923	hgsc.bcm.edu	37	12	7945627	7945627	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:7945627C>T	ENST00000229307.4	+	2	452	c.233C>T	c.(232-234)aCt>aTt	p.T78I	NANOG_ENST00000526286.1_Missense_Mutation_p.T78I	NM_024865.2	NP_079141.2	Q9H9S0	NANOG_HUMAN	Nanog homeobox	78					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|embryo development (GO:0009790)|embryonic pattern specification (GO:0009880)|endodermal cell fate specification (GO:0001714)|gonad development (GO:0008406)|mesodermal cell fate commitment (GO:0001710)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to retinoic acid (GO:0032526)|somatic stem cell maintenance (GO:0035019)|stem cell division (GO:0017145)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14				Kidney(36;0.0872)		AAACAACCCACTTCTGCAGAG	0.473																																					p.T78I		Atlas-SNP	.											.	NANOG	30	.	0			c.C233T						.						83.0	77.0	79.0					12																	7945627		2202	4295	6497	SO:0001583	missense	79923	exon2			AACCCACTTCTGC	AB093576	CCDS31736.1, CCDS73436.1	12p13.31	2011-06-20			ENSG00000111704	ENSG00000111704		"""Homeoboxes / ANTP class : NKL subclass"""	20857	protein-coding gene	gene with protein product		607937				12787505, 12787504	Standard	XM_005253484		Approved	FLJ12581, FLJ40451	uc009zfy.1	Q9H9S0		ENST00000229307.4:c.233C>T	chr12.hg19:g.7945627C>T	ENSP00000229307:p.Thr78Ile	194.0	0.0		134.0	62.0	NM_024865	D3DUU4|Q2TTG0|Q6JZS5	Missense_Mutation	SNP	ENST00000229307.4	hg19	CCDS31736.1	.	.	.	.	.	.	.	.	.	.	.	13.57	2.275830	0.40294	.	.	ENSG00000111704	ENST00000541267;ENST00000229307;ENST00000526286	D;D;D	0.91686	-2.88;-2.89;-2.88	4.42	-2.41	0.06562	Homeodomain-related (1);	2.536840	0.01075	N	0.004894	D	0.85566	0.5726	L	0.29908	0.895	0.09310	N	1	P	0.43885	0.82	B	0.42555	0.391	T	0.75566	-0.3273	10	0.39692	T	0.17	5.0072	0.335	0.00325	0.274:0.3064:0.1421:0.2775	.	78	Q9H9S0	NANOG_HUMAN	I	54;78;78	ENSP00000444434:T54I;ENSP00000229307:T78I;ENSP00000435288:T78I	ENSP00000229307:T78I	T	+	2	0	NANOG	7836894	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.390000	0.07332	-0.829000	0.04268	0.456000	0.33151	ACT	.	.		0.473	NANOG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387480.2	NM_024865	
OR9K2	441639	hgsc.bcm.edu	37	12	55524128	55524128	+	Silent	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:55524128T>C	ENST00000305377.5	+	1	664	c.576T>C	c.(574-576)tcT>tcC	p.S192S		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S192S(1)		NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						TTACTTTATCTTTTTGCGCTT	0.408																																					p.S192S		Atlas-SNP	.											OR9K2,NS,carcinoma,0,1	OR9K2	63	.	1	Substitution - coding silent(1)	lung(1)	c.T576C						.						153.0	141.0	145.0					12																	55524128		2203	4300	6503	SO:0001819	synonymous_variant	441639	exon1			TTTATCTTTTTGC	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.576T>C	chr12.hg19:g.55524128T>C		107.0	1.0		96.0	33.0	NM_001005243	B9EH19|Q6IFD6	Silent	SNP	ENST00000305377.5	hg19	CCDS31814.1																																																																																			.	.		0.408	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1		
TMBIM4	51643	hgsc.bcm.edu	37	12	66531753	66531753	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:66531753A>C	ENST00000358230.3	-	7	824	c.704T>G	c.(703-705)gTt>gGt	p.V235G	TMBIM4_ENST00000539652.1_3'UTR|TMBIM4_ENST00000556010.1_3'UTR|TMBIM4_ENST00000542724.1_Missense_Mutation_p.V204G|TMBIM4_ENST00000286424.7_Missense_Mutation_p.V282G|TMBIM4_ENST00000398033.4_3'UTR|TMBIM4_ENST00000544599.1_Missense_Mutation_p.V58G	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	235					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		CTTTTTATTAACTGCTTCCAG	0.333																																					p.V235G		Atlas-SNP	.											.	TMBIM4	47	.	0			c.T704G						.						94.0	89.0	90.0					12																	66531753		1844	4084	5928	SO:0001583	missense	51643	exon7			TTATTAACTGCTT	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.704T>G	chr12.hg19:g.66531753A>C	ENSP00000350965:p.Val235Gly	55.0	0.0		51.0	16.0	NM_016056	Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	hg19	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	A	11.84	1.758419	0.31137	.	.	ENSG00000155957	ENST00000358230;ENST00000544599;ENST00000286424;ENST00000539427;ENST00000542724	T;T;T	0.48522	1.42;1.4;0.81	5.87	3.53	0.40419	.	0.272984	0.33005	N	0.005381	T	0.21509	0.0518	N	0.02708	-0.52	0.80722	D	1	B;B;B	0.09022	0.002;0.001;0.001	B;B;B	0.18263	0.021;0.005;0.002	T	0.04065	-1.0980	9	.	.	.	-10.7337	10.4472	0.44501	0.8687:0.0:0.1313:0.0	.	282;204;235	G3XAA5;G3V1M2;Q9HC24	.;.;TMBI4_HUMAN	G	235;58;282;280;204	ENSP00000350965:V235G;ENSP00000286424:V282G;ENSP00000441291:V204G	.	V	-	2	0	TMBIM4	64818020	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.386000	0.59620	0.571000	0.29365	0.533000	0.62120	GTT	.	.		0.333	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85518185	85518185	+	Nonsense_Mutation	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:85518185A>T	ENST00000393217.2	+	17	3956	c.3895A>T	c.(3895-3897)Aga>Tga	p.R1299*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1299										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		ATGTCAGAAGAGAGAAGACAG	0.413																																					p.R1299X		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.A3895T						.						165.0	178.0	173.0					12																	85518185		2203	4300	6503	SO:0001587	stop_gained	84125	exon17			CAGAAGAGAGAAG	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3895A>T	chr12.hg19:g.85518185A>T	ENSP00000376910:p.Arg1299*	76.0	0.0		78.0	27.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	ENST00000393217.2	hg19	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	38	7.261921	0.98171	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.39	5.39	0.77823	.	1.220000	0.06013	N	0.649856	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5212	0.44920	0.8562:0.0:0.0:0.1438	.	.	.	.	X	1299;1274;1299	.	ENSP00000256007:R1299X	R	+	1	2	LRRIQ1	84042316	0.017000	0.18338	0.002000	0.10522	0.011000	0.07611	1.182000	0.32029	2.043000	0.60533	0.482000	0.46254	AGA	.	.		0.413	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85554390	85554390	+	Splice_Site	SNP	G	G	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:85554390G>C	ENST00000393217.2	+	24	4781		c.e24-1		LRRIQ1_ENST00000528777.3_Splice_Site	NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GTTTTGTTTAGATTCCACTGT	0.343																																					.		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.4721-1G>C						.						113.0	102.0	105.0					12																	85554390		1822	4093	5915	SO:0001630	splice_region_variant	84125	exon24			TGTTTAGATTCCA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4721-1G>C	chr12.hg19:g.85554390G>C		50.0	0.0		52.0	23.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Splice_Site	SNP	ENST00000393217.2	hg19	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	G	10.74	1.436600	0.25813	.	.	ENSG00000133640	ENST00000393217	.	.	.	4.76	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4921	0.67657	0.0:0.0:0.8517:0.1483	.	.	.	.	.	-1	.	.	.	+	.	.	LRRIQ1	84078521	1.000000	0.71417	0.995000	0.50966	0.417000	0.31264	4.755000	0.62198	1.083000	0.41159	0.650000	0.86243	.	.	.		0.343	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	Intron
HNF1A	6927	hgsc.bcm.edu	37	12	121431983	121431983	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:121431983A>G	ENST00000257555.6	+	4	956	c.730A>G	c.(730-732)Aga>Gga	p.R244G	HNF1A_ENST00000541395.1_Missense_Mutation_p.R244G|HNF1A_ENST00000544413.1_Missense_Mutation_p.R244G|HNF1A_ENST00000400024.2_Missense_Mutation_p.R244G|HNF1A_ENST00000402929.1_Missense_Mutation_p.R244G|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000543427.1_Missense_Mutation_p.R127G			P20823	HNF1A_HUMAN	HNF1 homeobox A	244			R -> G (in a hepatic adenoma sample; somatic mutation; expected to interfere with DNA binding). {ECO:0000269|PubMed:12355088}.		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R244G(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ATGCATCCAGAGAGGGGTGTC	0.602									Hepatic Adenoma, Familial Clustering of																												p.R244G		Atlas-SNP	.											HNF1A,NS,other,0,2	HNF1A	302	.	2	Substitution - Missense(2)	liver(2)	c.A730G						.						34.0	35.0	35.0					12																	121431983		2203	4300	6503	SO:0001583	missense	6927	exon4	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	ATCCAGAGAGGGG	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.730A>G	chr12.hg19:g.121431983A>G	ENSP00000257555:p.Arg244Gly	150.0	1.0		163.0	46.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	hg19	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	A	35	5.423542	0.96111	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.95622	-3.76;-3.76;-3.76;-3.76	4.84	4.84	0.62591	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97151	0.9069	M	0.70595	2.14	0.54753	D	0.999986	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.85130	0.997;0.995;0.994;0.969	D	0.97740	1.0208	10	0.87932	D	0	-35.8616	13.6279	0.62178	1.0:0.0:0.0:0.0	.	244;244;244;244	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	G	244;244;244;244;244;127;244;244;244;244;244	ENSP00000257555:R244G;ENSP00000439721:R127G;ENSP00000443112:R244G;ENSP00000438804:R244G	ENSP00000257555:R244G	R	+	1	2	HNF1A	119916366	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.421000	0.44688	1.820000	0.53075	0.335000	0.21663	AGA	.	.		0.602	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNF1A	6927	hgsc.bcm.edu	37	12	121434162	121434162	+	Silent	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:121434162G>T	ENST00000257555.6	+	5	1279	c.1053G>T	c.(1051-1053)gtG>gtT	p.V351V	HNF1A_ENST00000541395.1_Silent_p.V351V|HNF1A_ENST00000544413.1_Silent_p.V351V|HNF1A_ENST00000400024.2_Silent_p.V351V|HNF1A_ENST00000402929.1_Silent_p.V351V|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000543427.1_Silent_p.V234V			P20823	HNF1A_HUMAN	HNF1 homeobox A	351					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCCACCAAGTGTCCCCCACGG	0.582									Hepatic Adenoma, Familial Clustering of																												p.V351V		Atlas-SNP	.											.	HNF1A	302	.	0			c.G1053T	GRCh37	CD064655	HNF1A	D		.						107.0	95.0	99.0					12																	121434162		2203	4300	6503	SO:0001819	synonymous_variant	6927	exon5	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	CCAAGTGTCCCCC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1053G>T	chr12.hg19:g.121434162G>T		168.0	0.0		142.0	33.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Silent	SNP	ENST00000257555.6	hg19	CCDS9209.1																																																																																			.	.		0.582	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HNF1A	6927	hgsc.bcm.edu	37	12	121434164	121434164	+	Missense_Mutation	SNP	C	C	T	rs151344538		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:121434164C>T	ENST00000257555.6	+	5	1281	c.1055C>T	c.(1054-1056)tCc>tTc	p.S352F	HNF1A_ENST00000541395.1_Missense_Mutation_p.S352F|HNF1A_ENST00000544413.1_Missense_Mutation_p.S352F|HNF1A_ENST00000400024.2_Missense_Mutation_p.S352F|HNF1A_ENST00000402929.1_Missense_Mutation_p.S352F|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000543427.1_Missense_Mutation_p.S235F			P20823	HNF1A_HUMAN	HNF1 homeobox A	352					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CACCAAGTGTCCCCCACGGGC	0.587									Hepatic Adenoma, Familial Clustering of																												p.S352F		Atlas-SNP	.											.	HNF1A	302	.	0			c.C1055T						.						106.0	95.0	98.0					12																	121434164		2203	4300	6503	SO:0001583	missense	6927	exon5	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	AAGTGTCCCCCAC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1055C>T	chr12.hg19:g.121434164C>T	ENSP00000257555:p.Ser352Phe	167.0	0.0		141.0	29.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	hg19	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934898	0.73442	.	.	ENSG00000135100	ENST00000257555;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.98862	-5.19;-5.19;-5.19;-5.19	5.06	5.06	0.68205	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.000000	0.64402	D	0.000002	D	0.99017	0.9664	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.965	D;D;D;P	0.97110	1.0;1.0;1.0;0.734	D	0.99873	1.1099	10	0.87932	D	0	-20.899	17.4803	0.87671	0.0:1.0:0.0:0.0	.	352;352;352;352	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	F	352;352;352;352;235;352;352;352;352;352	ENSP00000257555:S352F;ENSP00000439721:S235F;ENSP00000443112:S352F;ENSP00000438804:S352F	ENSP00000257555:S352F	S	+	2	0	HNF1A	119918547	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	2.980000	0.49321	2.373000	0.80994	0.638000	0.83543	TCC	.	.		0.587	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
CPB2	1361	hgsc.bcm.edu	37	13	46638821	46638821	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:46638821G>A	ENST00000181383.4	-	8	774	c.758C>T	c.(757-759)aCa>aTa	p.T253I	CPB2_ENST00000439329.3_Missense_Mutation_p.T216I|CPB2-AS1_ENST00000415033.2_RNA|CPB2-AS1_ENST00000606351.1_RNA|CPB2-AS1_ENST00000606243.1_RNA|CPB2-AS1_ENST00000606991.1_RNA	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	253					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		ATTCAGGTCTGTTCCGATGCA	0.418																																					p.T253I		Atlas-SNP	.											.	CPB2	60	.	0			c.C758T						.						187.0	155.0	166.0					13																	46638821		2203	4300	6503	SO:0001583	missense	1361	exon8			AGGTCTGTTCCGA	M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.758C>T	chr13.hg19:g.46638821G>A	ENSP00000181383:p.Thr253Ile	160.0	0.0		145.0	50.0	NM_001872	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Missense_Mutation	SNP	ENST00000181383.4	hg19	CCDS9401.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744899	0.69418	.	.	ENSG00000080618	ENST00000181383;ENST00000439329	T;T	0.28454	1.61;2.87	5.66	5.66	0.87406	Peptidase M14, carboxypeptidase A (3);	0.156175	0.64402	D	0.000018	T	0.55386	0.1917	M	0.65498	2.005	0.47778	D	0.99951	D;D	0.71674	0.99;0.998	P;D	0.68483	0.891;0.958	T	0.55598	-0.8116	10	0.66056	D	0.02	.	18.74	0.91770	0.0:0.0:1.0:0.0	.	216;253	Q96IY4-2;Q96IY4	.;CBPB2_HUMAN	I	253;216	ENSP00000181383:T253I;ENSP00000400714:T216I	ENSP00000181383:T253I	T	-	2	0	CPB2	45536822	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	4.447000	0.60020	2.662000	0.90505	0.650000	0.86243	ACA	.	.		0.418	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044803.2	NM_001872	
KLHL1	57626	hgsc.bcm.edu	37	13	70293586	70293586	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:70293586T>C	ENST00000377844.4	-	9	2689	c.1930A>G	c.(1930-1932)Aca>Gca	p.T644A	KLHL1_ENST00000545028.1_Missense_Mutation_p.T451A	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	644					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CCGTCACATGTGGCCACTCCG	0.453																																					p.T644A		Atlas-SNP	.											.	KLHL1	164	.	0			c.A1930G						.						135.0	119.0	124.0					13																	70293586		2203	4300	6503	SO:0001583	missense	57626	exon9			CACATGTGGCCAC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1930A>G	chr13.hg19:g.70293586T>C	ENSP00000367075:p.Thr644Ala	146.0	0.0		130.0	32.0	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	ENST00000377844.4	hg19	CCDS9445.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.042209	0.55003	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.77358	-1.09;-1.09	5.68	5.68	0.88126	Galactose oxidase, beta-propeller (1);	0.095038	0.46145	N	0.000305	T	0.60741	0.2292	N	0.01649	-0.78	0.42107	D	0.991367	B;B	0.28128	0.201;0.106	B;B	0.37346	0.247;0.085	T	0.66172	-0.5990	10	0.49607	T	0.09	.	15.9251	0.79609	0.0:0.0:0.0:1.0	.	644;644	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	A	644;451	ENSP00000367075:T644A;ENSP00000439602:T451A	ENSP00000367075:T644A	T	-	1	0	KLHL1	69191587	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	6.289000	0.72696	2.156000	0.67533	0.459000	0.35465	ACA	.	.		0.453	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
LMO7	4008	hgsc.bcm.edu	37	13	76429476	76429476	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:76429476G>A	ENST00000321797.8	+	27	4764	c.4043G>A	c.(4042-4044)gGt>gAt	p.G1348D	LMO7_ENST00000341547.4_Missense_Mutation_p.G1299D|LMO7_ENST00000357063.3_Intron|LMO7_ENST00000377534.3_Intron|LMO7_ENST00000526202.1_Missense_Mutation_p.G1225D|LMO7_ENST00000465261.2_Intron			Q8WWI1	LMO7_HUMAN	LIM domain 7	1633					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GAGTCCCTGGGTCTTTGTTAT	0.493																																					p.G1299D		Atlas-SNP	.											.	LMO7	334	.	0			c.G3896A						.						146.0	121.0	129.0					13																	76429476		2203	4300	6503	SO:0001583	missense	4008	exon28			CCCTGGGTCTTTG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.4043G>A	chr13.hg19:g.76429476G>A	ENSP00000317802:p.Gly1348Asp	176.0	0.0		166.0	49.0	NM_005358	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	hg19		.	.	.	.	.	.	.	.	.	.	G	32	5.117643	0.94385	.	.	ENSG00000136153	ENST00000341547;ENST00000321797;ENST00000526202	D;D;D	0.87256	-2.23;-2.23;-2.23	5.99	5.99	0.97316	.	0.159223	0.56097	D	0.000033	D	0.92811	0.7714	L	0.56396	1.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92382	0.5914	10	0.66056	D	0.02	-23.5131	20.4777	0.99188	0.0:0.0:1.0:0.0	.	1225;1299	E9PMS6;Q8WWI1-3	.;.	D	1299;1348;1225	ENSP00000342112:G1299D;ENSP00000317802:G1348D;ENSP00000431129:G1225D	ENSP00000317802:G1348D	G	+	2	0	LMO7	75327477	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GGT	.	.		0.493	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
FBXL3	26224	hgsc.bcm.edu	37	13	77589641	77589641	+	Silent	SNP	A	A	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:77589641A>T	ENST00000355619.5	-	4	870	c.546T>A	c.(544-546)acT>acA	p.T182T	FBXL3_ENST00000477982.1_5'UTR	NM_012158.2	NP_036290.1	Q9UKT7	FBXL3_HUMAN	F-box and leucine-rich repeat protein 3	182					entrainment of circadian clock by photoperiod (GO:0043153)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|urinary_tract(1)	16		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.218)		GBM - Glioblastoma multiforme(99;0.0521)		CATCTACTGGAGTATCATCTA	0.393																																					p.T182T		Atlas-SNP	.											.	FBXL3	46	.	0			c.T546A						.						135.0	121.0	125.0					13																	77589641		2203	4300	6503	SO:0001819	synonymous_variant	26224	exon4			TACTGGAGTATCA	AF129532	CCDS9457.1	13q22	2011-06-09	2004-07-20	2004-07-21	ENSG00000005812	ENSG00000005812		"""F-boxes / Leucine-rich repeats"""	13599	protein-coding gene	gene with protein product		605653	"""F-box and leucine-rich repeat protein 3A"""	FBXL3A		10531035, 10828603	Standard	NM_012158		Approved	FBL3, FBL3A	uc001vkd.3	Q9UKT7	OTTHUMG00000017099	ENST00000355619.5:c.546T>A	chr13.hg19:g.77589641A>T		147.0	0.0		109.0	38.0	NM_012158	B2RB04|Q9P122	Silent	SNP	ENST00000355619.5	hg19	CCDS9457.1																																																																																			.	.		0.393	FBXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045312.3		
IRS2	8660	hgsc.bcm.edu	37	13	110437992	110437992	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr13:110437992G>A	ENST00000375856.3	-	1	923	c.409C>T	c.(409-411)Cgc>Tgc	p.R137C		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	137	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GTGAGCGCGCGGTACCAGCCC	0.756																																					p.R137C	Melanoma(100;613 2409 40847)	Atlas-SNP	.											.	IRS2	44	.	0			c.C409T						.						16.0	13.0	14.0					13																	110437992		2186	4284	6470	SO:0001583	missense	8660	exon1			GCGCGCGGTACCA	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.409C>T	chr13.hg19:g.110437992G>A	ENSP00000365016:p.Arg137Cys	30.0	0.0		39.0	12.0	NM_003749	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	hg19	CCDS9510.1	.	.	.	.	.	.	.	.	.	.	g	20.7	4.031136	0.75504	.	.	ENSG00000185950	ENST00000375856	T	0.76316	-1.01	3.39	3.39	0.38822	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.083411	0.49916	U	0.000137	D	0.86289	0.5897	M	0.73598	2.24	0.45366	D	0.998351	D	0.89917	1.0	D	0.74674	0.984	D	0.88089	0.2812	10	0.66056	D	0.02	-11.841	13.7503	0.62904	0.0:0.0:1.0:0.0	.	137	Q9Y4H2	IRS2_HUMAN	C	137	ENSP00000365016:R137C	ENSP00000365016:R137C	R	-	1	0	IRS2	109235993	0.991000	0.36638	1.000000	0.80357	0.992000	0.81027	1.617000	0.36943	1.747000	0.51819	0.487000	0.48397	CGC	.	.		0.756	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
NDN	4692	hgsc.bcm.edu	37	15	23931535	23931535	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr15:23931535T>C	ENST00000331837.4	-	1	915	c.830A>G	c.(829-831)gAg>gGg	p.E277G		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	277	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GGCCAGGAACTCCATGATTTG	0.592									Prader-Willi syndrome																												p.E277G		Atlas-SNP	.											.	NDN	79	.	0			c.A830G						.						30.0	33.0	32.0					15																	23931535		2202	4300	6502	SO:0001583	missense	4692	exon1	Familial Cancer Database	Prader-Labhart-Willi syndrome	AGGAACTCCATGA	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.830A>G	chr15.hg19:g.23931535T>C	ENSP00000332643:p.Glu277Gly	69.0	0.0		52.0	12.0	NM_002487	B2R6Z5	Missense_Mutation	SNP	ENST00000331837.4	hg19	CCDS10014.1	.	.	.	.	.	.	.	.	.	.	T	14.06	2.422619	0.43020	.	.	ENSG00000182636	ENST00000331837	T	0.03065	4.06	3.5	3.5	0.40072	.	0.285984	0.32190	N	0.006443	T	0.05456	0.0144	M	0.64567	1.98	0.43494	D	0.995736	B	0.16396	0.017	B	0.14578	0.011	T	0.14035	-1.0487	10	0.87932	D	0	.	8.7038	0.34343	0.0:0.0:0.0:1.0	.	277	Q99608	NECD_HUMAN	G	277	ENSP00000332643:E277G	ENSP00000332643:E277G	E	-	2	0	NDN	21482628	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.254000	0.32897	1.832000	0.53329	0.459000	0.35465	GAG	.	.		0.592	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251226.2	NM_002487	
UNC13C	440279	hgsc.bcm.edu	37	15	54590037	54590037	+	Silent	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr15:54590037T>A	ENST00000260323.11	+	11	4017	c.4017T>A	c.(4015-4017)tcT>tcA	p.S1339S	UNC13C_ENST00000545554.1_Silent_p.S1339S|UNC13C_ENST00000537900.1_Silent_p.S1337S	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1339					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CAGCTGTATCTGGGGCCATAC	0.363																																					p.S1339S		Atlas-SNP	.											.	UNC13C	674	.	0			c.T4017A						.						64.0	63.0	63.0					15																	54590037		1856	4088	5944	SO:0001819	synonymous_variant	440279	exon10			TGTATCTGGGGCC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4017T>A	chr15.hg19:g.54590037T>A		291.0	0.0		276.0	81.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	hg19	CCDS45264.1																																																																																			.	.		0.363	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
GTF3C1	2975	hgsc.bcm.edu	37	16	27549250	27549250	+	Splice_Site	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:27549250T>A	ENST00000356183.4	-	4	624		c.e4-2		GTF3C1_ENST00000561623.1_Splice_Site	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa						5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCATCAACCCTGGAGGAAAAG	0.448																																					.		Atlas-SNP	.											.	GTF3C1	210	.	0			c.609-2A>T						.						64.0	63.0	63.0					16																	27549250		2197	4300	6497	SO:0001630	splice_region_variant	2975	exon5			CAACCCTGGAGGA	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.609-2A>T	chr16.hg19:g.27549250T>A		71.0	0.0		79.0	26.0	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Splice_Site	SNP	ENST00000356183.4	hg19	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	T	17.55	3.416940	0.62511	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6229	0.76820	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTF3C1	27456751	1.000000	0.71417	0.975000	0.42487	0.517000	0.34286	7.421000	0.80204	2.164000	0.68074	0.460000	0.39030	.	.	.		0.448	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	Intron
VPS35	55737	hgsc.bcm.edu	37	16	46716005	46716005	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:46716005C>G	ENST00000299138.7	-	3	243	c.185G>C	c.(184-186)aGt>aCt	p.S62T		NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	62					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TTCATAGTAACTCTTTGGTGA	0.333																																					p.S62T		Atlas-SNP	.											.	VPS35	49	.	0			c.G185C						.						102.0	95.0	97.0					16																	46716005		2203	4299	6502	SO:0001583	missense	55737	exon3			TAGTAACTCTTTG	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.185G>C	chr16.hg19:g.46716005C>G	ENSP00000299138:p.Ser62Thr	214.0	0.0		156.0	10.0	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Missense_Mutation	SNP	ENST00000299138.7	hg19	CCDS10721.1	.	.	.	.	.	.	.	.	.	.	.	13.61	2.288658	0.40494	.	.	ENSG00000069329	ENST00000299138	T	0.42900	0.96	4.88	4.88	0.63580	.	0.084158	0.85682	D	0.000000	T	0.41096	0.1144	L	0.43152	1.355	0.80722	D	1	P	0.35383	0.498	B	0.40506	0.331	T	0.15122	-1.0448	10	0.14252	T	0.57	-5.5078	18.4459	0.90683	0.0:1.0:0.0:0.0	.	62	Q96QK1	VPS35_HUMAN	T	62	ENSP00000299138:S62T	ENSP00000299138:S62T	S	-	2	0	VPS35	45273506	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.405000	0.81733	0.551000	0.68910	AGT	.	.		0.333	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
DVL2	1856	hgsc.bcm.edu	37	17	7131298	7131298	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:7131298C>A	ENST00000005340.5	-	10	1382	c.1100G>T	c.(1099-1101)cGa>cTa	p.R367L	DVL2_ENST00000575458.1_Missense_Mutation_p.R361L|DVL2_ENST00000574642.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	367					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						TCACTCACTTCGGGGGAGAGT	0.642																																					p.R367L		Atlas-SNP	.											.	DVL2	49	.	0			c.G1100T						.						37.0	38.0	37.0					17																	7131298		2203	4300	6503	SO:0001583	missense	1856	exon10			TCACTTCGGGGGA	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1100G>T	chr17.hg19:g.7131298C>A	ENSP00000005340:p.Arg367Leu	187.0	0.0		97.0	51.0	NM_004422	D3DTN3|Q53XM0	Missense_Mutation	SNP	ENST00000005340.5	hg19	CCDS11091.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.719943	0.89205	.	.	ENSG00000004975	ENST00000005340	T	0.06371	3.31	4.89	4.89	0.63831	PDZ/DHR/GLGF (1);	0.065725	0.64402	D	0.000007	T	0.30448	0.0765	M	0.91459	3.21	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.71870	0.975;0.975	T	0.12760	-1.0535	10	0.59425	D	0.04	-17.7923	13.4054	0.60911	0.0:1.0:0.0:0.0	.	361;367	B4DLQ0;O14641	.;DVL2_HUMAN	L	367	ENSP00000005340:R367L	ENSP00000005340:R367L	R	-	2	0	DVL2	7072022	1.000000	0.71417	0.995000	0.50966	0.679000	0.39708	7.651000	0.83577	2.552000	0.86080	0.655000	0.94253	CGA	.	.		0.642	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
SHISA6	388336	hgsc.bcm.edu	37	17	11166833	11166833	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:11166833G>A	ENST00000409168.3	+	2	789	c.789G>A	c.(787-789)aaG>aaA	p.K263K	SHISA6_ENST00000441885.3_Silent_p.K263K|SHISA6_ENST00000432116.3_Silent_p.K263K	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	263						alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						GTACGGCCAAGCAGACTCCAG	0.522																																					p.K263K		Atlas-SNP	.											.	SHISA6	44	.	0			c.G789A						.						148.0	123.0	131.0					17																	11166833		692	1591	2283	SO:0001819	synonymous_variant	388336	exon2			GGCCAAGCAGACT	AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.789G>A	chr17.hg19:g.11166833G>A		228.0	0.0		116.0	58.0	NM_207386	B3KXV5|Q4PL63	Silent	SNP	ENST00000409168.3	hg19	CCDS54090.1																																																																																			.	.		0.522	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000333970.2	NM_207386	
KIAA0100	9703	hgsc.bcm.edu	37	17	26948494	26948494	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:26948494C>A	ENST00000528896.2	-	27	5056	c.4982G>T	c.(4981-4983)cGg>cTg	p.R1661L	KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1518L|KIAA0100_ENST00000579924.2_5'Flank|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1518L	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1661						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					ACTACGCTGCCGGTGCTCCTC	0.562																																					p.R1661L		Atlas-SNP	.											.	KIAA0100	175	.	0			c.G4982T						.						86.0	79.0	81.0					17																	26948494		2203	4300	6503	SO:0001583	missense	9703	exon27			CGCTGCCGGTGCT	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.4982G>T	chr17.hg19:g.26948494C>A	ENSP00000436773:p.Arg1661Leu	83.0	0.0		69.0	21.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.719966	0.48728	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.23552	1.9;1.9	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.31358	0.0794	N	0.08118	0	0.80722	D	1	D	0.63880	0.993	D	0.74023	0.982	T	0.21724	-1.0237	10	0.26408	T	0.33	.	18.2554	0.90017	0.0:1.0:0.0:0.0	.	1661	Q14667	K0100_HUMAN	L	1661;1631;1661;1518	ENSP00000436773:R1661L;ENSP00000446443:R1518L	ENSP00000005905:R1661L	R	-	2	0	KIAA0100	23972621	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.277000	0.78572	2.826000	0.97356	0.491000	0.48974	CGG	.	.		0.562	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
ABCA6	23460	hgsc.bcm.edu	37	17	67080447	67080447	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:67080447T>C	ENST00000284425.2	-	34	4484	c.4310A>G	c.(4309-4311)gAt>gGt	p.D1437G	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1437	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					AGATGGTTCATCCAGGAGCAA	0.517																																					p.D1437G		Atlas-SNP	.											.	ABCA6	210	.	0			c.A4310G						.						121.0	113.0	116.0					17																	67080447		2203	4300	6503	SO:0001583	missense	23460	exon34			GGTTCATCCAGGA	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4310A>G	chr17.hg19:g.67080447T>C	ENSP00000284425:p.Asp1437Gly	109.0	0.0		114.0	29.0	NM_080284	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	hg19	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.075929	0.76415	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.99695	-6.43	5.18	5.18	0.71444	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.52532	D	0.000074	D	0.99862	0.9935	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96409	0.9303	10	0.87932	D	0	.	14.3635	0.66789	0.0:0.0:0.0:1.0	.	1437	Q8N139	ABCA6_HUMAN	G	1437;297	ENSP00000284425:D1437G	ENSP00000284425:D1437G	D	-	2	0	ABCA6	64592042	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	7.229000	0.78088	2.171000	0.68590	0.533000	0.62120	GAT	.	.		0.517	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
SLC26A11	284129	hgsc.bcm.edu	37	17	78220002	78220002	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr17:78220002G>A	ENST00000361193.3	+	12	1427	c.1147G>A	c.(1147-1149)Gtg>Atg	p.V383M	SLC26A11_ENST00000546047.2_Missense_Mutation_p.V383M|SLC26A11_ENST00000411502.3_Missense_Mutation_p.V383M|SLC26A11_ENST00000572725.1_Missense_Mutation_p.V383M	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11											central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGGGGGCCTGGTGACGGGTAA	0.672																																					p.V383M		Atlas-SNP	.											.	SLC26A11	60	.	0			c.G1147A						.						42.0	51.0	48.0					17																	78220002		2201	4293	6494	SO:0001583	missense	284129	exon12			GGCCTGGTGACGG		CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.1147G>A	chr17.hg19:g.78220002G>A	ENSP00000355384:p.Val383Met	53.0	0.0		69.0	20.0	NM_173626		Missense_Mutation	SNP	ENST00000361193.3	hg19	CCDS11771.2	.	.	.	.	.	.	.	.	.	.	G	9.672	1.147078	0.21288	.	.	ENSG00000181045	ENST00000411502;ENST00000546047;ENST00000361193	D;D;D	0.94184	-3.37;-3.37;-3.37	4.12	3.12	0.35913	Sulphate transporter (1);	0.230563	0.45126	N	0.000389	D	0.92341	0.7570	M	0.77820	2.39	0.43852	D	0.996449	B	0.33448	0.412	B	0.39503	0.301	D	0.89902	0.4045	10	0.48119	T	0.1	-29.6563	7.1222	0.25450	0.1045:0.1875:0.7079:0.0	.	383	Q86WA9	S2611_HUMAN	M	383	ENSP00000403998:V383M;ENSP00000440724:V383M;ENSP00000355384:V383M	ENSP00000355384:V383M	V	+	1	0	SLC26A11	75834597	1.000000	0.71417	1.000000	0.80357	0.228000	0.25075	0.773000	0.26661	1.022000	0.39626	0.491000	0.48974	GTG	.	.		0.672	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1		
NDUFV2	4729	hgsc.bcm.edu	37	18	9102767	9102767	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr18:9102767C>T	ENST00000318388.6	+	1	140	c.26C>T	c.(25-27)gCc>gTc	p.A9V	RP11-21J18.1_ENST00000579126.1_RNA|NDUFV2_ENST00000400033.1_5'Flank|NDUFV2_ENST00000497577.2_Missense_Mutation_p.A9V	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	9					cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|lung(4)|ovary(1)|stomach(1)	7						GCGCTCCGGGCCCGGGCGGCT	0.706																																					p.A9V		Atlas-SNP	.											.	NDUFV2	17	.	0			c.C26T						.						6.0	8.0	7.0					18																	9102767		2125	4156	6281	SO:0001583	missense	4729	exon1			TCCGGGCCCGGGC	X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.26C>T	chr18.hg19:g.9102767C>T	ENSP00000327268:p.Ala9Val	20.0	0.0		33.0	16.0	NM_021074	Q9BV41	Missense_Mutation	SNP	ENST00000318388.6	hg19	CCDS11842.1	.	.	.	.	.	.	.	.	.	.	C	7.170	0.587450	0.13812	.	.	ENSG00000178127	ENST00000318388	T	0.46819	0.86	4.7	2.89	0.33648	.	.	.	.	.	T	0.30070	0.0753	N	0.22421	0.69	0.26272	N	0.978407	B	0.14438	0.01	B	0.09377	0.004	T	0.17745	-1.0359	9	0.33940	T	0.23	.	5.7902	0.18357	0.1899:0.7112:0.0:0.0988	.	9	P19404	NDUV2_HUMAN	V	9	ENSP00000327268:A9V	ENSP00000327268:A9V	A	+	2	0	NDUFV2	9092767	0.833000	0.29383	0.066000	0.19879	0.005000	0.04900	1.158000	0.31737	0.565000	0.29255	-0.150000	0.13652	GCC	.	.		0.706	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254475.2	NM_021074	
FZR1	51343	hgsc.bcm.edu	37	19	3522996	3522996	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:3522996G>A	ENST00000395095.3	+	1	9	c.9G>A	c.(7-9)caG>caA	p.Q3Q	FZR1_ENST00000313639.8_Silent_p.Q3Q|SNORD38_ENST00000516599.1_RNA|FZR1_ENST00000441788.2_Silent_p.Q3Q	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	3					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		CCATGGACCAGGACTATGAGC	0.692																																					p.Q3Q		Atlas-SNP	.											.	FZR1	42	.	0			c.G9A						.						70.0	72.0	72.0					19																	3522996		2203	4297	6500	SO:0001819	synonymous_variant	51343	exon1			GGACCAGGACTAT	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.9G>A	chr19.hg19:g.3522996G>A		164.0	0.0		202.0	66.0	NM_001136197	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Silent	SNP	ENST00000395095.3	hg19	CCDS45916.1																																																																																			.	.		0.692	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
ZNF558	148156	hgsc.bcm.edu	37	19	8932718	8932718	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:8932718G>A	ENST00000601372.1	-	6	792	c.81C>T	c.(79-81)ggC>ggT	p.G27G	ZNF558_ENST00000444186.2_5'Flank|ZNF558_ENST00000301475.1_Silent_p.G27G|CTD-2529P6.3_ENST00000594006.1_RNA|ZNF558_ENST00000599938.1_5'Flank			Q96NG5	ZN558_HUMAN	zinc finger protein 558	27					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	15						CCAGCTCTCCGCCCTGTGTGT	0.512																																					p.G27G		Atlas-SNP	.											ZNF558,NS,carcinoma,0,2	ZNF558	43	.	0			c.C81T						.						196.0	174.0	182.0					19																	8932718		2203	4300	6503	SO:0001819	synonymous_variant	148156	exon2			CTCTCCGCCCTGT	AK055494	CCDS12208.1	19p13.2	2013-09-20			ENSG00000167785	ENSG00000167785		"""Zinc fingers, C2H2-type"", ""-"""	26422	protein-coding gene	gene with protein product							Standard	NM_144693		Approved	FLJ30932	uc002mkn.1	Q96NG5	OTTHUMG00000182196	ENST00000601372.1:c.81C>T	chr19.hg19:g.8932718G>A		217.0	1.0		191.0	77.0	NM_144693	A8K5F0|B7Z798	Silent	SNP	ENST00000601372.1	hg19	CCDS12208.1																																																																																			.	.		0.512	ZNF558-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459955.2	NM_144693	
SCN1B	6324	hgsc.bcm.edu	37	19	35523452	35523452	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:35523452T>A	ENST00000262631.5	+	2	198	c.61T>A	c.(61-63)Tgc>Agc	p.C21S	SCN1B_ENST00000415950.3_Missense_Mutation_p.C21S|SCN1B_ENST00000596348.1_3'UTR|SCN1B_ENST00000595652.1_Missense_Mutation_p.C21S	NM_001037.4	NP_001028.1	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta subunit	21					axon guidance (GO:0007411)|cardiac conduction (GO:0061337)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|corticospinal neuron axon guidance (GO:0021966)|locomotion (GO:0040011)|membrane depolarization (GO:0051899)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during Purkinje myocyte cell action potential (GO:0086047)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|intercalated disc (GO:0014704)|node of Ranvier (GO:0033268)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)|voltage-gated sodium channel activity involved in Purkinje myocyte action potential (GO:0086062)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	11	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGCGGGGGCTGCGTGGAGGT	0.597																																					p.C21S		Atlas-SNP	.											.	SCN1B	32	.	0			c.T61A						.						90.0	90.0	90.0					19																	35523452		2203	4300	6503	SO:0001583	missense	6324	exon2			GGGGGCTGCGTGG		CCDS12441.1, CCDS46047.1	19q13.12	2014-09-17	2012-02-28		ENSG00000105711	ENSG00000105711		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10586	protein-coding gene	gene with protein product		600235	"""sodium channel, voltage-gated, type I, beta polypeptide"", ""sodium channel, voltage-gated, type I, beta"""			8394762	Standard	NM_001037		Approved		uc002nxo.2	Q07699	OTTHUMG00000182472	ENST00000262631.5:c.61T>A	chr19.hg19:g.35523452T>A	ENSP00000262631:p.Cys21Ser	87.0	0.0		80.0	19.0	NM_001037	Q5TZZ4|Q6TN97	Missense_Mutation	SNP	ENST00000262631.5	hg19	CCDS12441.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.756207	0.49362	.	.	ENSG00000105711	ENST00000262631;ENST00000415950	D;D	0.98044	-4.68;-2.33	3.72	3.72	0.42706	.	0.000000	0.85682	D	0.000000	D	0.97676	0.9238	L	0.59436	1.845	0.58432	D	0.999997	D;D;D	0.76494	0.981;0.981;0.999	D;D;D	0.83275	0.95;0.95;0.996	D	0.96414	0.9306	10	0.33940	T	0.23	-27.6615	8.7296	0.34491	0.0:0.0:0.0:1.0	.	21;21;21	B4DI92;Q07699;Q07699-2	.;SCN1B_HUMAN;.	S	21	ENSP00000262631:C21S;ENSP00000396915:C21S	ENSP00000262631:C21S	C	+	1	0	SCN1B	40215292	1.000000	0.71417	0.996000	0.52242	0.556000	0.35491	6.970000	0.76099	1.557000	0.49525	0.460000	0.39030	TGC	.	.		0.597	SCN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461567.1		
PLA2G4C	8605	hgsc.bcm.edu	37	19	48565344	48565344	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:48565344T>C	ENST00000599921.1	-	14	1525	c.1168A>G	c.(1168-1170)Atc>Gtc	p.I390V	PLA2G4C_ENST00000413144.2_Missense_Mutation_p.I390V|CTD-2265M8.2_ENST00000596552.1_RNA|CTD-2265M8.2_ENST00000601548.1_RNA|PLA2G4C_ENST00000354276.3_Missense_Mutation_p.I390V|CTD-2265M8.2_ENST00000601950.1_RNA|PLA2G4C_ENST00000596510.1_5'UTR|PLA2G4C_ENST00000599111.1_Missense_Mutation_p.I400V			Q9UP65	PA24C_HUMAN	phospholipase A2, group IVC (cytosolic, calcium-independent)	390	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|parturition (GO:0007567)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(12)|lung(13)|ovary(2)|prostate(1)|skin(3)	38		all_cancers(25;2.84e-05)|all_lung(116;4.62e-05)|Lung NSC(112;7.61e-05)|all_epithelial(76;0.000192)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;8.09e-05)|all cancers(93;0.000517)|Epithelial(262;0.0135)|GBM - Glioblastoma multiforme(486;0.0717)		GGAGTGTTGATGGCTAAACCA	0.572																																					p.I400V		Atlas-SNP	.											.	PLA2G4C	76	.	0			c.A1198G						.						88.0	69.0	76.0					19																	48565344		2203	4300	6503	SO:0001583	missense	8605	exon14			TGTTGATGGCTAA	AF065214	CCDS12710.1, CCDS54286.1, CCDS59403.1	19q13.3	2008-09-19					3.1.1.4		9037	protein-coding gene	gene with protein product		603602				9705332	Standard	NM_003706		Approved	cPLA2-gamma	uc002phx.3	Q9UP65		ENST00000599921.1:c.1168A>G	chr19.hg19:g.48565344T>C	ENSP00000469473:p.Ile390Val	162.0	0.0		147.0	43.0	NM_001159322	B2RB71|B4DI40|O75457|Q6IBI8|Q9UG68	Missense_Mutation	SNP	ENST00000599921.1	hg19	CCDS12710.1	.	.	.	.	.	.	.	.	.	.	T	13.54	2.268688	0.40095	.	.	ENSG00000105499	ENST00000354276;ENST00000413144	T;T	0.17370	2.28;2.28	2.79	2.79	0.32731	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.372534	0.21783	U	0.069161	T	0.13500	0.0327	L	0.44542	1.39	0.22457	N	0.999084	B;B	0.27117	0.104;0.168	B;B	0.26969	0.059;0.075	T	0.15983	-1.0418	10	0.39692	T	0.17	-8.6609	7.4822	0.27411	0.0:0.0:0.0:1.0	.	400;390	B4DI40;Q9UP65	.;PA24C_HUMAN	V	390	ENSP00000346228:I390V;ENSP00000400036:I390V	ENSP00000346228:I390V	I	-	1	0	PLA2G4C	53257156	1.000000	0.71417	0.999000	0.59377	0.281000	0.26958	3.354000	0.52254	1.045000	0.40225	0.333000	0.21579	ATC	.	.		0.572	PLA2G4C-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465551.1		
SHANK1	50944	hgsc.bcm.edu	37	19	51171701	51171701	+	Silent	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:51171701G>A	ENST00000293441.1	-	22	3534	c.3516C>T	c.(3514-3516)agC>agT	p.S1172S	SHANK1_ENST00000359082.3_Silent_p.S1163S|SYT3_ENST00000544769.1_5'Flank|SHANK1_ENST00000391813.1_Silent_p.S559S|SHANK1_ENST00000391814.1_Silent_p.S1180S	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1172					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		TGCTGCCCTGGCTGCTGCGGC	0.761																																					p.S1172S		Atlas-SNP	.											.	SHANK1	210	.	0			c.C3516T						.						18.0	19.0	19.0					19																	51171701		1537	3337	4874	SO:0001819	synonymous_variant	50944	exon22			GCCCTGGCTGCTG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.3516C>T	chr19.hg19:g.51171701G>A		18.0	0.0		15.0	6.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	ENST00000293441.1	hg19	CCDS12799.1																																																																																			.	.		0.761	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
ZNF480	147657	hgsc.bcm.edu	37	19	52817496	52817496	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr19:52817496G>T	ENST00000595962.1	+	3	229	c.163G>T	c.(163-165)Gtg>Ttg	p.V55L	CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000490272.1_Intron|ZNF480_ENST00000334564.7_Missense_Mutation_p.V55L|ZNF480_ENST00000335090.6_Intron	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	55	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		ATACAAGGATGTGATGTTGGA	0.507																																					p.V55L		Atlas-SNP	.											.	ZNF480	123	.	0			c.G163T						.						138.0	123.0	128.0					19																	52817496		2203	4300	6503	SO:0001583	missense	147657	exon3			AAGGATGTGATGT	AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.163G>T	chr19.hg19:g.52817496G>T	ENSP00000471754:p.Val55Leu	63.0	0.0		67.0	18.0	NM_144684	Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	ENST00000595962.1	hg19	CCDS12850.2	.	.	.	.	.	.	.	.	.	.	G	9.983	1.228670	0.22542	.	.	ENSG00000198464	ENST00000354515;ENST00000468240;ENST00000334564	T;T	0.03801	3.8;3.8	2.04	0.919	0.19392	Krueppel-associated box (4);	.	.	.	.	T	0.29914	0.0748	H	0.97940	4.11	0.20489	N	0.999899	P;D	0.63046	0.842;0.992	B;D	0.77004	0.201;0.989	T	0.07654	-1.0761	9	0.87932	D	0	.	6.3975	0.21620	0.1717:0.0:0.8283:0.0	.	55;55	F8WEZ9;Q8WV37	.;ZN480_HUMAN	L	77;55;55	ENSP00000417424:V55L;ENSP00000334164:V55L	ENSP00000334164:V55L	V	+	1	0	ZNF480	57509308	0.983000	0.35010	0.253000	0.24343	0.046000	0.14306	2.017000	0.40981	0.178000	0.19917	0.508000	0.49915	GTG	.	.		0.507	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349001.3	NM_144684	
BPIFA3	128861	hgsc.bcm.edu	37	20	31814775	31814775	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr20:31814775G>A	ENST00000375454.3	+	6	871	c.661G>A	c.(661-663)Gtg>Atg	p.V221M	BPIFA3_ENST00000490499.1_3'UTR|BPIFA3_ENST00000375452.3_Missense_Mutation_p.V185M	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3	221						extracellular region (GO:0005576)	lipid binding (GO:0008289)										GCAGCTGGATGTGAAACTGTT	0.537																																					p.V221M		Atlas-SNP	.											.	.	.	.	0			c.G661A						.						139.0	132.0	135.0					20																	31814775		2203	4300	6503	SO:0001583	missense	128861	exon6			CTGGATGTGAAAC		CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.661G>A	chr20.hg19:g.31814775G>A	ENSP00000364603:p.Val221Met	134.0	0.0		105.0	18.0	NM_178466	Q5JWG8|Q6NZ38	Missense_Mutation	SNP	ENST00000375454.3	hg19	CCDS13216.2	.	.	.	.	.	.	.	.	.	.	G	17.52	3.409226	0.62399	.	.	ENSG00000131059	ENST00000375454;ENST00000375452	T;T	0.04654	3.58;3.58	4.02	4.02	0.46733	.	0.000000	0.41194	D	0.000931	T	0.11537	0.0281	L	0.29908	0.895	0.31907	N	0.615221	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.995	T	0.00870	-1.1533	10	0.72032	D	0.01	-21.3752	11.9596	0.53001	0.0:0.0:1.0:0.0	.	185;221	Q9BQP9-2;Q9BQP9	.;BPIA3_HUMAN	M	221;185	ENSP00000364603:V221M;ENSP00000364601:V185M	ENSP00000364601:V185M	V	+	1	0	BPIFA3	31278436	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.665000	0.54532	2.538000	0.85594	0.462000	0.41574	GTG	.	.		0.537	BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466	
EPB41L1	2036	hgsc.bcm.edu	37	20	34773213	34773213	+	Silent	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr20:34773213C>T	ENST00000338074.2	+	7	902	c.741C>T	c.(739-741)acC>acT	p.T247T	EPB41L1_ENST00000441639.1_Silent_p.T185T|EPB41L1_ENST00000373950.2_Silent_p.T150T|EPB41L1_ENST00000202028.5_Silent_p.T185T|EPB41L1_ENST00000373946.3_Silent_p.T216T|EPB41L1_ENST00000373941.1_Silent_p.T247T	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	247	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CTAACCAGACCCGGGAGCTGG	0.592																																					p.T247T		Atlas-SNP	.											.	EPB41L1	111	.	0			c.C741T						.						48.0	46.0	47.0					20																	34773213		2203	4300	6503	SO:0001819	synonymous_variant	2036	exon8			CCAGACCCGGGAG	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.741C>T	chr20.hg19:g.34773213C>T		93.0	0.0		86.0	13.0	NM_001258329	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	hg19	CCDS13271.1																																																																																			.	.		0.592	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
ZSWIM1	90204	hgsc.bcm.edu	37	20	44511883	44511883	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr20:44511883A>C	ENST00000372523.1	+	2	747	c.652A>C	c.(652-654)Agc>Cgc	p.S218R	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.S218R	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	218						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				TACACTCCTGAGCAACTGCAT	0.597																																					p.S218R		Atlas-SNP	.											.	ZSWIM1	35	.	0			c.A652C						.						50.0	48.0	49.0					20																	44511883		2203	4300	6503	SO:0001583	missense	90204	exon2			CTCCTGAGCAACT	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.652A>C	chr20.hg19:g.44511883A>C	ENSP00000361601:p.Ser218Arg	80.0	0.0		74.0	20.0	NM_080603	Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	ENST00000372523.1	hg19	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	A	1.243	-0.620919	0.03636	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.24151	1.87;1.87	5.37	4.28	0.50868	.	0.328871	0.25439	U	0.030673	T	0.15089	0.0364	L	0.27053	0.805	0.26265	N	0.978518	B	0.26876	0.162	B	0.24006	0.05	T	0.24012	-1.0172	10	0.09084	T	0.74	-11.2214	9.9652	0.41721	0.924:0.0:0.076:0.0	.	218	Q9BR11	ZSWM1_HUMAN	R	218	ENSP00000361601:S218R;ENSP00000361598:S218R	ENSP00000361598:S218R	S	+	1	0	ZSWIM1	43945290	1.000000	0.71417	0.992000	0.48379	0.122000	0.20287	2.852000	0.48310	1.060000	0.40578	0.528000	0.53228	AGC	.	.		0.597	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603	
RFPL2	10739	hgsc.bcm.edu	37	22	32589248	32589248	+	Intron	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr22:32589248G>A	ENST00000400237.1	-	4	1201				RFPL2_ENST00000489846.1_5'UTR|RFPL2_ENST00000248980.4_Missense_Mutation_p.S5L|RFPL2_ENST00000400236.3_Intron|RFPL2_ENST00000248983.4_Intron			O75678	RFPL2_HUMAN	ret finger protein-like 2								zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						TGTGACAAGTGACAACCTTTT	0.468																																					p.S5L		Atlas-SNP	.											.	RFPL2	81	.	0			c.C14T						.						53.0	60.0	58.0					22																	32589248		1323	2305	3628	SO:0001627	intron_variant	10739	exon1			ACAAGTGACAACC	AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.266-69C>T	chr22.hg19:g.32589248G>A		217.0	0.0		211.0	106.0	NM_006605		Missense_Mutation	SNP	ENST00000400237.1	hg19	CCDS43009.2	.	.	.	.	.	.	.	.	.	.	G	3.137	-0.177170	0.06380	.	.	ENSG00000128253	ENST00000248980	T	0.54071	0.59	0.628	-1.26	0.09376	.	.	.	.	.	T	0.30070	0.0753	N	0.22421	0.69	0.09310	N	1	B	0.19817	0.039	B	0.18263	0.021	T	0.15896	-1.0421	7	.	.	.	.	.	.	.	.	5	O75678-3	.	L	5	ENSP00000248980:S5L	.	S	-	2	0	RFPL2	30919248	0.033000	0.19621	0.004000	0.12327	0.011000	0.07611	-0.582000	0.05814	-0.961000	0.03609	-0.693000	0.03709	TCA	.	.		0.468	RFPL2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075262.2	NM_006605	
CLCN5	1184	hgsc.bcm.edu	37	X	49854827	49854827	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:49854827G>T	ENST00000307367.2	+	10	1880	c.1589G>T	c.(1588-1590)gGt>gTt	p.G530V	CLCN5_ENST00000376108.3_Missense_Mutation_p.G530V|CLCN5_ENST00000376088.3_Missense_Mutation_p.G600V|CLCN5_ENST00000376091.3_Missense_Mutation_p.G600V			P51795	CLCN5_HUMAN	chloride channel, voltage-sensitive 5	530					chloride transmembrane transport (GO:1902476)|endocytosis (GO:0006897)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical part of cell (GO:0045177)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)	30	Ovarian(276;0.236)					GAACTGACTGGTGGCTTAGAA	0.498																																					p.G600V		Atlas-SNP	.											.	CLCN5	137	.	0			c.G1799T						.						181.0	165.0	171.0					X																	49854827		2203	4300	6503	SO:0001583	missense	1184	exon13			TGACTGGTGGCTT	X91906	CCDS14328.1, CCDS48115.1, CCDS69763.1	Xp11.23-p11.22	2012-09-26	2012-02-23		ENSG00000171365	ENSG00000171365		"""Ion channels / Chloride channels : Voltage-sensitive"""	2023	protein-coding gene	gene with protein product	"""Dent disease"""	300008	"""nephrolithiasis 2, X-linked"", ""nephrolithiasis 1 (X-linked)"", ""chloride channel 5"""	NPHL2, NPHL1		7874126, 8111383, 8099916, 8559248, 9602200	Standard	NM_001272102		Approved	DENTS, XLRH, hClC-K2, hCIC-K2, CLC5, XRN, ClC-5	uc004doq.1	P51795	OTTHUMG00000021514	ENST00000307367.2:c.1589G>T	chrX.hg19:g.49854827G>T	ENSP00000304257:p.Gly530Val	66.0	0.0		49.0	29.0	NM_001127898	A1L475|B3KPN6|Q5JQD5|Q7RTN8	Missense_Mutation	SNP	ENST00000307367.2	hg19	CCDS14328.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.455589	0.84209	.	.	ENSG00000171365	ENST00000376088;ENST00000450422;ENST00000376091;ENST00000376108;ENST00000307367	D;D;D;D	0.95069	-3.6;-3.6;-3.6;-3.6	5.79	5.79	0.91817	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.98416	0.9473	H	0.97682	4.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99723	1.1010	10	0.87932	D	0	-2.6316	17.6718	0.88220	0.0:0.0:1.0:0.0	.	530;600	P51795;P51795-2	CLCN5_HUMAN;.	V	600;432;600;530;530	ENSP00000365256:G600V;ENSP00000365259:G600V;ENSP00000365276:G530V;ENSP00000304257:G530V	ENSP00000304257:G530V	G	+	2	0	CLCN5	49741567	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.705000	0.98719	2.445000	0.82738	0.600000	0.82982	GGT	.	.		0.498	CLCN5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056544.1		
FAM46D	169966	hgsc.bcm.edu	37	X	79698451	79698451	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:79698451G>A	ENST00000308293.5	+	3	652	c.413G>A	c.(412-414)tGc>tAc	p.C138Y	FAM46D_ENST00000538312.1_Missense_Mutation_p.C138Y	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	138										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						GTCAAGGTTTGCAATGGGCAT	0.378																																					p.C138Y		Atlas-SNP	.											.	FAM46D	69	.	0			c.G413A						.						119.0	114.0	116.0					X																	79698451		2203	4298	6501	SO:0001583	missense	169966	exon5			AGGTTTGCAATGG	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.413G>A	chrX.hg19:g.79698451G>A	ENSP00000308575:p.Cys138Tyr	80.0	0.0		49.0	7.0	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	hg19	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	G	0.250	-1.007247	0.02112	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.24723	1.84;1.84	4.38	3.48	0.39840	Domain of unknown function DUF1693 (1);	0.123552	0.56097	D	0.000027	T	0.19886	0.0478	L	0.58101	1.795	0.33804	D	0.627047	P	0.34864	0.473	B	0.31812	0.136	T	0.12041	-1.0563	10	0.08179	T	0.78	-7.5637	9.7805	0.40645	0.0:0.4204:0.5796:0.0	.	138	Q8NEK8	FA46D_HUMAN	Y	138	ENSP00000443410:C138Y;ENSP00000308575:C138Y	ENSP00000308575:C138Y	C	+	2	0	FAM46D	79585107	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	2.639000	0.46570	2.025000	0.59659	0.538000	0.68166	TGC	.	.		0.378	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
SLC25A5	292	hgsc.bcm.edu	37	X	118603838	118603838	+	Missense_Mutation	SNP	T	T	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:118603838T>G	ENST00000317881.8	+	2	442	c.326T>G	c.(325-327)tTt>tGt	p.F109C	SLC25A5-AS1_ENST00000446986.1_RNA|SLC25A5_ENST00000460013.1_3'UTR	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	109					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	AGAACCCAGTTTTGGCTCTAC	0.517																																					p.F109C		Atlas-SNP	.											.	SLC25A5	33	.	0			c.T326G						.						105.0	105.0	105.0					X																	118603838		2203	4300	6503	SO:0001583	missense	292	exon2			CCCAGTTTTGGCT	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.326T>G	chrX.hg19:g.118603838T>G	ENSP00000360671:p.Phe109Cys	80.0	0.0		104.0	11.0	NM_001152	B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	hg19	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436537	0.62955	.	.	ENSG00000005022	ENST00000317881	T	0.78595	-1.19	4.35	4.35	0.52113	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.87736	0.6252	M	0.85299	2.745	0.58432	D	0.999998	D	0.76494	0.999	D	0.71414	0.973	D	0.89459	0.3735	10	0.87932	D	0	.	12.0671	0.53594	0.0:0.0:0.0:1.0	.	109	P05141	ADT2_HUMAN	C	109	ENSP00000360671:F109C	ENSP00000360671:F109C	F	+	2	0	SLC25A5	118487866	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.635000	0.83286	1.685000	0.51034	0.430000	0.28490	TTT	.	.		0.517	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058952.2	NM_001152	
XPNPEP2	7512	hgsc.bcm.edu	37	X	128876095	128876095	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:128876095G>T	ENST00000371106.3	+	2	253	c.61G>T	c.(61-63)Ggc>Tgc	p.G21C	XPNPEP2_ENST00000371105.3_Missense_Mutation_p.G21C	NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	21						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TTGTGCCTGGGGCCACACAAA	0.637																																					p.G21C		Atlas-SNP	.											.	XPNPEP2	84	.	0			c.G61T						.						52.0	46.0	48.0					X																	128876095		2203	4300	6503	SO:0001583	missense	7512	exon2			GCCTGGGGCCACA	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.61G>T	chrX.hg19:g.128876095G>T	ENSP00000360147:p.Gly21Cys	48.0	0.0		58.0	4.0	NM_003399	A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	hg19	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.850939	0.51270	.	.	ENSG00000122121	ENST00000371105;ENST00000371106	T	0.75367	-0.93	5.35	4.4	0.53042	.	0.145984	0.64402	D	0.000012	T	0.72011	0.3408	L	0.32530	0.975	0.30260	N	0.793254	D;D	0.71674	0.998;0.994	P;P	0.57371	0.797;0.819	T	0.70876	-0.4753	10	0.87932	D	0	-6.6377	5.5858	0.17274	0.1988:0.0:0.8012:0.0	.	21;21	B4DV70;O43895	.;XPP2_HUMAN	C	21	ENSP00000360147:G21C	ENSP00000360146:G21C	G	+	1	0	XPNPEP2	128703776	1.000000	0.71417	0.951000	0.38953	0.532000	0.34746	1.594000	0.36697	0.932000	0.37266	0.594000	0.82650	GGC	.	.		0.637	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	
BCORL1	63035	hgsc.bcm.edu	37	X	129149866	129149866	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:129149866C>G	ENST00000218147.7	+	4	3315	c.3118C>G	c.(3118-3120)Ctt>Gtt	p.L1040V	BCORL1_ENST00000303743.5_Missense_Mutation_p.L1040V|BCORL1_ENST00000359304.2_Missense_Mutation_p.L1040V|BCORL1_ENST00000540052.1_Missense_Mutation_p.L1040V			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1040					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GCGCCCACAGCTTGGAAGCCA	0.582																																					p.L1040V		Atlas-SNP	.											.	BCORL1	213	.	0			c.C3118G						.						71.0	61.0	65.0					X																	129149866		2203	4300	6503	SO:0001583	missense	63035	exon3			CCACAGCTTGGAA	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3118C>G	chrX.hg19:g.129149866C>G	ENSP00000218147:p.Leu1040Val	101.0	0.0		129.0	81.0	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	hg19	CCDS14616.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.207|9.207	1.029862|1.029862	0.19512|0.19512	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000441294|ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	.|T;T;T;T;T	.|0.41758	.|1.0;1.37;0.99;1.0;1.44	5.05|5.05	4.18|4.18	0.49190|0.49190	.|.	.|0.000000	.|0.32868	.|N	.|0.005546	T|T	0.30070|0.30070	0.0753|0.0753	N|N	0.24115|0.24115	0.695|0.695	0.24437|0.24437	N|N	0.994542|0.994542	.|P;P	.|0.45474	.|0.859;0.801	.|P;B	.|0.47673	.|0.554;0.275	T|T	0.09509|0.09509	-1.0671|-1.0671	5|10	.|0.30854	.|T	.|0.27	-12.9564|-12.9564	4.3872|4.3872	0.11323|0.11323	0.0:0.6334:0.0:0.3666|0.0:0.6334:0.0:0.3666	.|.	.|1040;1040	.|Q5H9F3-2;Q5H9F3	.|.;BCORL_HUMAN	G|V	475|1040;1040;1040;1040;640	.|ENSP00000218147:L1040V;ENSP00000307541:L1040V;ENSP00000352253:L1040V;ENSP00000437775:L1040V;ENSP00000399483:L640V	.|ENSP00000218147:L1040V	A|L	+|+	2|1	0|0	BCORL1|BCORL1	128977547|128977547	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.418000|0.418000	0.31294|0.31294	2.400000|2.400000	0.44504|0.44504	2.097000|2.097000	0.63578|0.63578	0.529000|0.529000	0.55759|0.55759	GCT|CTT	.	.		0.582	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
IGSF1	3547	hgsc.bcm.edu	37	X	130408573	130408573	+	Splice_Site	SNP	C	C	T			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:130408573C>T	ENST00000361420.3	-	18	3830	c.3751G>A	c.(3751-3753)Ggg>Agg	p.G1251R	IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Splice_Site_p.G1256R|IGSF1_ENST00000370910.1_Splice_Site_p.G1242R|IGSF1_ENST00000370904.1_Splice_Site_p.G1242R			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1251					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						ATTCTCTTACCTGCTGCCCCC	0.552																																					p.G1256R		Atlas-SNP	.											.	IGSF1	231	.	0			c.G3766A						.						109.0	100.0	103.0					X																	130408573		2203	4300	6503	SO:0001630	splice_region_variant	3547	exon18			TCTTACCTGCTGC	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3751+1G>A	chrX.hg19:g.130408573C>T		60.0	0.0		29.0	5.0	NM_001170961	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	hg19	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843851	0.51164	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.00705	5.82;5.82;5.82;5.81	5.42	5.42	0.78866	.	0.000000	0.48767	D	0.000176	T	0.02767	0.0083	L	0.48642	1.525	0.38767	D	0.954455	D;D;D	0.89917	0.958;1.0;1.0	P;D;D	0.87578	0.903;0.997;0.998	T	0.66221	-0.5978	9	.	.	.	.	13.7754	0.63050	0.0:1.0:0.0:0.0	.	1242;695;1251	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	R	1242;1251;1242;1256	ENSP00000359947:G1242R;ENSP00000355010:G1251R;ENSP00000359941:G1242R;ENSP00000359940:G1256R	.	G	-	1	0	IGSF1	130236254	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	2.509000	0.45459	2.410000	0.81850	0.594000	0.82650	GGG	.	.		0.552	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		Missense_Mutation
SLC9A6	10479	hgsc.bcm.edu	37	X	135106598	135106598	+	Silent	SNP	A	A	G			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:135106598A>G	ENST00000370698.3	+	12	1511	c.1476A>G	c.(1474-1476)gtA>gtG	p.V492V	SLC9A6_ENST00000370701.1_Silent_p.V472V|SLC9A6_ENST00000370695.4_Silent_p.V524V	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	492					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CCGTGTGGGTATTTGGTGGTG	0.408																																					p.V524V		Atlas-SNP	.											.	SLC9A6	64	.	0			c.A1572G						.						286.0	207.0	234.0					X																	135106598		2203	4300	6503	SO:0001819	synonymous_variant	10479	exon12			GTGGGTATTTGGT	AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1476A>G	chrX.hg19:g.135106598A>G		106.0	0.0		93.0	54.0	NM_001042537	A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	ENST00000370698.3	hg19	CCDS14654.1																																																																																			.	.		0.408	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058450.1	NM_006359	
GAB3	139716	hgsc.bcm.edu	37	X	153940659	153940659	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chrX:153940659G>A	ENST00000369575.3	-	4	942	c.911C>T	c.(910-912)tCc>tTc	p.S304F	GAB3_ENST00000496390.1_Intron|GAB3_ENST00000424127.2_Missense_Mutation_p.S305F	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	304					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TGGAGTGTTGGACATAATGTC	0.488																																					p.S305F		Atlas-SNP	.											.	GAB3	73	.	0			c.C914T						.						139.0	127.0	131.0					X																	153940659		2203	4300	6503	SO:0001583	missense	139716	exon4			GTGTTGGACATAA	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.911C>T	chrX.hg19:g.153940659G>A	ENSP00000358588:p.Ser304Phe	95.0	0.0		130.0	95.0	NM_001081573	A6NHF8|E9PB44	Missense_Mutation	SNP	ENST00000369575.3	hg19	CCDS14760.1	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461877	0.26248	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.21932	1.98;1.98;1.98	5.63	1.8	0.24995	.	0.378282	0.28376	N	0.015571	T	0.22936	0.0554	M	0.72118	2.19	0.09310	N	1	P;P;P	0.46395	0.877;0.877;0.877	P;P;P	0.45037	0.467;0.467;0.467	T	0.16364	-1.0405	10	0.54805	T	0.06	-0.1214	3.4229	0.07400	0.1424:0.1349:0.5809:0.1418	.	305;305;304	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	F	304;305;305	ENSP00000358588:S304F;ENSP00000358581:S305F;ENSP00000399588:S305F	ENSP00000358581:S305F	S	-	2	0	GAB3	153593853	0.022000	0.18835	0.000000	0.03702	0.489000	0.33432	0.867000	0.27968	-0.070000	0.12908	0.506000	0.49869	TCC	.	.		0.488	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061192.2	NM_001081573	
USP34	9736	hgsc.bcm.edu	37	2	61441759	61441760	+	In_Frame_Ins	INS	-	-	GACCTTGTT			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr2:61441759_61441760insGACCTTGTT	ENST00000398571.2	-	68	8193_8194	c.8117_8118insAACAAGGTC	c.(8116-8118)tct>tcAACAAGGTCt	p.2706_2706S>STRS	USP34_ENST00000472689.1_Intron	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2706					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GGATGTGCAAAGACCTTGTTGA	0.46																																					p.S2706delinsSTRS		Atlas-Indel,Pindel	.											.	USP34	334	.	0			c.8118_8119insAACAAGGTC						.																																			SO:0001652	inframe_insertion	9736	exon68			.	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.8109_8117dupAACAAGGTC	chr2.hg19:g.61441760_61441768dupGACCTTGTT	ENSP00000381577:p.ThrArgSer2706dup	236.0	0.0		267.0	21.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	In_Frame_Ins	INS	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.		0.460	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
HMGCR	3156	hgsc.bcm.edu	37	5	74651016	74651017	+	In_Frame_Ins	INS	-	-	CAAGAC			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:74651016_74651017insCAAGAC	ENST00000287936.4	+	13	1855_1856	c.1699_1700insCAAGAC	c.(1699-1701)aat>aCAAGACat	p.567_567N>TRH	HMGCR_ENST00000343975.5_Intron|HMGCR_ENST00000511206.1_In_Frame_Ins_p.567_567N>TRH	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	567	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	GGCCAGCACCAATAGAGGCTGC	0.406																																					p.N567delinsTRH		Atlas-INDEL	.											.	HMGCR	53	.	0			c.1699_1700insCAAGAC						.																																			SO:0001652	inframe_insertion	3156	exon13			.		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	Exception_encountered	chr5.hg19:g.74651016_74651017insCAAGAC	ENSP00000287936:p.Asn567delinsThrArgHis	112.0	0.0		107.0	21.0	NM_000859	B7Z3Y9|Q8N190	In_Frame_Ins	INS	ENST00000287936.4	hg19	CCDS4027.1																																																																																			.	.		0.406	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
UNKL	64718	hgsc.bcm.edu	37	16	1417163	1417179	+	Intron	DEL	CCGATGTCCCCACAGCC	CCGATGTCCCCACAGCC	-	rs372155593|rs529314659|rs557591189|rs149887709		TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	CCGATGTCCCCACAGCC	CCGATGTCCCCACAGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr16:1417163_1417179delCCGATGTCCCCACAGCC	ENST00000389221.4	-	14	1887				UNKL_ENST00000403703.1_Frame_Shift_Del_p.GCGDIG153fs|UNKL_ENST00000402641.2_Frame_Shift_Del_p.GCGDIG153fs|UNKL_ENST00000391893.2_Frame_Shift_Del_p.GCGDIG150fs|UNKL_ENST00000508903.2_Frame_Shift_Del_p.GCGDIG654fs|UNKL_ENST00000397464.1_Intron|UNKL_ENST00000248104.7_Frame_Shift_Del_p.GCGDIG150fs	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.I157I(1)		autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				GGGAATGGTGCCGATGTCCCCACAGCCCCGCAGCCCC	0.691																																					p.153_158del		Atlas-Indel,Pindel	.											.	UNKL	46	.	1	Substitution - coding silent(1)	lung(1)	c.458_474del						.																																			SO:0001627	intron_variant	64718	exon5			.	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.1887+63GGCTGTGGGGACATCGG>-	chr16.hg19:g.1417163_1417179delCCGATGTCCCCACAGCC		128.0	0.0		144.0	10.0	NM_023076	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Frame_Shift_Del	DEL	ENST00000389221.4	hg19	CCDS53981.1																																																																																			.	.		0.691	UNKL-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001037125	
HMGCR	3156	hgsc.bcm.edu	37	5	74651018	74651018	+	Frame_Shift_Del	DEL	T	T	-			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:74651018delT	ENST00000287936.4	+	13	1857	c.1701delT	c.(1699-1701)aatfs	p.N567fs	HMGCR_ENST00000343975.5_Intron|HMGCR_ENST00000511206.1_Frame_Shift_Del_p.N567fs	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	567	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	CCAGCACCAATAGAGGCTGCA	0.413																																					p.N567fs		Atlas-INDEL	.											.	HMGCR	53	.	0			c.1700delA						.						59.0	56.0	57.0					5																	74651018		2203	4300	6503	SO:0001589	frameshift_variant	3156	exon13			.		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.1701delT	chr5.hg19:g.74651018delT	ENSP00000287936:p.Asn567fs	108.0	0.0		106.0	21.0	NM_000859	B7Z3Y9|Q8N190	Frame_Shift_Del	DEL	ENST00000287936.4	hg19	CCDS4027.1																																																																																			.	.		0.413	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
ZDHHC4	55146	hgsc.bcm.edu	37	7	6621814	6621814	+	Frame_Shift_Del	DEL	T	T	-	rs183719718	byFrequency	TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr7:6621814delT	ENST00000396706.2	+	5	745	c.302delT	c.(301-303)cttfs	p.L103fs	AC079742.4_ENST00000434951.1_RNA|ZDHHC4_ENST00000396707.2_Frame_Shift_Del_p.L103fs|ZDHHC4_ENST00000396709.1_Frame_Shift_Del_p.L103fs|ZDHHC4_ENST00000405731.3_Frame_Shift_Del_p.L103fs|ZDHHC4_ENST00000396713.2_Frame_Shift_Del_p.L103fs|ZDHHC4_ENST00000335965.6_Frame_Shift_Del_p.L103fs			Q9NPG8	ZDHC4_HUMAN	zinc finger, DHHC-type containing 4	103						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.1)		TTGCATTACCTTCTTCTGCCC	0.468																																					p.L101fs		Atlas-Indel,Pindel	.											.	ZDHHC4	36	.	0			c.301delC						.						328.0	288.0	301.0					7																	6621814		2203	4300	6503	SO:0001589	frameshift_variant	55146	exon5			.	AF201931	CCDS5352.1	7p22.1	2011-01-11			ENSG00000136247	ENSG00000136247		"""Zinc fingers, DHHC-type"""	18471	protein-coding gene	gene with protein product							Standard	NM_018106		Approved	FLJ10479, ZNF374	uc003sqj.3	Q9NPG8	OTTHUMG00000023579	ENST00000396706.2:c.302delT	chr7.hg19:g.6621814delT	ENSP00000379934:p.Leu103fs	171.0	0.0		167.0	61.0	NM_018106	A4D2N9|Q53EV7|Q6FIB5|Q9H0R9	Frame_Shift_Del	DEL	ENST00000396706.2	hg19	CCDS5352.1																																																																																			.	.		0.468	ZDHHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207477.3	NM_018106	
HNF1A	6927	hgsc.bcm.edu	37	12	121434166	121434166	+	Frame_Shift_Del	DEL	C	C	-			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr12:121434166delC	ENST00000257555.6	+	5	1283	c.1057delC	c.(1057-1059)cccfs	p.P353fs	HNF1A_ENST00000541395.1_Frame_Shift_Del_p.P353fs|HNF1A_ENST00000544413.1_Frame_Shift_Del_p.P353fs|HNF1A_ENST00000400024.2_Frame_Shift_Del_p.P353fs|HNF1A_ENST00000402929.1_Frame_Shift_Del_p.P353fs|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000543427.1_Frame_Shift_Del_p.P236fs			P20823	HNF1A_HUMAN	HNF1 homeobox A	353					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCAAGTGTCCCCCACGGGCCT	0.582									Hepatic Adenoma, Familial Clustering of																												p.S352fs		Pindel	.											.	HNF1A	302	.	0			c.1056delC						.						103.0	93.0	97.0					12																	121434166		2203	4300	6503	SO:0001589	frameshift_variant	6927	exon5	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	.	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1057delC	chr12.hg19:g.121434166delC	ENSP00000257555:p.Pro353fs	168.0	0.0		139.0	21.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Frame_Shift_Del	DEL	ENST00000257555.6	hg19	CCDS9209.1																																																																																			.	.		0.582	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
HMGCR	3156	hgsc.bcm.edu	37	5	74651021	74651022	+	Frame_Shift_Ins	INS	-	-	CAAGA			TCGA-NI-A4U2-01A-11D-A28X-10	TCGA-NI-A4U2-10A-01D-A28X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1fa0d37a-b560-4a23-bc45-a3118eb5883a	3f6c5637-3042-4e1e-95c6-189ca0e5719e	g.chr5:74651021_74651022insCAAGA	ENST00000287936.4	+	13	1860_1861	c.1704_1705insCAAGA	c.(1705-1707)ggcfs	p.G569fs	HMGCR_ENST00000343975.5_Intron|HMGCR_ENST00000511206.1_Frame_Shift_Ins_p.G569fs	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	569	Catalytic.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	GCACCAATAGAGGCTGCAGAGC	0.406																																					p.R568fs		Pindel	.											.	HMGCR	53	.	0			c.1704_1705insCAAGA						.																																			SO:0001589	frameshift_variant	3156	exon13			.		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	Exception_encountered	chr5.hg19:g.74651021_74651022insCAAGA	ENSP00000287936:p.Gly569fs	107.0	0.0		107.0	16.0	NM_000859	B7Z3Y9|Q8N190	Frame_Shift_Ins	INS	ENST00000287936.4	hg19	CCDS4027.1																																																																																			.	.		0.406	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
