#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIAA1522	57648	hgsc.bcm.edu	37	1	33235673	33235673	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr1:33235673G>T	ENST00000373480.1	+	6	819	c.716G>T	c.(715-717)cGt>cTt	p.R239L	KIAA1522_ENST00000373481.3_Missense_Mutation_p.R250L|KIAA1522_ENST00000401073.2_Missense_Mutation_p.R298L|KIAA1522_ENST00000294521.3_Intron	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	239										breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CACATTGACCGTGTCTACCGG	0.682																																					p.R298L		Atlas-SNP	.											.	KIAA1522	68	.	0			c.G893T						.						31.0	37.0	35.0					1																	33235673		2060	4198	6258	SO:0001583	missense	57648	exon6			TTGACCGTGTCTA	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.716G>T	chr1.hg19:g.33235673G>T	ENSP00000362579:p.Arg239Leu	36.0	0.0		37.0	17.0	NM_020888	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	hg19	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452297	0.43531	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.34667	1.35;1.35;1.35	4.47	3.52	0.40303	.	0.197037	0.33382	N	0.004971	T	0.51227	0.1662	L	0.50333	1.59	0.32657	N	0.518551	D;D;D	0.65815	0.975;0.988;0.995	P;P;D	0.64506	0.767;0.86;0.926	T	0.64592	-0.6371	10	0.62326	D	0.03	-1.2713	14.4256	0.67212	0.0:0.1489:0.8511:0.0	.	250;239;298	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	L	298;250;239	ENSP00000383851:R298L;ENSP00000362580:R250L;ENSP00000362579:R239L	ENSP00000362579:R239L	R	+	2	0	KIAA1522	33008260	0.008000	0.16893	0.479000	0.27329	0.888000	0.51559	0.356000	0.20181	0.953000	0.37825	0.491000	0.48974	CGT	.	.		0.682	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
MACF1	23499	hgsc.bcm.edu	37	1	39748038	39748038	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr1:39748038C>A	ENST00000372915.3	+	6	789	c.702C>A	c.(700-702)caC>caA	p.H234Q	MACF1_ENST00000317713.7_Missense_Mutation_p.H234Q|MACF1_ENST00000564288.1_Missense_Mutation_p.H229Q|MACF1_ENST00000539005.1_Missense_Mutation_p.H234Q|MACF1_ENST00000545844.1_Missense_Mutation_p.H234Q|MACF1_ENST00000361689.2_Missense_Mutation_p.H234Q|MACF1_ENST00000536367.1_Missense_Mutation_p.H197Q|MACF1_ENST00000567887.1_Missense_Mutation_p.H266Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	234	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CACTCATTCACCGATACCGGT	0.438																																					p.H234Q		Atlas-SNP	.											.	MACF1	909	.	0			c.C702A						.						103.0	91.0	95.0					1																	39748038		2203	4300	6503	SO:0001583	missense	23499	exon8			CATTCACCGATAC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.702C>A	chr1.hg19:g.39748038C>A	ENSP00000362006:p.His234Gln	62.0	0.0		50.0	16.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.	.	.	.	.	.	.	.	.	.	C	19.21	3.783365	0.70222	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000404645;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000536367;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79;-3.79;-3.79;-3.79;-3.79	5.78	2.95	0.34219	.	.	.	.	.	D	0.98046	0.9356	H	0.94886	3.595	0.80722	D	1	D;B;D	0.89917	1.0;0.007;1.0	D;B;D	0.91635	0.999;0.001;0.968	D	0.97644	1.0150	9	0.87932	D	0	.	11.0288	0.47761	0.0:0.8001:0.0:0.1999	.	197;234;199	B4E2T3;F8W8Q1;Q9UPN3-3	.;.;.	Q	234;234;234;250;234;234;192;197;383;394	ENSP00000439537:H234Q;ENSP00000362006:H234Q;ENSP00000354573:H234Q;ENSP00000313438:H234Q;ENSP00000444364:H234Q;ENSP00000435070:H192Q;ENSP00000440369:H197Q;ENSP00000437059:H383Q	ENSP00000313438:H234Q	H	+	3	2	MACF1	39520625	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	3.372000	0.52387	0.383000	0.24910	-0.142000	0.14014	CAC	.	.		0.438	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
ROR1	4919	hgsc.bcm.edu	37	1	64643503	64643503	+	Silent	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr1:64643503G>T	ENST00000371079.1	+	9	2154	c.1779G>T	c.(1777-1779)ctG>ctT	p.L593L	ROR1_ENST00000545203.1_Silent_p.L44L	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	593	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						GAGATTTTCTGCACATTGCAA	0.478																																					p.L593L		Atlas-SNP	.											.	ROR1	113	.	0			c.G1779T						.						71.0	74.0	73.0					1																	64643503		2203	4300	6503	SO:0001819	synonymous_variant	4919	exon9			TTTTCTGCACATT	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.1779G>T	chr1.hg19:g.64643503G>T		56.0	0.0		48.0	19.0	NM_005012	Q5VVX6|Q66K77|Q92776	Silent	SNP	ENST00000371079.1	hg19	CCDS626.1																																																																																			.	.		0.478	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
USF1	7391	hgsc.bcm.edu	37	1	161011514	161011514	+	Silent	SNP	C	C	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr1:161011514C>A	ENST00000368021.3	-	6	603	c.399G>T	c.(397-399)tcG>tcT	p.S133S	TSTD1_ENST00000318289.10_5'Flank|TSTD1_ENST00000466967.1_5'Flank|TSTD1_ENST00000368024.1_5'Flank|F11R_ENST00000289779.3_5'Flank|USF1_ENST00000368020.1_Silent_p.S133S|TSTD1_ENST00000368023.3_5'Flank|USF1_ENST00000435396.1_Silent_p.S74S|TSTD1_ENST00000423014.2_5'Flank|USF1_ENST00000368019.1_Intron	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	133					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			CTGTACTCCCCGATGTGGTAC	0.597											OREG0013936	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S133S		Atlas-SNP	.											.	USF1	29	.	0			c.G399T						.						84.0	79.0	81.0					1																	161011514		2203	4300	6503	SO:0001819	synonymous_variant	7391	exon6			ACTCCCCGATGTG	BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.399G>T	chr1.hg19:g.161011514C>A		53.0	0.0	1813	48.0	28.0	NM_001276373	B2RBZ4|Q5SY46|Q7Z5Y1	Silent	SNP	ENST00000368021.3	hg19	CCDS1214.1																																																																																			.	.		0.597	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077050.1	NM_007122	
RAB3GAP2	25782	hgsc.bcm.edu	37	1	220406191	220406191	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr1:220406191A>C	ENST00000358951.2	-	2	246	c.130T>G	c.(130-132)Tgg>Ggg	p.W44G		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	44					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TCATCTTCCCAGTCTGTTGAT	0.328																																					p.W44G		Atlas-SNP	.											.	RAB3GAP2	120	.	0			c.T130G						.						186.0	170.0	176.0					1																	220406191		2203	4300	6503	SO:0001583	missense	25782	exon2			CTTCCCAGTCTGT	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.130T>G	chr1.hg19:g.220406191A>C	ENSP00000351832:p.Trp44Gly	219.0	0.0		174.0	76.0	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	hg19	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	A	19.83	3.899327	0.72754	.	.	ENSG00000118873	ENST00000358951	T	0.59224	0.28	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.62901	0.2466	N	0.22421	0.69	0.53005	D	0.999963	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.964	T	0.66988	-0.5784	10	0.72032	D	0.01	.	12.2973	0.54854	1.0:0.0:0.0:0.0	.	44;44	Q9H2M9-2;Q9H2M9	.;RBGPR_HUMAN	G	44	ENSP00000351832:W44G	ENSP00000351832:W44G	W	-	1	0	RAB3GAP2	218472814	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.023000	0.64084	2.224000	0.72417	0.533000	0.62120	TGG	.	.		0.328	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
SNTG2	54221	hgsc.bcm.edu	37	2	1204797	1204797	+	Silent	SNP	G	G	T	rs141600263		TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr2:1204797G>T	ENST00000308624.5	+	9	729	c.600G>T	c.(598-600)tcG>tcT	p.S200S	SNTG2_ENST00000467759.1_3'UTR|SNTG2_ENST00000407292.1_Silent_p.S73S	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	200			S -> L (in dbSNP:rs6751090).		central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		AGGCCCCATCGTCACCTTCCT	0.572																																					p.S200S		Atlas-SNP	.											.	SNTG2	125	.	0			c.G600T						.						69.0	76.0	74.0					2																	1204797		2091	4237	6328	SO:0001819	synonymous_variant	54221	exon9			CCCATCGTCACCT	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.600G>T	chr2.hg19:g.1204797G>T		58.0	0.0		24.0	12.0	NM_018968	Q05AH5	Silent	SNP	ENST00000308624.5	hg19	CCDS46220.1																																																																																			.	G|1.000;A|0.000		0.572	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	
CHRNA1	1134	hgsc.bcm.edu	37	2	175624301	175624301	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr2:175624301T>G	ENST00000261007.5	-	2	170	c.104A>C	c.(103-105)tAc>tCc	p.Y35S	CHRNA1_ENST00000348749.5_Missense_Mutation_p.Y35S|CHRNA1_ENST00000409542.1_Missense_Mutation_p.Y35S|CHRNA1_ENST00000409323.1_Missense_Mutation_p.Y35S|CHRNA1_ENST00000409219.1_Missense_Mutation_p.Y35S|AC018890.6_ENST00000442996.1_RNA	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	35					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CACGCTGCTGTAGTCTTTAAA	0.567																																					p.Y35S		Atlas-SNP	.											.	CHRNA1	92	.	0			c.A104C						.						112.0	110.0	111.0					2																	175624301		2203	4300	6503	SO:0001583	missense	1134	exon2			CTGCTGTAGTCTT	Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.104A>C	chr2.hg19:g.175624301T>G	ENSP00000261007:p.Tyr35Ser	38.0	0.0		33.0	9.0	NM_001039523	B4DRV6|D3DPE8	Missense_Mutation	SNP	ENST00000261007.5	hg19	CCDS33331.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.997709	0.93227	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	D;D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85;-2.85	5.91	5.91	0.95273	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.96741	0.8936	H	0.94264	3.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97766	1.0223	10	0.87932	D	0	.	16.3426	0.83092	0.0:0.0:0.0:1.0	.	35;35;35	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	S	35	ENSP00000261008:Y35S;ENSP00000261007:Y35S;ENSP00000387026:Y35S;ENSP00000386611:Y35S;ENSP00000386684:Y35S	ENSP00000261007:Y35S	Y	-	2	0	CHRNA1	175332547	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	7.988000	0.88194	2.263000	0.75096	0.379000	0.24179	TAC	.	.		0.567	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334116.1		
NBEAL1	65065	hgsc.bcm.edu	37	2	204009591	204009591	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr2:204009591G>T	ENST00000449802.1	+	31	5363	c.5030G>T	c.(5029-5031)tGt>tTt	p.C1677F		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1677										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CAAGAATATTGTAATTCAAAT	0.289																																					p.C1677F		Atlas-SNP	.											.	NBEAL1	266	.	0			c.G5030T						.						58.0	50.0	52.0					2																	204009591		1799	4067	5866	SO:0001583	missense	65065	exon31			AATATTGTAATTC	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.5030G>T	chr2.hg19:g.204009591G>T	ENSP00000399903:p.Cys1677Phe	103.0	0.0		81.0	29.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.591662	0.66219	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.59638	0.25	5.8	5.8	0.92144	.	0.092035	0.85682	D	0.000000	T	0.69305	0.3096	M	0.76574	2.34	0.58432	D	0.999997	D;D	0.54397	0.966;0.966	P;P	0.49665	0.618;0.618	T	0.73452	-0.3978	10	0.87932	D	0	.	19.6495	0.95795	0.0:0.0:1.0:0.0	.	1677;1666	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	F	1677	ENSP00000399903:C1677F	ENSP00000344985:C1677F	C	+	2	0	NBEAL1	203717836	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.502000	0.81614	2.748000	0.94277	0.655000	0.94253	TGT	.	.		0.289	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
TTLL4	9654	hgsc.bcm.edu	37	2	219614829	219614829	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr2:219614829A>G	ENST00000392102.1	+	15	3173	c.2833A>G	c.(2833-2835)Atc>Gtc	p.I945V	TTLL4_ENST00000258398.4_Missense_Mutation_p.I945V|TTLL4_ENST00000457313.1_Missense_Mutation_p.I780V|TTLL4_ENST00000442769.1_Missense_Mutation_p.I881V	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	945	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TGCAGAGGATATCATTTCCAG	0.532																																					p.I945V	GBM(172;1818 2053 15407 20943 49753)	Atlas-SNP	.											.	TTLL4	96	.	0			c.A2833G						.						134.0	128.0	130.0					2																	219614829		2203	4300	6503	SO:0001583	missense	9654	exon15			GAGGATATCATTT		CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.2833A>G	chr2.hg19:g.219614829A>G	ENSP00000375951:p.Ile945Val	61.0	0.0		42.0	14.0	NM_014640	A8K6V5|Q8WW29	Missense_Mutation	SNP	ENST00000392102.1	hg19	CCDS2422.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.691|0.691	-0.794509|-0.794509	0.02862|0.02862	.|.	.|.	ENSG00000135912|ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398|ENST00000436668	T;T;T;T|.	0.03920|.	3.99;4.22;3.76;4.22|.	4.95|4.95	-4.9|-4.9	0.03094|0.03094	.|.	1.054690|.	0.07303|.	N|.	0.874420|.	T|T	0.27063|0.27063	0.0663|0.0663	N|N	0.16266|0.16266	0.395|0.395	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.25850|.	0.0;0.0;0.136;0.0|.	B;B;B;B|.	0.26094|.	0.002;0.004;0.066;0.001|.	T|T	0.29274|0.29274	-1.0017|-1.0017	10|5	0.02654|.	T|.	1|.	.|.	13.8909|13.8909	0.63738|0.63738	0.4219:0.0:0.5781:0.0|0.4219:0.0:0.5781:0.0	.|.	148;780;881;945|.	B4DJF5;E9PH58;E7EX20;Q14679|.	.;.;.;TTLL4_HUMAN|.	V|C	780;945;881;945|89	ENSP00000393332:I780V;ENSP00000375951:I945V;ENSP00000396555:I881V;ENSP00000258398:I945V|.	ENSP00000258398:I945V|.	I|Y	+|+	1|2	0|0	TTLL4|TTLL4	219323073|219323073	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.940000|0.940000	0.58332|0.58332	-0.306000|-0.306000	0.08178|0.08178	-0.826000|-0.826000	0.04284|0.04284	-0.137000|-0.137000	0.14449|0.14449	ATC|TAT	.	.		0.532	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256726.1	NM_014640	
FYCO1	79443	hgsc.bcm.edu	37	3	46000930	46000930	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr3:46000930T>C	ENST00000296137.2	-	12	3747	c.3542A>G	c.(3541-3543)gAc>gGc	p.D1181G	FYCO1_ENST00000438446.1_5'Flank|FYCO1_ENST00000535325.1_Missense_Mutation_p.D1181G	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1181					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CCGCTTACAGTCGAGGCAGTG	0.607																																					p.D1181G		Atlas-SNP	.											.	FYCO1	115	.	0			c.A3542G						.						98.0	86.0	90.0					3																	46000930		2203	4300	6503	SO:0001583	missense	79443	exon12			TTACAGTCGAGGC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3542A>G	chr3.hg19:g.46000930T>C	ENSP00000296137:p.Asp1181Gly	89.0	0.0		48.0	14.0	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	hg19	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.386405	0.42308	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.71698	-0.59;-0.59	4.94	4.94	0.65067	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.069340	0.64402	D	0.000007	T	0.70649	0.3248	N	0.12961	0.28	0.42524	D	0.99301	D;P	0.89917	1.0;0.681	D;B	0.91635	0.999;0.324	T	0.71148	-0.4677	10	0.31617	T	0.26	-30.1794	13.1792	0.59645	0.0:0.0:0.0:1.0	.	1181;1181	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	G	1181	ENSP00000296137:D1181G;ENSP00000441178:D1181G	ENSP00000296137:D1181G	D	-	2	0	FYCO1	45975934	1.000000	0.71417	0.992000	0.48379	0.741000	0.42261	2.001000	0.40825	1.863000	0.54032	0.533000	0.62120	GAC	.	.		0.607	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
CADPS	8618	hgsc.bcm.edu	37	3	62467525	62467525	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr3:62467525G>T	ENST00000383710.4	-	22	3395	c.3046C>A	c.(3046-3048)Ccc>Acc	p.P1016T	CADPS_ENST00000283269.9_Intron|CADPS_ENST00000357948.3_Intron	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1016	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TTCACATTGGGTAGGTTACTG	0.433																																					p.P1016T		Atlas-SNP	.											.	CADPS	387	.	0			c.C3046A						.						222.0	210.0	214.0					3																	62467525		1900	4135	6035	SO:0001583	missense	8618	exon22			CATTGGGTAGGTT	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3046C>A	chr3.hg19:g.62467525G>T	ENSP00000373215:p.Pro1016Thr	164.0	0.0		110.0	34.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	hg19	CCDS46858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.73|17.73	3.460924|3.460924	0.63513|0.63513	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000383709;ENST00000383710|ENST00000473635	T|.	0.31769|.	1.48|.	5.28|5.28	5.28|5.28	0.74379|0.74379	Munc13 homology 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.65811|.	0.2727|.	L|L	0.38838|0.38838	1.175|1.175	0.80722|0.80722	D|D	1|1	P|.	0.38395|.	0.629|.	B|.	0.39185|.	0.293|.	T|.	0.60707|.	-0.7210|.	10|.	0.72032|.	D|.	0.01|.	.|.	19.2786|19.2786	0.94042|0.94042	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1016|.	Q9ULU8|.	CAPS1_HUMAN|.	T|X	1016|2	ENSP00000373215:P1016T|.	ENSP00000373214:P1016T|.	P|Y	-|-	1|3	0|2	CADPS|CADPS	62442565|62442565	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.375000|9.375000	0.97178|0.97178	2.641000|2.641000	0.89580|0.89580	0.563000|0.563000	0.77884|0.77884	CCC|TAC	.	.		0.433	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
EGF	1950	hgsc.bcm.edu	37	4	110925746	110925746	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr4:110925746G>T	ENST00000265171.5	+	22	3704	c.3259G>T	c.(3259-3261)Gag>Tag	p.E1087*	EGF_ENST00000509793.1_Nonsense_Mutation_p.E1045*|EGF_ENST00000503392.1_Nonsense_Mutation_p.E1046*	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	1087					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	TGCTGACACTGAGGATGGGAT	0.453																																					p.E1087X		Atlas-SNP	.											.	EGF	113	.	0			c.G3259T						.						114.0	105.0	108.0					4																	110925746		2203	4300	6503	SO:0001587	stop_gained	1950	exon22			GACACTGAGGATG	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.3259G>T	chr4.hg19:g.110925746G>T	ENSP00000265171:p.Glu1087*	46.0	0.0		38.0	11.0	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Nonsense_Mutation	SNP	ENST00000265171.5	hg19	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	G	39	7.909228	0.98557	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	.	.	.	4.2	3.35	0.38373	.	0.679812	0.12713	N	0.445348	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	8.14	0.31078	0.1112:0.0:0.8888:0.0	.	.	.	.	X	1045;1087;1046	.	ENSP00000265171:E1087X	E	+	1	0	EGF	111145195	0.355000	0.24921	0.010000	0.14722	0.017000	0.09413	1.542000	0.36137	1.097000	0.41459	0.650000	0.86243	GAG	.	.		0.453	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
TLL1	7092	hgsc.bcm.edu	37	4	166981307	166981307	+	Silent	SNP	G	G	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr4:166981307G>A	ENST00000061240.2	+	15	2621	c.1974G>A	c.(1972-1974)gtG>gtA	p.V658V	TLL1_ENST00000507499.1_Silent_p.V681V	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	658	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GAATTTCTGTGAAGTTTGAGT	0.413																																					p.V658V		Atlas-SNP	.											.	TLL1	194	.	0			c.G1974A						.						95.0	97.0	97.0					4																	166981307		2203	4300	6503	SO:0001819	synonymous_variant	7092	exon15			TTCTGTGAAGTTT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1974G>A	chr4.hg19:g.166981307G>A		95.0	0.0		54.0	17.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	ENST00000061240.2	hg19	CCDS3811.1																																																																																			.	.		0.413	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
SPCS3	60559	hgsc.bcm.edu	37	4	177241334	177241334	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr4:177241334G>A	ENST00000503362.1	+	1	220	c.107G>A	c.(106-108)aGc>aAc	p.S36N	RP11-87F15.2_ENST00000512634.1_RNA	NM_021928.3	NP_068747.1	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3 homolog (S. cerevisiae)	36					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			ovary(2)	2		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		AAAGACAGGAGCGTCCCGGTG	0.692																																					p.S36N		Atlas-SNP	.											.	SPCS3	15	.	0			c.G107A						.						39.0	46.0	44.0					4																	177241334		2014	4179	6193	SO:0001583	missense	60559	exon1			ACAGGAGCGTCCC	AK092634	CCDS54823.1	4q34.2	2008-02-05				ENSG00000129128			26212	protein-coding gene	gene with protein product						12477932	Standard	NM_021928		Approved	FLJ22649, SPC22/23, SPC3, YLR066W, PRO3567	uc003iur.4	P61009		ENST00000503362.1:c.107G>A	chr4.hg19:g.177241334G>A	ENSP00000427463:p.Ser36Asn	38.0	0.0		30.0	12.0	NM_021928	P12280|Q9H0S7	Missense_Mutation	SNP	ENST00000503362.1	hg19	CCDS54823.1	.	.	.	.	.	.	.	.	.	.	G	9.101	1.004234	0.19199	.	.	ENSG00000129128	ENST00000503362	.	.	.	3.11	3.11	0.35812	.	0.284907	0.39083	N	0.001467	T	0.42359	0.1199	L	0.38838	1.175	0.38828	D	0.955795	B	0.12630	0.006	B	0.23716	0.048	T	0.27872	-1.0061	9	0.18276	T	0.48	-4.2881	7.6483	0.28334	0.0:0.0:0.7472:0.2528	.	36	P61009	SPCS3_HUMAN	N	36	.	ENSP00000427463:S36N	S	+	2	0	SPCS3	177478328	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	4.516000	0.60496	1.702000	0.51228	0.455000	0.32223	AGC	.	.		0.692	SPCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362329.1	NM_021928	
FAM135A	57579	hgsc.bcm.edu	37	6	71243558	71243558	+	Splice_Site	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr6:71243558G>T	ENST00000418814.2	+	18	4579		c.e18+1		FAM135A_ENST00000370479.3_Splice_Site|FAM135A_ENST00000505769.1_Splice_Site|FAM135A_ENST00000361499.3_Splice_Site|FAM135A_ENST00000457062.2_Splice_Site|FAM135A_ENST00000505868.1_Splice_Site	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A											breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						CAAAAATAAGGTATCTTCTTT	0.264																																					.		Atlas-SNP	.											.	FAM135A	181	.	0			c.3377+1G>T						.						61.0	60.0	60.0					6																	71243558		2191	4268	6459	SO:0001630	splice_region_variant	57579	exon18			AATAAGGTATCTT	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.3965+1G>T	chr6.hg19:g.71243558G>T		65.0	0.0		63.0	16.0	NM_001105531	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Splice_Site	SNP	ENST00000418814.2	hg19	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.209065	0.79240	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000457062;ENST00000361499;ENST00000505868	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9956	0.92812	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM135A	71300279	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	9.711000	0.98735	2.553000	0.86117	0.557000	0.71058	.	.	.		0.264	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819	Intron
NME8	51314	hgsc.bcm.edu	37	7	37890296	37890296	+	Nonsense_Mutation	SNP	A	A	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr7:37890296A>T	ENST00000199447.4	+	5	529	c.157A>T	c.(157-159)Aaa>Taa	p.K53*	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Nonsense_Mutation_p.K53*	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	53	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										CAGAAAATTGAAAAATGAACT	0.318																																					p.K53X		Atlas-SNP	.											.	.	.	.	0			c.A157T						.						109.0	120.0	116.0					7																	37890296		2203	4300	6503	SO:0001587	stop_gained	51314	exon5			AAATTGAAAAATG	AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.157A>T	chr7.hg19:g.37890296A>T	ENSP00000199447:p.Lys53*	97.0	0.0		88.0	24.0	NM_016616	Q9NZH1	Nonsense_Mutation	SNP	ENST00000199447.4	hg19	CCDS5452.1	.	.	.	.	.	.	.	.	.	.	A	34	5.298407	0.95574	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	.	.	.	5.01	5.01	0.66863	.	0.214969	0.33127	N	0.005252	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.9391	13.9841	0.64324	1.0:0.0:0.0:0.0	.	.	.	.	X	53	.	ENSP00000199447:K53X	K	+	1	0	TXNDC3	37856821	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	6.394000	0.73223	2.007000	0.58848	0.459000	0.35465	AAA	.	.		0.318	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
CCAR2	57805	hgsc.bcm.edu	37	8	22471762	22471762	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr8:22471762G>C	ENST00000308511.4	+	9	1111	c.862G>C	c.(862-864)Gag>Cag	p.E288Q	RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000520861.1_5'UTR|CCAR2_ENST00000389279.3_Missense_Mutation_p.E288Q			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	288					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										TTCTGAAAAGGAGGCAGCTCC	0.537																																					p.E288Q		Atlas-SNP	.											.	KIAA1967	72	.	0			c.G862C						.						54.0	49.0	51.0					8																	22471762		2203	4300	6503	SO:0001583	missense	57805	exon9			GAAAAGGAGGCAG	AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.862G>C	chr8.hg19:g.22471762G>C	ENSP00000310670:p.Glu288Gln	70.0	0.0		23.0	15.0	NM_021174	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	ENST00000308511.4	hg19	CCDS34863.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736328	0.69189	.	.	ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000522599	T;T;T	0.47869	1.38;1.38;0.83	5.47	5.47	0.80525	.	0.068742	0.56097	D	0.000035	T	0.36663	0.0975	N	0.22421	0.69	0.80722	D	1	B	0.31153	0.31	B	0.34138	0.176	T	0.11966	-1.0566	10	0.17832	T	0.49	-20.8075	16.6012	0.84816	0.0:0.0:1.0:0.0	.	288	Q8N163	K1967_HUMAN	Q	288;288;106	ENSP00000310670:E288Q;ENSP00000373930:E288Q;ENSP00000429739:E106Q	ENSP00000310670:E288Q	E	+	1	0	KIAA1967	22527707	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.109000	0.89561	2.723000	0.93209	0.655000	0.94253	GAG	.	.		0.537	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375865.1	NM_021174	
ANK1	286	hgsc.bcm.edu	37	8	41552758	41552758	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr8:41552758T>C	ENST00000347528.4	-	27	3135	c.3052A>G	c.(3052-3054)Aag>Gag	p.K1018E	ANK1_ENST00000352337.4_Missense_Mutation_p.K1018E|ANK1_ENST00000265709.8_Missense_Mutation_p.K1059E|ANK1_ENST00000396942.1_Missense_Mutation_p.K1018E|ANK1_ENST00000289734.7_Missense_Mutation_p.K1018E|ANK1_ENST00000379758.2_Missense_Mutation_p.K1018E|ANK1_ENST00000396945.1_Missense_Mutation_p.K1018E	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1018	ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CTGTGCTCCTTCCACACGGAG	0.622																																					p.K1059E		Atlas-SNP	.											.	ANK1	497	.	0			c.A3175G						.						109.0	106.0	107.0					8																	41552758		2203	4300	6503	SO:0001583	missense	286	exon28			GCTCCTTCCACAC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.3052A>G	chr8.hg19:g.41552758T>C	ENSP00000339620:p.Lys1018Glu	43.0	0.0		21.0	17.0	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	ENST00000347528.4	hg19	CCDS6119.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.7|22.7	4.318432|4.318432	0.81469|0.81469	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000520299|ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	.|T;T;T;T;T;T;T	.|0.68479	.|-0.31;-0.32;-0.29;-0.27;-0.29;-0.28;-0.33	5.09|5.09	5.09|5.09	0.68999|0.68999	.|ZU5 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75236|0.75236	0.3822|0.3822	M|M	0.74467|0.74467	2.265|2.265	0.80722|0.80722	D|D	1|1	.|P;P;P;D;B;P	.|0.60160	.|0.462;0.838;0.899;0.987;0.325;0.66	.|B;B;B;P;B;P	.|0.52031	.|0.303;0.327;0.413;0.688;0.303;0.58	T|T	0.79921|0.79921	-0.1599|-0.1599	5|10	.|0.87932	.|D	.|0	.|.	14.87|14.87	0.70450|0.70450	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1059;1018;1018;1018;1018;334	.|P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.|.;.;ANK1_HUMAN;.;.;.	G|E	339|1018;1018;1018;1018;1018;1018;1059;1018	.|ENSP00000339620:K1018E;ENSP00000289734:K1018E;ENSP00000369082:K1018E;ENSP00000380149:K1018E;ENSP00000380147:K1018E;ENSP00000309131:K1018E;ENSP00000265709:K1059E	.|ENSP00000265709:K1059E	E|K	-|-	2|1	0|0	ANK1|ANK1	41671915|41671915	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.186000|6.186000	0.72026|0.72026	1.904000|1.904000	0.55121|0.55121	0.460000|0.460000	0.39030|0.39030	GAA|AAG	.	.		0.622	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
NOV	4856	hgsc.bcm.edu	37	8	120431544	120431544	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr8:120431544G>A	ENST00000259526.3	+	4	963	c.736G>A	c.(736-738)Gtg>Atg	p.V246M	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	1566	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			GCTCTGCATGGTGCGGCCCTG	0.557																																					p.V246M		Atlas-SNP	.											.	NOV	51	.	0			c.G736A						.						114.0	108.0	110.0					8																	120431544		2203	4300	6503	SO:0001583	missense	4856	exon4			TGCATGGTGCGGC	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.736G>A	chr8.hg19:g.120431544G>A	ENSP00000259526:p.Val246Met	24.0	0.0		84.0	18.0	NM_002514		Missense_Mutation	SNP	ENST00000259526.3	hg19	CCDS6328.1	.	.	.	.	.	.	.	.	.	.	G	18.25	3.583257	0.65992	.	.	ENSG00000136999	ENST00000259526	T	0.50277	0.75	5.96	5.96	0.96718	.	0.127113	0.56097	D	0.000028	T	0.52725	0.1752	M	0.65498	2.005	0.36443	D	0.865631	P	0.47762	0.9	P	0.45794	0.493	T	0.64106	-0.6485	10	0.59425	D	0.04	-23.9678	14.0108	0.64495	0.0772:0.0:0.9228:0.0	.	246	P48745	NOV_HUMAN	M	246	ENSP00000259526:V246M	ENSP00000259526:V246M	V	+	1	0	NOV	120500725	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.311000	0.51919	2.832000	0.97577	0.655000	0.94253	GTG	.	.		0.557	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514	
CFAP70	118491	hgsc.bcm.edu	37	10	75013758	75013758	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr10:75013758A>G	ENST00000310715.3	-	28	3461	c.3341T>C	c.(3340-3342)gTt>gCt	p.V1114A	MRPS16_ENST00000416782.2_5'Flank|TTC18_ENST00000394865.1_Missense_Mutation_p.V1084A|RP11-152N13.5_ENST00000457758.1_RNA|TTC18_ENST00000493787.1_5'UTR|DNAJC9-AS1_ENST00000440197.2_RNA|RP11-152N13.5_ENST00000457147.1_RNA|TTC18_ENST00000401621.2_Missense_Mutation_p.V1114A|TTC18_ENST00000355577.3_Missense_Mutation_p.V583A|MRPS16_ENST00000372945.3_5'Flank|RP11-152N13.5_ENST00000394864.2_RNA|MRPS16_ENST00000479005.1_5'Flank|TTC18_ENST00000340329.3_Missense_Mutation_p.V354A|MRPS16_ENST00000372940.3_5'Flank	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		1114						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TCCAAAGCCAACTGTTTCCTG	0.428																																					p.V1114A		Atlas-SNP	.											.	TTC18	106	.	0			c.T3341C						.						166.0	149.0	155.0					10																	75013758		2203	4300	6503	SO:0001583	missense	118491	exon28			AAGCCAACTGTTT																												ENST00000310715.3:c.3341T>C	chr10.hg19:g.75013758A>G	ENSP00000310829:p.Val1114Ala	69.0	0.0		41.0	25.0	NM_145170	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	ENST00000310715.3	hg19	CCDS7324.3	.	.	.	.	.	.	.	.	.	.	A	22.4	4.285467	0.80803	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000340329;ENST00000372928;ENST00000433268;ENST00000394865	T;T;T;T;T	0.52754	1.83;1.83;0.93;0.65;1.47	5.13	5.13	0.70059	.	0.078974	0.51477	D	0.000091	T	0.53498	0.1800	M	0.73962	2.25	0.39017	D	0.959676	P	0.50617	0.937	P	0.47827	0.558	T	0.59440	-0.7454	10	0.39692	T	0.17	-1.9903	11.2498	0.49020	1.0:0.0:0.0:0.0	.	1114	Q5T0N1	TTC18_HUMAN	A	1114;1114;1114;354;578;491;1084	ENSP00000310829:V1114A;ENSP00000384479:V1114A;ENSP00000343650:V354A;ENSP00000409527:V491A;ENSP00000378334:V1084A	ENSP00000310829:V1114A	V	-	2	0	TTC18	74683764	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	4.778000	0.62368	2.152000	0.67230	0.533000	0.62120	GTT	.	.		0.428	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
IDE	3416	hgsc.bcm.edu	37	10	94267913	94267913	+	Silent	SNP	A	A	G			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr10:94267913A>G	ENST00000265986.6	-	8	1166	c.1110T>C	c.(1108-1110)ttT>ttC	p.F370F		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	370					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TAAAAAACATAAAACCTCGGG	0.358																																					p.F370F		Atlas-SNP	.											.	IDE	77	.	0			c.T1110C						.						151.0	161.0	158.0					10																	94267913		2203	4300	6503	SO:0001819	synonymous_variant	3416	exon8			AAACATAAAACCT	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1110T>C	chr10.hg19:g.94267913A>G		170.0	0.0		111.0	41.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	ENST00000265986.6	hg19	CCDS7421.1																																																																																			.	.		0.358	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
PHRF1	57661	hgsc.bcm.edu	37	11	592654	592654	+	Silent	SNP	C	C	G			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr11:592654C>G	ENST00000264555.5	+	6	728	c.600C>G	c.(598-600)ctC>ctG	p.L200L	PHRF1_ENST00000533464.1_Silent_p.L196L|PHRF1_ENST00000416188.2_Silent_p.L200L|PHRF1_ENST00000413872.2_Silent_p.L199L	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	200					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GGCTTTTGCTCTGCGACGGCT	0.652																																					p.L200L		Atlas-SNP	.											.	PHRF1	188	.	0			c.C600G						.						116.0	134.0	128.0					11																	592654		2158	4246	6404	SO:0001819	synonymous_variant	57661	exon6			TTTGCTCTGCGAC	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.600C>G	chr11.hg19:g.592654C>G		40.0	0.0		26.0	8.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	ENST00000264555.5	hg19																																																																																				.	.		0.652	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
PRKRIR	5612	hgsc.bcm.edu	37	11	76063483	76063483	+	Silent	SNP	C	C	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr11:76063483C>T	ENST00000260045.3	-	5	816	c.711G>A	c.(709-711)caG>caA	p.Q237Q	PRKRIR_ENST00000531878.1_5'Flank	NM_004705.2	NP_004696.2	O43422	P52K_HUMAN	protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)	237					negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)|signal transduction (GO:0007165)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(4)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	25						TCTCTAGCATCTGCCTCTGCT	0.438																																					p.Q237Q		Atlas-SNP	.											.	PRKRIR	65	.	0			c.G711A						.						28.0	27.0	27.0					11																	76063483		2152	4177	6329	SO:0001819	synonymous_variant	5612	exon5			TAGCATCTGCCTC	AF007393	CCDS8243.1	11q13.5	2013-01-25			ENSG00000137492	ENSG00000137492		"""THAP (C2CH-type zinc finger) domain containing"""	9440	protein-coding gene	gene with protein product	"""THAP domain containing 12"""	607374				9447982	Standard	NM_004705		Approved	P52rIPK, DAP4, THAP12	uc001oxh.1	O43422	OTTHUMG00000165280	ENST00000260045.3:c.711G>A	chr11.hg19:g.76063483C>T		176.0	0.0		313.0	200.0	NM_004705	A8K728|Q17RY9|Q8WTW1|Q9Y3Z4	Silent	SNP	ENST00000260045.3	hg19	CCDS8243.1																																																																																			.	.		0.438	PRKRIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383188.1	NM_004705	
SC5D	6309	hgsc.bcm.edu	37	11	121177921	121177921	+	Silent	SNP	G	G	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr11:121177921G>A	ENST00000392789.2	+	5	837	c.600G>A	c.(598-600)ttG>ttA	p.L200L	SC5D_ENST00000534230.1_Silent_p.L200L|SC5D_ENST00000528991.1_3'UTR|SC5D_ENST00000264027.4_Silent_p.L200L	NM_001024956.2	NP_001020127.1	O75845	SC5D_HUMAN	sterol-C5-desaturase	200					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via lathosterol (GO:0033490)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	C-5 sterol desaturase activity (GO:0000248)|iron ion binding (GO:0005506)|lathosterol oxidase activity (GO:0050046)										TGTACATCTTGGTTAATATCT	0.378																																					p.L200L		Atlas-SNP	.											.	.	.	.	0			c.G600A						.						211.0	205.0	207.0					11																	121177921		2203	4299	6502	SO:0001819	synonymous_variant	6309	exon5			CATCTTGGTTAAT		CCDS8435.1	11q23.3	2013-03-04	2013-03-04	2013-03-04	ENSG00000109929	ENSG00000109929	1.14.21.6	"""Fatty acid hydroxylase domain containing"""	10547	protein-coding gene	gene with protein product	"""lathosterol oxidase"""	602286	"""sterol-C5-desaturase (fungal ERG3, delta-5-desaturase)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, fungal)-like"", ""sterol-C5-desaturase (ERG3 delta-5-desaturase homolog, S. cerevisiae)-like"""	SC5DL		8976377	Standard	NM_006918		Approved		uc001pxu.3	O75845	OTTHUMG00000166068	ENST00000392789.2:c.600G>A	chr11.hg19:g.121177921G>A		201.0	0.0		80.0	22.0	NM_001024956	O00119|Q6GTM5|Q9UK15	Silent	SNP	ENST00000392789.2	hg19	CCDS8435.1																																																																																			.	.		0.378	SC5D-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387702.1	NM_001024956	
KRT6B	3854	hgsc.bcm.edu	37	12	52845422	52845422	+	Silent	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr12:52845422G>T	ENST00000252252.3	-	1	488	c.441C>A	c.(439-441)ccC>ccA	p.P147P		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	147	Head.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		GCAGGTTGAGGGGAGTCAGGA	0.617																																					p.P147P		Atlas-SNP	.											.	KRT6B	90	.	0			c.C441A						.						116.0	150.0	139.0					12																	52845422		2201	4300	6501	SO:0001819	synonymous_variant	3854	exon1			GTTGAGGGGAGTC	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.441C>A	chr12.hg19:g.52845422G>T		187.0	0.0		114.0	34.0	NM_005555	P48669	Silent	SNP	ENST00000252252.3	hg19	CCDS8828.1																																																																																			.	.		0.617	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
E2F7	144455	hgsc.bcm.edu	37	12	77427753	77427753	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr12:77427753T>G	ENST00000322886.7	-	8	1428	c.1193A>C	c.(1192-1194)cAa>cCa	p.Q398P	E2F7_ENST00000416496.2_Missense_Mutation_p.Q398P	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	398					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						TGCACAGACTTGAATCTGGCC	0.443																																					p.Q398P		Atlas-SNP	.											.	E2F7	201	.	0			c.A1193C						.						106.0	96.0	99.0					12																	77427753		2203	4300	6503	SO:0001583	missense	144455	exon8			CAGACTTGAATCT	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.1193A>C	chr12.hg19:g.77427753T>G	ENSP00000323246:p.Gln398Pro	113.0	0.0		67.0	36.0	NM_203394	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	hg19	CCDS9016.1	.	.	.	.	.	.	.	.	.	.	T	11.62	1.692498	0.30052	.	.	ENSG00000165891	ENST00000322886;ENST00000416496;ENST00000550669	T;T;T	0.19532	2.4;2.14;2.15	6.17	1.03	0.20045	.	0.864831	0.10780	N	0.634984	T	0.17619	0.0423	M	0.62723	1.935	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.33803	-0.9854	10	0.27785	T	0.31	-1.8517	2.0996	0.03676	0.1237:0.1455:0.1459:0.5849	.	398	Q96AV8	E2F7_HUMAN	P	398	ENSP00000323246:Q398P;ENSP00000393639:Q398P;ENSP00000448245:Q398P	ENSP00000323246:Q398P	Q	-	2	0	E2F7	75951884	0.344000	0.24827	0.113000	0.21522	0.989000	0.77384	0.613000	0.24299	0.214000	0.20742	0.533000	0.62120	CAA	.	.		0.443	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871	
SPRY2	10253	hgsc.bcm.edu	37	13	80911669	80911669	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr13:80911669C>A	ENST00000377102.1	-	2	1149	c.172G>T	c.(172-174)Ggg>Tgg	p.G58W	SPRY2_ENST00000377104.3_Missense_Mutation_p.G58W|SPRY2_ENST00000540649.1_Missense_Mutation_p.G58W			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	58					bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		ACAGTAGGCCCCTCTGTGTAC	0.617																																					p.G58W		Atlas-SNP	.											.	SPRY2	28	.	0			c.G172T						.						102.0	100.0	101.0					13																	80911669		2203	4300	6503	SO:0001583	missense	10253	exon2			TAGGCCCCTCTGT	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.172G>T	chr13.hg19:g.80911669C>A	ENSP00000366306:p.Gly58Trp	95.0	0.0		42.0	21.0	NM_005842	B2R9J9|Q5T6Z7	Missense_Mutation	SNP	ENST00000377102.1	hg19	CCDS9463.1	.	.	.	.	.	.	.	.	.	.	C	17.21	3.331054	0.60853	.	.	ENSG00000136158	ENST00000377104;ENST00000377102;ENST00000541655;ENST00000540649	T;T;T	0.57273	0.41;0.41;0.41	5.44	4.6	0.57074	.	0.052372	0.85682	D	0.000000	T	0.63141	0.2486	M	0.72894	2.215	0.58432	D	0.999998	D	0.54047	0.964	P	0.54706	0.759	T	0.66960	-0.5791	10	0.87932	D	0	.	10.4188	0.44338	0.0:0.7928:0.1348:0.0723	.	58	O43597	SPY2_HUMAN	W	58	ENSP00000366308:G58W;ENSP00000366306:G58W;ENSP00000439027:G58W	ENSP00000366306:G58W	G	-	1	0	SPRY2	79809670	1.000000	0.71417	0.976000	0.42696	0.998000	0.95712	4.577000	0.60922	1.313000	0.45069	0.650000	0.86243	GGG	.	.		0.617	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		
LIPC	3990	hgsc.bcm.edu	37	15	58830682	58830682	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr15:58830682C>T	ENST00000356113.6	+	4	854	c.239C>T	c.(238-240)tCc>tTc	p.S80F	LIPC_ENST00000414170.3_Missense_Mutation_p.S80F|LIPC_ENST00000299022.5_Missense_Mutation_p.S80F|LIPC_ENST00000433326.2_Missense_Mutation_p.S80F			P11150	LIPC_HUMAN	lipase, hepatic	80					cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		TTCAACTCCTCCCTGCCTCTG	0.473																																					p.S80F		Atlas-SNP	.											.	LIPC	56	.	0			c.C239T						.						148.0	138.0	141.0					15																	58830682		2192	4292	6484	SO:0001583	missense	3990	exon2			ACTCCTCCCTGCC		CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.239C>T	chr15.hg19:g.58830682C>T	ENSP00000348425:p.Ser80Phe	80.0	0.0		44.0	11.0	NM_000236	A2RUB4|A8K9B6|O43571|P78529|Q99465	Missense_Mutation	SNP	ENST00000356113.6	hg19	CCDS10166.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500264	0.64298	.	.	ENSG00000166035	ENST00000356113;ENST00000414170;ENST00000299022;ENST00000433326	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	5.08	5.08	0.68730	Lipase, N-terminal (1);	0.114849	0.64402	D	0.000011	D	0.96984	0.9015	M	0.90870	3.155	0.21220	N	0.999753	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91873	0.5509	10	0.87932	D	0	.	18.6648	0.91485	0.0:1.0:0.0:0.0	.	80;80	E7EUK6;P11150	.;LIPC_HUMAN	F	80	ENSP00000348425:S80F;ENSP00000395569:S80F;ENSP00000299022:S80F;ENSP00000395002:S80F	ENSP00000299022:S80F	S	+	2	0	LIPC	56617974	0.965000	0.33210	0.388000	0.26195	0.851000	0.48451	3.191000	0.50981	2.632000	0.89209	0.514000	0.50259	TCC	.	.		0.473	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416209.1		
PDE8A	5151	hgsc.bcm.edu	37	15	85610299	85610299	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr15:85610299T>A	ENST00000310298.4	+	4	550	c.298T>A	c.(298-300)Tgt>Agt	p.C100S	PDE8A_ENST00000394553.1_Missense_Mutation_p.C100S|PDE8A_ENST00000339708.5_Missense_Mutation_p.C100S|PDE8A_ENST00000557819.2_3'UTR|PDE8A_ENST00000557957.1_Missense_Mutation_p.C28S			O60658	PDE8A_HUMAN	phosphodiesterase 8A	100					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	CTGCAGGGCATGTGAAAAAGC	0.383																																					p.C100S		Atlas-SNP	.											.	PDE8A	50	.	0			c.T298A						.						153.0	135.0	141.0					15																	85610299		2203	4299	6502	SO:0001583	missense	5151	exon3			AGGGCATGTGAAA	AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.298T>A	chr15.hg19:g.85610299T>A	ENSP00000311453:p.Cys100Ser	61.0	0.0		41.0	17.0	NM_173454	B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	ENST00000310298.4	hg19	CCDS10336.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.166748	0.78339	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.41758	0.99;0.99;0.99	4.79	4.79	0.61399	Signal transduction response regulator, receiver domain (1);	0.047145	0.85682	D	0.000000	T	0.56124	0.1964	L	0.50333	1.59	0.80722	D	1	P;D	0.89917	0.851;1.0	P;D	0.91635	0.493;0.999	T	0.52793	-0.8528	10	0.35671	T	0.21	.	12.6121	0.56556	0.0:0.0:0.0:1.0	.	100;100	O60658-2;O60658	.;PDE8A_HUMAN	S	100	ENSP00000311453:C100S;ENSP00000378056:C100S;ENSP00000340679:C100S	ENSP00000311453:C100S	C	+	1	0	PDE8A	83411303	1.000000	0.71417	0.984000	0.44739	0.996000	0.88848	7.180000	0.77674	2.136000	0.66102	0.533000	0.62120	TGT	.	.		0.383	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000309018.1	NM_002605	
NFAT5	10725	hgsc.bcm.edu	37	16	69689669	69689669	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr16:69689669T>C	ENST00000354436.2	+	5	1427	c.1109T>C	c.(1108-1110)gTc>gCc	p.V370A	NFAT5_ENST00000566899.1_Missense_Mutation_p.V294A|NFAT5_ENST00000349945.1_Missense_Mutation_p.V294A|NFAT5_ENST00000567239.1_Missense_Mutation_p.V388A|NFAT5_ENST00000393742.2_Missense_Mutation_p.V294A|NFAT5_ENST00000432919.1_Missense_Mutation_p.V388A	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	370	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						GTTATAGAAGTCGGCCTTGAT	0.403																																					p.V388A		Atlas-SNP	.											.	NFAT5	184	.	0			c.T1163C						.						124.0	116.0	118.0					16																	69689669		2198	4300	6498	SO:0001583	missense	10725	exon6			TAGAAGTCGGCCT	AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.1109T>C	chr16.hg19:g.69689669T>C	ENSP00000346420:p.Val370Ala	67.0	0.0		23.0	15.0	NM_001113178	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	ENST00000354436.2	hg19	CCDS10881.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.953608	0.92660	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.58	5.58	0.84498	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	L	0.47190	1.495	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.85130	0.984;0.984;0.997;0.972	T	0.66110	-0.6005	10	0.87932	D	0	-2.5899	15.7498	0.77976	0.0:0.0:0.0:1.0	.	388;370;388;294	A2RRB4;O94916;E9PHR7;O94916-2	.;NFAT5_HUMAN;.;.	A	388;388;294;370;294	ENSP00000396538:V388A;ENSP00000338806:V294A;ENSP00000346420:V370A;ENSP00000377343:V294A	ENSP00000338806:V294A	V	+	2	0	NFAT5	68247170	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.988000	0.88194	2.131000	0.65755	0.383000	0.25322	GTC	.	.		0.403	NFAT5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268952.2	NM_138714	
ABCC3	8714	hgsc.bcm.edu	37	17	48745041	48745041	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr17:48745041G>A	ENST00000285238.8	+	12	1638	c.1558G>A	c.(1558-1560)Ggt>Agt	p.G520S	ABCC3_ENST00000427699.1_Missense_Mutation_p.G520S	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	520	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CATCAGGCAGGGTGAGCTCCA	0.627																																					p.G520S		Atlas-SNP	.											.	ABCC3	138	.	0			c.G1558A						.						73.0	59.0	64.0					17																	48745041		2203	4300	6503	SO:0001583	missense	8714	exon12			AGGCAGGGTGAGC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1558G>A	chr17.hg19:g.48745041G>A	ENSP00000285238:p.Gly520Ser	38.0	0.0		29.0	11.0	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	hg19	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078803	0.36662	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.91351	-2.83;-2.49	4.1	-3.37	0.04898	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.969547	0.08502	N	0.936248	T	0.77329	0.4114	N	0.04994	-0.135	0.09310	N	1	B;B	0.13594	0.008;0.001	B;B	0.17433	0.018;0.004	T	0.62623	-0.6815	10	0.44086	T	0.13	0.8153	7.6537	0.28363	0.701:0.0:0.1718:0.1272	.	520;520	O15438;O15438-5	MRP3_HUMAN;.	S	520	ENSP00000395160:G520S;ENSP00000285238:G520S	ENSP00000285238:G520S	G	+	1	0	ABCC3	46100040	0.008000	0.16893	0.005000	0.12908	0.978000	0.69477	0.102000	0.15272	-0.765000	0.04645	0.543000	0.68304	GGT	.	.		0.627	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	
CD300C	10871	hgsc.bcm.edu	37	17	72540897	72540897	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr17:72540897A>T	ENST00000330793.1	-	2	611	c.251T>A	c.(250-252)aTc>aAc	p.I84N		NM_006678.3	NP_006669.1	Q08708	CLM6_HUMAN	CD300c molecule	84	Ig-like V-type.				cellular defense response (GO:0006968)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|skin(2)|upper_aerodigestive_tract(1)	21						ACTGTCCCTGATGGACACTCG	0.547																																					p.I84N	Esophageal Squamous(66;421 1121 20537 25337 27468)	Atlas-SNP	.											.	CD300C	41	.	0			c.T251A						.						232.0	175.0	194.0					17																	72540897		2203	4300	6503	SO:0001583	missense	10871	exon2			TCCCTGATGGACA	BC022279	CCDS11701.1	17q25.2	2014-05-15	2006-03-28		ENSG00000167850	ENSG00000167850		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	19320	protein-coding gene	gene with protein product		606786	"""CD300c antigen"""			1349532, 10746781	Standard	NM_006678		Approved	CMRF35, LIR, CMRF-35A, CMRF35A, IGSF16	uc002jky.2	Q08708	OTTHUMG00000067608	ENST00000330793.1:c.251T>A	chr17.hg19:g.72540897A>T	ENSP00000329507:p.Ile84Asn	96.0	0.0		50.0	15.0	NM_006678		Missense_Mutation	SNP	ENST00000330793.1	hg19	CCDS11701.1	.	.	.	.	.	.	.	.	.	.	A	13.40	2.225356	0.39300	.	.	ENSG00000167850	ENST00000330793	T	0.68025	-0.3	4.33	4.33	0.51752	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.47455	D	0.000232	D	0.84915	0.5578	H	0.94886	3.595	0.26518	N	0.974482	D	0.89917	1.0	D	0.97110	1.0	T	0.79024	-0.1972	10	0.87932	D	0	.	10.5252	0.44943	1.0:0.0:0.0:0.0	.	84	Q08708	CLM6_HUMAN	N	84	ENSP00000329507:I84N	ENSP00000329507:I84N	I	-	2	0	CD300C	70052492	1.000000	0.71417	1.000000	0.80357	0.053000	0.15095	2.521000	0.45563	1.920000	0.55613	0.454000	0.30748	ATC	.	.		0.547	CD300C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145084.1	NM_006678	
ZBTB14	7541	hgsc.bcm.edu	37	18	5291933	5291933	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr18:5291933A>T	ENST00000357006.4	-	4	612	c.274T>A	c.(274-276)Tac>Aac	p.Y92N	ZBTB14_ENST00000400143.3_Missense_Mutation_p.Y92N	NM_001143823.2|NM_001243704.1	NP_001137295.1|NP_001230633.1	O43829	ZBT14_HUMAN	zinc finger and BTB domain containing 14	92	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)										GTGTACATGTAGTTCAGGACC	0.348																																					p.Y92N		Atlas-SNP	.											.	.	.	.	0			c.T274A						.						99.0	105.0	103.0					18																	5291933		2203	4300	6503	SO:0001583	missense	7541	exon4			ACATGTAGTTCAG	D89859	CCDS11837.1	18p11.31	2013-09-19	2013-01-08	2013-01-08	ENSG00000198081	ENSG00000198081		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12860	protein-coding gene	gene with protein product		602126	"""zinc finger protein 161 homolog (mouse)"", ""zinc finger protein 161"", ""ZFP161 zinc finger protein"""	ZFP161		9244432	Standard	NM_001243702		Approved	ZNF478	uc010dkp.3	O43829	OTTHUMG00000131563	ENST00000357006.4:c.274T>A	chr18.hg19:g.5291933A>T	ENSP00000349503:p.Tyr92Asn	149.0	0.0		52.0	30.0	NM_001243702	O00403|Q2TB80	Missense_Mutation	SNP	ENST00000357006.4	hg19	CCDS11837.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.196790	0.79015	.	.	ENSG00000198081	ENST00000357006;ENST00000400143	T;T	0.71103	-0.54;-0.54	6.07	6.07	0.98685	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.87759	0.6258	H	0.95816	3.725	0.80722	D	1	D	0.69078	0.997	D	0.85130	0.997	D	0.87654	0.2530	10	0.11794	T	0.64	-34.2054	16.6288	0.85011	1.0:0.0:0.0:0.0	.	92	O43829	ZF161_HUMAN	N	92	ENSP00000349503:Y92N;ENSP00000383009:Y92N	ENSP00000349503:Y92N	Y	-	1	0	ZFP161	5281933	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.281000	0.95811	2.326000	0.78906	0.533000	0.62120	TAC	.	.		0.348	ZBTB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254425.1	NM_003409	
JUNB	3726	hgsc.bcm.edu	37	19	12902979	12902979	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr19:12902979C>A	ENST00000302754.4	+	1	670	c.394C>A	c.(394-396)Cag>Aag	p.Q132K		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	132					cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						CACCGAGGAGCAGGAGGGCTT	0.687																																					p.Q132K		Atlas-SNP	.											.	JUNB	14	.	0			c.C394A						.						10.0	10.0	10.0					19																	12902979		2117	4203	6320	SO:0001583	missense	3726	exon1			GAGGAGCAGGAGG	M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.394C>A	chr19.hg19:g.12902979C>A	ENSP00000303315:p.Gln132Lys	35.0	0.0		33.0	16.0	NM_002229	Q96GH3	Missense_Mutation	SNP	ENST00000302754.4	hg19	CCDS12280.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883833	0.91814	.	.	ENSG00000171223	ENST00000302754	T	0.35605	1.3	4.53	4.53	0.55603	Jun-like transcription factor (1);	0.000000	0.85682	U	0.000000	T	0.60843	0.2300	M	0.88241	2.94	0.80722	D	1	D	0.56287	0.975	P	0.56042	0.79	T	0.71909	-0.4450	10	0.87932	D	0	-8.7849	16.0705	0.80922	0.0:1.0:0.0:0.0	.	132	P17275	JUNB_HUMAN	K	132	ENSP00000303315:Q132K	ENSP00000303315:Q132K	Q	+	1	0	JUNB	12763979	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.884000	0.69729	2.058000	0.61347	0.549000	0.68633	CAG	.	.		0.687	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451015.1	NM_002229	
LYL1	4066	hgsc.bcm.edu	37	19	13211948	13211948	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr19:13211948G>A	ENST00000264824.4	-	2	398	c.38C>T	c.(37-39)aCc>aTc	p.T13I		NM_005583.4	NP_005574.2	P12980	LYL1_HUMAN	lymphoblastic leukemia associated hematopoiesis regulator 1	13					B cell differentiation (GO:0030183)|blood vessel maturation (GO:0001955)|definitive hemopoiesis (GO:0060216)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)	7			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)			CTCAGTCATGGTGGGGCCCAC	0.692			T	TRB@	T-ALL																																p.T13I		Atlas-SNP	.		Dom	yes		19	19p13.2-p13.1	4066	lymphoblastic leukemia derived sequence 1		L	.	LYL1	17	.	0			c.C38T						.						5.0	6.0	6.0					19																	13211948		2084	4116	6200	SO:0001583	missense	4066	exon2			GTCATGGTGGGGC		CCDS12292.1	19p13.2	2014-01-20	2014-01-20			ENSG00000104903		"""Basic helix-loop-helix proteins"""	6734	protein-coding gene	gene with protein product		151440	"""lymphoblastic leukemia derived sequence 1"""			2752424	Standard	NM_005583		Approved	bHLHa18	uc002mwi.3	P12980		ENST00000264824.4:c.38C>T	chr19.hg19:g.13211948G>A	ENSP00000264824:p.Thr13Ile	35.0	0.0		37.0	10.0	NM_005583	O76102	Missense_Mutation	SNP	ENST00000264824.4	hg19	CCDS12292.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878989	0.51801	.	.	ENSG00000104903	ENST00000264824	D	0.97688	-4.49	4.67	2.37	0.29283	.	0.492587	0.18312	N	0.145081	D	0.93946	0.8062	L	0.40543	1.245	0.23204	N	0.998127	B	0.15141	0.012	B	0.12156	0.007	D	0.88317	0.2960	10	0.59425	D	0.04	-19.1591	4.6531	0.12605	0.1875:0.0:0.6371:0.1754	.	13	P12980	LYL1_HUMAN	I	13	ENSP00000264824:T13I	ENSP00000264824:T13I	T	-	2	0	LYL1	13072948	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.123000	0.31308	0.953000	0.37825	0.555000	0.69702	ACC	.	.		0.692	LYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452827.1	NM_005583	
CYP2A13	1553	hgsc.bcm.edu	37	19	41594950	41594950	+	Silent	SNP	C	C	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr19:41594950C>T	ENST00000330436.3	+	2	297	c.297C>T	c.(295-297)agC>agT	p.S99S		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	99					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	AGGAGTTCAGCGGGCGAGGCG	0.642																																					p.S99S		Atlas-SNP	.											.	CYP2A13	90	.	0			c.C297T						.						62.0	59.0	60.0					19																	41594950		2202	4277	6479	SO:0001819	synonymous_variant	1553	exon2			GTTCAGCGGGCGA	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.297C>T	chr19.hg19:g.41594950C>T		92.0	0.0		49.0	20.0	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	ENST00000330436.3	hg19	CCDS12571.1																																																																																			.	.		0.642	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
PTPRT	11122	hgsc.bcm.edu	37	20	40979316	40979316	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr20:40979316G>T	ENST00000373187.1	-	11	1816	c.1817C>A	c.(1816-1818)aCc>aAc	p.T606N	PTPRT_ENST00000373184.1_Missense_Mutation_p.T606N|PTPRT_ENST00000373190.1_Missense_Mutation_p.T606N|PTPRT_ENST00000373198.4_Missense_Mutation_p.T606N|PTPRT_ENST00000356100.2_Missense_Mutation_p.T606N|PTPRT_ENST00000373201.1_Missense_Mutation_p.T606N|PTPRT_ENST00000373193.3_Missense_Mutation_p.T606N			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	606	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CACTGTGATGGTCGTGTCTGT	0.527																																					p.T606N		Atlas-SNP	.											.	PTPRT	372	.	0			c.C1817A						.						185.0	192.0	190.0					20																	40979316		2082	4218	6300	SO:0001583	missense	11122	exon11			GTGATGGTCGTGT	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1817C>A	chr20.hg19:g.40979316G>T	ENSP00000362283:p.Thr606Asn	48.0	0.0		40.0	18.0	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	hg19	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	33	5.269636	0.95429	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.39787	1.07;1.06;1.06;1.08;1.08;1.09;1.09	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.69672	0.3137	M	0.84326	2.69	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.71184	0.972;0.937	T	0.70781	-0.4779	10	0.62326	D	0.03	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	606;606	O14522-1;O14522	.;PTPRT_HUMAN	N	606	ENSP00000362286:T606N;ENSP00000362283:T606N;ENSP00000362289:T606N;ENSP00000348408:T606N;ENSP00000362294:T606N;ENSP00000362280:T606N;ENSP00000362297:T606N	ENSP00000348408:T606N	T	-	2	0	PTPRT	40412730	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.569000	0.98170	2.882000	0.98803	0.655000	0.94253	ACC	.	.		0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
CACNA1I	8911	hgsc.bcm.edu	37	22	40060133	40060133	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr22:40060133C>A	ENST00000402142.3	+	20	3635	c.3635C>A	c.(3634-3636)aCg>aAg	p.T1212K	CACNA1I_ENST00000336649.4_Missense_Mutation_p.T1218K|CACNA1I_ENST00000407673.1_Missense_Mutation_p.T1177K|CACNA1I_ENST00000401624.1_Missense_Mutation_p.T1212K|CACNA1I_ENST00000400164.3_Missense_Mutation_p.T1177K|CACNA1I_ENST00000404898.1_Missense_Mutation_p.T1177K	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1212					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	TACATCTTCACGGCCATCTTC	0.632																																					p.T1212K		Atlas-SNP	.											.	CACNA1I	264	.	0			c.C3635A						.						87.0	92.0	90.0					22																	40060133		1972	4152	6124	SO:0001583	missense	8911	exon20			TCTTCACGGCCAT	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.3635C>A	chr22.hg19:g.40060133C>A	ENSP00000385019:p.Thr1212Lys	53.0	0.0		46.0	16.0	NM_021096	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	hg19	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	C	36	5.632153	0.96682	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18;-5.18;-5.18	5.4	5.4	0.78164	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99551	0.9839	H	0.98664	4.295	0.80722	D	1	D;D;D;D	0.89917	0.999;0.996;1.0;0.998	D;D;D;D	0.76071	0.969;0.919;0.987;0.949	D	0.97805	1.0247	10	0.87932	D	0	.	19.1739	0.93594	0.0:1.0:0.0:0.0	.	1177;1212;1177;1212	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	K	1212;1177;1212;1177;1218;1177	ENSP00000385019:T1212K;ENSP00000384093:T1177K;ENSP00000383887:T1212K;ENSP00000385680:T1177K;ENSP00000337829:T1218K;ENSP00000383028:T1177K	ENSP00000337829:T1218K	T	+	2	0	CACNA1I	38390079	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	7.660000	0.83776	2.521000	0.84997	0.561000	0.74099	ACG	.	.		0.632	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
TTC38	55020	hgsc.bcm.edu	37	22	46677505	46677505	+	Missense_Mutation	SNP	A	A	G	rs370933560		TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr22:46677505A>G	ENST00000381031.3	+	7	701	c.625A>G	c.(625-627)Att>Gtt	p.I209V	TTC38_ENST00000445282.2_Missense_Mutation_p.I151V	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	209						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						GGCTTTATCTATTAACCCGAC	0.562																																					p.I209V		Atlas-SNP	.											.	TTC38	40	.	0			c.A625G						.	A	VAL/ILE	0,3988		0,0,1994	109.0	110.0	110.0		625	-8.9	0.0	22		110	1,8341		0,1,4170	no	missense	TTC38	NM_017931.2	29	0,1,6164	GG,GA,AA		0.012,0.0,0.0081	benign	209/470	46677505	1,12329	1994	4171	6165	SO:0001583	missense	55020	exon7			TTATCTATTAACC		CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.625A>G	chr22.hg19:g.46677505A>G	ENSP00000370419:p.Ile209Val	64.0	0.0		43.0	14.0	NM_017931	Q8WV27|Q9NWP8	Missense_Mutation	SNP	ENST00000381031.3	hg19	CCDS43030.1	.	.	.	.	.	.	.	.	.	.	A	9.478	1.097324	0.20552	0.0	1.2E-4	ENSG00000075234	ENST00000381031;ENST00000445282	T;T	0.77620	1.41;-1.11	5.79	-8.87	0.00792	Tetratricopeptide-like helical (1);	0.640491	0.16711	N	0.202670	T	0.62307	0.2417	L	0.32530	0.975	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.003	T	0.16837	-1.0389	10	0.44086	T	0.13	-15.3182	15.5879	0.76499	0.2753:0.0981:0.6266:0.0	.	151;209	E7ES35;Q5R3I4	.;TTC38_HUMAN	V	209;151	ENSP00000370419:I209V;ENSP00000393960:I151V	ENSP00000370419:I209V	I	+	1	0	TTC38	45056169	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.419000	0.07071	-2.126000	0.00820	-1.054000	0.02325	ATT	.	.		0.562	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000318469.1	NM_017931	
TBL1X	6907	hgsc.bcm.edu	37	X	9677338	9677338	+	Silent	SNP	C	C	G			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chrX:9677338C>G	ENST00000217964.7	+	14	1927	c.1287C>G	c.(1285-1287)tcC>tcG	p.S429S	TBL1X_ENST00000407597.2_Silent_p.S429S|TBL1X_ENST00000424279.1_Silent_p.S378S|TBL1X_ENST00000380961.1_Silent_p.S378S|TBL1X_ENST00000536365.1_Silent_p.S378S	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	429					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				TGCTGGCATCCTGCTCGGATG	0.522											OREG0019658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S429S		Atlas-SNP	.											.	TBL1X	103	.	0			c.C1287G						.						120.0	82.0	95.0					X																	9677338		2203	4300	6503	SO:0001819	synonymous_variant	6907	exon14			GGCATCCTGCTCG	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1287C>G	chrX.hg19:g.9677338C>G		93.0	0.0	658	52.0	33.0	NM_001139466	A8K044|A8K4J7|Q86UY2	Silent	SNP	ENST00000217964.7	hg19	CCDS14133.1																																																																																			.	.		0.522	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
ENOX2	10495	hgsc.bcm.edu	37	X	129813524	129813524	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chrX:129813524T>C	ENST00000370927.1	-	4	560	c.539A>G	c.(538-540)tAt>tGt	p.Y180C	ENOX2_ENST00000338144.3_Missense_Mutation_p.Y180C|ENOX2_ENST00000370935.1_Missense_Mutation_p.Y151C|ENOX2_ENST00000394363.1_Missense_Mutation_p.Y151C|ENOX2_ENST00000492263.1_5'Flank			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	180	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						ACCAGACAGATACAGGGCTTT	0.453																																					p.Y180C	Ovarian(101;828 1506 2951 9500 35258)	Atlas-SNP	.											.	ENOX2	70	.	0			c.A539G						.						217.0	189.0	198.0					X																	129813524		2203	4300	6503	SO:0001583	missense	10495	exon7			GACAGATACAGGG	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.539A>G	chrX.hg19:g.129813524T>C	ENSP00000359965:p.Tyr180Cys	83.0	0.0		49.0	43.0	NM_182314	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	ENST00000370927.1	hg19	CCDS14626.1	.	.	.	.	.	.	.	.	.	.	t	19.34	3.809744	0.70797	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37	5.36	5.36	0.76844	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.068024	0.64402	D	0.000008	T	0.25644	0.0624	L	0.35644	1.08	0.38372	D	0.944901	D;P	0.58970	0.984;0.944	P;P	0.58660	0.843;0.735	T	0.04427	-1.0952	9	.	.	.	-11.6689	12.0624	0.53570	0.0:0.0:0.0:1.0	.	180;208	Q16206;A4QPE1	ENOX2_HUMAN;.	C	151;151;180;151;208;180;151	ENSP00000359973:Y151C;ENSP00000337146:Y180C;ENSP00000377890:Y151C;ENSP00000359965:Y180C;ENSP00000400304:Y151C	.	Y	-	2	0	ENOX2	129641205	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.390000	0.59646	1.978000	0.57642	0.483000	0.47432	TAT	.	.		0.453	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314	
NYAP2	57624	hgsc.bcm.edu	37	2	226378129	226378129	+	Frame_Shift_Del	DEL	G	G	-			TCGA-RC-A7SF-01A-11D-A34Z-10	TCGA-RC-A7SF-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6704f86-2ea2-4f7c-8043-351f98123fc8	e9d14b6e-0f63-4c76-8189-1f7e8fad71db	g.chr2:226378129delG	ENST00000272907.6	+	3	677	c.264delG	c.(262-264)gtgfs	p.V88fs	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	88					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GAAGTTACGTGGGCAAACATT	0.493																																					p.V88fs		Atlas-Indel,Pindel	.											.	.	.	.	0			c.263delT						.						77.0	81.0	80.0					2																	226378129		2046	4187	6233	SO:0001589	frameshift_variant	57624	exon3			.	AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.264delG	chr2.hg19:g.226378129delG	ENSP00000272907:p.Val88fs	100.0	0.0		55.0	26.0	NM_020864	A2RRN4|Q96NL2	Frame_Shift_Del	DEL	ENST00000272907.6	hg19	CCDS46529.1																																																																																			.	.		0.493	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331258.1	NM_020864	
