#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBE4B	10277	hgsc.bcm.edu	37	1	10211424	10211424	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:10211424A>G	ENST00000253251.8	+	20	3183	c.2344A>G	c.(2344-2346)Att>Gtt	p.I782V	UBE4B_ENST00000343090.6_Missense_Mutation_p.I911V|UBE4B_ENST00000377157.3_Missense_Mutation_p.I666V					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TACTCAGGATATTGTGATGTT	0.463																																					p.I911V		Atlas-SNP	.											.	UBE4B	233	.	0			c.A2731G						.						144.0	138.0	140.0					1																	10211424		2203	4300	6503	SO:0001583	missense	10277	exon21			CAGGATATTGTGA	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.2344A>G	chr1.hg19:g.10211424A>G	ENSP00000253251:p.Ile782Val	146.0	0.0		96.0	84.0	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	hg19	CCDS110.1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.159028	0.38119	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.45668	0.89;0.89;0.89	5.33	1.76	0.24704	Ubiquitin conjugation factor E4, core (1);	0.049545	0.85682	D	0.000000	T	0.27454	0.0674	L	0.31926	0.97	0.44409	D	0.997324	B;B;B	0.18461	0.001;0.028;0.001	B;B;B	0.15870	0.004;0.014;0.003	T	0.06180	-1.0841	10	0.21540	T	0.41	-8.3086	8.8945	0.35455	0.6261:0.0:0.3739:0.0	.	782;911;782	A8K8S9;O95155;O95155-2	.;UBE4B_HUMAN;.	V	782;666;911	ENSP00000253251:I782V;ENSP00000366362:I666V;ENSP00000343001:I911V	ENSP00000253251:I782V	I	+	1	0	UBE4B	10134011	0.999000	0.42202	0.971000	0.41717	0.949000	0.60115	1.427000	0.34881	0.048000	0.15891	-0.467000	0.05162	ATT	.	.		0.463	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
EFCAB14	9813	hgsc.bcm.edu	37	1	47150244	47150244	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:47150244T>C	ENST00000371933.3	-	9	2081	c.1105A>G	c.(1105-1107)Aag>Gag	p.K369E	EFCAB14_ENST00000484461.1_5'UTR|EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14-AS1_ENST00000442839.1_RNA|EFCAB14_ENST00000544071.1_Missense_Mutation_p.K305E	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	369							calcium ion binding (GO:0005509)										TCTCTTAGCTTGGATACCTGA	0.443																																					p.K369E		Atlas-SNP	.											.	.	.	.	0			c.A1105G						.						115.0	113.0	114.0					1																	47150244		2203	4300	6503	SO:0001583	missense	9813	exon9			TTAGCTTGGATAC	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.1105A>G	chr1.hg19:g.47150244T>C	ENSP00000361001:p.Lys369Glu	70.0	0.0		49.0	37.0	NM_014774	D3DQ23|Q5SXB8	Missense_Mutation	SNP	ENST00000371933.3	hg19	CCDS30706.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.236118	0.39498	.	.	ENSG00000159658	ENST00000544071;ENST00000371933	D;T	0.95518	-3.73;1.9	5.43	3.12	0.35913	.	0.448963	0.25783	N	0.028331	D	0.88392	0.6424	N	0.21448	0.665	0.23834	N	0.996718	B;B;B;B	0.14438	0.006;0.005;0.01;0.003	B;B;B;B	0.13407	0.009;0.006;0.006;0.004	T	0.74084	-0.3779	10	0.15066	T	0.55	-4.6064	6.6632	0.23027	0.0:0.0784:0.1545:0.7671	.	161;305;305;369	B7Z3D1;F5H7K3;B7Z444;O75071	.;.;.;K0494_HUMAN	E	305;369	ENSP00000442465:K305E;ENSP00000361001:K369E	ENSP00000361001:K369E	K	-	1	0	KIAA0494	46922831	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	1.814000	0.38972	0.511000	0.28236	0.528000	0.53228	AAG	.	.		0.443	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774	
CIART	148523	hgsc.bcm.edu	37	1	150255908	150255908	+	Silent	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:150255908A>G	ENST00000290363.5	+	1	680	c.231A>G	c.(229-231)ccA>ccG	p.P77P	C1orf51_ENST00000369094.1_5'UTR|C1orf51_ENST00000369095.1_Silent_p.P77P|C1orf51_ENST00000469255.1_3'UTR	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		77					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCATACACCATCTCATCCGA	0.572																																					p.P77P		Atlas-SNP	.											.	C1orf51	35	.	0			c.A231G						.						142.0	139.0	140.0					1																	150255908		2203	4300	6503	SO:0001819	synonymous_variant	148523	exon1			TACACCATCTCAT																												ENST00000290363.5:c.231A>G	chr1.hg19:g.150255908A>G		155.0	0.0		304.0	141.0	NM_144697	B2RD43|D3DV01|Q8N795|Q96MG6	Silent	SNP	ENST00000290363.5	hg19	CCDS949.1																																																																																			.	.		0.572	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035058.1		
GON4L	54856	hgsc.bcm.edu	37	1	155735915	155735915	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:155735915G>A	ENST00000368331.1	-	21	3397	c.3349C>T	c.(3349-3351)Cgg>Tgg	p.R1117W	GON4L_ENST00000361040.5_Missense_Mutation_p.R1117W|GON4L_ENST00000437809.1_Missense_Mutation_p.R1117W|GON4L_ENST00000271883.5_Missense_Mutation_p.R1117W|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1117					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					GAGGGTCTCCGTCTCACATAT	0.532																																					p.R1117W		Atlas-SNP	.											.	GON4L	392	.	0			c.C3349T						.						128.0	122.0	124.0					1																	155735915		2203	4300	6503	SO:0001583	missense	54856	exon21			GTCTCCGTCTCAC	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.3349C>T	chr1.hg19:g.155735915G>A	ENSP00000357315:p.Arg1117Trp	141.0	0.0		294.0	16.0	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	hg19		.	.	.	.	.	.	.	.	.	.	G	9.775	1.173736	0.21704	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000361040	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	5.28	3.32	0.38043	.	0.372495	0.23515	N	0.047351	T	0.12860	0.0312	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.28378	0.066;0.049;0.133;0.209	B;B;B;B	0.27500	0.011;0.007;0.037;0.08	T	0.05162	-1.0902	10	0.49607	T	0.09	.	4.9596	0.14059	0.1551:0.0:0.4804:0.3645	.	1117;313;1117;1117	Q3T8J9-2;Q1ED43;Q3T8J9;Q3T8J9-3	.;.;GON4L_HUMAN;.	W	1117	ENSP00000396117:R1117W;ENSP00000357315:R1117W;ENSP00000271883:R1117W;ENSP00000354322:R1117W	ENSP00000271883:R1117W	R	-	1	2	GON4L	154002539	0.035000	0.19736	0.958000	0.39756	0.362000	0.29581	0.963000	0.29293	1.415000	0.47037	0.655000	0.94253	CGG	.	.		0.532	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
ETV3	2117	hgsc.bcm.edu	37	1	157095415	157095415	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:157095415G>A	ENST00000368192.4	-	5	821	c.757C>T	c.(757-759)Cct>Tct	p.P253S		NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	253					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				CCGCGGCCAGGGATTGGAGAG	0.567																																					p.P253S		Atlas-SNP	.											.	ETV3	50	.	0			c.C757T						.						130.0	124.0	126.0					1																	157095415		692	1591	2283	SO:0001583	missense	2117	exon5			GGCCAGGGATTGG	BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.757C>T	chr1.hg19:g.157095415G>A	ENSP00000357175:p.Pro253Ser	197.0	0.0		355.0	74.0	NM_001145312	B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	ENST00000368192.4	hg19	CCDS44250.1	.	.	.	.	.	.	.	.	.	.	G	19.86	3.905351	0.72868	.	.	ENSG00000117036	ENST00000368192	T	0.32515	1.45	4.9	3.96	0.45880	.	0.090092	0.47852	D	0.000212	T	0.37598	0.1009	L	0.53249	1.67	0.80722	D	1	D	0.71674	0.998	D	0.66979	0.948	T	0.23619	-1.0183	10	0.49607	T	0.09	.	14.2903	0.66273	0.0:0.1503:0.8497:0.0	.	253	P41162	ETV3_HUMAN	S	253	ENSP00000357175:P253S	ENSP00000357175:P253S	P	-	1	0	ETV3	155362039	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	4.956000	0.63645	1.384000	0.46424	0.561000	0.74099	CCT	.	.		0.567	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082843.2	NM_005240	
SPTA1	6708	hgsc.bcm.edu	37	1	158607950	158607950	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:158607950T>G	ENST00000368147.4	-	36	5242	c.5062A>C	c.(5062-5064)Aaa>Caa	p.K1688Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1688					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					ACATTATCTTTTTTCTTCACA	0.443																																					p.K1688Q		Atlas-SNP	.											.	SPTA1	720	.	0			c.A5062C						.						96.0	89.0	91.0					1																	158607950		1882	4111	5993	SO:0001583	missense	6708	exon36			TATCTTTTTTCTT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5062A>C	chr1.hg19:g.158607950T>G	ENSP00000357129:p.Lys1688Gln	88.0	0.0		122.0	29.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	7.137	0.580974	0.13686	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.49139	0.79;0.79	5.36	2.93	0.34026	.	1.073180	0.07483	N	0.904274	T	0.09642	0.0237	N	0.04508	-0.205	0.23913	N	0.996486	B	0.11235	0.004	B	0.14023	0.01	T	0.28713	-1.0035	10	0.12103	T	0.63	.	11.4052	0.49894	0.0:0.0:0.3493:0.6507	.	1688	P02549	SPTA1_HUMAN	Q	1688	ENSP00000357130:K1688Q;ENSP00000357129:K1688Q	ENSP00000357129:K1688Q	K	-	1	0	SPTA1	156874574	0.886000	0.30341	0.135000	0.22099	0.002000	0.02628	3.527000	0.53517	1.010000	0.39314	0.482000	0.46254	AAA	.	.		0.443	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
CACNA1E	777	hgsc.bcm.edu	37	1	181754899	181754899	+	Silent	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:181754899G>A	ENST00000367573.2	+	43	5730	c.5730G>A	c.(5728-5730)gaG>gaA	p.E1910E	CACNA1E_ENST00000360108.3_Silent_p.E1891E|CACNA1E_ENST00000358338.5_Silent_p.E1842E|CACNA1E_ENST00000357570.5_Silent_p.E1861E|CACNA1E_ENST00000367567.4_Silent_p.E1517E|CACNA1E_ENST00000367570.1_Silent_p.E1910E|CACNA1E_ENST00000526775.1_Silent_p.E1891E	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1910					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.E1910D(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGCCTCAGGAGATCATTGCTA	0.507																																					p.E1910E		Atlas-SNP	.											CACNA1E,NS,carcinoma,0,1	CACNA1E	778	.	2	Substitution - Missense(2)	endometrium(2)	c.G5730A						.						191.0	185.0	187.0					1																	181754899		1923	4144	6067	SO:0001819	synonymous_variant	777	exon43			TCAGGAGATCATT	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5730G>A	chr1.hg19:g.181754899G>A		195.0	0.0		357.0	99.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	hg19	CCDS55664.1																																																																																			.	.		0.507	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
NCOA1	8648	hgsc.bcm.edu	37	2	24930641	24930641	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr2:24930641C>G	ENST00000406961.1	+	13	2954	c.2302C>G	c.(2302-2304)Ctg>Gtg	p.L768V	NCOA1_ENST00000407230.1_Missense_Mutation_p.L617V|NCOA1_ENST00000405141.1_Missense_Mutation_p.L768V|NCOA1_ENST00000348332.3_Missense_Mutation_p.L768V|NCOA1_ENST00000538539.1_Missense_Mutation_p.L768V|NCOA1_ENST00000288599.5_Missense_Mutation_p.L768V|NCOA1_ENST00000395856.3_Missense_Mutation_p.L768V			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	768					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAACCTGAGCCTGGATGATGT	0.383			T	PAX3	alveolar rhadomyosarcoma																																p.L768V		Atlas-SNP	.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1	210	.	0			c.C2302G						.						66.0	63.0	64.0					2																	24930641		2203	4300	6503	SO:0001583	missense	8648	exon11			CTGAGCCTGGATG	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2302C>G	chr2.hg19:g.24930641C>G	ENSP00000385216:p.Leu768Val	380.0	1.0		303.0	117.0	NM_147223	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	ENST00000406961.1	hg19	CCDS1712.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826331	0.50739	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02525	4.36;4.35;4.26;4.35;4.36;4.35;4.36	6.04	2.22	0.28083	.	0.066860	0.64402	D	0.000008	T	0.07143	0.0181	L	0.34521	1.04	0.53688	D	0.999977	D;D;D;D	0.67145	0.996;0.993;0.958;0.993	D;D;P;D	0.76071	0.986;0.967;0.827;0.987	T	0.25467	-1.0131	10	0.40728	T	0.16	.	10.2693	0.43473	0.0:0.7304:0.0:0.2696	.	768;768;768;617	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	V	768;768;617;768;768;768;768	ENSP00000385216:L768V;ENSP00000385097:L768V;ENSP00000385195:L617V;ENSP00000444039:L768V;ENSP00000320940:L768V;ENSP00000288599:L768V;ENSP00000379197:L768V	ENSP00000288599:L768V	L	+	1	2	NCOA1	24784145	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	1.824000	0.39072	0.129000	0.18514	0.563000	0.77884	CTG	.	.		0.383	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
TUBA3D	113457	hgsc.bcm.edu	37	2	132238155	132238155	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr2:132238155G>A	ENST00000321253.6	+	4	996	c.889G>A	c.(889-891)Gag>Aag	p.E297K		NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	297					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		TGCCTGCTTCGAGCCAGCCAA	0.597																																					p.E297K	Ovarian(137;2059 2432 35543 39401)	Atlas-SNP	.											.	TUBA3D	60	.	0			c.G889A						.						94.0	127.0	116.0					2																	132238155		2202	4300	6502	SO:0001583	missense	113457	exon4			TGCTTCGAGCCAG	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.889G>A	chr2.hg19:g.132238155G>A	ENSP00000326042:p.Glu297Lys	136.0	0.0		99.0	27.0	NM_080386	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000321253.6	hg19	CCDS33290.1	.	.	.	.	.	.	.	.	.	.	g	14.15	2.449913	0.43531	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	D	0.84730	-1.89	2.24	2.24	0.28232	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.46442	U	0.000298	D	0.93403	0.7896	H	0.97707	4.06	0.47441	D	0.99942	D	0.58620	0.983	P	0.60886	0.88	D	0.93888	0.7177	10	0.87932	D	0	.	10.1507	0.42791	0.0:0.0:1.0:0.0	.	297	Q13748	TBA3C_HUMAN	K	297	ENSP00000326042:E297K	ENSP00000326042:E297K	E	+	1	0	TUBA3D	131954625	1.000000	0.71417	1.000000	0.80357	0.465000	0.32709	5.331000	0.65905	1.243000	0.43853	0.194000	0.17425	GAG	.	.		0.597	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331800.2	NM_080386	
FIGN	55137	hgsc.bcm.edu	37	2	164466190	164466190	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr2:164466190G>T	ENST00000333129.3	-	3	2466	c.2152C>A	c.(2152-2154)Ccc>Acc	p.P718T	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'Flank	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	718					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						AACTGGCTGGGCATAATGGCT	0.478																																					p.P718T		Atlas-SNP	.											.	FIGN	106	.	0			c.C2152A						.						57.0	60.0	59.0					2																	164466190		1965	4151	6116	SO:0001583	missense	55137	exon3			GGCTGGGCATAAT	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.2152C>A	chr2.hg19:g.164466190G>T	ENSP00000333836:p.Pro718Thr	75.0	0.0		71.0	31.0	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	hg19	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	G	13.39	2.222143	0.39300	.	.	ENSG00000182263	ENST00000333129	D	0.98512	-4.97	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.95825	0.8641	L	0.31294	0.92	0.80722	D	1	B	0.30406	0.278	B	0.23018	0.043	D	0.93518	0.6859	10	0.45353	T	0.12	-22.3937	20.2527	0.98410	0.0:0.0:1.0:0.0	.	718	Q5HY92	FIGN_HUMAN	T	718	ENSP00000333836:P718T	ENSP00000333836:P718T	P	-	1	0	FIGN	164174436	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.004000	0.88535	2.788000	0.95919	0.557000	0.71058	CCC	.	.		0.478	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
GORASP2	26003	hgsc.bcm.edu	37	2	171804921	171804921	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr2:171804921C>T	ENST00000234160.4	+	2	940	c.125C>T	c.(124-126)tCt>tTt	p.S42F	GORASP2_ENST00000452526.2_Missense_Mutation_p.S54F|GORASP2_ENST00000493692.1_3'UTR	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	42	PDZ.				mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						TTTATTGTTTCTATTAATGGT	0.333																																					p.S42F		Atlas-SNP	.											.	GORASP2	40	.	0			c.C125T						.						105.0	110.0	109.0					2																	171804921		2203	4300	6503	SO:0001583	missense	26003	exon2			TTGTTTCTATTAA		CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.125C>T	chr2.hg19:g.171804921C>T	ENSP00000234160:p.Ser42Phe	83.0	0.0		60.0	31.0	NM_015530	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	ENST00000234160.4	hg19	CCDS33325.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917866	0.92249	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.34275	1.37;1.37	5.73	5.73	0.89815	PDZ/DHR/GLGF (2);	0.000000	0.85682	D	0.000000	T	0.68128	0.2967	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.71777	-0.4490	10	0.72032	D	0.01	-14.6155	20.2786	0.98501	0.0:1.0:0.0:0.0	.	54;42	B4DKT0;Q9H8Y8	.;GORS2_HUMAN	F	42;54	ENSP00000234160:S42F;ENSP00000410208:S54F	ENSP00000234160:S42F	S	+	2	0	GORASP2	171513167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.711000	0.84669	2.868000	0.98415	0.557000	0.71058	TCT	.	.		0.333	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333719.2		
CCDC141	285025	hgsc.bcm.edu	37	2	179736264	179736264	+	Nonsense_Mutation	SNP	T	T	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr2:179736264T>A	ENST00000420890.2	-	14	2212	c.2095A>T	c.(2095-2097)Aaa>Taa	p.K699*	CCDC141_ENST00000295723.5_Nonsense_Mutation_p.K124*	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	699										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TGAAGAAGTTTTAAGTTGTGA	0.408																																					p.K699X		Atlas-SNP	.											.	CCDC141	362	.	0			c.A2095T						.						118.0	121.0	120.0					2																	179736264		2203	4300	6503	SO:0001587	stop_gained	285025	exon14			GAAGTTTTAAGTT	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2095A>T	chr2.hg19:g.179736264T>A	ENSP00000395995:p.Lys699*	113.0	0.0		72.0	37.0	NM_173648	H7C0P1|J3KNW6|Q8N8H3	Nonsense_Mutation	SNP	ENST00000420890.2	hg19		.	.	.	.	.	.	.	.	.	.	T	39	7.432768	0.98282	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	.	.	.	5.79	5.79	0.91817	.	0.101829	0.42821	D	0.000642	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.9236	13.6573	0.62346	0.0:0.0:0.0:1.0	.	.	.	.	X	699;143;124;699	.	ENSP00000295723:K124X	K	-	1	0	CCDC141	179444509	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	0.981000	0.29526	2.200000	0.70718	0.455000	0.32223	AAA	.	.		0.408	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
CWC22	57703	hgsc.bcm.edu	37	2	180810422	180810422	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr2:180810422C>G	ENST00000410053.3	-	20	2460	c.2161G>C	c.(2161-2163)Gga>Cga	p.G721R	CWC22_ENST00000295749.6_Missense_Mutation_p.G721R	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	721					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						TTCCCATGTCCCTTCTTTCTT	0.328																																					p.G721R		Atlas-SNP	.											.	CWC22	62	.	0			c.G2161C						.						53.0	49.0	51.0					2																	180810422		1842	4081	5923	SO:0001583	missense	57703	exon20			CATGTCCCTTCTT		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.2161G>C	chr2.hg19:g.180810422C>G	ENSP00000387006:p.Gly721Arg	22.0	0.0		16.0	7.0	NM_020943	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	ENST00000410053.3	hg19	CCDS46465.1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.210574	0.00292	.	.	ENSG00000163510	ENST00000410053;ENST00000295749;ENST00000404136	T;T;T	0.21361	2.01;2.01;2.03	5.11	2.31	0.28768	.	1.095140	0.06803	N	0.789018	T	0.11153	0.0272	N	0.12182	0.205	0.22571	N	0.998974	B	0.02656	0.0	B	0.01281	0.0	T	0.38499	-0.9658	10	0.11794	T	0.64	-0.2803	6.8627	0.24076	0.0:0.5952:0.0:0.4048	.	721	Q9HCG8	CWC22_HUMAN	R	721	ENSP00000387006:G721R;ENSP00000295749:G721R;ENSP00000384159:G721R	ENSP00000295749:G721R	G	-	1	0	CWC22	180518667	0.009000	0.17119	0.989000	0.46669	0.199000	0.23934	0.185000	0.16958	0.261000	0.21753	-0.140000	0.14226	GGA	.	.		0.328	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334537.1	NM_020943	
KCNH8	131096	hgsc.bcm.edu	37	3	19556821	19556821	+	Missense_Mutation	SNP	G	G	A	rs373726349		TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr3:19556821G>A	ENST00000328405.2	+	14	2709	c.2443G>A	c.(2443-2445)Gat>Aat	p.D815N		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	815					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						TAGGATTGTTGATGGAATTGA	0.353																																					p.D815N	NSCLC(124;1625 1765 8018 24930 42026)	Atlas-SNP	.											.	KCNH8	189	.	0			c.G2443A						.	G	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	66.0	69.0	68.0		2443	5.6	1.0	3		68	0,8600		0,0,4300	no	missense	KCNH8	NM_144633.2	23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	815/1108	19556821	1,13005	2203	4300	6503	SO:0001583	missense	131096	exon14			ATTGTTGATGGAA	AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.2443G>A	chr3.hg19:g.19556821G>A	ENSP00000328813:p.Asp815Asn	61.0	0.0		61.0	26.0	NM_144633	B7Z2I7|Q59GQ6	Missense_Mutation	SNP	ENST00000328405.2	hg19	CCDS2632.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655270	0.88056	2.27E-4	0.0	ENSG00000183960	ENST00000328405	D	0.99829	-7.0	5.59	5.59	0.84812	.	0.000000	0.32372	U	0.006186	D	0.99746	0.9899	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97739	1.0207	9	.	.	.	.	17.7599	0.88461	0.0:0.0:1.0:0.0	.	815	Q96L42	KCNH8_HUMAN	N	815	ENSP00000328813:D815N	.	D	+	1	0	KCNH8	19531825	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.328000	0.72915	2.630000	0.89119	0.650000	0.86243	GAT	.	.		0.353	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252139.2	NM_144633	
HTR1F	3355	hgsc.bcm.edu	37	3	88040639	88040639	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr3:88040639T>A	ENST00000319595.4	+	1	794	c.740T>A	c.(739-741)cTa>cAa	p.L247Q		NM_000866.3	NP_000857.1	P30939	5HT1F_HUMAN	5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled	247					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(8;0.147)	Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00664)	Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Ketamine(DB01221)|Methysergide(DB00247)|Mianserin(DB06148)|Naratriptan(DB00952)|Rizatriptan(DB00953)|Sumatriptan(DB00669)|Zolmitriptan(DB00315)	TCCTATGTACTAGAAAAGTCT	0.408																																					p.L247Q		Atlas-SNP	.											.	HTR1F	66	.	0			c.T740A						.						62.0	63.0	63.0					3																	88040639		2203	4300	6503	SO:0001583	missense	3355	exon2			ATGTACTAGAAAA	L05597	CCDS2920.1	3p12	2012-08-08	2012-02-03		ENSG00000179097	ENSG00000179097		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5292	protein-coding gene	gene with protein product		182134	"""5-hydroxytryptamine (serotonin) receptor 1F"""			8384716, 8380639	Standard	NM_000866		Approved	HTR1EL, 5-HT1F	uc003dqr.2	P30939	OTTHUMG00000159008	ENST00000319595.4:c.740T>A	chr3.hg19:g.88040639T>A	ENSP00000322924:p.Leu247Gln	114.0	0.0		54.0	48.0	NM_000866		Missense_Mutation	SNP	ENST00000319595.4	hg19	CCDS2920.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.497188	0.00159	.	.	ENSG00000179097	ENST00000319595	T	0.71817	-0.6	5.14	-0.319	0.12725	GPCR, rhodopsin-like superfamily (1);	1.163830	0.06367	U	0.712788	T	0.52789	0.1756	L	0.29908	0.895	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.27020	-1.0086	10	0.13108	T	0.6	.	4.8955	0.13748	0.146:0.3432:0.0:0.5108	.	247	P30939	5HT1F_HUMAN	Q	247	ENSP00000322924:L247Q	ENSP00000322924:L247Q	L	+	2	0	HTR1F	88123329	0.000000	0.05858	0.263000	0.24496	0.002000	0.02628	0.055000	0.14229	0.014000	0.14944	-1.481000	0.00988	CTA	.	.		0.408	HTR1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352890.1	NM_000866	
NCEH1	57552	hgsc.bcm.edu	37	3	172351356	172351356	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr3:172351356C>T	ENST00000475381.1	-	5	1369	c.1136G>A	c.(1135-1137)gGa>gAa	p.G379E	NCEH1_ENST00000273512.3_Missense_Mutation_p.G411E|NCEH1_ENST00000538775.1_Missense_Mutation_p.G419E|NCEH1_ENST00000543711.1_Missense_Mutation_p.G246E			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	379					lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						AATCATACATCCGTGAAAGCC	0.488																																					p.G419E		Atlas-SNP	.											.	NCEH1	63	.	0			c.G1256A						.						123.0	111.0	115.0					3																	172351356		2203	4300	6503	SO:0001583	missense	57552	exon5			ATACATCCGTGAA	AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.1136G>A	chr3.hg19:g.172351356C>T	ENSP00000418571:p.Gly379Glu	144.0	0.0		162.0	52.0	NM_001146276	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Missense_Mutation	SNP	ENST00000475381.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.27	3.076449	0.55753	.	.	ENSG00000144959	ENST00000475381;ENST00000538775;ENST00000273512;ENST00000543711	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	5.7	4.82	0.62117	Alpha/beta hydrolase fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.78426	0.4281	M	0.69523	2.12	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81470	-0.0918	10	0.87932	D	0	-21.9418	16.0129	0.80417	0.1358:0.8642:0.0:0.0	.	419;379	F5H7K4;Q6PIU2	.;NCEH1_HUMAN	E	379;419;411;246	ENSP00000418571:G379E;ENSP00000442464:G419E;ENSP00000273512:G411E;ENSP00000443227:G246E	ENSP00000273512:G411E	G	-	2	0	NCEH1	173834050	1.000000	0.71417	0.157000	0.22605	0.189000	0.23516	7.484000	0.81180	1.382000	0.46385	-0.291000	0.09656	GGA	.	.		0.488	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000346367.3	NM_020792	
OPA1	4976	hgsc.bcm.edu	37	3	193380662	193380663	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr3:193380662_193380663GA>TT	ENST00000392438.3	+	24	2641_2642	c.2407_2408GA>TT	c.(2407-2409)GAg>TTg	p.E803L	OPA1_ENST00000361510.2_Missense_Mutation_p.E858L|OPA1_ENST00000361908.3_Missense_Mutation_p.E840L|OPA1_ENST00000361150.2_Missense_Mutation_p.E804L|OPA1_ENST00000361715.2_Missense_Mutation_p.E822L|OPA1_ENST00000361828.2_Missense_Mutation_p.E821L	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	803					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GAAATGTAATGAGGAGCACCCA	0.366																																					p.E858X|p.E858V		Atlas-SNP	.											.	OPA1	79	.	0			c.G2572T|c.A2573T						.																																			SO:0001583	missense	4976	exon26			TGTAATGAGGAGC|GTAATGAGGAGCA	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	Exception_encountered	chr3.hg19:g.193380662_193380663delinsTT	ENSP00000376233:p.Glu803Leu	305.0|304.0	1.0|0.0		291.0|294.0	127.0|130.0	NM_130837	D3DNW4	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000392438.3	hg19	CCDS43186.1																																																																																			.	.		0.366	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
PACRGL	133015	hgsc.bcm.edu	37	4	20706145	20706145	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr4:20706145A>T	ENST00000503585.1	+	2	432	c.41A>T	c.(40-42)aAc>aTc	p.N14I	PACRGL_ENST00000538990.1_Missense_Mutation_p.N14I|PACRGL_ENST00000513459.1_Missense_Mutation_p.N14I|PACRGL_ENST00000360916.5_Missense_Mutation_p.N14I|PACRGL_ENST00000507634.1_Missense_Mutation_p.N14I|PACRGL_ENST00000502938.1_Missense_Mutation_p.N14I|PACRGL_ENST00000444671.2_Missense_Mutation_p.N14I|PACRGL_ENST00000502374.1_Missense_Mutation_p.N14I|PACRGL_ENST00000295290.8_Missense_Mutation_p.N14I	NM_001258345.1	NP_001245274.1	Q8N7B6	PACRL_HUMAN	PARK2 co-regulated-like	14										endometrium(2)|lung(7)|prostate(1)	10						CAGTTGAAAAACAGAGCAACA	0.388																																					p.N14I		Atlas-SNP	.											.	PACRGL	30	.	0			c.A41T						.						75.0	78.0	77.0					4																	20706145		2203	4300	6503	SO:0001583	missense	133015	exon2			TGAAAAACAGAGC	AK098692	CCDS3427.1, CCDS47034.1, CCDS58895.1, CCDS58896.1	4p15.31	2008-10-02	2008-10-02	2008-10-02	ENSG00000163138	ENSG00000163138			28442	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 28"""	C4orf28		12477932	Standard	NM_145048		Approved	MGC29898	uc010iek.3	Q8N7B6	OTTHUMG00000128550	ENST00000503585.1:c.41A>T	chr4.hg19:g.20706145A>T	ENSP00000423881:p.Asn14Ile	687.0	1.0		672.0	233.0	NM_001258345	B2RDB9|B4DFF8|B4DMN7|Q8TBA8	Missense_Mutation	SNP	ENST00000503585.1	hg19	CCDS58895.1	.	.	.	.	.	.	.	.	.	.	A	17.37	3.372967	0.61624	.	.	ENSG00000163138	ENST00000510051;ENST00000503585;ENST00000360916;ENST00000295290;ENST00000514485;ENST00000444671;ENST00000506745;ENST00000514663;ENST00000509469;ENST00000515339;ENST00000513861;ENST00000502374;ENST00000538990;ENST00000511160;ENST00000504630;ENST00000513590;ENST00000514292;ENST00000502938;ENST00000507634;ENST00000513459;ENST00000511089	.	.	.	5.87	-0.911	0.10507	.	0.454632	0.22985	N	0.053263	T	0.32615	0.0835	L	0.54323	1.7	0.30671	N	0.753412	D;B;P;P;P;P	0.53462	0.96;0.28;0.868;0.773;0.664;0.573	B;B;B;B;B;B	0.42422	0.387;0.117;0.312;0.246;0.08;0.232	T	0.39292	-0.9621	9	0.72032	D	0.01	-9.1787	5.7827	0.18316	0.5953:0.1289:0.2758:0.0	.	14;14;62;14;14;14	B4DFF8;Q8N7B6;D6R9N9;B4DMN7;D6RGK2;Q8N7B6-2	.;PACRL_HUMAN;.;.;.;.	I	62;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14;14	.	ENSP00000295290:N14I	N	+	2	0	PACRGL	20315243	0.003000	0.15002	0.971000	0.41717	0.575000	0.36095	-0.825000	0.04433	-0.262000	0.09392	0.533000	0.62120	AAC	.	.		0.388	PACRGL-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360321.2	NM_145048	
SLC9B2	133308	hgsc.bcm.edu	37	4	103987527	103987527	+	Silent	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr4:103987527C>T	ENST00000394785.3	-	3	859	c.228G>A	c.(226-228)ctG>ctA	p.L76L	SLC9B2_ENST00000362026.3_Silent_p.L76L|SLC9B2_ENST00000503230.1_Silent_p.L76L|SLC9B2_ENST00000505838.1_5'UTR|SLC9B2_ENST00000339611.4_Silent_p.L76L|SLC9B2_ENST00000503103.1_Silent_p.L76L	NM_178833.4	NP_849155.2	Q86UD5	SL9B2_HUMAN	solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2	76					ion transmembrane transport (GO:0034220)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	solute:proton antiporter activity (GO:0015299)										GAGGGCAAGCCAGCATTTGTC	0.383																																					p.L76L		Atlas-SNP	.											.	.	.	.	0			c.G228A						.						322.0	273.0	290.0					4																	103987527		2203	4300	6503	SO:0001819	synonymous_variant	133308	exon3			GCAAGCCAGCATT	AK172823	CCDS3662.1, CCDS75173.1, CCDS75174.1	4q24	2013-05-22	2012-03-22	2011-08-03	ENSG00000164038	ENSG00000164038		"""Solute carriers"""	25143	protein-coding gene	gene with protein product		611789	"""Na+/H+ exchanger domain containing 2"", ""solute carrier family 9, subfamily B (cation proton antiporter 2), member 2"""	NHEDC2		18600791	Standard	XM_005262758		Approved	FLJ23984, NHA2	uc003hwy.3	Q86UD5	OTTHUMG00000131125	ENST00000394785.3:c.228G>A	chr4.hg19:g.103987527C>T		112.0	0.0		67.0	55.0	NM_178833	B5ME52|Q6ZMD8|Q96D95	Silent	SNP	ENST00000394785.3	hg19	CCDS3662.1																																																																																			.	.		0.383	SLC9B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253805.1	NM_178833	
CDH9	1007	hgsc.bcm.edu	37	5	26881658	26881658	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr5:26881658G>A	ENST00000231021.4	-	12	2129	c.1957C>T	c.(1957-1959)Cgg>Tgg	p.R653W		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	653					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATGTTGTCCCGGACATCGTCT	0.413																																					p.R653W	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.C1957T						.						120.0	124.0	122.0					5																	26881658		2203	4300	6503	SO:0001583	missense	1007	exon12			TGTCCCGGACATC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1957C>T	chr5.hg19:g.26881658G>A	ENSP00000231021:p.Arg653Trp	52.0	0.0		58.0	27.0	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049021	0.55110	.	.	ENSG00000113100	ENST00000231021	D	0.84589	-1.87	4.96	4.06	0.47325	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.94604	0.8261	H	0.97265	3.97	0.49798	D	0.999828	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95132	0.8256	9	.	.	.	.	11.3279	0.49458	0.0:0.0:0.6308:0.3692	.	246;653	B4DFP0;Q9ULB4	.;CADH9_HUMAN	W	653	ENSP00000231021:R653W	.	R	-	1	2	CDH9	26917415	1.000000	0.71417	0.987000	0.45799	0.788000	0.44548	2.029000	0.41098	1.145000	0.42336	0.557000	0.71058	CGG	.	.		0.413	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
LNPEP	4012	hgsc.bcm.edu	37	5	96315623	96315623	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr5:96315623A>G	ENST00000231368.5	+	2	1493	c.801A>G	c.(799-801)atA>atG	p.I267M	LNPEP_ENST00000395770.3_Missense_Mutation_p.I253M	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	267					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CGGCAAATATATCTAGTTCTT	0.408																																					p.I267M		Atlas-SNP	.											.	LNPEP	80	.	0			c.A801G						.						60.0	57.0	58.0					5																	96315623		2203	4300	6503	SO:0001583	missense	4012	exon2			AAATATATCTAGT	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.801A>G	chr5.hg19:g.96315623A>G	ENSP00000231368:p.Ile267Met	140.0	0.0		147.0	80.0	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	hg19	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	A	7.268	0.606616	0.14002	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.03212	4.01;4.01	5.83	-11.7	0.00046	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.174230	0.50627	D	0.000112	T	0.01592	0.0051	N	0.25992	0.78	0.24869	N	0.992291	B	0.12013	0.005	B	0.23018	0.043	T	0.33523	-0.9865	10	0.54805	T	0.06	.	0.919	0.01311	0.187:0.1719:0.2203:0.4208	.	267	Q9UIQ6	LCAP_HUMAN	M	267;253	ENSP00000231368:I267M;ENSP00000379117:I253M	ENSP00000231368:I267M	I	+	3	3	LNPEP	96341379	0.268000	0.24133	0.341000	0.25589	0.031000	0.12232	-0.200000	0.09478	-1.853000	0.01165	-1.070000	0.02257	ATA	.	.		0.408	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
PCDHB7	56129	hgsc.bcm.edu	37	5	140554310	140554310	+	Missense_Mutation	SNP	G	G	C	rs17844473	byFrequency	TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr5:140554310G>C	ENST00000231137.3	+	1	2068	c.1894G>C	c.(1894-1896)Gag>Cag	p.E632Q		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	632	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTGCTGAGCGAGCGCGACGC	0.692																																					p.E632Q		Atlas-SNP	.											.	PCDHB7	231	.	0			c.G1894C						.						40.0	64.0	56.0					5																	140554310		2180	4280	6460	SO:0001583	missense	56129	exon1			CTGAGCGAGCGCG	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1894G>C	chr5.hg19:g.140554310G>C	ENSP00000231137:p.Glu632Gln	76.0	0.0		78.0	32.0	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	hg19	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259888	0.80246	.	.	ENSG00000113212	ENST00000231137	T	0.51325	0.71	3.98	3.98	0.46160	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.70640	0.3247	M	0.83774	2.66	0.45284	D	0.998288	D	0.89917	1.0	D	0.81914	0.995	T	0.77797	-0.2453	9	0.87932	D	0	.	16.1064	0.81225	0.0:0.0:1.0:0.0	.	632	Q9Y5E2	PCDB7_HUMAN	Q	632	ENSP00000231137:E632Q	ENSP00000231137:E632Q	E	+	1	0	PCDHB7	140534494	0.999000	0.42202	1.000000	0.80357	0.923000	0.55619	4.242000	0.58714	1.922000	0.55676	0.449000	0.29647	GAG	.	G|0.995;T|0.005		0.692	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
GABRA6	2559	hgsc.bcm.edu	37	5	161116134	161116134	+	Silent	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr5:161116134C>T	ENST00000274545.5	+	4	838	c.405C>T	c.(403-405)ctC>ctT	p.L135L	GABRA6_ENST00000523217.1_Silent_p.L125L|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	135					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CTAATAAACTCTTCAGAATAA	0.368										TCGA Ovarian(5;0.080)																											p.L135L		Atlas-SNP	.											.	GABRA6	139	.	0			c.C405T						.						64.0	65.0	64.0					5																	161116134		2203	4300	6503	SO:0001819	synonymous_variant	2559	exon4			TAAACTCTTCAGA		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.405C>T	chr5.hg19:g.161116134C>T		143.0	0.0		119.0	25.0	NM_000811	A8K096|Q4VAV2	Silent	SNP	ENST00000274545.5	hg19	CCDS4356.1	.	.	.	.	.	.	.	.	.	.	C	7.920	0.738319	0.15574	.	.	ENSG00000145863	ENST00000520000	.	.	.	5.65	0.687	0.18020	.	.	.	.	.	T	0.42675	0.1213	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22521	-1.0214	4	.	.	.	.	1.9535	0.03371	0.1186:0.3951:0.232:0.2543	.	.	.	.	F	75	.	.	S	+	2	0	GABRA6	161048712	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.210000	0.32370	0.113000	0.18004	-0.181000	0.13052	TCT	.	.		0.368	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
RARS	5917	hgsc.bcm.edu	37	5	167937603	167937603	+	Missense_Mutation	SNP	G	G	A	rs199894860		TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr5:167937603G>A	ENST00000231572.3	+	12	1418	c.1364G>A	c.(1363-1365)cGt>cAt	p.R455H	RARS_ENST00000538719.1_Missense_Mutation_p.R249H	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	455					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		TTTAAAACACGTTCGGGTGAA	0.373																																					p.R455H		Atlas-SNP	.											.	RARS	58	.	0			c.G1364A						.						54.0	55.0	55.0					5																	167937603		2203	4300	6503	SO:0001583	missense	5917	exon12			AAACACGTTCGGG	BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.1364G>A	chr5.hg19:g.167937603G>A	ENSP00000231572:p.Arg455His	266.0	0.0		287.0	19.0	NM_002887	B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	ENST00000231572.3	hg19	CCDS4367.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110347	0.77210	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	D;D	0.82167	-1.58;-1.58	4.99	4.99	0.66335	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.097855	0.64402	D	0.000001	D	0.95730	0.8611	H	0.99740	4.74	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98154	1.0443	10	0.87932	D	0	-9.6139	18.6482	0.91419	0.0:0.0:1.0:0.0	.	455	P54136	SYRC_HUMAN	H	455;249	ENSP00000231572:R455H;ENSP00000439108:R249H	ENSP00000231572:R455H	R	+	2	0	RARS	167870181	1.000000	0.71417	0.998000	0.56505	0.501000	0.33797	9.328000	0.96403	2.462000	0.83206	0.655000	0.94253	CGT	.	G|0.999;A|0.001		0.373	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252794.2	NM_002887	
HDGFL1	154150	hgsc.bcm.edu	37	6	22570024	22570024	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr6:22570024G>A	ENST00000230012.3	+	1	347	c.220G>A	c.(220-222)Ggc>Agc	p.G74S	HDGFL1_ENST00000510882.2_Missense_Mutation_p.G74S	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	74										kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					CAAGAGGCGCGGCTTCAGCGC	0.622																																					p.G74S		Atlas-SNP	.											.	HDGFL1	33	.	0			c.G220A						.						42.0	41.0	41.0					6																	22570024		2203	4300	6503	SO:0001583	missense	154150	exon1			AGGCGCGGCTTCA	AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.220G>A	chr6.hg19:g.22570024G>A	ENSP00000230012:p.Gly74Ser	89.0	0.0		108.0	53.0	NM_138574	Q96MJ6	Missense_Mutation	SNP	ENST00000230012.3	hg19	CCDS34347.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.259295	0.80246	.	.	ENSG00000112273	ENST00000230012;ENST00000510882	T;T	0.69806	-0.43;-0.43	3.28	2.41	0.29592	.	0.060986	0.64402	N	0.000004	T	0.77082	0.4078	M	0.91510	3.215	0.42829	D	0.994013	D	0.76494	0.999	D	0.67725	0.953	T	0.80094	-0.1526	10	0.87932	D	0	-56.8526	8.6839	0.34225	0.118:0.0:0.882:0.0	.	74	Q5TGJ6	HDGL1_HUMAN	S	74	ENSP00000230012:G74S;ENSP00000442129:G74S	ENSP00000230012:G74S	G	+	1	0	HDGFL1	22678003	1.000000	0.71417	0.898000	0.35279	0.942000	0.58702	5.145000	0.64839	0.956000	0.37904	0.491000	0.48974	GGC	.	.		0.622	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043500.1	NM_138574	
ELOVL4	6785	hgsc.bcm.edu	37	6	80629233	80629234	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr6:80629233_80629234GA>TT	ENST00000369816.4	-	5	872_873	c.572_573TC>AA	c.(571-573)aTC>aAA	p.I191K		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	191					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)			central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	TAATCACATGGATAAAGGAATT	0.366																																					p.I191I|p.I191N		Atlas-SNP	.											.	ELOVL4	46	.	0			c.C573A|c.T572A						.																																			SO:0001583	missense	6785	exon5			CACATGGATAAAG|ACATGGATAAAGG	AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.572_573delinsTT	chr6.hg19:g.80629233_80629234delinsTT	ENSP00000358831:p.Ile191Lys	130.0|131.0	0.0		139.0|138.0	53.0|51.0	NM_022726	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Silent|Missense_Mutation	SNP	ENST00000369816.4	hg19	CCDS4992.1																																																																																			.	.		0.366	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041315.1		
FAM26E	254228	hgsc.bcm.edu	37	6	116837131	116837131	+	Silent	SNP	G	G	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr6:116837131G>T	ENST00000368599.3	+	2	960	c.909G>T	c.(907-909)gtG>gtT	p.V303V	TRAPPC3L_ENST00000368602.3_Intron	NM_153711.2	NP_714922.1	Q8N5C1	FA26E_HUMAN	family with sequence similarity 26, member E	303					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(87;0.0608)|all_epithelial(87;0.05)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0242)|all cancers(137;0.0419)|OV - Ovarian serous cystadenocarcinoma(136;0.0671)|Epithelial(106;0.212)		TGGTCCTTGTGGGTACTGCCC	0.498																																					p.V303V		Atlas-SNP	.											.	FAM26E	26	.	0			c.G909T						.						118.0	103.0	108.0					6																	116837131		2203	4300	6503	SO:0001819	synonymous_variant	254228	exon2			CCTTGTGGGTACT	BC032556	CCDS5108.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000178033	ENSG00000178033			21568	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 188"""	C6orf188			Standard	NM_153711		Approved	dJ493F7.3, MGC45451	uc003pwy.3	Q8N5C1	OTTHUMG00000015442	ENST00000368599.3:c.909G>T	chr6.hg19:g.116837131G>T		40.0	0.0		59.0	8.0	NM_153711	B2RDJ9|B3KSR3	Silent	SNP	ENST00000368599.3	hg19	CCDS5108.1																																																																																			.	.		0.498	FAM26E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041956.1	NM_153711	
HOXA7	3204	hgsc.bcm.edu	37	7	27196120	27196120	+	Silent	SNP	C	C	A	rs201461196		TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr7:27196120C>A	ENST00000242159.3	-	1	178	c.45G>T	c.(43-45)acG>acT	p.T15T	RP1-170O19.21_ENST00000602610.1_lincRNA|HOXA7_ENST00000523796.2_5'Flank|HOXA-AS3_ENST00000518947.2_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7	15					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						AAGCCCCCGCCGTATATTTGC	0.527																																					p.T15T		Atlas-SNP	.											.	HOXA7	34	.	0			c.G45T						.						65.0	81.0	76.0					7																	27196120		2197	4289	6486	SO:0001819	synonymous_variant	3204	exon1			CCCCGCCGTATAT		CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217	ENST00000242159.3:c.45G>T	chr7.hg19:g.27196120C>A		203.0	0.0		216.0	88.0	NM_006896	A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	Silent	SNP	ENST00000242159.3	hg19	CCDS5408.1																																																																																			.	C|0.999;T|0.001		0.527	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358695.1		
CACNA2D1	781	hgsc.bcm.edu	37	7	81599250	81599250	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr7:81599250T>A	ENST00000356253.5	-	28	2546	c.2291A>T	c.(2290-2292)tAt>tTt	p.Y764F	CACNA2D1_ENST00000535308.1_Intron|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.Y752F			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	764					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	GCTCCTTTTATAGAAGCTGTC	0.348																																					p.Y752F		Atlas-SNP	.											.	CACNA2D1	191	.	0			c.A2255T						.						151.0	147.0	149.0					7																	81599250		2203	4299	6502	SO:0001583	missense	781	exon28			CTTTTATAGAAGC	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2291A>T	chr7.hg19:g.81599250T>A	ENSP00000348589:p.Tyr764Phe	88.0	0.0		88.0	37.0	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.173693|5.173693	0.94807|0.94807	.|.	.|.	ENSG00000153956|ENSG00000153956	ENST00000443883|ENST00000356860;ENST00000284088;ENST00000356253	.|T;T	.|0.80393	.|-1.37;-1.37	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87951|0.87951	0.6307|0.6307	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.78314	.|0.991	D|D	0.89011|0.89011	0.3428|0.3428	5|10	.|0.87932	.|D	.|0	-20.1323|-20.1323	16.1756|16.1756	0.81847|0.81847	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|752	.|P54289-2	.|.	L|F	263|752;771;764	.|ENSP00000349320:Y752F;ENSP00000348589:Y764F	.|ENSP00000284088:Y771F	I|Y	-|-	1|2	0|0	CACNA2D1|CACNA2D1	81437186|81437186	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.581000|7.581000	0.82535|0.82535	2.213000|2.213000	0.71641|0.71641	0.528000|0.528000	0.53228|0.53228	ATA|TAT	.	.		0.348	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
CACNA2D1	781	hgsc.bcm.edu	37	7	81599275	81599277	+	Missense_Mutation	TNP	GGT	GGT	AAC			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G|G|T	G|G|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr7:81599275_81599277GGT>AAC	ENST00000356253.5	-	28	2519_2521	c.2264_2266ACC>GTT	c.(2263-2268)aACCca>aGTTca	p.755_756NP>SS	CACNA2D1_ENST00000535308.1_Intron|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.743_744NP>SS			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	755					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TATGTCTCTGGGTTTTCTTGCCA	0.379																																					p.P744S|p.N743N|p.N743S		Atlas-SNP	.											.	CACNA2D1	191	.	0			c.C2230T|c.C2229T|c.A2228G						.																																			SO:0001583	missense	781	exon28			TCTCTGGGTTTTC|CTCTGGGTTTTCT|TCTGGGTTTTCTT	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2264_2266ACC>GTT	chr7.hg19:g.81599275GGT>AAC	ENSP00000348589:p.N755_P756delinsSS	90.0|89.0|89.0	0.0		83.0|82.0|81.0	33.0|32.0|32.0	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation|Silent|Missense_Mutation	SNP	ENST00000356253.5	hg19																																																																																				.	.		0.379	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
PPP1R3A	5506	hgsc.bcm.edu	37	7	113519477	113519477	+	Missense_Mutation	SNP	G	G	A	rs536084008		TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr7:113519477G>A	ENST00000284601.3	-	4	1738	c.1670C>T	c.(1669-1671)gCt>gTt	p.A557V		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	557					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TCTGTTACTAGCTCCAATCCC	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		18250	0.0		0.0	False		,,,				2504	0.001				p.A557V		Atlas-SNP	.											.	PPP1R3A	317	.	0			c.C1670T						.						112.0	103.0	106.0					7																	113519477		2203	4300	6503	SO:0001583	missense	5506	exon4			TTACTAGCTCCAA	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1670C>T	chr7.hg19:g.113519477G>A	ENSP00000284601:p.Ala557Val	97.0	0.0		131.0	66.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	hg19	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.817134	0.32145	.	.	ENSG00000154415	ENST00000284601	T	0.23348	1.91	6.02	1.12	0.20585	.	0.506301	0.19399	N	0.115227	T	0.20292	0.0488	L	0.56769	1.78	0.09310	N	1	B	0.25719	0.132	B	0.20577	0.03	T	0.16808	-1.0390	10	0.46703	T	0.11	-0.608	4.3255	0.11038	0.2638:0.0:0.3737:0.3626	.	557	Q16821	PPR3A_HUMAN	V	557	ENSP00000284601:A557V	ENSP00000284601:A557V	A	-	2	0	PPP1R3A	113306713	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	0.138000	0.16016	0.146000	0.19002	-0.953000	0.02652	GCT	.	.		0.423	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
SLC4A2	6522	hgsc.bcm.edu	37	7	150767561	150767561	+	Silent	SNP	A	A	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr7:150767561A>T	ENST00000485713.1	+	11	2507	c.1467A>T	c.(1465-1467)ccA>ccT	p.P489P	SLC4A2_ENST00000310317.5_Silent_p.P407P|SLC4A2_ENST00000392826.2_Silent_p.P480P|SLC4A2_ENST00000461735.1_Silent_p.P475P|SLC4A2_ENST00000413384.2_Silent_p.P489P	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	489					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCCGCCTCCAGCACCACCAG	0.647																																					p.P489P		Atlas-SNP	.											.	SLC4A2	98	.	0			c.A1467T						.						29.0	27.0	27.0					7																	150767561		2203	4300	6503	SO:0001819	synonymous_variant	6522	exon11			GCCTCCAGCACCA		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.1467A>T	chr7.hg19:g.150767561A>T		89.0	0.0		96.0	57.0	NM_003040	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Silent	SNP	ENST00000485713.1	hg19	CCDS5917.1																																																																																			.	.		0.647	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
MMP16	4325	hgsc.bcm.edu	37	8	89128908	89128908	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr8:89128908G>A	ENST00000286614.6	-	6	1192	c.911C>T	c.(910-912)cCg>cTg	p.P304L	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	304					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P304L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GGGCACTGTCGGTAGAGGTCT	0.517																																					p.P304L		Atlas-SNP	.											MMP16,rectum,carcinoma,+1,1	MMP16	176	.	1	Substitution - Missense(1)	lung(1)	c.C911T						.						198.0	205.0	203.0					8																	89128908		2203	4300	6503	SO:0001583	missense	4325	exon6			ACTGTCGGTAGAG	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.911C>T	chr8.hg19:g.89128908G>A	ENSP00000286614:p.Pro304Leu	195.0	1.0		238.0	77.0	NM_005941	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	hg19	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.689527	0.68271	.	.	ENSG00000156103	ENST00000286614	T	0.18502	2.21	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.35098	0.0920	M	0.76574	2.34	0.80722	D	1	P;B	0.46912	0.886;0.055	P;B	0.49047	0.599;0.03	T	0.05954	-1.0854	10	0.66056	D	0.02	.	20.0498	0.97621	0.0:0.0:1.0:0.0	.	304;304	P51512-2;P51512	.;MMP16_HUMAN	L	304	ENSP00000286614:P304L	ENSP00000286614:P304L	P	-	2	0	MMP16	89198024	1.000000	0.71417	0.896000	0.35187	0.993000	0.82548	8.004000	0.88535	2.753000	0.94483	0.557000	0.71058	CCG	.	.		0.517	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
COL22A1	169044	hgsc.bcm.edu	37	8	139890313	139890313	+	Missense_Mutation	SNP	C	C	T	rs375895986		TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr8:139890313C>T	ENST00000303045.6	-	3	784	c.338G>A	c.(337-339)gGc>gAc	p.G113D	COL22A1_ENST00000435777.1_Missense_Mutation_p.G113D	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	113	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTTGGTGTTGCCCCCGTGGTA	0.711										HNSCC(7;0.00092)																											p.G113D		Atlas-SNP	.											.	COL22A1	390	.	0			c.G338A						.	C	ASP/GLY	0,4374		0,0,2187	18.0	21.0	20.0		338	5.1	1.0	8		20	1,8523		0,1,4261	no	missense	COL22A1	NM_152888.1	94	0,1,6448	TT,TC,CC		0.0117,0.0,0.0078	probably-damaging	113/1627	139890313	1,12897	2187	4262	6449	SO:0001583	missense	169044	exon3			GTGTTGCCCCCGT	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.338G>A	chr8.hg19:g.139890313C>T	ENSP00000303153:p.Gly113Asp	80.0	0.0		118.0	33.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	ENST00000303045.6	hg19	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425601	0.83667	0.0	1.17E-4	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.84370	-1.84;-1.84	5.11	5.11	0.69529	von Willebrand factor, type A (3);	0.000000	0.48767	U	0.000172	D	0.93530	0.7935	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94382	0.7605	9	.	.	.	.	17.5098	0.87757	0.0:1.0:0.0:0.0	.	113	Q8NFW1	COMA1_HUMAN	D	113	ENSP00000303153:G113D;ENSP00000387655:G113D	.	G	-	2	0	COL22A1	139959495	1.000000	0.71417	1.000000	0.80357	0.340000	0.28889	7.366000	0.79548	2.341000	0.79615	0.591000	0.81541	GGC	.	.		0.711	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
LURAP1L	286343	hgsc.bcm.edu	37	9	12821394	12821394	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr9:12821394A>G	ENST00000319264.3	+	2	1017	c.322A>G	c.(322-324)Aga>Gga	p.R108G		NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	111																	GGTTAACCTCAGAGCCACAGA	0.468																																					p.R108G		Atlas-SNP	.											.	.	.	.	0			c.A322G						.						116.0	123.0	120.0					9																	12821394		2203	4300	6503	SO:0001583	missense	286343	exon2			AACCTCAGAGCCA	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.322A>G	chr9.hg19:g.12821394A>G	ENSP00000321026:p.Arg108Gly	48.0	0.0		47.0	23.0	NM_203403	Q5VZX7|Q8N923|Q8NCG2	Missense_Mutation	SNP	ENST00000319264.3	hg19	CCDS6473.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.493087	0.64186	.	.	ENSG00000153714	ENST00000319264	T	0.64085	-0.08	5.31	4.14	0.48551	.	0.000000	0.52532	D	0.000065	T	0.74230	0.3689	L	0.58810	1.83	0.51012	D	0.999907	D	0.89917	1.0	D	0.83275	0.996	T	0.75399	-0.3331	10	0.87932	D	0	.	11.9139	0.52755	0.5306:0.4694:0.0:0.0	.	111	Q8IV03	CI150_HUMAN	G	108	ENSP00000321026:R108G	ENSP00000321026:R108G	R	+	1	2	C9orf150	12811394	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	2.671000	0.46842	0.818000	0.34468	0.460000	0.39030	AGA	.	.		0.468	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
PRRC2B	84726	hgsc.bcm.edu	37	9	134334701	134334701	+	Silent	SNP	G	G	A	rs565217318	byFrequency	TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr9:134334701G>A	ENST00000357304.4	+	10	1417	c.1362G>A	c.(1360-1362)ccG>ccA	p.P454P	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Silent_p.P454P|PRRC2B_ENST00000405995.1_Silent_p.P454P	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	454							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						CTCAGCCACCGCCCAGGAAGC	0.617													G|||	2	0.000399361	0.0	0.0	5008	,	,		15507	0.0		0.0	False		,,,				2504	0.002				p.P454P		Atlas-SNP	.											.	PRRC2B	266	.	0			c.G1362A						.						39.0	47.0	44.0					9																	134334701		2077	4213	6290	SO:0001819	synonymous_variant	84726	exon10			GCCACCGCCCAGG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.1362G>A	chr9.hg19:g.134334701G>A		100.0	0.0		76.0	13.0	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	hg19	CCDS48044.1																																																																																			.	.		0.617	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
BICC1	80114	hgsc.bcm.edu	37	10	60577443	60577443	+	Silent	SNP	G	G	C			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr10:60577443G>C	ENST00000373886.3	+	19	2659	c.2655G>C	c.(2653-2655)ctG>ctC	p.L885L		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	885	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TCAGCAAACTGGGCCTGGGCA	0.418																																					p.L885L		Atlas-SNP	.											.	BICC1	121	.	0			c.G2655C						.						85.0	81.0	82.0					10																	60577443		2203	4300	6503	SO:0001819	synonymous_variant	80114	exon19			CAAACTGGGCCTG	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2655G>C	chr10.hg19:g.60577443G>C		101.0	0.0		144.0	8.0	NM_001080512		Silent	SNP	ENST00000373886.3	hg19	CCDS31206.1																																																																																			.	.		0.418	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
HK1	3098	hgsc.bcm.edu	37	10	71119657	71119657	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr10:71119657G>T	ENST00000359426.6	+	3	335	c.231G>T	c.(229-231)aaG>aaT	p.K77N	HK1_ENST00000298649.3_Missense_Mutation_p.K76N|HK1_ENST00000448642.2_Missense_Mutation_p.K112N|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000360289.2_Missense_Mutation_p.K65N|HK1_ENST00000404387.2_Missense_Mutation_p.K81N	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	77	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						AAACAGAAAAGGGAGATTTCA	0.498																																					p.K81N		Atlas-SNP	.											.	HK1	170	.	0			c.G243T						.						143.0	125.0	131.0					10																	71119657		2203	4300	6503	SO:0001583	missense	3098	exon6			AGAAAAGGGAGAT	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.231G>T	chr10.hg19:g.71119657G>T	ENSP00000352398:p.Lys77Asn	100.0	0.0		91.0	4.0	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	hg19	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664767	0.29604	.	.	ENSG00000156515	ENST00000450646;ENST00000360289;ENST00000448642;ENST00000421088;ENST00000404387;ENST00000436817;ENST00000298649;ENST00000359426;ENST00000405407	T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.51	2.61	0.31194	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.42607	0.1210	L	0.51853	1.615	0.58432	D	0.999999	B;B;B;B;B	0.16603	0.001;0.0;0.001;0.0;0.018	B;B;B;B;B	0.12156	0.004;0.004;0.005;0.007;0.002	T	0.22941	-1.0202	10	0.26408	T	0.33	-1.7372	9.4688	0.38829	0.3362:0.0:0.6638:0.0	.	77;76;112;81;65	P19367;P19367-2;E7ENR4;P19367-3;P19367-4	HXK1_HUMAN;.;.;.;.	N	81;65;112;65;81;76;76;77;77	ENSP00000409761:K81N;ENSP00000353433:K65N;ENSP00000402103:K112N;ENSP00000398316:K65N;ENSP00000384774:K81N;ENSP00000415949:K76N;ENSP00000298649:K76N;ENSP00000352398:K77N	ENSP00000298649:K76N	K	+	3	2	HK1	70789663	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.377000	0.34317	0.691000	0.31592	0.561000	0.74099	AAG	.	.		0.498	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
R3HCC1L	27291	hgsc.bcm.edu	37	10	99994235	99994235	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr10:99994235A>G	ENST00000298999.3	+	7	2297	c.1994A>G	c.(1993-1995)gAt>gGt	p.D665G	R3HCC1L_ENST00000370584.3_Missense_Mutation_p.D665G|R3HCC1L_ENST00000370586.2_Missense_Mutation_p.D71G|R3HCC1L_ENST00000314594.5_Missense_Mutation_p.D81G	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	679							nucleotide binding (GO:0000166)										TGGGTGGATGATACACATGCC	0.318																																					p.D679G		Atlas-SNP	.											.	R3HCC1L	3	.	0			c.A2036G						.						143.0	145.0	144.0					10																	99994235		2203	4300	6503	SO:0001583	missense	27291	exon8			TGGATGATACACA	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1994A>G	chr10.hg19:g.99994235A>G	ENSP00000298999:p.Asp665Gly	106.0	0.0		116.0	71.0	NM_001256619	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	hg19	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.474899	0.84640	.	.	ENSG00000166024	ENST00000370584;ENST00000298999;ENST00000370586;ENST00000314594;ENST00000544834	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.93	5.93	0.95920	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.67664	0.2917	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	T	0.71104	-0.4689	9	.	.	.	-17.5791	15.3526	0.74402	1.0:0.0:0.0:0.0	.	71;679;665	Q7Z5L2-3;Q7Z5L2;Q7Z5L2-2	.;GIDRP_HUMAN;.	G	665;665;71;81;72	ENSP00000359616:D665G;ENSP00000298999:D665G;ENSP00000359618:D71G;ENSP00000314018:D81G	.	D	+	2	0	C10orf28	99984225	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.379000	0.79691	2.257000	0.74773	0.528000	0.53228	GAT	.	.		0.318	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472	
MCMBP	79892	hgsc.bcm.edu	37	10	121587247	121587247	+	IGR	SNP	T	T	C			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr10:121587247T>C	ENST00000360003.3	-	0	4113				INPP5F_ENST00000369080.3_Silent_p.L508L|INPP5F_ENST00000361976.2_Silent_p.L1118L	NM_001256378.1|NM_001256379.1|NM_024834.3	NP_001243307.1|NP_001243308.1|NP_079110.1	Q9BTE3	MCMBP_HUMAN	minichromosome maintenance complex binding protein						DNA-dependent DNA replication (GO:0006261)|mitotic nuclear division (GO:0007067)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(2)|skin(2)	21						AAAATGAACTTAAAAAGATGT	0.348																																					p.L1118L		Atlas-SNP	.											.	INPP5F	112	.	0			c.T3354C						.						62.0	67.0	65.0					10																	121587247		2203	4300	6503	SO:0001628	intergenic_variant	22876	exon20			TGAACTTAAAAAG	BC007219	CCDS7617.1, CCDS58099.1	10q26.13	2013-10-11	2011-01-05	2011-01-05	ENSG00000197771	ENSG00000197771			25782	protein-coding gene	gene with protein product		610909	"""chromosome 10 open reading frame 119"""	C10orf119		17296731	Standard	NM_024834		Approved	FLJ13081, MCM-BP	uc001ler.3	Q9BTE3	OTTHUMG00000019159		chr10.hg19:g.121587247T>C		100.0	0.0		130.0	64.0	NM_014937	B3KSP7|Q6IA56|Q9BVT9|Q9H916	Silent	SNP	ENST00000360003.3	hg19	CCDS7617.1																																																																																			.	.		0.348	MCMBP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050684.1	NM_024834	
GPR123	84435	hgsc.bcm.edu	37	10	134942342	134942342	+	Missense_Mutation	SNP	C	C	T	rs374092448	byFrequency	TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr10:134942342C>T	ENST00000392607.3	+	7	1446	c.1010C>T	c.(1009-1011)gCg>gTg	p.A337V	GPR123_ENST00000607359.1_Missense_Mutation_p.A1056V|GPR123_ENST00000392606.2_Missense_Mutation_p.A240V	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	337					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		AACGGGGCCGCGCTGGGCCGC	0.741													C|||	2	0.000399361	0.0015	0.0	5008	,	,		10236	0.0		0.0	False		,,,				2504	0.0				p.A337V		Atlas-SNP	.											.	GPR123	118	.	0			c.C1010T						.	C	VAL/ALA	7,4021		0,7,2007	7.0	8.0	8.0		1010	-0.3	0.0	10		8	0,7888		0,0,3944	no	missense	GPR123	NM_001083909.1	64	0,7,5951	TT,TC,CC		0.0,0.1738,0.0587	probably-damaging	337/561	134942342	7,11909	2014	3944	5958	SO:0001583	missense	84435	exon7			GGGCCGCGCTGGG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.1010C>T	chr10.hg19:g.134942342C>T	ENSP00000376384:p.Ala337Val	63.0	0.0		110.0	35.0	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	hg19	CCDS41580.1	.	.	.	.	.	.	.	.	.	.	.	9.521	1.108353	0.20714	0.001738	0.0	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.04194	3.68	3.83	-0.313	0.12754	.	0.241123	0.28236	N	0.016092	T	0.08492	0.0211	M	0.71581	2.175	0.19945	N	0.999943	P;D	0.56035	0.609;0.974	B;P	0.48400	0.144;0.576	T	0.15178	-1.0446	10	0.44086	T	0.13	-2.8051	7.8744	0.29584	0.0:0.6171:0.0:0.3829	.	337;1056	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	V	1056;337;241	ENSP00000376384:A337V	ENSP00000357566:A1056V	A	+	2	0	GPR123	134792332	0.147000	0.22687	0.045000	0.18777	0.071000	0.16799	1.259000	0.32956	-0.136000	0.11475	0.561000	0.74099	GCG	.	.		0.741	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
OR52J3	119679	hgsc.bcm.edu	37	11	5068137	5068137	+	Missense_Mutation	SNP	G	G	T	rs2500017	byFrequency	TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr11:5068137G>T	ENST00000380370.1	+	1	382	c.382G>T	c.(382-384)Gtc>Ttc	p.V128F		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	128			V -> I (in dbSNP:rs2500017). {ECO:0000269|PubMed:14983052, ECO:0000269|Ref.1, ECO:0000269|Ref.3}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTATGTGGCCGTCTGTGCTCC	0.483																																					p.V128F		Atlas-SNP	.											.	OR52J3	77	.	0			c.G382T						.						176.0	117.0	137.0					11																	5068137		2201	4298	6499	SO:0001583	missense	119679	exon1			GTGGCCGTCTGTG	AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.382G>T	chr11.hg19:g.5068137G>T	ENSP00000369728:p.Val128Phe	72.0	0.0		94.0	36.0	NM_001001916	Q6IFE4	Missense_Mutation	SNP	ENST00000380370.1	hg19	CCDS31370.1	.	.	.	.	.	.	.	.	.	.	A	10.39	1.335962	0.24253	.	.	ENSG00000205495	ENST00000380370	T	0.49720	0.77	4.19	4.19	0.49359	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000211	T	0.46870	0.1415	L	0.54908	1.71	0.51767	P	6.799999999995698E-5	B	0.31290	0.318	B	0.39217	0.294	T	0.59451	-0.7452	9	0.87932	D	0	.	8.6796	0.34201	0.9077:0.0:0.0923:0.0	.	128	Q8NH60	O52J3_HUMAN	F	128	ENSP00000369728:V128F	ENSP00000369728:V128F	V	+	1	0	OR52J3	5024713	0.985000	0.35326	0.891000	0.34965	0.100000	0.18952	2.872000	0.48467	0.651000	0.30788	-0.254000	0.11334	GTC	.	G|0.493;A|0.507		0.483	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142807.1	NM_001001916	
A2M	2	hgsc.bcm.edu	37	12	9248257	9248257	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr12:9248257G>T	ENST00000318602.7	-	16	2198	c.1891C>A	c.(1891-1893)Cct>Act	p.P631T		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	631					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AAAGGCCCAGGGAAGCCAGTG	0.348																																					p.P631T		Atlas-SNP	.											.	A2M	180	.	0			c.C1891A						.						93.0	90.0	91.0					12																	9248257		1850	4095	5945	SO:0001583	missense	2	exon16			GCCCAGGGAAGCC	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.1891C>A	chr12.hg19:g.9248257G>T	ENSP00000323929:p.Pro631Thr	99.0	0.0		83.0	36.0	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	ENST00000318602.7	hg19	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	G	7.387	0.630049	0.14257	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	T	0.32023	1.47	5.65	5.65	0.86999	.	3.847120	0.00357	N	0.000035	T	0.46229	0.1382	M	0.85542	2.76	0.33882	D	0.636253	B	0.29955	0.263	B	0.29598	0.104	T	0.53443	-0.8438	10	0.23302	T	0.38	.	13.6006	0.62018	0.0:0.0:0.8447:0.1553	.	631	P01023	A2MG_HUMAN	T	631;646	ENSP00000323929:P631T	ENSP00000323929:P631T	P	-	1	0	A2M	9139524	1.000000	0.71417	0.995000	0.50966	0.247000	0.25773	4.205000	0.58466	2.821000	0.97095	0.650000	0.86243	CCT	.	.		0.348	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	
BHLHE41	79365	hgsc.bcm.edu	37	12	26275005	26275005	+	Silent	SNP	A	A	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr12:26275005A>T	ENST00000242728.4	-	5	1790	c.1443T>A	c.(1441-1443)gcT>gcA	p.A481A		NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	481					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						GGATTCAGGGAGCTTCCTTTC	0.587																																					p.A481A		Atlas-SNP	.											.	BHLHE41	20	.	0			c.T1443A						.						3.0	2.0	2.0					12																	26275005		1667	3098	4765	SO:0001819	synonymous_variant	79365	exon5			TCAGGGAGCTTCC	AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.1443T>A	chr12.hg19:g.26275005A>T		135.0	0.0		135.0	54.0	NM_030762	A2I2N8	Silent	SNP	ENST00000242728.4	hg19	CCDS8706.1	.	.	.	.	.	.	.	.	.	.	A	1.076	-0.668390	0.03428	.	.	ENSG00000123095	ENST00000540731	.	.	.	3.95	-1.3	0.09259	.	.	.	.	.	T	0.50837	0.1639	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43556	-0.9384	5	0.39692	T	0.17	.	3.6405	0.08165	0.3994:0.0:0.4314:0.1692	.	.	.	.	H	350	.	ENSP00000437369:L350H	L	-	2	0	BHLHE41	26166272	0.088000	0.21588	0.219000	0.23793	0.080000	0.17528	0.616000	0.24344	-0.398000	0.07679	-3.390000	0.00040	CTC	.	.		0.587	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1	NM_030762	
TM7SF3	51768	hgsc.bcm.edu	37	12	27133508	27133508	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr12:27133508T>C	ENST00000343028.4	-	8	1252	c.1027A>G	c.(1027-1029)Aag>Gag	p.K343E	TM7SF3_ENST00000542667.1_Intron|RP11-421F16.3_ENST00000500632.1_RNA	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	343						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					CCATCATACTTGATAGGTGTC	0.353																																					p.K343E		Atlas-SNP	.											.	TM7SF3	41	.	0			c.A1027G						.						82.0	81.0	81.0					12																	27133508		2203	4299	6502	SO:0001583	missense	51768	exon8			CATACTTGATAGG	AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.1027A>G	chr12.hg19:g.27133508T>C	ENSP00000342322:p.Lys343Glu	78.0	0.0		62.0	14.0	NM_016551	B3KMZ3|Q9NUS4	Missense_Mutation	SNP	ENST00000343028.4	hg19	CCDS8710.1	.	.	.	.	.	.	.	.	.	.	T	8.721	0.914400	0.17907	.	.	ENSG00000064115	ENST00000343028;ENST00000545344;ENST00000537406;ENST00000543655;ENST00000535819	T;T;T	0.41400	1.57;1.0;1.0	5.09	-2.53	0.06326	.	0.589219	0.18894	N	0.128232	T	0.23133	0.0559	L	0.36672	1.1	0.09310	N	1	B	0.27013	0.166	B	0.28916	0.096	T	0.32824	-0.9892	10	0.07644	T	0.81	-1.8963	6.3213	0.21219	0.0:0.278:0.344:0.378	.	343	Q9NS93	TM7S3_HUMAN	E	343;57;12;134;134	ENSP00000342322:K343E;ENSP00000441924:K134E;ENSP00000445156:K134E	ENSP00000342322:K343E	K	-	1	0	TM7SF3	27024775	0.000000	0.05858	0.001000	0.08648	0.505000	0.33919	-0.072000	0.11486	-0.223000	0.09943	0.482000	0.46254	AAG	.	.		0.353	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	NM_016551	
ARID2	196528	hgsc.bcm.edu	37	12	46244622	46244622	+	Missense_Mutation	SNP	G	G	C			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr12:46244622G>C	ENST00000334344.6	+	15	2888	c.2716G>C	c.(2716-2718)Gtt>Ctt	p.V906L	ARID2_ENST00000444670.1_Missense_Mutation_p.V516L|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.V757L|ARID2_ENST00000457135.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	906	Gln-rich.			V -> F (in Ref. 3; CAD91164). {ECO:0000305}.	chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTCTCAGCAAGTTTCATCTAC	0.473			"""N, S, F"""		hepatocellular carcinoma																																p.V906L		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.G2716C						.						136.0	120.0	125.0					12																	46244622		2203	4300	6503	SO:0001583	missense	196528	exon15			CAGCAAGTTTCAT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2716G>C	chr12.hg19:g.46244622G>C	ENSP00000335044:p.Val906Leu	153.0	0.0		175.0	13.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.773200	0.49680	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T	0.38077	1.16	5.54	4.65	0.58169	.	0.128362	0.52532	D	0.000067	T	0.25232	0.0613	N	0.24115	0.695	0.80722	D	1	B;P;B	0.37370	0.241;0.592;0.001	B;B;B	0.35971	0.157;0.215;0.001	T	0.03157	-1.1066	10	0.23302	T	0.38	-11.5509	14.5934	0.68386	0.0706:0.0:0.9294:0.0	.	906;516;906	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	L	906;757;516	ENSP00000335044:V906L	ENSP00000335044:V906L	V	+	1	0	ARID2	44530889	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.877000	0.63086	1.350000	0.45770	-0.254000	0.11334	GTT	.	.		0.473	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
HOXC4	3221	hgsc.bcm.edu	37	12	54448087	54448087	+	Silent	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr12:54448087C>T	ENST00000430889.2	+	1	427	c.381C>T	c.(379-381)agC>agT	p.S127S	HOXC4_ENST00000609810.1_Silent_p.S127S|HOXC4_ENST00000303406.4_Silent_p.S127S	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	127					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						ATCCCTCCAGCGCCGCCAGCA	0.642																																					p.S127S		Atlas-SNP	.											.	HOXC4	29	.	0			c.C381T						.						22.0	22.0	22.0					12																	54448087		2198	4298	6496	SO:0001819	synonymous_variant	3221	exon3			CTCCAGCGCCGCC		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.381C>T	chr12.hg19:g.54448087C>T		155.0	0.0		103.0	85.0	NM_014620		Silent	SNP	ENST00000430889.2	hg19	CCDS8873.1																																																																																			.	.		0.642	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
APAF1	317	hgsc.bcm.edu	37	12	99071268	99071268	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr12:99071268A>G	ENST00000551964.1	+	13	2595	c.1859A>G	c.(1858-1860)cAt>cGt	p.H620R	APAF1_ENST00000552268.1_Intron|APAF1_ENST00000357310.1_Missense_Mutation_p.H620R|APAF1_ENST00000549007.1_Missense_Mutation_p.H620R|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000550527.1_Missense_Mutation_p.H609R|APAF1_ENST00000547045.1_Missense_Mutation_p.H620R|APAF1_ENST00000359972.2_Missense_Mutation_p.H609R|APAF1_ENST00000339433.3_Missense_Mutation_p.H620R	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	620				H -> R (in Ref. 2; CAB55587). {ECO:0000305}.	activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	GCTGTTTACCATGCCTGCTTT	0.388																																					p.H620R		Atlas-SNP	.											.	APAF1	111	.	0			c.A1859G						.						108.0	92.0	97.0					12																	99071268		2203	4300	6503	SO:0001583	missense	317	exon13			TTTACCATGCCTG	AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.1859A>G	chr12.hg19:g.99071268A>G	ENSP00000448165:p.His620Arg	110.0	0.0		120.0	55.0	NM_181868	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	ENST00000551964.1	hg19	CCDS9069.1	.	.	.	.	.	.	.	.	.	.	A	16.92	3.255707	0.59321	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23;0.23;0.23	5.86	4.72	0.59763	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.205916	0.52532	D	0.000074	T	0.58921	0.2156	N	0.17838	0.53	0.80722	D	1	D;D;D;D;D	0.69078	0.971;0.995;0.964;0.995;0.997	P;D;P;D;D	0.74023	0.856;0.948;0.749;0.924;0.982	T	0.55029	-0.8204	10	0.25106	T	0.35	-15.9152	11.7691	0.51947	0.9314:0.0:0.0686:0.0	.	620;620;609;620;609	C9JLV4;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	R	620;609;620;620;609;620;620	ENSP00000448165:H620R;ENSP00000353059:H609R;ENSP00000349862:H620R;ENSP00000341830:H620R;ENSP00000448449:H609R;ENSP00000449791:H620R;ENSP00000448161:H620R	ENSP00000341830:H620R	H	+	2	0	APAF1	97595399	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.254000	0.65457	1.046000	0.40249	0.528000	0.53228	CAT	.	.		0.388	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408006.1	NM_181861.1	
ERICH6B	220081	hgsc.bcm.edu	37	13	46170693	46170693	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr13:46170693C>T	ENST00000298738.2	-	3	612	c.448G>A	c.(448-450)Gat>Aat	p.D150N		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		150	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TCAATATAATCTTCCTTCTCC	0.488																																					p.D150N		Atlas-SNP	.											.	FAM194B	42	.	0			c.G448A						.						146.0	118.0	127.0					13																	46170693		692	1591	2283	SO:0001583	missense	220081	exon3			TATAATCTTCCTT																												ENST00000298738.2:c.448G>A	chr13.hg19:g.46170693C>T	ENSP00000298738:p.Asp150Asn	127.0	0.0		82.0	9.0	NM_182542	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	hg19	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	c	4.363	0.066966	0.08388	.	.	ENSG00000165837	ENST00000298738	T	0.06142	3.34	2.35	-0.342	0.12635	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.42799	-0.9430	9	0.87932	D	0	1.6835	2.6243	0.04925	0.2111:0.3856:0.0:0.4033	.	150;150	A2VDI6;Q5W0A0	.;F194B_HUMAN	N	150	ENSP00000298738:D150N	ENSP00000298738:D150N	D	-	1	0	FAM194B	45068694	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-0.485000	0.06520	-0.329000	0.08527	0.511000	0.50034	GAT	.	.		0.488	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
SPERT	220082	hgsc.bcm.edu	37	13	46288182	46288182	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr13:46288182A>G	ENST00000310521.1	+	3	1102	c.1022A>G	c.(1021-1023)gAg>gGg	p.E341G	SPERT_ENST00000378966.3_Missense_Mutation_p.E305G	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	341						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		TCCGGGGAGGAGGAGGCCAAG	0.706																																					p.E341G		Atlas-SNP	.											.	SPERT	54	.	0			c.A1022G						.						5.0	5.0	5.0					13																	46288182		2110	4094	6204	SO:0001583	missense	220082	exon3			GGGAGGAGGAGGC	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.1022A>G	chr13.hg19:g.46288182A>G	ENSP00000309189:p.Glu341Gly	76.0	0.0		33.0	25.0	NM_152719	A8K8I5|Q8NHV2	Missense_Mutation	SNP	ENST00000310521.1	hg19	CCDS9399.1	.	.	.	.	.	.	.	.	.	.	A	17.34	3.364809	0.61513	.	.	ENSG00000174015	ENST00000310521;ENST00000378966	T;T	0.55588	0.55;0.51	4.83	4.83	0.62350	.	0.497398	0.18429	N	0.141494	T	0.61223	0.2330	L	0.32530	0.975	0.37858	D	0.929633	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.66172	-0.5990	10	0.62326	D	0.03	.	11.8769	0.52552	1.0:0.0:0.0:0.0	.	305;341	Q8NA61-2;Q8NA61	.;SPERT_HUMAN	G	341;305	ENSP00000309189:E341G;ENSP00000368249:E305G	ENSP00000309189:E341G	E	+	2	0	SPERT	45186183	0.994000	0.37717	0.525000	0.27900	0.573000	0.36030	2.934000	0.48956	2.032000	0.59987	0.496000	0.49642	GAG	.	.		0.706	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
TM9SF2	9375	hgsc.bcm.edu	37	13	100172304	100172304	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr13:100172304A>T	ENST00000376387.4	+	3	444	c.254A>T	c.(253-255)cAa>cTa	p.Q85L	TM9SF2_ENST00000463709.1_3'UTR	NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	85					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					GATTTTTGCCAAGCATCAGAA	0.363																																					p.Q85L		Atlas-SNP	.											.	TM9SF2	52	.	0			c.A254T						.						74.0	73.0	74.0					13																	100172304		2203	4300	6503	SO:0001583	missense	9375	exon3			TTTGCCAAGCATC	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.254A>T	chr13.hg19:g.100172304A>T	ENSP00000365567:p.Gln85Leu	158.0	1.0		79.0	52.0	NM_004800	A8K399|Q2TAY5	Missense_Mutation	SNP	ENST00000376387.4	hg19	CCDS9493.1	.	.	.	.	.	.	.	.	.	.	A	12.57	1.978954	0.34942	.	.	ENSG00000125304	ENST00000376387	T	0.41758	0.99	5.75	4.53	0.55603	.	0.556104	0.21188	N	0.078691	T	0.33440	0.0863	L	0.36672	1.1	0.43025	D	0.994585	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.06643	-1.0815	10	0.25751	T	0.34	-13.4889	12.8755	0.57988	0.864:0.136:0.0:0.0	.	85;85	E9PHW5;Q99805	.;TM9S2_HUMAN	L	85	ENSP00000365567:Q85L	ENSP00000365567:Q85L	Q	+	2	0	TM9SF2	98970305	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.414000	0.59802	0.968000	0.38212	0.477000	0.44152	CAA	.	.		0.363	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3		
ATP6V1D	51382	hgsc.bcm.edu	37	14	67805346	67805346	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr14:67805346A>G	ENST00000216442.7	-	9	1286	c.736T>C	c.(736-738)Ttt>Ctt	p.F246L	ATP6V1D_ENST00000555474.1_Missense_Mutation_p.F147L|Y_RNA_ENST00000362885.1_RNA|ATP6V1D_ENST00000555431.1_Missense_Mutation_p.F191L|ATP6V1D_ENST00000554236.1_3'UTR|ATP6V1D_ENST00000553974.1_5'Flank	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	246					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		GATTATTCAAATAGAAGATCC	0.403																																					p.F246L		Atlas-SNP	.											.	ATP6V1D	21	.	0			c.T736C						.						155.0	163.0	160.0					14																	67805346		2203	4300	6503	SO:0001583	missense	51382	exon9			ATTCAAATAGAAG	AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.736T>C	chr14.hg19:g.67805346A>G	ENSP00000216442:p.Phe246Leu	98.0	0.0		52.0	43.0	NM_015994	B2RE33|Q9Y688	Missense_Mutation	SNP	ENST00000216442.7	hg19	CCDS9780.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716225	0.89205	.	.	ENSG00000100554	ENST00000555474;ENST00000216442;ENST00000555431	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	N	0.24115	0.695	0.80722	D	1	D	0.67145	0.996	P	0.60682	0.878	T	0.67082	-0.5760	9	0.87932	D	0	-14.4258	16.0152	0.80434	1.0:0.0:0.0:0.0	.	246	Q9Y5K8	VATD_HUMAN	L	147;246;191	.	ENSP00000216442:F246L	F	-	1	0	ATP6V1D	66875099	1.000000	0.71417	0.997000	0.53966	0.539000	0.34962	8.395000	0.90188	2.180000	0.69256	0.533000	0.62120	TTT	.	.		0.403	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412511.1	NM_015994	
TICRR	90381	hgsc.bcm.edu	37	15	90169017	90169017	+	Splice_Site	SNP	G	G	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr15:90169017G>T	ENST00000268138.7	+	20	5581	c.5476G>T	c.(5476-5478)Ggc>Tgc	p.G1826C	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Splice_Site_p.G1825C			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1826					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)	p.G1826C(1)									GTTTGTTTCCGGTGAGTTCGT	0.502																																					p.G1826C		Atlas-SNP	.											C15orf42,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	endometrium(1)	c.G5476T						.						80.0	90.0	87.0					15																	90169017		2195	4292	6487	SO:0001630	splice_region_variant	90381	exon20			GTTTCCGGTGAGT	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.5476+1G>T	chr15.hg19:g.90169017G>T		81.0	0.0		86.0	4.0	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	hg19	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	G	14.48	2.546689	0.45383	.	.	ENSG00000140534	ENST00000268138	T	0.13538	2.58	4.96	4.04	0.47022	.	0.397421	0.23021	N	0.052841	T	0.31544	0.0800	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	T	0.02603	-1.1135	10	0.72032	D	0.01	-14.9411	10.9939	0.47565	0.0906:0.0:0.9094:0.0	.	1826	Q7Z2Z1	TICRR_HUMAN	C	1826	ENSP00000268138:G1826C	ENSP00000268138:G1826C	G	+	1	0	C15orf42	87970021	1.000000	0.71417	0.912000	0.35992	0.194000	0.23727	3.463000	0.53050	1.210000	0.43336	0.557000	0.71058	GGC	.	.		0.502	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	Missense_Mutation
ERCC4	2072	hgsc.bcm.edu	37	16	14041908	14041908	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr16:14041908A>G	ENST00000311895.7	+	11	2464	c.2455A>G	c.(2455-2457)Agc>Ggc	p.S819G		NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	819					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						GCTGAAACAAAGCAAGCCACA	0.512			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.S819G		Atlas-SNP	.	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	.	ERCC4	100	.	0			c.A2455G						.						48.0	46.0	47.0					16																	14041908		2197	4300	6497	SO:0001583	missense	2072	exon11	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AAACAAAGCAAGC	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.2455A>G	chr16.hg19:g.14041908A>G	ENSP00000310520:p.Ser819Gly	99.0	0.0		107.0	42.0	NM_005236	A5PKV6|A8K111|O00140|Q8TD83	Missense_Mutation	SNP	ENST00000311895.7	hg19	CCDS32390.1	.	.	.	.	.	.	.	.	.	.	A	2.819	-0.245292	0.05906	.	.	ENSG00000175595	ENST00000311895;ENST00000389138	T	0.58358	0.34	6.16	2.66	0.31614	DNA repair nuclease, XPF-type/Helicase (1);Restriction endonuclease, type II-like (1);	0.138164	0.64402	D	0.000003	T	0.14527	0.0351	N	0.00332	-1.63	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29912	-0.9996	10	0.11485	T	0.65	-19.1712	6.6597	0.23007	0.7356:0.1297:0.1346:0.0	.	819	Q92889	XPF_HUMAN	G	819;807	ENSP00000310520:S819G	ENSP00000310520:S819G	S	+	1	0	ERCC4	13949409	1.000000	0.71417	0.000000	0.03702	0.955000	0.61496	5.547000	0.67249	0.180000	0.19960	0.528000	0.53228	AGC	.	.		0.512	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	
TCF25	22980	hgsc.bcm.edu	37	16	89967154	89967154	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr16:89967154C>T	ENST00000263346.8	+	12	1389	c.1333C>T	c.(1333-1335)Cag>Tag	p.Q445*	TCF25_ENST00000263347.7_Nonsense_Mutation_p.Q210*	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	445					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		CTCTGCCAGGCAGAAGGCCTC	0.597																																					p.Q445X		Atlas-SNP	.											.	TCF25	61	.	0			c.C1333T						.						84.0	77.0	80.0					16																	89967154		2197	4300	6497	SO:0001587	stop_gained	22980	exon12			GCCAGGCAGAAGG	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1333C>T	chr16.hg19:g.89967154C>T	ENSP00000263346:p.Gln445*	60.0	0.0		42.0	35.0	NM_014972	Q2MK75|Q9UPV3	Nonsense_Mutation	SNP	ENST00000263346.8	hg19	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	C	8.576	0.881236	0.17467	.	.	ENSG00000141002	ENST00000263346;ENST00000263347	.	.	.	5.52	3.54	0.40534	.	0.545274	0.21024	N	0.081450	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	16.0841	0.81025	0.0:0.3894:0.6106:0.0	.	.	.	.	X	445;210	.	ENSP00000263346:Q445X	Q	+	1	0	TCF25	88494655	1.000000	0.71417	0.286000	0.24833	0.016000	0.09150	3.582000	0.53921	0.685000	0.31468	-0.226000	0.12346	CAG	.	.		0.597	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272875.2	NM_014972	
TP53	7157	hgsc.bcm.edu	37	17	7578260	7578260	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr17:7578260C>A	ENST00000269305.4	-	6	778	c.589G>T	c.(589-591)Gtg>Ttg	p.V197L	TP53_ENST00000413465.2_Missense_Mutation_p.V197L|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.V197L|TP53_ENST00000359597.4_Missense_Mutation_p.V197L|TP53_ENST00000420246.2_Missense_Mutation_p.V197L|TP53_ENST00000455263.2_Missense_Mutation_p.V197L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	197	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> E (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V197M(10)|p.0?(8)|p.V197L(6)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.V104L(1)|p.V65L(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTTCCTTCCACTCGGATAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V197L	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,+1,29	TP53	33396	.	42	Substitution - Missense(18)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Complex - deletion inframe(5)|Complex - frameshift(1)	breast(6)|biliary_tract(5)|large_intestine(5)|liver(5)|skin(4)|bone(4)|central_nervous_system(3)|lung(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|stomach(1)|oesophagus(1)|ovary(1)	c.G589T	GRCh37	CM070297	TP53	M		.						108.0	96.0	100.0					17																	7578260		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CTTCCACTCGGAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.589G>T	chr17.hg19:g.7578260C>A	ENSP00000269305:p.Val197Leu	173.0	0.0		89.0	69.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900571	0.52227	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99824	-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96	5.41	4.44	0.53790	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.059878	0.64402	D	0.000004	D	0.99739	0.9897	M	0.77820	2.39	0.51767	D	0.999939	D;P;P;D;B;D;D	0.89917	0.997;0.484;0.927;0.999;0.367;0.995;1.0	D;P;P;D;P;D;D	0.87578	0.972;0.735;0.856;0.975;0.72;0.985;0.998	D	0.97374	0.9978	10	0.54805	T	0.06	-16.054	12.3714	0.55256	0.0:0.9175:0.0:0.0824	.	158;197;197;104;197;197;197	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	197;197;197;197;197;197;186;104;65;104;65	ENSP00000410739:V197L;ENSP00000352610:V197L;ENSP00000269305:V197L;ENSP00000398846:V197L;ENSP00000391127:V197L;ENSP00000391478:V197L;ENSP00000425104:V65L;ENSP00000423862:V104L	ENSP00000269305:V197L	V	-	1	0	TP53	7518985	0.994000	0.37717	0.999000	0.59377	0.021000	0.10359	3.252000	0.51461	1.420000	0.47138	0.655000	0.94253	GTG	.	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SPECC1	92521	hgsc.bcm.edu	37	17	20013852	20013852	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr17:20013852A>G	ENST00000261503.5	+	3	311	c.260A>G	c.(259-261)gAg>gGg	p.E87G	SPECC1_ENST00000395527.4_Missense_Mutation_p.E87G|SPECC1_ENST00000395529.3_Missense_Mutation_p.E87G|SPECC1_ENST00000472876.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	87					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		GAGCTCACGGAGAGCCGCCTG	0.652																																					p.E87G		Atlas-SNP	.											.	SPECC1	100	.	0			c.A260G						.						26.0	29.0	28.0					17																	20013852		2203	4299	6502	SO:0001583	missense	92521	exon3			TCACGGAGAGCCG	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.260A>G	chr17.hg19:g.20013852A>G	ENSP00000261503:p.Glu87Gly	146.0	0.0		175.0	78.0	NM_001033553	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	hg19	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.166950	0.78339	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529	T;T	0.68903	-0.36;2.67	5.47	5.47	0.80525	.	0.128130	0.50627	D	0.000104	T	0.76414	0.3984	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.85130	0.997;0.905	T	0.78051	-0.2355	10	0.62326	D	0.03	-26.4673	13.8105	0.63260	1.0:0.0:0.0:0.0	.	87;87	Q5M775-2;Q5M775	.;CYTSB_HUMAN	G	87	ENSP00000261503:E87G;ENSP00000378900:E87G	ENSP00000261503:E87G	E	+	2	0	SPECC1	19954444	1.000000	0.71417	0.997000	0.53966	0.293000	0.27360	4.079000	0.57613	2.219000	0.72066	0.533000	0.62120	GAG	.	.		0.652	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
PSENEN	55851	hgsc.bcm.edu	37	19	36236844	36236844	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr19:36236844C>T	ENST00000587708.2	+	2	696	c.13C>T	c.(13-15)Cga>Tga	p.R5*	U2AF1L4_ENST00000378975.3_5'Flank|PSENEN_ENST00000591949.1_Nonsense_Mutation_p.R5*|U2AF1L4_ENST00000412391.2_5'Flank|PSENEN_ENST00000222266.2_Nonsense_Mutation_p.R5*|LIN37_ENST00000301159.9_5'Flank|U2AF1L4_ENST00000588100.1_5'Flank|AC002398.9_ENST00000591613.2_Nonsense_Mutation_p.R5*|U2AF1L4_ENST00000292879.5_5'Flank|AC002398.11_ENST00000585365.1_RNA|AD000671.6_ENST00000589807.1_5'Flank|AC002398.11_ENST00000591091.1_RNA			Q9NZ42	PEN2_HUMAN	presenilin enhancer gamma secretase subunit	5					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|prostate(1)	8	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAACCTGGAGCGAGTGTCCAA	0.567																																					p.R5X		Atlas-SNP	.											.	PSENEN	16	.	0			c.C13T						.						69.0	69.0	69.0					19																	36236844		2203	4300	6503	SO:0001587	stop_gained	55851	exon2			CTGGAGCGAGTGT	AF220053	CCDS12474.1	19q13.12	2014-09-17	2013-09-12			ENSG00000205155			30100	protein-coding gene	gene with protein product		607632	"""presenilin enhancer 2 homolog (C. elegans)"""			12110170, 12660785	Standard	NM_172341		Approved	PEN2	uc002obi.1	Q9NZ42		ENST00000587708.2:c.13C>T	chr19.hg19:g.36236844C>T	ENSP00000468411:p.Arg5*	70.0	0.0		87.0	5.0	NM_172341	B2R5L9	Nonsense_Mutation	SNP	ENST00000587708.2	hg19	CCDS12474.1	.	.	.	.	.	.	.	.	.	.	C	38	6.656232	0.97739	.	.	ENSG00000205155	ENST00000222266	.	.	.	5.4	4.37	0.52481	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-0.9524	13.2086	0.59811	0.0:0.9228:0.0:0.0772	.	.	.	.	X	5	.	ENSP00000222266:R5X	R	+	1	2	PSENEN	40928684	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.305000	0.43664	1.536000	0.49237	0.650000	0.86243	CGA	.	.		0.567	PSENEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459101.2	NM_172341	
ZFP30	22835	hgsc.bcm.edu	37	19	38126594	38126594	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr19:38126594G>T	ENST00000351218.2	-	6	1405	c.848C>A	c.(847-849)gCa>gAa	p.A283E	ZFP30_ENST00000514101.2_Missense_Mutation_p.A283E|ZFP30_ENST00000392144.1_Missense_Mutation_p.A283E|ZFP30_ENST00000589018.1_Intron	NM_014898.2	NP_055713.1	Q9Y2G7	ZFP30_HUMAN	ZFP30 zinc finger protein	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	21			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTAAGGTGTGCATACTGCCT	0.448																																					p.A283E		Atlas-SNP	.											.	ZFP30	68	.	0			c.C848A						.						121.0	117.0	118.0					19																	38126594		2203	4300	6503	SO:0001583	missense	22835	exon6			AGGTGTGCATACT	AB023178	CCDS33005.1	19q13.13	2013-01-08	2012-11-27		ENSG00000120784	ENSG00000120784		"""Zinc fingers, C2H2-type"", ""-"""	29555	protein-coding gene	gene with protein product			"""zinc finger protein 30 homolog (mouse)"""			10231032	Standard	NM_014898		Approved	ZNF745, KIAA0961	uc002ogx.1	Q9Y2G7	OTTHUMG00000048177	ENST00000351218.2:c.848C>A	chr19.hg19:g.38126594G>T	ENSP00000343581:p.Ala283Glu	82.0	0.0		99.0	4.0	NM_014898	Q58EY8	Missense_Mutation	SNP	ENST00000351218.2	hg19	CCDS33005.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352555	0.61293	.	.	ENSG00000120784	ENST00000351218;ENST00000514101;ENST00000392144	T;T;T	0.36699	1.24;1.24;1.24	3.99	3.99	0.46301	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34802	N	0.003678	T	0.42743	0.1216	N	0.17474	0.49	0.30295	N	0.789964	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.43523	-0.9386	10	0.72032	D	0.01	.	13.4446	0.61134	0.0:0.0:1.0:0.0	.	283;283	D3Y2A0;Q9Y2G7	.;ZFP30_HUMAN	E	283	ENSP00000343581:A283E;ENSP00000422930:A283E;ENSP00000375988:A283E	ENSP00000343581:A283E	A	-	2	0	ZFP30	42818434	0.040000	0.19996	1.000000	0.80357	0.988000	0.76386	2.368000	0.44222	2.223000	0.72356	0.655000	0.94253	GCA	.	.		0.448	ZFP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109601.2	NM_014898	
ZIM2	23619	hgsc.bcm.edu	37	19	57286077	57286077	+	Silent	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr19:57286077A>G	ENST00000391708.3	-	12	2105	c.1563T>C	c.(1561-1563)acT>acC	p.T521T	AC006115.3_ENST00000595954.1_RNA|ZIM2_ENST00000593711.1_Silent_p.T521T|AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000221722.5_Silent_p.T521T|AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000601070.1_Silent_p.T521T|ZIM2_ENST00000599935.1_Silent_p.T521T	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		CGCACTCAACAGTTTTCTCTT	0.448																																					p.T521T		Atlas-SNP	.											.	ZIM2	511	.	0			c.T1563C						.						98.0	94.0	95.0					19																	57286077		2203	4300	6503	SO:0001819	synonymous_variant	23619	exon11			CTCAACAGTTTTC	AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.1563T>C	chr19.hg19:g.57286077A>G		98.0	0.0		125.0	55.0	NM_015363	Q2M3K1	Silent	SNP	ENST00000391708.3	hg19	CCDS33123.1																																																																																			.	.		0.448	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2		
HSPA13	6782	hgsc.bcm.edu	37	21	15750651	15750651	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr21:15750651C>G	ENST00000285667.3	-	3	516	c.449G>C	c.(448-450)cGa>cCa	p.R150P	HSPA13_ENST00000544452.1_Intron|HSPA13_ENST00000478035.1_5'Flank	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	150						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						CAACAATAGTCGAGAGCCAAC	0.393																																					p.R150P		Atlas-SNP	.											.	HSPA13	44	.	0			c.G449C						.						102.0	92.0	95.0					21																	15750651		2203	4300	6503	SO:0001583	missense	6782	exon3			AATAGTCGAGAGC		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.449G>C	chr21.hg19:g.15750651C>G	ENSP00000285667:p.Arg150Pro	89.0	0.0		150.0	50.0	NM_006948	B2R616|Q8NE40	Missense_Mutation	SNP	ENST00000285667.3	hg19	CCDS13567.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026400	0.75390	.	.	ENSG00000155304	ENST00000285667	T	0.01025	5.43	5.88	4.98	0.66077	.	0.111621	0.64402	D	0.000012	T	0.03220	0.0094	M	0.72894	2.215	0.80722	D	1	D	0.59767	0.986	P	0.59761	0.863	T	0.35375	-0.9791	10	0.52906	T	0.07	-15.6822	7.9899	0.30235	0.0:0.7594:0.0:0.2406	.	150	P48723	HSP13_HUMAN	P	150	ENSP00000285667:R150P	ENSP00000285667:R150P	R	-	2	0	HSPA13	14672522	0.903000	0.30736	0.997000	0.53966	0.996000	0.88848	0.854000	0.27791	2.780000	0.95670	0.655000	0.94253	CGA	.	.		0.393	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
TBL1X	6907	hgsc.bcm.edu	37	X	9677726	9677726	+	Silent	SNP	A	A	G			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chrX:9677726A>G	ENST00000217964.7	+	15	2005	c.1365A>G	c.(1363-1365)aaA>aaG	p.K455K	TBL1X_ENST00000424279.1_Silent_p.K404K|TBL1X_ENST00000407597.2_Silent_p.K455K|TBL1X_ENST00000380961.1_Silent_p.K404K|TBL1X_ENST00000536365.1_Silent_p.K404K	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	455					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				CTCACAATAAAGAGATCTACA	0.517											OREG0019658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K455K		Atlas-SNP	.											.	TBL1X	103	.	0			c.A1365G						.						58.0	40.0	46.0					X																	9677726		2203	4300	6503	SO:0001819	synonymous_variant	6907	exon15			CAATAAAGAGATC	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.1365A>G	chrX.hg19:g.9677726A>G		147.0	0.0	658	178.0	165.0	NM_001139466	A8K044|A8K4J7|Q86UY2	Silent	SNP	ENST00000217964.7	hg19	CCDS14133.1																																																																																			.	.		0.517	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
MAGEB18	286514	hgsc.bcm.edu	37	X	26157400	26157400	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chrX:26157400G>A	ENST00000325250.1	+	2	485	c.298G>A	c.(298-300)Gag>Aag	p.E100K		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	100	Interaction with LNX1.					cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						AAGGGAAGCTGAGGGCTGGAA	0.448																																					p.E100K		Atlas-SNP	.											.	MAGEB18	67	.	0			c.G298A						.						37.0	32.0	33.0					X																	26157400		2202	4300	6502	SO:0001583	missense	286514	exon2			GAAGCTGAGGGCT	AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.298G>A	chrX.hg19:g.26157400G>A	ENSP00000314543:p.Glu100Lys	55.0	0.0		50.0	46.0	NM_173699		Missense_Mutation	SNP	ENST00000325250.1	hg19	CCDS14216.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909150	0.33721	.	.	ENSG00000176774	ENST00000325250	T	0.02197	4.4	4.79	2.11	0.27256	.	1.601550	0.03768	N	0.259320	T	0.03520	0.0101	L	0.52266	1.64	0.09310	N	1	B	0.24317	0.101	B	0.21708	0.036	T	0.46005	-0.9222	10	0.37606	T	0.19	.	6.1073	0.20081	0.3212:0.0:0.6788:0.0	.	100	Q96M61	MAGBI_HUMAN	K	100	ENSP00000314543:E100K	ENSP00000314543:E100K	E	+	1	0	MAGEB18	26067321	0.017000	0.18338	0.003000	0.11579	0.007000	0.05969	0.654000	0.24918	0.327000	0.23409	0.600000	0.82982	GAG	.	.		0.448	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056120.1	NM_173699	
MAGEB16	139604	hgsc.bcm.edu	37	X	35820424	35820424	+	Silent	SNP	C	C	T			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chrX:35820424C>T	ENST00000399989.1	+	2	390	c.111C>T	c.(109-111)acC>acT	p.T37T	MAGEB16_ENST00000399988.1_Silent_p.T37T|MAGEB16_ENST00000399985.1_Silent_p.T37T|MAGEB16_ENST00000399987.1_Silent_p.T37T|MAGEB16_ENST00000399992.1_Silent_p.T69T	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	37										breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						TGGAGAAGACCCTCCTCTCCT	0.552																																					p.T37T		Atlas-SNP	.											.	MAGEB16	64	.	0			c.C111T						.						42.0	42.0	42.0					X																	35820424		2025	4158	6183	SO:0001819	synonymous_variant	139604	exon2			GAAGACCCTCCTC		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.111C>T	chrX.hg19:g.35820424C>T		66.0	0.0		81.0	19.0	NM_001099921	A8MU30	Silent	SNP	ENST00000399989.1	hg19	CCDS43927.1																																																																																			.	.		0.552	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1		
ITIH6	347365	hgsc.bcm.edu	37	X	54784679	54784679	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chrX:54784679T>C	ENST00000218436.6	-	8	1857	c.1828A>G	c.(1828-1830)Atg>Gtg	p.M610V		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	610					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										GGTTGCACCATGACCAGTGAA	0.567																																					p.M610V		Atlas-SNP	.											.	.	.	.	0			c.A1828G						.						52.0	40.0	44.0					X																	54784679		2203	4300	6503	SO:0001583	missense	347365	exon8			GCACCATGACCAG	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1828A>G	chrX.hg19:g.54784679T>C	ENSP00000218436:p.Met610Val	105.0	0.0		106.0	93.0	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	hg19	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.634509	0.00114	.	.	ENSG00000102313	ENST00000218436	T	0.04275	3.66	3.88	1.44	0.22558	.	0.246831	0.32161	N	0.006485	T	0.02342	0.0072	N	0.19112	0.55	0.23550	N	0.997432	B	0.02656	0.0	B	0.01281	0.0	T	0.48186	-0.9057	10	0.02654	T	1	.	5.6045	0.17371	0.0:0.4751:0.0:0.5249	.	610	Q6UXX5	ITH5L_HUMAN	V	610	ENSP00000218436:M610V	ENSP00000218436:M610V	M	-	1	0	ITIH5L	54801404	1.000000	0.71417	0.906000	0.35671	0.110000	0.19582	1.595000	0.36708	0.272000	0.22027	0.483000	0.47432	ATG	.	.		0.567	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
AR	367	hgsc.bcm.edu	37	X	66931524	66931524	+	Silent	SNP	C	C	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chrX:66931524C>A	ENST00000374690.3	+	4	2690	c.2166C>A	c.(2164-2166)gcC>gcA	p.A722A	AR_ENST00000396043.2_Silent_p.A190A|AR_ENST00000396044.3_Silent_p.A722A	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	721	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.		L -> F (in AIS).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GGGCCAAGGCCTTGCCTGGTA	0.532									Androgen Insensitivity Syndrome																												p.A722A		Atlas-SNP	.											.	AR	249	.	0			c.C2166A	GRCh37	CD025334	AR	D		.						67.0	52.0	57.0					X																	66931524		2203	4300	6503	SO:0001819	synonymous_variant	367	exon4	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CAAGGCCTTGCCT	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2166C>A	chrX.hg19:g.66931524C>A		178.0	0.0		185.0	22.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.		0.532	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
SLITRK2	84631	hgsc.bcm.edu	37	X	144904694	144904694	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chrX:144904694G>A	ENST00000370490.1	+	1	5006	c.751G>A	c.(751-753)Ggg>Agg	p.G251R	SLITRK2_ENST00000434188.2_Missense_Mutation_p.G251R|SLITRK2_ENST00000428560.2_Missense_Mutation_p.G251R|SLITRK2_ENST00000447897.2_Missense_Mutation_p.G251R|SLITRK2_ENST00000413937.2_Missense_Mutation_p.G251R			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	251	LRRCT 1.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TAGGTTGCATGGGAAAGACGT	0.512																																					p.G251R		Atlas-SNP	.											.	SLITRK2	221	.	0			c.G751A						.						104.0	98.0	100.0					X																	144904694		2203	4300	6503	SO:0001583	missense	84631	exon5			TTGCATGGGAAAG	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.751G>A	chrX.hg19:g.144904694G>A	ENSP00000359521:p.Gly251Arg	69.0	0.0		80.0	75.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	hg19	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.020340	0.75275	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2	5.0	5.0	0.66597	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.79947	0.4534	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84226	0.0464	10	0.62326	D	0.03	-7.7593	14.7267	0.69349	0.0:0.0:1.0:0.0	.	251	Q9H156	SLIK2_HUMAN	R	251	ENSP00000334374:G251R;ENSP00000411681:G251R;ENSP00000359521:G251R;ENSP00000397015:G251R;ENSP00000407347:G251R;ENSP00000412010:G251R	ENSP00000334374:G251R	G	+	1	0	SLITRK2	144712386	1.000000	0.71417	0.980000	0.43619	0.996000	0.88848	9.869000	0.99810	2.058000	0.61347	0.600000	0.82982	GGG	.	.		0.512	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
FAM20A	54757	hgsc.bcm.edu	37	17	66538937	66538937	+	Frame_Shift_Del	DEL	G	G	-	rs387907215		TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr17:66538937delG	ENST00000592554.1	-	6	1548	c.826delC	c.(826-828)cgafs	p.R277fs	FAM20A_ENST00000226094.5_5'UTR|PRKAR1A_ENST00000588188.2_Intron|AC079210.1_ENST00000600820.1_5'Flank	NM_001243746.1|NM_017565.3	NP_001230675.1|NP_060035.2	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A	277					calcium ion homeostasis (GO:0055074)|enamel mineralization (GO:0070166)|tooth eruption (GO:0044691)	cell (GO:0005623)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)				cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(1)	9	Breast(10;1.64e-13)					GGCACCCGTCGGAAGTCCAGA	0.522																																					p.R276fs		Atlas-INDEL	.											FAM20A,NS,carcinoma,0,1	FAM20A	35	.	0			c.827delG						.						98.0	95.0	96.0					17																	66538937		2203	4300	6503	SO:0001589	frameshift_variant	54757	exon6			.	AK056789	CCDS11679.1	17q24.2	2014-02-07			ENSG00000108950	ENSG00000108950			23015	protein-coding gene	gene with protein product		611062					Standard	NM_017565		Approved	DKFZp434F2322	uc002jho.3	Q96MK3	OTTHUMG00000180152	ENST00000592554.1:c.826delC	chr17.hg19:g.66538937delG	ENSP00000468308:p.Arg277fs	63.0	0.0		68.0	26.0	NM_017565	B2RN47|B2RN49|Q9UF95	Frame_Shift_Del	DEL	ENST00000592554.1	hg19	CCDS11679.1																																																																																			.	.		0.522	FAM20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450029.2	NM_017565	
SLC25A47	283600	hgsc.bcm.edu	37	14	100795930	100795932	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr14:100795930_100795932delTCT	ENST00000361529.3	+	6	953_955	c.875_877delTCT	c.(874-879)gtcttc>gtc	p.F293del	SLC25A47_ENST00000557052.1_In_Frame_Del_p.F147del	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47	293					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						AACATGGTGGTCTTCGTCGCCTA	0.64																																					p.292_292del	GBM(11;1289 1351)	Atlas-INDEL	.											.	SLC25A47	36	.	0			c.874_876del						.																																			SO:0001651	inframe_deletion	283600	exon6			.		CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.875_877delTCT	chr14.hg19:g.100795930_100795932delTCT	ENSP00000354886:p.Phe293del	48.0	0.0		33.0	23.0	NM_207117	B2RP39|Q68CL2|Q6PZD8|Q86U14	In_Frame_Del	DEL	ENST00000361529.3	hg19	CCDS9959.1																																																																																			.	.		0.640	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414231.1		
POMGNT1	55624	hgsc.bcm.edu	37	1	46654650	46654653	+	3'UTR	DEL	GGCC	GGCC	-			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	GGCC	GGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr1:46654650_46654653delGGCC	ENST00000371984.3	-	0	2429_2432				POMGNT1_ENST00000396420.3_3'UTR|POMGNT1_ENST00000535522.1_3'UTR|POMGNT1_ENST00000371986.3_Splice_Site_p.A663fs|POMGNT1_ENST00000485714.1_5'Flank|POMGNT1_ENST00000371992.1_Splice_Site_p.A663fs	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)						protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					TTCTGAGCCAGGCCTGGAAAGTGA	0.495																																					p.662_663del		Atlas-INDEL	.											.	POMGNT1	96	.	0			c.1986_1989del						.																																			SO:0001624	3_prime_UTR_variant	55624	exon23			.		CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.*292GGCC>-	chr1.hg19:g.46654650_46654653delGGCC		39.0	0.0		25.0	23.0	NM_001243766	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Frame_Shift_Del	DEL	ENST00000371984.3	hg19	CCDS531.1																																																																																			.	.		0.495	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020146.1	NM_017739	
ANKRD30B	374860	hgsc.bcm.edu	37	18	14772230	14772230	+	Intron	DEL	A	A	-			TCGA-RC-A7SH-01A-11D-A382-10	TCGA-RC-A7SH-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	bd131049-2873-436b-8759-496f580bd84e	13d667d3-0fd0-4480-9de6-f626c9dc9128	g.chr18:14772230delA	ENST00000358984.4	+	9	1509				AP006564.1_ENST00000579337.1_RNA|ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Intron	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CTACCAAGGTAAAATGTTCTT	0.299																																					.		Atlas-INDEL	.											.	ANKRD30B	237	.	0			c.1329+2A>-						.						108.0	91.0	96.0					18																	14772230		692	1587	2279	SO:0001627	intron_variant	374860	exon9			.	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.1329+3A>-	chr18.hg19:g.14772230delA		93.0	0.0		114.0	40.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Splice_Site	DEL	ENST00000358984.4	hg19	CCDS54182.1																																																																																			.	.		0.299	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	
