#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
YTHDF2	51441	hgsc.bcm.edu	37	1	29070165	29070165	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:29070165C>T	ENST00000373812.3	+	4	1745	c.1383C>T	c.(1381-1383)gtC>gtT	p.V461V	YTHDF2_ENST00000542507.1_Silent_p.V461V|YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000541996.1_Silent_p.V411V	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2	461	Interaction with m6A-containing mRNAs.|YTH. {ECO:0000255|PROSITE- ProRule:PRU00225}.				humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		TTTTCAGTGTCAACGGCAGTG	0.483																																					p.V461V		Atlas-SNP	.											.	YTHDF2	47	.	0			c.C1383T						.						64.0	63.0	63.0					1																	29070165		1912	4131	6043	SO:0001819	synonymous_variant	51441	exon4			CAGTGTCAACGGC	AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.1383C>T	chr1.hg19:g.29070165C>T		356.0	0.0		302.0	55.0	NM_016258	A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	Silent	SNP	ENST00000373812.3	hg19	CCDS41296.1																																																																																			.	.		0.483	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010335.1	NM_016258	
MACF1	23499	hgsc.bcm.edu	37	1	39909144	39909144	+	Missense_Mutation	SNP	A	A	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:39909144A>T	ENST00000372915.3	+	78	19113	c.19026A>T	c.(19024-19026)gaA>gaT	p.E6342D	MACF1_ENST00000567887.1_Missense_Mutation_p.E6480D|MACF1_ENST00000564288.1_Missense_Mutation_p.E6443D|MACF1_ENST00000289893.4_Missense_Mutation_p.E4886D|MACF1_ENST00000539005.1_Missense_Mutation_p.E4254D|MACF1_ENST00000317713.7_Missense_Mutation_p.E4384D|MACF1_ENST00000545844.1_Missense_Mutation_p.E4384D|MACF1_ENST00000361689.2_Missense_Mutation_p.E4384D			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6342					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTGAAATTGAAGATTTCCTCT	0.408																																					p.E4384D		Atlas-SNP	.											.	MACF1	909	.	0			c.A13152T						.						85.0	88.0	87.0					1																	39909144		2203	4300	6503	SO:0001583	missense	23499	exon76			AATTGAAGATTTC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.19026A>T	chr1.hg19:g.39909144A>T	ENSP00000362006:p.Glu6342Asp	55.0	0.0		42.0	28.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.54|18.54	3.645261|3.645261	0.67358|0.67358	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.47528|.	1.39;0.84;1.39;1.39;1.39;0.84|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.64402|.	D|.	0.000005|.	T|.	0.63896|.	0.2550|.	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	P;D|.	0.62365|.	0.709;0.991|.	B;P|.	0.59595|.	0.338;0.86|.	T|.	0.65421|.	-0.6172|.	10|.	0.59425|.	D|.	0.04|.	.|.	7.6753|7.6753	0.28481|0.28481	0.7893:0.1416:0.0691:0.0|0.7893:0.1416:0.0691:0.0	.|.	6342;4384|.	Q9UPN3;F8W8Q1|.	MACF1_HUMAN;.|.	D|X	4384;6342;4384;4384;4254;4886|3388	ENSP00000439537:E4384D;ENSP00000362006:E6342D;ENSP00000354573:E4384D;ENSP00000313438:E4384D;ENSP00000444364:E4254D;ENSP00000289893:E4886D|.	ENSP00000289893:E4886D|.	E|R	+|+	3|1	2|2	MACF1|MACF1	39681731|39681731	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.051000|3.051000	0.49885|0.49885	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	GAA|AGA	.	.		0.408	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
SEMA6C	10500	hgsc.bcm.edu	37	1	151111134	151111134	+	Nonsense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:151111134G>T	ENST00000341697.3	-	7	2119	c.428C>A	c.(427-429)tCa>tAa	p.S143*				Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	143	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGGGCTGAATGAGTTCGTTCC	0.527																																					p.S143X		Atlas-SNP	.											.	SEMA6C	70	.	0			c.C428A						.						94.0	86.0	89.0					1																	151111134		2203	4300	6503	SO:0001587	stop_gained	10500	exon7			CTGAATGAGTTCG	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.428C>A	chr1.hg19:g.151111134G>T	ENSP00000344148:p.Ser143*	203.0	0.0		205.0	29.0	NM_001178061	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Nonsense_Mutation	SNP	ENST00000341697.3	hg19	CCDS984.1	.	.	.	.	.	.	.	.	.	.	G	38	7.054255	0.98032	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697;ENST00000392792	.	.	.	5.06	5.06	0.68205	.	0.063943	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	15.9776	0.80083	0.0:0.0:1.0:0.0	.	.	.	.	X	143	.	ENSP00000344148:S143X	S	-	2	0	SEMA6C	149377758	1.000000	0.71417	0.978000	0.43139	0.939000	0.58152	9.101000	0.94219	2.642000	0.89623	0.561000	0.74099	TCA	.	.		0.527	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
FCRL5	83416	hgsc.bcm.edu	37	1	157488260	157488260	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:157488260T>C	ENST00000361835.3	-	15	2928	c.2771A>G	c.(2770-2772)tAc>tGc	p.Y924C	FCRL5_ENST00000461387.1_5'UTR|FCRL5_ENST00000356953.4_Missense_Mutation_p.Y924C	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	924					negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TACTTCTGAGTAAACCACATT	0.438																																					p.Y924C		Atlas-SNP	.											.	FCRL5	177	.	0			c.A2771G						.						218.0	203.0	208.0					1																	157488260		2203	4300	6503	SO:0001583	missense	83416	exon15			TCTGAGTAAACCA	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.2771A>G	chr1.hg19:g.157488260T>C	ENSP00000354691:p.Tyr924Cys	105.0	0.0		113.0	27.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	hg19	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.252872	0.39797	.	.	ENSG00000143297	ENST00000361835;ENST00000356953	T;T	0.57595	0.39;0.4	5.04	5.04	0.67666	.	515.203000	0.00166	N	0.000000	T	0.67277	0.2876	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.52313	-0.8592	9	0.72032	D	0.01	.	11.0693	0.47993	0.0:0.0:0.0:1.0	.	924	Q96RD9	FCRL5_HUMAN	C	924	ENSP00000354691:Y924C;ENSP00000349434:Y924C	ENSP00000349434:Y924C	Y	-	2	0	FCRL5	155754884	0.969000	0.33509	0.963000	0.40424	0.107000	0.19398	3.093000	0.50217	2.108000	0.64289	0.533000	0.62120	TAC	.	.		0.438	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
CENPF	1063	hgsc.bcm.edu	37	1	214818024	214818024	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:214818024T>C	ENST00000366955.3	+	13	5279	c.5111T>C	c.(5110-5112)cTa>cCa	p.L1704P		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1800					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GACCTCAATCTAGACATTGAG	0.428																																					p.L1704P	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											.	CENPF	321	.	0			c.T5111C						.						69.0	68.0	69.0					1																	214818024		2203	4300	6503	SO:0001583	missense	1063	exon13			TCAATCTAGACAT	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.5111T>C	chr1.hg19:g.214818024T>C	ENSP00000355922:p.Leu1704Pro	276.0	0.0		254.0	99.0	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	T	9.826	1.187201	0.21870	.	.	ENSG00000117724	ENST00000366955	T	0.03920	3.76	5.04	1.25	0.21368	.	0.000000	0.30528	N	0.009422	T	0.06371	0.0164	M	0.68317	2.08	0.20307	N	0.999915	P	0.50943	0.94	P	0.44990	0.466	T	0.29058	-1.0024	10	0.66056	D	0.02	.	1.8429	0.03153	0.1734:0.0913:0.1611:0.5741	.	1800	P49454	CENPF_HUMAN	P	1704	ENSP00000355922:L1704P	ENSP00000355922:L1704P	L	+	2	0	CENPF	212884647	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.556000	0.23438	0.352000	0.24053	0.496000	0.49642	CTA	.	.		0.428	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
NUP133	55746	hgsc.bcm.edu	37	1	229601263	229601263	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:229601263T>A	ENST00000261396.3	-	17	2294	c.2203A>T	c.(2203-2205)Atg>Ttg	p.M735L	NUP133_ENST00000537506.1_Missense_Mutation_p.M719L	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	735					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GCCTGCAGCATATCCTGGAAA	0.338																																					p.M735L		Atlas-SNP	.											.	NUP133	111	.	0			c.A2203T						.						129.0	129.0	129.0					1																	229601263		2202	4299	6501	SO:0001583	missense	55746	exon17			GCAGCATATCCTG		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.2203A>T	chr1.hg19:g.229601263T>A	ENSP00000261396:p.Met735Leu	59.0	0.0		56.0	18.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	hg19	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.869923	0.51588	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.25250	2.0;1.81;2.01	5.88	5.88	0.94601	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.108239	0.85682	D	0.000000	T	0.31638	0.0803	M	0.72894	2.215	0.52501	D	0.999955	B	0.19445	0.036	B	0.27608	0.081	T	0.08186	-1.0734	10	0.21540	T	0.41	-24.8757	14.5382	0.67976	0.0:0.0:0.0:1.0	.	735	Q8WUM0	NU133_HUMAN	L	735;735;735;719	ENSP00000261396:M735L;ENSP00000355640:M735L;ENSP00000443496:M719L	ENSP00000261396:M735L	M	-	1	0	NUP133	227667886	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.465000	0.53064	2.243000	0.73865	0.528000	0.53228	ATG	.	.		0.338	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
ABCB10	23456	hgsc.bcm.edu	37	1	229667460	229667460	+	Missense_Mutation	SNP	G	G	A	rs139689788		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:229667460G>A	ENST00000344517.4	-	7	1400	c.1358C>T	c.(1357-1359)tCg>tTg	p.S453L		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	453	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CATCAGCTCCGAGTAGAAAGA	0.542																																					p.S453L		Atlas-SNP	.											ABCB10,caecum,carcinoma,0,1	ABCB10	71	.	0			c.C1358T						.	G	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	55.0	60.0	58.0		1358	6.0	1.0	1	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ABCB10	NM_012089.2	145	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	453/739	229667460	2,13004	2203	4300	6503	SO:0001583	missense	23456	exon7			AGCTCCGAGTAGA	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1358C>T	chr1.hg19:g.229667460G>A	ENSP00000355637:p.Ser453Leu	158.0	1.0		103.0	18.0	NM_012089	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	ENST00000344517.4	hg19	CCDS1580.1	.	.	.	.	.	.	.	.	.	.	G	35	5.541785	0.96474	2.27E-4	1.16E-4	ENSG00000135776	ENST00000344517	T	0.80653	-1.4	5.96	5.96	0.96718	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.82710	0.5096	M	0.79805	2.47	0.80722	D	1	P	0.51351	0.944	B	0.39503	0.301	D	0.85866	0.1413	10	0.72032	D	0.01	-16.8627	20.4043	0.99006	0.0:0.0:1.0:0.0	.	453	Q9NRK6	ABCBA_HUMAN	L	453	ENSP00000355637:S453L	ENSP00000355637:S453L	S	-	2	0	ABCB10	227734083	1.000000	0.71417	0.967000	0.41034	0.963000	0.63663	9.407000	0.97325	2.823000	0.97156	0.650000	0.86243	TCG	.	G|1.000;A|0.000		0.542	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089	
GNPAT	8443	hgsc.bcm.edu	37	1	231408132	231408132	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:231408132C>G	ENST00000366647.4	+	11	1766	c.1597C>G	c.(1597-1599)Cta>Gta	p.L533V	GNPAT_ENST00000366646.3_Missense_Mutation_p.L472V	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	533					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				AGGAAACACACTAAAGGTAAA	0.403																																					p.L533V		Atlas-SNP	.											.	GNPAT	73	.	0			c.C1597G						.						200.0	186.0	191.0					1																	231408132		2203	4300	6503	SO:0001583	missense	8443	exon11			AACACACTAAAGG	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1597C>G	chr1.hg19:g.231408132C>G	ENSP00000355607:p.Leu533Val	91.0	0.0		69.0	5.0	NM_014236	B4DNM9|Q5TBH7|Q9BWC2	Missense_Mutation	SNP	ENST00000366647.4	hg19	CCDS1592.1	.	.	.	.	.	.	.	.	.	.	C	1.005	-0.689837	0.03328	.	.	ENSG00000116906	ENST00000366647;ENST00000366646;ENST00000416000	T;T;T	0.63096	-0.02;-0.01;-0.02	4.71	-5.7	0.02421	.	1.030390	0.07678	N	0.936573	T	0.43700	0.1259	L	0.33485	1.01	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.23261	-1.0193	10	0.30854	T	0.27	-16.7215	7.0632	0.25137	0.1704:0.166:0.5403:0.1234	.	472;533	B4DNM9;O15228	.;GNPAT_HUMAN	V	533;472;523	ENSP00000355607:L533V;ENSP00000355606:L472V;ENSP00000411640:L523V	ENSP00000355606:L472V	L	+	1	2	GNPAT	229474755	0.020000	0.18652	0.001000	0.08648	0.854000	0.48673	-0.241000	0.08940	-1.325000	0.02269	-1.126000	0.01995	CTA	.	.		0.403	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092871.1		
DISC1	27185	hgsc.bcm.edu	37	1	231829897	231829897	+	Silent	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr1:231829897G>A	ENST00000602281.1	+	2	446	c.393G>A	c.(391-393)agG>agA	p.R131R	DISC1_ENST00000317586.4_Silent_p.R131R|DISC1_ENST00000537876.1_Silent_p.R131R|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000539444.1_Silent_p.R131R|DISC1_ENST00000535983.1_Silent_p.R131R|TSNAX-DISC1_ENST00000602962.1_3'UTR|DISC1_ENST00000439617.2_Silent_p.R131R|DISC1_ENST00000366633.3_Silent_p.R131R|DISC1_ENST00000366636.4_Silent_p.R131R	NM_001164542.1|NM_001164544.1	NP_001158014.1|NP_001158016.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	131	Interaction with MAP1A.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				TGCCTGACAGGCTTAGCTGGC	0.602																																					p.R131R		Atlas-SNP	.											.	DISC1	207	.	0			c.G393A						.						42.0	41.0	41.0					1																	231829897		2203	4300	6503	SO:0001819	synonymous_variant	27185	exon2			TGACAGGCTTAGC	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000602281.1:c.393G>A	chr1.hg19:g.231829897G>A		58.0	0.0		46.0	18.0	NM_001164541	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Silent	SNP	ENST00000602281.1	hg19	CCDS59205.1																																																																																			.	.		0.602	DISC1-019	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000467451.1	NM_018662	
FAM161A	84140	hgsc.bcm.edu	37	2	62069387	62069387	+	Missense_Mutation	SNP	T	T	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr2:62069387T>G	ENST00000405894.3	-	2	393	c.292A>C	c.(292-294)Aaa>Caa	p.K98Q	FAM161A_ENST00000404929.1_Missense_Mutation_p.K98Q	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	98					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCTTCTACTTTCTTGAAATAC	0.398																																					p.K98Q		Atlas-SNP	.											.	FAM161A	200	.	0			c.A292C						.						73.0	66.0	68.0					2																	62069387		1838	4085	5923	SO:0001583	missense	84140	exon2			CTACTTTCTTGAA		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.292A>C	chr2.hg19:g.62069387T>G	ENSP00000385893:p.Lys98Gln	80.0	0.0		78.0	31.0	NM_032180	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	hg19	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	T	18.05	3.537587	0.65085	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.66815	-0.23;-0.23	5.95	5.95	0.96441	.	.	.	.	.	T	0.74261	0.3693	L	0.46157	1.445	0.30066	N	0.810514	D;D	0.71674	0.959;0.998	P;D	0.63113	0.631;0.911	T	0.71404	-0.4603	9	0.35671	T	0.21	-8.4	13.8073	0.63240	0.0:0.0:0.0:1.0	.	98;98	Q3B820;Q3B820-3	F161A_HUMAN;.	Q	98	ENSP00000385158:K98Q;ENSP00000385893:K98Q	ENSP00000385158:K98Q	K	-	1	0	FAM161A	61922891	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	5.099000	0.64554	2.279000	0.76181	0.533000	0.62120	AAA	.	.		0.398	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
SAP130	79595	hgsc.bcm.edu	37	2	128757662	128757662	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr2:128757662G>A	ENST00000259235.3	-	9	1283	c.1154C>T	c.(1153-1155)gCa>gTa	p.A385V	SAP130_ENST00000357702.5_Missense_Mutation_p.A385V|SAP130_ENST00000259234.6_Missense_Mutation_p.A359V	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	385					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		GGTGTTGGTTGCCAAAATAGG	0.483																																					p.A385V		Atlas-SNP	.											.	SAP130	169	.	0			c.C1154T						.						140.0	139.0	139.0					2																	128757662		2203	4300	6503	SO:0001583	missense	79595	exon9			TTGGTTGCCAAAA	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1154C>T	chr2.hg19:g.128757662G>A	ENSP00000259235:p.Ala385Val	166.0	0.0		118.0	26.0	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	ENST00000259235.3	hg19	CCDS2153.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213174	0.79352	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.58	5.58	0.84498	.	0.095244	0.64402	D	0.000001	T	0.62768	0.2455	N	0.14661	0.345	0.80722	D	1	B;D;D;D	0.89917	0.42;1.0;0.998;0.996	B;D;D;D	0.85130	0.143;0.997;0.994;0.99	T	0.62704	-0.6798	9	0.30854	T	0.27	-18.7903	19.5825	0.95473	0.0:0.0:1.0:0.0	.	385;358;385;23	B7ZLM3;Q96DP1;Q9H0E3;B3KRT9	.;.;SP130_HUMAN;.	V	385;385;359	.	ENSP00000259234:A359V	A	-	2	0	SAP130	128474132	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.014000	0.93635	2.624000	0.88883	0.655000	0.94253	GCA	.	.		0.483	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	
LRP1B	53353	hgsc.bcm.edu	37	2	142012194	142012194	+	Silent	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr2:142012194G>A	ENST00000389484.3	-	4	1331	c.360C>T	c.(358-360)tgC>tgT	p.C120C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	120	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCAGCTGTTGGCAATTGGATA	0.318										TSP Lung(27;0.18)																											p.C120C	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.C360T						.						116.0	103.0	107.0					2																	142012194		2201	4297	6498	SO:0001819	synonymous_variant	53353	exon4			CTGTTGGCAATTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.360C>T	chr2.hg19:g.142012194G>A		64.0	0.0		57.0	12.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	hg19	CCDS2182.1																																																																																			.	.		0.318	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SCRN3	79634	hgsc.bcm.edu	37	2	175289262	175289262	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr2:175289262C>T	ENST00000272732.6	+	7	1059	c.977C>T	c.(976-978)tCa>tTa	p.S326L	SCRN3_ENST00000548921.1_3'UTR|SCRN3_ENST00000409673.3_Missense_Mutation_p.S319L	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	326							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			GATACCAGTTCACCAACATTT	0.318																																					p.S326L		Atlas-SNP	.											.	SCRN3	76	.	0			c.C977T						.						70.0	67.0	68.0					2																	175289262		2203	4300	6503	SO:0001583	missense	79634	exon7			CCAGTTCACCAAC	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.977C>T	chr2.hg19:g.175289262C>T	ENSP00000272732:p.Ser326Leu	342.0	0.0		257.0	119.0	NM_024583	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	ENST00000272732.6	hg19	CCDS2258.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.322743	0.81580	.	.	ENSG00000144306	ENST00000409673;ENST00000272732	T;T	0.13778	2.56;2.62	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.43634	0.1256	M	0.85373	2.75	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.995;0.994	T	0.50398	-0.8833	10	0.59425	D	0.04	-7.4432	18.1068	0.89523	0.0:1.0:0.0:0.0	.	319;326	B4DI11;Q0VDG4	.;SCRN3_HUMAN	L	319;326	ENSP00000387142:S319L;ENSP00000272732:S326L	ENSP00000272732:S326L	S	+	2	0	SCRN3	174997508	1.000000	0.71417	0.995000	0.50966	0.525000	0.34531	7.238000	0.78173	2.281000	0.76405	0.555000	0.69702	TCA	.	.		0.318	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583	
TTN	7273	hgsc.bcm.edu	37	2	179448455	179448455	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr2:179448455C>A	ENST00000591111.1	-	262	60755	c.60531G>T	c.(60529-60531)gaG>gaT	p.E20177D	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E12945D|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E12878D|TTN_ENST00000460472.2_Missense_Mutation_p.E12753D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E21818D|TTN_ENST00000342992.6_Missense_Mutation_p.E19250D|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20177	Fibronectin type-III 46. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGCTGTGTACTCTTCCTGGG	0.463																																					p.E21818D		Atlas-SNP	.											.	TTN	18412	.	0			c.G65454T						.						69.0	67.0	67.0					2																	179448455		1894	4112	6006	SO:0001583	missense	7273	exon312			TGTGTACTCTTCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.60531G>T	chr2.hg19:g.179448455C>A	ENSP00000465570:p.Glu20177Asp	125.0	0.0		106.0	20.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.09	2.431502	0.43122	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	6.02	3.22	0.36961	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54711	0.1875	L	0.55834	1.745	0.46222	D	0.998936	P;P;P;P	0.48503	0.704;0.704;0.704;0.911	B;B;B;P	0.49752	0.388;0.388;0.388;0.621	T	0.57260	-0.7842	9	0.87932	D	0	.	10.0919	0.42451	0.0:0.6767:0.0:0.3233	.	12753;12878;12945;20177	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	19250;12753;12945;12878;12751	ENSP00000343764:E19250D;ENSP00000434586:E12753D;ENSP00000340554:E12945D;ENSP00000352154:E12878D	ENSP00000340554:E12945D	E	-	3	2	TTN	179156701	0.985000	0.35326	1.000000	0.80357	0.998000	0.95712	0.208000	0.17415	0.867000	0.35654	0.655000	0.94253	GAG	.	.		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
AOX1	316	hgsc.bcm.edu	37	2	201462230	201462230	+	Splice_Site	SNP	T	T	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr2:201462230T>G	ENST00000374700.2	+	4	550		c.e4+2			NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1						inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	CCTGTTCAGGTGAGGATGTGC	0.517																																					.		Atlas-SNP	.											.	AOX1	152	.	0			c.309+2T>G						.						130.0	110.0	117.0					2																	201462230		2203	4300	6503	SO:0001630	splice_region_variant	316	exon4			TTCAGGTGAGGAT	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.309+2T>G	chr2.hg19:g.201462230T>G		53.0	0.0		34.0	6.0	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Splice_Site	SNP	ENST00000374700.2	hg19	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.347637	0.82022	.	.	ENSG00000138356	ENST00000374700;ENST00000454629	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4513	0.67386	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	AOX1	201170475	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	6.897000	0.75671	2.075000	0.62263	0.533000	0.62120	.	.	.		0.517	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	Intron
ABCA12	26154	hgsc.bcm.edu	37	2	215840618	215840618	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr2:215840618C>A	ENST00000272895.7	-	34	5491	c.5272G>T	c.(5272-5274)Gtt>Ttt	p.V1758F	ABCA12_ENST00000389661.4_Missense_Mutation_p.V1440F	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1758					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GCAGTGGTAACAAAGACGATG	0.498																																					p.V1758F	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.G5272T						.						171.0	158.0	162.0					2																	215840618		2203	4300	6503	SO:0001583	missense	26154	exon34			TGGTAACAAAGAC	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5272G>T	chr2.hg19:g.215840618C>A	ENSP00000272895:p.Val1758Phe	209.0	0.0		179.0	36.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784689	0.90282	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.91180	-2.8;-2.8	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000013	D	0.96222	0.8768	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.993;0.997	D	0.96145	0.9103	10	0.87932	D	0	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	1758;1440	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	F	1758;1440	ENSP00000272895:V1758F;ENSP00000374312:V1440F	ENSP00000272895:V1758F	V	-	1	0	ABCA12	215548863	1.000000	0.71417	0.983000	0.44433	0.946000	0.59487	6.039000	0.70972	2.854000	0.98071	0.655000	0.94253	GTT	.	.		0.498	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SCN10A	6336	hgsc.bcm.edu	37	3	38830494	38830494	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr3:38830494C>T	ENST00000449082.2	-	3	422	c.423G>A	c.(421-423)ttG>ttA	p.L141L		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	141					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CACAATTAACCAAAATAGTGA	0.388																																					p.L141L		Atlas-SNP	.											.	SCN10A	359	.	0			c.G423A						.						137.0	126.0	130.0					3																	38830494		2203	4300	6503	SO:0001819	synonymous_variant	6336	exon3			ATTAACCAAAATA	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.423G>A	chr3.hg19:g.38830494C>T		114.0	0.0		135.0	17.0	NM_006514	A6NDQ1	Silent	SNP	ENST00000449082.2	hg19	CCDS33736.1																																																																																			.	.		0.388	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	147.0	0.0		168.0	86.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
ZBTB11	27107	hgsc.bcm.edu	37	3	101370476	101370476	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr3:101370476C>A	ENST00000312938.4	-	11	3276	c.2696G>T	c.(2695-2697)cGa>cTa	p.R899L		NM_014415.3	NP_055230.2	O95625	ZBT11_HUMAN	zinc finger and BTB domain containing 11	899					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						TTTTAGAGATCGGGCATCAGC	0.433																																					p.R899L		Atlas-SNP	.											.	ZBTB11	77	.	0			c.G2696T						.						83.0	84.0	83.0					3																	101370476		2203	4300	6503	SO:0001583	missense	27107	exon11			AGAGATCGGGCAT	U69274	CCDS2943.1	3q12.3	2013-01-09			ENSG00000066422	ENSG00000066422		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	16740	protein-coding gene	gene with protein product							Standard	NM_014415		Approved	ZNF-U69274, ZNF913	uc003dve.4	O95625	OTTHUMG00000159133	ENST00000312938.4:c.2696G>T	chr3.hg19:g.101370476C>A	ENSP00000326200:p.Arg899Leu	66.0	0.0		72.0	32.0	NM_014415	Q2NKP9	Missense_Mutation	SNP	ENST00000312938.4	hg19	CCDS2943.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.727218	0.89390	.	.	ENSG00000066422	ENST00000312938	T	0.07567	3.18	5.81	4.92	0.64577	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.11793	0.0287	N	0.25286	0.73	0.80722	D	1	P	0.51653	0.947	P	0.50590	0.645	T	0.06162	-1.0842	10	0.49607	T	0.09	-8.654	16.6963	0.85336	0.0:0.8703:0.1296:0.0	.	899	O95625	ZBT11_HUMAN	L	899	ENSP00000326200:R899L	ENSP00000326200:R899L	R	-	2	0	ZBTB11	102853166	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.434000	0.80377	1.423000	0.47198	0.555000	0.69702	CGA	.	.		0.433	ZBTB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353441.2	NM_014415	
KBTBD12	166348	hgsc.bcm.edu	37	3	127642047	127642047	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr3:127642047T>A	ENST00000405109.1	+	2	610	c.143T>A	c.(142-144)gTc>gAc	p.V48D	KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000343941.4_5'Flank|KBTBD12_ENST00000405256.1_Missense_Mutation_p.V48D			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	48	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CACAGACTGGTCCTGGCTGCA	0.378																																					p.V48D		Atlas-SNP	.											.	KBTBD12	41	.	0			c.T143A						.						93.0	90.0	91.0					3																	127642047		1922	4142	6064	SO:0001583	missense	166348	exon1			GACTGGTCCTGGC		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.143T>A	chr3.hg19:g.127642047T>A	ENSP00000385957:p.Val48Asp	323.0	0.0		286.0	52.0	NM_207335	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	ENST00000405109.1	hg19	CCDS33848.2	.	.	.	.	.	.	.	.	.	.	T	21.4	4.142710	0.77888	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.74106	-0.81;-0.81	5.7	5.7	0.88788	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	D	0.90796	0.7110	H	0.97516	4.02	0.80722	D	1	D	0.67145	0.996	D	0.68039	0.955	D	0.93986	0.7262	9	0.87932	D	0	.	15.9694	0.80001	0.0:0.0:0.0:1.0	.	48	Q3ZCT8	KBTBC_HUMAN	D	48	ENSP00000385957:V48D;ENSP00000385879:V48D	ENSP00000385957:V48D	V	+	2	0	KBTBD12	129124737	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.698000	0.84413	2.177000	0.69029	0.377000	0.23210	GTC	.	.		0.378	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
MAGEF1	64110	hgsc.bcm.edu	37	3	184429511	184429511	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr3:184429511C>T	ENST00000317897.3	-	1	325	c.99G>A	c.(97-99)tcG>tcA	p.S33S		NM_022149.4	NP_071432.2	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	33						extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|urinary_tract(1)	11	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			GGCGCTCCTGCGAGGCGGTCG	0.726																																					p.S33S		Atlas-SNP	.											MAGEF1,colon,carcinoma,0,1	MAGEF1	27	.	0			c.G99A						.						9.0	12.0	11.0					3																	184429511		2132	4200	6332	SO:0001819	synonymous_variant	64110	exon1			CTCCTGCGAGGCG	AF295378	CCDS3269.1	3q13	2008-02-05			ENSG00000177383	ENSG00000177383			29639	protein-coding gene	gene with protein product		609267				11313144	Standard	NM_022149		Approved		uc003fpa.3	Q9HAY2	OTTHUMG00000156712	ENST00000317897.3:c.99G>A	chr3.hg19:g.184429511C>T		151.0	1.0		93.0	45.0	NM_022149	Q9H215	Silent	SNP	ENST00000317897.3	hg19	CCDS3269.1																																																																																			.	.		0.726	MAGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345417.1	NM_022149	
EVC2	132884	hgsc.bcm.edu	37	4	5633652	5633652	+	Silent	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:5633652G>A	ENST00000344408.5	-	11	1631	c.1578C>T	c.(1576-1578)caC>caT	p.H526H	EVC2_ENST00000344938.1_Silent_p.H526H|EVC2_ENST00000310917.2_Silent_p.H446H	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	526					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CCAGCTGTCTGTGAGCTTTGG	0.463																																					p.H526H		Atlas-SNP	.											.	EVC2	202	.	0			c.C1578T						.						106.0	108.0	107.0					4																	5633652		2203	4300	6503	SO:0001819	synonymous_variant	132884	exon11			CTGTCTGTGAGCT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1578C>T	chr4.hg19:g.5633652G>A		142.0	0.0		73.0	12.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Silent	SNP	ENST00000344408.5	hg19	CCDS3382.2																																																																																			.	.		0.463	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
WDR19	57728	hgsc.bcm.edu	37	4	39254852	39254852	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:39254852A>G	ENST00000399820.3	+	25	2970	c.2816A>G	c.(2815-2817)gAa>gGa	p.E939G	WDR19_ENST00000288634.7_Missense_Mutation_p.E779G	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	939					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						AATAATCCTGAAAAAGCTGTC	0.353																																					p.E939G		Atlas-SNP	.											.	WDR19	96	.	0			c.A2816G						.						71.0	69.0	70.0					4																	39254852		1826	4102	5928	SO:0001583	missense	57728	exon25			ATCCTGAAAAAGC	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.2816A>G	chr4.hg19:g.39254852A>G	ENSP00000382717:p.Glu939Gly	135.0	0.0		88.0	24.0	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	ENST00000399820.3	hg19	CCDS47042.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.682521	0.88542	.	.	ENSG00000157796	ENST00000399820;ENST00000288634	T;T	0.79247	-1.25;-1.25	5.49	5.49	0.81192	Tetratricopeptide-like helical (1);	0.044980	0.85682	D	0.000000	T	0.80944	0.4721	M	0.85197	2.74	0.80722	D	1	P	0.35011	0.48	B	0.35312	0.2	T	0.82667	-0.0344	10	0.54805	T	0.06	-27.2414	15.5954	0.76574	1.0:0.0:0.0:0.0	.	939	Q8NEZ3	WDR19_HUMAN	G	939;779	ENSP00000382717:E939G;ENSP00000288634:E779G	ENSP00000288634:E779G	E	+	2	0	WDR19	38931247	1.000000	0.71417	0.890000	0.34922	0.930000	0.56654	9.296000	0.96104	2.075000	0.62263	0.528000	0.53228	GAA	.	.		0.353	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
OCIAD2	132299	hgsc.bcm.edu	37	4	48901944	48901944	+	Splice_Site	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:48901944T>C	ENST00000508632.1	-	3	299		c.e3-2		OCIAD2_ENST00000508069.2_Intron|OCIAD2_ENST00000273860.4_Splice_Site	NM_001014446.1	NP_001014446.1	Q56VL3	OCAD2_HUMAN	OCIA domain containing 2							endosome (GO:0005768)|mitochondrial inner membrane (GO:0005743)				kidney(1)|lung(3)|skin(1)|urinary_tract(1)	6						CAACAGGCTCTGTAAGGAAAG	0.408																																					.		Atlas-SNP	.											.	OCIAD2	16	.	0			c.67-2A>G						.						134.0	128.0	130.0					4																	48901944		2203	4300	6503	SO:0001630	splice_region_variant	132299	exon4			AGGCTCTGTAAGG	BC032808	CCDS3485.1, CCDS33981.1	4p12	2013-10-11			ENSG00000145247	ENSG00000145247			28685	protein-coding gene	gene with protein product						17054434	Standard	NM_001286774		Approved	MGC45416	uc003gyt.3	Q56VL3	OTTHUMG00000128626	ENST00000508632.1:c.67-2A>G	chr4.hg19:g.48901944T>C		109.0	0.0		77.0	11.0	NM_152398	B4DPE7|Q8N544	Splice_Site	SNP	ENST00000508632.1	hg19	CCDS33981.1	.	.	.	.	.	.	.	.	.	.	T	11.65	1.701698	0.30142	.	.	ENSG00000145247	ENST00000508632;ENST00000273860;ENST00000381464	.	.	.	4.74	4.74	0.60224	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.792	0.46438	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	OCIAD2	48596701	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	3.901000	0.56303	2.111000	0.64477	0.379000	0.24179	.	.	.		0.408	OCIAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361984.5	NM_152398	Intron
LPHN3	23284	hgsc.bcm.edu	37	4	62936333	62936333	+	Missense_Mutation	SNP	C	C	G	rs146722627		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:62936333C>G	ENST00000514591.1	+	25	4446	c.4117C>G	c.(4117-4119)Ccc>Gcc	p.P1373A	RP11-84A1.3_ENST00000509461.1_RNA|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000512091.2_3'UTR|LPHN3_ENST00000511324.1_3'UTR|LPHN3_ENST00000507625.1_Missense_Mutation_p.P1432A|RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000506720.1_Missense_Mutation_p.P1484A|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000506746.1_Missense_Mutation_p.P1475A|LPHN3_ENST00000509896.1_3'UTR|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000514157.1_3'UTR|LPHN3_ENST00000514996.1_Missense_Mutation_p.P1407A|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000508946.1_Missense_Mutation_p.P1416A|LPHN3_ENST00000545650.1_Missense_Mutation_p.P1373A|LPHN3_ENST00000508693.1_3'UTR			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1351					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TCTCCAGTCACCCCATAGAGA	0.567																																					p.P1373A		Atlas-SNP	.											.	LPHN3	800	.	0			c.C4117G						.						53.0	52.0	52.0					4																	62936333		692	1591	2283	SO:0001583	missense	23284	exon23			CAGTCACCCCATA	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4117C>G	chr4.hg19:g.62936333C>G	ENSP00000422533:p.Pro1373Ala	165.0	0.0		129.0	34.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.35|14.35	2.508538|2.508538	0.44660|0.44660	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000514591;ENST00000545650;ENST00000295349;ENST00000507625;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	D;D;D;T;T;T;T|.	0.83755|.	-1.69;-1.69;-1.76;-1.22;-1.27;-1.29;-1.24|.	5.39|5.39	5.39|5.39	0.77823|0.77823	GPCR, family 2, latrophilin, C-terminal (1);|.	0.177067|.	0.50627|.	D|.	0.000103|.	T|T	0.75975|0.75975	0.3923|0.3923	M|M	0.69823|0.69823	2.125|2.125	0.58432|0.58432	D|D	0.999998|0.999998	P;P|.	0.42078|.	0.77;0.77|.	B;B|.	0.42112|.	0.376;0.376|.	T|T	0.74731|0.74731	-0.3566|-0.3566	10|5	0.87932|.	D|.	0|.	.|.	19.1541|19.1541	0.93503|0.93503	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1373;1351|.	E9PE04;Q9HAR2|.	.;LPHN3_HUMAN|.	A|S	1373;1373;1351;1432;1416;1484;1475;1407|821	ENSP00000422533:P1373A;ENSP00000439831:P1373A;ENSP00000421372:P1432A;ENSP00000421627:P1416A;ENSP00000420931:P1484A;ENSP00000425884:P1475A;ENSP00000424258:P1407A|.	ENSP00000295349:P1351A|.	P|T	+|+	1|2	0|0	LPHN3|LPHN3	62618928|62618928	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.929000|0.929000	0.56500|0.56500	6.763000|6.763000	0.74955|0.74955	2.535000|2.535000	0.85469|0.85469	0.591000|0.591000	0.81541|0.81541	CCC|ACC	.	C|1.000;T|0.000		0.567	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
GSTCD	79807	hgsc.bcm.edu	37	4	106638934	106638934	+	Missense_Mutation	SNP	A	A	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:106638934A>T	ENST00000515279.1	+	2	384	c.164A>T	c.(163-165)gAg>gTg	p.E55V	GSTCD_ENST00000394728.3_Missense_Mutation_p.E55V|GSTCD_ENST00000507281.1_Splice_Site_p.E55V|GSTCD_ENST00000394730.3_Splice_Site_p.E55V|GSTCD_ENST00000360505.5_Missense_Mutation_p.E55V|GSTCD_ENST00000515255.1_Intron			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	55						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GTCACCAAAGAGGTGAGTAGA	0.368																																					p.E55V		Atlas-SNP	.											.	GSTCD	69	.	0			c.A164T						.						94.0	92.0	93.0					4																	106638934		2203	4300	6503	SO:0001583	missense	79807	exon2			CCAAAGAGGTGAG	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.164A>T	chr4.hg19:g.106638934A>T	ENSP00000422354:p.Glu55Val	267.0	0.0		260.0	91.0	NM_024751	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	ENST00000515279.1	hg19	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	A	15.61	2.885516	0.51908	.	.	ENSG00000138780	ENST00000394730;ENST00000507281;ENST00000515279;ENST00000360505;ENST00000510865;ENST00000509336;ENST00000394728	.	.	.	5.71	3.37	0.38596	.	0.216488	0.42294	D	0.000724	T	0.50000	0.1590	M	0.65975	2.015	0.09310	N	1	P;P	0.52842	0.956;0.946	P;P	0.54499	0.575;0.754	T	0.38265	-0.9669	9	0.51188	T	0.08	-6.647	8.5481	0.33435	0.806:0.0:0.194:0.0	.	55;55	Q8NEC7;D6RCC9	GSTCD_HUMAN;.	V	55	.	ENSP00000353695:E55V	E	+	2	0	GSTCD	106858383	0.958000	0.32768	0.401000	0.26359	0.888000	0.51559	1.643000	0.37217	2.187000	0.69744	0.533000	0.62120	GAG	.	.		0.368	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
PITX2	5308	hgsc.bcm.edu	37	4	111543517	111543517	+	Intron	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:111543517C>A	ENST00000354925.2	-	6	1890				PITX2_ENST00000557119.2_Missense_Mutation_p.A34S|PITX2_ENST00000394595.3_Intron|PITX2_ENST00000306732.3_Missense_Mutation_p.A34S|PITX2_ENST00000556049.1_5'Flank|PITX2_ENST00000355080.5_Intron|PITX2_ENST00000394598.2_Intron	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2						atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		GAAGCCATGGCTAACGGCTGG	0.642																																					p.A34S		Atlas-SNP	.											.	PITX2	73	.	0			c.G100T						.						24.0	25.0	24.0					4																	111543517		2199	4297	6496	SO:0001627	intron_variant	5308	exon1			CCATGGCTAACGG	U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.185-992G>T	chr4.hg19:g.111543517C>A		518.0	0.0		442.0	92.0	NM_000325	A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Missense_Mutation	SNP	ENST00000354925.2	hg19	CCDS3692.1	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666144	0.47677	.	.	ENSG00000164093	ENST00000306732	D	0.90504	-2.68	5.17	3.33	0.38152	.	0.895466	0.09905	N	0.740565	D	0.82277	0.5002	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.65841	-0.6070	9	0.07030	T	0.85	.	14.5773	0.68258	0.0:0.7208:0.2792:0.0	.	34	Q99697-2	.	S	34	ENSP00000304169:A34S	ENSP00000304169:A34S	A	-	1	0	PITX2	111762966	1.000000	0.71417	0.894000	0.35097	0.899000	0.52679	2.630000	0.46494	0.486000	0.27676	0.655000	0.94253	GCC	.	.		0.642	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256308.2		
SYNPO2	171024	hgsc.bcm.edu	37	4	119951690	119951690	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:119951690G>T	ENST00000429713.2	+	4	1942	c.1760G>T	c.(1759-1761)aGa>aTa	p.R587I	SYNPO2_ENST00000434046.2_Missense_Mutation_p.R587I|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_Missense_Mutation_p.R587I	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	587						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CCCATGAATAGAACGGCCAAA	0.537																																					p.R587I		Atlas-SNP	.											.	SYNPO2	353	.	0			c.G1760T						.						102.0	95.0	97.0					4																	119951690		2203	4300	6503	SO:0001583	missense	171024	exon4			TGAATAGAACGGC	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1760G>T	chr4.hg19:g.119951690G>T	ENSP00000395143:p.Arg587Ile	135.0	0.0		138.0	25.0	NM_001128934	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	hg19	CCDS47129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.93|12.93	2.084096|2.084096	0.36758|0.36758	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046|ENST00000504178	T;T;T|.	0.43294|.	0.95;0.95;0.95|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|.	0.71929|.	0.3398|.	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.76494|.	0.999;0.998;0.999;0.999|.	D;D;D;D|.	0.85130|.	0.997;0.914;0.997;0.994|.	T|.	0.71869|.	-0.4462|.	9|.	.|.	.|.	.|.	-17.4592|-17.4592	12.7569|12.7569	0.57341|0.57341	0.0783:0.0:0.9217:0.0|0.0783:0.0:0.9217:0.0	.|.	587;587;587;587|.	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6|.	.;.;.;SYNP2_HUMAN|.	I|Y	587|538	ENSP00000306015:R587I;ENSP00000395143:R587I;ENSP00000390965:R587I|.	.|.	R|X	+|+	2|3	0|2	SYNPO2|SYNPO2	120171138|120171138	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.015000|0.015000	0.08874|0.08874	4.749000|4.749000	0.62155|0.62155	2.530000|2.530000	0.85305|0.85305	0.655000|0.655000	0.94253|0.94253	AGA|TAG	.	.		0.537	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
MAB21L2	10586	hgsc.bcm.edu	37	4	151505054	151505054	+	Nonsense_Mutation	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr4:151505054G>A	ENST00000317605.4	+	1	1978	c.873G>A	c.(871-873)tgG>tgA	p.W291*	LRBA_ENST00000507224.1_Intron|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000357115.3_Intron|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000510413.1_Intron|LRBA_ENST00000503716.1_5'Flank	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	291					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		AAACGGACTGGGACGAGTCGT	0.637																																					p.W291X		Atlas-SNP	.											.	MAB21L2	53	.	0			c.G873A						.						97.0	86.0	90.0					4																	151505054		2203	4300	6503	SO:0001587	stop_gained	10586	exon1			GGACTGGGACGAG	AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.873G>A	chr4.hg19:g.151505054G>A	ENSP00000324701:p.Trp291*	154.0	0.0		145.0	55.0	NM_006439	B3KP37|Q9HBA7	Nonsense_Mutation	SNP	ENST00000317605.4	hg19	CCDS3774.1	.	.	.	.	.	.	.	.	.	.	G	45	12.033157	0.99629	.	.	ENSG00000181541	ENST00000317605	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.9011	18.9656	0.92695	0.0:0.0:1.0:0.0	.	.	.	.	X	291	.	ENSP00000324701:W291X	W	+	3	0	MAB21L2	151724504	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.550000	0.86006	0.462000	0.41574	TGG	.	.		0.637	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439	
SEMA5A	9037	hgsc.bcm.edu	37	5	9227034	9227034	+	Missense_Mutation	SNP	G	G	A	rs139668453		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:9227034G>A	ENST00000382496.5	-	7	1044	c.379C>T	c.(379-381)Cgg>Tgg	p.R127W		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	127	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GTGAATAACCGGTCGCCACCC	0.403																																					p.R127W		Atlas-SNP	.											.	SEMA5A	236	.	0			c.C379T						.	G	TRP/ARG	0,4406		0,0,2203	65.0	68.0	67.0		379	1.0	0.0	5	dbSNP_134	67	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SEMA5A	NM_003966.2	101	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	127/1075	9227034	2,13004	2203	4300	6503	SO:0001583	missense	9037	exon7			ATAACCGGTCGCC	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.379C>T	chr5.hg19:g.9227034G>A	ENSP00000371936:p.Arg127Trp	803.0	1.0		555.0	250.0	NM_003966	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	hg19	CCDS3875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.86|13.86	2.363229|2.363229	0.41902|0.41902	0.0|0.0	2.33E-4|2.33E-4	ENSG00000112902|ENSG00000112902	ENST00000514923|ENST00000382496;ENST00000513968	.|T;T	.|0.12039	.|2.72;2.72	4.93|4.93	1.05|1.05	0.20165|0.20165	.|WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	.|0.179987	.|0.47852	.|N	.|0.000216	T|T	0.16041|0.16041	0.0386|0.0386	M|M	0.84082|0.84082	2.675|2.675	0.48511|0.48511	D|D	0.999665|0.999665	.|B	.|0.11235	.|0.004	.|B	.|0.08055	.|0.003	T|T	0.03898|0.03898	-1.0994|-1.0994	5|10	.|0.56958	.|D	.|0.05	.|.	4.3178|4.3178	0.11002|0.11002	0.1732:0.0:0.5138:0.3131|0.1732:0.0:0.5138:0.3131	.|.	.|127	.|Q13591	.|SEM5A_HUMAN	L|W	74|127	.|ENSP00000371936:R127W;ENSP00000421961:R127W	.|ENSP00000371936:R127W	P|R	-|-	2|1	0|2	SEMA5A|SEMA5A	9280034|9280034	1.000000|1.000000	0.71417|0.71417	0.039000|0.039000	0.18376|0.18376	0.989000|0.989000	0.77384|0.77384	0.819000|0.819000	0.27308|0.27308	-0.025000|-0.025000	0.13918|0.13918	0.655000|0.655000	0.94253|0.94253	CCG|CGG	.	G|1.000;A|0.000		0.403	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
DNAH5	1767	hgsc.bcm.edu	37	5	13894846	13894846	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:13894846C>T	ENST00000265104.4	-	16	2448	c.2344G>A	c.(2344-2346)Gat>Aat	p.D782N	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	782	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGAGCTTCATCCACTTTGGCC	0.438									Kartagener syndrome																												p.D782N		Atlas-SNP	.											.	DNAH5	868	.	0			c.G2344A						.						177.0	164.0	169.0					5																	13894846		2203	4300	6503	SO:0001583	missense	1767	exon16	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CTTCATCCACTTT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.2344G>A	chr5.hg19:g.13894846C>T	ENSP00000265104:p.Asp782Asn	108.0	0.0		60.0	13.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819972	0.50633	.	.	ENSG00000039139	ENST00000265104	T	0.57273	0.41	5.44	3.63	0.41609	Dynein heavy chain, domain-1 (1);	0.095346	0.64402	D	0.000001	T	0.58509	0.2127	M	0.82630	2.6	0.50813	D	0.999893	B	0.26845	0.161	B	0.35899	0.213	T	0.55604	-0.8115	10	0.37606	T	0.19	.	10.895	0.47017	0.0:0.7982:0.1309:0.0709	.	782	Q8TE73	DYH5_HUMAN	N	782	ENSP00000265104:D782N	ENSP00000265104:D782N	D	-	1	0	DNAH5	13947846	1.000000	0.71417	0.993000	0.49108	0.596000	0.36781	4.314000	0.59166	0.648000	0.30732	-0.479000	0.04858	GAT	.	.		0.438	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
MTMR12	54545	hgsc.bcm.edu	37	5	32230150	32230150	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:32230150T>C	ENST00000382142.3	-	16	2148	c.1978A>G	c.(1978-1980)Act>Gct	p.T660A	MTMR12_ENST00000264934.5_Missense_Mutation_p.T550A|MTMR12_ENST00000280285.5_Missense_Mutation_p.T606A|MTMR12_ENST00000510216.1_5'Flank	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	660						cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TTGCTCAGAGTGGCCACTTGG	0.562																																					p.T660A		Atlas-SNP	.											.	MTMR12	76	.	0			c.A1978G						.						104.0	113.0	110.0					5																	32230150		2203	4300	6503	SO:0001583	missense	54545	exon16			TCAGAGTGGCCAC	AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.1978A>G	chr5.hg19:g.32230150T>C	ENSP00000371577:p.Thr660Ala	111.0	0.0		107.0	44.0	NM_001040446	Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	ENST00000382142.3	hg19	CCDS34138.1	.	.	.	.	.	.	.	.	.	.	T	3.410	-0.120354	0.06838	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	T;T;T	0.39229	1.09;1.09;1.09	5.78	1.99	0.26369	.	0.344395	0.27139	N	0.020755	T	0.28632	0.0709	L	0.39633	1.23	0.20563	N	0.999883	B;B;P	0.34837	0.003;0.287;0.472	B;B;B	0.35182	0.004;0.124;0.197	T	0.14309	-1.0477	10	0.19590	T	0.45	.	6.7996	0.23744	0.0:0.1339:0.128:0.7381	.	550;606;660	Q9C0I1-3;Q9C0I1-2;Q9C0I1	.;.;MTMRC_HUMAN	A	606;660;550	ENSP00000280285:T606A;ENSP00000371577:T660A;ENSP00000264934:T550A	ENSP00000264934:T550A	T	-	1	0	MTMR12	32265907	1.000000	0.71417	0.211000	0.23655	0.917000	0.54804	2.762000	0.47597	0.107000	0.17824	0.459000	0.35465	ACT	.	.		0.562	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366579.1	NM_019061	
NPR3	4883	hgsc.bcm.edu	37	5	32711930	32711930	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:32711930C>T	ENST00000265074.8	+	1	391	c.48C>T	c.(46-48)ggC>ggT	p.G16G	NPR3_ENST00000434067.2_Intron|NPR3_ENST00000415685.2_Intron|NPR3_ENST00000415167.2_Silent_p.G16G	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	16					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	TACTACTCGGCTGGGCGTTGC	0.736																																					p.G16G		Atlas-SNP	.											.	NPR3	65	.	0			c.C48T						.						3.0	4.0	4.0					5																	32711930		1436	2889	4325	SO:0001819	synonymous_variant	4883	exon1			ACTCGGCTGGGCG		CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.48C>T	chr5.hg19:g.32711930C>T		157.0	0.0		135.0	44.0	NM_000908	A2RRD1|B4DT84|E7EPG9	Silent	SNP	ENST00000265074.8	hg19	CCDS56357.1																																																																																			.	.		0.736	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317550.3	NM_000908	
DAB2	1601	hgsc.bcm.edu	37	5	39392502	39392502	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:39392502G>T	ENST00000320816.6	-	4	762	c.295C>A	c.(295-297)Ctt>Att	p.L99I	DAB2_ENST00000339788.6_Missense_Mutation_p.L99I|DAB2_ENST00000545653.1_Missense_Mutation_p.L99I|DAB2_ENST00000509337.1_Missense_Mutation_p.L99I|DAB2_ENST00000512525.1_5'UTR	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	99	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			ATCCCAGAAAGGGAAATGTTG	0.428																																					p.L99I		Atlas-SNP	.											.	DAB2	124	.	0			c.C295A						.						94.0	99.0	98.0					5																	39392502		2203	4300	6503	SO:0001583	missense	1601	exon4			CAGAAAGGGAAAT	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.295C>A	chr5.hg19:g.39392502G>T	ENSP00000313391:p.Leu99Ile	60.0	0.0		67.0	11.0	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	ENST00000320816.6	hg19	CCDS34149.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696212	0.48202	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.71	3.92	0.45320	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.052775	0.85682	D	0.000000	T	0.28699	0.0711	N	0.25426	0.745	0.44595	D	0.997561	B;B	0.34214	0.442;0.282	P;B	0.53549	0.729;0.301	T	0.07385	-1.0775	10	0.25106	T	0.35	-13.0302	12.6941	0.56992	0.1348:0.0:0.8652:0.0	.	99;99	P98082;P98082-3	DAB2_HUMAN;.	I	99	ENSP00000313391:L99I;ENSP00000345508:L99I;ENSP00000439919:L99I;ENSP00000426245:L99I	ENSP00000313391:L99I	L	-	1	0	DAB2	39428259	1.000000	0.71417	0.772000	0.31596	0.991000	0.79684	3.380000	0.52448	0.761000	0.33130	-0.136000	0.14681	CTT	.	.		0.428	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
MAP1B	4131	hgsc.bcm.edu	37	5	71496132	71496132	+	Missense_Mutation	SNP	A	A	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:71496132A>T	ENST00000296755.7	+	5	7248	c.6950A>T	c.(6949-6951)gAc>gTc	p.D2317V		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2317	Mediates interaction with TMEM185A.				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		GAAGAGAAAGACAAGGAGACC	0.522																																					p.D2317V	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.A6950T						.						119.0	121.0	120.0					5																	71496132		2203	4300	6503	SO:0001583	missense	4131	exon5			AGAAAGACAAGGA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6950A>T	chr5.hg19:g.71496132A>T	ENSP00000296755:p.Asp2317Val	194.0	0.0		179.0	72.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	hg19	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	A	18.38	3.612111	0.66672	.	.	ENSG00000131711	ENST00000296755	T	0.03663	3.85	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000001	T	0.13200	0.0320	L	0.43152	1.355	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.74348	0.983;0.942	T	0.00461	-1.1725	10	0.87932	D	0	-27.9704	16.2302	0.82332	1.0:0.0:0.0:0.0	.	2191;2317	A2BDK6;P46821	.;MAP1B_HUMAN	V	2317	ENSP00000296755:D2317V	ENSP00000296755:D2317V	D	+	2	0	MAP1B	71531888	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.715000	0.74697	2.228000	0.72767	0.533000	0.62120	GAC	.	.		0.522	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
LYSMD3	116068	hgsc.bcm.edu	37	5	89815032	89815032	+	Silent	SNP	T	T	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:89815032T>A	ENST00000315948.6	-	3	669	c.525A>T	c.(523-525)acA>acT	p.T175T	LYSMD3_ENST00000500869.2_Intron|LYSMD3_ENST00000509384.1_3'UTR	NM_198273.1	NP_938014.1	Q7Z3D4	LYSM3_HUMAN	LysM, putative peptidoglycan-binding, domain containing 3	175						integral component of membrane (GO:0016021)				breast(2)|large_intestine(1)|lung(2)|prostate(1)|urinary_tract(1)	7		all_cancers(142;5.03e-09)|all_epithelial(76;1.23e-11)|Lung NSC(167;2.46e-05)|all_lung(232;3.25e-05)|Ovarian(174;0.00832)|Colorectal(57;0.122)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-31)|Epithelial(54;5.22e-26)|all cancers(79;2.42e-22)		TCTTATTGTCTGTACACTTTA	0.388																																					p.T175T		Atlas-SNP	.											.	LYSMD3	25	.	0			c.A525T						.						201.0	193.0	195.0					5																	89815032		1859	4107	5966	SO:0001819	synonymous_variant	116068	exon3			ATTGTCTGTACAC	BX537972	CCDS43338.1, CCDS68911.1	5q14.3	2010-12-09			ENSG00000176018	ENSG00000176018			26969	protein-coding gene	gene with protein product							Standard	NM_001286812		Approved	FLJ13542	uc003kjr.3	Q7Z3D4	OTTHUMG00000162667	ENST00000315948.6:c.525A>T	chr5.hg19:g.89815032T>A		104.0	0.0		110.0	20.0	NM_198273	Q5H9U0|Q6PEK0|Q9NTE9	Silent	SNP	ENST00000315948.6	hg19	CCDS43338.1																																																																																			.	.		0.388	LYSMD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369987.2	XM_371760	
TCOF1	6949	hgsc.bcm.edu	37	5	149772339	149772339	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:149772339G>T	ENST00000504761.2	+	22	3586	c.3586G>T	c.(3586-3588)Gtg>Ttg	p.V1196L	TCOF1_ENST00000377797.3_Missense_Mutation_p.V1197L|TCOF1_ENST00000445265.2_Missense_Mutation_p.V1120L|TCOF1_ENST00000513346.1_Missense_Mutation_p.V1196L|TCOF1_ENST00000439160.2_Missense_Mutation_p.V1159L|TCOF1_ENST00000451292.1_Missense_Mutation_p.V1233L|TCOF1_ENST00000323668.7_Missense_Mutation_p.V1119L			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1196					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGATGATGTGGTGGCGCCATC	0.622																																					p.V1196L		Atlas-SNP	.											.	TCOF1	154	.	0			c.G3586T						.						53.0	50.0	51.0					5																	149772339		2203	4300	6503	SO:0001583	missense	6949	exon22			GATGTGGTGGCGC		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3586G>T	chr5.hg19:g.149772339G>T	ENSP00000421655:p.Val1196Leu	94.0	0.0		79.0	8.0	NM_001135243	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	hg19	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790003	0.70337	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	5.55	3.37	0.38596	.	0.000000	0.35936	N	0.002893	T	0.59376	0.2189	L	0.36672	1.1	0.20196	N	0.999927	D;D;D;D;D	0.60160	0.974;0.987;0.974;0.978;0.987	P;P;P;P;P	0.54100	0.742;0.742;0.742;0.557;0.742	T	0.51988	-0.8635	10	0.72032	D	0.01	-10.0827	7.514	0.27590	0.1013:0.1735:0.7252:0.0	.	1159;1119;1158;1196;1120	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	L	1233;1197;1120;1119;1159;1158;1196;1196	ENSP00000400939:V1233L;ENSP00000367028:V1197L;ENSP00000409944:V1120L;ENSP00000325223:V1119L;ENSP00000406888:V1159L;ENSP00000390717:V1158L;ENSP00000421655:V1196L;ENSP00000427484:V1196L	ENSP00000325223:V1119L	V	+	1	0	TCOF1	149752532	1.000000	0.71417	0.967000	0.41034	0.977000	0.68977	2.246000	0.43142	1.293000	0.44690	0.561000	0.74099	GTG	.	.		0.622	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
ATP10B	23120	hgsc.bcm.edu	37	5	160071238	160071238	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr5:160071238G>T	ENST00000327245.5	-	9	1621	c.775C>A	c.(775-777)Cag>Aag	p.Q259K		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	259					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTCCTGGTCTGGTCAGGATGC	0.522																																					p.Q259K		Atlas-SNP	.											.	ATP10B	201	.	0			c.C775A						.						95.0	95.0	95.0					5																	160071238		1988	4156	6144	SO:0001583	missense	23120	exon9			TGGTCTGGTCAGG	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.775C>A	chr5.hg19:g.160071238G>T	ENSP00000313600:p.Gln259Lys	110.0	0.0		94.0	31.0	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	hg19	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	G	2.002	-0.429275	0.04701	.	.	ENSG00000118322	ENST00000327245	T	0.73258	-0.73	4.8	-2.03	0.07365	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.441709	0.24452	N	0.038409	T	0.36220	0.0959	N	0.02158	-0.66	0.24060	N	0.996015	B;B;B;B	0.10296	0.003;0.0;0.001;0.0	B;B;B;B	0.09377	0.004;0.001;0.002;0.002	T	0.28522	-1.0041	9	.	.	.	.	9.8556	0.41084	0.0:0.3255:0.2316:0.443	.	303;259;231;259	B4DHG1;O94823-2;O94823-3;O94823	.;.;.;AT10B_HUMAN	K	259	ENSP00000313600:Q259K	.	Q	-	1	0	ATP10B	160003816	0.372000	0.25064	0.640000	0.29408	0.990000	0.78478	-0.020000	0.12525	-0.937000	0.03719	-0.261000	0.10672	CAG	.	.		0.522	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
CRISP1	167	hgsc.bcm.edu	37	6	49806179	49806179	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr6:49806179C>T	ENST00000335847.4	-	7	694	c.593G>A	c.(592-594)tGc>tAc	p.C198Y	CRISP1_ENST00000505118.1_Missense_Mutation_p.C198Y|CRISP1_ENST00000536021.1_Intron|CRISP1_ENST00000355791.2_Missense_Mutation_p.C198Y|CRISP1_ENST00000507853.1_Intron|CRISP1_ENST00000329411.5_Intron	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	198					binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)			endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					GTTACTTGGGCAGGCTTCACA	0.358																																					p.C198Y		Atlas-SNP	.											.	CRISP1	45	.	0			c.G593A						.						167.0	161.0	163.0					6																	49806179		2203	4300	6503	SO:0001583	missense	167	exon7			CTTGGGCAGGCTT	D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.593G>A	chr6.hg19:g.49806179C>T	ENSP00000338276:p.Cys198Tyr	99.0	0.0		136.0	20.0	NM_001205220	B5BU98|O00698|Q13248|Q14082|Q96SF6	Missense_Mutation	SNP	ENST00000335847.4	hg19	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	C	14.91	2.676642	0.47886	.	.	ENSG00000124812	ENST00000335847;ENST00000355791;ENST00000505118	T;T;T	0.25579	1.79;1.79;1.79	4.85	3.97	0.46021	Cysteine-rich secretory protein (1);	0.000000	0.85682	D	0.000000	T	0.49064	0.1535	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62039	-0.6938	9	.	.	.	.	11.4627	0.50219	0.0:0.818:0.182:0.0	.	198	P54107	CRIS1_HUMAN	Y	198	ENSP00000338276:C198Y;ENSP00000348044:C198Y;ENSP00000427589:C198Y	.	C	-	2	0	CRISP1	49914138	0.999000	0.42202	0.235000	0.24058	0.007000	0.05969	2.277000	0.43417	1.150000	0.42419	0.650000	0.86243	TGC	.	.		0.358	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	
GCM1	8521	hgsc.bcm.edu	37	6	52999070	52999070	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr6:52999070T>A	ENST00000259803.7	-	3	339	c.128A>T	c.(127-129)cAc>cTc	p.H43L		NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	43					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					GCTGTAGATGTGTTTGGCATA	0.488																																					p.H43L		Atlas-SNP	.											.	GCM1	47	.	0			c.A128T						.						119.0	110.0	113.0					6																	52999070		2203	4300	6503	SO:0001583	missense	8521	exon3			TAGATGTGTTTGG	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.128A>T	chr6.hg19:g.52999070T>A	ENSP00000259803:p.His43Leu	137.0	0.0		149.0	17.0	NM_003643	Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	ENST00000259803.7	hg19	CCDS4950.1	.	.	.	.	.	.	.	.	.	.	T	8.363	0.833474	0.16820	.	.	ENSG00000137270	ENST00000259803	T	0.72942	-0.7	4.84	3.66	0.41972	.	0.090351	0.47093	D	0.000250	T	0.30885	0.0779	N	0.05078	-0.115	0.39922	D	0.974165	P	0.46142	0.873	P	0.46825	0.528	T	0.13469	-1.0508	10	0.15066	T	0.55	-2.2513	5.4822	0.16729	0.1428:0.1234:0.0:0.7338	.	43	Q9NP62	GCM1_HUMAN	L	43	ENSP00000259803:H43L	ENSP00000259803:H43L	H	-	2	0	GCM1	53107029	1.000000	0.71417	0.988000	0.46212	0.236000	0.25371	0.988000	0.29616	0.833000	0.34828	0.533000	0.62120	CAC	.	.		0.488	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040953.1		
POU3F2	5454	hgsc.bcm.edu	37	6	99283620	99283620	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr6:99283620G>A	ENST00000328345.5	+	1	1041	c.871G>A	c.(871-873)Gtg>Atg	p.V291M		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	291	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		CCAAGCGGACGTGGGGCTGGC	0.607																																					p.V291M		Atlas-SNP	.											.	POU3F2	33	.	0			c.G871A						.						184.0	193.0	190.0					6																	99283620		2203	4300	6503	SO:0001583	missense	5454	exon1			GCGGACGTGGGGC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.871G>A	chr6.hg19:g.99283620G>A	ENSP00000329170:p.Val291Met	168.0	0.0		135.0	27.0	NM_005604	Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	ENST00000328345.5	hg19	CCDS5040.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783505	0.70222	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	D	0.89875	-2.58	4.47	4.47	0.54385	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.64402	U	0.000019	D	0.94135	0.8119	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95003	0.8145	10	0.87932	D	0	.	16.042	0.80691	0.0:0.0:1.0:0.0	.	291	P20265	PO3F2_HUMAN	M	291;224	ENSP00000329170:V291M	ENSP00000329170:V291M	V	+	1	0	POU3F2	99390341	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	9.530000	0.98051	2.306000	0.77630	0.305000	0.20034	GTG	.	.		0.607	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
STXBP5	134957	hgsc.bcm.edu	37	6	147704135	147704135	+	Splice_Site	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr6:147704135G>A	ENST00000321680.6	+	27	3414		c.e27+1		STXBP5_ENST00000367480.3_Splice_Site|STXBP5_ENST00000367481.3_Splice_Site|STXBP5_ENST00000179882.6_Splice_Site	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)						exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TGCTCATGAGGTACGACTCTC	0.383																																					.		Atlas-SNP	.											.	STXBP5	163	.	0			c.3306+1G>A						.						59.0	61.0	61.0					6																	147704135		2203	4300	6503	SO:0001630	splice_region_variant	134957	exon25			CATGAGGTACGAC	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.3414+1G>A	chr6.hg19:g.147704135G>A		116.0	0.0		65.0	48.0	NM_139244	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Splice_Site	SNP	ENST00000321680.6	hg19	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757575	0.69648	.	.	ENSG00000164506	ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3423	0.94349	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STXBP5	147745828	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	9.794000	0.99096	2.652000	0.90054	0.460000	0.39030	.	.	.		0.383	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		Intron
HOXA4	3201	hgsc.bcm.edu	37	7	27170333	27170333	+	Missense_Mutation	SNP	A	A	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:27170333A>G	ENST00000360046.5	-	1	85	c.20T>C	c.(19-21)tTg>tCg	p.L7S	HOXA-AS2_ENST00000521687.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA3_ENST00000521401.1_Intron|RP1-170O19.22_ENST00000467897.2_RNA|HOXA4_ENST00000428284.2_Missense_Mutation_p.L7S|HOXA-AS2_ENST00000521159.1_RNA|HOXA-AS3_ENST00000518848.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	7					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						GGAGTTTATCAAAAACGAGCT	0.582																																					p.L7S		Atlas-SNP	.											.	HOXA4	21	.	0			c.T20C						.						16.0	16.0	16.0					7																	27170333		2201	4291	6492	SO:0001583	missense	3201	exon1			TTTATCAAAAACG		CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.20T>C	chr7.hg19:g.27170333A>G	ENSP00000353151:p.Leu7Ser	310.0	0.0		255.0	43.0	NM_002141	A4D180|O43366	Missense_Mutation	SNP	ENST00000360046.5	hg19	CCDS5405.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.321792	0.41096	.	.	ENSG00000197576	ENST00000360046;ENST00000428284;ENST00000552601;ENST00000548581	D;D	0.83419	-1.72;-1.72	3.63	3.63	0.41609	.	0.000000	0.28877	N	0.013857	D	0.90051	0.6893	M	0.78637	2.42	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.91178	0.4974	10	0.87932	D	0	.	12.6889	0.56964	1.0:0.0:0.0:0.0	.	7	Q00056	HXA4_HUMAN	S	7	ENSP00000353151:L7S;ENSP00000408845:L7S	ENSP00000353151:L7S	L	-	2	0	HOXA4	27136858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.663000	0.83820	1.644000	0.50603	0.491000	0.48974	TTG	.	.		0.582	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059534.4		
URGCP	55665	hgsc.bcm.edu	37	7	43921551	43921551	+	Nonsense_Mutation	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:43921551C>A	ENST00000453200.1	-	4	611	c.118G>T	c.(118-120)Gaa>Taa	p.E40*	URGCP_ENST00000446958.1_Nonsense_Mutation_p.E31*|URGCP_ENST00000443736.1_5'UTR|URGCP-MRPS24_ENST00000603700.1_Nonsense_Mutation_p.E31*|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000447717.3_5'UTR|URGCP_ENST00000336086.6_5'UTR|URGCP_ENST00000223341.7_5'UTR|URGCP_ENST00000402306.3_Nonsense_Mutation_p.E31*			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	40					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						tcTCTCCATTCCAAATCTAGA	0.418																																					p.E40X		Atlas-SNP	.											.	URGCP	170	.	0			c.G118T						.						137.0	135.0	136.0					7																	43921551		1847	4084	5931	SO:0001587	stop_gained	55665	exon4			TCCATTCCAAATC		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.118G>T	chr7.hg19:g.43921551C>A	ENSP00000396918:p.Glu40*	89.0	0.0		91.0	10.0	NM_001077663	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Nonsense_Mutation	SNP	ENST00000453200.1	hg19	CCDS47578.1	.	.	.	.	.	.	.	.	.	.	C	41	8.824523	0.98968	.	.	ENSG00000106608	ENST00000402306;ENST00000453200;ENST00000446958	.	.	.	4.68	4.68	0.58851	.	0.000000	0.49305	D	0.000154	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-26.3343	13.4128	0.60952	0.0:1.0:0.0:0.0	.	.	.	.	X	31;40;31	.	ENSP00000384955:E31X	E	-	1	0	URGCP	43888076	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.650000	0.46665	2.884000	0.98904	0.655000	0.94253	GAA	.	.		0.418	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338995.1	NM_001077664	
NACAD	23148	hgsc.bcm.edu	37	7	45121229	45121229	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:45121229G>T	ENST00000490531.2	-	4	4247	c.4228C>A	c.(4228-4230)Cag>Aag	p.Q1410K		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	1410					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CTGCGACTCTGCTTGGCTTTG	0.642																																					p.Q1410K		Atlas-SNP	.											.	NACAD	44	.	0			c.C4228A						.						99.0	87.0	91.0					7																	45121229		692	1591	2283	SO:0001583	missense	23148	exon4			GACTCTGCTTGGC	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.4228C>A	chr7.hg19:g.45121229G>T	ENSP00000420477:p.Gln1410Lys	88.0	0.0		71.0	25.0	NM_001146334		Missense_Mutation	SNP	ENST00000490531.2	hg19	CCDS47582.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985876	0.74589	.	.	ENSG00000136274	ENST00000490531	T	0.15372	2.43	4.58	4.58	0.56647	.	0.000000	0.64402	U	0.000001	T	0.30854	0.0778	L	0.34521	1.04	0.80722	D	1	D	0.64830	0.994	D	0.69654	0.965	T	0.05533	-1.0879	10	0.87932	D	0	-16.0133	16.1057	0.81220	0.0:0.0:1.0:0.0	.	1410	O15069	NACAD_HUMAN	K	1410	ENSP00000420477:Q1410K	ENSP00000420477:Q1410K	Q	-	1	0	NACAD	45087754	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.747000	0.85070	2.364000	0.80123	0.442000	0.29010	CAG	.	.		0.642	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
ZNF479	90827	hgsc.bcm.edu	37	7	57188071	57188071	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:57188071T>C	ENST00000331162.4	-	5	1321	c.1051A>G	c.(1051-1053)Aaa>Gaa	p.K351E		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	351					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GCATAGGGTTTCTCTCTAGTA	0.433																																					p.K351E		Atlas-SNP	.											.	ZNF479	193	.	0			c.A1051G						.						25.0	27.0	26.0					7																	57188071		2088	4253	6341	SO:0001583	missense	90827	exon5			AGGGTTTCTCTCT	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1051A>G	chr7.hg19:g.57188071T>C	ENSP00000333776:p.Lys351Glu	350.0	0.0		272.0	117.0	NM_033273		Missense_Mutation	SNP	ENST00000331162.4	hg19	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	t	11.06	1.526538	0.27299	.	.	ENSG00000185177	ENST00000331162	T	0.27104	1.69	0.946	0.946	0.19549	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.36991	0.0987	M	0.76328	2.33	0.29448	N	0.858676	D	0.67145	0.996	P	0.53954	0.738	T	0.31138	-0.9954	9	0.87932	D	0	.	5.7317	0.18042	0.0:0.0:0.0:1.0	.	351	Q96JC4	ZN479_HUMAN	E	351	ENSP00000333776:K351E	ENSP00000333776:K351E	K	-	1	0	ZNF479	57192013	0.407000	0.25352	0.037000	0.18230	0.035000	0.12851	2.842000	0.48230	0.339000	0.23719	0.329000	0.21502	AAA	.	.		0.433	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
SEMA3E	9723	hgsc.bcm.edu	37	7	83119477	83119477	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:83119477G>A	ENST00000307792.3	-	2	696	c.229C>T	c.(229-231)Ctt>Ttt	p.L77F	SEMA3E_ENST00000427262.1_Missense_Mutation_p.L17F	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	77	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GAATATACAAGGTCCCTGCCT	0.413																																					p.L77F		Atlas-SNP	.											.	SEMA3E	125	.	0			c.C229T						.						89.0	82.0	85.0					7																	83119477		2203	4300	6503	SO:0001583	missense	9723	exon2			ATACAAGGTCCCT	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.229C>T	chr7.hg19:g.83119477G>A	ENSP00000303212:p.Leu77Phe	99.0	0.0		77.0	22.0	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	hg19	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.815992	0.70912	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514;ENST00000442159	T;T;T	0.11063	2.81;2.81;2.81	5.92	4.99	0.66335	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.276307	0.36778	N	0.002409	T	0.19087	0.0458	L	0.34521	1.04	0.40511	D	0.980733	D	0.54964	0.969	P	0.61800	0.894	T	0.02326	-1.1176	10	0.20519	T	0.43	.	15.9138	0.79496	0.0:0.0:0.8642:0.1358	.	77	O15041	SEM3E_HUMAN	F	77;17;77;17	ENSP00000303212:L77F;ENSP00000405052:L17F;ENSP00000412867:L17F	ENSP00000303212:L77F	L	-	1	0	SEMA3E	82957413	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.177000	0.50871	2.814000	0.96858	0.585000	0.79938	CTT	.	.		0.413	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
ZNF804B	219578	hgsc.bcm.edu	37	7	88963831	88963831	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:88963831G>T	ENST00000333190.4	+	4	2144	c.1535G>T	c.(1534-1536)aGa>aTa	p.R512I		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	512							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAGACTAAAAGAGAGAGCCAA	0.373										HNSCC(36;0.09)																											p.R512I		Atlas-SNP	.											.	ZNF804B	322	.	0			c.G1535T						.						39.0	41.0	41.0					7																	88963831		2202	4299	6501	SO:0001583	missense	219578	exon4			CTAAAAGAGAGAG	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1535G>T	chr7.hg19:g.88963831G>T	ENSP00000329638:p.Arg512Ile	338.0	0.0		298.0	67.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	hg19	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	G	7.034	0.561250	0.13498	.	.	ENSG00000182348	ENST00000333190	T	0.04862	3.54	5.3	-9.86	0.00473	.	1.851780	0.02014	N	0.047226	T	0.01421	0.0046	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47824	-0.9087	10	0.36615	T	0.2	3.2589	2.1295	0.03747	0.313:0.1584:0.3848:0.1438	.	512	A4D1E1	Z804B_HUMAN	I	512	ENSP00000329638:R512I	ENSP00000329638:R512I	R	+	2	0	ZNF804B	88801767	0.000000	0.05858	0.000000	0.03702	0.300000	0.27592	-0.224000	0.09164	-1.337000	0.02236	-0.262000	0.10625	AGA	.	.		0.373	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
PEX1	5189	hgsc.bcm.edu	37	7	92118609	92118609	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:92118609C>G	ENST00000248633.4	-	23	3860	c.3765G>C	c.(3763-3765)gaG>gaC	p.E1255D	PEX1_ENST00000438045.1_Missense_Mutation_p.E933D|AC007566.10_ENST00000441539.1_RNA|AC007566.10_ENST00000427458.1_RNA|PEX1_ENST00000428214.1_Missense_Mutation_p.E1198D	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1255					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TTACTTACAGCTCAGCAAAAT	0.338																																					p.E1255D		Atlas-SNP	.											.	PEX1	102	.	0			c.G3765C						.						109.0	92.0	98.0					7																	92118609		2203	4300	6503	SO:0001583	missense	5189	exon23			TTACAGCTCAGCA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3765G>C	chr7.hg19:g.92118609C>G	ENSP00000248633:p.Glu1255Asp	97.0	0.0		115.0	15.0	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	hg19	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.500221	0.26861	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	D;D;D	0.94576	-3.41;-3.42;-3.46	5.32	0.00308	0.14053	.	0.312771	0.39146	N	0.001451	D	0.86981	0.6064	L	0.35723	1.085	0.80722	D	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.09377	0.004;0.004;0.004	T	0.75519	-0.3289	10	0.46703	T	0.11	-3.5957	1.3274	0.02128	0.1533:0.2427:0.1502:0.4538	.	933;1047;1255	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	D	933;1255;1198	ENSP00000410438:E933D;ENSP00000248633:E1255D;ENSP00000394413:E1198D	ENSP00000248633:E1255D	E	-	3	2	PEX1	91956545	0.954000	0.32549	0.998000	0.56505	0.657000	0.38888	-0.012000	0.12699	0.290000	0.22444	-0.140000	0.14226	GAG	.	.		0.338	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
CALCR	799	hgsc.bcm.edu	37	7	93055707	93055707	+	Silent	SNP	G	G	A	rs138214388		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:93055707G>A	ENST00000394441.1	-	13	1701	c.1386C>T	c.(1384-1386)atC>atT	p.I462I	CALCR_ENST00000421592.1_Silent_p.I478I|CALCR_ENST00000360249.4_Silent_p.I478I|CALCR_ENST00000359558.2_Silent_p.I496I|CALCR_ENST00000426151.1_Silent_p.I462I	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor	496	Poly-Ala.				adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.I462I(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	TCAAAGGGATGATCTCAGCAC	0.507																																					p.I496I		Atlas-SNP	.											CALCR,arm,malignant_melanoma,0,1	CALCR	200	.	1	Substitution - coding silent(1)	skin(1)	c.C1488T						.						198.0	171.0	180.0					7																	93055707		2203	4300	6503	SO:0001819	synonymous_variant	799	exon16			AGGGATGATCTCA	L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.1386C>T	chr7.hg19:g.93055707G>A		97.0	0.0		81.0	26.0	NM_001164737	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	Silent	SNP	ENST00000394441.1	hg19	CCDS5631.1																																																																																			.	.		0.507	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254661.2	NM_001742	
PODXL	5420	hgsc.bcm.edu	37	7	131241049	131241049	+	Missense_Mutation	SNP	G	G	A	rs201847316		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:131241049G>A	ENST00000378555.3	-	1	317	c.70C>T	c.(70-72)Ccg>Tcg	p.P24S	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_Missense_Mutation_p.P24S|PODXL_ENST00000322985.9_Missense_Mutation_p.P24S|PODXL_ENST00000541194.1_Missense_Mutation_p.P24S			O00592	PODXL_HUMAN	podocalyxin-like	24					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacggcgacgacggc	0.736																																					p.P24S		Atlas-SNP	.											.	PODXL	53	.	0			c.C70T						.						4.0	7.0	6.0					7																	131241049		1890	3825	5715	SO:0001583	missense	5420	exon1			GCGACGGCGACGA		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.70C>T	chr7.hg19:g.131241049G>A	ENSP00000367817:p.Pro24Ser	170.0	0.0		125.0	7.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	hg19	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359685	0.24598	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.11604	2.96;2.76;2.97;2.95	.	.	.	.	7739.210000	0.00166	N	0.000002	T	0.11495	0.0280	N	0.08118	0	0.09310	N	0.999992	P;P	0.51449	0.945;0.909	P;P	0.56648	0.803;0.641	T	0.21008	-1.0258	8	0.34782	T	0.22	.	.	.	.	.	24;24	O00592-2;O00592	.;PODXL_HUMAN	S	24	ENSP00000440518:P24S;ENSP00000442655:P24S;ENSP00000367817:P24S;ENSP00000319782:P24S	ENSP00000319782:P24S	P	-	1	0	PODXL	130891589	0.006000	0.16342	0.042000	0.18584	0.043000	0.13939	1.910000	0.39927	0.088000	0.17205	0.089000	0.15464	CCG	.	.		0.736	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
SSPO	23145	hgsc.bcm.edu	37	7	149480011	149480011	+	RNA	SNP	C	C	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:149480011C>G	ENST00000378016.2	+	0	1977							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCGAGCTTCCTCTGCCTTTC	0.657																																					p.S659S		Atlas-SNP	.											.	.	.	.	0			c.C1977G						.						42.0	52.0	49.0					7																	149480011		2150	4253	6403			23145	exon15			AGCTTCCTCTGCC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149480011C>G		91.0	0.0		72.0	9.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.657	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
SSPO	23145	hgsc.bcm.edu	37	7	149480083	149480083	+	RNA	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:149480083C>T	ENST00000378016.2	+	0	2049							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TAGCCTACATCACCCTGGACC	0.657																																					p.I683I		Atlas-SNP	.											.	.	.	.	0			c.C2049T						.						31.0	37.0	35.0					7																	149480083		2090	4203	6293			23145	exon15			CTACATCACCCTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149480083C>T		110.0	0.0		95.0	11.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.657	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
GIMAP8	155038	hgsc.bcm.edu	37	7	150171329	150171329	+	Silent	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:150171329G>A	ENST00000307271.3	+	4	1486	c.912G>A	c.(910-912)ccG>ccA	p.P304P		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	304	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		TTGATGCTCCGGACATCTCAT	0.458																																					p.P304P		Atlas-SNP	.											GIMAP8,NS,carcinoma,0,2	GIMAP8	136	.	0			c.G912A						.						78.0	85.0	83.0					7																	150171329		2203	4300	6503	SO:0001819	synonymous_variant	155038	exon4			TGCTCCGGACATC	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.912G>A	chr7.hg19:g.150171329G>A		184.0	0.0		90.0	6.0	NM_175571		Silent	SNP	ENST00000307271.3	hg19	CCDS34777.1																																																																																			.	.		0.458	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
GIMAP4	55303	hgsc.bcm.edu	37	7	150269493	150269493	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:150269493C>T	ENST00000255945.2	+	3	510	c.335C>T	c.(334-336)cCa>cTa	p.P112L	GIMAP4_ENST00000461940.1_Missense_Mutation_p.P126L|GIMAP4_ENST00000494750.1_3'UTR	NM_018326.2	NP_060796.1	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	112	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGACCTCCCCAGGGCCTCAT	0.512																																					p.P112L		Atlas-SNP	.											.	GIMAP4	61	.	0			c.C335T						.						101.0	92.0	95.0					7																	150269493		2203	4300	6503	SO:0001583	missense	55303	exon3			CCTCCCCAGGGCC	AK001972	CCDS5904.1	7q36.1	2014-04-04			ENSG00000133574	ENSG00000133574		"""GTPases, IMAP"""	21872	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 1"""	608087				15474311, 18701445	Standard	NM_018326		Approved	HIMAP4, FLJ11110, IMAP4, IAN1	uc003whl.3	Q9NUV9	OTTHUMG00000157475	ENST00000255945.2:c.335C>T	chr7.hg19:g.150269493C>T	ENSP00000255945:p.Pro112Leu	176.0	0.0		203.0	33.0	NM_018326		Missense_Mutation	SNP	ENST00000255945.2	hg19	CCDS5904.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.340210	0.60963	.	.	ENSG00000133574	ENST00000255945;ENST00000461940;ENST00000479232	T;T;T	0.06068	3.35;3.35;3.35	4.72	4.72	0.59763	AIG1 (1);	0.059524	0.64402	D	0.000002	T	0.33177	0.0854	M	0.93638	3.44	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.98;0.998	T	0.37197	-0.9716	10	0.87932	D	0	.	13.0417	0.58904	0.0:1.0:0.0:0.0	.	126;112	G5E9W9;Q9NUV9	.;GIMA4_HUMAN	L	112;126;126	ENSP00000255945:P112L;ENSP00000419545:P126L;ENSP00000418615:P126L	ENSP00000255945:P112L	P	+	2	0	GIMAP4	149900426	0.969000	0.33509	0.661000	0.29709	0.125000	0.20455	4.031000	0.57267	2.473000	0.83533	0.655000	0.94253	CCA	.	.		0.512	GIMAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348927.1	NM_018326	
KCNH2	3757	hgsc.bcm.edu	37	7	150649763	150649763	+	Missense_Mutation	SNP	G	G	A	rs199472901		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:150649763G>A	ENST00000262186.5	-	6	1708	c.1307C>T	c.(1306-1308)aCg>aTg	p.T436M	KCNH2_ENST00000330883.4_Missense_Mutation_p.T96M|KCNH2_ENST00000392968.2_Missense_Mutation_p.T340M|KCNH2_ENST00000430723.3_Missense_Mutation_p.T436M	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	436			T -> M (in LQT2).		cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GCCTTCTTCCGTCTCCTTCAG	0.597																																					p.T436M	GBM(137;110 1844 13671 20123 45161)	Atlas-SNP	.											.	KCNH2	157	.	0			c.C1307T	GRCh37	CM993712	KCNH2	M		.						139.0	125.0	129.0					7																	150649763		2203	4300	6503	SO:0001583	missense	3757	exon6			TCTTCCGTCTCCT	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.1307C>T	chr7.hg19:g.150649763G>A	ENSP00000262186:p.Thr436Met	129.0	0.0		59.0	21.0	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	hg19	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	G	8.326	0.825346	0.16749	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186;ENST00000350328;ENST00000430723	D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43	4.59	2.68	0.31781	.	0.377546	0.27896	N	0.017420	T	0.82047	0.4952	N	0.03608	-0.345	0.09310	N	1	P;B;B;B;B	0.46327	0.876;0.137;0.302;0.021;0.008	B;B;B;B;B	0.31442	0.13;0.027;0.042;0.018;0.005	T	0.76399	-0.2973	10	0.40728	T	0.16	.	12.5371	0.56147	0.0:0.3865:0.6135:0.0	.	340;436;96;436;96	C4PFH9;G5E9I0;Q708S9;Q12809;Q12809-2	.;.;.;KCNH2_HUMAN;.	M	96;340;436;96;436	ENSP00000328531:T96M;ENSP00000376695:T340M;ENSP00000262186:T436M;ENSP00000387657:T436M	ENSP00000262186:T436M	T	-	2	0	KCNH2	150280696	0.002000	0.14202	0.696000	0.30242	0.687000	0.40016	1.205000	0.32308	0.916000	0.36871	0.549000	0.68633	ACG	.	.		0.597	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
EPHX2	2053	hgsc.bcm.edu	37	8	27369359	27369359	+	Missense_Mutation	SNP	A	A	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr8:27369359A>T	ENST00000521400.1	+	6	1097	c.667A>T	c.(667-669)Aat>Tat	p.N223Y	EPHX2_ENST00000380476.3_Missense_Mutation_p.N170Y|EPHX2_ENST00000521780.1_Missense_Mutation_p.N157Y|EPHX2_ENST00000517536.1_Intron|EPHX2_ENST00000518379.1_Missense_Mutation_p.N223Y	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	223	Phosphatase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		ACAGCTTCTCAATACCCCGGC	0.532																																					p.N223Y		Atlas-SNP	.											.	EPHX2	57	.	0			c.A667T						.						188.0	163.0	171.0					8																	27369359		2203	4300	6503	SO:0001583	missense	2053	exon6			CTTCTCAATACCC	L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.667A>T	chr8.hg19:g.27369359A>T	ENSP00000430269:p.Asn223Tyr	122.0	0.0		61.0	35.0	NM_001979	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	ENST00000521400.1	hg19	CCDS6060.1	.	.	.	.	.	.	.	.	.	.	A	11.90	1.776149	0.31411	.	.	ENSG00000120915	ENST00000521400;ENST00000521780;ENST00000380476;ENST00000415449;ENST00000518379	T;T;T;T	0.36520	1.63;1.25;1.39;3.51	4.76	-9.52	0.00578	HAD-like domain (1);	1.266460	0.05101	N	0.487138	T	0.17023	0.0409	N	0.08118	0	0.09310	N	1	B;B;B	0.28801	0.014;0.223;0.038	B;B;B	0.23852	0.019;0.049;0.044	T	0.36163	-0.9759	10	0.62326	D	0.03	-11.9592	11.8602	0.52461	0.1262:0.5323:0.3415:0.0	.	223;223;223	E5RFU2;E7ETW9;P34913	.;.;HYES_HUMAN	Y	223;157;170;227;223	ENSP00000430269:N223Y;ENSP00000430302:N157Y;ENSP00000369843:N170Y;ENSP00000427956:N223Y	ENSP00000369843:N170Y	N	+	1	0	EPHX2	27425276	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.003000	0.03682	-1.961000	0.01016	0.459000	0.35465	AAT	.	.		0.532	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219954.4		
PREX2	80243	hgsc.bcm.edu	37	8	68950408	68950408	+	Silent	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr8:68950408T>C	ENST00000288368.4	+	7	997	c.720T>C	c.(718-720)acT>acC	p.T240T	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	240					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CCAACATCACTGACACCTGCA	0.353																																					p.T240T		Atlas-SNP	.											.	PREX2	614	.	0			c.T720C						.						124.0	118.0	120.0					8																	68950408		2203	4300	6503	SO:0001819	synonymous_variant	80243	exon7			CATCACTGACACC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.720T>C	chr8.hg19:g.68950408T>C		105.0	0.0		115.0	11.0	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	hg19	CCDS6201.1																																																																																			.	.		0.353	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
RUNX1T1	862	hgsc.bcm.edu	37	8	93003931	93003931	+	Missense_Mutation	SNP	G	G	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr8:93003931G>C	ENST00000523629.1	-	7	1381	c.927C>G	c.(925-927)caC>caG	p.H309Q	RUNX1T1_ENST00000396218.1_Missense_Mutation_p.H282Q|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.H272Q|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.H309Q|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.H272Q|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.H320Q|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.H282Q|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.H272Q	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	309					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CCCTGTAGTGGTGGGCAATGG	0.537																																					p.H368Q		Atlas-SNP	.											.	RUNX1T1	516	.	0			c.C1104G						.						221.0	182.0	195.0					8																	93003931		2203	4300	6503	SO:0001583	missense	862	exon7			GTAGTGGTGGGCA	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.927C>G	chr8.hg19:g.93003931G>C	ENSP00000428543:p.His309Gln	182.0	0.0		166.0	32.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	hg19	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.678132	0.68042	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.34667	1.37;1.35;1.37;1.35;1.35;1.35;1.36;1.35	6.17	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	L	0.55103	1.725	0.58432	D	0.999997	B;B;D	0.69078	0.415;0.129;0.997	B;B;D	0.71656	0.083;0.041;0.974	T	0.45293	-0.9271	10	0.29301	T	0.29	-21.2245	11.3316	0.49479	0.139:0.0:0.861:0.0	.	320;309;282	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	Q	309;282;309;272;272;272;320;282	ENSP00000428543:H309Q;ENSP00000379520:H282Q;ENSP00000265814:H309Q;ENSP00000353504:H272Q;ENSP00000390137:H272Q;ENSP00000428742:H272Q;ENSP00000402257:H320Q;ENSP00000430728:H282Q	ENSP00000265814:H309Q	H	-	3	2	RUNX1T1	93073107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.167000	0.64972	1.634000	0.50500	0.655000	0.94253	CAC	.	.		0.537	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
SEC16A	9919	hgsc.bcm.edu	37	9	139355726	139355726	+	Splice_Site	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr9:139355726C>A	ENST00000371706.3	-	11	4393	c.4360G>T	c.(4360-4362)Gat>Tat	p.D1454Y	SEC16A_ENST00000431893.2_Splice_Site_p.D1454Y|SEC16A_ENST00000290037.6_Splice_Site_p.D1454Y|SEC16A_ENST00000313050.7_Splice_Site_p.D1632Y			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1454					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCCAAAGCATCCTGCAAAAGG	0.547																																					p.D1632Y		Atlas-SNP	.											.	SEC16A	249	.	0			c.G4894T						.						47.0	49.0	49.0					9																	139355726		2078	4211	6289	SO:0001630	splice_region_variant	9919	exon13			AAGCATCCTGCAA	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.4360-1G>T	chr9.hg19:g.139355726C>A		91.0	0.0		66.0	26.0	NM_014866	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	ENST00000371706.3	hg19		.	.	.	.	.	.	.	.	.	.	C	21.0	4.076652	0.76415	.	.	ENSG00000148396	ENST00000313050;ENST00000277537;ENST00000453963;ENST00000371706;ENST00000290037;ENST00000431893;ENST00000404925	T;T;T;T;T;T	0.50813	1.73;0.73;1.35;1.74;1.74;1.73	5.23	5.23	0.72850	.	0.098725	0.64402	D	0.000002	T	0.70868	0.3273	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.999;1.0	T	0.74601	-0.3611	10	0.87932	D	0	-24.6315	18.1559	0.89690	0.0:1.0:0.0:0.0	.	1632;1454;1454;1022	F1T0I1;O15027-5;O15027-4;A4QN19	.;.;.;.	Y	1632;26;354;1454;1454;1454;1022	ENSP00000325827:D1632Y;ENSP00000277537:D26Y;ENSP00000403525:D354Y;ENSP00000360771:D1454Y;ENSP00000290037:D1454Y;ENSP00000387583:D1454Y	ENSP00000277537:D26Y	D	-	1	0	SEC16A	138475547	1.000000	0.71417	0.999000	0.59377	0.559000	0.35586	7.432000	0.80349	2.612000	0.88384	0.561000	0.74099	GAT	.	.		0.547	SEC16A-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000055077.1	XM_088459	Missense_Mutation
ANK3	288	hgsc.bcm.edu	37	10	61832737	61832737	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr10:61832737C>T	ENST00000280772.2	-	37	8093	c.7902G>A	c.(7900-7902)gtG>gtA	p.V2634V	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2634					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CTGTCAGTAGCACTTTCTCAG	0.507																																					p.V2634V		Atlas-SNP	.											.	ANK3	703	.	0			c.G7902A						.						105.0	82.0	90.0					10																	61832737		2203	4300	6503	SO:0001819	synonymous_variant	288	exon37			CAGTAGCACTTTC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.7902G>A	chr10.hg19:g.61832737C>T		105.0	0.0		92.0	31.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	ENST00000280772.2	hg19	CCDS7258.1																																																																																			.	.		0.507	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
JMJD1C	221037	hgsc.bcm.edu	37	10	64950795	64950795	+	Silent	SNP	G	G	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr10:64950795G>C	ENST00000399262.2	-	17	6368	c.6150C>G	c.(6148-6150)ggC>ggG	p.G2050G	JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Silent_p.G1813G|JMJD1C_ENST00000542921.1_Silent_p.G1868G	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2050					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GTGATGTTCTGCCATTTGGAG	0.393																																					p.G2050G		Atlas-SNP	.											.	JMJD1C	347	.	0			c.C6150G						.						300.0	289.0	292.0					10																	64950795		1896	4109	6005	SO:0001819	synonymous_variant	221037	exon17			TGTTCTGCCATTT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.6150C>G	chr10.hg19:g.64950795G>C		156.0	0.0		124.0	5.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	hg19	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	8.451	0.852998	0.17106	.	.	ENSG00000171988	ENST00000327520	.	.	.	5.35	3.51	0.40186	.	.	.	.	.	T	0.62221	0.2410	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58629	-0.7603	4	.	.	.	-0.2904	11.6312	0.51175	0.1463:0.0:0.8537:0.0	.	.	.	.	G	597	.	.	A	-	2	0	JMJD1C	64620801	0.997000	0.39634	0.999000	0.59377	0.992000	0.81027	0.451000	0.21779	0.766000	0.33244	0.650000	0.86243	GCA	.	.		0.393	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
MGEA5	10724	hgsc.bcm.edu	37	10	103560098	103560098	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr10:103560098C>T	ENST00000361464.3	-	8	1491	c.1096G>A	c.(1096-1098)Gaa>Aaa	p.E366K	MGEA5_ENST00000370094.3_Missense_Mutation_p.E366K|MGEA5_ENST00000357797.5_Intron|MGEA5_ENST00000482611.1_5'Flank|MGEA5_ENST00000439817.1_Intron	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	366					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TCAATATCTTCATCACTGCCT	0.353																																					p.E366K		Atlas-SNP	.											.	MGEA5	53	.	0			c.G1096A						.						163.0	138.0	147.0					10																	103560098		2203	4300	6503	SO:0001583	missense	10724	exon8			TATCTTCATCACT	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.1096G>A	chr10.hg19:g.103560098C>T	ENSP00000354850:p.Glu366Lys	63.0	0.0		59.0	24.0	NM_012215	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	ENST00000361464.3	hg19	CCDS7520.1	.	.	.	.	.	.	.	.	.	.	C	33	5.277177	0.95459	.	.	ENSG00000198408	ENST00000361464;ENST00000370094	T;T	0.33865	1.41;1.39	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.42017	0.1184	L	0.29908	0.895	0.80722	D	1	D;P	0.53885	0.963;0.938	P;P	0.53313	0.723;0.554	T	0.03684	-1.1013	10	0.26408	T	0.33	-21.983	20.0572	0.97657	0.0:1.0:0.0:0.0	.	366;366	O60502-3;O60502	.;NCOAT_HUMAN	K	366	ENSP00000354850:E366K;ENSP00000359112:E366K	ENSP00000354850:E366K	E	-	1	0	MGEA5	103550088	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.445000	0.80570	2.826000	0.97356	0.655000	0.94253	GAA	.	.		0.353	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049987.1	NM_012215	
CFAP43	80217	hgsc.bcm.edu	37	10	105944833	105944833	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr10:105944833A>C	ENST00000278064.2	-	16	2200	c.1875T>G	c.(1873-1875)gaT>gaG	p.D625E	WDR96_ENST00000428666.1_Missense_Mutation_p.D695E|WDR96_ENST00000357060.3_Missense_Mutation_p.D694E																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TGTTTTGTCCATCCATTGAAA	0.403																																					p.D694E		Atlas-SNP	.											.	WDR96	183	.	0			c.T2082G						.						195.0	171.0	179.0					10																	105944833		2203	4300	6503	SO:0001583	missense	80217	exon16			TTGTCCATCCATT																												ENST00000278064.2:c.1875T>G	chr10.hg19:g.105944833A>C	ENSP00000278064:p.Asp625Glu	82.0	0.0		87.0	17.0	NM_025145		Missense_Mutation	SNP	ENST00000278064.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.53|17.53	3.413482|3.413482	0.62511|0.62511	.|.	.|.	ENSG00000197748|ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064|ENST00000434629	T;T;T|.	0.38240|.	1.15;1.15;1.15|.	5.18|5.18	4.05|4.05	0.47172|0.47172	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.136364|.	0.47093|.	D|.	0.000260|.	T|T	0.52805|0.52805	0.1757|0.1757	L|L	0.41415|0.41415	1.275|1.275	0.38840|0.38840	D|D	0.956045|0.956045	D;D;D|.	0.89917|.	0.998;1.0;1.0|.	D;D;D|.	0.83275|.	0.972;0.988;0.996|.	T|T	0.49560|0.49560	-0.8927|-0.8927	10|5	0.49607|.	T|.	0.09|.	.|.	8.4011|8.4011	0.32586|0.32586	0.9037:0.0:0.0963:0.0|0.9037:0.0:0.0963:0.0	.|.	695;695;694|.	G5E9L1;B4DHB6;Q8NDM7|.	.;.;WDR96_HUMAN|.	E|R	694;695;625|55	ENSP00000349568:D694E;ENSP00000400289:D695E;ENSP00000278064:D625E|.	ENSP00000278064:D625E|.	D|M	-|-	3|2	2|0	WDR96|WDR96	105934823|105934823	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.519000|0.519000	0.34347|0.34347	2.679000|2.679000	0.46909|0.46909	0.819000|0.819000	0.34492|0.34492	0.533000|0.533000	0.62120|0.62120	GAT|ATG	.	.		0.403	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1		
TACC2	10579	hgsc.bcm.edu	37	10	123844186	123844186	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr10:123844186C>T	ENST00000369005.1	+	4	2511	c.2171C>T	c.(2170-2172)cCa>cTa	p.P724L	TACC2_ENST00000358010.1_Intron|TACC2_ENST00000515603.1_Missense_Mutation_p.P724L|TACC2_ENST00000453444.2_Missense_Mutation_p.P724L|TACC2_ENST00000515273.1_Missense_Mutation_p.P724L|TACC2_ENST00000334433.3_Missense_Mutation_p.P724L|TACC2_ENST00000513429.1_Intron	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	724					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TCAGATTTTCCACCAACTCCT	0.502																																					p.P724L		Atlas-SNP	.											.	TACC2	271	.	0			c.C2171T						.						60.0	67.0	65.0					10																	123844186		2203	4300	6503	SO:0001583	missense	10579	exon4			ATTTTCCACCAAC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.2171C>T	chr10.hg19:g.123844186C>T	ENSP00000358001:p.Pro724Leu	195.0	0.0		175.0	67.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	hg19	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	C	0.109	-1.140435	0.01728	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.02258	4.37;4.39;4.4;4.37;4.39	5.47	-3.6	0.04570	.	0.844828	0.09380	N	0.810141	T	0.00695	0.0023	N	0.01048	-1.04	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46569	-0.9182	10	0.02654	T	1	-0.0103	6.9713	0.24650	0.0:0.2605:0.4041:0.3354	.	724;724;724	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	L	724;724;724;724;724;714	ENSP00000358001:P724L;ENSP00000424467:P724L;ENSP00000427618:P724L;ENSP00000334280:P724L;ENSP00000395048:P724L	ENSP00000334280:P724L	P	+	2	0	TACC2	123834176	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.294000	0.08309	-0.524000	0.06400	-0.415000	0.06103	CCA	.	.		0.502	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
SPTBN2	6712	hgsc.bcm.edu	37	11	66468343	66468343	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr11:66468343T>A	ENST00000533211.1	-	17	3558	c.3227A>T	c.(3226-3228)gAc>gTc	p.D1076V	SPTBN2_ENST00000529997.1_Missense_Mutation_p.D1076V|SPTBN2_ENST00000309996.2_Missense_Mutation_p.D1076V			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1076					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GGCCTGGAAGTCATCCAAGCT	0.682																																					p.D1076V		Atlas-SNP	.											.	SPTBN2	188	.	0			c.A3227T						.						19.0	21.0	21.0					11																	66468343		2194	4283	6477	SO:0001583	missense	6712	exon16			TGGAAGTCATCCA	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3227A>T	chr11.hg19:g.66468343T>A	ENSP00000432568:p.Asp1076Val	75.0	0.0		39.0	8.0	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	hg19	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.283163	0.80803	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.55588	0.51;0.51;0.51	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.70046	0.3179	M	0.75777	2.31	0.80722	D	1	D	0.67145	0.996	D	0.68621	0.959	T	0.74414	-0.3673	10	0.72032	D	0.01	.	13.264	0.60122	0.0:0.0:0.0:1.0	.	1076	O15020	SPTN2_HUMAN	V	1076	ENSP00000432568:D1076V;ENSP00000311489:D1076V;ENSP00000433593:D1076V	ENSP00000311489:D1076V	D	-	2	0	SPTBN2	66224919	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.074000	0.57577	1.979000	0.57680	0.402000	0.26972	GAC	.	.		0.682	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
FAT3	120114	hgsc.bcm.edu	37	11	92624158	92624158	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr11:92624158C>A	ENST00000298047.6	+	27	13666	c.13649C>A	c.(13648-13650)tCt>tAt	p.S4550Y	FAT3_ENST00000525166.1_Missense_Mutation_p.S4400Y|FAT3_ENST00000409404.2_Missense_Mutation_p.S4518Y|FAT3_ENST00000533797.1_Missense_Mutation_p.S853Y			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4550					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCGGATGTGTCTGCCAACTGC	0.567										TCGA Ovarian(4;0.039)																											p.S4518Y		Atlas-SNP	.											.	FAT3	1822	.	0			c.C13553A						.						39.0	41.0	41.0					11																	92624158		2076	4212	6288	SO:0001583	missense	120114	exon25			ATGTGTCTGCCAA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.13649C>A	chr11.hg19:g.92624158C>A	ENSP00000298047:p.Ser4550Tyr	97.0	0.0		71.0	9.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	C	20.3	3.963441	0.74016	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	D;T;D;D	0.89681	-1.94;-1.46;-1.97;-2.55	5.55	5.55	0.83447	.	.	.	.	.	D	0.91928	0.7444	M	0.76574	2.34	0.80722	D	1	P;B	0.49358	0.923;0.091	P;B	0.49276	0.605;0.141	D	0.92769	0.6230	9	0.87932	D	0	.	19.4974	0.95079	0.0:1.0:0.0:0.0	.	4518;4550	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	Y	4550;4518;4400;853	ENSP00000298047:S4550Y;ENSP00000387040:S4518Y;ENSP00000432586:S4400Y;ENSP00000436399:S853Y	ENSP00000298047:S4550Y	S	+	2	0	FAT3	92263806	1.000000	0.71417	0.634000	0.29324	0.654000	0.38779	6.009000	0.70745	2.606000	0.88127	0.655000	0.94253	TCT	.	.		0.567	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
PLET1	349633	hgsc.bcm.edu	37	11	112119549	112119549	+	Silent	SNP	A	A	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr11:112119549A>T	ENST00000338832.2	-	4	867	c.597T>A	c.(595-597)gcT>gcA	p.A199A	AP002884.1_ENST00000401135.1_RNA	NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN		199					cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						TGGTGAGAAAAGCAAGCAGGA	0.483																																					p.A199A		Atlas-SNP	.											.	C11orf34	6	.	0			c.T597A						.						112.0	109.0	110.0					11																	112119549		692	1591	2283	SO:0001819	synonymous_variant	349633	exon4			GAGAAAAGCAAGC																												ENST00000338832.2:c.597T>A	chr11.hg19:g.112119549A>T		188.0	0.0		114.0	25.0	NM_001145024	Q6UQ24|Q6UQ25|Q6UQ27	Silent	SNP	ENST00000338832.2	hg19		.	.	.	.	.	.	.	.	.	.	A	2.402	-0.337374	0.05278	.	.	ENSG00000188771	ENST00000533819	.	.	.	5.22	3.17	0.36434	.	.	.	.	.	T	0.54886	0.1886	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47355	-0.9124	4	.	.	.	.	6.2342	0.20754	0.2211:0.0:0.7789:0.0	.	.	.	.	H	20	.	.	L	-	2	0	C11orf34	111624759	0.598000	0.26882	0.768000	0.31515	0.086000	0.17979	0.399000	0.20916	0.600000	0.29862	0.528000	0.53228	CTT	.	.		0.483	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
ARHGAP32	9743	hgsc.bcm.edu	37	11	128840898	128840898	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr11:128840898C>T	ENST00000310343.9	-	22	4167	c.4168G>A	c.(4168-4170)Gcc>Acc	p.A1390T	ARHGAP32_ENST00000527272.1_Missense_Mutation_p.A1041T|ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.A1041T	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1390					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						GGGACCCGGGCACCGTCCCGC	0.642																																					p.A1390T		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.G4168A						.						47.0	48.0	48.0					11																	128840898		2201	4297	6498	SO:0001583	missense	9743	exon22			CCCGGGCACCGTC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.4168G>A	chr11.hg19:g.128840898C>T	ENSP00000310561:p.Ala1390Thr	66.0	0.0		35.0	7.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	hg19	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	C	2.420	-0.333262	0.05278	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.07688	3.18;3.17;3.17	5.71	-4.52	0.03472	.	0.938103	0.09066	N	0.853533	T	0.05318	0.0141	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.41124	-0.9526	10	0.37606	T	0.19	.	2.6734	0.05074	0.1929:0.2074:0.0959:0.5037	.	1390	A7KAX9	RHG32_HUMAN	T	1390;1041;1041	ENSP00000310561:A1390T;ENSP00000376425:A1041T;ENSP00000432862:A1041T	ENSP00000310561:A1390T	A	-	1	0	ARHGAP32	128346108	0.000000	0.05858	0.000000	0.03702	0.251000	0.25915	-0.983000	0.03759	-0.938000	0.03714	0.655000	0.94253	GCC	.	.		0.642	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
CLEC1A	51267	hgsc.bcm.edu	37	12	10233967	10233967	+	Missense_Mutation	SNP	G	G	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr12:10233967G>C	ENST00000315330.4	-	3	322	c.260C>G	c.(259-261)tCt>tGt	p.S87C	CLEC1A_ENST00000457018.2_Missense_Mutation_p.S54C|CLEC1A_ENST00000420265.2_Intron|RN7SKP161_ENST00000411110.1_RNA	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	87					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						TTCCATTTGAGAAATGGTGTC	0.393																																					p.S87C		Atlas-SNP	.											.	CLEC1A	48	.	0			c.C260G						.						119.0	117.0	118.0					12																	10233967		2203	4300	6503	SO:0001583	missense	51267	exon3			ATTTGAGAAATGG	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.260C>G	chr12.hg19:g.10233967G>C	ENSP00000326407:p.Ser87Cys	191.0	0.0		145.0	54.0	NM_016511	Q8IUW7|Q9NZH3	Missense_Mutation	SNP	ENST00000315330.4	hg19	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	G	8.337	0.827802	0.16749	.	.	ENSG00000150048	ENST00000315330;ENST00000457018	T;T	0.01505	4.82;4.89	4.71	2.86	0.33363	.	1.095560	0.07058	N	0.833228	T	0.03783	0.0107	L	0.46157	1.445	0.09310	N	0.999999	D;B	0.58620	0.983;0.028	P;B	0.50231	0.635;0.016	T	0.47195	-0.9136	10	0.59425	D	0.04	.	5.6287	0.17497	0.1:0.0:0.7062:0.1937	.	54;87	E9PFB4;Q8NC01	.;CLC1A_HUMAN	C	87;54	ENSP00000326407:S87C;ENSP00000415048:S54C	ENSP00000326407:S87C	S	-	2	0	CLEC1A	10125234	0.000000	0.05858	0.044000	0.18714	0.005000	0.04900	0.554000	0.23407	0.570000	0.29347	0.563000	0.77884	TCT	.	.		0.393	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511	
COPZ1	22818	hgsc.bcm.edu	37	12	54743441	54743441	+	Splice_Site	SNP	A	A	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr12:54743441A>G	ENST00000262061.2	+	8	522	c.485A>G	c.(484-486)cAg>cGg	p.Q162R	COPZ1_ENST00000455864.2_Splice_Site_p.Q139R|COPZ1_ENST00000549043.1_Splice_Site_p.Q170R|COPZ1_ENST00000551779.1_Missense_Mutation_p.Q162R|COPZ1_ENST00000552362.1_Intron|COPZ1_ENST00000416254.2_Splice_Site_p.Q111R|COPZ1_ENST00000552218.1_Splice_Site_p.Q183R|COPZ1_ENST00000553231.1_Splice_Site_p.Q139R|COPZ1_ENST00000548281.1_3'UTR|COPZ1_ENST00000548753.1_Splice_Site_p.Q74R|COPZ1_ENST00000549116.1_Splice_Site_p.Q104R	NM_001271734.1|NM_001271736.1|NM_016057.1	NP_001258663.1|NP_001258665.1|NP_057141.1	P61923	COPZ1_HUMAN	coatomer protein complex, subunit zeta 1	162					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)				kidney(1)|lung(4)	5						ACCGTGTCTCAGGTATGACTC	0.488																																					p.Q170R		Atlas-SNP	.											.	COPZ1	10	.	0			c.A509G						.						277.0	249.0	258.0					12																	54743441		2203	4300	6503	SO:0001630	splice_region_variant	22818	exon8			TGTCTCAGGTATG	AF151878	CCDS8877.1, CCDS61137.1, CCDS61138.1, CCDS61139.1	12q13.2-q13.3	2008-02-05		2003-07-23					2243	protein-coding gene	gene with protein product		615472	"""coatomer protein complex, subunit zeta"""	COPZ			Standard	NM_001271734		Approved	CGI-120	uc009znm.2	P61923		ENST00000262061.2:c.486+1A>G	chr12.hg19:g.54743441A>G		150.0	0.0		113.0	41.0	NM_001271736	B4DDX8|B4DHZ0|F8VS17|F8VWL5|Q549N6|Q9Y3C3	Missense_Mutation	SNP	ENST00000262061.2	hg19	CCDS8877.1	.	.	.	.	.	.	.	.	.	.	A	19.02	3.745670	0.69418	.	.	ENSG00000111481	ENST00000262061;ENST00000549043;ENST00000552218;ENST00000553231;ENST00000455864;ENST00000416254;ENST00000549116;ENST00000551779;ENST00000548753	.	.	.	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	D	0.84433	0.5471	M	0.93854	3.465	0.80722	D	1	P;D;D;P	0.76494	0.872;0.995;0.999;0.676	P;D;D;P	0.68621	0.512;0.92;0.959;0.512	D	0.88126	0.2835	9	0.87932	D	0	0.3815	12.1292	0.53934	1.0:0.0:0.0:0.0	.	139;170;111;162	B4DDX8;F8VWL5;B4DHZ0;P61923	.;.;.;COPZ1_HUMAN	R	162;170;183;139;139;111;104;162;74	.	ENSP00000262061:Q162R	Q	+	2	0	COPZ1	53029708	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.841000	0.75374	2.032000	0.59987	0.454000	0.30748	CAG	.	.		0.488	COPZ1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405753.1	NM_016057	Missense_Mutation
OR6C4	341418	hgsc.bcm.edu	37	12	55945104	55945104	+	Missense_Mutation	SNP	A	A	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr12:55945104A>C	ENST00000394256.2	+	1	122	c.94A>C	c.(94-96)Acc>Ccc	p.T32P	RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA	NM_001005494.1	NP_001005494.1	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C, member 4	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	11						TCTGTTCCTCACCTACATGCT	0.423																																					p.T32P		Atlas-SNP	.											.	OR6C4	34	.	0			c.A94C						.						161.0	159.0	160.0					12																	55945104		2203	4300	6503	SO:0001583	missense	341418	exon1			TTCCTCACCTACA	BK004261	CCDS31827.1	12q14.2	2012-08-09				ENSG00000179626		"""GPCR / Class A : Olfactory receptors"""	19632	protein-coding gene	gene with protein product							Standard	NM_001005494		Approved		uc010spp.2	Q8NGE1	OTTHUMG00000169959	ENST00000394256.2:c.94A>C	chr12.hg19:g.55945104A>C	ENSP00000377799:p.Thr32Pro	178.0	0.0		178.0	64.0	NM_001005494	A8MZG7|B2RNN2|Q6IFK1	Missense_Mutation	SNP	ENST00000394256.2	hg19	CCDS31827.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.600178	0.46423	.	.	ENSG00000179626	ENST00000394256	T	0.00514	6.88	4.81	-1.84	0.07809	.	0.129427	0.34853	N	0.003638	T	0.01029	0.0034	M	0.78285	2.405	0.09310	N	1	P	0.48089	0.905	P	0.53988	0.739	T	0.19582	-1.0301	10	0.87932	D	0	.	11.7152	0.51647	0.4861:0.0:0.5139:0.0	.	32	Q8NGE1	OR6C4_HUMAN	P	32	ENSP00000377799:T32P	ENSP00000377799:T32P	T	+	1	0	OR6C4	54231371	0.000000	0.05858	0.010000	0.14722	0.768000	0.43524	-1.044000	0.03532	-0.400000	0.07656	0.528000	0.53228	ACC	.	.		0.423	OR6C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406678.1		
METTL21B	25895	hgsc.bcm.edu	37	12	58163586	58163586	+	5'Flank	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr12:58163586T>C	ENST00000300209.8	+	0	0				METTL21B_ENST00000551420.1_5'Flank|METTL1_ENST00000257848.7_Intron|CYP27B1_ENST00000228606.4_5'Flank|METTL1_ENST00000324871.7_Missense_Mutation_p.K143R|METTL1_ENST00000548681.1_5'Flank|METTL21B_ENST00000333012.5_5'Flank|METTL21B_ENST00000548256.1_5'Flank	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						AGGAAGGTGCTTCATGGCATT	0.602																																					p.K143R		Atlas-SNP	.											.	METTL1	14	.	0			c.A428G						.						70.0	63.0	66.0					12																	58163586		2203	4300	6503	SO:0001631	upstream_gene_variant	4234	exon3			AGGTGCTTCATGG	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		chr12.hg19:g.58163586T>C	Exception_encountered	135.0	0.0		109.0	36.0	NM_005371	Q9H749|Q9Y3W2	Missense_Mutation	SNP	ENST00000300209.8	hg19	CCDS8957.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577573	0.86645	.	.	ENSG00000037897	ENST00000324871	T	0.44881	0.91	5.08	5.08	0.68730	.	0.162430	0.52532	N	0.000068	T	0.59972	0.2233	M	0.85777	2.775	0.80722	D	1	P	0.40834	0.73	P	0.49953	0.627	T	0.65442	-0.6167	10	0.54805	T	0.06	-15.3727	13.8131	0.63274	0.0:0.0:0.0:1.0	.	143	Q9UBP6	TRMB_HUMAN	R	143	ENSP00000314441:K143R	ENSP00000314441:K143R	K	-	2	0	METTL1	56449853	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.020000	0.76419	1.905000	0.55150	0.533000	0.62120	AAG	.	.		0.602	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
TNFRSF19	55504	hgsc.bcm.edu	37	13	24242840	24242840	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr13:24242840C>T	ENST00000382258.4	+	9	1053	c.849C>T	c.(847-849)ggC>ggT	p.G283G	TNFRSF19_ENST00000403372.2_Silent_p.G151G|TNFRSF19_ENST00000248484.4_Silent_p.G283G|TNFRSF19_ENST00000382263.3_Silent_p.G283G	NM_018647.3	NP_061117.2	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily, member 19	283					apoptotic process (GO:0006915)|hair follicle development (GO:0001942)|JNK cascade (GO:0007254)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)	tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	22		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		GAAACGCAGGCCCAGCCGGGG	0.493																																					p.G283G		Atlas-SNP	.											.	TNFRSF19	52	.	0			c.C849T						.						79.0	80.0	80.0					13																	24242840		2203	4300	6503	SO:0001819	synonymous_variant	55504	exon9			CGCAGGCCCAGCC	AB040434	CCDS9301.1, CCDS9302.1, CCDS55893.1	13q12.11-q12.3	2008-07-18			ENSG00000127863	ENSG00000127863		"""Tumor necrosis factor receptor superfamily"""	11915	protein-coding gene	gene with protein product	"""toxicity and JNK inducer"""	606122				10764796, 10809768	Standard	NM_018647		Approved	TAJ-alpha, TROY, TAJ, TRADE	uc001uov.2	Q9NS68	OTTHUMG00000016568	ENST00000382258.4:c.849C>T	chr13.hg19:g.24242840C>T		73.0	0.0		83.0	26.0	NM_018647	A8KA09|A8KA26|B1AM40|B1AM41|B4E2I6|Q9BXZ9|Q9BY00|Q9NZV2	Silent	SNP	ENST00000382258.4	hg19	CCDS9302.1																																																																																			.	.		0.493	TNFRSF19-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044156.2	NM_018647	
COG6	57511	hgsc.bcm.edu	37	13	40256393	40256393	+	Silent	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr13:40256393C>A	ENST00000455146.3	+	8	830	c.780C>A	c.(778-780)gtC>gtA	p.V260V	COG6_ENST00000416691.1_Silent_p.V260V|COG6_ENST00000465775.1_3'UTR	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	260					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		ACAGACCTGTCTTATATAAGT	0.318																																					p.V260V		Atlas-SNP	.											.	COG6	49	.	0			c.C780A						.						67.0	69.0	69.0					13																	40256393		2203	4300	6503	SO:0001819	synonymous_variant	57511	exon8			ACCTGTCTTATAT	AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.780C>A	chr13.hg19:g.40256393C>A		436.0	0.0		200.0	68.0	NM_001145079	Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Silent	SNP	ENST00000455146.3	hg19	CCDS9370.1																																																																																			.	.		0.318	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044622.3		
LIG4	3981	hgsc.bcm.edu	37	13	108863529	108863529	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr13:108863529T>C	ENST00000356922.4	-	2	360	c.88A>G	c.(88-90)Aaa>Gaa	p.K30E	LIG4_ENST00000405925.1_Missense_Mutation_p.K30E|LIG4_ENST00000442234.1_Missense_Mutation_p.K30E	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	30					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GCACGTCCTTTACTTTTCTGT	0.388								Non-homologous end-joining																													p.K30E		Atlas-SNP	.											.	LIG4	91	.	0			c.A88G						.						43.0	44.0	43.0					13																	108863529		2203	4297	6500	SO:0001583	missense	3981	exon3			GTCCTTTACTTTT	X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.88A>G	chr13.hg19:g.108863529T>C	ENSP00000349393:p.Lys30Glu	99.0	0.0		104.0	17.0	NM_206937	Q8IY66|Q8TEU5	Missense_Mutation	SNP	ENST00000356922.4	hg19	CCDS9508.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.482176	0.44147	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.17691	2.26;2.26;2.26	6.15	6.15	0.99193	DNA ligase, ATP-dependent, N-terminal (3);	0.089927	0.85682	D	0.000000	T	0.29588	0.0738	L	0.52126	1.63	0.58432	D	0.999999	B	0.34349	0.45	P	0.47705	0.555	T	0.01966	-1.1238	10	0.31617	T	0.26	.	15.9697	0.80004	0.0:0.0:0.0:1.0	.	30	P49917	DNLI4_HUMAN	E	30	ENSP00000385955:K30E;ENSP00000402030:K30E;ENSP00000349393:K30E	ENSP00000349393:K30E	K	-	1	0	LIG4	107661530	1.000000	0.71417	0.991000	0.47740	0.911000	0.54048	7.590000	0.82653	2.363000	0.80096	0.523000	0.50628	AAA	.	.		0.388	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045738.4	NM_002312	
OR4K2	390431	hgsc.bcm.edu	37	14	20345061	20345061	+	Missense_Mutation	SNP	T	T	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr14:20345061T>G	ENST00000298642.2	+	1	671	c.635T>G	c.(634-636)aTt>aGt	p.I212S		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	212						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TCCTGTTTTATTGTTTTATTT	0.393																																					p.I212S		Atlas-SNP	.											.	OR4K2	97	.	0			c.T635G						.						273.0	278.0	276.0					14																	20345061		2203	4299	6502	SO:0001583	missense	390431	exon1			GTTTTATTGTTTT		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.635T>G	chr14.hg19:g.20345061T>G	ENSP00000298642:p.Ile212Ser	91.0	0.0		78.0	10.0	NM_001005501	B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	hg19	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	7.595	0.671511	0.14776	.	.	ENSG00000165762	ENST00000298642	T	0.38887	1.11	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.135127	0.33650	N	0.004700	T	0.28167	0.0695	N	0.17278	0.47	0.41615	D	0.98893	B	0.16166	0.016	B	0.22880	0.042	T	0.09250	-1.0683	10	0.45353	T	0.12	.	11.0079	0.47646	0.0:0.0:0.0:1.0	.	212	Q8NGD2	OR4K2_HUMAN	S	212	ENSP00000298642:I212S	ENSP00000298642:I212S	I	+	2	0	OR4K2	19414901	0.248000	0.23930	1.000000	0.80357	0.110000	0.19582	2.910000	0.48766	2.097000	0.63578	0.383000	0.25322	ATT	.	.		0.393	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1		
C14orf39	317761	hgsc.bcm.edu	37	14	60928094	60928094	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr14:60928094C>T	ENST00000321731.3	-	13	1254	c.1095G>A	c.(1093-1095)caG>caA	p.Q365Q		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	365					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TTTCCGACCACTGATTGGAAT	0.279																																					p.Q365Q		Atlas-SNP	.											.	C14orf39	79	.	0			c.G1095A						.						67.0	62.0	64.0					14																	60928094		2202	4299	6501	SO:0001819	synonymous_variant	317761	exon13			CGACCACTGATTG	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.1095G>A	chr14.hg19:g.60928094C>T		174.0	0.0		96.0	34.0	NM_174978	Q08AQ4	Silent	SNP	ENST00000321731.3	hg19	CCDS9746.1																																																																																			.	.		0.279	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276948.1	NM_174978	
TMEM30B	161291	hgsc.bcm.edu	37	14	61747677	61747677	+	Silent	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr14:61747677C>T	ENST00000555868.1	-	1	881	c.189G>A	c.(187-189)ctG>ctA	p.L63L	TMEM30B_ENST00000355702.2_Silent_p.L63L|TMEM30B_ENST00000557163.1_Intron	NM_001017970.2	NP_001017970.1	Q3MIR4	CC50B_HUMAN	transmembrane protein 30B	63					lipid transport (GO:0006869)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.107)|BRCA - Breast invasive adenocarcinoma(234;0.181)		AGTCGTACTCCAGCTCCTTGA	0.701																																					p.L63L		Atlas-SNP	.											.	TMEM30B	13	.	0			c.G189A						.						7.0	6.0	6.0					14																	61747677		1969	3870	5839	SO:0001819	synonymous_variant	161291	exon1			GTACTCCAGCTCC	AK091169	CCDS32093.1	14q23.1	2006-09-20				ENSG00000182107			27254	protein-coding gene	gene with protein product		611029				15375526	Standard	NM_001017970		Approved	CDC50B	uc001xfl.3	Q3MIR4		ENST00000555868.1:c.189G>A	chr14.hg19:g.61747677C>T		38.0	0.0		34.0	12.0	NM_001017970	B3KR84|Q14D00	Silent	SNP	ENST00000555868.1	hg19	CCDS32093.1																																																																																			.	.		0.701	TMEM30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413358.1	XM_090844	
SHC4	399694	hgsc.bcm.edu	37	15	49255156	49255156	+	Silent	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr15:49255156G>A	ENST00000332408.4	-	1	485	c.57C>T	c.(55-57)ttC>ttT	p.F19F		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	19	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		CGGGGTGCCCGAAGAGTCCTA	0.592																																					p.F19F		Atlas-SNP	.											SHC4,bladder,carcinoma,0,1	SHC4	70	.	0			c.C57T						.						75.0	81.0	79.0					15																	49255156		2194	4285	6479	SO:0001819	synonymous_variant	399694	exon1			GTGCCCGAAGAGT	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.57C>T	chr15.hg19:g.49255156G>A		107.0	0.0		56.0	10.0	NM_203349	Q6UXQ3|Q8IYW3	Silent	SNP	ENST00000332408.4	hg19	CCDS10130.1																																																																																			.	.		0.592	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
MAN2C1	4123	hgsc.bcm.edu	37	15	75651670	75651671	+	Splice_Site	DNP	TC	TC	GA			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr15:75651670_75651671TC>GA	ENST00000267978.5	-	17	2090_2091	c.2044_2045GA>TC	c.(2044-2046)GAg>TCg	p.E682S	MAN2C1_ENST00000563622.1_Splice_Site_p.E583S|MAN2C1_ENST00000569482.1_Splice_Site_p.E682S|MAN2C1_ENST00000565683.1_Splice_Site_p.R686I	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	682					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						AGGACTCACCTCTTGCACTACG	0.629																																					p.R686S|p.E682X		Atlas-SNP	.											.	MAN2C1	76	.	0			c.A2058C|c.G2044T						.																																			SO:0001630	splice_region_variant	4123	exon17			CTCACCTCTTGCA|TCACCTCTTGCAC	AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.2044_2045delinsGA	chr15.hg19:g.75651670_75651671delinsGA		122.0|123.0	0.0		75.0|76.0	19.0	NM_001256494|NM_006715	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000267978.5	hg19	CCDS32298.1																																																																																			.	.		0.629	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419965.1		Missense_Mutation
ITGAM	3684	hgsc.bcm.edu	37	16	31336283	31336283	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr16:31336283C>T	ENST00000287497.8	+	19	2369	c.2294C>T	c.(2293-2295)cCc>cTc	p.P765L	ITGAM_ENST00000544665.3_Missense_Mutation_p.P766L			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	765					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						TAAAAGTTTCCCTTTGAGAAG	0.343																																					p.P766L		Atlas-SNP	.											.	ITGAM	137	.	0			c.C2297T						.						57.0	52.0	54.0					16																	31336283		1842	4087	5929	SO:0001583	missense	3684	exon19			AGTTTCCCTTTGA	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2294C>T	chr16.hg19:g.31336283C>T	ENSP00000287497:p.Pro765Leu	48.0	0.0		57.0	10.0	NM_001145808	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	hg19	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	C	18.89	3.720534	0.68959	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.51325	0.71;0.71	4.94	4.94	0.65067	Integrin alpha-2 (1);	.	.	.	.	T	0.70718	0.3256	M	0.81682	2.555	0.58432	D	0.99999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.979;0.979	T	0.75391	-0.3334	9	0.87932	D	0	.	17.0841	0.86606	0.0:1.0:0.0:0.0	.	171;765;765	B3KXM6;Q4VAK1;P11215	.;.;ITAM_HUMAN	L	766;765	ENSP00000441691:P766L;ENSP00000287497:P765L	ENSP00000287497:P765L	P	+	2	0	ITGAM	31243784	0.998000	0.40836	1.000000	0.80357	0.742000	0.42306	2.916000	0.48813	2.571000	0.86741	0.655000	0.94253	CCC	.	.		0.343	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
SUPT6H	6830	hgsc.bcm.edu	37	17	27024667	27024667	+	Silent	SNP	T	T	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr17:27024667T>G	ENST00000314616.6	+	31	4522	c.4239T>G	c.(4237-4239)gcT>gcG	p.A1413A	SUPT6H_ENST00000347486.4_Silent_p.A1413A	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1413	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					AGATTGTTGCTCGCTATGTCC	0.512																																					p.A1413A		Atlas-SNP	.											.	SUPT6H	165	.	0			c.T4239G						.						89.0	81.0	84.0					17																	27024667		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon31			TGTTGCTCGCTAT	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4239T>G	chr17.hg19:g.27024667T>G		115.0	0.0		77.0	23.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	hg19	CCDS32596.1																																																																																			.	.		0.512	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
ACACA	31	hgsc.bcm.edu	37	17	35615246	35615246	+	Missense_Mutation	SNP	T	T	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr17:35615246T>A	ENST00000394406.2	-	13	1629	c.1439A>T	c.(1438-1440)tAt>tTt	p.Y480F	ACACA_ENST00000360679.3_Missense_Mutation_p.Y422F|ACACA_ENST00000353139.5_Missense_Mutation_p.Y517F|ACACA_ENST00000335166.5_Missense_Mutation_p.Y402F	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	480	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGATACCCCATACATCATACG	0.408																																					p.Y517F	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.A1550T						.						87.0	84.0	85.0					17																	35615246		2203	4300	6503	SO:0001583	missense	31	exon13			ACCCCATACATCA	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.1439A>T	chr17.hg19:g.35615246T>A	ENSP00000377928:p.Tyr480Phe	232.0	0.0		216.0	38.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	hg19	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.937431	0.92458	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	D;D;D;D	0.97811	-4.55;-4.55;-4.55;-4.55	5.93	5.93	0.95920	ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.98093	0.9371	M	0.83692	2.655	0.80722	D	1	B;P;P	0.49447	0.174;0.587;0.924	B;B;P	0.51866	0.159;0.354;0.682	D	0.98336	1.0536	10	0.52906	T	0.07	-12.7689	15.5755	0.76380	0.0:0.0:0.0:1.0	.	517;480;422	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	F	517;422;480;504;402	ENSP00000344789:Y517F;ENSP00000353898:Y422F;ENSP00000377928:Y480F;ENSP00000335323:Y402F	ENSP00000335323:Y402F	Y	-	2	0	ACACA	32689359	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.040000	0.89188	2.281000	0.76405	0.533000	0.62120	TAT	.	.		0.408	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
MPP2	4355	hgsc.bcm.edu	37	17	41975687	41975687	+	Silent	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr17:41975687C>A	ENST00000461854.1	-	3	178	c.93G>T	c.(91-93)ctG>ctT	p.L31L	MPP2_ENST00000520305.1_Intron|MPP2_ENST00000377184.3_Silent_p.L48L|MPP2_ENST00000536246.1_Silent_p.L20L|MPP2_ENST00000523501.1_Silent_p.L20L|MPP2_ENST00000473246.1_5'UTR|MPP2_ENST00000518766.1_Silent_p.L76L|MPP2_ENST00000269095.4_Silent_p.L31L			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	31	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		AGATCAGGTCCAGCTCTGCAG	0.587																																					p.L31L		Atlas-SNP	.											.	MPP2	67	.	0			c.G93T						.						123.0	106.0	112.0					17																	41975687		2203	4300	6503	SO:0001819	synonymous_variant	4355	exon3			CAGGTCCAGCTCT		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.93G>T	chr17.hg19:g.41975687C>A		130.0	0.0		97.0	16.0	NM_005374	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Silent	SNP	ENST00000461854.1	hg19																																																																																				.	.		0.587	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	protein_coding	OTTHUMT00000258388.2	NM_005374	
AXIN2	8313	hgsc.bcm.edu	37	17	63545701	63545701	+	Missense_Mutation	SNP	T	T	C	rs139274803		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr17:63545701T>C	ENST00000375702.5	-	2	1001	c.893A>G	c.(892-894)aAc>aGc	p.N298S	AXIN2_ENST00000307078.5_Missense_Mutation_p.N298S|CTD-2535L24.2_ENST00000577662.1_3'UTR			Q9Y2T1	AXIN2_HUMAN	axin 2	298					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						CTCACTGTCGTTGGCGCTGGT	0.522									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.N298S		Atlas-SNP	.											.	AXIN2	92	.	0			c.A893G						.	T	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	180.0	118.0	139.0		893	5.9	1.0	17	dbSNP_134	139	0,8600		0,0,4300	no	missense	AXIN2	NM_004655.3	46	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging	298/844	63545701	1,13005	2203	4300	6503	SO:0001583	missense	8313	exon3	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	CTGTCGTTGGCGC	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.893A>G	chr17.hg19:g.63545701T>C	ENSP00000364854:p.Asn298Ser	128.0	0.0		100.0	30.0	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	ENST00000375702.5	hg19		.	.	.	.	.	.	.	.	.	.	T	27.1	4.797842	0.90538	2.27E-4	0.0	ENSG00000168646	ENST00000307078;ENST00000375702	D;D	0.81908	-1.55;-1.55	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.91734	0.7386	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.83275	0.996;0.992;0.996	D	0.92799	0.6255	10	0.87932	D	0	-36.2622	16.3483	0.83171	0.0:0.0:0.0:1.0	.	298;298;298	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	S	298	ENSP00000302625:N298S;ENSP00000364854:N298S	ENSP00000302625:N298S	N	-	2	0	AXIN2	60976163	1.000000	0.71417	0.993000	0.49108	0.865000	0.49528	7.990000	0.88215	2.254000	0.74563	0.533000	0.62120	AAC	.	T|1.000;C|0.000		0.522	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	
H3F3B	3021	hgsc.bcm.edu	37	17	73775166	73775166	+	Silent	SNP	A	A	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr17:73775166A>C	ENST00000254810.4	-	2	222	c.90T>G	c.(88-90)gcT>gcG	p.A30A	H3F3B_ENST00000593254.1_Intron|H3F3B_ENST00000592643.1_Silent_p.A30A|H3F3B_ENST00000587560.1_Silent_p.A30A|H3F3B_ENST00000591890.1_Silent_p.A30A|H3F3B_ENST00000589599.1_Silent_p.A30A|H3F3B_ENST00000586607.1_Silent_p.A30A	NM_005324.3	NP_005315.1	P84243	H33_HUMAN	H3 histone, family 3B (H3.3B)	30					blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			large_intestine(1)|lung(4)|ovary(2)|skin(1)	8	all_cancers(13;1.5e-07)		all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGGTAGAGGGAGCGCTTTTCC	0.642											OREG0024740	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A30A		Atlas-SNP	.											.	H3F3B	12	.	0			c.T90G						.						26.0	28.0	28.0					17																	73775166		2202	4300	6502	SO:0001819	synonymous_variant	3021	exon2			AGAGGGAGCGCTT	Z48950	CCDS11729.1	17q25.1	2011-06-01			ENSG00000132475	ENSG00000132475		"""Histones / Replication-independent"""	4765	protein-coding gene	gene with protein product		601058				8586426	Standard	NM_005324		Approved	H3.3B	uc002jpl.3	P84243		ENST00000254810.4:c.90T>G	chr17.hg19:g.73775166A>C		143.0	0.0	1147	112.0	37.0	NM_005324	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Silent	SNP	ENST00000254810.4	hg19	CCDS11729.1																																																																																			.	.		0.642	H3F3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448499.1	NM_005324	
CEP192	55125	hgsc.bcm.edu	37	18	13100343	13100343	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr18:13100343G>T	ENST00000325971.8	+	36	6508	c.4915G>T	c.(4915-4917)Gtg>Ttg	p.V1639L	CEP192_ENST00000430049.2_Missense_Mutation_p.V1760L|CEP192_ENST00000506447.1_Missense_Mutation_p.V2235L|CEP192_ENST00000540847.2_3'UTR			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1639					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTTAACTCAAGTGGAACTTTT	0.363																																					p.V2235L		Atlas-SNP	.											.	CEP192	340	.	0			c.G6703T						.						66.0	64.0	65.0					18																	13100343		2203	4300	6503	SO:0001583	missense	55125	exon38			ACTCAAGTGGAAC	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.4915G>T	chr18.hg19:g.13100343G>T	ENSP00000317156:p.Val1639Leu	189.0	0.0		161.0	47.0	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	hg19		.	.	.	.	.	.	.	.	.	.	G	5.392	0.257472	0.10239	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.05513	3.43;3.43;3.43	5.15	0.0428	0.14219	.	0.817735	0.11458	N	0.562074	T	0.02571	0.0078	N	0.08118	0	0.09310	N	1	B;B;B;B	0.25667	0.131;0.003;0.001;0.008	B;B;B;B	0.21151	0.033;0.009;0.0;0.006	T	0.44742	-0.9308	10	0.30854	T	0.27	-2.4109	1.6192	0.02710	0.3154:0.1289:0.4234:0.1323	.	1760;2235;239;837	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	L	2235;1639;1639;1760;239	ENSP00000427550:V2235L;ENSP00000317156:V1639L;ENSP00000389190:V1760L	ENSP00000317156:V1639L	V	+	1	0	CEP192	13090343	0.011000	0.17503	0.001000	0.08648	0.123000	0.20343	0.136000	0.15974	-0.225000	0.09913	0.655000	0.94253	GTG	.	.		0.363	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
GAREM	64762	hgsc.bcm.edu	37	18	29890207	29890207	+	Missense_Mutation	SNP	C	C	G			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr18:29890207C>G	ENST00000269209.6	-	3	345	c.342G>C	c.(340-342)aaG>aaC	p.K114N	GAREM_ENST00000399218.4_Missense_Mutation_p.K114N|GAREM_ENST00000578619.1_5'UTR			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	114	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CAGGAAATGCCTTAGCCACCT	0.413																																					p.K114N		Atlas-SNP	.											.	.	.	.	0			c.G342C						.						256.0	218.0	231.0					18																	29890207		2203	4300	6503	SO:0001583	missense	64762	exon3			AAATGCCTTAGCC	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.342G>C	chr18.hg19:g.29890207C>G	ENSP00000269209:p.Lys114Asn	201.0	0.0		109.0	20.0	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	hg19	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	C	16.03	3.006715	0.54361	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.14516	2.5;2.5	5.76	2.12	0.27331	.	0.000000	0.85682	D	0.000000	T	0.25717	0.0626	L	0.47716	1.5	0.58432	D	0.999996	D;P	0.89917	1.0;0.741	D;P	0.87578	0.998;0.636	T	0.00295	-1.1839	10	0.33940	T	0.23	-23.8486	10.1079	0.42544	0.0:0.1584:0.0:0.8416	.	114;114	Q9H706;Q9H706-3	FA59A_HUMAN;.	N	114	ENSP00000382165:K114N;ENSP00000269209:K114N	ENSP00000269209:K114N	K	-	3	2	FAM59A	28144205	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.598000	0.36740	0.125000	0.18397	-0.140000	0.14226	AAG	.	.		0.413	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
MYO5B	4645	hgsc.bcm.edu	37	18	47364067	47364067	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr18:47364067C>T	ENST00000285039.7	-	37	5257	c.4958G>A	c.(4957-4959)tGc>tAc	p.C1653Y	SCARNA17_ENST00000589499.1_RNA|RP11-886H22.1_ENST00000590532.2_5'Flank|MYO5B_ENST00000324581.6_Missense_Mutation_p.C768Y|MYO5B_ENST00000592688.1_Missense_Mutation_p.C223Y	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1653	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGCTTCCAGGCAGTATGAGTT	0.522																																					p.C1653Y		Atlas-SNP	.											.	MYO5B	178	.	0			c.G4958A						.						75.0	70.0	72.0					18																	47364067		1950	4153	6103	SO:0001583	missense	4645	exon37			TCCAGGCAGTATG	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.4958G>A	chr18.hg19:g.47364067C>T	ENSP00000285039:p.Cys1653Tyr	159.0	0.0		94.0	8.0	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	hg19	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	11.38	1.622644	0.28889	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	D;T	0.85861	-2.04;2.59	4.87	3.99	0.46301	Dilute (1);	0.125660	0.52532	D	0.000064	T	0.72087	0.3417	N	0.08118	0	0.38104	D	0.937366	B;P	0.39131	0.08;0.661	B;B	0.37387	0.105;0.248	T	0.77536	-0.2551	10	0.49607	T	0.09	.	14.543	0.68008	0.0:0.7219:0.2781:0.0	.	1653;768	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	Y	1653;768	ENSP00000285039:C1653Y;ENSP00000315531:C768Y	ENSP00000285039:C1653Y	C	-	2	0	MYO5B	45618065	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	2.257000	0.43240	1.389000	0.46526	0.655000	0.94253	TGC	.	.		0.522	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
ZNF443	10224	hgsc.bcm.edu	37	19	12542634	12542634	+	Missense_Mutation	SNP	G	G	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:12542634G>C	ENST00000301547.5	-	4	549	c.352C>G	c.(352-354)Ctt>Gtt	p.L118V	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	118					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						TAACAATTAAGGGATGAATGA	0.438																																					p.L118V		Atlas-SNP	.											.	ZNF443	63	.	0			c.C352G						.						137.0	118.0	125.0					19																	12542634		2203	4300	6503	SO:0001583	missense	10224	exon4			AATTAAGGGATGA	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.352C>G	chr19.hg19:g.12542634G>C	ENSP00000301547:p.Leu118Val	207.0	0.0		133.0	56.0	NM_005815		Missense_Mutation	SNP	ENST00000301547.5	hg19	CCDS32918.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336580	0.24253	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.08370	3.1	1.37	-2.74	0.05932	.	.	.	.	.	T	0.22551	0.0544	M	0.84846	2.72	0.09310	N	1	D	0.65815	0.995	D	0.65443	0.935	T	0.06935	-1.0799	9	0.66056	D	0.02	.	3.5813	0.07954	0.3219:0.2117:0.4664:0.0	.	118	Q9Y2A4	ZN443_HUMAN	V	118	ENSP00000301547:L118V	ENSP00000301547:L118V	L	-	1	0	ZNF443	12403634	0.001000	0.12720	0.000000	0.03702	0.073000	0.16967	0.351000	0.20096	-0.771000	0.04608	0.461000	0.40582	CTT	.	.		0.438	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344084.1	NM_005815	
CACNA1A	773	hgsc.bcm.edu	37	19	13387894	13387894	+	Missense_Mutation	SNP	T	T	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:13387894T>C	ENST00000360228.5	-	23	3870	c.3871A>G	c.(3871-3873)Atg>Gtg	p.M1291V	CACNA1A_ENST00000573710.2_Missense_Mutation_p.M1292V	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1292					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TTGATCACCATCTCAAAGGTA	0.453											OREG0025295	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M1292V		Atlas-SNP	.											.	CACNA1A	715	.	0			c.A3874G						.						106.0	95.0	99.0					19																	13387894		1908	4123	6031	SO:0001583	missense	773	exon23			TCACCATCTCAAA	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3871A>G	chr19.hg19:g.13387894T>C	ENSP00000353362:p.Met1291Val	135.0	0.0	687	108.0	20.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	hg19	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	T	12.94	2.089448	0.36855	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.97529	-4.42	4.54	4.54	0.55810	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97876	0.9302	M	0.80332	2.49	0.54753	D	0.999987	P;D;B	0.53885	0.938;0.963;0.136	P;P;B	0.59825	0.864;0.729;0.177	D	0.98383	1.0559	10	0.72032	D	0.01	.	12.8714	0.57966	0.0:0.0:0.0:1.0	.	1292;1295;1291	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	V	1291;1295;1292;1292	ENSP00000353362:M1291V	ENSP00000317661:M1292V	M	-	1	0	CACNA1A	13248894	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	5.693000	0.68264	1.690000	0.51089	0.482000	0.46254	ATG	.	.		0.453	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
COMP	1311	hgsc.bcm.edu	37	19	18895754	18895754	+	Nonsense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:18895754C>T	ENST00000222271.2	-	16	1910	c.1866G>A	c.(1864-1866)tgG>tgA	p.W622*	COMP_ENST00000425807.1_Nonsense_Mutation_p.W569*|COMP_ENST00000542601.2_Nonsense_Mutation_p.W589*	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	622	Mediates cell survival and induction of the IAP family of survival proteins.|TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GGTTCGCCTGCCAATACGTTT	0.602																																					p.W622X		Atlas-SNP	.											.	COMP	62	.	0			c.G1866A						.						151.0	113.0	126.0					19																	18895754		2203	4300	6503	SO:0001587	stop_gained	1311	exon16			CGCCTGCCAATAC	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1866G>A	chr19.hg19:g.18895754C>T	ENSP00000222271:p.Trp622*	110.0	0.0		97.0	20.0	NM_000095	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Nonsense_Mutation	SNP	ENST00000222271.2	hg19	CCDS12385.1	.	.	.	.	.	.	.	.	.	.	C	41	9.065774	0.99053	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	.	.	.	3.99	3.99	0.46301	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.2722	14.7691	0.69662	0.0:1.0:0.0:0.0	.	.	.	.	X	589;622;569;609	.	ENSP00000222271:W622X	W	-	3	0	COMP	18756754	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.507000	0.81676	2.056000	0.61249	0.471000	0.43371	TGG	.	.		0.602	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095	
ZNF729	100287226	hgsc.bcm.edu	37	19	22499578	22499578	+	Missense_Mutation	SNP	C	C	T	rs567431275		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:22499578C>T	ENST00000601693.1	+	4	3477	c.3359C>T	c.(3358-3360)aCg>aTg	p.T1120M	ZNF729_ENST00000357491.6_Missense_Mutation_p.T1092M			A6NN14	ZN729_HUMAN	zinc finger protein 729	1120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TCAACCCTTACGAAACATAAG	0.368													C|||	1	0.000199681	0.0008	0.0	5008	,	,		20926	0.0		0.0	False		,,,				2504	0.0				p.T1120M		Atlas-SNP	.											.	ZNF729	78	.	0			c.C3359T						.																																			SO:0001583	missense	100287226	exon4			CCCTTACGAAACA		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3359C>T	chr19.hg19:g.22499578C>T	ENSP00000469582:p.Thr1120Met	56.0	0.0		51.0	24.0	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	hg19	CCDS59368.1	.	.	.	.	.	.	.	.	.	.	.	3.971	-0.008391	0.07727	.	.	ENSG00000196350	ENST00000357491	T	0.35421	1.31	0.96	-1.92	0.07618	.	.	.	.	.	T	0.20981	0.0505	N	0.21508	0.67	.	.	.	.	.	.	.	.	.	T	0.23154	-1.0196	6	0.30854	T	0.27	.	4.4759	0.11739	0.2361:0.5296:0.2343:0.0	.	.	.	.	M	1092	ENSP00000350085:T1092M	ENSP00000350085:T1092M	T	+	2	0	ZNF729	22291418	0.000000	0.05858	0.021000	0.16686	0.029000	0.11900	-2.590000	0.00899	-1.764000	0.01305	-1.800000	0.00619	ACG	.	.		0.368	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
WDR87	83889	hgsc.bcm.edu	37	19	38380266	38380266	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:38380266C>T	ENST00000303868.5	-	6	4152	c.3928G>A	c.(3928-3930)Gtc>Atc	p.V1310I	WDR87_ENST00000447313.2_Missense_Mutation_p.V1349I	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1310										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TCTGGCGGGACTACATCCCAA	0.473																																					p.V1310I		Atlas-SNP	.											.	WDR87	191	.	0			c.G3928A						.						134.0	100.0	111.0					19																	38380266		692	1591	2283	SO:0001583	missense	83889	exon6			GCGGGACTACATC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3928G>A	chr19.hg19:g.38380266C>T	ENSP00000368025:p.Val1310Ile	113.0	0.0		105.0	20.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	C	7.979	0.750692	0.15778	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.10099	2.91;2.91	4.35	0.954	0.19595	.	0.786906	0.10737	N	0.639896	T	0.05044	0.0135	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.04013	0.001;0.001	T	0.45469	-0.9259	10	0.21540	T	0.41	-0.6284	7.213	0.25945	0.0:0.6117:0.0:0.3883	.	1310;1349	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	I	1349;1310	ENSP00000405012:V1349I;ENSP00000368025:V1310I	ENSP00000368025:V1310I	V	-	1	0	WDR87	43072106	0.000000	0.05858	0.002000	0.10522	0.169000	0.22640	0.784000	0.26816	0.170000	0.19704	0.442000	0.29010	GTC	.	.		0.473	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
LIPE	3991	hgsc.bcm.edu	37	19	42914801	42914801	+	Silent	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:42914801C>A	ENST00000244289.4	-	2	1353	c.1077G>T	c.(1075-1077)gcG>gcT	p.A359A	LIPE_ENST00000602000.1_Intron|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000593491.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	359					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CAAAGAGGTGCGCCACACCCA	0.692																																					p.A359A		Atlas-SNP	.											.	LIPE	83	.	0			c.G1077T						.						24.0	24.0	24.0					19																	42914801		2202	4296	6498	SO:0001819	synonymous_variant	3991	exon2			GAGGTGCGCCACA	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1077G>T	chr19.hg19:g.42914801C>A		141.0	0.0		113.0	45.0	NM_005357	Q3LRT2|Q6NSL7	Silent	SNP	ENST00000244289.4	hg19	CCDS12607.1																																																																																			.	.		0.692	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
ARHGAP35	2909	hgsc.bcm.edu	37	19	47422764	47422764	+	Nonsense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:47422764G>T	ENST00000404338.3	+	1	832	c.832G>T	c.(832-834)Gag>Tag	p.E278*		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	278	FF 1.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										AGACAAGTATGAGTGGCTGGT	0.448																																					p.E278X		Atlas-SNP	.											.	.	.	.	0			c.G832T						.						54.0	55.0	55.0					19																	47422764		2019	4213	6232	SO:0001587	stop_gained	2909	exon1			AAGTATGAGTGGC	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.832G>T	chr19.hg19:g.47422764G>T	ENSP00000385720:p.Glu278*	124.0	0.0		83.0	4.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Nonsense_Mutation	SNP	ENST00000404338.3	hg19	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	G	36	5.791456	0.96945	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-39.3794	19.2296	0.93833	0.0:0.0:1.0:0.0	.	.	.	.	X	278	.	ENSP00000324820:E278X	E	+	1	0	ARHGAP35	52114604	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.062000	0.89475	2.835000	0.97688	0.650000	0.86243	GAG	.	.		0.448	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
CACNG6	59285	hgsc.bcm.edu	37	19	54515342	54515342	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:54515342G>A	ENST00000252729.2	+	4	1272	c.682G>A	c.(682-684)Ggc>Agc	p.G228S	CACNG6_ENST00000352529.1_Missense_Mutation_p.G157S|CACNG6_ENST00000346968.2_Missense_Mutation_p.G182S	NM_145814.1	NP_665813.1	Q9BXT2	CCG6_HUMAN	calcium channel, voltage-dependent, gamma subunit 6	228					calcium ion transport (GO:0006816)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		CGTGGGGGCCGGCCTGATCCT	0.711																																					p.G228S		Atlas-SNP	.											.	CACNG6	42	.	0			c.G682A						.						23.0	28.0	26.0					19																	54515342		2183	4263	6446	SO:0001583	missense	59285	exon4			GGGGCCGGCCTGA	AF288386	CCDS12870.1, CCDS12871.1	19q13.4	2008-05-02			ENSG00000130433	ENSG00000130433		"""Calcium channel subunits"""	13625	protein-coding gene	gene with protein product		606898				11170751	Standard	NM_145814		Approved		uc002qct.3	Q9BXT2	OTTHUMG00000064907	ENST00000252729.2:c.682G>A	chr19.hg19:g.54515342G>A	ENSP00000252729:p.Gly228Ser	46.0	0.0		57.0	11.0	NM_145814		Missense_Mutation	SNP	ENST00000252729.2	hg19	CCDS12870.1	.	.	.	.	.	.	.	.	.	.	G	9.064	0.995102	0.19043	.	.	ENSG00000130433	ENST00000252729;ENST00000352529;ENST00000346968	T;T;T	0.67865	-0.29;1.44;1.43	3.76	-0.149	0.13420	.	0.302241	0.29508	N	0.011955	T	0.52677	0.1749	L	0.57536	1.79	0.09310	N	1	P;B;B	0.45428	0.858;0.131;0.028	B;B;B	0.40009	0.316;0.03;0.035	T	0.48625	-0.9019	10	0.17832	T	0.49	-3.3502	6.2253	0.20703	0.3787:0.0:0.6213:0.0	.	157;182;228	A6NP74;A6NFR2;Q9BXT2	.;.;CCG6_HUMAN	S	228;157;182	ENSP00000252729:G228S;ENSP00000319135:G157S;ENSP00000319097:G182S	ENSP00000252729:G228S	G	+	1	0	CACNG6	59207154	0.183000	0.23186	0.168000	0.22838	0.945000	0.59286	0.438000	0.21559	0.064000	0.16427	-0.261000	0.10672	GGC	.	.		0.711	CACNG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139359.1		
ZNF135	7694	hgsc.bcm.edu	37	19	58579098	58579098	+	Missense_Mutation	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr19:58579098G>A	ENST00000313434.5	+	5	1347	c.1246G>A	c.(1246-1248)Ggg>Agg	p.G416R	ZNF135_ENST00000401053.4_Missense_Mutation_p.G440R|ZNF135_ENST00000511556.1_Missense_Mutation_p.G428R|ZNF135_ENST00000506786.1_Missense_Mutation_p.G374R|ZNF135_ENST00000439855.2_Missense_Mutation_p.G416R|ZNF135_ENST00000359978.6_Intron|RN7SL526P_ENST00000469492.2_RNA	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	416					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		TGGTGAGTGTGGGAAAGCCTT	0.537																																					p.G440R		Atlas-SNP	.											.	ZNF135	159	.	0			c.G1318A						.						72.0	75.0	74.0					19																	58579098		2203	4300	6503	SO:0001583	missense	7694	exon4			GAGTGTGGGAAAG	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.1246G>A	chr19.hg19:g.58579098G>A	ENSP00000321406:p.Gly416Arg	135.0	0.0		133.0	67.0	NM_007134	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	hg19		.	.	.	.	.	.	.	.	.	.	G	12.17	1.858541	0.32791	.	.	ENSG00000176293	ENST00000401053;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786	T;T;T;T;T	0.01484	4.84;4.84;4.84;4.84;4.84	3.1	3.1	0.35709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09069	0.0224	M	0.71920	2.185	0.32425	N	0.548872	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.963	T	0.02588	-1.1137	9	0.87932	D	0	.	13.4044	0.60903	0.0:0.0:1.0:0.0	.	428;416	E9PEV2;P52742	.;ZN135_HUMAN	R	440;416;416;428;374	ENSP00000441410:G440R;ENSP00000444828:G416R;ENSP00000321406:G416R;ENSP00000422074:G428R;ENSP00000427691:G374R	ENSP00000321406:G416R	G	+	1	0	ZNF135	63270910	1.000000	0.71417	0.530000	0.27963	0.010000	0.07245	6.676000	0.74498	1.736000	0.51660	0.557000	0.71058	GGG	.	.		0.537	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
POFUT1	23509	hgsc.bcm.edu	37	20	30803178	30803178	+	Missense_Mutation	SNP	C	C	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr20:30803178C>A	ENST00000375749.3	+	3	415	c.353C>A	c.(352-354)cCc>cAc	p.P118H	POFUT1_ENST00000539210.1_Intron|POFUT1_ENST00000486717.1_3'UTR|POFUT1_ENST00000375730.3_Missense_Mutation_p.P118H	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	118					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ACCCACTGGCCCCCTGAGAAG	0.602																																					p.P118H		Atlas-SNP	.											.	POFUT1	52	.	0			c.C353A						.						79.0	84.0	82.0					20																	30803178		2203	4300	6503	SO:0001583	missense	23509	exon3			ACTGGCCCCCTGA	AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.353C>A	chr20.hg19:g.30803178C>A	ENSP00000364902:p.Pro118His	143.0	0.0		174.0	22.0	NM_172236	A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	ENST00000375749.3	hg19	CCDS13198.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.036603	0.93630	.	.	ENSG00000101346	ENST00000375749;ENST00000375730	T;T	0.32023	1.47;1.47	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.66703	0.2816	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.987	T	0.74182	-0.3748	10	0.87932	D	0	-13.4122	19.7154	0.96115	0.0:1.0:0.0:0.0	.	118;118	Q9H488;Q9H488-2	OFUT1_HUMAN;.	H	118	ENSP00000364902:P118H;ENSP00000364882:P118H	ENSP00000364882:P118H	P	+	2	0	POFUT1	30266839	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.539000	0.67199	2.664000	0.90586	0.655000	0.94253	CCC	.	.		0.602	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078613.1	NM_015352	
ARHGAP40	343578	hgsc.bcm.edu	37	20	37272355	37272355	+	Silent	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr20:37272355G>A	ENST00000373345.4	+	11	1380	c.1212G>A	c.(1210-1212)ctG>ctA	p.L404L		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	404	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						AGGCACTGCTGGAATTCCTCA	0.577																																					p.L456L		Atlas-SNP	.											.	ARHGAP40	50	.	0			c.G1368A						.						79.0	87.0	84.0					20																	37272355		692	1591	2283	SO:0001819	synonymous_variant	343578	exon11			ACTGCTGGAATTC	AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.1212G>A	chr20.hg19:g.37272355G>A		83.0	0.0		91.0	5.0	NM_001164431		Silent	SNP	ENST00000373345.4	hg19		.	.	.	.	.	.	.	.	.	.	G	6.234	0.411228	0.11812	.	.	ENSG00000124143	ENST00000243967	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.69575	0.3126	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69595	-0.5103	4	.	.	.	.	14.1393	0.65308	0.0:0.0:1.0:0.0	.	.	.	.	R	345	.	.	G	+	1	0	ARHGAP40	36705769	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	2.682000	0.46934	1.932000	0.55993	0.484000	0.47621	GGA	.	.		0.577	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_293123	
MTFP1	51537	hgsc.bcm.edu	37	22	30823227	30823227	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr22:30823227G>T	ENST00000266263.5	+	3	615	c.265G>T	c.(265-267)Gct>Tct	p.A89S	RP4-539M6.19_ENST00000439838.1_Missense_Mutation_p.A261S|MTFP1_ENST00000355143.4_Intron|MTFP1_ENST00000407550.3_Splice_Site_p.A66S	NM_016498.4	NP_057582.2	Q9UDX5	MTFP1_HUMAN	mitochondrial fission process 1	89					apoptotic process (GO:0006915)|mitochondrial fission (GO:0000266)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(1)|large_intestine(1)|lung(2)	4						TGTATGGCAGGCTCTAGCCTC	0.642																																					p.A89S		Atlas-SNP	.											.	MTFP1	7	.	0			c.G265T						.						124.0	110.0	115.0					22																	30823227		2203	4300	6503	SO:0001583	missense	51537	exon3			TGGCAGGCTCTAG	AF151076	CCDS33634.1, CCDS33635.1	22q	2010-09-02			ENSG00000242114	ENSG00000242114			26945	protein-coding gene	gene with protein product		610235				15155745, 15985469	Standard	NM_016498		Approved	MTP18, HSPC242		Q9UDX5	OTTHUMG00000151057	ENST00000266263.5:c.265G>T	chr22.hg19:g.30823227G>T	ENSP00000266263:p.Ala89Ser	72.0	0.0		41.0	6.0	NM_016498	A6NFQ5|Q9H3K1|Q9P0N6	Missense_Mutation	SNP	ENST00000266263.5	hg19	CCDS33635.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274720	0.40194	.	.	ENSG00000249590;ENSG00000242114;ENSG00000242114	ENST00000439838;ENST00000266263;ENST00000407550	T	0.65549	-0.16	4.87	3.83	0.44106	.	0.164767	0.52532	N	0.000066	T	0.34395	0.0896	N	0.05330	-0.07	0.80722	D	1	B	0.06786	0.001	B	0.11329	0.006	T	0.16158	-1.0412	10	0.06365	T	0.9	-20.1429	8.7535	0.34633	0.0815:0.0:0.7609:0.1576	.	89	Q9UDX5	MTFP1_HUMAN	S	261;89;66	ENSP00000415178:A261S	ENSP00000266263:A89S	A	+	1	0	MTFP1;RP4-539M6.19	29153227	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	5.245000	0.65405	1.211000	0.43351	0.655000	0.94253	GCT	.	.		0.642	MTFP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321126.3	NM_016498	
TCF20	6942	hgsc.bcm.edu	37	22	42607116	42607116	+	Missense_Mutation	SNP	G	G	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr22:42607116G>T	ENST00000359486.3	-	1	4332	c.4196C>A	c.(4195-4197)gCt>gAt	p.A1399D	TCF20_ENST00000335626.4_Missense_Mutation_p.A1399D|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1399					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						ATCCTGAACAGCAACACTCCC	0.522																																					p.A1399D		Atlas-SNP	.											.	TCF20	164	.	0			c.C4196A						.						120.0	116.0	117.0					22																	42607116		2203	4300	6503	SO:0001583	missense	6942	exon1			TGAACAGCAACAC	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.4196C>A	chr22.hg19:g.42607116G>T	ENSP00000352463:p.Ala1399Asp	133.0	0.0		86.0	27.0	NM_181492	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	ENST00000359486.3	hg19	CCDS14033.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560700	0.45590	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.62941	-0.01;-0.01	5.8	5.8	0.92144	.	0.172580	0.39834	N	0.001251	T	0.56934	0.2019	N	0.24115	0.695	0.80722	D	1	P;P	0.46142	0.873;0.799	B;B	0.43916	0.436;0.252	T	0.62483	-0.6845	10	0.87932	D	0	-5.3152	20.0609	0.97674	0.0:0.0:1.0:0.0	.	1399;1399	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	D	1399	ENSP00000352463:A1399D;ENSP00000335561:A1399D	ENSP00000335561:A1399D	A	-	2	0	TCF20	40937060	0.101000	0.21875	0.063000	0.19743	0.900000	0.52787	2.733000	0.47360	2.755000	0.94549	0.655000	0.94253	GCT	.	.		0.522	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320531.1	NM_181492	
FAM120C	54954	hgsc.bcm.edu	37	X	54209040	54209040	+	Missense_Mutation	SNP	C	C	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chrX:54209040C>T	ENST00000375180.2	-	1	648	c.592G>A	c.(592-594)Gtg>Atg	p.V198M	FAM120C_ENST00000328235.4_Missense_Mutation_p.V198M|FAM120C_ENST00000477084.1_Missense_Mutation_p.V198M|FAM120C_ENST00000497680.1_5'UTR	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	198							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						ACGTGTCCCACGATCAGTTGC	0.706																																					p.V198M		Atlas-SNP	.											.	FAM120C	89	.	0			c.G592A						.						31.0	23.0	25.0					X																	54209040		2190	4290	6480	SO:0001583	missense	54954	exon1			GTCCCACGATCAG	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.592G>A	chrX.hg19:g.54209040C>T	ENSP00000364324:p.Val198Met	80.0	0.0		88.0	45.0	NM_017848	B2RMT7	Missense_Mutation	SNP	ENST00000375180.2	hg19	CCDS14356.1	.	.	.	.	.	.	.	.	.	.	c	15.32	2.799408	0.50208	.	.	ENSG00000184083	ENST00000375180;ENST00000328235;ENST00000477084	T;T;T	0.60672	0.17;0.17;0.17	3.38	3.38	0.38709	.	0.079920	0.49305	U	0.000160	T	0.59473	0.2196	N	0.24115	0.695	0.42452	D	0.99275	P;D;P	0.89917	0.854;1.0;0.759	B;D;B	0.76071	0.157;0.987;0.161	T	0.61397	-0.7071	10	0.51188	T	0.08	-0.5376	10.0371	0.42135	0.0:0.7963:0.2037:0.0	.	198;198;198	F8W881;Q9NX05-2;Q9NX05	.;.;F120C_HUMAN	M	198	ENSP00000364324:V198M;ENSP00000329896:V198M;ENSP00000420718:V198M	ENSP00000329896:V198M	V	-	1	0	FAM120C	54225765	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	4.248000	0.58760	1.694000	0.51137	0.513000	0.50165	GTG	.	.		0.706	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056795.2	NM_017848	
POF1B	79983	hgsc.bcm.edu	37	X	84600900	84600900	+	Missense_Mutation	SNP	A	A	T			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chrX:84600900A>T	ENST00000262753.4	-	6	834	c.689T>A	c.(688-690)cTg>cAg	p.L230Q	POF1B_ENST00000373145.3_Missense_Mutation_p.L230Q	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	230						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						ACTATGGCACAGTTCATTTCC	0.408																																					p.L230Q		Atlas-SNP	.											.	POF1B	77	.	0			c.T689A						.						228.0	193.0	205.0					X																	84600900		2203	4300	6503	SO:0001583	missense	79983	exon6			TGGCACAGTTCAT	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.689T>A	chrX.hg19:g.84600900A>T	ENSP00000262753:p.Leu230Gln	74.0	0.0		83.0	34.0	NM_024921	A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	ENST00000262753.4	hg19	CCDS14452.1	.	.	.	.	.	.	.	.	.	.	A	8.074	0.770971	0.15983	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.13196	2.61;2.61	4.32	1.87	0.25490	.	0.518620	0.16008	N	0.233929	T	0.15565	0.0375	L	0.47716	1.5	0.09310	N	1	P;P	0.44195	0.828;0.571	P;B	0.48400	0.576;0.236	T	0.12142	-1.0559	10	0.66056	D	0.02	.	3.799	0.08751	0.6638:0.2179:0.1183:0.0	.	230;230	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	Q	230	ENSP00000262753:L230Q;ENSP00000362238:L230Q	ENSP00000262753:L230Q	L	-	2	0	POF1B	84487556	0.009000	0.17119	0.000000	0.03702	0.110000	0.19582	1.580000	0.36547	0.153000	0.19213	0.481000	0.45027	CTG	.	.		0.408	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057391.2	NM_024921	
GPC4	2239	hgsc.bcm.edu	37	X	132548888	132548888	+	Missense_Mutation	SNP	G	G	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chrX:132548888G>C	ENST00000370828.3	-	1	630	c.106C>G	c.(106-108)Ctt>Gtt	p.L36V	GPC4_ENST00000535467.1_5'Flank	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	36					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					GACACGTAAAGACGTCGCACT	0.627																																					p.L36V		Atlas-SNP	.											.	GPC4	58	.	0			c.C106G						.						90.0	81.0	84.0					X																	132548888		2203	4300	6503	SO:0001583	missense	2239	exon1			CGTAAAGACGTCG	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.106C>G	chrX.hg19:g.132548888G>C	ENSP00000359864:p.Leu36Val	162.0	0.0		138.0	43.0	NM_001448	B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	ENST00000370828.3	hg19	CCDS14637.1	.	.	.	.	.	.	.	.	.	.	G	2.549	-0.304433	0.05495	.	.	ENSG00000076716	ENST00000370828;ENST00000536418	T	0.49139	0.79	4.42	3.49	0.39957	.	0.300521	0.31747	N	0.007130	T	0.22244	0.0536	N	0.04297	-0.235	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.08743	-1.0707	10	0.08179	T	0.78	-5.201	12.5219	0.56065	0.0:0.1856:0.8144:0.0	.	36	O75487	GPC4_HUMAN	V	36	ENSP00000359864:L36V	ENSP00000359864:L36V	L	-	1	0	GPC4	132376554	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.999000	0.49473	1.782000	0.52362	0.529000	0.55759	CTT	.	.		0.627	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058338.1	NM_001448	
PNMA3	29944	hgsc.bcm.edu	37	X	152225496	152225496	+	Missense_Mutation	SNP	G	G	C			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chrX:152225496G>C	ENST00000370264.4	+	1	110	c.84G>C	c.(82-84)gaG>gaC	p.E28D	PNMA3_ENST00000370265.4_Missense_Mutation_p.E28D|PNMA3_ENST00000447306.1_Missense_Mutation_p.E28D			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	28					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					ggatccccgaggactgtggcg	0.587																																					p.E28D		Atlas-SNP	.											.	PNMA3	81	.	0			c.G84C						.						102.0	86.0	91.0					X																	152225496		2203	4300	6503	SO:0001583	missense	29944	exon2			CCCCGAGGACTGT	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.84G>C	chrX.hg19:g.152225496G>C	ENSP00000359286:p.Glu28Asp	140.0	0.0		121.0	47.0	NM_013364	D3DWT7|Q9H0A4	Missense_Mutation	SNP	ENST00000370264.4	hg19	CCDS35435.2	.	.	.	.	.	.	.	.	.	.	g	11.47	1.649080	0.29336	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.10288	2.89;2.89;2.89	2.23	1.31	0.21738	.	.	.	.	.	T	0.08891	0.0220	L	0.28274	0.84	0.09310	N	1	P	0.45348	0.856	P	0.48598	0.583	T	0.25502	-1.0130	9	0.14656	T	0.56	.	4.7598	0.13102	0.1979:0.0:0.8021:0.0	.	28	Q9UL41	PNMA3_HUMAN	D	28	ENSP00000359288:E28D;ENSP00000407642:E28D;ENSP00000359286:E28D	ENSP00000359286:E28D	E	+	3	2	PNMA3	151976152	0.829000	0.29322	0.016000	0.15963	0.404000	0.30871	0.733000	0.26087	0.349000	0.23975	0.411000	0.27672	GAG	.	.		0.587	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364	
ARHGAP4	393	hgsc.bcm.edu	37	X	153174961	153174961	+	Silent	SNP	G	G	A			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chrX:153174961G>A	ENST00000350060.5	-	20	2484	c.2443C>T	c.(2443-2445)Ctg>Ttg	p.L815L	ARHGAP4_ENST00000370016.1_Silent_p.L794L|ARHGAP4_ENST00000467421.1_Intron|ARHGAP4_ENST00000537206.1_Silent_p.L792L|ARHGAP4_ENST00000370028.3_Silent_p.L855L|ARHGAP4_ENST00000393721.1_Silent_p.L637L	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	815					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAGTCTGCAGCCCTGCGCCC	0.697																																					p.L855L		Atlas-SNP	.											.	ARHGAP4	103	.	0			c.C2563T						.						32.0	30.0	30.0					X																	153174961		2202	4300	6502	SO:0001819	synonymous_variant	393	exon21			TCTGCAGCCCTGC	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2443C>T	chrX.hg19:g.153174961G>A		142.0	0.0		114.0	87.0	NM_001164741	Q14144|Q86UY3	Silent	SNP	ENST00000350060.5	hg19	CCDS14736.1																																																																																			.	.		0.697	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	
TTF1	7270	hgsc.bcm.edu	37	9	135277372	135277373	+	Frame_Shift_Ins	INS	-	-	T	rs531537365		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr9:135277372_135277373insT	ENST00000334270.2	-	2	875_876	c.836_837insA	c.(835-837)aagfs	p.K279fs		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	279	Poly-Lys.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		ACTTTTTCTTCTTTTTTTTCTT	0.48																																					p.K279fs		Atlas-INDEL	.											.	TTF1	82	.	0			c.837_838insA						.																																			SO:0001589	frameshift_variant	7270	exon2			.	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.837dupA	chr9.hg19:g.135277380_135277380dupT	ENSP00000333920:p.Lys279fs	78.0	0.0		68.0	16.0	NM_007344	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Frame_Shift_Ins	INS	ENST00000334270.2	hg19	CCDS6948.1																																																																																			.	.		0.480	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344	
STARD5	80765	hgsc.bcm.edu	37	15	81616431	81616432	+	Frame_Shift_Ins	INS	-	-	CGGGTCCATTGCGT	rs567953882		TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr15:81616431_81616432insCGGGTCCATTGCGT	ENST00000302824.6	-	1	34_35	c.9_10insACGCAATGGACCCG	c.(7-12)ccggcgfs	p.A4fs	RP11-761I4.3_ENST00000560973.1_RNA|RP11-761I4.3_ENST00000559781.1_RNA|STARD5_ENST00000559913.1_De_novo_Start_OutOfFrame	NM_181900.2	NP_871629.1	Q9NSY2	STAR5_HUMAN	StAR-related lipid transfer (START) domain containing 5	4	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				C21-steroid hormone biosynthetic process (GO:0006700)|lipid transport (GO:0006869)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytosol (GO:0005829)	lipid binding (GO:0008289)			large_intestine(3)|ovary(1)|skin(1)|stomach(1)	6						GCTGCCAGCGCCGGGTCCATTG	0.673																																					p.A4fs		Atlas-INDEL	.											.	STARD5	20	.	0			c.10_11insACGCAATGGACCCG						.																																			SO:0001589	frameshift_variant	80765	exon1			.	AF480304	CCDS10318.1	15q26	2011-09-12	2007-08-16		ENSG00000172345	ENSG00000172345		"""StAR-related lipid transfer (START) domain containing"""	18065	protein-coding gene	gene with protein product		607050	"""START domain containing 5"""			12011452	Standard	NM_181900		Approved	MGC10327	uc002bgm.3	Q9NSY2	OTTHUMG00000147342	ENST00000302824.6:c.-4_9dupACGCAATGGACCCG	chr15.hg19:g.81616431_81616432insCGGGTCCATTGCGT	ENSP00000304032:p.Ala4fs	143.0	0.0		83.0	14.0	NM_181900	P59094	Frame_Shift_Ins	INS	ENST00000302824.6	hg19	CCDS10318.1																																																																																			.	.		0.673	STARD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303950.2		
CROT	54677	hgsc.bcm.edu	37	7	86978406	86978406	+	Frame_Shift_Del	DEL	T	T	-			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr7:86978406delT	ENST00000331536.3	+	3	207	c.22delT	c.(22-24)tcafs	p.S8fs	CROT_ENST00000412227.2_Frame_Shift_Del_p.S8fs|CROT_ENST00000419147.2_Frame_Shift_Del_p.S8fs|CROT_ENST00000442291.1_Frame_Shift_Del_p.S8fs	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	8					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	ATTGGCTAAATCAACTGAAGA	0.358																																					p.K7fs		Atlas-INDEL	.											.	CROT	81	.	0			c.21delA						.						81.0	82.0	82.0					7																	86978406		2203	4300	6503	SO:0001589	frameshift_variant	54677	exon3			.		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.22delT	chr7.hg19:g.86978406delT	ENSP00000331981:p.Ser8fs	528.0	0.0		376.0	143.0	NM_001243745	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Frame_Shift_Del	DEL	ENST00000331536.3	hg19	CCDS5604.1																																																																																			.	.		0.358	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151	
TP53	7157	hgsc.bcm.edu	37	17	7577112	7577113	+	Frame_Shift_Ins	INS	-	-	ACAA			TCGA-NI-A8LF-01A-11D-A35Z-10	TCGA-NI-A8LF-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	591e019d-1317-490a-b687-1d8f75118e1f	9145d9de-76f8-4fbf-863f-d7f80611dcd9	g.chr17:7577112_7577113insACAA	ENST00000269305.4	-	8	1014_1015	c.825_826insTTGT	c.(823-828)tgtgccfs	p.A276fs	TP53_ENST00000455263.2_Frame_Shift_Ins_p.A276fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Frame_Shift_Ins_p.A276fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.A276fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.A276fs|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	276	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A276P(15)|p.A276S(9)|p.0?(8)|p.C275W(7)|p.A276T(7)|p.C275C(4)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.A276fs*68(1)|p.R273_C275delRVC(1)|p.C275_A276ins10(1)|p.V274_P278del(1)|p.C275*(1)|p.F270_D281del12(1)|p.A276fs*31(1)|p.C275_R283delCACPGRDRR(1)|p.A276fs*70(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.A276_C277delAC(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275fs*20(1)|p.A276fs*29(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCAGGACAGGCACAAACACGCA	0.55		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.A276fs	Pancreas(47;798 1329 9957 10801)	Atlas-INDEL	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,NS,+1,2	TP53	33396	.	70	Substitution - Missense(38)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Substitution - coding silent(4)|Insertion - Frameshift(2)|Unknown(2)|Substitution - Nonsense(1)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(13)|upper_aerodigestive_tract(6)|stomach(6)|large_intestine(6)|breast(6)|bone(6)|biliary_tract(4)|central_nervous_system(4)|thymus(3)|urinary_tract(3)|oesophagus(3)|skin(3)|ovary(2)|soft_tissue(1)|kidney(1)|endometrium(1)|lung(1)|prostate(1)	c.826_827insTTGT						.																																			SO:0001589	frameshift_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.822_825dupTTGT	chr17.hg19:g.7577113_7577116dupACAA	ENSP00000269305:p.Ala276fs	138.0	0.0		58.0	36.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.550	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
