#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PER3	8863	hgsc.bcm.edu	37	1	7887481	7887481	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:7887481G>A	ENST00000361923.2	+	17	2643	c.2468G>A	c.(2467-2469)gGc>gAc	p.G823D	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.G831D	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	823	Pro-rich.				circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		GCACCGGAAGGCCTGCATGGG	0.607																																					p.G823D		Atlas-SNP	.											.	PER3	95	.	0			c.G2468A						.						89.0	90.0	89.0					1																	7887481		2203	4300	6503	SO:0001583	missense	8863	exon17			CGGAAGGCCTGCA	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2468G>A	chr1.hg19:g.7887481G>A	ENSP00000355031:p.Gly823Asp	101.0	0.0		100.0	38.0	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	hg19	CCDS89.1	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343053	0.24339	.	.	ENSG00000049246	ENST00000377532;ENST00000361923;ENST00000539773	T;T	0.09817	2.95;2.94	4.04	-1.84	0.07809	.	2.607050	0.00945	N	0.002889	T	0.04003	0.0112	N	0.08118	0	0.09310	N	1	B;B;B;B	0.31730	0.112;0.337;0.082;0.112	B;B;B;B	0.25759	0.039;0.063;0.037;0.039	T	0.19353	-1.0308	10	0.12103	T	0.63	.	0.4408	0.00486	0.2089:0.2182:0.3026:0.2703	.	823;831;831;823	A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;PER3_HUMAN	D	831;823;34	ENSP00000366755:G831D;ENSP00000355031:G823D	ENSP00000355031:G823D	G	+	2	0	PER3	7810068	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.443000	0.21644	-0.197000	0.10350	-1.157000	0.01802	GGC	.	.		0.607	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
EIF4G3	8672	hgsc.bcm.edu	37	1	21276594	21276594	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:21276594C>T	ENST00000264211.8	-	7	751	c.557G>A	c.(556-558)aGc>aAc	p.S186N	EIF4G3_ENST00000374937.3_Missense_Mutation_p.S192N|EIF4G3_ENST00000374935.3_Missense_Mutation_p.S186N|EIF4G3_ENST00000602326.1_Missense_Mutation_p.S192N|EIF4G3_ENST00000356916.3_Missense_Mutation_p.S197N|EIF4G3_ENST00000536266.1_Intron|EIF4G3_ENST00000400422.1_Missense_Mutation_p.S186N|EIF4G3_ENST00000374927.4_Missense_Mutation_p.S186N	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	186					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GGGGACCTGGCTGGGCAGCTG	0.532																																					p.S197N		Atlas-SNP	.											.	EIF4G3	300	.	0			c.G590A						.						46.0	47.0	47.0					1																	21276594		2203	4300	6503	SO:0001583	missense	8672	exon13			ACCTGGCTGGGCA	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.557G>A	chr1.hg19:g.21276594C>T	ENSP00000264211:p.Ser186Asn	27.0	0.0		57.0	14.0	NM_001198803	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	hg19	CCDS214.1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.249850	0.59212	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000374937;ENST00000356916;ENST00000374927;ENST00000537059;ENST00000438975	T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91	5.85	5.85	0.93711	.	0.402206	0.31922	N	0.006859	T	0.32102	0.0818	N	0.08118	0	0.80722	D	1	D;D;D;D;D;D	0.69078	0.997;0.995;0.993;0.996;0.993;0.997	D;D;D;D;D;D	0.78314	0.991;0.966;0.968;0.986;0.953;0.986	T	0.25745	-1.0123	10	0.19147	T	0.46	-9.7486	20.1663	0.98152	0.0:1.0:0.0:0.0	.	186;381;186;312;192;186	B4DXR2;Q59GJ0;Q504Z1;B1AN89;B9EGQ7;O43432	.;.;.;.;.;IF4G3_HUMAN	N	186;382;186;186;192;312;186;197;186	ENSP00000264211:S186N;ENSP00000383274:S186N;ENSP00000364071:S186N;ENSP00000364073:S192N;ENSP00000364062:S186N;ENSP00000395381:S186N	ENSP00000264211:S186N	S	-	2	0	EIF4G3	21149181	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.069000	0.57541	2.773000	0.95371	0.585000	0.79938	AGC	.	.		0.532	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
MPL	4352	hgsc.bcm.edu	37	1	43805039	43805039	+	Silent	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:43805039T>C	ENST00000372470.3	+	4	531	c.489T>C	c.(487-489)gaT>gaC	p.D163D	MPL_ENST00000413998.2_Silent_p.D163D	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	163					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	AAATCAGTGATTTCCTGAGGT	0.592			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														p.D163D	NSCLC(52;534 1204 10016 41452 44427)	Atlas-SNP	.	yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	.	MPL	651	.	0			c.T489C						.						71.0	65.0	67.0					1																	43805039		2203	4300	6503	SO:0001819	synonymous_variant	4352	exon4			CAGTGATTTCCTG	M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.489T>C	chr1.hg19:g.43805039T>C		105.0	0.0		145.0	41.0	NM_005373	Q5JUZ0	Silent	SNP	ENST00000372470.3	hg19	CCDS483.1																																																																																			.	.		0.592	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019522.1	NM_005373	
NRD1	4898	hgsc.bcm.edu	37	1	52269532	52269532	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:52269532T>C	ENST00000354831.7	-	22	2660	c.2471A>G	c.(2470-2472)gAa>gGa	p.E824G	NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000544028.1_Missense_Mutation_p.E624G|RP4-657D16.6_ENST00000607338.1_RNA|NRD1_ENST00000352171.7_Missense_Mutation_p.E756G|NRD1_ENST00000539524.1_Missense_Mutation_p.E692G	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	755					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						TAAACCATGTTCTCCAGCTAC	0.373																																					p.E824G		Atlas-SNP	.											.	NRD1	89	.	0			c.A2471G						.						97.0	94.0	95.0					1																	52269532		2203	4300	6503	SO:0001583	missense	4898	exon22			CCATGTTCTCCAG	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.2471A>G	chr1.hg19:g.52269532T>C	ENSP00000346890:p.Glu824Gly	100.0	0.0		81.0	28.0	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.681688	0.88542	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169;ENST00000544028	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	4.82	4.82	0.62117	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.63390	0.2507	M	0.85197	2.74	0.80722	D	1	D;D;D	0.67145	0.996;0.992;0.992	P;P;P	0.59424	0.857;0.821;0.821	T	0.68100	-0.5498	10	0.42905	T	0.14	-13.6702	14.5576	0.68113	0.0:0.0:0.0:1.0	.	756;755;824	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	G	756;824;692;186;756;624	ENSP00000262679:E756G;ENSP00000346890:E824G;ENSP00000444416:E692G;ENSP00000442262:E624G	ENSP00000262679:E756G	E	-	2	0	NRD1	52042120	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.525000	0.81892	2.031000	0.59945	0.482000	0.46254	GAA	.	.		0.373	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
ZFYVE9	9372	hgsc.bcm.edu	37	1	52732378	52732378	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:52732378A>C	ENST00000371591.1	+	5	2461	c.2330A>C	c.(2329-2331)aAc>aCc	p.N777T	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.N777T|ZFYVE9_ENST00000357206.2_Intron	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	777	SBD.				endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						CCTAACCCTAACAATCCTGCT	0.493																																					p.N777T		Atlas-SNP	.											.	ZFYVE9	131	.	0			c.A2330C						.						173.0	154.0	161.0					1																	52732378		2203	4300	6503	SO:0001583	missense	9372	exon6			ACCCTAACAATCC	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.2330A>C	chr1.hg19:g.52732378A>C	ENSP00000360647:p.Asn777Thr	45.0	0.0		62.0	9.0	NM_004799	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	hg19	CCDS563.1	.	.	.	.	.	.	.	.	.	.	A	18.88	3.718036	0.68844	.	.	ENSG00000157077	ENST00000287727;ENST00000371591	T;T	0.43688	0.94;0.94	5.25	5.25	0.73442	Smad anchor for receptor activation, Smad-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.51312	0.1667	L	0.55990	1.75	0.80722	D	1	P	0.38677	0.642	P	0.48304	0.573	T	0.54536	-0.8279	10	0.66056	D	0.02	.	15.1582	0.72761	1.0:0.0:0.0:0.0	.	777	O95405	ZFYV9_HUMAN	T	777	ENSP00000287727:N777T;ENSP00000360647:N777T	ENSP00000287727:N777T	N	+	2	0	ZFYVE9	52504966	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.203000	0.95033	1.975000	0.57531	0.533000	0.62120	AAC	.	.		0.493	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156917232	156917232	+	Silent	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:156917232C>T	ENST00000361409.2	-	25	2974	c.2232G>A	c.(2230-2232)gtG>gtA	p.V744V	ARHGEF11_ENST00000487682.1_5'Flank|ARHGEF11_ENST00000315174.8_Silent_p.V160V|ARHGEF11_ENST00000368194.3_Silent_p.V784V	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	744	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AAGCTTCAGTCACAAACAGCT	0.577																																					p.V784V		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.G2352A						.						29.0	31.0	30.0					1																	156917232		2203	4300	6503	SO:0001819	synonymous_variant	9826	exon26			TTCAGTCACAAAC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2232G>A	chr1.hg19:g.156917232C>T		36.0	0.0		47.0	22.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	hg19	CCDS1162.1																																																																																			.	.		0.577	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
PYHIN1	149628	hgsc.bcm.edu	37	1	158913594	158913594	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:158913594G>T	ENST00000368140.1	+	6	1262	c.1017G>T	c.(1015-1017)agG>agT	p.R339S	PYHIN1_ENST00000392252.3_Missense_Mutation_p.R330S|PYHIN1_ENST00000392254.2_Missense_Mutation_p.R339S|PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000368138.3_Missense_Mutation_p.R330S	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	339	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					TTGTAAATAGGAAGACGACAA	0.343																																					p.R339S		Atlas-SNP	.											.	PYHIN1	208	.	0			c.G1017T						.						63.0	65.0	64.0					1																	158913594		2203	4300	6503	SO:0001583	missense	149628	exon6			AAATAGGAAGACG	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1017G>T	chr1.hg19:g.158913594G>T	ENSP00000357122:p.Arg339Ser	177.0	0.0		183.0	29.0	NM_152501	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	ENST00000368140.1	hg19	CCDS1178.1	.	.	.	.	.	.	.	.	.	.	G	0.826	-0.746839	0.03065	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.13420	2.59;2.59;2.59;2.59	3.13	-6.26	0.02033	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.01905	0.0060	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.22541	0.058;0.032;0.058;0.071	B;B;B;B	0.25884	0.023;0.064;0.023;0.038	T	0.44528	-0.9322	9	0.18710	T	0.47	.	1.7041	0.02878	0.402:0.3137:0.1595:0.1248	.	330;339;330;339	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	S	339;330;339;330	ENSP00000357122:R339S;ENSP00000357120:R330S;ENSP00000376083:R339S;ENSP00000376082:R330S	ENSP00000357120:R330S	R	+	3	2	PYHIN1	157180218	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-4.421000	0.00236	-1.716000	0.01387	-0.150000	0.13652	AGG	.	.		0.343	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
RYR2	6262	hgsc.bcm.edu	37	1	237693789	237693789	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr1:237693789A>G	ENST00000366574.2	+	25	3202	c.2885A>G	c.(2884-2886)aAa>aGa	p.K962R	RYR2_ENST00000360064.6_Missense_Mutation_p.K960R|RYR2_ENST00000542537.1_Missense_Mutation_p.K946R	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	962	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GACAAGGTGAAAAAAATGAAG	0.358																																					p.K962R		Atlas-SNP	.											.	RYR2	1273	.	0			c.A2885G						.						101.0	94.0	96.0					1																	237693789		1860	4097	5957	SO:0001583	missense	6262	exon25			AGGTGAAAAAAAT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2885A>G	chr1.hg19:g.237693789A>G	ENSP00000355533:p.Lys962Arg	59.0	0.0		68.0	15.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	11.79	1.742337	0.30865	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96774	-4.12;-4.1;-4.11	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000004	D	0.90724	0.7089	N	0.20610	0.595	0.80722	D	1	P	0.48230	0.907	B	0.41036	0.346	D	0.89441	0.3723	10	0.09843	T	0.71	.	12.6068	0.56527	1.0:0.0:0.0:0.0	.	962	Q92736	RYR2_HUMAN	R	962;960;946	ENSP00000355533:K962R;ENSP00000353174:K960R;ENSP00000443798:K946R	ENSP00000353174:K960R	K	+	2	0	RYR2	235760412	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.453000	0.73488	1.952000	0.56665	0.455000	0.32223	AAA	.	.		0.358	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
ZAP70	7535	hgsc.bcm.edu	37	2	98340508	98340508	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr2:98340508C>A	ENST00000264972.5	+	3	224	c.9C>A	c.(7-9)gaC>gaA	p.D3E	ZAP70_ENST00000442208.1_5'Flank	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	3					adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CGATGCCAGACCCCGCGGCGC	0.692																																					p.D3E		Atlas-SNP	.											.	ZAP70	77	.	0			c.C9A						.						7.0	9.0	8.0					2																	98340508		2158	4230	6388	SO:0001583	missense	7535	exon3			GCCAGACCCCGCG	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.9C>A	chr2.hg19:g.98340508C>A	ENSP00000264972:p.Asp3Glu	23.0	0.0		20.0	14.0	NM_001079	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	ENST00000264972.5	hg19	CCDS33254.1	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845964	0.51164	.	.	ENSG00000115085	ENST00000264972	T	0.73575	-0.76	4.99	1.58	0.23477	.	0.000000	0.51477	D	0.000098	T	0.63710	0.2534	L	0.56769	1.78	0.80722	D	1	B;B	0.14012	0.009;0.001	B;B	0.14578	0.011;0.003	T	0.58555	-0.7616	10	0.51188	T	0.08	.	3.4075	0.07347	0.0:0.479:0.2006:0.3204	.	3;3	B4E0E2;P43403	.;ZAP70_HUMAN	E	3	ENSP00000264972:D3E	ENSP00000264972:D3E	D	+	3	2	ZAP70	97706940	0.990000	0.36364	1.000000	0.80357	0.965000	0.64279	0.544000	0.23253	0.607000	0.29982	0.585000	0.79938	GAC	.	.		0.692	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329278.1		
FN1	2335	hgsc.bcm.edu	37	2	216261911	216261911	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr2:216261911T>C	ENST00000359671.1	-	23	3818	c.3553A>G	c.(3553-3555)Aac>Gac	p.N1185D	FN1_ENST00000354785.4_Missense_Mutation_p.N1185D|FN1_ENST00000357009.2_Missense_Mutation_p.N1185D|FN1_ENST00000323926.6_Missense_Mutation_p.N1185D|FN1_ENST00000421182.1_Missense_Mutation_p.N1185D|FN1_ENST00000336916.4_Missense_Mutation_p.N1185D|FN1_ENST00000346544.3_Missense_Mutation_p.N1185D|FN1_ENST00000432072.2_Missense_Mutation_p.N1185D|FN1_ENST00000345488.5_Missense_Mutation_p.N1185D|FN1_ENST00000357867.4_Missense_Mutation_p.N1185D|FN1_ENST00000443816.1_Missense_Mutation_p.N1185D|FN1_ENST00000446046.1_Missense_Mutation_p.N1185D|FN1_ENST00000356005.4_Missense_Mutation_p.N1185D			P02751	FINC_HUMAN	fibronectin 1	1185	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GTGTCAGGGTTTGCCTCCAGA	0.478																																					p.N1185D		Atlas-SNP	.											.	FN1	521	.	0			c.A3553G						.						191.0	189.0	189.0					2																	216261911		2203	4300	6503	SO:0001583	missense	2335	exon23			CAGGGTTTGCCTC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3553A>G	chr2.hg19:g.216261911T>C	ENSP00000352696:p.Asn1185Asp	61.0	0.0		49.0	8.0	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	T	13.23	2.176311	0.38413	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.62	4.44	0.53790	.	0.069763	0.64402	D	0.000016	T	0.56455	0.1986	N	0.24115	0.695	0.52501	D	0.999954	D;P;P;P;P;P;D;P;P;D	0.61080	0.961;0.84;0.868;0.945;0.791;0.615;0.989;0.897;0.942;0.962	P;P;P;P;P;P;D;D;D;P	0.67103	0.839;0.713;0.687;0.508;0.641;0.46;0.918;0.949;0.949;0.878	T	0.56396	-0.7986	10	0.42905	T	0.14	.	12.9834	0.58577	0.0:0.0:0.135:0.8649	.	1185;1185;1185;1185;1185;1185;1185;1185;1185;1185	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	D	1185	ENSP00000394423:N1185D;ENSP00000323534:N1185D;ENSP00000338200:N1185D;ENSP00000350534:N1185D;ENSP00000346839:N1185D;ENSP00000352696:N1185D;ENSP00000265312:N1185D;ENSP00000273049:N1185D;ENSP00000349509:N1185D;ENSP00000410422:N1185D;ENSP00000415018:N1185D;ENSP00000399538:N1185D;ENSP00000348285:N1185D	ENSP00000265313:N1185D	N	-	1	0	FN1	215970156	1.000000	0.71417	0.789000	0.31954	0.215000	0.24574	7.434000	0.80377	1.032000	0.39892	0.477000	0.44152	AAC	.	.		0.478	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
STK25	10494	hgsc.bcm.edu	37	2	242439594	242439594	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr2:242439594T>C	ENST00000316586.4	-	5	770	c.421A>G	c.(421-423)Atc>Gtc	p.I141V	STK25_ENST00000478403.1_5'Flank|STK25_ENST00000401869.1_Missense_Mutation_p.I141V|STK25_ENST00000405883.3_Missense_Mutation_p.I64V|STK25_ENST00000403346.3_Missense_Mutation_p.I141V|STK25_ENST00000405585.1_Missense_Mutation_p.I64V|STK25_ENST00000535007.1_Missense_Mutation_p.I47V|STK25_ENST00000543554.1_Missense_Mutation_p.I47V	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25	141	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		GGACCTTTGATGTCTCGGTGG	0.582																																					p.I141V	NSCLC(99;1100 1566 7679 28647 48345)	Atlas-SNP	.											.	STK25	32	.	0			c.A421G						.						113.0	103.0	106.0					2																	242439594		2203	4300	6503	SO:0001583	missense	10494	exon5			CTTTGATGTCTCG	D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.421A>G	chr2.hg19:g.242439594T>C	ENSP00000325748:p.Ile141Val	85.0	0.0		64.0	20.0	NM_006374	A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	Missense_Mutation	SNP	ENST00000316586.4	hg19	CCDS2549.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.387266	0.82902	.	.	ENSG00000115694	ENST00000316586;ENST00000403346;ENST00000401869;ENST00000405883;ENST00000545437;ENST00000405585;ENST00000543554;ENST00000535007;ENST00000450497;ENST00000424537;ENST00000442307;ENST00000413760;ENST00000429279;ENST00000436402;ENST00000440109;ENST00000435225	T;T;T;T;T;T;T;T;T;T;T;D;T;D;D	0.85339	1.54;1.54;1.54;1.54;1.54;1.54;1.54;2.28;2.28;2.28;2.28;-1.97;0.76;-1.97;-1.97	5.07	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87160	0.6108	L	0.48260	1.515	0.80722	D	1	P;P;P;P	0.42973	0.796;0.791;0.576;0.576	P;P;P;B	0.53035	0.716;0.667;0.501;0.304	D	0.86704	0.1931	10	0.41790	T	0.15	.	15.1502	0.72692	0.0:0.0:0.0:1.0	.	141;67;64;141	B4DZ52;B4DVS7;A8K6Z3;O00506	.;.;.;STK25_HUMAN	V	141;141;141;64;47;64;47;47;47;45;47;47;47;141;47;47	ENSP00000325748:I141V;ENSP00000384162:I141V;ENSP00000385687:I141V;ENSP00000384444:I64V;ENSP00000385541:I64V;ENSP00000444886:I47V;ENSP00000446008:I47V;ENSP00000399212:I47V;ENSP00000417020:I45V;ENSP00000403607:I47V;ENSP00000395104:I47V;ENSP00000404960:I47V;ENSP00000412617:I141V;ENSP00000403866:I47V;ENSP00000401114:I47V	ENSP00000325748:I141V	I	-	1	0	STK25	242088267	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.834000	0.86773	2.035000	0.60131	0.533000	0.62120	ATC	.	.		0.582	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257265.4	NM_006374	
UBA7	7318	hgsc.bcm.edu	37	3	49848783	49848783	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr3:49848783C>G	ENST00000333486.3	-	9	1203	c.1045G>C	c.(1045-1047)Gtc>Ctc	p.V349L	UBA7_ENST00000494212.1_5'Flank	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	349	2 approximate repeats.				cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CTTAGGGCGACTGTCCGCACT	0.622																																					p.V349L		Atlas-SNP	.											.	UBA7	64	.	0			c.G1045C						.						145.0	114.0	125.0					3																	49848783		2203	4300	6503	SO:0001583	missense	7318	exon9			GGGCGACTGTCCG	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.1045G>C	chr3.hg19:g.49848783C>G	ENSP00000333266:p.Val349Leu	80.0	0.0		81.0	38.0	NM_003335	Q9BRB2	Missense_Mutation	SNP	ENST00000333486.3	hg19	CCDS2805.1	.	.	.	.	.	.	.	.	.	.	C	0.266	-0.996159	0.02145	.	.	ENSG00000182179	ENST00000333486	T	0.28666	1.6	5.76	0.164	0.14990	Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.472532	0.24222	N	0.040426	T	0.08582	0.0213	N	0.05078	-0.115	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.25467	-1.0131	10	0.02654	T	1	-6.9929	1.0506	0.01579	0.192:0.3541:0.1076:0.3464	.	349	P41226	UBA7_HUMAN	L	349	ENSP00000333266:V349L	ENSP00000333266:V349L	V	-	1	0	UBA7	49823787	0.000000	0.05858	0.000000	0.03702	0.497000	0.33675	0.025000	0.13577	0.073000	0.16731	-0.379000	0.06801	GTC	.	.		0.622	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350503.1	NM_003335	
POLQ	10721	hgsc.bcm.edu	37	3	121215700	121215700	+	Missense_Mutation	SNP	G	G	T	rs373455498		TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr3:121215700G>T	ENST00000264233.5	-	14	2361	c.2233C>A	c.(2233-2235)Cgt>Agt	p.R745S		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	745					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		ATCTGCCCACGATTGCATCCA	0.363								DNA polymerases (catalytic subunits)																													p.R745S	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.C2233A						.						102.0	101.0	101.0					3																	121215700		2203	4300	6503	SO:0001583	missense	10721	exon14			GCCCACGATTGCA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.2233C>A	chr3.hg19:g.121215700G>T	ENSP00000264233:p.Arg745Ser	63.0	0.0		59.0	24.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.538819	0.65085	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.59083	0.29	5.63	5.63	0.86233	.	0.110946	0.64402	D	0.000006	T	0.78142	0.4237	M	0.88775	2.98	0.80722	D	1	D	0.55800	0.973	P	0.56751	0.805	T	0.82269	-0.0541	10	0.87932	D	0	.	19.753	0.96275	0.0:0.0:1.0:0.0	.	745	O75417	DPOLQ_HUMAN	S	368;745;881	ENSP00000264233:R745S	ENSP00000264233:R745S	R	-	1	0	POLQ	122698390	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	8.799000	0.91895	2.669000	0.90835	0.461000	0.40582	CGT	.	.		0.363	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
STAG1	10274	hgsc.bcm.edu	37	3	136057110	136057110	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr3:136057110T>G	ENST00000383202.2	-	34	4019	c.3763A>C	c.(3763-3765)Atg>Ctg	p.M1255L	STAG1_ENST00000236698.5_Missense_Mutation_p.M1218L|STAG1_ENST00000434713.2_Missense_Mutation_p.M995L|STAG1_ENST00000536929.1_Missense_Mutation_p.M839L	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1255					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						AACATAGGCATTCCAAATCCC	0.318																																					p.M1255L		Atlas-SNP	.											.	STAG1	135	.	0			c.A3763C						.						59.0	62.0	61.0					3																	136057110		2203	4300	6503	SO:0001583	missense	10274	exon34			TAGGCATTCCAAA	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.3763A>C	chr3.hg19:g.136057110T>G	ENSP00000372689:p.Met1255Leu	128.0	0.0		144.0	29.0	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	hg19	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.819704	0.32145	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.27104	2.1;2.02;2.05;1.69	5.76	5.76	0.90799	.	0.042059	0.85682	D	0.000000	T	0.28599	0.0708	L	0.54323	1.7	0.58432	D	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.02498	-1.1150	10	0.48119	T	0.1	.	16.0645	0.80861	0.0:0.0:0.0:1.0	.	1218;1255	Q6P275;Q8WVM7	.;STAG1_HUMAN	L	1255;1218;995;839	ENSP00000372689:M1255L;ENSP00000236698:M1218L;ENSP00000404396:M995L;ENSP00000445787:M839L	ENSP00000236698:M1218L	M	-	1	0	STAG1	137539800	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.344000	0.79328	2.200000	0.70718	0.482000	0.46254	ATG	.	.		0.318	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
ANKUB1	389161	hgsc.bcm.edu	37	3	149485434	149485434	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr3:149485434A>G	ENST00000383050.3	-	5	1471	c.1015T>C	c.(1015-1017)Ttt>Ctt	p.F339L	ANKUB1_ENST00000446160.1_Missense_Mutation_p.F339L|ANKUB1_ENST00000462519.2_Missense_Mutation_p.F339L			A6NFN9	ANKUB_HUMAN	ankyrin repeat and ubiquitin domain containing 1	339										breast(1)|kidney(1)|lung(1)|skin(1)	4						TTTGCCCCAAAGACCCTTGCT	0.433																																					p.F339L		Atlas-SNP	.											.	ANKUB1	27	.	0			c.T1015C						.						75.0	60.0	65.0					3																	149485434		692	1591	2283	SO:0001583	missense	389161	exon5			CCCCAAAGACCCT	AK027233		3q25.1	2013-01-11	2011-05-10	2011-05-10	ENSG00000206199	ENSG00000206199		"""Ankyrin repeat domain containing"""	29642	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 16"""	C3orf16			Standard	NM_001144960		Approved		uc003exl.3	A6NFN9	OTTHUMG00000159615	ENST00000383050.3:c.1015T>C	chr3.hg19:g.149485434A>G	ENSP00000372522:p.Phe339Leu	102.0	0.0		122.0	20.0	NM_001144960	B4E2N8	Missense_Mutation	SNP	ENST00000383050.3	hg19		.	.	.	.	.	.	.	.	.	.	A	9.203	1.028952	0.19512	.	.	ENSG00000206199	ENST00000446160;ENST00000383050;ENST00000462519	T;T;T	0.25250	1.81;1.83;1.83	5.31	1.47	0.22746	.	.	.	.	.	T	0.10766	0.0263	N	0.04959	-0.14	0.21604	N	0.999622	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.35301	-0.9794	9	0.23302	T	0.38	.	5.9052	0.18992	0.708:0.1397:0.1523:0.0	.	339;339	A6NFN9;E9PHT4	ANKUB_HUMAN;.	L	339	ENSP00000387907:F339L;ENSP00000372522:F339L;ENSP00000417635:F339L	ENSP00000372522:F339L	F	-	1	0	ANKUB1	150968124	0.000000	0.05858	0.029000	0.17559	0.969000	0.65631	0.873000	0.28052	0.015000	0.14971	0.482000	0.46254	TTT	.	.		0.433	ANKUB1-201	KNOWN	basic	protein_coding	protein_coding		NM_001144960	
IL12A	3592	hgsc.bcm.edu	37	3	159711492	159711492	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr3:159711492T>A	ENST00000305579.2	+	6	774	c.467T>A	c.(466-468)cTg>cAg	p.L156Q	IL12A_ENST00000466512.1_Missense_Mutation_p.L142Q|IL12A_ENST00000480787.1_Missense_Mutation_p.L118Q|IL12A-AS1_ENST00000497452.1_RNA	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	122					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			ACCCAGGCCCTGTGCCTTAGT	0.438																																					p.L156Q		Atlas-SNP	.											.	IL12A	23	.	0			c.T467A						.						137.0	131.0	133.0					3																	159711492		2203	4300	6503	SO:0001583	missense	3592	exon6			AGGCCCTGTGCCT	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.467T>A	chr3.hg19:g.159711492T>A	ENSP00000303231:p.Leu156Gln	118.0	0.0		125.0	5.0	NM_000882	Q96QZ1	Missense_Mutation	SNP	ENST00000305579.2	hg19	CCDS3187.1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.005378	0.35415	.	.	ENSG00000168811	ENST00000305579;ENST00000480787;ENST00000466512	.	.	.	5.44	1.34	0.21922	.	1.184600	0.05890	N	0.628057	T	0.69151	0.3079	M	0.78049	2.395	0.32999	D	0.52594	D	0.89917	1.0	D	0.91635	0.999	T	0.63189	-0.6693	9	0.25751	T	0.34	-6.2614	6.1194	0.20144	0.1452:0.0:0.2527:0.6021	.	156	O60595	.	Q	156;118;142	.	ENSP00000303231:L156Q	L	+	2	0	IL12A	161194186	0.658000	0.27402	0.997000	0.53966	0.419000	0.31324	0.355000	0.20163	0.882000	0.36016	-0.327000	0.08410	CTG	.	.		0.438	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882	
PHC3	80012	hgsc.bcm.edu	37	3	169867033	169867033	+	Splice_Site	SNP	C	C	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr3:169867033C>G	ENST00000494943.1	-	5	447		c.e5-1		PHC3_ENST00000474275.1_Splice_Site|PHC3_ENST00000495893.2_Splice_Site|RNU6-315P_ENST00000362666.1_RNA|PHC3_ENST00000467570.1_Intron			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)						multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			AGAGGTTGATCTAAGGAAGAA	0.433																																					.		Atlas-SNP	.											.	PHC3	113	.	0			c.415-1G>C						.						78.0	73.0	75.0					3																	169867033		1884	4119	6003	SO:0001630	splice_region_variant	80012	exon6			GTTGATCTAAGGA		CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.379-1G>C	chr3.hg19:g.169867033C>G		39.0	0.0		25.0	9.0	NM_024947	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Splice_Site	SNP	ENST00000494943.1	hg19		.	.	.	.	.	.	.	.	.	.	C	22.8	4.331147	0.81690	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000475729;ENST00000474275	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0784	0.97758	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PHC3	171349727	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.266000	0.78452	2.736000	0.93811	0.655000	0.94253	.	.	.		0.433	PHC3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000352182.3	NM_024947	Intron
LRRC15	131578	hgsc.bcm.edu	37	3	194080170	194080170	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr3:194080170C>T	ENST00000347624.3	-	2	1688	c.1603G>A	c.(1603-1605)Gcc>Acc	p.A535T	LRRC15_ENST00000439944.2_Missense_Mutation_p.A541T|LRRC15_ENST00000428839.1_Missense_Mutation_p.A541T	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	535					negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		CCGCTCTGGGCCTGGGTCATG	0.592																																					p.A541T		Atlas-SNP	.											.	LRRC15	137	.	0			c.G1621A						.						81.0	81.0	81.0					3																	194080170		2203	4300	6503	SO:0001583	missense	131578	exon3			TCTGGGCCTGGGT	AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1603G>A	chr3.hg19:g.194080170C>T	ENSP00000306276:p.Ala535Thr	81.0	0.0		76.0	32.0	NM_001135057	Q495Q6|Q7RTN7	Missense_Mutation	SNP	ENST00000347624.3	hg19	CCDS3306.1	.	.	.	.	.	.	.	.	.	.	C	5.869	0.344505	0.11126	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.58797	0.31;0.36;0.36	5.25	3.45	0.39498	.	0.750699	0.12463	N	0.466711	T	0.35537	0.0935	N	0.14661	0.345	0.27643	N	0.947656	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.22521	-1.0214	10	0.19590	T	0.45	.	6.4735	0.22022	0.0:0.5481:0.2658:0.1861	.	535;541	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	T	535;541;541	ENSP00000306276:A535T;ENSP00000389128:A541T;ENSP00000413707:A541T	ENSP00000306276:A535T	A	-	1	0	LRRC15	195561465	0.174000	0.23070	0.877000	0.34402	0.621000	0.37620	0.328000	0.19681	0.722000	0.32252	0.563000	0.77884	GCC	.	.		0.592	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342858.2		
SHROOM3	57619	hgsc.bcm.edu	37	4	77660340	77660340	+	Silent	SNP	A	A	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr4:77660340A>C	ENST00000296043.6	+	5	1967	c.1014A>C	c.(1012-1014)tcA>tcC	p.S338S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	338					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCCGAGCCTCAGCAAATGGTC	0.562																																					p.S338S		Atlas-SNP	.											.	SHROOM3	134	.	0			c.A1014C						.						56.0	61.0	59.0					4																	77660340		2203	4300	6503	SO:0001819	synonymous_variant	57619	exon5			AGCCTCAGCAAAT	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.1014A>C	chr4.hg19:g.77660340A>C		67.0	0.0		43.0	10.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	hg19	CCDS3579.2																																																																																			.	.		0.562	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
COPS4	51138	hgsc.bcm.edu	37	4	83970469	83970469	+	Splice_Site	SNP	A	A	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr4:83970469A>T	ENST00000264389.2	+	3	440	c.305A>T	c.(304-306)cAg>cTg	p.Q102L	COPS4_ENST00000509093.1_Splice_Site_p.Q102L|COPS4_ENST00000511653.1_Splice_Site_p.Q102L|COPS4_ENST00000503682.1_Splice_Site_p.Q102L	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	102					cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				TTTGAGGAGCAGGTAAAAATC	0.353																																					p.Q102L		Atlas-SNP	.											.	COPS4	31	.	0			c.A305T						.						75.0	74.0	74.0					4																	83970469		2203	4300	6503	SO:0001630	splice_region_variant	51138	exon3			AGGAGCAGGTAAA	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.306+1A>T	chr4.hg19:g.83970469A>T		59.0	0.0		49.0	12.0	NM_016129	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	ENST00000264389.2	hg19	CCDS3600.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.838993	0.91117	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000503682;ENST00000511653	T;T;T;T	0.54479	0.61;0.64;0.57;0.61	4.78	4.78	0.61160	.	0.057874	0.64402	D	0.000001	T	0.78194	0.4245	M	0.92219	3.285	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.80764	0.94;0.987;0.994;0.962	D	0.84350	0.0532	10	0.87932	D	0	-8.9026	14.6034	0.68460	1.0:0.0:0.0:0.0	.	102;102;102;102	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	L	102	ENSP00000425976:Q102L;ENSP00000264389:Q102L;ENSP00000424791:Q102L;ENSP00000424655:Q102L	ENSP00000264389:Q102L	Q	+	2	0	COPS4	84189493	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.071000	0.93980	1.920000	0.55613	0.482000	0.46254	CAG	.	.		0.353	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252643.1		Missense_Mutation
PPP3CA	5530	hgsc.bcm.edu	37	4	102117189	102117189	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr4:102117189G>A	ENST00000394854.3	-	2	826	c.143C>T	c.(142-144)gCg>gTg	p.A48V	PPP3CA_ENST00000523694.2_Intron|PPP3CA_ENST00000394853.4_Missense_Mutation_p.A48V|PPP3CA_ENST00000323055.6_Missense_Mutation_p.A48V|PPP3CA_ENST00000512215.1_Missense_Mutation_p.A48V|PPP3CA_ENST00000507176.1_Intron	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	48	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		CATAAGATGCGCCTTTAAGAT	0.408																																					p.A48V		Atlas-SNP	.											.	PPP3CA	51	.	0			c.C143T						.						129.0	130.0	130.0					4																	102117189		2203	4300	6503	SO:0001583	missense	5530	exon2			AGATGCGCCTTTA		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.143C>T	chr4.hg19:g.102117189G>A	ENSP00000378323:p.Ala48Val	101.0	0.0		96.0	25.0	NM_000944	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Missense_Mutation	SNP	ENST00000394854.3	hg19	CCDS34037.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.535778	0.64972	.	.	ENSG00000138814	ENST00000512215;ENST00000394854;ENST00000323055;ENST00000394853	T;T;T;T	0.62941	3.4;-0.01;-0.01;-0.01	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	L	0.55481	1.735	0.80722	D	1	P;D;B;B	0.54772	0.577;0.968;0.259;0.155	B;P;B;B	0.44772	0.016;0.46;0.016;0.009	T	0.67833	-0.5568	10	0.59425	D	0.04	-12.4637	19.0843	0.93196	0.0:0.0:1.0:0.0	.	48;48;48;48	Q08209;A8W6Z8;A8W6Z7;Q08209-2	PP2BA_HUMAN;.;.;.	V	48	ENSP00000422781:A48V;ENSP00000378323:A48V;ENSP00000320580:A48V;ENSP00000378322:A48V	ENSP00000320580:A48V	A	-	2	0	PPP3CA	102336212	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.157000	0.71846	2.824000	0.97209	0.655000	0.94253	GCG	.	.		0.408	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
NDST3	9348	hgsc.bcm.edu	37	4	119154228	119154228	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr4:119154228C>G	ENST00000296499.5	+	9	2284	c.1881C>G	c.(1879-1881)agC>agG	p.S627R	NDST3_ENST00000433996.2_Missense_Mutation_p.S546R	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	627	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						ACTCCCCCAGCCCAAAAACCT	0.358																																					p.S627R		Atlas-SNP	.											.	NDST3	107	.	0			c.C1881G						.						147.0	146.0	147.0					4																	119154228		2203	4300	6503	SO:0001583	missense	9348	exon9			CCCCAGCCCAAAA	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1881C>G	chr4.hg19:g.119154228C>G	ENSP00000296499:p.Ser627Arg	119.0	0.0		80.0	27.0	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	hg19	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188441	0.78789	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.56611	0.45;0.45	5.64	5.64	0.86602	Sulfotransferase domain (1);	0.042915	0.85682	D	0.000000	T	0.75421	0.3847	M	0.80982	2.52	0.41180	D	0.986227	D;D	0.76494	0.996;0.999	D;D	0.74674	0.913;0.984	T	0.77726	-0.2480	10	0.62326	D	0.03	.	19.7051	0.96069	0.0:1.0:0.0:0.0	.	546;627	B4DI67;O95803	.;NDST3_HUMAN	R	627;546	ENSP00000296499:S627R;ENSP00000396625:S546R	ENSP00000296499:S627R	S	+	3	2	NDST3	119373676	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.498000	0.45363	2.645000	0.89757	0.637000	0.83480	AGC	.	.		0.358	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
ARHGAP10	79658	hgsc.bcm.edu	37	4	148984418	148984418	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr4:148984418C>T	ENST00000336498.3	+	21	2386	c.2147C>T	c.(2146-2148)cCt>cTt	p.P716L	ARHGAP10_ENST00000414545.2_Intron	NM_024605.3	NP_078881.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 10	0					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			autonomic_ganglia(2)|endometrium(5)|kidney(2)|large_intestine(4)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		CCCTTTTCTCCTCCTGCTACT	0.542																																					p.P716L		Atlas-SNP	.											.	ARHGAP10	92	.	0			c.C2147T						.						133.0	93.0	106.0					4																	148984418		2203	4300	6503	SO:0001583	missense	79658	exon21			TTTCTCCTCCTGC	BC047914	CCDS34075.1	4q31.23	2013-09-20			ENSG00000071205	ENSG00000071205		"""Rho GTPase activating proteins"""	26099	protein-coding gene	gene with protein product		609746				8288572	Standard	NM_024605		Approved	FLJ20896, FLJ41791, GRAF2	uc003ilf.3	A1A4S6	OTTHUMG00000161460	ENST00000336498.3:c.2147C>T	chr4.hg19:g.148984418C>T	ENSP00000336923:p.Pro716Leu	77.0	0.0		65.0	16.0	NM_024605	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	ENST00000336498.3	hg19	CCDS34075.1	.	.	.	.	.	.	.	.	.	.	C	7.301	0.612987	0.14066	.	.	ENSG00000071205	ENST00000336498	T	0.10960	2.82	5.32	-0.0926	0.13656	Src homology-3 domain (1);	1.180830	0.05937	N	0.636303	T	0.04952	0.0133	N	0.04203	-0.255	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.42481	-0.9449	10	0.30854	T	0.27	.	5.0433	0.14471	0.155:0.5414:0.0:0.3036	.	149;297;716	Q9H7G7;Q86T21;A1A4S6	.;.;RHG10_HUMAN	L	716	ENSP00000336923:P716L	ENSP00000336923:P716L	P	+	2	0	ARHGAP10	149203868	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-0.760000	0.04756	-0.394000	0.07727	0.455000	0.32223	CCT	.	.		0.542	ARHGAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365005.1	NM_024605	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5200316	5200316	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr5:5200316T>C	ENST00000274181.7	+	9	1523	c.1385T>C	c.(1384-1386)tTg>tCg	p.L462S	ADAMTS16_ENST00000511368.1_Missense_Mutation_p.L462S	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	462	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TCCCCTACATTGGCAGGACGC	0.473																																					p.L462S		Atlas-SNP	.											.	ADAMTS16	543	.	0			c.T1385C						.						88.0	91.0	90.0					5																	5200316		1972	4176	6148	SO:0001583	missense	170690	exon9			CTACATTGGCAGG	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1385T>C	chr5.hg19:g.5200316T>C	ENSP00000274181:p.Leu462Ser	71.0	0.0		92.0	24.0	NM_139056	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	hg19	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518284	0.64634	.	.	ENSG00000145536	ENST00000274181;ENST00000511368;ENST00000536857	D;D	0.87029	-2.2;-2.2	4.76	4.76	0.60689	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000017	D	0.92622	0.7656	M	0.75777	2.31	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.93472	0.6820	10	0.87932	D	0	.	13.5732	0.61858	0.0:0.0:0.0:1.0	.	462;462;462	Q8TE57;Q8TE57-2;Q2XQZ0	ATS16_HUMAN;.;.	S	462	ENSP00000274181:L462S;ENSP00000421631:L462S	ENSP00000274181:L462S	L	+	2	0	ADAMTS16	5253316	1.000000	0.71417	0.826000	0.32828	0.535000	0.34838	7.425000	0.80255	1.903000	0.55091	0.533000	0.62120	TTG	.	.		0.473	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
SEMA6A	57556	hgsc.bcm.edu	37	5	115782757	115782757	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr5:115782757G>A	ENST00000343348.6	-	19	3432	c.2645C>T	c.(2644-2646)cCa>cTa	p.P882L	CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000282394.6_Missense_Mutation_p.P359L|SEMA6A_ENST00000257414.8_Missense_Mutation_p.P899L|CTB-118N6.3_ENST00000508424.1_RNA|CTB-118N6.3_ENST00000512128.1_RNA|SEMA6A_ENST00000510263.1_Missense_Mutation_p.P882L|SEMA6A_ENST00000503865.1_Missense_Mutation_p.P261L|SEMA6A_ENST00000513137.1_Missense_Mutation_p.P309L|CTB-118N6.3_ENST00000514214.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	882					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		CTCCCGCTGTGGAACTTTGGG	0.592																																					p.P882L		Atlas-SNP	.											.	SEMA6A	93	.	0			c.C2645T						.						108.0	114.0	112.0					5																	115782757		1948	4111	6059	SO:0001583	missense	57556	exon19			CGCTGTGGAACTT	AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2645C>T	chr5.hg19:g.115782757G>A	ENSP00000345512:p.Pro882Leu	129.0	0.0		110.0	36.0	NM_020796	Q9P2H9	Missense_Mutation	SNP	ENST00000343348.6	hg19	CCDS47256.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.34|19.34	3.809732|3.809732	0.70797|0.70797	.|.	.|.	ENSG00000092421|ENSG00000092421	ENST00000515129|ENST00000343348;ENST00000257414;ENST00000513137;ENST00000282394;ENST00000503865;ENST00000510263	.|T;T;T;T;T;T	.|0.79247	.|0.34;0.34;-1.25;0.76;-1.08;0.34	5.22|5.22	5.22|5.22	0.72569|0.72569	.|.	.|0.508000	.|0.20614	.|N	.|0.088904	D|D	0.87148|0.87148	0.6105|0.6105	L|L	0.61218|0.61218	1.895|1.895	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.91635	.|0.998;0.998;0.999;0.999;0.999;0.999	D|D	0.88163|0.88163	0.2859|0.2859	5|10	.|0.87932	.|D	.|0	.|.	18.3651|18.3651	0.90388|0.90388	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|261;882;426;899;359;309	.|E9PDV9;Q9H2E6;Q96SM8;Q9H2E6-2;E7ERF3;B3KU01	.|.;SEM6A_HUMAN;.;.;.;.	Y|L	397|882;899;309;359;261;882	.|ENSP00000345512:P882L;ENSP00000257414:P899L;ENSP00000422997:P309L;ENSP00000282394:P359L;ENSP00000425364:P261L;ENSP00000424388:P882L	.|ENSP00000257414:P899L	H|P	-|-	1|2	0|0	SEMA6A|SEMA6A	115810656|115810656	1.000000|1.000000	0.71417|0.71417	0.902000|0.902000	0.35471|0.35471	0.914000|0.914000	0.54420|0.54420	9.417000|9.417000	0.97391|0.97391	2.436000|2.436000	0.82500|0.82500	0.563000|0.563000	0.77884|0.77884	CAC|CCA	.	.		0.592	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371270.1	NM_020796	
ZNF454	285676	hgsc.bcm.edu	37	5	178391941	178391941	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr5:178391941A>G	ENST00000320129.3	+	5	839	c.536A>G	c.(535-537)gAg>gGg	p.E179G	ZNF454_ENST00000519564.1_Missense_Mutation_p.E179G	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		AATGCCTTTGAGTGTAGTGAG	0.363																																					p.E179G		Atlas-SNP	.											.	ZNF454	99	.	0			c.A536G						.						59.0	60.0	60.0					5																	178391941		2203	4300	6503	SO:0001583	missense	285676	exon5			CCTTTGAGTGTAG	AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.536A>G	chr5.hg19:g.178391941A>G	ENSP00000326249:p.Glu179Gly	78.0	0.0		87.0	10.0	NM_001178089	Q2M1P2|Q2M323	Missense_Mutation	SNP	ENST00000320129.3	hg19	CCDS4441.1	.	.	.	.	.	.	.	.	.	.	A	6.641	0.486839	0.12641	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.53206	0.63;0.63	4.75	4.75	0.60458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.182769	0.26390	N	0.024657	T	0.39358	0.1075	L	0.41356	1.27	0.20307	N	0.999916	B	0.27316	0.175	B	0.31390	0.129	T	0.38394	-0.9663	10	0.59425	D	0.04	-15.3568	8.7512	0.34616	0.8087:0.1913:0.0:0.0	.	179	Q8N9F8	ZN454_HUMAN	G	179	ENSP00000326249:E179G;ENSP00000430354:E179G	ENSP00000326249:E179G	E	+	2	0	ZNF454	178324547	0.003000	0.15002	0.979000	0.43373	0.243000	0.25628	2.021000	0.41020	2.117000	0.64856	0.528000	0.53228	GAG	.	.		0.363	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253476.2	XM_209718	
LGSN	51557	hgsc.bcm.edu	37	6	63990999	63990999	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr6:63990999A>C	ENST00000370657.4	-	4	490	c.457T>G	c.(457-459)Tta>Gta	p.L153V	LGSN_ENST00000370658.5_Missense_Mutation_p.L153V			Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase domain	153					glutamine biosynthetic process (GO:0006542)	plasma membrane (GO:0005886)	glutamate-ammonia ligase activity (GO:0004356)			NS(1)|endometrium(2)|large_intestine(5)|lung(16)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AAGGTTGATAACTCTGGCATT	0.423																																					p.L153V		Atlas-SNP	.											.	LGSN	82	.	0			c.T457G						.						141.0	132.0	135.0					6																	63990999		2203	4300	6503	SO:0001583	missense	51557	exon4			TTGATAACTCTGG	AF242388	CCDS4964.1, CCDS55027.1	6q12	2013-09-19	2008-09-19	2008-09-19	ENSG00000146166	ENSG00000146166			21016	protein-coding gene	gene with protein product		611470	"""glutamate-ammonia ligase (glutamine synthetase) domain containing 1"""	GLULD1		12107412	Standard	NM_016571		Approved	LGS	uc003peh.3	Q5TDP6	OTTHUMG00000014946	ENST00000370657.4:c.457T>G	chr6.hg19:g.63990999A>C	ENSP00000359691:p.Leu153Val	124.0	0.0		135.0	19.0	NM_016571	A1L421|Q0PVN9|Q0PVP0|Q9NYJ0	Missense_Mutation	SNP	ENST00000370657.4	hg19	CCDS4964.1	.	.	.	.	.	.	.	.	.	.	A	3.089	-0.187352	0.06299	.	.	ENSG00000146166	ENST00000370658;ENST00000370657	T;T	0.47869	0.83;0.83	5.7	-11.4	0.00090	Glutamine synthetase, beta-Grasp (3);	0.061115	0.64402	D	0.000004	T	0.27489	0.0675	M	0.82193	2.58	0.20307	N	0.999912	B;B	0.22800	0.075;0.019	B;B	0.37731	0.107;0.257	T	0.51212	-0.8734	10	0.52906	T	0.07	-7.0035	10.5622	0.45152	0.6646:0.0643:0.2064:0.0647	.	153;153	Q5TDP6-2;Q5TDP6	.;LGSN_HUMAN	V	153	ENSP00000359692:L153V;ENSP00000359691:L153V	ENSP00000359691:L153V	L	-	1	2	LGSN	64048958	0.998000	0.40836	0.000000	0.03702	0.003000	0.03518	0.589000	0.23939	-3.794000	0.00106	-3.611000	0.00028	TTA	.	.		0.423	LGSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041076.2	NM_016571	
COL12A1	1303	hgsc.bcm.edu	37	6	75861697	75861697	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr6:75861697T>C	ENST00000322507.8	-	20	4195	c.3886A>G	c.(3886-3888)Atg>Gtg	p.M1296V	COL12A1_ENST00000483888.2_Missense_Mutation_p.M1296V|COL12A1_ENST00000416123.2_Missense_Mutation_p.M1296V|COL12A1_ENST00000345356.6_Missense_Mutation_p.M132V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1296	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CGAGGTCTCATGCCAGCTTGG	0.438																																					p.M1296V		Atlas-SNP	.											.	COL12A1	385	.	0			c.A3886G						.						173.0	166.0	168.0					6																	75861697		1948	4160	6108	SO:0001583	missense	1303	exon20			GTCTCATGCCAGC	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3886A>G	chr6.hg19:g.75861697T>C	ENSP00000325146:p.Met1296Val	116.0	0.0		112.0	37.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.55|14.55	2.567415|2.567415	0.45694|0.45694	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000419671|ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	.|D;D;D;D	.|0.82893	.|-1.66;-1.66;-1.66;-1.66	5.68|5.68	4.49|4.49	0.54785|0.54785	.|von Willebrand factor, type A (3);	.|0.115748	.|0.64402	.|D	.|0.000017	T|T	0.61776|0.61776	0.2374|0.2374	L|L	0.41961|0.41961	1.31|1.31	0.37323|0.37323	D|D	0.909637|0.909637	.|B;B	.|0.22211	.|0.007;0.066	.|B;B	.|0.25759	.|0.039;0.063	T|T	0.56805|0.56805	-0.7918|-0.7918	5|10	.|0.26408	.|T	.|0.33	.|.	8.4367|8.4367	0.32791|0.32791	0.1369:0.0:0.1271:0.7361|0.1369:0.0:0.1271:0.7361	.|.	.|132;1296	.|Q99715-2;Q99715	.|.;COCA1_HUMAN	R|V	37|1296;1296;132;1296;1296	.|ENSP00000325146:M1296V;ENSP00000305147:M132V;ENSP00000412864:M1296V;ENSP00000421216:M1296V	.|ENSP00000325146:M1296V	H|M	-|-	2|1	0|0	COL12A1|COL12A1	75918417|75918417	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	3.124000|3.124000	0.50461|0.50461	0.945000|0.945000	0.37605|0.37605	0.528000|0.528000	0.53228|0.53228	CAT|ATG	.	.		0.438	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
SNAP91	9892	hgsc.bcm.edu	37	6	84270639	84270639	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr6:84270639C>G	ENST00000439399.2	-	27	2786	c.2470G>C	c.(2470-2472)Gtt>Ctt	p.V824L	SNAP91_ENST00000428679.2_Missense_Mutation_p.V824L|SNAP91_ENST00000195649.6_Missense_Mutation_p.V819L|SNAP91_ENST00000520302.1_Missense_Mutation_p.V794L|SNAP91_ENST00000521743.1_Missense_Mutation_p.V824L|SNAP91_ENST00000437520.1_Missense_Mutation_p.V517L|SNAP91_ENST00000521485.1_Missense_Mutation_p.V819L|SNAP91_ENST00000520213.1_Missense_Mutation_p.V517L|SNAP91_ENST00000369694.2_Missense_Mutation_p.V824L	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	824	Pro-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		ACAGGAGGAACTGAACTGGTT	0.428																																					p.V824L		Atlas-SNP	.											.	SNAP91	199	.	0			c.G2470C						.						46.0	46.0	46.0					6																	84270639		1947	4158	6105	SO:0001583	missense	9892	exon26			GAGGAACTGAACT	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2470G>C	chr6.hg19:g.84270639C>G	ENSP00000400459:p.Val824Leu	120.0	0.0		124.0	40.0	NM_001242792	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	hg19	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082577	0.55861	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448	T;T;T;T;T;T;T;T;T;T	0.23348	2.48;2.49;2.49;2.48;2.49;2.51;2.48;2.49;2.51;1.91	5.46	5.46	0.80206	.	0.669551	0.14796	N	0.297925	T	0.39306	0.1073	M	0.66939	2.045	0.28030	N	0.934172	B;P;P;P;P	0.47910	0.034;0.902;0.841;0.841;0.841	B;P;P;P;P	0.61722	0.023;0.893;0.846;0.846;0.846	T	0.16335	-1.0406	10	0.49607	T	0.09	-7.8988	18.8976	0.92430	0.0:1.0:0.0:0.0	.	700;517;794;824;822	B7Z2N2;O60641-3;E5RI02;O60641;E1P549	.;.;.;AP180_HUMAN;.	L	819;824;824;819;824;517;794;824;517;165	ENSP00000429776:V819L;ENSP00000358708:V824L;ENSP00000400459:V824L;ENSP00000195649:V819L;ENSP00000412492:V824L;ENSP00000413277:V517L;ENSP00000428511:V794L;ENSP00000428215:V824L;ENSP00000428026:V517L;ENSP00000430255:V165L	ENSP00000195649:V819L	V	-	1	0	SNAP91	84327358	0.999000	0.42202	0.995000	0.50966	0.763000	0.43281	3.668000	0.54554	2.542000	0.85734	0.555000	0.69702	GTT	.	.		0.428	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
SOBP	55084	hgsc.bcm.edu	37	6	107956286	107956286	+	Silent	SNP	G	G	A	rs541688197	byFrequency	TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr6:107956286G>A	ENST00000317357.5	+	6	2897	c.2238G>A	c.(2236-2238)ccG>ccA	p.P746P	SOBP_ENST00000494935.1_3'UTR	NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		AGCAgccgccgccgccgccgc	0.731																																					p.P746P		Atlas-SNP	.											.	SOBP	53	.	0			c.G2238A						.						5.0	7.0	6.0					6																	107956286		1616	3651	5267	SO:0001819	synonymous_variant	55084	exon6			GCCGCCGCCGCCG	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.2238G>A	chr6.hg19:g.107956286G>A		39.0	0.0		38.0	12.0	NM_018013		Silent	SNP	ENST00000317357.5	hg19	CCDS43488.1																																																																																			.	.		0.731	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041693.2	NM_018013	
FAM184A	79632	hgsc.bcm.edu	37	6	119338099	119338099	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr6:119338099T>C	ENST00000338891.7	-	5	1786	c.1343A>G	c.(1342-1344)gAa>gGa	p.E448G	FAM184A_ENST00000368475.4_Missense_Mutation_p.E328G|FAM184A_ENST00000522284.1_Missense_Mutation_p.E328G|FAM184A_ENST00000521531.1_Missense_Mutation_p.E448G|FAM184A_ENST00000352896.5_Missense_Mutation_p.E328G|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	448						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						TCTCTTTGCTTCATTTACTTT	0.333																																					p.E448G		Atlas-SNP	.											.	FAM184A	109	.	0			c.A1343G						.						77.0	73.0	74.0					6																	119338099		1802	4065	5867	SO:0001583	missense	79632	exon5			TTTGCTTCATTTA	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.1343A>G	chr6.hg19:g.119338099T>C	ENSP00000342604:p.Glu448Gly	310.0	0.0		292.0	103.0	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	hg19	CCDS43499.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.2|20.2	3.946402|3.946402	0.73672|0.73672	.|.	.|.	ENSG00000111879|ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284|ENST00000448815	T;T;T;T;T|.	0.42513|.	0.97;0.97;0.97;0.97;0.97|.	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	0.052144|.	0.64402|.	D|.	0.000001|.	T|T	0.63558|0.63558	0.2521|0.2521	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	P;B;P|.	0.44044|.	0.787;0.449;0.825|.	B;B;B|.	0.44044|.	0.439;0.154;0.398|.	T|T	0.65001|0.65001	-0.6274|-0.6274	10|5	0.42905|.	T|.	0.14|.	-7.9209|-7.9209	14.5917|14.5917	0.68371|0.68371	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	448;328;448|.	Q8NB25-2;F8W8D6;Q8NB25|.	.;.;F184A_HUMAN|.	G|E	448;328;328;448;328|34	ENSP00000342604:E448G;ENSP00000326608:E328G;ENSP00000357460:E328G;ENSP00000430442:E448G;ENSP00000429826:E328G|.	ENSP00000342604:E448G|.	E|K	-|-	2|1	0|0	FAM184A|FAM184A	119379798|119379798	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	6.519000|6.519000	0.73768|0.73768	1.876000|1.876000	0.54355|0.54355	0.402000|0.402000	0.26972|0.26972	GAA|AAG	.	.		0.333	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
OPRM1	4988	hgsc.bcm.edu	37	6	154414480	154414480	+	Intron	SNP	G	G	C	rs200463796		TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr6:154414480G>C	ENST00000330432.7	+	3	1401				OPRM1_ENST00000337049.4_Intron|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000419506.2_Intron|OPRM1_ENST00000522236.1_Intron|OPRM1_ENST00000452687.2_Intron|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000414028.2_Intron|OPRM1_ENST00000522555.1_Intron|OPRM1_ENST00000435918.2_Intron|OPRM1_ENST00000360422.4_Intron|OPRM1_ENST00000434900.2_Intron|OPRM1_ENST00000524163.1_Intron|OPRM1_ENST00000229768.5_Missense_Mutation_p.G414R	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	ACCACTGCAAGGACCTCTTGT	0.517																																					p.G414R		Atlas-SNP	.											OPRM1,NS,carcinoma,0,1	OPRM1	241	.	0			c.G1240C						.						241.0	231.0	234.0					6																	154414480		1984	4167	6151	SO:0001627	intron_variant	4988	exon4			CTGCAAGGACCTC	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1164+1873G>C	chr6.hg19:g.154414480G>C		109.0	0.0		84.0	31.0	NM_001008505	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	hg19	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	G	12.41	1.929945	0.34096	.	.	ENSG00000112038	ENST00000229768	T	0.71341	-0.56	5.56	0.708	0.18144	.	.	.	.	.	T	0.35068	0.0919	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.32981	-0.9886	8	0.66056	D	0.02	.	3.9214	0.09245	0.3373:0.0:0.506:0.1567	.	414	P35372-3	.	R	414	ENSP00000229768:G414R	ENSP00000229768:G414R	G	+	1	0	OPRM1	154456173	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.194000	0.17135	0.044000	0.15775	-0.140000	0.14226	GGA	.	.		0.517	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
RNF216	54476	hgsc.bcm.edu	37	7	5754691	5754691	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr7:5754691G>C	ENST00000425013.2	-	11	1879	c.1655C>G	c.(1654-1656)tCt>tGt	p.S552C	RNF216_ENST00000389902.3_Missense_Mutation_p.S609C	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	552					apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		TACCTTTCCAGATCCAAAGAC	0.448																																					p.S609C		Atlas-SNP	.											.	RNF216	71	.	0			c.C1826G						.						136.0	125.0	128.0					7																	5754691		2203	4300	6503	SO:0001583	missense	54476	exon11			TTTCCAGATCCAA	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.1655C>G	chr7.hg19:g.5754691G>C	ENSP00000404602:p.Ser552Cys	54.0	0.0		62.0	20.0	NM_207111	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	hg19	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127690	0.77549	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.32515	1.45;1.45	5.88	5.88	0.94601	.	0.166604	0.49916	D	0.000130	T	0.56046	0.1959	M	0.61703	1.905	0.51012	D	0.9999	D;D	0.89917	0.998;1.0	D;D	0.87578	0.956;0.998	T	0.54050	-0.8351	10	0.66056	D	0.02	-17.5102	19.2161	0.93778	0.0:0.0:1.0:0.0	.	552;609	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	C	552;609;364	ENSP00000404602:S552C;ENSP00000374552:S609C	ENSP00000374552:S609C	S	-	2	0	RNF216	5721217	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.044000	0.71012	2.778000	0.95560	0.655000	0.94253	TCT	.	.		0.448	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
VWDE	221806	hgsc.bcm.edu	37	7	12414692	12414692	+	Missense_Mutation	SNP	G	G	T	rs375551327	byFrequency	TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr7:12414692G>T	ENST00000275358.3	-	8	1374	c.1186C>A	c.(1186-1188)Caa>Aaa	p.Q396K		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	396						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						ACTATTGGTTGCACTACAATG	0.398													G|||	7	0.00139776	0.0053	0.0	5008	,	,		14561	0.0		0.0	False		,,,				2504	0.0				p.Q396K		Atlas-SNP	.											.	VWDE	123	.	0			c.C1186A						.	G	LYS/GLN	1,1383		0,1,691	133.0	117.0	122.0		1186	0.3	0.0	7		122	0,3182		0,0,1591	no	missense	VWDE	NM_001135924.1	53	0,1,2282	TT,TG,GG		0.0,0.0723,0.0219	benign	396/1591	12414692	1,4565	692	1591	2283	SO:0001583	missense	221806	exon8			TTGGTTGCACTAC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.1186C>A	chr7.hg19:g.12414692G>T	ENSP00000275358:p.Gln396Lys	106.0	0.0		131.0	32.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	G	9.852	1.194001	0.22037	7.23E-4	0.0	ENSG00000146530	ENST00000275358	T	0.81078	-1.45	4.46	0.261	0.15592	.	.	.	.	.	T	0.66567	0.2802	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.52990	-0.8501	9	0.44086	T	0.13	.	8.9864	0.35997	0.0:0.6795:0.1572:0.1634	.	396	Q8N2E2	VWDE_HUMAN	K	396	ENSP00000275358:Q396K	ENSP00000275358:Q396K	Q	-	1	0	VWDE	12381217	0.077000	0.21312	0.012000	0.15200	0.768000	0.43524	0.368000	0.20399	-0.136000	0.11475	0.585000	0.79938	CAA	.	.		0.398	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
ZPBP	11055	hgsc.bcm.edu	37	7	49977181	49977181	+	Silent	SNP	T	T	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr7:49977181T>A	ENST00000046087.2	-	8	1068	c.999A>T	c.(997-999)ggA>ggT	p.G333G	ZPBP_ENST00000491129.1_Intron|ZPBP_ENST00000419417.1_Silent_p.G332G	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	333					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					GGCAATGAATTCCATCACGGG	0.348																																					p.G333G		Atlas-SNP	.											.	ZPBP	65	.	0			c.A999T						.						101.0	102.0	101.0					7																	49977181		2203	4300	6503	SO:0001819	synonymous_variant	11055	exon8			ATGAATTCCATCA	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.999A>T	chr7.hg19:g.49977181T>A		64.0	0.0		69.0	14.0	NM_007009	A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Silent	SNP	ENST00000046087.2	hg19	CCDS5509.1																																																																																			.	.		0.348	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009	
CCDC146	57639	hgsc.bcm.edu	37	7	76908085	76908085	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr7:76908085T>C	ENST00000285871.4	+	12	1584	c.1457T>C	c.(1456-1458)aTt>aCt	p.I486T	CCDC146_ENST00000415740.2_3'UTR|CCDC146_ENST00000431197.1_Missense_Mutation_p.I200T	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	486										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				TACACCAACATTGTTAAAGAA	0.299																																					p.I486T		Atlas-SNP	.											.	CCDC146	87	.	0			c.T1457C						.						68.0	64.0	66.0					7																	76908085		2202	4298	6500	SO:0001583	missense	57639	exon12			CCAACATTGTTAA	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.1457T>C	chr7.hg19:g.76908085T>C	ENSP00000285871:p.Ile486Thr	119.0	0.0		149.0	55.0	NM_020879	A8K8X6|Q9P223	Missense_Mutation	SNP	ENST00000285871.4	hg19	CCDS34671.1	.	.	.	.	.	.	.	.	.	.	T	6.083	0.383528	0.11524	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.28069	1.63;1.63	5.17	2.69	0.31865	.	0.627918	0.17149	N	0.185140	T	0.20047	0.0482	L	0.34521	1.04	0.09310	N	1	B;B	0.27416	0.178;0.098	B;B	0.29942	0.053;0.109	T	0.29731	-1.0002	10	0.12103	T	0.63	-1.4516	7.7051	0.28646	0.0:0.0746:0.1401:0.7854	.	200;486	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	T	486;200	ENSP00000285871:I486T;ENSP00000413885:I200T	ENSP00000285871:I486T	I	+	2	0	AC007000.1	76746021	0.001000	0.12720	0.002000	0.10522	0.410000	0.31052	1.056000	0.30480	0.256000	0.21614	0.533000	0.62120	ATT	.	.		0.299	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
TMEM229A	730130	hgsc.bcm.edu	37	7	123672011	123672011	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr7:123672011G>C	ENST00000455783.1	-	1	1512	c.1047C>G	c.(1045-1047)atC>atG	p.I349M	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	349						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						ACATCAGGGTGATGAGGCCCA	0.517																																					p.I349M		Atlas-SNP	.											.	TMEM229A	31	.	0			c.C1047G						.						44.0	44.0	44.0					7																	123672011		692	1591	2283	SO:0001583	missense	730130	exon1			CAGGGTGATGAGG	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.1047C>G	chr7.hg19:g.123672011G>C	ENSP00000395244:p.Ile349Met	37.0	0.0		54.0	13.0	NM_001136002	A4D0X6	Missense_Mutation	SNP	ENST00000455783.1	hg19	CCDS47694.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.474767	0.63737	.	.	ENSG00000234224	ENST00000455783	.	.	.	5.55	2.79	0.32731	.	.	.	.	.	T	0.69133	0.3077	M	0.79926	2.475	0.31816	N	0.626638	D	0.76494	0.999	D	0.70016	0.967	T	0.71002	-0.4718	8	0.87932	D	0	-16.4334	7.724	0.28748	0.2621:0.0:0.7379:0.0	.	349	B2RXF0	T229A_HUMAN	M	349	.	ENSP00000395244:I349M	I	-	3	3	TMEM229A	123459247	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.335000	0.43929	0.304000	0.22809	0.655000	0.94253	ATC	.	.		0.517	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336960.3	NM_001136002	
RP1L1	94137	hgsc.bcm.edu	37	8	10466938	10466938	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr8:10466938G>T	ENST00000382483.3	-	4	4893	c.4670C>A	c.(4669-4671)gCg>gAg	p.A1557E		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1637					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CAGCTCGGCCGCCATCTGGTC	0.657																																					p.A1557E		Atlas-SNP	.											.	RP1L1	453	.	0			c.C4670A						.						15.0	18.0	17.0					8																	10466938		2103	4222	6325	SO:0001583	missense	94137	exon4			TCGGCCGCCATCT	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4670C>A	chr8.hg19:g.10466938G>T	ENSP00000371923:p.Ala1557Glu	49.0	0.0		57.0	4.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	hg19	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	9.337	1.062151	0.19987	.	.	ENSG00000183638	ENST00000382483	T	0.04234	3.67	5.32	-0.25	0.13007	.	0.286195	0.18802	U	0.130778	T	0.03136	0.0092	N	0.14661	0.345	0.19575	N	0.999965	B	0.31730	0.337	B	0.30029	0.11	T	0.40079	-0.9582	10	0.44086	T	0.13	-11.317	11.6311	0.51175	0.8314:0.0:0.1686:0.0	.	1557	A6NKC6	.	E	1557	ENSP00000371923:A1557E	ENSP00000371923:A1557E	A	-	2	0	RP1L1	10504348	0.976000	0.34144	0.182000	0.23118	0.054000	0.15201	2.591000	0.46163	-0.285000	0.09089	-1.469000	0.01011	GCG	.	.		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
SGCZ	137868	hgsc.bcm.edu	37	8	14181674	14181674	+	Nonsense_Mutation	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr8:14181674G>A	ENST00000382080.1	-	3	989	c.274C>T	c.(274-276)Cga>Tga	p.R92*	SGCZ_ENST00000421524.2_Intron	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	79					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.R92*(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		CCTTCAAGTCGGATTCCCTTC	0.358																																					p.R92X		Atlas-SNP	.											SGCZ,colon,carcinoma,0,1	SGCZ	96	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.C274T						.						118.0	112.0	114.0					8																	14181674		2203	4300	6503	SO:0001587	stop_gained	137868	exon3			CAAGTCGGATTCC	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.274C>T	chr8.hg19:g.14181674G>A	ENSP00000371512:p.Arg92*	61.0	0.0		48.0	9.0	NM_139167	Q6REU0	Nonsense_Mutation	SNP	ENST00000382080.1	hg19	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	G	43	10.493145	0.99415	.	.	ENSG00000185053	ENST00000382080	.	.	.	5.27	5.27	0.74061	.	0.079076	0.52532	D	0.000064	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.8551	0.88760	0.0:0.0:1.0:0.0	.	.	.	.	X	92	.	ENSP00000371512:R92X	R	-	1	2	SGCZ	14226045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.014000	0.64029	2.642000	0.89623	0.563000	0.77884	CGA	.	.		0.358	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
IDO2	169355	hgsc.bcm.edu	37	8	39836668	39836668	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr8:39836668G>C	ENST00000389060.4	+	3	278	c.278G>C	c.(277-279)gGt>gCt	p.G93A	IDO2_ENST00000502986.2_Missense_Mutation_p.G106A|IDO2_ENST00000343295.4_3'UTR|RP11-44K6.3_ENST00000517623.1_RNA			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	93					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)	p.G93A(1)|p.G106A(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						CTCACCATGGGTTATGTCTGG	0.612																																					p.G106A		Atlas-SNP	.											IDO2_ENST00000502986,NS,carcinoma,0,2	IDO2	78	.	2	Substitution - Missense(2)	kidney(2)	c.G317C						.						32.0	35.0	34.0					8																	39836668		2023	4183	6206	SO:0001583	missense	169355	exon4			CCATGGGTTATGT	AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.278G>C	chr8.hg19:g.39836668G>C	ENSP00000426447:p.Gly93Ala	42.0	0.0		29.0	5.0	NM_194294	A4UD41	Missense_Mutation	SNP	ENST00000389060.4	hg19		.	.	.	.	.	.	.	.	.	.	G	12.76	2.034699	0.35893	.	.	ENSG00000188676	ENST00000502986;ENST00000389060	T;T	0.35789	1.29;1.29	5.36	5.36	0.76844	.	0.103335	0.64402	D	0.000003	T	0.37972	0.1023	N	0.21617	0.685	0.42214	D	0.991825	P	0.47677	0.899	P	0.54060	0.741	T	0.07404	-1.0774	9	.	.	.	.	14.5911	0.68365	0.0:0.0:1.0:0.0	.	106	F5H5G0	.	A	106;93	ENSP00000443432:G106A;ENSP00000426447:G93A	.	G	+	2	0	IDO2	39955825	1.000000	0.71417	0.882000	0.34594	0.438000	0.31896	7.396000	0.79891	2.533000	0.85409	0.467000	0.42956	GGT	.	.		0.612	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294	
RP1	6101	hgsc.bcm.edu	37	8	55539235	55539235	+	Silent	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr8:55539235T>C	ENST00000220676.1	+	4	2941	c.2793T>C	c.(2791-2793)ccT>ccC	p.P931P		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	931					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CTTTAAAGCCTATAAAATCAG	0.323																																					p.P931P	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.T2793C						.						36.0	38.0	37.0					8																	55539235		2202	4300	6502	SO:0001819	synonymous_variant	6101	exon4			AAAGCCTATAAAA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2793T>C	chr8.hg19:g.55539235T>C		107.0	0.0		109.0	15.0	NM_006269		Silent	SNP	ENST00000220676.1	hg19	CCDS6160.1																																																																																			.	.		0.323	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
TRPA1	8989	hgsc.bcm.edu	37	8	72958753	72958753	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr8:72958753G>T	ENST00000262209.4	-	17	2263	c.2056C>A	c.(2056-2058)Ctc>Atc	p.L686I	RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000524152.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	686					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CTTACGTTGAGGGCTGTAAGC	0.294																																					p.L686I		Atlas-SNP	.											.	TRPA1	256	.	0			c.C2056A						.						169.0	181.0	177.0					8																	72958753		2203	4299	6502	SO:0001583	missense	8989	exon17			CGTTGAGGGCTGT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2056C>A	chr8.hg19:g.72958753G>T	ENSP00000262209:p.Leu686Ile	63.0	0.0		121.0	15.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	hg19	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	G	7.043	0.562975	0.13498	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.79033	-1.23;-1.23	4.65	3.75	0.43078	.	0.241300	0.32314	N	0.006273	T	0.75206	0.3818	M	0.79805	2.47	0.50632	D	0.999887	B	0.23650	0.089	B	0.25140	0.058	T	0.73322	-0.4019	10	0.66056	D	0.02	-7.6287	5.4294	0.16444	0.1688:0.0:0.6603:0.1708	.	686	O75762	TRPA1_HUMAN	I	538;686	ENSP00000428151:L538I;ENSP00000262209:L686I	ENSP00000262209:L686I	L	-	1	0	TRPA1	73121307	0.996000	0.38824	0.768000	0.31515	0.064000	0.16182	2.454000	0.44979	1.033000	0.39918	0.555000	0.69702	CTC	.	.		0.294	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
HHLA1	10086	hgsc.bcm.edu	37	8	133078139	133078139	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr8:133078139A>T	ENST00000414222.1	-	15	1545	c.1546T>A	c.(1546-1548)Tcg>Acg	p.S516T	OC90_ENST00000262283.5_Intron	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	516						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						TTACTGTGCGAGTGGGACACC	0.403																																					p.S516T		Atlas-SNP	.											.	HHLA1	35	.	0			c.T1546A						.						211.0	167.0	180.0					8																	133078139		692	1591	2283	SO:0001583	missense	10086	exon15			TGTGCGAGTGGGA	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.1546T>A	chr8.hg19:g.133078139A>T	ENSP00000388322:p.Ser516Thr	89.0	0.0		120.0	15.0	NM_001145095		Missense_Mutation	SNP	ENST00000414222.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.95	3.263008	0.59431	.	.	ENSG00000132297	ENST00000414222	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	T	0.40570	0.1122	N	0.08118	0	0.22511	N	0.999038	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.41413	-0.9510	8	0.87932	D	0	.	12.4683	0.55773	1.0:0.0:0.0:0.0	.	516;373	C9JL84;C9JL84-2	HHLA1_HUMAN;.	T	516	.	ENSP00000388322:S516T	S	-	1	0	HHLA1	133147321	1.000000	0.71417	0.726000	0.30738	0.362000	0.29581	5.049000	0.64244	2.193000	0.70182	0.523000	0.50628	TCG	.	.		0.403	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XR_017860	
TMEM2	23670	hgsc.bcm.edu	37	9	74355007	74355007	+	Silent	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr9:74355007A>G	ENST00000377044.4	-	5	1715	c.1176T>C	c.(1174-1176)tcT>tcC	p.S392S	TMEM2_ENST00000377066.5_Silent_p.S392S	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	392					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AAGCTGTCACAGAGAACTTCT	0.373																																					p.S392S		Atlas-SNP	.											.	TMEM2	112	.	0			c.T1176C						.						115.0	111.0	112.0					9																	74355007		2203	4300	6503	SO:0001819	synonymous_variant	23670	exon5			TGTCACAGAGAAC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.1176T>C	chr9.hg19:g.74355007A>G		51.0	0.0		53.0	9.0	NM_001135820	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Silent	SNP	ENST00000377044.4	hg19	CCDS6638.1																																																																																			.	.		0.373	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
PRRC2B	84726	hgsc.bcm.edu	37	9	134357801	134357801	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr9:134357801G>T	ENST00000357304.4	+	20	5082	c.5027G>T	c.(5026-5028)aGt>aTt	p.S1676I	PRRC2B_ENST00000458550.1_Missense_Mutation_p.S982I|PRRC2B_ENST00000405995.1_Missense_Mutation_p.S982I|PRRC2B_ENST00000372249.1_5'UTR	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1676							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GTTGACTTGAGTGCCGAGTCT	0.582																																					p.S1676I		Atlas-SNP	.											.	PRRC2B	266	.	0			c.G5027T						.						154.0	161.0	159.0					9																	134357801		2006	4177	6183	SO:0001583	missense	84726	exon20			ACTTGAGTGCCGA	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.5027G>T	chr9.hg19:g.134357801G>T	ENSP00000349856:p.Ser1676Ile	124.0	0.0		134.0	37.0	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	hg19	CCDS48044.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.033066|4.033066	0.75504|0.75504	.|.	.|.	ENSG00000130723|ENSG00000130723	ENST00000451855|ENST00000405995;ENST00000357304;ENST00000458550	.|T;T;T	.|0.03982	.|3.74;4.18;3.74	4.92|4.92	4.92|4.92	0.64577|0.64577	.|.	.|0.000000	.|0.48767	.|U	.|0.000163	T|T	0.19725|0.19725	0.0474|0.0474	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.998	.|D;D	.|0.71656	.|0.974;0.957	T|T	0.00316|0.00316	-1.1823|-1.1823	5|10	.|0.56958	.|D	.|0.05	-15.1703|-15.1703	17.105|17.105	0.86660|0.86660	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|408;1676	.|Q5JSZ8;Q5JSZ5	.|.;PRC2B_HUMAN	D|I	408|982;1676;982	.|ENSP00000384606:S982I;ENSP00000349856:S1676I;ENSP00000398853:S982I	.|ENSP00000349856:S1676I	E|S	+|+	3|2	2|0	PRRC2B|PRRC2B	133347622|133347622	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.840000|0.840000	0.47671|0.47671	7.507000|7.507000	0.81676|0.81676	2.275000|2.275000	0.75901|0.75901	0.561000|0.561000	0.74099|0.74099	GAG|AGT	.	.		0.582	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SARDH	1757	hgsc.bcm.edu	37	9	136597702	136597702	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr9:136597702G>A	ENST00000371872.4	-	3	610	c.353C>T	c.(352-354)cCc>cTc	p.P118L	SARDH_ENST00000422262.2_5'UTR|SARDH_ENST00000298628.5_Missense_Mutation_p.P118L|SARDH_ENST00000439388.1_Missense_Mutation_p.P118L|SARDH_ENST00000371867.1_Missense_Mutation_p.P29L	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	118					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CACGTCACTGGGCCGCAGCTG	0.667																																					p.P118L		Atlas-SNP	.											.	SARDH	112	.	0			c.C353T						.						46.0	48.0	47.0					9																	136597702		2203	4300	6503	SO:0001583	missense	1757	exon3			TCACTGGGCCGCA		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.353C>T	chr9.hg19:g.136597702G>A	ENSP00000360938:p.Pro118Leu	34.0	0.0		46.0	23.0	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	hg19	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	G	31	5.080959	0.94050	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000427237;ENST00000539227;ENST00000535281;ENST00000371867;ENST00000393050;ENST00000298628	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	4.32	4.32	0.51571	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.91415	0.7291	M	0.83603	2.65	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.93142	0.6542	10	0.87932	D	0	-29.0247	16.7821	0.85565	0.0:0.0:1.0:0.0	.	118	Q9UL12	SARDH_HUMAN	L	118;118;118;118;118;29;96;118	ENSP00000360938:P118L;ENSP00000403084:P118L;ENSP00000360933:P29L;ENSP00000298628:P118L	ENSP00000298628:P118L	P	-	2	0	SARDH	135587523	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.229000	0.95273	1.942000	0.56320	0.462000	0.41574	CCC	.	.		0.667	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
GSTO1	9446	hgsc.bcm.edu	37	10	106025865	106025865	+	Silent	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr10:106025865C>T	ENST00000369713.5	+	5	683	c.489C>T	c.(487-489)acC>acT	p.T163T	GSTO1_ENST00000493946.1_3'UTR|MIR4482-1_ENST00000583050.1_RNA|GSTO1_ENST00000369710.4_Silent_p.T130T|GSTO2_ENST00000450629.2_5'Flank|GSTO1_ENST00000539281.1_Silent_p.T135T	NM_004832.2	NP_004823.1	P78417	GSTO1_HUMAN	glutathione S-transferase omega 1	163	GST C-terminal.				cellular response to arsenic-containing substance (GO:0071243)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|positive regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014810)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione dehydrogenase (ascorbate) activity (GO:0045174)|glutathione transferase activity (GO:0004364)|methylarsonate reductase activity (GO:0050610)|oxidoreductase activity (GO:0016491)			large_intestine(1)|lung(1)|stomach(1)	3		Colorectal(252;0.102)|Breast(234;0.122)		Epithelial(162;8.07e-10)|all cancers(201;2.72e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0147)	Glutathione(DB00143)|Vitamin E(DB00163)	AGAAGACGACCTTCTTTGGTG	0.358																																					p.T163T		Atlas-SNP	.											.	GSTO1	14	.	0			c.C489T						.						209.0	202.0	204.0					10																	106025865		2203	4300	6503	SO:0001819	synonymous_variant	9446	exon5			GACGACCTTCTTT	AF212303	CCDS7555.1, CCDS53572.1, CCDS53573.1	10q25.1	2012-06-21			ENSG00000148834	ENSG00000148834	2.5.1.18, 1.8.5.1, 1.20.4.2	"""Glutathione S-transferases / Soluble"""	13312	protein-coding gene	gene with protein product		605482				10783391, 12618591	Standard	NM_004832		Approved	GSTTLp28, P28	uc001kya.3	P78417	OTTHUMG00000019001	ENST00000369713.5:c.489C>T	chr10.hg19:g.106025865C>T		131.0	0.0		99.0	28.0	NM_004832	D3DRA3|F5H7H0|Q5TA03|Q7Z3T2	Silent	SNP	ENST00000369713.5	hg19	CCDS7555.1																																																																																			.	.		0.358	GSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050193.1	NM_004832	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73020542	73020542	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr11:73020542C>T	ENST00000263674.3	+	1	1209	c.859C>T	c.(859-861)Cac>Tac	p.H287Y	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	287					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						TGAGGGCGGCCACCGCTGGGG	0.667																																					p.H287Y		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.C859T						.						20.0	26.0	24.0					11																	73020542		2162	4262	6424	SO:0001583	missense	9828	exon1			GGCGGCCACCGCT	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.859C>T	chr11.hg19:g.73020542C>T	ENSP00000263674:p.His287Tyr	31.0	0.0		26.0	15.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	C	7.148	0.583216	0.13749	.	.	ENSG00000110237	ENST00000263674	T	0.57907	0.37	3.84	2.91	0.33838	.	0.382913	0.19293	N	0.117841	T	0.32556	0.0833	N	0.19112	0.55	0.09310	N	1	B	0.24483	0.104	B	0.15052	0.012	T	0.20338	-1.0278	10	0.72032	D	0.01	-2.6484	6.3799	0.21529	0.0:0.8675:0.0:0.1325	.	287	Q96PE2	ARHGH_HUMAN	Y	287	ENSP00000263674:H287Y	ENSP00000263674:H287Y	H	+	1	0	ARHGEF17	72698190	0.008000	0.16893	0.101000	0.21167	0.459000	0.32528	1.540000	0.36115	2.101000	0.63845	0.313000	0.20887	CAC	.	.		0.667	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123448102	123448102	+	Silent	SNP	G	G	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr11:123448102G>T	ENST00000529750.1	+	2	378	c.51G>T	c.(49-51)acG>acT	p.T17T	GRAMD1B_ENST00000322282.7_Silent_p.T17T|GRAMD1B_ENST00000456860.2_Silent_p.T17T	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	17						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		ACCGCAGCACGCCGGCCTGCT	0.637											OREG0021454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T17T		Atlas-SNP	.											GRAMD1B_ENST00000529750,NS,carcinoma,0,2	GRAMD1B	122	.	0			c.G51T						.						15.0	19.0	18.0					11																	123448102		2111	4218	6329	SO:0001819	synonymous_variant	57476	exon2			CAGCACGCCGGCC	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.51G>T	chr11.hg19:g.123448102G>T		85.0	0.0	1526	47.0	2.0	NM_020716	Q6UW85|Q9ULL9	Silent	SNP	ENST00000529750.1	hg19	CCDS53720.1																																																																																			.	.		0.637	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
KRT85	3891	hgsc.bcm.edu	37	12	52754698	52754698	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr12:52754698G>A	ENST00000257901.3	-	9	1538	c.1463C>T	c.(1462-1464)cCc>cTc	p.P488L	KRT85_ENST00000544265.1_Missense_Mutation_p.P276L	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	488	Tail.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGCTGGCAGGGGGCACAGGA	0.667																																					p.P488L		Atlas-SNP	.											.	KRT85	78	.	0			c.C1463T						.						37.0	45.0	42.0					12																	52754698		2202	4300	6502	SO:0001583	missense	3891	exon9			TGGCAGGGGGCAC	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.1463C>T	chr12.hg19:g.52754698G>A	ENSP00000257901:p.Pro488Leu	40.0	0.0		42.0	18.0	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	hg19	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	G	18.73	3.687351	0.68157	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	D;T	0.82081	-1.57;-1.48	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000013	D	0.88078	0.6340	M	0.71036	2.16	0.43545	D	0.995843	D	0.69078	0.997	P	0.58210	0.835	D	0.88348	0.2979	10	0.54805	T	0.06	.	14.1477	0.65360	0.0:0.0:1.0:0.0	.	488	P78386	KRT85_HUMAN	L	488;276	ENSP00000257901:P488L;ENSP00000440240:P276L	ENSP00000257901:P488L	P	-	2	0	KRT85	51040965	1.000000	0.71417	0.991000	0.47740	0.582000	0.36321	2.419000	0.44671	2.711000	0.92665	0.609000	0.83330	CCC	.	.		0.667	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
OR9K2	441639	hgsc.bcm.edu	37	12	55524501	55524501	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr12:55524501A>G	ENST00000305377.5	+	1	1037	c.949A>G	c.(949-951)Aac>Gac	p.N317D		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						CTCTCTGAGGAACAAAGATGT	0.343																																					p.N317D		Atlas-SNP	.											.	OR9K2	63	.	0			c.A949G						.						84.0	84.0	84.0					12																	55524501		2203	4300	6503	SO:0001583	missense	441639	exon1			CTGAGGAACAAAG	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.949A>G	chr12.hg19:g.55524501A>G	ENSP00000307598:p.Asn317Asp	131.0	0.0		135.0	54.0	NM_001005243	B9EH19|Q6IFD6	Missense_Mutation	SNP	ENST00000305377.5	hg19	CCDS31814.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.040964	0.75732	.	.	ENSG00000170605	ENST00000305377	T	0.48836	0.8	4.86	4.86	0.63082	.	0.000000	0.56097	D	0.000023	T	0.78291	0.4260	H	0.97940	4.11	0.33353	D	0.57132	D	0.62365	0.991	D	0.63033	0.91	D	0.89802	0.3976	10	0.87932	D	0	-23.6752	14.5967	0.68413	1.0:0.0:0.0:0.0	.	317	Q8NGE7	OR9K2_HUMAN	D	317	ENSP00000307598:N317D	ENSP00000307598:N317D	N	+	1	0	OR9K2	53810768	0.985000	0.35326	1.000000	0.80357	0.982000	0.71751	5.778000	0.68940	2.176000	0.68965	0.528000	0.53228	AAC	.	.		0.343	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1		
GRIP1	23426	hgsc.bcm.edu	37	12	66856725	66856725	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr12:66856725C>G	ENST00000398016.3	-	9	1089	c.1021G>C	c.(1021-1023)Gcc>Ccc	p.A341P	GRIP1_ENST00000286445.7_Missense_Mutation_p.A341P|GRIP1_ENST00000359742.4_Missense_Mutation_p.A341P	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CCCTTTAGGGCCAGCCGGGTC	0.552																																					p.A341P		Atlas-SNP	.											.	GRIP1	106	.	0			c.G1021C						.						90.0	86.0	87.0					12																	66856725		1922	4138	6060	SO:0001583	missense	23426	exon9			TTAGGGCCAGCCG	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1021G>C	chr12.hg19:g.66856725C>G	ENSP00000381098:p.Ala341Pro	97.0	0.0		105.0	40.0	NM_001178074	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	hg19	CCDS41807.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	8.233|8.233|8.233	0.805203|0.805203|0.805203	0.16467|0.16467|0.16467	.|.|.	.|.|.	ENSG00000155974|ENSG00000155974|ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215|ENST00000543172|ENST00000538164	T;T;T;T;T;T|.|.	0.41400|.|.	2.05;1.0;1.0;2.06;2.12;1.0|.|.	5.21|5.21|5.21	5.21|5.21|5.21	0.72293|0.72293|0.72293	PDZ/DHR/GLGF (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|T	0.56046|0.56046|0.56046	0.1959|0.1959|0.1959	N|N|N	0.21142|0.21142|0.21142	0.635|0.635|0.635	0.58432|0.58432|0.58432	D|D|D	0.999997|0.999997|0.999997	B;B;B;B|.|.	0.28584|.|.	0.019;0.216;0.009;0.019|.|.	B;B;B;B|.|.	0.25759|.|.	0.02;0.063;0.014;0.034|.|.	T|T|T	0.48758|0.48758|0.48758	-0.9007|-0.9007|-0.9007	9|5|5	.|.|.	.|.|.	.|.|.	-17.9385|-17.9385|-17.9385	19.6542|19.6542|19.6542	0.95830|0.95830|0.95830	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	341;341;341;341|.|.	F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2|.|.	.;GRIP1_HUMAN;.;.|.|.	P|A|C	341;341;341;341;285;285|161|155	ENSP00000381098:A341P;ENSP00000352780:A341P;ENSP00000286445:A341P;ENSP00000446047:A341P;ENSP00000446024:A285P;ENSP00000446011:A285P|.|.	.|.|.	A|G|W	-|-|-	1|2|3	0|0|0	GRIP1|GRIP1|GRIP1	65142992|65142992|65142992	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.432000|0.432000|0.432000	0.31715|0.31715|0.31715	3.136000|3.136000|3.136000	0.50554|0.50554|0.50554	2.816000|2.816000|2.816000	0.96949|0.96949|0.96949	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GCC|GGC|TGG	.	.		0.552	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
SOX21	11166	hgsc.bcm.edu	37	13	95363707	95363707	+	Silent	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr13:95363707G>A	ENST00000376945.2	-	1	682	c.597C>T	c.(595-597)acC>acT	p.T199T	SOX21-AS1_ENST00000438290.2_lincRNA	NM_007084.2	NP_009015.1	Q9Y651	SOX21_HUMAN	SRY (sex determining region Y)-box 21	199					hair follicle development (GO:0001942)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6	all_neural(89;0.0646)|Medulloblastoma(90;0.163)					CCGCGCCCGCGGTCGGGTAGC	0.776																																					p.T199T		Atlas-SNP	.											.	SOX21	21	.	0			c.C597T						.						2.0	3.0	3.0					13																	95363707		1157	2292	3449	SO:0001819	synonymous_variant	11166	exon1			GCCCGCGGTCGGG	AF107044	CCDS9473.1	13q31-q32	2008-07-18			ENSG00000125285	ENSG00000125285		"""SRY (sex determining region Y)-boxes"""	11197	protein-coding gene	gene with protein product	"""SRY-box 21"""	604974				10441749	Standard	NM_007084		Approved	SOX25	uc001vma.3	Q9Y651	OTTHUMG00000017209	ENST00000376945.2:c.597C>T	chr13.hg19:g.95363707G>A		26.0	0.0		18.0	9.0	NM_007084	P35715|Q15504|Q5TBS1	Silent	SNP	ENST00000376945.2	hg19	CCDS9473.1																																																																																			.	.		0.776	SOX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045467.4	NM_007084	
RNASE1	6035	hgsc.bcm.edu	37	14	21269973	21269973	+	Silent	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr14:21269973G>A	ENST00000397967.4	-	2	761	c.255C>T	c.(253-255)gtC>gtT	p.V85V	RNASE1_ENST00000555698.1_Silent_p.V45V|RNASE1_ENST00000412779.2_Silent_p.V85V|RNASE1_ENST00000340900.3_Silent_p.V85V|RNASE1_ENST00000397970.4_Silent_p.V85V	NM_002933.4	NP_002924.1	P07998	RNAS1_HUMAN	ribonuclease, RNase A family, 1 (pancreatic)	85					RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	extracellular vesicular exosome (GO:0070062)	nucleic acid binding (GO:0003676)|pancreatic ribonuclease activity (GO:0004522)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	5	all_cancers(95;0.00671)	all_lung(585;0.235)	Epithelial(56;9.21e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0126)	Guanidine(DB00536)|L-Aspartic Acid(DB00128)	CCTGGAAACAGACATTCTGGA	0.542																																					p.V85V		Atlas-SNP	.											.	RNASE1	14	.	0			c.C255T						.						158.0	141.0	147.0					14																	21269973		2203	4300	6503	SO:0001819	synonymous_variant	6035	exon3			GAAACAGACATTC	BC005324	CCDS9559.1	14q11.2	2014-03-13			ENSG00000129538	ENSG00000129538	3.1.27.5	"""Ribonucleases, RNase A"""	10044	protein-coding gene	gene with protein product		180440		RNS1		8588814	Standard	NM_002933		Approved		uc001vyi.3	P07998	OTTHUMG00000029603	ENST00000397967.4:c.255C>T	chr14.hg19:g.21269973G>A		130.0	0.0		135.0	65.0	NM_198235	B2R589|D3DS06|Q16830|Q16869|Q1KHR2|Q6ICS5|Q9UCB4|Q9UCB5	Silent	SNP	ENST00000397967.4	hg19	CCDS9559.1																																																																																			.	.		0.542	RNASE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073791.3		
REC114	283677	hgsc.bcm.edu	37	15	73766189	73766189	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr15:73766189A>C	ENST00000331090.6	+	2	204	c.176A>C	c.(175-177)gAa>gCa	p.E59A	C15orf60_ENST00000560581.1_Missense_Mutation_p.E59A	NM_001042367.1	NP_001035826.1	Q7Z4M0	RE114_HUMAN		59					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17						GATTCCAATGAAGAATCTGGA	0.313																																					p.E59A		Atlas-SNP	.											.	C15orf60	26	.	0			c.A176C						.						94.0	83.0	86.0					15																	73766189		1812	4063	5875	SO:0001583	missense	283677	exon2			CCAATGAAGAATC																												ENST00000331090.6:c.176A>C	chr15.hg19:g.73766189A>C	ENSP00000328423:p.Glu59Ala	68.0	0.0		86.0	16.0	NM_001042367		Missense_Mutation	SNP	ENST00000331090.6	hg19	CCDS45296.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.930580	0.52866	.	.	ENSG00000183324	ENST00000331090	T	0.54071	0.59	5.69	4.58	0.56647	.	0.119294	0.56097	D	0.000038	T	0.55673	0.1935	M	0.64997	1.995	0.40368	D	0.97931	D	0.56035	0.974	P	0.50659	0.647	T	0.61763	-0.6996	10	0.72032	D	0.01	-1.874	7.6117	0.28135	0.9072:0.0:0.0928:0.0	.	59	Q7Z4M0	CO060_HUMAN	A	59	ENSP00000328423:E59A	ENSP00000328423:E59A	E	+	2	0	C15orf60	71553242	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.805000	0.55575	2.170000	0.68504	0.528000	0.53228	GAA	.	.		0.313	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419069.1		
IFT140	9742	hgsc.bcm.edu	37	16	1630796	1630796	+	Silent	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr16:1630796C>T	ENST00000426508.2	-	13	1851	c.1488G>A	c.(1486-1488)acG>acA	p.T496T	IFT140_ENST00000439987.2_5'UTR|LA16c-395F10.2_ENST00000563162.1_RNA|LA16c-425C2.1_ENST00000568149.1_RNA	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	496					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				TTGACTCCACCGTGTAAACGT	0.488																																					p.T496T		Atlas-SNP	.											.	IFT140	128	.	0			c.G1488A						.						121.0	96.0	104.0					16																	1630796		2199	4300	6499	SO:0001819	synonymous_variant	9742	exon13			CTCCACCGTGTAA	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.1488G>A	chr16.hg19:g.1630796C>T		83.0	0.0		63.0	26.0	NM_014714	A2A2A8|D3DU75|O60332|Q9UG52	Silent	SNP	ENST00000426508.2	hg19	CCDS10439.1																																																																																			.	.		0.488	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
TRIM72	493829	hgsc.bcm.edu	37	16	31235616	31235616	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr16:31235616C>T	ENST00000322122.3	+	7	1258	c.974C>T	c.(973-975)cCg>cTg	p.P325L	RP11-388M20.9_ENST00000576745.1_lincRNA	NM_001008274.3	NP_001008275.2			tripartite motif containing 72, E3 ubiquitin protein ligase											breast(1)|endometrium(2)|large_intestine(2)|lung(9)|skin(1)	15						GGGGAGGACCCGCGCCAGTTC	0.711																																					p.P325L		Atlas-SNP	.											TRIM72,NS,lymphoid_neoplasm,0,2	TRIM72	32	.	0			c.C974T						.						14.0	15.0	14.0					16																	31235616		2190	4279	6469	SO:0001583	missense	493829	exon7			AGGACCCGCGCCA	AK090695	CCDS32437.1	16p11.2	2014-02-10	2014-02-10					"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32671	protein-coding gene	gene with protein product	"""mitsugumin 53"""	613288	"""tripartite motif-containing 72"", ""tripartite motif containing 72"""			20399744, 23354051	Standard	NM_001008274		Approved	MG53	uc002ebn.2	Q6ZMU5		ENST00000322122.3:c.974C>T	chr16.hg19:g.31235616C>T	ENSP00000312675:p.Pro325Leu	44.0	0.0		39.0	18.0	NM_001008274		Missense_Mutation	SNP	ENST00000322122.3	hg19	CCDS32437.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246196	0.80024	.	.	ENSG00000177238	ENST00000322122	T	0.24151	1.87	5.44	3.46	0.39613	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.086125	0.49305	D	0.000159	T	0.43077	0.1231	M	0.86864	2.845	0.58432	D	0.999996	P	0.46784	0.884	P	0.50659	0.647	T	0.41142	-0.9525	10	0.56958	D	0.05	.	9.3522	0.38145	0.1445:0.7787:0.0:0.0768	.	325	Q6ZMU5	TRI72_HUMAN	L	325	ENSP00000312675:P325L	ENSP00000312675:P325L	P	+	2	0	TRIM72	31143117	0.950000	0.32346	0.830000	0.32933	0.860000	0.49131	3.447000	0.52936	0.661000	0.30985	0.491000	0.48974	CCG	.	.		0.711	TRIM72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433567.1	NM_001008274	
ITGAD	3681	hgsc.bcm.edu	37	16	31419205	31419205	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr16:31419205A>G	ENST00000389202.2	+	9	1026	c.977A>G	c.(976-978)aAg>aGg	p.K326R		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	326	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						AGCATCCAGAAGCAGCTGCAG	0.582																																					p.K326R		Atlas-SNP	.											.	ITGAD	154	.	0			c.A977G						.						59.0	58.0	59.0					16																	31419205		2197	4300	6497	SO:0001583	missense	3681	exon9			TCCAGAAGCAGCT	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.977A>G	chr16.hg19:g.31419205A>G	ENSP00000373854:p.Lys326Arg	55.0	0.0		67.0	12.0	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	hg19	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	a	13.09	2.133649	0.37630	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	D	0.83914	-1.78	5.01	3.33	0.38152	von Willebrand factor, type A (3);	.	.	.	.	T	0.73210	0.3558	L	0.37850	1.14	0.21553	N	0.999644	B;B	0.14012	0.009;0.005	B;B	0.15484	0.013;0.013	T	0.58463	-0.7632	9	0.31617	T	0.26	.	7.2029	0.25891	0.8363:0.0:0.1637:0.0	.	342;326	Q59H14;Q13349	.;ITAD_HUMAN	R	342;326	ENSP00000373854:K326R	ENSP00000373854:K326R	K	+	2	0	ITGAD	31326706	0.912000	0.30974	0.931000	0.37212	0.962000	0.63368	2.009000	0.40903	0.432000	0.26286	0.477000	0.44152	AAG	.	.		0.582	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
HSDL1	83693	hgsc.bcm.edu	37	16	84163813	84163813	+	Silent	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr16:84163813C>T	ENST00000219439.4	-	4	620	c.444G>A	c.(442-444)ttG>ttA	p.L148L	HSDL1_ENST00000434463.3_Intron	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	148						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						CGTTATTTACCAAGATGCCAA	0.473																																					p.L148L		Atlas-SNP	.											.	HSDL1	23	.	0			c.G444A						.						147.0	130.0	135.0					16																	84163813		2200	4300	6500	SO:0001819	synonymous_variant	83693	exon4			ATTTACCAAGATG	AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.444G>A	chr16.hg19:g.84163813C>T		97.0	0.0		93.0	20.0	NM_031463	B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Silent	SNP	ENST00000219439.4	hg19	CCDS10942.1																																																																																			.	.		0.473	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269076.3	NM_031463	
ZNF469	84627	hgsc.bcm.edu	37	16	88499415	88499415	+	Missense_Mutation	SNP	C	C	T	rs539550777		TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr16:88499415C>T	ENST00000437464.1	+	2	5453	c.5453C>T	c.(5452-5454)aCg>aTg	p.T1818M	ZNF469_ENST00000565624.1_Missense_Mutation_p.T1846M	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1818					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CTCCACCCCACGGCAGGGAGG	0.672																																					p.T1818M		Atlas-SNP	.											.	ZNF469	121	.	0			c.C5453T						.						12.0	12.0	12.0					16																	88499415		692	1585	2277	SO:0001583	missense	84627	exon2			ACCCCACGGCAGG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.5453C>T	chr16.hg19:g.88499415C>T	ENSP00000402343:p.Thr1818Met	74.0	0.0		94.0	23.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	8.956	0.969364	0.18659	.	.	ENSG00000225614	ENST00000437464	T	0.06371	3.31	3.88	-7.77	0.01227	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.08055	0.003	T	0.48525	-0.9028	9	0.56958	D	0.05	.	6.9452	0.24514	0.0:0.2223:0.46:0.3177	.	1818	Q96JG9	ZN469_HUMAN	M	1818	ENSP00000402343:T1818M	ENSP00000402343:T1818M	T	+	2	0	ZNF469	87026916	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.531000	0.06171	-0.939000	0.03709	0.467000	0.42956	ACG	.	.		0.672	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
PIEZO1	9780	hgsc.bcm.edu	37	16	88801357	88801357	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr16:88801357T>C	ENST00000301015.9	-	14	2020	c.1774A>G	c.(1774-1776)Agc>Ggc	p.S592G	RP5-1142A6.2_ENST00000440406.2_RNA|RP5-1142A6.2_ENST00000567968.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	592					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCGGCGAAGCTGACCACGATG	0.617																																					p.S592G		Atlas-SNP	.											.	PIEZO1	79	.	0			c.A1774G						.						105.0	101.0	102.0					16																	88801357		692	1591	2283	SO:0001583	missense	9780	exon14			CGAAGCTGACCAC	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.1774A>G	chr16.hg19:g.88801357T>C	ENSP00000301015:p.Ser592Gly	36.0	0.0		34.0	6.0	NM_001142864	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	hg19	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.72|16.72	3.201961|3.201961	0.58234|0.58234	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.12672	.|2.66	4.59|4.59	4.59|4.59	0.56863|0.56863	.|.	.|0.149876	.|0.46145	.|D	.|0.000303	T|T	0.29061|0.29061	0.0722|0.0722	L|L	0.47078|0.47078	1.49|1.49	0.80722|0.80722	D|D	1|1	.|D	.|0.69078	.|0.997	.|D	.|0.75020	.|0.985	T|T	0.01280|0.01280	-1.1397|-1.1397	5|10	.|0.46703	.|T	.|0.11	-34.8751|-34.8751	13.6267|13.6267	0.62168|0.62168	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|592	.|Q92508	.|PIEZ1_HUMAN	R|G	537|592	.|ENSP00000301015:S592G	.|ENSP00000301015:S592G	Q|S	-|-	2|1	0|0	FAM38A|FAM38A	87328858|87328858	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.694000|0.694000	0.40290|0.40290	3.903000|3.903000	0.56318|0.56318	1.713000|1.713000	0.51359|0.51359	0.397000|0.397000	0.26171|0.26171	CAG|AGC	.	.		0.617	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
DNAH9	1770	hgsc.bcm.edu	37	17	11784551	11784551	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr17:11784551T>C	ENST00000262442.4	+	55	10695	c.10627T>C	c.(10627-10629)Tgt>Cgt	p.C3543R	DNAH9_ENST00000608377.1_5'Flank|DNAH9_ENST00000454412.2_Missense_Mutation_p.C3543R	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3543	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGACAAAGAATGTGAATACAA	0.458																																					p.C3543R		Atlas-SNP	.											.	DNAH9	695	.	0			c.T10627C						.						99.0	93.0	95.0					17																	11784551		2203	4300	6503	SO:0001583	missense	1770	exon55			AAAGAATGTGAAT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10627T>C	chr17.hg19:g.11784551T>C	ENSP00000262442:p.Cys3543Arg	82.0	0.0		69.0	42.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.141712	0.77775	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.22945	1.93;1.93	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.49881	0.1583	M	0.81682	2.555	0.80722	D	1	P	0.52842	0.956	P	0.60345	0.873	T	0.56571	-0.7957	10	0.72032	D	0.01	.	14.8948	0.70636	0.0:0.0:0.0:1.0	.	3543	Q9NYC9	DYH9_HUMAN	R	3543;3543;2125	ENSP00000262442:C3543R;ENSP00000414874:C3543R	ENSP00000262442:C3543R	C	+	1	0	DNAH9	11725276	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	3.995000	0.57001	2.159000	0.67721	0.533000	0.62120	TGT	.	.		0.458	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
ZNF624	57547	hgsc.bcm.edu	37	17	16527675	16527675	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr17:16527675T>C	ENST00000311331.7	-	6	616	c.525A>G	c.(523-525)atA>atG	p.I175M		NM_020787.3	NP_065838.2	Q9P2J8	ZN624_HUMAN	zinc finger protein 624	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	26				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GTAATCTCAATATCCTATCAT	0.363																																					p.I175M	NSCLC(186;1023 2134 13330 38202 39800)	Atlas-SNP	.											.	ZNF624	91	.	0			c.A525G						.						101.0	100.0	100.0					17																	16527675		2203	4300	6503	SO:0001583	missense	57547	exon6			TCTCAATATCCTA	AB037770	CCDS11180.1	17p11.2	2013-01-08			ENSG00000197566	ENSG00000197566		"""Zinc fingers, C2H2-type"", ""-"""	29254	protein-coding gene	gene with protein product						10718198	Standard	NM_020787		Approved	KIAA1349	uc010cpi.2	Q9P2J8	OTTHUMG00000058996	ENST00000311331.7:c.525A>G	chr17.hg19:g.16527675T>C	ENSP00000310472:p.Ile175Met	160.0	0.0		90.0	54.0	NM_020787	Q3SY62|Q3SY63|Q6ZN27	Missense_Mutation	SNP	ENST00000311331.7	hg19	CCDS11180.1	.	.	.	.	.	.	.	.	.	.	T	6.844	0.524884	0.13066	.	.	ENSG00000197566	ENST00000311331	T	0.05139	3.49	2.95	0.508	0.16972	.	.	.	.	.	T	0.03053	0.0090	N	0.08118	0	0.23298	N	0.997958	B	0.19583	0.037	B	0.15870	0.014	T	0.45220	-0.9276	9	0.33940	T	0.23	.	5.534	0.17001	0.4969:0.0:0.0:0.5031	.	175	Q9P2J8	ZN624_HUMAN	M	175	ENSP00000310472:I175M	ENSP00000310472:I175M	I	-	3	3	ZNF624	16468400	0.093000	0.21703	0.087000	0.20705	0.117000	0.20001	0.665000	0.25083	0.048000	0.15891	0.533000	0.62120	ATA	.	.		0.363	ZNF624-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130512.3	XM_047617	
CHMP6	79643	hgsc.bcm.edu	37	17	78972941	78972941	+	Silent	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr17:78972941G>A	ENST00000325167.5	+	8	672	c.594G>A	c.(592-594)gtG>gtA	p.V198V	CTD-2561B21.7_ENST00000576215.1_RNA|CTD-2561B21.7_ENST00000577061.2_RNA	NM_024591.4	NP_078867.2	Q96FZ7	CHMP6_HUMAN	charged multivesicular body protein 6	198					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein N-terminus binding (GO:0047485)			lung(2)|ovary(1)	3	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CGGAGCTGGTGGCAGCTTCGT	0.617																																					p.V198V		Atlas-SNP	.											.	CHMP6	16	.	0			c.G594A						.						120.0	100.0	107.0					17																	78972941		2203	4300	6503	SO:0001819	synonymous_variant	79643	exon8			GCTGGTGGCAGCT	BC010108	CCDS11774.1	17q25.3	2014-08-13	2011-09-21		ENSG00000176108	ENSG00000176108		"""Charged multivesicular body proteins"""	25675	protein-coding gene	gene with protein product		610901	"""chromatin modifying protein 6"""			11559748, 15511219	Standard	NM_024591		Approved	FLJ11749, VPS20	uc002jyw.4	Q96FZ7	OTTHUMG00000177645	ENST00000325167.5:c.594G>A	chr17.hg19:g.78972941G>A		50.0	0.0		37.0	13.0	NM_024591	A8K7U0|Q53FU4|Q9HAE8	Silent	SNP	ENST00000325167.5	hg19	CCDS11774.1																																																																																			.	.		0.617	CHMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438215.1	NM_024591	
NETO1	81832	hgsc.bcm.edu	37	18	70423359	70423359	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr18:70423359A>C	ENST00000327305.6	-	8	1549	c.892T>G	c.(892-894)Ttc>Gtc	p.F298V	NETO1_ENST00000583169.1_Missense_Mutation_p.F298V|NETO1_ENST00000299430.2_Missense_Mutation_p.F297V	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	298	LDL-receptor class A. {ECO:0000255|PROSITE-ProRule:PRU00124}.				memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		CTATGGCAGAAGAATGTGTTG	0.353																																					p.F298V		Atlas-SNP	.											NETO1,NS,carcinoma,0,2	NETO1	178	.	0			c.T892G						.						100.0	96.0	97.0					18																	70423359		2203	4300	6503	SO:0001583	missense	81832	exon8			GGCAGAAGAATGT	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.892T>G	chr18.hg19:g.70423359A>C	ENSP00000313088:p.Phe298Val	152.0	0.0		158.0	26.0	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	ENST00000327305.6	hg19	CCDS12000.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.349816	0.82132	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	D;D	0.95238	-3.65;-3.65	5.41	5.41	0.78517	.	0.000000	0.56097	D	0.000035	D	0.96494	0.8856	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.80764	0.986;0.994	D	0.96705	0.9521	10	0.56958	D	0.05	-14.5672	15.7499	0.77976	1.0:0.0:0.0:0.0	.	297;298	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	V	298;297	ENSP00000313088:F298V;ENSP00000299430:F297V	ENSP00000299430:F297V	F	-	1	0	NETO1	68574339	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.287000	0.95975	2.188000	0.69820	0.533000	0.62120	TTC	.	.		0.353	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
FBN3	84467	hgsc.bcm.edu	37	19	8161856	8161856	+	Silent	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr19:8161856G>A	ENST00000600128.1	-	43	5736	c.5322C>T	c.(5320-5322)tgC>tgT	p.C1774C	FBN3_ENST00000601739.1_Silent_p.C1774C|FBN3_ENST00000270509.2_Silent_p.C1774C			Q75N90	FBN3_HUMAN	fibrillin 3	1774	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CATTCTGCTGGCAGGGACTCT	0.567																																					p.C1774C		Atlas-SNP	.											.	FBN3	300	.	0			c.C5322T						.						66.0	60.0	62.0					19																	8161856		2203	4300	6503	SO:0001819	synonymous_variant	84467	exon42			CTGCTGGCAGGGA		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5322C>T	chr19.hg19:g.8161856G>A		37.0	0.0		30.0	11.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	hg19	CCDS12196.1																																																																																			.	.		0.567	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
OR7D2	162998	hgsc.bcm.edu	37	19	9297230	9297230	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr19:9297230T>C	ENST00000344248.2	+	1	952	c.773T>C	c.(772-774)gTc>gCc	p.V258A		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	258					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						GGCATTGGGGTCCACTTCACT	0.502																																					p.V258A		Atlas-SNP	.											.	OR7D2	55	.	0			c.T773C						.						91.0	80.0	83.0					19																	9297230		2203	4300	6503	SO:0001583	missense	162998	exon1			TTGGGGTCCACTT	AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.773T>C	chr19.hg19:g.9297230T>C	ENSP00000345563:p.Val258Ala	69.0	0.0		60.0	21.0	NM_175883	Q6IFJ7|Q8N133	Missense_Mutation	SNP	ENST00000344248.2	hg19	CCDS32900.1	.	.	.	.	.	.	.	.	.	.	T	13.05	2.120735	0.37436	.	.	ENSG00000188000	ENST00000344248	T	0.00036	8.86	2.21	2.21	0.28008	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35970	U	0.002869	T	0.00300	0.0009	L	0.61218	1.895	0.09310	N	1	D	0.69078	0.997	D	0.72075	0.976	T	0.46219	-0.9207	10	0.72032	D	0.01	.	3.6433	0.08176	0.0:0.3113:0.0:0.6887	.	258	Q96RA2	OR7D2_HUMAN	A	258	ENSP00000345563:V258A	ENSP00000345563:V258A	V	+	2	0	OR7D2	9158230	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	-0.008000	0.12788	1.296000	0.44742	0.418000	0.28097	GTC	.	.		0.502	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449002.1		
IL27RA	9466	hgsc.bcm.edu	37	19	14150478	14150478	+	Splice_Site	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr19:14150478G>A	ENST00000263379.2	+	3	501		c.e3+1			NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha						cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						GAAACCCAAAGTAACGTGGCA	0.607																																					.	Colon(164;1849 1896 4443 37792 47834)	Atlas-SNP	.											.	IL27RA	56	.	0			c.376+1G>A						.						60.0	62.0	62.0					19																	14150478		2203	4300	6503	SO:0001630	splice_region_variant	9466	exon3			CCCAAAGTAACGT	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.376+1G>A	chr19.hg19:g.14150478G>A		53.0	0.0		65.0	22.0	NM_004843	A0N0L1|O60624	Splice_Site	SNP	ENST00000263379.2	hg19	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396688	0.25205	.	.	ENSG00000104998	ENST00000263379	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6941	0.62567	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL27RA	14011478	1.000000	0.71417	0.934000	0.37439	0.084000	0.17831	4.443000	0.59994	2.704000	0.92352	0.555000	0.69702	.	.	.		0.607	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	Intron
ZNF429	353088	hgsc.bcm.edu	37	19	21720356	21720356	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr19:21720356A>G	ENST00000358491.4	+	4	1709	c.1501A>G	c.(1501-1503)Aaa>Gaa	p.K501E	ZNF429_ENST00000597078.1_Intron	NM_001001415.2	NP_001001415.2	Q86V71	ZN429_HUMAN	zinc finger protein 429	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(13)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	34						CAGTCATAAAAAAATTCATAG	0.378																																					p.K501E		Atlas-SNP	.											.	ZNF429	338	.	0			c.A1501G						.						39.0	43.0	42.0					19																	21720356		2103	4255	6358	SO:0001583	missense	353088	exon4			CATAAAAAAATTC	AY269786	CCDS42537.1	19p12	2014-02-14			ENSG00000197013	ENSG00000197013		"""Zinc fingers, C2H2-type"", ""-"""	20817	protein-coding gene	gene with protein product							Standard	NM_001001415		Approved		uc002nqd.1	Q86V71	OTTHUMG00000182848	ENST00000358491.4:c.1501A>G	chr19.hg19:g.21720356A>G	ENSP00000351280:p.Lys501Glu	33.0	0.0		29.0	10.0	NM_001001415	A6NLV7|Q9BZE6	Missense_Mutation	SNP	ENST00000358491.4	hg19	CCDS42537.1	.	.	.	.	.	.	.	.	.	.	.	5.812	0.334056	0.11013	.	.	ENSG00000197013	ENST00000358491	T	0.01068	5.38	0.81	0.81	0.18732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01489	0.0048	L	0.50333	1.59	0.21147	N	0.999771	P	0.45827	0.867	B	0.41271	0.352	T	0.50083	-0.8869	9	0.52906	T	0.07	.	6.5745	0.22557	1.0:0.0:0.0:0.0	.	501	Q86V71	ZN429_HUMAN	E	501	ENSP00000351280:K501E	ENSP00000351280:K501E	K	+	1	0	ZNF429	21512196	0.000000	0.05858	0.644000	0.29465	0.643000	0.38383	-0.256000	0.08757	0.156000	0.19299	0.155000	0.16302	AAA	.	.		0.378	ZNF429-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463981.1	NM_001001415	
AP2A1	160	hgsc.bcm.edu	37	19	50306439	50306439	+	Silent	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr19:50306439G>A	ENST00000359032.5	+	18	2313	c.2313G>A	c.(2311-2313)caG>caA	p.Q771Q	AP2A1_ENST00000354293.5_Silent_p.Q749Q	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	771					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		AGTTCCGACAGAACCTGGGTG	0.607																																					p.Q771Q		Atlas-SNP	.											.	AP2A1	108	.	0			c.G2313A						.						70.0	76.0	74.0					19																	50306439		1973	4156	6129	SO:0001819	synonymous_variant	160	exon18			CCGACAGAACCTG	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.2313G>A	chr19.hg19:g.50306439G>A		34.0	0.0		35.0	14.0	NM_014203	Q96CI7|Q96PP6|Q96PP7|Q9H070	Silent	SNP	ENST00000359032.5	hg19	CCDS46148.1																																																																																			.	.		0.607	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465809.1		
ZNF470	388566	hgsc.bcm.edu	37	19	57088623	57088623	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr19:57088623A>G	ENST00000330619.8	+	6	1512	c.826A>G	c.(826-828)Aga>Gga	p.R276G	ZNF470_ENST00000391709.3_Missense_Mutation_p.R276G|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		TCAACATCAGAGAATACACAC	0.428																																					p.R276G		Atlas-SNP	.											.	ZNF470	103	.	0			c.A826G						.						78.0	83.0	81.0					19																	57088623		2201	4300	6501	SO:0001583	missense	388566	exon6			CATCAGAGAATAC	AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.826A>G	chr19.hg19:g.57088623A>G	ENSP00000333223:p.Arg276Gly	93.0	0.0		132.0	26.0	NM_001001668	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	ENST00000330619.8	hg19	CCDS33122.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.772897	0.69992	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.02421	4.3;4.3	3.89	3.89	0.44902	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10637	0.0260	L	0.52126	1.63	0.21652	N	0.999602	D	0.89917	1.0	D	0.80764	0.994	T	0.06481	-1.0824	9	0.72032	D	0.01	.	11.8193	0.52228	1.0:0.0:0.0:0.0	.	276	Q6ECI4	ZN470_HUMAN	G	276	ENSP00000375590:R276G;ENSP00000333223:R276G	ENSP00000333223:R276G	R	+	1	2	ZNF470	61780435	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	0.088000	0.14979	1.640000	0.50565	0.377000	0.23210	AGA	.	.		0.428	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
ZNF17	7565	hgsc.bcm.edu	37	19	57931549	57931549	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr19:57931549A>G	ENST00000601808.1	+	3	902	c.689A>G	c.(688-690)aAc>aGc	p.N230S	AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000307658.7_Missense_Mutation_p.N232S	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TTTAGGTACAACTCCGACCTT	0.403																																					p.N230S	Melanoma(149;1637 1853 29914 42869 44988)	Atlas-SNP	.											.	ZNF17	49	.	0			c.A689G						.						89.0	92.0	91.0					19																	57931549		2199	4299	6498	SO:0001583	missense	7565	exon3			GGTACAACTCCGA	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.689A>G	chr19.hg19:g.57931549A>G	ENSP00000471905:p.Asn230Ser	59.0	0.0		84.0	34.0	NM_006959	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	ENST00000601808.1	hg19	CCDS42636.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.195553	0.00299	.	.	ENSG00000186272	ENST00000307658	.	.	.	2.0	0.954	0.19595	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07638	0.0192	N	0.00926	-1.1	0.09310	N	1	B;B	0.24768	0.111;0.015	B;B	0.19391	0.025;0.002	T	0.35895	-0.9770	8	0.07030	T	0.85	.	4.9605	0.14063	0.5197:0.0:0.4803:0.0	.	232;230	P17021-2;P17021	.;ZNF17_HUMAN	S	230	.	ENSP00000302455:N230S	N	+	2	0	ZNF17	62623361	0.000000	0.05858	0.009000	0.14445	0.533000	0.34776	-1.843000	0.01680	0.219000	0.20840	0.528000	0.53228	AAC	.	.		0.403	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959	
CHD6	84181	hgsc.bcm.edu	37	20	40085989	40085989	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr20:40085989C>T	ENST00000373233.3	-	18	2921	c.2744G>A	c.(2743-2745)cGc>cAc	p.R915H	CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	915	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				AAACATCTCGCGCTCGTAGGA	0.552																																					p.R915H		Atlas-SNP	.											.	CHD6	312	.	0			c.G2744A						.						137.0	106.0	117.0					20																	40085989		2203	4300	6503	SO:0001583	missense	84181	exon18			ATCTCGCGCTCGT	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.2744G>A	chr20.hg19:g.40085989C>T	ENSP00000362330:p.Arg915His	70.0	0.0		67.0	34.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	hg19	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933703	0.92458	.	.	ENSG00000124177	ENST00000373233	T	0.75821	-0.97	5.42	5.42	0.78866	Helicase, C-terminal (1);	0.000000	0.51477	D	0.000088	T	0.80031	0.4549	N	0.21142	0.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82534	-0.0409	10	0.87932	D	0	-18.213	19.5951	0.95533	0.0:1.0:0.0:0.0	.	915	Q8TD26	CHD6_HUMAN	H	915	ENSP00000362330:R915H	ENSP00000362330:R915H	R	-	2	0	CHD6	39519403	1.000000	0.71417	0.998000	0.56505	0.453000	0.32348	7.729000	0.84864	2.705000	0.92388	0.591000	0.81541	CGC	.	.		0.552	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
MED14	9282	hgsc.bcm.edu	37	X	40562816	40562816	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chrX:40562816T>C	ENST00000324817.1	-	11	1409	c.1291A>G	c.(1291-1293)Ata>Gta	p.I431V		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	431	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GCAGTCTCTATGGAAGCTGAA	0.338																																					p.I431V		Atlas-SNP	.											.	MED14	108	.	0			c.A1291G						.						45.0	40.0	42.0					X																	40562816		2203	4300	6503	SO:0001583	missense	9282	exon11			TCTCTATGGAAGC	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.1291A>G	chrX.hg19:g.40562816T>C	ENSP00000323720:p.Ile431Val	214.0	0.0		153.0	88.0	NM_004229	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	hg19	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	T	9.951	1.220037	0.22373	.	.	ENSG00000180182	ENST00000324817	T	0.39406	1.08	5.57	5.57	0.84162	.	0.040402	0.85682	D	0.000000	T	0.26011	0.0634	N	0.17082	0.46	0.58432	D	0.99999	B	0.02656	0.0	B	0.06405	0.002	T	0.08391	-1.0724	10	0.31617	T	0.26	.	9.3415	0.38082	0.0:0.0809:0.0:0.9191	.	431	O60244	MED14_HUMAN	V	431	ENSP00000323720:I431V	ENSP00000323720:I431V	I	-	1	0	MED14	40447760	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.971000	0.70440	1.866000	0.54105	0.437000	0.28790	ATA	.	.		0.338	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060692.1	NM_004229	
KLHL13	90293	hgsc.bcm.edu	37	X	117053617	117053617	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chrX:117053617C>T	ENST00000262820.3	-	4	1346	c.437G>A	c.(436-438)aGg>aAg	p.R146K	KLHL13_ENST00000371878.1_Missense_Mutation_p.R95K|KLHL13_ENST00000540167.1_Missense_Mutation_p.R130K|KLHL13_ENST00000539496.1_Missense_Mutation_p.R149K|KLHL13_ENST00000371882.1_Missense_Mutation_p.R95K|KLHL13_ENST00000469946.1_Missense_Mutation_p.R95K|KLHL13_ENST00000371876.1_Missense_Mutation_p.R95K|KLHL13_ENST00000545703.1_Missense_Mutation_p.R104K|KLHL13_ENST00000541812.1_Missense_Mutation_p.R130K	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	146	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)				NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						AATAATTTTCCTTAGACCGAC	0.353																																					p.R149K		Atlas-SNP	.											.	KLHL13	87	.	0			c.G446A						.						68.0	69.0	69.0					X																	117053617		2203	4300	6503	SO:0001583	missense	90293	exon5			ATTTTCCTTAGAC	AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.437G>A	chrX.hg19:g.117053617C>T	ENSP00000262820:p.Arg146Lys	168.0	0.0		113.0	66.0	NM_001168299	B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Missense_Mutation	SNP	ENST00000262820.3	hg19	CCDS14571.1	.	.	.	.	.	.	.	.	.	.	C	0.135	-1.109328	0.01813	.	.	ENSG00000003096	ENST00000371882;ENST00000371876;ENST00000371878;ENST00000447671;ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820;ENST00000545703;ENST00000469946	T;T;T;T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.21	4.27	0.50696	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.098404	0.64402	N	0.000002	T	0.26011	0.0634	N	0.01640	-0.785	0.29187	N	0.876121	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.001	T	0.16247	-1.0409	10	0.10636	T	0.68	.	3.568	0.07907	0.0:0.3964:0.0:0.6036	.	130;149;140;146	Q9P2N7-3;Q9P2N7-5;Q9P2N7-4;Q9P2N7	.;.;.;KLH13_HUMAN	K	95;95;95;95;130;130;149;146;104;95	ENSP00000360949:R95K;ENSP00000360943:R95K;ENSP00000360945:R95K;ENSP00000412640:R95K;ENSP00000444450:R130K;ENSP00000441029:R130K;ENSP00000443191:R149K;ENSP00000262820:R146K;ENSP00000440707:R104K;ENSP00000419803:R95K	ENSP00000262820:R146K	R	-	2	0	KLHL13	116937645	1.000000	0.71417	0.987000	0.45799	0.003000	0.03518	4.943000	0.63554	1.042000	0.40150	0.506000	0.49869	AGG	.	.		0.353	KLHL13-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_033495	
MT-CO1	4512	hgsc.bcm.edu	37	M	5970	5970	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chrM:5970G>A	ENST00000361624.2	+	1	67	c.67G>A	c.(67-69)Ggc>Agc	p.G23S	MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	23					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACCTATTATTCGGCGCATGAG	0.507																																					p.G23S		Atlas-SNP	.											.	.	.	.	0			c.G67A						.																																			SO:0001583	missense	5742	exon1			TTATTCGGCGCAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.67G>A	chrM.hg19:g.5970G>A	ENSP00000354499:p.Gly23Ser	47.0	0.0		16.0	10.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.507	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
RIPK2	8767	hgsc.bcm.edu	37	8	90796369	90796370	+	Splice_Site	INS	-	-	AAAA	rs200269713|rs200988597|rs377038313|rs398008705|rs374266923|rs560035192|rs71268283	byFrequency	TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr8:90796369_90796370insAAAA	ENST00000220751.4	+	8	1343		c.e8+2		RIPK2_ENST00000540020.1_Splice_Site	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2						activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			CCACAAGAGGTaaaaaaaaaaa	0.297																																					.		Atlas-INDEL	.											.	RIPK2	37	.	0			c.1029+2->AAAA						.																																			SO:0001630	splice_region_variant	8767	exon8			.	AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.1029+2->AAAA	chr8.hg19:g.90796374_90796377dupAAAA		75.0	0.0		136.0	13.0	NM_003821	B7Z748|Q6UWF0	Splice_Site	INS	ENST00000220751.4	hg19	CCDS6247.1																																																																																			.	.		0.297	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375686.1		Intron
PDGFC	56034	hgsc.bcm.edu	37	4	157892010	157892019	+	Frame_Shift_Del	DEL	GGCCGGCCAG	GGCCGGCCAG	-	rs200141022		TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	GGCCGGCCAG	GGCCGGCCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr4:157892010_157892019delGGCCGGCCAG	ENST00000502773.1	-	1	527_536	c.37_46delCTGGCCGGCC	c.(37-48)ctggccggccagfs	p.LAGQ13fs	PDGFC_ENST00000541126.1_5'UTR|PDGFC_ENST00000422544.2_Frame_Shift_Del_p.LAGQ13fs	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	13					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		CCCTGTCTCTGGCCGGCCAGGGCAGATGTC	0.581											OREG0016375	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.13_16del		Atlas-Indel,Pindel	.											.	PDGFC	46	.	0			c.38_47del						.																																			SO:0001589	frameshift_variant	56034	exon1			.	AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.37_46delCTGGCCGGCC	chr4.hg19:g.157892010_157892019delGGCCGGCCAG	ENSP00000422464:p.Leu13fs	71.0	0.0	1789	43.0	11.0	NM_016205	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Frame_Shift_Del	DEL	ENST00000502773.1	hg19	CCDS3795.1																																																																																			.	.		0.581	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366123.1		
ARAP1	116985	hgsc.bcm.edu	37	11	72406835	72406836	+	Frame_Shift_Ins	INS	-	-	TGGGA			TCGA-RC-A6M3-01A-11D-A32G-10	TCGA-RC-A6M3-10A-01D-A32G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	00fb960e-81b6-45ea-bf27-b39c7dcdce6a	58134b29-9c26-4b08-8b60-e053d9564b76	g.chr11:72406835_72406836insTGGGA	ENST00000393609.3	-	24	3549_3550	c.3347_3348insTCCCA	c.(3346-3348)cagfs	p.Q1116fs	ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000455638.2_Frame_Shift_Ins_p.Q1116fs|ARAP1_ENST00000393605.3_Frame_Shift_Ins_p.Q876fs|ARAP1_ENST00000359373.5_Frame_Shift_Ins_p.Q1116fs|ARAP1_ENST00000426523.1_Frame_Shift_Ins_p.Q871fs|ARAP1_ENST00000334211.8_Frame_Shift_Ins_p.Q871fs|ARAP1_ENST00000429686.1_Frame_Shift_Ins_p.Q810fs	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1116	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						GCCCATCTGTCTGGAAGAGCGT	0.564																																					p.Q1116fs	Ovarian(102;1198 1520 13195 17913 37529)	Atlas-Indel,Pindel	.											.	ARAP1	168	.	0			c.3348_3349insTCCCA						.																																			SO:0001589	frameshift_variant	116985	exon24			.	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3347_3348insTCCCA	chr11.hg19:g.72406835_72406836insTGGGA	ENSP00000377233:p.Gln1116fs	62.0	0.0		43.0	20.0	NM_001040118	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Frame_Shift_Ins	INS	ENST00000393609.3	hg19	CCDS41687.1																																																																																			.	.		0.564	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347428.1	NM_001040118	
