#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VAMP3	9341	hgsc.bcm.edu	37	1	7837247	7837247	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:7837247G>A	ENST00000054666.6	+	3	215	c.100G>A	c.(100-102)Gac>Aac	p.D34N	RP3-467L1.6_ENST00000602406.1_RNA|VAMP3_ENST00000470357.1_Missense_Mutation_p.D6N	NM_004781.3	NP_004772.1	Q15836	VAMP3_HUMAN	vesicle-associated membrane protein 3	34	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				calcium ion-dependent exocytosis (GO:0017156)|exocytosis (GO:0006887)|Golgi to plasma membrane protein transport (GO:0043001)|membrane fusion (GO:0061025)|positive regulation of receptor recycling (GO:0001921)|protein complex assembly (GO:0006461)|retrograde transport, endosome to Golgi (GO:0042147)|SNARE complex assembly (GO:0035493)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|secretory granule (GO:0030141)|SNARE complex (GO:0031201)|synapse (GO:0045202)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	6	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;6.33e-69)|GBM - Glioblastoma multiforme(8;2.07e-34)|Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.38e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000805)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		AGTTAACGTGGACAAGGTTCT	0.527																																					p.D34N		Atlas-SNP	.											.	VAMP3	14	.	0			c.G100A						.						102.0	95.0	97.0					1																	7837247		2203	4300	6503	SO:0001583	missense	9341	exon3			AACGTGGACAAGG	BC003570	CCDS88.1	1p36.23	2013-02-13	2012-10-17		ENSG00000049245	ENSG00000049245		"""Vesicle-associated membrane proteins"""	12644	protein-coding gene	gene with protein product	"""cellubrevin"""	603657				9885218	Standard	NM_004781		Approved	CEB	uc001aol.3	Q15836	OTTHUMG00000001225	ENST00000054666.6:c.100G>A	chr1.hg19:g.7837247G>A	ENSP00000054666:p.Asp34Asn	112.0	0.0		41.0	9.0	NM_004781	Q9BRV4	Missense_Mutation	SNP	ENST00000054666.6	hg19	CCDS88.1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440217	0.63067	.	.	ENSG00000049245	ENST00000054666	T	0.33216	1.42	6.17	5.24	0.73138	Synaptobrevin (4);	0.000000	0.85682	D	0.000000	T	0.39358	0.1075	M	0.62723	1.935	0.80722	D	1	B	0.29766	0.256	B	0.36378	0.223	T	0.23940	-1.0174	10	0.49607	T	0.09	-0.399	17.4035	0.87467	0.0:0.1246:0.8754:0.0	.	34	Q15836	VAMP3_HUMAN	N	34	ENSP00000054666:D34N	ENSP00000054666:D34N	D	+	1	0	VAMP3	7759834	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	9.760000	0.98935	1.565000	0.49641	0.655000	0.94253	GAC	.	.		0.527	VAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003625.1	NM_004781	
GMEB1	10691	hgsc.bcm.edu	37	1	29040743	29040743	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:29040743T>C	ENST00000294409.2	+	10	1270	c.1180T>C	c.(1180-1182)Tct>Cct	p.S394P	GMEB1_ENST00000361872.4_Missense_Mutation_p.S384P|GMEB1_ENST00000373816.1_Missense_Mutation_p.S384P|GMEB1_ENST00000480454.1_3'UTR	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	394					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		CTTGAGCCCTTCTCCTCCTGT	0.557																																					p.S394P		Atlas-SNP	.											.	GMEB1	28	.	0			c.T1180C						.						104.0	99.0	101.0					1																	29040743		2203	4300	6503	SO:0001583	missense	10691	exon10			AGCCCTTCTCCTC	AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.1180T>C	chr1.hg19:g.29040743T>C	ENSP00000294409:p.Ser394Pro	146.0	0.0		70.0	19.0	NM_006582	B1AT48|Q9NWH1|Q9UKD0	Missense_Mutation	SNP	ENST00000294409.2	hg19	CCDS327.1	.	.	.	.	.	.	.	.	.	.	T	16.95	3.264587	0.59431	.	.	ENSG00000162419	ENST00000373816;ENST00000456852;ENST00000361872;ENST00000294409	T;T;T	0.61980	0.06;0.06;0.06	5.47	5.47	0.80525	.	0.131431	0.52532	D	0.000066	T	0.54498	0.1862	L	0.52573	1.65	0.26378	N	0.976773	B;B	0.12630	0.006;0.006	B;B	0.09377	0.004;0.004	T	0.53599	-0.8416	10	0.72032	D	0.01	-15.6911	9.1279	0.36828	0.0:0.0828:0.0:0.9172	.	394;384	Q9Y692;B1AT47	GMEB1_HUMAN;.	P	384;360;384;394	ENSP00000362922:S384P;ENSP00000355186:S384P;ENSP00000294409:S394P	ENSP00000294409:S394P	S	+	1	0	GMEB1	28913330	0.973000	0.33851	1.000000	0.80357	0.998000	0.95712	1.856000	0.39389	2.076000	0.62316	0.533000	0.62120	TCT	.	.		0.557	GMEB1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000010333.1	NM_006582	
EPHA10	284656	hgsc.bcm.edu	37	1	38185617	38185617	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:38185617A>G	ENST00000373048.4	-	14	2525	c.2526T>C	c.(2524-2526)ttT>ttC	p.F842F	EPHA10_ENST00000427468.2_Silent_p.F842F|EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000540011.1_3'UTR|EPHA10_ENST00000330210.7_Silent_p.F337F	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	842	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCCGCTCCCCAAAGGCCATCA	0.607																																					p.F842F		Atlas-SNP	.											.	EPHA10	120	.	0			c.T2526C						.						62.0	66.0	65.0					1																	38185617		2203	4300	6503	SO:0001819	synonymous_variant	284656	exon14			CTCCCCAAAGGCC	AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.2526T>C	chr1.hg19:g.38185617A>G		96.0	0.0		49.0	28.0	NM_001099439	A4FU89|J3KPB5|Q6NW42	Silent	SNP	ENST00000373048.4	hg19	CCDS41305.1																																																																																			.	.		0.607	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000012497.2	NM_173641	
MROH7	374977	hgsc.bcm.edu	37	1	55144944	55144944	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:55144944A>T	ENST00000421030.2	+	12	2343	c.2058A>T	c.(2056-2058)ggA>ggT	p.G686G	MROH7_ENST00000545244.1_Silent_p.G254G|MROH7_ENST00000339553.5_Silent_p.G686G|MROH7_ENST00000409996.1_Silent_p.G254G|MROH7_ENST00000454855.2_Silent_p.G204G|MROH7_ENST00000395690.2_Silent_p.G686G|MROH7-TTC4_ENST00000414150.2_Silent_p.G686G	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	686						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											AGGAATTTGGAGACTTCCTGG	0.562																																					p.G686G		Atlas-SNP	.											.	.	.	.	0			c.A2058T						.						107.0	111.0	109.0					1																	55144944		1904	4121	6025	SO:0001819	synonymous_variant	374977	exon12			ATTTGGAGACTTC	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.2058A>T	chr1.hg19:g.55144944A>T		209.0	0.0		71.0	19.0	NM_001039464	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	hg19	CCDS41342.2																																																																																			.	.		0.562	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547	
CRTC2	200186	hgsc.bcm.edu	37	1	153920974	153920974	+	Silent	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:153920974G>A	ENST00000368633.1	-	13	1948	c.1821C>T	c.(1819-1821)caC>caT	p.H607H	CRTC2_ENST00000368630.3_Silent_p.H287H|DENND4B_ENST00000361217.4_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	607					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGCGGGAACAGTGGGTCAAGT	0.562																																					p.H607H		Atlas-SNP	.											.	CRTC2	58	.	0			c.C1821T						.						127.0	115.0	119.0					1																	153920974		2203	4300	6503	SO:0001819	synonymous_variant	200186	exon13			GGAACAGTGGGTC	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.1821C>T	chr1.hg19:g.153920974G>A		150.0	0.0		87.0	16.0	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Silent	SNP	ENST00000368633.1	hg19	CCDS30875.1																																																																																			.	.		0.562	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
LMNA	4000	hgsc.bcm.edu	37	1	156100406	156100406	+	Splice_Site	SNP	A	A	G	rs113610699		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:156100406A>G	ENST00000368300.4	+	2	568		c.e2-1		LMNA_ENST00000368299.3_Splice_Site|LMNA_ENST00000448611.2_Splice_Site|LMNA_ENST00000392353.3_Splice_Site|LMNA_ENST00000368297.1_Splice_Site|LMNA_ENST00000368301.2_Splice_Site|LMNA_ENST00000473598.2_Splice_Site|LMNA_ENST00000347559.2_Splice_Site|LMNA_ENST00000361308.4_Splice_Site	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TCTCTTCTTTAGCAATACCAA	0.577									Werner syndrome;Hutchinson-Gilford Progeria Syndrome		OREG0013866	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		Atlas-SNP	.											.	LMNA	31	.	0			c.357-2A>G						.						46.0	45.0	45.0					1																	156100406		2203	4300	6503	SO:0001630	splice_region_variant	4000	exon2	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	TTCTTTAGCAATA	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.357-1A>G	chr1.hg19:g.156100406A>G		89.0	0.0	1775	49.0	14.0	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Splice_Site	SNP	ENST00000368300.4	hg19	CCDS1129.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.054233	0.55218	.	.	ENSG00000160789	ENST00000368301;ENST00000347559;ENST00000361308;ENST00000368300;ENST00000368299;ENST00000292302;ENST00000392355;ENST00000448611;ENST00000368297;ENST00000504687;ENST00000473598;ENST00000392353	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7178	0.62708	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LMNA	154367030	1.000000	0.71417	0.958000	0.39756	0.496000	0.33645	9.267000	0.95665	2.129000	0.65627	0.533000	0.62120	.	.	.		0.577	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	Intron
BCAN	63827	hgsc.bcm.edu	37	1	156616630	156616630	+	Silent	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:156616630G>A	ENST00000329117.5	+	3	465	c.129G>A	c.(127-129)gcG>gcA	p.A43A	BCAN_ENST00000361588.5_Silent_p.A43A|RP11-284F21.10_ENST00000605886.1_RNA|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	43	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CGGGCGACGCGCCACTGCAGG	0.721																																					p.A43A		Atlas-SNP	.											.	BCAN	174	.	0			c.G129A						.						15.0	17.0	17.0					1																	156616630		2177	4239	6416	SO:0001819	synonymous_variant	63827	exon3			CGACGCGCCACTG	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.129G>A	chr1.hg19:g.156616630G>A		109.0	0.0		54.0	8.0	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent	SNP	ENST00000329117.5	hg19	CCDS1149.1																																																																																			.	.		0.721	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
HSPA6	3310	hgsc.bcm.edu	37	1	161494890	161494890	+	Missense_Mutation	SNP	G	G	C	rs373442940		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:161494890G>C	ENST00000309758.4	+	1	855	c.442G>C	c.(442-444)Gtg>Ctg	p.V148L	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	148					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			AGTGATCACCGTGCCCGCCTA	0.637																																					p.V148L		Atlas-SNP	.											.	HSPA6	53	.	0			c.G442C						.						27.0	30.0	29.0					1																	161494890		2202	4300	6502	SO:0001583	missense	3310	exon1			ATCACCGTGCCCG		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.442G>C	chr1.hg19:g.161494890G>C	ENSP00000310219:p.Val148Leu	108.0	0.0		64.0	13.0	NM_002155	Q1HBA8|Q8IYK7|Q9BT95	Missense_Mutation	SNP	ENST00000309758.4	hg19	CCDS1231.1	.	.	.	.	.	.	.	.	.	.	.	17.50	3.405612	0.62288	.	.	ENSG00000173110	ENST00000309758;ENST00000545155	T	0.01745	4.66	3.43	3.43	0.39272	.	0.000000	0.38897	U	0.001534	T	0.17365	0.0417	H	0.99962	5.075	0.51482	D	0.999924	D	0.89917	1.0	D	0.91635	0.999	T	0.48019	-0.9071	10	0.87932	D	0	-27.8476	12.3829	0.55317	0.0:0.0:1.0:0.0	.	148	P17066	HSP76_HUMAN	L	148;124	ENSP00000310219:V148L	ENSP00000310219:V148L	V	+	1	0	HSPA6	159761514	1.000000	0.71417	0.318000	0.25279	0.472000	0.32918	8.329000	0.90017	1.725000	0.51514	0.586000	0.80456	GTG	.	.		0.637	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	NM_002155	
PPP1R15B	84919	hgsc.bcm.edu	37	1	204380351	204380351	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:204380351C>A	ENST00000367188.4	-	1	568	c.189G>T	c.(187-189)tgG>tgT	p.W63C	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	63					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			GCAGTTTCGTCCAGTAACTGA	0.577																																					p.W63C		Atlas-SNP	.											.	PPP1R15B	67	.	0			c.G189T						.						66.0	71.0	69.0					1																	204380351		2203	4300	6503	SO:0001583	missense	84919	exon1			TTTCGTCCAGTAA	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.189G>T	chr1.hg19:g.204380351C>A	ENSP00000356156:p.Trp63Cys	87.0	0.0		79.0	10.0	NM_032833	Q53GQ4|Q658M2|Q6P156|Q96SN1	Missense_Mutation	SNP	ENST00000367188.4	hg19	CCDS1445.1	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893365	0.52121	.	.	ENSG00000158615	ENST00000367188	T	0.28666	1.6	5.22	5.22	0.72569	Protein phosphatase 1, regulatory subunit 15B, N-terminal (1);	0.095508	0.45867	D	0.000324	T	0.51890	0.1701	M	0.61703	1.905	0.58432	D	0.999995	D	0.76494	0.999	D	0.69824	0.966	T	0.53194	-0.8473	10	0.87932	D	0	-2.1296	14.6287	0.68640	0.0:1.0:0.0:0.0	.	63	Q5SWA1	PR15B_HUMAN	C	63	ENSP00000356156:W63C	ENSP00000356156:W63C	W	-	3	0	PPP1R15B	202646974	0.986000	0.35501	0.669000	0.29828	0.131000	0.20780	3.691000	0.54720	2.586000	0.87340	0.655000	0.94253	TGG	.	.		0.577	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
PLXNA2	5362	hgsc.bcm.edu	37	1	208219347	208219347	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:208219347T>G	ENST00000367033.3	-	18	4128	c.3371A>C	c.(3370-3372)aAc>aCc	p.N1124T		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1124	IPT/TIG 3.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TTGGACATTGTTAAAGACAAA	0.502																																					p.N1124T		Atlas-SNP	.											.	PLXNA2	178	.	0			c.A3371C						.						172.0	164.0	167.0					1																	208219347		2203	4300	6503	SO:0001583	missense	5362	exon18			ACATTGTTAAAGA	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3371A>C	chr1.hg19:g.208219347T>G	ENSP00000356000:p.Asn1124Thr	109.0	0.0		61.0	19.0	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411607	0.83340	.	.	ENSG00000076356	ENST00000367033	T	0.60171	0.21	4.51	4.51	0.55191	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	L	0.57536	1.79	0.80722	D	1	D	0.53151	0.958	P	0.49140	0.601	T	0.68138	-0.5488	10	0.87932	D	0	.	14.1385	0.65303	0.0:0.0:0.0:1.0	.	1124	O75051	PLXA2_HUMAN	T	1124	ENSP00000356000:N1124T	ENSP00000356000:N1124T	N	-	2	0	PLXNA2	206285970	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.708000	0.84633	1.804000	0.52760	0.460000	0.39030	AAC	.	.		0.502	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
RCOR3	55758	hgsc.bcm.edu	37	1	211451497	211451497	+	Nonsense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:211451497C>G	ENST00000367005.4	+	5	522	c.381C>G	c.(379-381)taC>taG	p.Y127*	RCOR3_ENST00000452621.2_Nonsense_Mutation_p.Y185*|RCOR3_ENST00000367006.4_Nonsense_Mutation_p.Y185*|RCOR3_ENST00000419091.2_Nonsense_Mutation_p.Y185*	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	127	SANT 1. {ECO:0000255|PROSITE- ProRule:PRU00624}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		TAAAATATTACTATTCTTGGA	0.333																																					p.Y185X		Atlas-SNP	.											.	RCOR3	51	.	0			c.C555G						.						75.0	77.0	77.0					1																	211451497		2203	4300	6503	SO:0001587	stop_gained	55758	exon6			ATATTACTATTCT	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.381C>G	chr1.hg19:g.211451497C>G	ENSP00000355972:p.Tyr127*	105.0	0.0		85.0	14.0	NM_001136223	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Nonsense_Mutation	SNP	ENST00000367005.4	hg19	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	C	34	5.381058	0.95945	.	.	ENSG00000117625	ENST00000533469;ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005	.	.	.	5.66	2.75	0.32379	.	0.055362	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.1984	11.2275	0.48892	0.0:0.7999:0.0:0.2001	.	.	.	.	X	127;185;185;185;127	.	ENSP00000355972:Y127X	Y	+	3	2	RCOR3	209518120	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.633000	0.46519	0.326000	0.23384	0.460000	0.39030	TAC	.	.		0.333	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
HEATR1	55127	hgsc.bcm.edu	37	1	236751283	236751283	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:236751283T>C	ENST00000366582.3	-	13	1705	c.1591A>G	c.(1591-1593)Ata>Gta	p.I531V	HEATR1_ENST00000366581.2_Missense_Mutation_p.I531V	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	531					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACAACATCTATATTATCATCA	0.343																																					p.I531V		Atlas-SNP	.											.	HEATR1	197	.	0			c.A1591G						.						123.0	116.0	119.0					1																	236751283		2203	4299	6502	SO:0001583	missense	55127	exon13			CATCTATATTATC	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1591A>G	chr1.hg19:g.236751283T>C	ENSP00000355541:p.Ile531Val	239.0	0.0		122.0	20.0	NM_018072	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	hg19	CCDS31066.1	.	.	.	.	.	.	.	.	.	.	T	0.046	-1.265675	0.01433	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.66460	-0.11;-0.21	5.84	-7.28	0.01456	Armadillo-like helical (1);Armadillo-type fold (1);	0.475201	0.23973	N	0.042742	T	0.21267	0.0512	N	0.02011	-0.69	0.30579	N	0.762751	B	0.02656	0.0	B	0.04013	0.001	T	0.45687	-0.9244	10	0.02654	T	1	.	2.2291	0.03992	0.489:0.189:0.0855:0.2364	.	531	Q9H583	HEAT1_HUMAN	V	531	ENSP00000355541:I531V;ENSP00000355540:I531V	ENSP00000355540:I531V	I	-	1	0	HEATR1	234817906	0.000000	0.05858	0.032000	0.17829	0.370000	0.29829	-0.847000	0.04331	-0.736000	0.04831	0.533000	0.62120	ATA	.	.		0.343	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
AHCTF1	25909	hgsc.bcm.edu	37	1	247014692	247014692	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:247014692T>C	ENST00000391829.2	-	33	4739	c.4616A>G	c.(4615-4617)aAt>aGt	p.N1539S	AHCTF1_ENST00000366508.1_Missense_Mutation_p.N1574S|AHCTF1_ENST00000326225.3_Missense_Mutation_p.N1548S|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1539	Disordered. {ECO:0000250}.|Mediates transcriptional activity. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AAATGAAAGATTCCTAGCCTC	0.328																																					p.N1548S	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.A4643G						.						29.0	29.0	29.0					1																	247014692		2200	4297	6497	SO:0001583	missense	25909	exon33			GAAAGATTCCTAG		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.4616A>G	chr1.hg19:g.247014692T>C	ENSP00000375705:p.Asn1539Ser	235.0	0.0		127.0	43.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	hg19		.	.	.	.	.	.	.	.	.	.	T	0.335	-0.953685	0.02285	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.28895	1.59;1.59;1.59	6.17	-4.03	0.04021	.	0.574707	0.18629	N	0.135631	T	0.08626	0.0214	N	0.08118	0	0.09310	N	1	B;B;B	0.20052	0.041;0.004;0.003	B;B;B	0.16722	0.016;0.007;0.003	T	0.31641	-0.9936	10	0.05525	T	0.97	-6.6212	3.355	0.07165	0.0954:0.3805:0.189:0.3351	.	400;1574;1539	B3KTD2;Q8WYP5-2;Q8WYP5	.;.;ELYS_HUMAN	S	1574;1548;1539	ENSP00000355464:N1574S;ENSP00000355465:N1548S;ENSP00000375705:N1539S	ENSP00000355465:N1548S	N	-	2	0	AHCTF1	245081315	0.026000	0.19158	0.016000	0.15963	0.653000	0.38743	-0.820000	0.04457	-0.589000	0.05874	0.533000	0.62120	AAT	.	.		0.328	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
NBAS	51594	hgsc.bcm.edu	37	2	15523423	15523423	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:15523423C>T	ENST00000281513.5	-	29	3301	c.3276G>A	c.(3274-3276)gaG>gaA	p.E1092E	NBAS_ENST00000441750.1_Silent_p.E972E	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1092					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TCCAATGAGACTCACTGACAG	0.373																																					p.E1092E		Atlas-SNP	.											.	NBAS	246	.	0			c.G3276A						.						89.0	88.0	89.0					2																	15523423		2203	4300	6503	SO:0001819	synonymous_variant	51594	exon29			ATGAGACTCACTG	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.3276G>A	chr2.hg19:g.15523423C>T		218.0	0.0		142.0	25.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	hg19	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	C	8.232	0.804942	0.16467	.	.	ENSG00000151779	ENST00000442506	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	T	0.76673	0.4020	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74312	-0.3706	4	.	.	.	.	19.9559	0.97218	0.0:1.0:0.0:0.0	.	.	.	.	N	140	.	.	S	-	2	0	NBAS	15440874	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	3.274000	0.51631	2.728000	0.93425	0.462000	0.41574	AGT	.	.		0.373	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
TTC27	55622	hgsc.bcm.edu	37	2	32891709	32891709	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:32891709G>T	ENST00000317907.4	+	7	1044	c.813G>T	c.(811-813)ttG>ttT	p.L271F		NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	271										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						CAGGTGCTTTGGGAAAAAGAA	0.368																																					p.L271F		Atlas-SNP	.											.	TTC27	71	.	0			c.G813T						.						104.0	110.0	108.0					2																	32891709		2203	4300	6503	SO:0001583	missense	55622	exon7			TGCTTTGGGAAAA	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.813G>T	chr2.hg19:g.32891709G>T	ENSP00000313953:p.Leu271Phe	91.0	0.0		37.0	8.0	NM_017735	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	hg19	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	G	17.65	3.441403	0.63067	.	.	ENSG00000018699	ENST00000317907	T	0.71222	-0.55	5.74	0.907	0.19321	.	0.000000	0.64402	D	0.000001	D	0.83161	0.5194	M	0.88640	2.97	0.53688	D	0.999972	D	0.89917	1.0	D	0.73708	0.981	T	0.82452	-0.0450	10	0.72032	D	0.01	-0.8942	9.5603	0.39364	0.3601:0.0:0.6399:0.0	.	271	Q6P3X3	TTC27_HUMAN	F	271	ENSP00000313953:L271F	ENSP00000313953:L271F	L	+	3	2	TTC27	32745213	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	1.388000	0.34442	0.092000	0.17331	-0.218000	0.12543	TTG	.	.		0.368	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43922295	43922295	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:43922295A>G	ENST00000282406.4	+	6	544	c.434A>G	c.(433-435)aAt>aGt	p.N145S		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	145					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GAATTGGAGAATCAGAATCTT	0.269																																					p.N145S		Atlas-SNP	.											.	PLEKHH2	156	.	0			c.A434G						.						49.0	47.0	48.0					2																	43922295		2199	4296	6495	SO:0001583	missense	130271	exon6			TGGAGAATCAGAA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.434A>G	chr2.hg19:g.43922295A>G	ENSP00000282406:p.Asn145Ser	503.0	0.0		266.0	28.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	hg19	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.353659	0.82243	.	.	ENSG00000152527	ENST00000282406	T	0.43688	0.94	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.61640	0.2363	L	0.58810	1.83	0.53688	D	0.999971	D;D	0.89917	0.996;1.0	P;D	0.91635	0.787;0.999	T	0.63550	-0.6612	10	0.59425	D	0.04	-30.3231	15.7573	0.78043	1.0:0.0:0.0:0.0	.	145;145	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	S	145	ENSP00000282406:N145S	ENSP00000282406:N145S	N	+	2	0	PLEKHH2	43775799	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.163000	0.77524	2.120000	0.65058	0.477000	0.44152	AAT	.	.		0.269	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
MSH6	2956	hgsc.bcm.edu	37	2	48027047	48027047	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:48027047A>G	ENST00000234420.5	+	4	2077	c.1925A>G	c.(1924-1926)tAt>tGt	p.Y642C	MSH6_ENST00000540021.1_Missense_Mutation_p.Y512C|MSH6_ENST00000538136.1_Missense_Mutation_p.Y340C|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	642					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GAGGAAGAATATTTTAGGGAA	0.453			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.Y642C		Atlas-SNP	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6	341	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A1925G						.						95.0	94.0	95.0					2																	48027047		2203	4300	6503	SO:0001583	missense	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	AAGAATATTTTAG	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1925A>G	chr2.hg19:g.48027047A>G	ENSP00000234420:p.Tyr642Cys	78.0	0.0		35.0	17.0	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	hg19	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	A	13.39	2.221981	0.39300	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.87809	-2.3;-2.3;-2.3	5.49	5.49	0.81192	DNA mismatch repair protein MutS, connector (1);	0.118381	0.64402	D	0.000013	D	0.95149	0.8428	M	0.93197	3.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.967	D	0.96333	0.9245	10	0.87932	D	0	-12.5268	15.5875	0.76495	1.0:0.0:0.0:0.0	.	512;642;642	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	C	642;640;512;340	ENSP00000234420:Y642C;ENSP00000446475:Y512C;ENSP00000438580:Y340C	ENSP00000234420:Y642C	Y	+	2	0	MSH6	47880551	1.000000	0.71417	0.979000	0.43373	0.272000	0.26649	8.891000	0.92485	2.089000	0.63090	0.477000	0.44152	TAT	.	.		0.453	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
DNAH6	1768	hgsc.bcm.edu	37	2	84844030	84844030	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:84844030A>T	ENST00000237449.6	+	22	3504	c.3496A>T	c.(3496-3498)Aac>Tac	p.N1166Y	DNAH6_ENST00000398278.2_Missense_Mutation_p.N1166Y|DNAH6_ENST00000389394.3_Missense_Mutation_p.N1166Y			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1166	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AACTTTTCAAAACAATAATGC	0.274																																					p.N1166Y		Atlas-SNP	.											.	DNAH6	194	.	0			c.A3496T						.						43.0	39.0	40.0					2																	84844030		692	1579	2271	SO:0001583	missense	1768	exon23			TTTCAAAACAATA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3496A>T	chr2.hg19:g.84844030A>T	ENSP00000237449:p.Asn1166Tyr	328.0	0.0		215.0	80.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.313751	0.60414	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.61510	0.1;0.1;0.1	5.14	5.14	0.70334	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.71693	0.3370	M	0.64997	1.995	0.34886	D	0.745037	D	0.63046	0.992	D	0.67900	0.954	T	0.81022	-0.1121	9	0.66056	D	0.02	.	13.9504	0.64113	1.0:0.0:0.0:0.0	.	1166	Q9C0G6	DYH6_HUMAN	Y	1166	ENSP00000374045:N1166Y;ENSP00000381326:N1166Y;ENSP00000237449:N1166Y	ENSP00000237449:N1166Y	N	+	1	0	DNAH6	84697541	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.768000	0.62293	1.934000	0.56057	0.455000	0.32223	AAC	.	.		0.274	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125192135	125192135	+	Nonsense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:125192135A>T	ENST00000431078.1	+	5	968	c.604A>T	c.(604-606)Aaa>Taa	p.K202*		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	202	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GAGTACTCTCAAAGATGTGAT	0.483																																					p.K202X		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.A604T						.						124.0	118.0	120.0					2																	125192135		2003	4197	6200	SO:0001587	stop_gained	129684	exon5			ACTCTCAAAGATG	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.604A>T	chr2.hg19:g.125192135A>T	ENSP00000399013:p.Lys202*	161.0	0.0		65.0	28.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Nonsense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	A	42	9.240057	0.99111	.	.	ENSG00000155052	ENST00000431078	.	.	.	5.48	5.48	0.80851	.	0.000000	0.50627	D	0.000111	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7735	0.69699	1.0:0.0:0.0:0.0	.	.	.	.	X	202	.	ENSP00000399013:K202X	K	+	1	0	CNTNAP5	124908605	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	9.169000	0.94788	2.084000	0.62774	0.533000	0.62120	AAA	.	.		0.483	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
POTEE	445582	hgsc.bcm.edu	37	2	132020969	132020969	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:132020969A>C	ENST00000356920.5	+	15	2035	c.1941A>C	c.(1939-1941)gaA>gaC	p.E647D	PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	647					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.E647D(1)									TCTTGCATGAAAATAGTACGT	0.353																																					p.E647D		Atlas-SNP	.											ENSG00000188219,NS,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	lung(1)	c.A1941C						.						27.0	29.0	28.0					2																	132020969		1938	4163	6101	SO:0001583	missense	445582	exon15			GCATGAAAATAGT	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.1941A>C	chr2.hg19:g.132020969A>C	ENSP00000439189:p.Glu647Asp	491.0	0.0		229.0	106.0	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	hg19	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	9.831	1.188323	0.21954	.	.	ENSG00000188219	ENST00000356920	T	0.79247	-1.25	0.993	-0.217	0.13149	.	.	.	.	.	T	0.67325	0.2881	M	0.76838	2.35	0.25569	N	0.986913	P	0.42584	0.784	B	0.28784	0.094	T	0.61667	-0.7016	9	0.87932	D	0	.	2.8547	0.05569	0.6759:0.0:0.3241:0.0	.	647	Q6S8J3	POTEE_HUMAN	D	647	ENSP00000439189:E647D	ENSP00000439189:E647D	E	+	3	2	AC131180.1	131737439	0.810000	0.29049	0.005000	0.12908	0.012000	0.07955	1.495000	0.35627	-0.075000	0.12798	0.155000	0.16302	GAA	.	.		0.353	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
PLA2R1	22925	hgsc.bcm.edu	37	2	160808016	160808016	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:160808016A>T	ENST00000283243.7	-	24	3581	c.3375T>A	c.(3373-3375)acT>acA	p.T1125T	PLA2R1_ENST00000392771.1_Silent_p.T1125T	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1125	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						TTATTTTGTAAGTTCTGTTTC	0.378																																					p.T1125T		Atlas-SNP	.											.	PLA2R1	153	.	0			c.T3375A						.						198.0	182.0	187.0					2																	160808016		2203	4300	6503	SO:0001819	synonymous_variant	22925	exon24			TTTGTAAGTTCTG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3375T>A	chr2.hg19:g.160808016A>T		301.0	0.0		175.0	73.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	hg19	CCDS33309.1																																																																																			.	.		0.378	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
SCN7A	6332	hgsc.bcm.edu	37	2	167319005	167319005	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:167319005C>G	ENST00000409855.1	-	9	1103	c.977G>C	c.(976-978)gGc>gCc	p.G326A		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	326					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AGGATTTATGCCAGCTTTTAC	0.378																																					p.G326A		Atlas-SNP	.											.	SCN7A	410	.	0			c.G977C						.						75.0	67.0	69.0					2																	167319005		1847	4101	5948	SO:0001583	missense	6332	exon9			TTTATGCCAGCTT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.977G>C	chr2.hg19:g.167319005C>G	ENSP00000386796:p.Gly326Ala	108.0	0.0		49.0	26.0	NM_002976		Missense_Mutation	SNP	ENST00000409855.1	hg19	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.717331	0.89205	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98617	-5.03;-5.03;-5.03	4.43	4.43	0.53597	Ion transport (1);	0.000000	0.49916	D	0.000127	D	0.98754	0.9581	M	0.83692	2.655	0.48236	D	0.999613	D	0.53151	0.958	P	0.54431	0.752	D	0.99671	1.0996	10	0.87932	D	0	.	15.978	0.80086	0.0:1.0:0.0:0.0	.	326	Q01118	SCN7A_HUMAN	A	326	ENSP00000386796:G326A;ENSP00000413699:G326A;ENSP00000403846:G326A	ENSP00000259060:G326A	G	-	2	0	SCN7A	167027251	0.999000	0.42202	0.927000	0.36925	0.995000	0.86356	4.835000	0.62781	2.150000	0.67090	0.585000	0.79938	GGC	.	.		0.378	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
HOXD1	3231	hgsc.bcm.edu	37	2	177054752	177054752	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:177054752A>G	ENST00000331462.4	+	2	1092	c.869A>G	c.(868-870)gAa>gGa	p.E290G	HOXD-AS1_ENST00000425005.1_RNA|HOXD-AS1_ENST00000452365.1_RNA|HOXD-AS1_ENST00000436126.1_RNA|HOXD-AS1_ENST00000417086.1_RNA|HOXD-AS1_ENST00000413969.1_RNA	NM_024501.2	NP_078777.1	Q9GZZ0	HXD1_HUMAN	homeobox D1	290					embryonic skeletal system development (GO:0048706)|neuron differentiation (GO:0030182)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.0226)		AGGGAACGAGAAGGGCTTCTG	0.552																																					p.E290G		Atlas-SNP	.											.	HOXD1	33	.	0			c.A869G						.						117.0	126.0	123.0					2																	177054752		2203	4300	6503	SO:0001583	missense	3231	exon2			AACGAGAAGGGCT		CCDS2271.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128645	ENSG00000128645		"""Homeoboxes / ANTP class : HOXL subclass"""	5132	protein-coding gene	gene with protein product		142987	"""homeo box D1"""	HOX4, HOX4G		1973146, 1358459	Standard	NM_024501		Approved		uc002ukv.5	Q9GZZ0	OTTHUMG00000132512	ENST00000331462.4:c.869A>G	chr2.hg19:g.177054752A>G	ENSP00000328598:p.Glu290Gly	137.0	0.0		109.0	8.0	NM_024501	B2RAB4	Missense_Mutation	SNP	ENST00000331462.4	hg19	CCDS2271.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593027	0.86953	.	.	ENSG00000128645	ENST00000331462	D	0.91843	-2.92	5.66	5.66	0.87406	Homeobox (1);Homeodomain-like (1);	0.000000	0.48767	D	0.000163	D	0.93533	0.7936	L	0.34521	1.04	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.978	D	0.94038	0.7307	10	0.54805	T	0.06	.	15.5503	0.76145	1.0:0.0:0.0:0.0	.	290;290	Q96CA4;Q9GZZ0	.;HXD1_HUMAN	G	290	ENSP00000328598:E290G	ENSP00000328598:E290G	E	+	2	0	HOXD1	176762998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.344000	0.79328	2.143000	0.66587	0.533000	0.62120	GAA	.	.		0.552	HOXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255693.2		
PLEKHA3	65977	hgsc.bcm.edu	37	2	179343059	179343059	+	5'Flank	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:179343059T>C	ENST00000234453.5	+	0	0				FKBP7_ENST00000464248.1_5'UTR|FKBP7_ENST00000434643.2_Silent_p.L56L|FKBP7_ENST00000424785.2_Silent_p.L56L	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3							Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			AATGGGCATTTAGTAGGTCTC	0.468																																					p.L56L		Atlas-SNP	.											.	FKBP7	16	.	0			c.A168G						.						120.0	114.0	116.0					2																	179343059		2203	4300	6503	SO:0001631	upstream_gene_variant	51661	exon1			GGCATTTAGTAGG	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446		chr2.hg19:g.179343059T>C	Exception_encountered	147.0	0.0		123.0	9.0	NM_181342	Q4ZG69|Q86TQ1|Q9NXT3	Silent	SNP	ENST00000234453.5	hg19	CCDS33336.1																																																																																			.	.		0.468	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335241.2	NM_019091	
MSTN	2660	hgsc.bcm.edu	37	2	190924808	190924808	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:190924808C>T	ENST00000260950.4	-	2	859	c.727G>A	c.(727-729)Gga>Aga	p.G243R	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	243					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			TCTCCTGGTCCTGGGAAGGTT	0.348																																					p.G243R		Atlas-SNP	.											MSTN,colon,carcinoma,0,1	MSTN	46	.	0			c.G727A						.						122.0	120.0	121.0					2																	190924808		2203	4300	6503	SO:0001583	missense	2660	exon2			CTGGTCCTGGGAA	AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.727G>A	chr2.hg19:g.190924808C>T	ENSP00000260950:p.Gly243Arg	134.0	0.0		139.0	81.0	NM_005259	A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	ENST00000260950.4	hg19	CCDS2303.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.493228	0.26774	.	.	ENSG00000138379	ENST00000260950	T	0.66280	-0.2	5.25	4.38	0.52667	Transforming growth factor-beta, N-terminal (1);	0.218941	0.46442	N	0.000283	T	0.47967	0.1474	L	0.27053	0.805	0.43642	D	0.996043	B	0.02656	0.0	B	0.06405	0.002	T	0.37126	-0.9719	10	0.22706	T	0.39	-6.8459	14.0005	0.64431	0.0:0.9274:0.0:0.0726	.	243	O14793	GDF8_HUMAN	R	243	ENSP00000260950:G243R	ENSP00000260950:G243R	G	-	1	0	MSTN	190633053	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.183000	0.50918	1.453000	0.47775	0.585000	0.79938	GGA	.	.		0.348	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255917.2	NM_005259	
SPEG	10290	hgsc.bcm.edu	37	2	220333678	220333678	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:220333678C>T	ENST00000312358.7	+	12	3531	c.3399C>T	c.(3397-3399)ctC>ctT	p.L1133L	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1133	Ig-like 5.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ACGAGGGGCTCTATGCGGTCA	0.647																																					p.L1133L		Atlas-SNP	.											.	SPEG	272	.	0			c.C3399T						.						43.0	53.0	49.0					2																	220333678		2088	4218	6306	SO:0001819	synonymous_variant	10290	exon12			GGGGCTCTATGCG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.3399C>T	chr2.hg19:g.220333678C>T		68.0	0.0		30.0	14.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	hg19	CCDS42824.1																																																																																			.	.		0.647	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
PSMD1	5707	hgsc.bcm.edu	37	2	231936937	231936937	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:231936937G>T	ENST00000308696.6	+	7	851	c.689G>T	c.(688-690)aGt>aTt	p.S230I	PSMD1_ENST00000409643.1_Missense_Mutation_p.S230I|PSMD1_ENST00000373635.4_Missense_Mutation_p.S230I	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	230					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CAGGCTGTGAGTGATATCTTA	0.343																																					p.S230I		Atlas-SNP	.											.	PSMD1	77	.	0			c.G689T						.						173.0	167.0	169.0					2																	231936937		2203	4300	6503	SO:0001583	missense	5707	exon7			CTGTGAGTGATAT	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.689G>T	chr2.hg19:g.231936937G>T	ENSP00000309474:p.Ser230Ile	189.0	0.0		80.0	11.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	hg19	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065328	0.76187	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	.	.	.	5.98	5.98	0.97165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65863	0.2732	L	0.46819	1.47	0.80722	D	1	B;P	0.35944	0.049;0.529	B;B	0.42386	0.01;0.386	T	0.64537	-0.6384	9	0.54805	T	0.06	-7.1736	20.4581	0.99154	0.0:0.0:1.0:0.0	.	230;230	Q99460;Q99460-2	PSMD1_HUMAN;.	I	230	.	ENSP00000309474:S230I	S	+	2	0	PSMD1	231645181	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.835000	0.97688	0.650000	0.86243	AGT	.	.		0.343	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
PSMD1	5707	hgsc.bcm.edu	37	2	231936939	231936939	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr2:231936939G>T	ENST00000308696.6	+	7	853	c.691G>T	c.(691-693)Gat>Tat	p.D231Y	PSMD1_ENST00000409643.1_Missense_Mutation_p.D231Y|PSMD1_ENST00000373635.4_Missense_Mutation_p.D231Y	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	231					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GGCTGTGAGTGATATCTTAGA	0.343																																					p.D231Y		Atlas-SNP	.											.	PSMD1	77	.	0			c.G691T						.						177.0	170.0	172.0					2																	231936939		2203	4300	6503	SO:0001583	missense	5707	exon7			GTGAGTGATATCT	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.691G>T	chr2.hg19:g.231936939G>T	ENSP00000309474:p.Asp231Tyr	190.0	0.0		80.0	12.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	hg19	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.918713	0.73098	.	.	ENSG00000173692	ENST00000308696;ENST00000373635;ENST00000409643	.	.	.	5.98	5.98	0.97165	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78947	0.4364	M	0.69823	2.125	0.80722	D	1	B;D	0.67145	0.052;0.996	B;D	0.64877	0.04;0.93	T	0.78710	-0.2098	9	0.62326	D	0.03	-8.8292	20.4581	0.99154	0.0:0.0:1.0:0.0	.	231;231	Q99460;Q99460-2	PSMD1_HUMAN;.	Y	231	.	ENSP00000309474:D231Y	D	+	1	0	PSMD1	231645183	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.835000	0.97688	0.650000	0.86243	GAT	.	.		0.343	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
JAGN1	84522	hgsc.bcm.edu	37	3	9934999	9934999	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:9934999T>C	ENST00000307768.4	+	2	659	c.490T>C	c.(490-492)Tac>Cac	p.Y164H		NM_032492.3	NP_115881.3			jagunal homolog 1 (Drosophila)											breast(1)|central_nervous_system(1)|endometrium(4)|lung(3)|ovary(1)	10	Medulloblastoma(99;0.227)					CTGGCAGTTGTACTACAGCAA	0.512																																					p.Y164H		Atlas-SNP	.											.	JAGN1	18	.	0			c.T490C						.						179.0	112.0	135.0					3																	9934999		2203	4300	6503	SO:0001583	missense	84522	exon2			CAGTTGTACTACA	AK074760	CCDS2588.1	3p25.2	2010-03-23			ENSG00000171135	ENSG00000171135			26926	protein-coding gene	gene with protein product						12477932	Standard	NM_032492		Approved	GL009, FLJ14602	uc003btt.4	Q8N5M9	OTTHUMG00000128523	ENST00000307768.4:c.490T>C	chr3.hg19:g.9934999T>C	ENSP00000306106:p.Tyr164His	241.0	0.0		154.0	54.0	NM_032492		Missense_Mutation	SNP	ENST00000307768.4	hg19	CCDS2588.1	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508007	0.64410	.	.	ENSG00000171135	ENST00000307768;ENST00000543379	.	.	.	5.56	3.19	0.36642	.	0.059088	0.64402	N	0.000001	T	0.75443	0.3850	M	0.75264	2.295	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	T	0.74942	-0.3492	9	0.87932	D	0	-22.2684	9.5034	0.39031	0.0:0.145:0.0:0.855	.	164	Q8N5M9	JAGN1_HUMAN	H	164;162	.	ENSP00000306106:Y164H	Y	+	1	0	JAGN1	9909999	1.000000	0.71417	0.519000	0.27824	0.817000	0.46193	6.213000	0.72194	0.414000	0.25790	0.260000	0.18958	TAC	.	.		0.512	JAGN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250335.1	NM_032492	
TIMP4	7079	hgsc.bcm.edu	37	3	12195209	12195209	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:12195209T>C	ENST00000287814.4	-	5	991	c.481A>G	c.(481-483)Acc>Gcc	p.T161A	SYN2_ENST00000432424.2_RNA	NM_003256.3	NP_003247.1	Q99727	TIMP4_HUMAN	TIMP metallopeptidase inhibitor 4	161					central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|ovulation cycle (GO:0042698)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)|sarcomere (GO:0030017)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11						TAGCAGGTGGTGATCTAGAGT	0.502																																					p.T161A	Melanoma(199;1446 2144 30617 38794 51714)	Atlas-SNP	.											.	TIMP4	21	.	0			c.A481G						.						120.0	110.0	114.0					3																	12195209		2203	4300	6503	SO:0001583	missense	7079	exon5			AGGTGGTGATCTA	U76456	CCDS2608.1	3p25	2005-10-31	2005-08-08		ENSG00000157150	ENSG00000157150			11823	protein-coding gene	gene with protein product		601915	"""tissue inhibitor of metalloproteinase 4"""			8939999, 9693046	Standard	NM_003256		Approved		uc003bwo.3	Q99727	OTTHUMG00000129763	ENST00000287814.4:c.481A>G	chr3.hg19:g.12195209T>C	ENSP00000287814:p.Thr161Ala	56.0	0.0		44.0	12.0	NM_003256	B2R7K6	Missense_Mutation	SNP	ENST00000287814.4	hg19	CCDS2608.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.305396	0.40795	.	.	ENSG00000157150	ENST00000287814	D	0.93307	-3.2	4.88	4.88	0.63580	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.118425	0.56097	D	0.000025	D	0.89989	0.6875	M	0.62723	1.935	0.42982	D	0.994464	B	0.28584	0.216	B	0.28553	0.091	D	0.85526	0.1206	10	0.12103	T	0.63	.	10.5746	0.45219	0.144:0.0:0.0:0.856	.	161	Q99727	TIMP4_HUMAN	A	161	ENSP00000287814:T161A	ENSP00000287814:T161A	T	-	1	0	TIMP4	12170209	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.220000	0.42908	2.052000	0.61016	0.402000	0.26972	ACC	.	.		0.502	TIMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251978.1	NM_003256	
XIRP1	165904	hgsc.bcm.edu	37	3	39230338	39230338	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:39230338A>G	ENST00000340369.3	-	2	827	c.599T>C	c.(598-600)cTg>cCg	p.L200P	XIRP1_ENST00000396251.1_Missense_Mutation_p.L200P|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	200					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CAGGCGGTCCAGCGGCCGCGT	0.627																																					p.L200P		Atlas-SNP	.											.	XIRP1	173	.	0			c.T599C						.						45.0	47.0	46.0					3																	39230338		2203	4300	6503	SO:0001583	missense	165904	exon2			CGGTCCAGCGGCC	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.599T>C	chr3.hg19:g.39230338A>G	ENSP00000343140:p.Leu200Pro	54.0	0.0		26.0	11.0	NM_001198621	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	hg19	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.409130	0.62399	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.58358	0.34;0.34	4.66	3.4	0.38934	.	0.000000	0.64402	D	0.000003	T	0.68339	0.2990	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71484	-0.4579	10	0.87932	D	0	.	9.3876	0.38352	0.8207:0.1793:0.0:0.0	.	200;200	Q702N8;Q702N8-2	XIRP1_HUMAN;.	P	200	ENSP00000379550:L200P;ENSP00000343140:L200P	ENSP00000343140:L200P	L	-	2	0	XIRP1	39205342	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.338000	0.79269	1.877000	0.54381	0.482000	0.46254	CTG	.	.		0.627	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
SETD2	29072	hgsc.bcm.edu	37	3	47098371	47098371	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:47098371T>C	ENST00000409792.3	-	15	6945	c.6903A>G	c.(6901-6903)acA>acG	p.T2301T		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2301	Gln-rich.|Low charge region.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTGTTGGACATGTCTGTCCTT	0.398			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.T2301T		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.A6903G						.						119.0	114.0	116.0					3																	47098371		2203	4300	6503	SO:0001819	synonymous_variant	29072	exon15			TGGACATGTCTGT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6903A>G	chr3.hg19:g.47098371T>C		223.0	0.0		111.0	31.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Silent	SNP	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.		0.398	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
DZIP3	9666	hgsc.bcm.edu	37	3	108347953	108347953	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:108347953T>C	ENST00000361582.3	+	8	856	c.626T>C	c.(625-627)aTt>aCt	p.I209T	DZIP3_ENST00000463306.1_Missense_Mutation_p.I209T	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	209					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						TTACAAGAAATTGGAGACAAA	0.308																																					p.I209T		Atlas-SNP	.											.	DZIP3	111	.	0			c.T626C						.						102.0	108.0	106.0					3																	108347953		2203	4300	6503	SO:0001583	missense	9666	exon8			AAGAAATTGGAGA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.626T>C	chr3.hg19:g.108347953T>C	ENSP00000355028:p.Ile209Thr	141.0	0.0		81.0	15.0	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	hg19	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	T	11.79	1.743053	0.30865	.	.	ENSG00000198919	ENST00000393969;ENST00000361582;ENST00000486815;ENST00000479138;ENST00000463306	T;T	0.30714	1.52;1.52	4.37	3.2	0.36748	.	0.000000	0.52532	D	0.000061	T	0.34571	0.0902	N	0.19112	0.55	0.31840	N	0.623543	D	0.76494	0.999	D	0.78314	0.991	T	0.38757	-0.9646	10	0.87932	D	0	-8.7949	6.6666	0.23044	0.0:0.109:0.0:0.891	.	209	Q86Y13	DZIP3_HUMAN	T	209;209;125;209;209	ENSP00000355028:I209T;ENSP00000419981:I209T	ENSP00000355028:I209T	I	+	2	0	DZIP3	109830643	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	2.064000	0.41432	0.701000	0.31803	0.482000	0.46254	ATT	.	.		0.308	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
SLC15A2	6565	hgsc.bcm.edu	37	3	121641941	121641941	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:121641941C>A	ENST00000489711.1	+	10	1310	c.922C>A	c.(922-924)Cca>Aca	p.P308T	AC072031.1_ENST00000581491.1_RNA|SLC15A2_ENST00000295605.2_Missense_Mutation_p.P277T	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	308					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CCTTTATATCCCATTGCCCAT	0.453																																					p.P308T		Atlas-SNP	.											.	SLC15A2	92	.	0			c.C922A						.						163.0	168.0	166.0					3																	121641941		2203	4300	6503	SO:0001583	missense	6565	exon10			TATATCCCATTGC	BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.922C>A	chr3.hg19:g.121641941C>A	ENSP00000417085:p.Pro308Thr	192.0	0.0		95.0	19.0	NM_021082	A8K1A5|B4E2A7	Missense_Mutation	SNP	ENST00000489711.1	hg19	CCDS3007.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.828034	0.90955	.	.	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605	T;T	0.56941	0.43;0.43	5.86	5.86	0.93980	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.72898	0.3518	M	0.73372	2.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.74481	-0.3651	10	0.87932	D	0	-10.4065	17.6924	0.88272	0.0:1.0:0.0:0.0	.	277;308	B4E2A7;Q16348	.;S15A2_HUMAN	T	308;270;277	ENSP00000417085:P308T;ENSP00000295605:P277T	ENSP00000295605:P277T	P	+	1	0	SLC15A2	123124631	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.278000	0.78587	2.781000	0.95711	0.650000	0.86243	CCA	.	.		0.453	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355239.1	NM_021082	
HEG1	57493	hgsc.bcm.edu	37	3	124732258	124732258	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:124732258G>T	ENST00000311127.4	-	6	2232	c.2165C>A	c.(2164-2166)tCc>tAc	p.S722Y	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	722	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TGTCGTTAAGGATACTGGTAA	0.493																																					p.S722Y		Atlas-SNP	.											.	HEG1	109	.	0			c.C2165A						.						200.0	201.0	201.0					3																	124732258		2061	4209	6270	SO:0001583	missense	57493	exon6			GTTAAGGATACTG	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2165C>A	chr3.hg19:g.124732258G>T	ENSP00000311502:p.Ser722Tyr	112.0	0.0		57.0	19.0	NM_020733	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	hg19	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.186032	0.38609	.	.	ENSG00000173706	ENST00000311127	D	0.89415	-2.51	5.2	4.29	0.51040	.	0.000000	0.38492	U	0.001667	D	0.92743	0.7693	M	0.66939	2.045	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.96	D	0.85642	0.1277	10	0.66056	D	0.02	.	12.7971	0.57565	0.0:0.0:0.8379:0.1621	.	722;722	Q9ULI3-2;Q9ULI3	.;HEG1_HUMAN	Y	722	ENSP00000311502:S722Y	ENSP00000311502:S722Y	S	-	2	0	HEG1	126214948	0.303000	0.24463	0.154000	0.22540	0.016000	0.09150	3.333000	0.52090	2.706000	0.92434	0.561000	0.74099	TCC	.	.		0.493	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
KBTBD12	166348	hgsc.bcm.edu	37	3	127702969	127702969	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:127702969T>C	ENST00000405109.1	+	6	2187	c.1720T>C	c.(1720-1722)Ttg>Ctg	p.L574L	KBTBD12_ENST00000405256.1_Silent_p.L574L|KBTBD12_ENST00000407609.3_Silent_p.L181L|KBTBD12_ENST00000343941.4_Silent_p.L149L|KBTBD12_ENST00000492025.1_3'UTR			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	574										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CAAAGAAATATTGGAACTGGA	0.453																																					p.L574L		Atlas-SNP	.											.	KBTBD12	41	.	0			c.T1720C						.						156.0	147.0	150.0					3																	127702969		2203	4300	6503	SO:0001819	synonymous_variant	166348	exon5			GAAATATTGGAAC		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1720T>C	chr3.hg19:g.127702969T>C		177.0	0.0		94.0	18.0	NM_207335	B5MCC6|Q6ZRK1	Silent	SNP	ENST00000405109.1	hg19	CCDS33848.2																																																																																			.	.		0.453	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
DNAJC19	131118	hgsc.bcm.edu	37	3	180704791	180704791	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr3:180704791T>C	ENST00000382564.2	-	4	319	c.149A>G	c.(148-150)tAt>tGt	p.Y50C	DNAJC19_ENST00000491873.1_Missense_Mutation_p.Y25C|DNAJC19_ENST00000486355.1_Missense_Mutation_p.Y50C|DNAJC19_ENST00000479269.1_Missense_Mutation_p.Y25C	NM_145261.3	NP_660304.1	Q96DA6	TIM14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 19	50					cellular protein metabolic process (GO:0044267)|genitalia development (GO:0048806)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				large_intestine(2)|lung(1)	3	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			CCCACCTCTATAATAGCCACC	0.328																																					p.Y50C		Atlas-SNP	.											.	DNAJC19	4	.	0			c.A149G						.						81.0	88.0	85.0					3																	180704791		2203	4300	6503	SO:0001583	missense	131118	exon4			CCTCTATAATAGC		CCDS33895.1, CCDS54684.1	3q26.33	2014-09-17			ENSG00000205981	ENSG00000205981		"""Heat shock proteins / DNAJ (HSP40)"""	30528	protein-coding gene	gene with protein product		608977				19564938	Standard	NM_145261		Approved	TIMM14, Tim14, Pam18	uc003fkt.3	Q96DA6	OTTHUMG00000158180	ENST00000382564.2:c.149A>G	chr3.hg19:g.180704791T>C	ENSP00000372005:p.Tyr50Cys	207.0	0.0		127.0	27.0	NM_145261	B2R4B1|C9JBV1	Missense_Mutation	SNP	ENST00000382564.2	hg19	CCDS33895.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.266136	0.80358	.	.	ENSG00000205981	ENST00000382564;ENST00000491873;ENST00000479269	.	.	.	5.77	5.77	0.91146	.	0.052954	0.85682	D	0.000000	T	0.79992	0.4542	M	0.93375	3.41	0.80722	D	1	D	0.59767	0.986	P	0.53722	0.733	D	0.85443	0.1156	9	0.66056	D	0.02	-1.6047	14.9515	0.71077	0.0:0.0:0.0:1.0	.	50	Q96DA6	TIM14_HUMAN	C	50;25;25	.	ENSP00000372005:Y50C	Y	-	2	0	DNAJC19	182187485	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.599000	0.74127	2.326000	0.78906	0.528000	0.53228	TAT	.	.		0.328	DNAJC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350336.1	NM_145261	
KIAA0232	9778	hgsc.bcm.edu	37	4	6862633	6862633	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:6862633A>G	ENST00000307659.5	+	7	979	c.524A>G	c.(523-525)tAt>tGt	p.Y175C	KIAA0232_ENST00000425103.1_Missense_Mutation_p.Y175C	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	175							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TTCAGGTACTATGAAGCATTT	0.358																																					p.Y175C		Atlas-SNP	.											.	KIAA0232	102	.	0			c.A524G						.						129.0	124.0	125.0					4																	6862633		1902	4126	6028	SO:0001583	missense	9778	exon7			GGTACTATGAAGC	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.524A>G	chr4.hg19:g.6862633A>G	ENSP00000303928:p.Tyr175Cys	176.0	0.0		85.0	11.0	NM_014743	A7E2D2	Missense_Mutation	SNP	ENST00000307659.5	hg19	CCDS43209.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.222657	0.79464	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.75657	0.3879	L	0.55481	1.735	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78221	-0.2288	9	0.87932	D	0	-11.9197	15.6476	0.77068	1.0:0.0:0.0:0.0	.	175	Q92628	K0232_HUMAN	C	175	.	ENSP00000303928:Y175C	Y	+	2	0	KIAA0232	6913534	1.000000	0.71417	0.952000	0.39060	0.857000	0.48899	8.881000	0.92415	2.103000	0.63969	0.533000	0.62120	TAT	.	.		0.358	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
KLB	152831	hgsc.bcm.edu	37	4	39448206	39448206	+	Silent	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:39448206G>T	ENST00000257408.4	+	4	1957	c.1860G>T	c.(1858-1860)ctG>ctT	p.L620L		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	620	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GACAGGCCCTGAGGTACTACA	0.602																																					p.L620L		Atlas-SNP	.											.	KLB	95	.	0			c.G1860T						.						91.0	88.0	89.0					4																	39448206		2203	4300	6503	SO:0001819	synonymous_variant	152831	exon4			GGCCCTGAGGTAC	AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.1860G>T	chr4.hg19:g.39448206G>T		35.0	0.0		22.0	16.0	NM_175737	Q2M3K8	Silent	SNP	ENST00000257408.4	hg19	CCDS3451.1																																																																																			.	.		0.602	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250429.1	NM_175737	
SOWAHB	345079	hgsc.bcm.edu	37	4	77817982	77817982	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:77817982C>G	ENST00000334306.2	-	1	1020	c.1021G>C	c.(1021-1023)Gaa>Caa	p.E341Q		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	341																	GAGCCGGGTTCCAAGGGCAGC	0.642																																					p.E341Q		Atlas-SNP	.											.	.	.	.	0			c.G1021C						.						42.0	52.0	48.0					4																	77817982		2203	4300	6503	SO:0001583	missense	345079	exon1			CGGGTTCCAAGGG		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1021G>C	chr4.hg19:g.77817982C>G	ENSP00000334879:p.Glu341Gln	95.0	0.0		21.0	8.0	NM_001029870	B2RP29	Missense_Mutation	SNP	ENST00000334306.2	hg19	CCDS34017.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.929822	0.52759	.	.	ENSG00000186212	ENST00000334306	T	0.07216	3.21	3.83	2.87	0.33458	.	.	.	.	.	T	0.04907	0.0132	L	0.27053	0.805	0.09310	N	1	P	0.37466	0.596	B	0.29267	0.1	T	0.32745	-0.9895	9	0.30078	T	0.28	-3.6903	6.8808	0.24173	0.0:0.7959:0.0:0.2041	.	341	A6NEL2	ANR56_HUMAN	Q	341	ENSP00000334879:E341Q	ENSP00000334879:E341Q	E	-	1	0	ANKRD56	78037006	0.000000	0.05858	0.006000	0.13384	0.008000	0.06430	0.970000	0.29383	1.968000	0.57251	0.491000	0.48974	GAA	.	.		0.642	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
NAA11	84779	hgsc.bcm.edu	37	4	80246710	80246710	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:80246710A>G	ENST00000286794.4	-	1	494	c.322T>C	c.(322-324)Tct>Cct	p.S108P	NAA11_ENST00000513733.1_5'Flank	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	108	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						ACGTGCAGAGACACGTATTTG	0.532																																					p.S108P		Atlas-SNP	.											.	NAA11	43	.	0			c.T322C						.						58.0	62.0	61.0					4																	80246710		2109	4244	6353	SO:0001583	missense	84779	exon1			GCAGAGACACGTA		CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.322T>C	chr4.hg19:g.80246710A>G	ENSP00000286794:p.Ser108Pro	65.0	0.0		23.0	7.0	NM_032693	Q66K19|Q6P479	Missense_Mutation	SNP	ENST00000286794.4	hg19	CCDS47084.1	.	.	.	.	.	.	.	.	.	.	A	17.42	3.386248	0.61956	.	.	ENSG00000156269	ENST00000286794	T	0.35048	1.33	5.17	5.17	0.71159	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	U	0.000000	T	0.71281	0.3321	H	0.97103	3.94	0.80722	D	1	D	0.69078	0.997	D	0.72982	0.979	T	0.81243	-0.1021	9	.	.	.	-16.9732	13.3112	0.60380	1.0:0.0:0.0:0.0	.	108	Q9BSU3	NAA11_HUMAN	P	108	ENSP00000286794:S108P	.	S	-	1	0	NAA11	80465734	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	8.223000	0.89779	2.308000	0.77769	0.533000	0.62120	TCT	.	.		0.532	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362922.1		
UBE2D3	7323	hgsc.bcm.edu	37	4	103747665	103747665	+	Start_Codon_SNP	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:103747665T>C	ENST00000453744.2	-	2	514	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	UBE2D3_ENST00000343106.5_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000321805.7_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000350435.7_5'Flank|UBE2D3_ENST00000504211.1_5'Flank|RP11-10L12.4_ENST00000501133.2_RNA|UBE2D3_ENST00000502404.1_5'Flank|UBE2D3_ENST00000394801.4_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000349311.8_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000394803.5_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000357194.6_Intron|UBE2D3_ENST00000394804.2_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000505207.1_5'Flank|UBE2D3_ENST00000513098.1_5'UTR|UBE2D3_ENST00000338145.3_Start_Codon_SNP_p.M1V|UBE2D3_ENST00000507845.1_5'Flank	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	1					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TTCAGCGCCATAGTGTGTGCT	0.577																																					p.M1V		Atlas-SNP	.											.	UBE2D3	25	.	0			c.A1G						.						223.0	208.0	213.0					4																	103747665		2203	4300	6503	SO:0001582	initiator_codon_variant	7323	exon2			GCGCCATAGTGTG	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.1A>G	chr4.hg19:g.103747665T>C	ENSP00000396901:p.Met1Val	93.0	0.0		27.0	9.0	NM_181886	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Missense_Mutation	SNP	ENST00000453744.2	hg19	CCDS3660.1	.	.	.	.	.	.	.	.	.	.	T	13.33	2.203650	0.38905	.	.	ENSG00000109332	ENST00000453744;ENST00000394801;ENST00000394803;ENST00000394804;ENST00000343106;ENST00000321805;ENST00000338145;ENST00000349311;ENST00000508238;ENST00000502690;ENST00000508249	T;T;T;T;T;T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;0.95	4.61	3.41	0.39046	Ubiquitin-conjugating enzyme/RWD-like (2);	.	.	.	.	T	0.76300	0.3968	.	.	.	0.80722	D	1	B;P	0.34826	0.034;0.471	B;P	0.50405	0.347;0.64	T	0.75892	-0.3157	8	0.87932	D	0	.	7.1484	0.25595	0.0:0.1017:0.0:0.8983	.	1;1	P61077;P61077-2	UB2D3_HUMAN;.	V	1	ENSP00000396901:M1V;ENSP00000378280:M1V;ENSP00000378282:M1V;ENSP00000378283:M1V;ENSP00000345285:M1V;ENSP00000318494:M1V;ENSP00000337208:M1V;ENSP00000344069:M1V;ENSP00000423487:M1V;ENSP00000425762:M1V;ENSP00000421310:M1V	ENSP00000318494:M1V	M	-	1	0	UBE2D3	103966800	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.734000	0.38166	0.893000	0.36288	0.455000	0.32223	ATG	.	.		0.577	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893	Missense_Mutation
CCRN4L	25819	hgsc.bcm.edu	37	4	139965791	139965791	+	Splice_Site	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:139965791A>T	ENST00000280614.2	+	3	653		c.e3-1		ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)						circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					TTTTCTTTTCAGCTCTTGGAG	0.458																																					.	Ovarian(144;566 1842 19130 21379 22209)	Atlas-SNP	.											.	CCRN4L	22	.	0			c.461-2A>T						.						44.0	45.0	45.0					4																	139965791		2203	4300	6503	SO:0001630	splice_region_variant	25819	exon3			CTTTTCAGCTCTT	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.461-1A>T	chr4.hg19:g.139965791A>T		45.0	0.0		10.0	5.0	NM_012118	D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Splice_Site	SNP	ENST00000280614.2	hg19	CCDS3743.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937617	0.73557	.	.	ENSG00000151014	ENST00000280614	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9463	0.71035	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCRN4L	140185241	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.262000	0.95591	1.938000	0.56188	0.454000	0.30748	.	.	.		0.458	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3	NM_012118	Intron
NAA15	80155	hgsc.bcm.edu	37	4	140299908	140299908	+	Splice_Site	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:140299908A>G	ENST00000296543.5	+	17	2379		c.e17-1		NAA15_ENST00000398947.1_Splice_Site	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						CTCTTTTTATAGAAAAGTTTC	0.348																																					.		Atlas-SNP	.											.	NAA15	88	.	0			c.2057-2A>G						.						121.0	105.0	110.0					4																	140299908		1791	4067	5858	SO:0001630	splice_region_variant	80155	exon17			TTTTATAGAAAAG	AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.2057-1A>G	chr4.hg19:g.140299908A>G		206.0	0.0		67.0	22.0	NM_057175	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Splice_Site	SNP	ENST00000296543.5	hg19	CCDS43270.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.222284	0.79464	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2127	0.82178	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NAA15	140519358	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.730000	0.91510	2.236000	0.73375	0.533000	0.62120	.	.	.		0.348	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000267839.2	NM_057175	Intron
WDR17	116966	hgsc.bcm.edu	37	4	177071048	177071048	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr4:177071048C>A	ENST00000280190.4	+	15	2216	c.2060C>A	c.(2059-2061)aCt>aAt	p.T687N	WDR17_ENST00000507824.2_Missense_Mutation_p.T670N|WDR17_ENST00000393643.2_Missense_Mutation_p.T663N|WDR17_ENST00000508596.1_Missense_Mutation_p.T663N			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	687										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GCCTTAGTCACTCCTGTACAA	0.408																																					p.T687N		Atlas-SNP	.											.	WDR17	198	.	0			c.C2060A						.						110.0	113.0	112.0					4																	177071048		2203	4300	6503	SO:0001583	missense	116966	exon15			TAGTCACTCCTGT	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2060C>A	chr4.hg19:g.177071048C>A	ENSP00000280190:p.Thr687Asn	379.0	0.0		126.0	45.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	hg19	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	C	11.53	1.667257	0.29604	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.58506	0.36;0.38;0.33	5.38	5.38	0.77491	WD40/YVTN repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.364693	0.27319	N	0.019907	T	0.45915	0.1366	L	0.33485	1.01	0.33193	D	0.551143	B;B	0.12013	0.005;0.005	B;B	0.11329	0.006;0.006	T	0.51756	-0.8665	10	0.21014	T	0.42	-11.1321	13.9314	0.63998	0.1899:0.8101:0.0:0.0	.	663;687	E7EQX0;Q8IZU2	.;WDR17_HUMAN	N	663;663;687;670	ENSP00000422763:T663N;ENSP00000377258:T663N;ENSP00000280190:T687N	ENSP00000280190:T687N	T	+	2	0	WDR17	177308042	0.991000	0.36638	0.988000	0.46212	0.788000	0.44548	4.442000	0.59988	2.505000	0.84491	0.563000	0.77884	ACT	.	.		0.408	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
ICE1	23379	hgsc.bcm.edu	37	5	5462475	5462475	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:5462475G>T	ENST00000296564.7	+	13	3250	c.3028G>T	c.(3028-3030)Gtg>Ttg	p.V1010L		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1010					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGAAGTGACTGTGTCAGGAGG	0.547																																					p.V1010L		Atlas-SNP	.											.	KIAA0947	301	.	0			c.G3028T						.						70.0	73.0	72.0					5																	5462475		2012	4195	6207	SO:0001583	missense	23379	exon13			GTGACTGTGTCAG																												ENST00000296564.7:c.3028G>T	chr5.hg19:g.5462475G>T	ENSP00000296564:p.Val1010Leu	71.0	0.0		33.0	13.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	a	1.978	-0.434756	0.04669	.	.	ENSG00000164151	ENST00000296564	T	0.08984	3.03	3.9	-5.33	0.02713	.	2.536700	0.01415	N	0.014178	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32929	-0.9888	10	0.02654	T	1	-0.0224	1.6646	0.02799	0.3694:0.2282:0.2877:0.1147	.	1010	Q9Y2F5	K0947_HUMAN	L	1010	ENSP00000296564:V1010L	ENSP00000296564:V1010L	V	+	1	0	KIAA0947	5515475	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.373000	0.07494	-1.178000	0.02741	-0.871000	0.02989	GTG	.	.		0.547	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
ERAP1	51752	hgsc.bcm.edu	37	5	96116195	96116195	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:96116195A>G	ENST00000443439.2	-	18	2668	c.2602T>C	c.(2602-2604)Tca>Cca	p.S868P	ERAP1_ENST00000514604.1_5'Flank|ERAP1_ENST00000296754.3_Missense_Mutation_p.S868P	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	868					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		ATGGAAGATGAGCCAAGTTCA	0.318																																					p.S868P		Atlas-SNP	.											.	ERAP1	59	.	0			c.T2602C						.						74.0	76.0	75.0					5																	96116195		2203	4300	6503	SO:0001583	missense	51752	exon18			AAGATGAGCCAAG	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.2602T>C	chr5.hg19:g.96116195A>G	ENSP00000406304:p.Ser868Pro	63.0	0.0		21.0	9.0	NM_001198541	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	ENST00000443439.2	hg19	CCDS47250.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789163	0.49997	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.07114	3.22;3.22	6.09	6.09	0.99107	.	0.063289	0.64402	D	0.000003	T	0.34454	0.0898	M	0.85197	2.74	0.54753	D	0.999983	B;D;D	0.89917	0.018;0.999;1.0	B;D;D	0.81914	0.315;0.995;0.995	T	0.14392	-1.0474	10	0.87932	D	0	.	16.331	0.83014	1.0:0.0:0.0:0.0	.	868;868;868	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	P	868	ENSP00000296754:S868P;ENSP00000406304:S868P	ENSP00000296754:S868P	S	-	1	0	ERAP1	96141951	1.000000	0.71417	0.996000	0.52242	0.462000	0.32619	6.407000	0.73280	2.338000	0.79540	0.533000	0.62120	TCA	.	.		0.318	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370699.1	NM_016442	
SEC24A	10802	hgsc.bcm.edu	37	5	133997259	133997259	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:133997259A>G	ENST00000398844.2	+	2	836	c.548A>G	c.(547-549)aAt>aGt	p.N183S	SEC24A_ENST00000322887.4_Missense_Mutation_p.N183S	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	183	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCACTTCAAAATAGCTTCATA	0.323																																					p.N183S		Atlas-SNP	.											.	SEC24A	77	.	0			c.A548G						.						62.0	57.0	58.0					5																	133997259		1848	4091	5939	SO:0001583	missense	10802	exon2			TTCAAAATAGCTT	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.548A>G	chr5.hg19:g.133997259A>G	ENSP00000381823:p.Asn183Ser	71.0	0.0		52.0	13.0	NM_001252231	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	hg19	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	A	11.47	1.647317	0.29246	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	D;D	0.96967	-4.19;-4.19	5.55	4.38	0.52667	.	1.361580	0.04318	N	0.350250	D	0.94768	0.8311	L	0.55481	1.735	0.25787	N	0.984663	B	0.26400	0.148	B	0.28385	0.089	T	0.81609	-0.0855	10	0.09338	T	0.73	-2.9968	12.4654	0.55755	0.8549:0.1451:0.0:0.0	.	183	O95486	SC24A_HUMAN	S	183	ENSP00000381823:N183S;ENSP00000321749:N183S	ENSP00000321749:N183S	N	+	2	0	SEC24A	134025158	1.000000	0.71417	1.000000	0.80357	0.482000	0.33219	3.240000	0.51368	0.914000	0.36822	0.533000	0.62120	AAT	.	.		0.323	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
PCDHA6	56142	hgsc.bcm.edu	37	5	140209555	140209555	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:140209555T>C	ENST00000529310.1	+	1	1993	c.1879T>C	c.(1879-1881)Tac>Cac	p.Y627H	PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	627	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGGGGCTGTACACGGGCGA	0.667																																					p.Y627H		Atlas-SNP	.											.	PCDHA6	442	.	0			c.T1879C						.						72.0	78.0	76.0					5																	140209555		2203	4300	6503	SO:0001583	missense	56142	exon1			GGGCTGTACACGG	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1879T>C	chr5.hg19:g.140209555T>C	ENSP00000433378:p.Tyr627His	62.0	0.0		29.0	9.0	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	hg19	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	T	5.432	0.264827	0.10294	.	.	ENSG00000081842	ENST00000529310	T	0.51071	0.72	3.98	2.8	0.32819	Cadherin (4);Cadherin-like (1);	0.000000	0.33610	U	0.004721	T	0.29524	0.0736	L	0.31207	0.915	0.80722	D	1	B;B	0.29612	0.042;0.251	B;B	0.29353	0.036;0.101	T	0.03922	-1.0992	10	0.14656	T	0.56	.	7.1846	0.25793	0.0:0.1789:0.0:0.8211	.	627;627	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	H	627	ENSP00000433378:Y627H	ENSP00000433378:Y627H	Y	+	1	0	PCDHA6	140189739	0.240000	0.23847	1.000000	0.80357	0.187000	0.23431	0.196000	0.17176	0.692000	0.31613	0.254000	0.18369	TAC	.	.		0.667	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHA8	56140	hgsc.bcm.edu	37	5	140222076	140222076	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:140222076G>A	ENST00000531613.1	+	1	1170	c.1170G>A	c.(1168-1170)atG>atA	p.M390I	PCDHA8_ENST00000378123.3_Missense_Mutation_p.M390I|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	390	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCCTGATGCCCCATGTCC	0.562																																					p.M390I		Atlas-SNP	.											.	PCDHA8	366	.	0			c.G1170A						.						180.0	167.0	171.0					5																	140222076		2203	4300	6503	SO:0001583	missense	56140	exon1			CCTGATGCCCCAT	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1170G>A	chr5.hg19:g.140222076G>A	ENSP00000434655:p.Met390Ile	218.0	0.0		85.0	39.0	NM_031856	B9EGT7|O75281	Missense_Mutation	SNP	ENST00000531613.1	hg19	CCDS54919.1	.	.	.	.	.	.	.	.	.	.	G	9.768	1.172031	0.21704	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.01685	4.69;4.69	3.57	-5.89	0.02282	Cadherin (4);Cadherin-like (1);	1.579270	0.04935	U	0.457653	T	0.00875	0.0029	N	0.02129	-0.67	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.50668	-0.8801	10	0.46703	T	0.11	.	6.6828	0.23129	0.4666:0.0:0.4186:0.1148	.	390;390	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	I	390	ENSP00000434655:M390I;ENSP00000367363:M390I	ENSP00000367363:M390I	M	+	3	0	PCDHA8	140202260	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-4.392000	0.00241	-1.411000	0.02032	0.306000	0.20318	ATG	.	.		0.562	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
RNF145	153830	hgsc.bcm.edu	37	5	158588365	158588365	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:158588365C>T	ENST00000424310.2	-	10	1894	c.1535G>A	c.(1534-1536)cGc>cAc	p.R512H	RNF145_ENST00000518802.1_Missense_Mutation_p.R542H|RNF145_ENST00000520638.1_Missense_Mutation_p.R526H|RNF145_ENST00000519865.1_Missense_Mutation_p.R512H|RNF145_ENST00000274542.2_Missense_Mutation_p.R540H|RNF145_ENST00000521606.2_Missense_Mutation_p.R529H|RNF145_ENST00000518284.1_5'UTR	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	512						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCATCCCTGCGGAGAAGAAA	0.448																																					p.R542H		Atlas-SNP	.											RNF145,caecum,carcinoma,-1,1	RNF145	110	.	0			c.G1625A						.						46.0	45.0	46.0					5																	158588365		2203	4300	6503	SO:0001583	missense	153830	exon10			TCCCTGCGGAGAA	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.1535G>A	chr5.hg19:g.158588365C>T	ENSP00000409064:p.Arg512His	165.0	0.0		70.0	28.0	NM_001199380	B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	ENST00000424310.2	hg19	CCDS56390.1	.	.	.	.	.	.	.	.	.	.	C	36	5.603213	0.96614	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	D;D;D;D;D;D;D	0.82344	-1.6;-1.58;-1.58;-1.6;-1.6;-1.6;-1.6	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.91768	0.7396	M	0.79011	2.435	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.994;0.997;0.994;0.999	D	0.90729	0.4641	10	0.52906	T	0.07	-16.4831	20.6439	0.99570	0.0:1.0:0.0:0.0	.	529;526;542;512;540	B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;RN145_HUMAN;.	H	540;512;512;528;529;542;512;526	ENSP00000274542:R540H;ENSP00000430397:R512H;ENSP00000409064:R512H;ENSP00000430753:R528H;ENSP00000445115:R529H;ENSP00000430955:R542H;ENSP00000429071:R526H	ENSP00000274542:R540H	R	-	2	0	RNF145	158520943	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.711000	0.84669	2.890000	0.99128	0.650000	0.86243	CGC	.	.		0.448	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
ATP10B	23120	hgsc.bcm.edu	37	5	159992727	159992727	+	Silent	SNP	T	T	C	rs528864040		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:159992727T>C	ENST00000327245.5	-	26	4965	c.4119A>G	c.(4117-4119)acA>acG	p.T1373T		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1373					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGTCCTGTCCTGTGATAGATG	0.542													T|||	1	0.000199681	0.0	0.0	5008	,	,		15610	0.0		0.0	False		,,,				2504	0.001				p.T1373T		Atlas-SNP	.											.	ATP10B	201	.	0			c.A4119G						.						123.0	133.0	130.0					5																	159992727		1984	4168	6152	SO:0001819	synonymous_variant	23120	exon26			CTGTCCTGTGATA	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.4119A>G	chr5.hg19:g.159992727T>C		83.0	0.0		49.0	20.0	NM_025153	Q9H725	Silent	SNP	ENST00000327245.5	hg19	CCDS43394.1																																																																																			.	.		0.542	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
RGS14	10636	hgsc.bcm.edu	37	5	176793252	176793252	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:176793252A>T	ENST00000408923.3	+	3	330	c.142A>T	c.(142-144)Agt>Tgt	p.S48C		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	48					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGCCTCCCCAGTGGTCCCAG	0.692																																					p.S48C	NSCLC(47;353 1896 28036)	Atlas-SNP	.											.	RGS14	34	.	0			c.A142T						.						11.0	18.0	16.0					5																	176793252		1959	4141	6100	SO:0001583	missense	10636	exon3			CTCCCCAGTGGTC	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.142A>T	chr5.hg19:g.176793252A>T	ENSP00000386229:p.Ser48Cys	67.0	0.0		41.0	10.0	NM_006480	O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	ENST00000408923.3	hg19	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.601775	0.66445	.	.	ENSG00000169220	ENST00000408923;ENST00000336477	T	0.42900	0.96	4.44	3.18	0.36537	.	0.137147	0.50627	D	0.000103	T	0.39600	0.1084	L	0.57536	1.79	0.35940	D	0.833173	P	0.43885	0.82	B	0.44163	0.443	T	0.53892	-0.8374	10	0.72032	D	0.01	-7.7575	6.5417	0.22385	0.6343:0.2816:0.0841:0.0	.	48	O43566	RGS14_HUMAN	C	48	ENSP00000386229:S48C	ENSP00000336864:S48C	S	+	1	0	RGS14	176725858	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.821000	0.48065	1.645000	0.50612	0.363000	0.22086	AGT	.	.		0.692	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372676.1	NM_006480	
FLT4	2324	hgsc.bcm.edu	37	5	180048202	180048202	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:180048202C>T	ENST00000261937.6	-	14	2149	c.2071G>A	c.(2071-2073)Gtg>Atg	p.V691M	FLT4_ENST00000393347.3_Missense_Mutation_p.V691M|FLT4_ENST00000502649.1_Missense_Mutation_p.V691M|FLT4_ENST00000424276.2_5'UTR	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	691	Ig-like C2-type 7.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAGTCGCTCACGTTCACCAGG	0.627																																					p.V691M	Colon(97;1075 1466 27033 27547 35871)	Atlas-SNP	.											.	FLT4	356	.	0			c.G2071A						.						32.0	34.0	33.0					5																	180048202		2203	4298	6501	SO:0001583	missense	2324	exon14			CGCTCACGTTCAC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2071G>A	chr5.hg19:g.180048202C>T	ENSP00000261937:p.Val691Met	131.0	0.0		56.0	25.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	hg19	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397803	0.83120	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	D;D;D	0.82803	-1.65;-1.65;-1.65	4.53	3.64	0.41730	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.89856	0.6836	M	0.79926	2.475	0.58432	D	0.999991	D;D;D;P	0.89917	1.0;0.984;0.972;0.946	D;P;P;P	0.75020	0.985;0.908;0.764;0.703	D	0.90474	0.4455	9	0.72032	D	0.01	.	11.2555	0.49052	0.0:0.8499:0.0:0.1501	.	691;501;691;691	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	M	691;691;691;501	ENSP00000261937:V691M;ENSP00000377016:V691M;ENSP00000426057:V691M	ENSP00000261937:V691M	V	-	1	0	FLT4	179980808	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.941000	0.49011	2.249000	0.74217	0.561000	0.74099	GTG	.	.		0.627	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
DCDC2	51473	hgsc.bcm.edu	37	6	24205315	24205315	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:24205315T>G	ENST00000378454.3	-	8	1239	c.938A>C	c.(937-939)aAa>aCa	p.K313T	DCDC2_ENST00000378450.3_Missense_Mutation_p.K66T	NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	313					cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TGCTCCAGCTTTGAAAATGCC	0.433																																					p.K313T		Atlas-SNP	.											.	DCDC2	53	.	0			c.A938C						.						207.0	198.0	201.0					6																	24205315		2203	4299	6502	SO:0001583	missense	51473	exon9			CCAGCTTTGAAAA	AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.938A>C	chr6.hg19:g.24205315T>G	ENSP00000367715:p.Lys313Thr	207.0	0.0		131.0	16.0	NM_001195610	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Missense_Mutation	SNP	ENST00000378454.3	hg19	CCDS4550.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.392928	0.83011	.	.	ENSG00000146038	ENST00000378454;ENST00000378450	T;T	0.59364	4.18;0.27	6.07	6.07	0.98685	.	0.170523	0.51477	D	0.000083	T	0.71151	0.3306	M	0.78049	2.395	0.42088	D	0.991287	P;D	0.71674	0.891;0.998	B;D	0.68039	0.439;0.955	T	0.76063	-0.3096	10	0.87932	D	0	-0.4623	16.3141	0.82909	0.0:0.0:0.0:1.0	.	313;66	Q9UHG0;Q9UHG0-2	DCDC2_HUMAN;.	T	313;66	ENSP00000367715:K313T;ENSP00000367711:K66T	ENSP00000367711:K66T	K	-	2	0	DCDC2	24313294	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.679000	0.54634	2.326000	0.78906	0.533000	0.62120	AAA	.	.		0.433	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356	
ZKSCAN4	387032	hgsc.bcm.edu	37	6	28217606	28217606	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:28217606C>G	ENST00000377294.2	-	2	673	c.430G>C	c.(430-432)Gtt>Ctt	p.V144L	ZKSCAN4_ENST00000423974.2_5'UTR	NM_019110.3	NP_061983.2	Q969J2	ZKSC4_HUMAN	zinc finger with KRAB and SCAN domains 4	144					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(2)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TGGTCACCAACGGGAACCTAG	0.438																																					p.V144L		Atlas-SNP	.											.	ZKSCAN4	42	.	0			c.G430C						.						211.0	195.0	200.0					6																	28217606		2203	4300	6503	SO:0001583	missense	387032	exon2			CACCAACGGGAAC	AK056698	CCDS4647.1	6p21	2013-01-09	2007-02-20	2007-02-20	ENSG00000187626	ENSG00000187626		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13854	protein-coding gene	gene with protein product		611643	"""zinc finger protein 307"", ""zinc finger protein 427"""	ZNF307, ZNF427		12477932	Standard	NM_019110		Approved	p373c6.1, P1P373C6, FLJ32136, ZSCAN36	uc003nks.1	Q969J2	OTTHUMG00000014511	ENST00000377294.2:c.430G>C	chr6.hg19:g.28217606C>G	ENSP00000366509:p.Val144Leu	81.0	0.0		44.0	9.0	NM_019110	B2RE32|Q5U7L4	Missense_Mutation	SNP	ENST00000377294.2	hg19	CCDS4647.1	.	.	.	.	.	.	.	.	.	.	C	0.719	-0.784323	0.02907	.	.	ENSG00000187626	ENST00000377294	T	0.05447	3.44	4.29	1.02	0.19986	Transcription regulator SCAN (1);	.	.	.	.	T	0.00875	0.0029	N	0.08118	0	0.09310	N	0.999998	B	0.19073	0.033	B	0.17722	0.019	T	0.47983	-0.9074	9	0.36615	T	0.2	.	3.063	0.06205	0.2038:0.5124:0.0:0.2837	.	144	Q969J2	ZKSC4_HUMAN	L	144	ENSP00000366509:V144L	ENSP00000366509:V144L	V	-	1	0	ZKSCAN4	28325585	0.027000	0.19231	0.002000	0.10522	0.029000	0.11900	0.216000	0.17585	0.042000	0.15717	-0.182000	0.12963	GTT	.	.		0.438	ZKSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040179.1	NM_019110	
OR5V1	81696	hgsc.bcm.edu	37	6	29323799	29323799	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:29323799A>T	ENST00000377154.1	-	4	473	c.174T>A	c.(172-174)ccT>ccA	p.P58P	OR5V1_ENST00000543825.1_Silent_p.P58P			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AATAATACATAGGTGTATGCA	0.393																																					p.P58P	Ovarian(32;43 883 21137 32120 42650)	Atlas-SNP	.											.	OR5V1	63	.	0			c.T174A						.						153.0	150.0	151.0					6																	29323799		2203	4300	6503	SO:0001819	synonymous_variant	81696	exon1			ATACATAGGTGTA		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.174T>A	chr6.hg19:g.29323799A>T		116.0	0.0		58.0	18.0	NM_030876	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Silent	SNP	ENST00000377154.1	hg19	CCDS4657.1																																																																																			.	.		0.393	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3		
OR2H1	26716	hgsc.bcm.edu	37	6	29430101	29430101	+	Silent	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:29430101C>A	ENST00000377136.1	+	4	1020	c.555C>A	c.(553-555)ctC>ctA	p.L185L	OR2H1_ENST00000473369.1_3'UTR|OR2H1_ENST00000442615.1_Silent_p.L185L|OR2H1_ENST00000396792.2_Silent_p.L185L|OR2H1_ENST00000377132.1_Silent_p.L185L|OR2H1_ENST00000377133.1_Silent_p.L185L			Q9GZK4	OR2H1_HUMAN	olfactory receptor, family 2, subfamily H, member 1	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(5)|lung(12)	17						TGATTCGACTCTCCTGTGGAG	0.502																																					p.L185L		Atlas-SNP	.											.	OR2H1	38	.	0			c.C555A						.						189.0	194.0	192.0					6																	29430101		1511	2709	4220	SO:0001819	synonymous_variant	26716	exon3			TCGACTCTCCTGT	AF044491	CCDS4660.1	6p22.1	2014-02-19	2002-02-28		ENSG00000204688	ENSG00000204688		"""GPCR / Class A : Olfactory receptors"""	8252	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily H, member 8"""	OR2H6, OR2H8			Standard	NM_030883		Approved	OR6-2	uc003nmi.3	Q9GZK4	OTTHUMG00000031050	ENST00000377136.1:c.555C>A	chr6.hg19:g.29430101C>A		152.0	0.0		80.0	15.0	NM_030883	B0S7T4|O43629|O43661|O43662|Q5SUN6|Q9GZK9	Silent	SNP	ENST00000377136.1	hg19	CCDS4660.1																																																																																			.	.		0.502	OR2H1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194014.3		
NRM	11270	hgsc.bcm.edu	37	6	30657906	30657906	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:30657906T>G	ENST00000259953.4	-	3	599	c.248A>C	c.(247-249)gAa>gCa	p.E83A	NRM_ENST00000376421.5_Missense_Mutation_p.E83A|PPP1R18_ENST00000274853.3_5'Flank|PPP1R18_ENST00000399199.3_5'Flank|NRM_ENST00000376420.5_Missense_Mutation_p.E83A|PPP1R18_ENST00000488324.1_5'Flank|NRM_ENST00000470733.1_5'UTR	NM_007243.2	NP_009174.1	Q8IXM6	NRM_HUMAN	nurim (nuclear envelope membrane protein)	83						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)				large_intestine(1)|lung(2)	3						CTTCACTCTTTCAGCTGCCAT	0.607																																					p.E83A		Atlas-SNP	.											.	NRM	7	.	0			c.A248C						.						107.0	101.0	103.0					6																	30657906		1510	2708	4218	SO:0001583	missense	11270	exon2			ACTCTTTCAGCTG	AF143676	CCDS4686.1, CCDS59498.1	6p21.3	2010-02-17			ENSG00000137404	ENSG00000137404			8003	protein-coding gene	gene with protein product						10402458, 17517639	Standard	NM_007243		Approved	NRM29	uc031sng.1	Q8IXM6	OTTHUMG00000031223	ENST00000259953.4:c.248A>C	chr6.hg19:g.30657906T>G	ENSP00000259953:p.Glu83Ala	120.0	0.0		61.0	15.0	NM_001270709	B0S7R0|B0S7R1|I3XIE2|I3XIE3|Q5JP57|Q5JP58|Q5JP59|Q5JP60|Q8WU45|Q9BSX3|Q9UN92	Missense_Mutation	SNP	ENST00000259953.4	hg19	CCDS4686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.06|14.06	2.422431|2.422431	0.43020|0.43020	.|.	.|.	ENSG00000137404|ENSG00000137404	ENST00000259953;ENST00000376420;ENST00000376421|ENST00000444096	T;T|.	0.30448|.	1.53;1.53|.	4.6|4.6	4.6|4.6	0.57074|0.57074	.|.	0.328653|.	0.29253|.	N|.	0.012684|.	T|.	0.07638|.	0.0192|.	N|N	0.05351|0.05351	-0.065|-0.065	0.09310|0.09310	N|N	1|1	B|.	0.21688|.	0.059|.	B|.	0.22386|.	0.039|.	T|.	0.20605|.	-1.0270|.	10|.	0.09590|.	T|.	0.72|.	-3.6807|-3.6807	8.3286|8.3286	0.32173|0.32173	0.0:0.0:0.2:0.8|0.0:0.0:0.2:0.8	.|.	83|.	Q8IXM6|.	NRM_HUMAN|.	A|C	83|82	ENSP00000259953:E83A;ENSP00000365603:E83A|.	ENSP00000259953:E83A|.	E|X	-|-	2|3	0|0	NRM|NRM	30765885|30765885	0.071000|0.071000	0.21146|0.21146	0.587000|0.587000	0.28692|0.28692	0.543000|0.543000	0.35085|0.35085	1.412000|1.412000	0.34714|0.34714	1.928000|1.928000	0.55862|0.55862	0.379000|0.379000	0.24179|0.24179	GAA|TGA	.	.		0.607	NRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076466.2		
TNXB	7148	hgsc.bcm.edu	37	6	32012931	32012931	+	Silent	SNP	C	C	A	rs545042173		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:32012931C>A	ENST00000375244.3	-	32	10980	c.10779G>T	c.(10777-10779)acG>acT	p.T3593T	TNXB_ENST00000375247.2_Silent_p.T3591T|TNXB_ENST00000451343.1_Silent_p.T22T			P22105	TENX_HUMAN	tenascin XB	3638					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCTGCCCGTTCGTGTCCTCAT	0.637																																					p.T3591T		Atlas-SNP	.											TNXB_ENST00000375247,right_upper_lobe,carcinoma,0,3	TNXB	553	.	0			c.G10773T						.						62.0	54.0	57.0					6																	32012931		1507	2706	4213	SO:0001819	synonymous_variant	7148	exon32			CCCGTTCGTGTCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10779G>T	chr6.hg19:g.32012931C>A		402.0	0.0		255.0	13.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	hg19																																																																																				.	.		0.637	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
OSTM1	28962	hgsc.bcm.edu	37	6	108372287	108372287	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:108372287A>G	ENST00000193322.3	-	4	816	c.731T>C	c.(730-732)cTt>cCt	p.L244P		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	244					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		CTTATTCTCAAGTTCATTCAT	0.338																																					p.L244P	Melanoma(162;1427 1909 3096 17430 21396)	Atlas-SNP	.											.	OSTM1	22	.	0			c.T731C						.						212.0	186.0	195.0					6																	108372287		2203	4300	6503	SO:0001583	missense	28962	exon4			TTCTCAAGTTCAT	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.731T>C	chr6.hg19:g.108372287A>G	ENSP00000193322:p.Leu244Pro	264.0	0.0		103.0	14.0	NM_014028	E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	ENST00000193322.3	hg19	CCDS5062.1	.	.	.	.	.	.	.	.	.	.	a	16.32	3.090238	0.55968	.	.	ENSG00000081087	ENST00000193322;ENST00000440575	T	0.46063	0.88	5.79	-6.46	0.01908	.	0.795303	0.11237	N	0.585048	T	0.20047	0.0482	L	0.51422	1.61	0.20764	N	0.999856	P	0.52577	0.954	P	0.48952	0.596	T	0.19321	-1.0309	10	0.40728	T	0.16	-6.5411	6.8972	0.24262	0.2689:0.3795:0.0:0.3515	.	244	Q86WC4	OSTM1_HUMAN	P	244;97	ENSP00000193322:L244P	ENSP00000193322:L244P	L	-	2	0	OSTM1	108478980	0.001000	0.12720	0.152000	0.22495	0.998000	0.95712	-0.957000	0.03861	-0.462000	0.06984	0.533000	0.62120	CTT	.	.		0.338	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041709.3	NM_014028	
KIF25	3834	hgsc.bcm.edu	37	6	168445527	168445527	+	Missense_Mutation	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:168445527G>T	ENST00000443060.2	+	10	1397	c.1006G>T	c.(1006-1008)Gtg>Ttg	p.V336L	KIF25_ENST00000351261.3_Missense_Mutation_p.V284L|KIF25_ENST00000354419.2_Missense_Mutation_p.V336L			Q9UIL4	KIF25_HUMAN	kinesin family member 25	336	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GAAGTTACTGGTGATTCTCTG	0.562																																					p.V336L		Atlas-SNP	.											.	KIF25	75	.	0			c.G1006T						.						124.0	134.0	131.0					6																	168445527		2203	4300	6503	SO:0001583	missense	3834	exon9			TTACTGGTGATTC	AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.1006G>T	chr6.hg19:g.168445527G>T	ENSP00000388878:p.Val336Leu	69.0	0.0		27.0	13.0	NM_030615	O94775|Q5SZU9	Missense_Mutation	SNP	ENST00000443060.2	hg19	CCDS5305.1	.	.	.	.	.	.	.	.	.	.	G	7.299	0.612739	0.14066	.	.	ENSG00000125337	ENST00000443060;ENST00000354419;ENST00000351261	T;T;T	0.69175	-0.38;-0.38;1.14	4.12	3.24	0.37175	Kinesin, motor domain (3);	0.221217	0.31495	N	0.007550	T	0.25195	0.0612	N	0.12920	0.275	0.27757	N	0.943963	P;B	0.40638	0.725;0.043	B;B	0.36666	0.23;0.105	T	0.07751	-1.0756	10	0.72032	D	0.01	-18.3591	5.641	0.17565	0.1136:0.202:0.6844:0.0	.	284;336	Q9UIL4-2;Q9UIL4	.;KIF25_HUMAN	L	336;336;284	ENSP00000388878:V336L;ENSP00000346401:V336L;ENSP00000252688:V284L	ENSP00000252688:V284L	V	+	1	0	KIF25	168188376	1.000000	0.71417	0.128000	0.21923	0.087000	0.18053	2.977000	0.49297	0.692000	0.31613	0.609000	0.83330	GTG	.	.		0.562	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362509.1		
AHR	196	hgsc.bcm.edu	37	7	17382597	17382597	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:17382597A>C	ENST00000242057.4	+	11	3099	c.2456A>C	c.(2455-2457)aAt>aCt	p.N819T		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	819				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857). {ECO:0000305}.	apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AATAACATAAATAACACTCAG	0.373																																					p.N819T		Atlas-SNP	.											.	AHR	89	.	0			c.A2456C						.						176.0	168.0	171.0					7																	17382597		2203	4300	6503	SO:0001583	missense	196	exon11			ACATAAATAACAC	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2456A>C	chr7.hg19:g.17382597A>C	ENSP00000242057:p.Asn819Thr	168.0	0.0		91.0	25.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	hg19	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	8.702	0.909958	0.17833	.	.	ENSG00000106546	ENST00000242057	T	0.46451	0.87	5.35	-6.25	0.02039	.	0.673664	0.15455	N	0.261409	T	0.36413	0.0966	L	0.59436	1.845	0.09310	N	1	B	0.34181	0.44	B	0.30646	0.118	T	0.18999	-1.0319	10	0.59425	D	0.04	.	19.0415	0.93002	0.2359:0.0:0.7641:0.0	.	819	P35869	AHR_HUMAN	T	819	ENSP00000242057:N819T	ENSP00000242057:N819T	N	+	2	0	AHR	17349122	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.874000	0.04210	-1.090000	0.03069	0.533000	0.62120	AAT	.	.		0.373	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
AHR	196	hgsc.bcm.edu	37	7	17382606	17382606	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:17382606A>C	ENST00000242057.4	+	11	3108	c.2465A>C	c.(2464-2466)cAg>cCg	p.Q822P		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	822				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857). {ECO:0000305}.	apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	AATAACACTCAGACTACCACA	0.363																																					p.Q822P		Atlas-SNP	.											.	AHR	89	.	0			c.A2465C						.						191.0	180.0	184.0					7																	17382606		2203	4300	6503	SO:0001583	missense	196	exon11			ACACTCAGACTAC	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2465A>C	chr7.hg19:g.17382606A>C	ENSP00000242057:p.Gln822Pro	179.0	0.0		96.0	26.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	hg19	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	5.009	0.187412	0.09547	.	.	ENSG00000106546	ENST00000242057	T	0.50277	0.75	4.92	3.74	0.42951	.	0.542144	0.19216	N	0.119809	T	0.36991	0.0987	L	0.47016	1.485	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.21245	-1.0251	10	0.30854	T	0.27	.	7.1893	0.25816	0.7009:0.1425:0.0:0.1566	.	822	P35869	AHR_HUMAN	P	822	ENSP00000242057:Q822P	ENSP00000242057:Q822P	Q	+	2	0	AHR	17349131	0.722000	0.28017	0.010000	0.14722	0.066000	0.16364	1.866000	0.39489	0.918000	0.36919	0.533000	0.62120	CAG	.	.		0.363	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
AHR	196	hgsc.bcm.edu	37	7	17382611	17382611	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:17382611A>G	ENST00000242057.4	+	11	3113	c.2470A>G	c.(2470-2472)Acc>Gcc	p.T824A		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	824				LNETYPAELNNINNTQTTTHLQPLHHPSEARPFPDLTSSGF L -> FK (in Ref. 1; BAA03857). {ECO:0000305}.	apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	CACTCAGACTACCACACATCT	0.378																																					p.T824A		Atlas-SNP	.											.	AHR	89	.	0			c.A2470G						.						200.0	188.0	192.0					7																	17382611		2203	4300	6503	SO:0001583	missense	196	exon11			CAGACTACCACAC	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.2470A>G	chr7.hg19:g.17382611A>G	ENSP00000242057:p.Thr824Ala	184.0	0.0		100.0	26.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	hg19	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	0.004	-2.282525	0.00251	.	.	ENSG00000106546	ENST00000242057	T	0.41758	0.99	4.92	-9.85	0.00476	.	1.132360	0.06303	N	0.701195	T	0.14700	0.0355	N	0.02973	-0.45	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37478	-0.9704	10	0.02654	T	1	.	14.1452	0.65347	0.164:0.084:0.673:0.079	.	824	P35869	AHR_HUMAN	A	824	ENSP00000242057:T824A	ENSP00000242057:T824A	T	+	1	0	AHR	17349136	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-1.026000	0.03596	-3.335000	0.00184	-0.250000	0.11733	ACC	.	.		0.378	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
ABCB5	340273	hgsc.bcm.edu	37	7	20691108	20691109	+	Missense_Mutation	DNP	GG	GG	TT	rs560906981		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:20691108_20691109GG>TT	ENST00000404938.2	+	13	2050_2051	c.1398_1399GG>TT	c.(1396-1401)gtGGtt>gtTTtt	p.V467F	ABCB5_ENST00000258738.6_Missense_Mutation_p.V22F|ABCB5_ENST00000477094.1_3'UTR|ABCB5_ENST00000406935.1_Missense_Mutation_p.V22F|ABCB5_ENST00000443026.2_Missense_Mutation_p.V22F	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	467	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATATTGGAGTGGTTAGTCAAGA	0.446																																					p.V466V|p.V467F		Atlas-SNP	.											ABCB5,NS,carcinoma,0,1|.	ABCB5	357	.	0			c.G1398T|c.G1399T						.																																			SO:0001583	missense	340273	exon13			TGGAGTGGTTAGT|GGAGTGGTTAGTC	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	Exception_encountered	chr7.hg19:g.20691108_20691109delinsTT	ENSP00000384881:p.Val467Phe	118.0|117.0	0.0		58.0|59.0	24.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Silent|Missense_Mutation	SNP	ENST00000404938.2	hg19	CCDS55090.1																																																																																			.	.		0.446	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
NPSR1	387129	hgsc.bcm.edu	37	7	34867130	34867130	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:34867130C>T	ENST00000360581.1	+	5	724	c.596C>T	c.(595-597)gCc>gTc	p.A199V	NPSR1_ENST00000381539.3_Missense_Mutation_p.A199V|NPSR1_ENST00000381542.1_Missense_Mutation_p.A133V|NPSR1_ENST00000531252.1_Missense_Mutation_p.A188V|NPSR1_ENST00000359791.1_Missense_Mutation_p.A199V	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1	199						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	CAGTGCTGGGCCCTGTGGCCT	0.537																																					p.A199V		Atlas-SNP	.											.	NPSR1	134	.	0			c.C596T						.						159.0	137.0	144.0					7																	34867130		2203	4300	6503	SO:0001583	missense	387129	exon5			GCTGGGCCCTGTG	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.596C>T	chr7.hg19:g.34867130C>T	ENSP00000353788:p.Ala199Val	151.0	0.0		42.0	13.0	NM_207172	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	Missense_Mutation	SNP	ENST00000360581.1	hg19	CCDS5444.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.877943	0.91664	.	.	ENSG00000187258	ENST00000360581;ENST00000381542;ENST00000359791;ENST00000531252;ENST00000381539;ENST00000334481	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.44	5.44	0.79542	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	T	0.57051	0.2027	L	0.55743	1.74	0.51012	D	0.999903	D;D;D;P;D;P	0.89917	0.999;0.992;1.0;0.767;0.99;0.898	D;P;D;P;P;P	0.85130	0.997;0.814;0.997;0.661;0.741;0.823	T	0.53865	-0.8378	10	0.45353	T	0.12	-26.2085	18.2637	0.90044	0.0:1.0:0.0:0.0	.	133;188;133;199;199;199	B7ZMA2;Q6W5P4-5;Q6W5P4-2;Q6W5P4-4;Q6W5P4-3;Q6W5P4	.;.;.;.;.;NPSR1_HUMAN	V	199;133;199;188;199;62	ENSP00000353788:A199V;ENSP00000370953:A133V;ENSP00000352839:A199V;ENSP00000433258:A188V;ENSP00000370950:A199V	ENSP00000334093:A62V	A	+	2	0	NPSR1	34833655	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.937000	0.56575	2.553000	0.86117	0.655000	0.94253	GCC	.	.		0.537	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216837.1	NM_207173	
NPC1L1	29881	hgsc.bcm.edu	37	7	44578553	44578553	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:44578553A>G	ENST00000289547.4	-	2	1498	c.1443T>C	c.(1441-1443)agT>agC	p.S481S	NPC1L1_ENST00000423141.1_Silent_p.S481S|NPC1L1_ENST00000381160.3_Silent_p.S481S|NPC1L1_ENST00000546276.1_Silent_p.S481S	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	481					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	AGTCGTAGAGACTGGTATTGT	0.597																																					p.S481S		Atlas-SNP	.											.	NPC1L1	141	.	0			c.T1443C						.						127.0	109.0	115.0					7																	44578553		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon2			GTAGAGACTGGTA		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.1443T>C	chr7.hg19:g.44578553A>G		144.0	0.0		45.0	20.0	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	hg19	CCDS5491.1																																																																																			.	.		0.597	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
GRM3	2913	hgsc.bcm.edu	37	7	86493597	86493597	+	Splice_Site	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:86493597G>T	ENST00000361669.2	+	6	3665		c.e6-1		GRM3_ENST00000439827.1_Splice_Site|GRM3_ENST00000546348.1_Splice_Site|GRM3_ENST00000394720.2_Splice_Site|GRM3_ENST00000536043.1_Splice_Site	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TTGTTTTCCAGCCTCTGCAAG	0.498																																					.	GBM(52;969 1098 3139 52280)	Atlas-SNP	.											.	GRM3	237	.	0			c.2567-1G>T						.						219.0	185.0	197.0					7																	86493597		2203	4300	6503	SO:0001630	splice_region_variant	2913	exon6			TTTCCAGCCTCTG		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2567-1G>T	chr7.hg19:g.86493597G>T		119.0	0.0		75.0	15.0	NM_000840	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Splice_Site	SNP	ENST00000361669.2	hg19	CCDS5600.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.472337	0.84533	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043;ENST00000439827;ENST00000394720	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4659	0.94939	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRM3	86331533	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.502000	0.90505	2.840000	0.97914	0.655000	0.94253	.	.	.		0.498	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253362.2		Intron
PEX1	5189	hgsc.bcm.edu	37	7	92122372	92122372	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:92122372A>C	ENST00000248633.4	-	20	3197	c.3102T>G	c.(3100-3102)caT>caG	p.H1034Q	AC007566.10_ENST00000441539.1_RNA|AC007566.10_ENST00000427458.1_RNA|PEX1_ENST00000438045.1_Missense_Mutation_p.H712Q|PEX1_ENST00000428214.1_Missense_Mutation_p.H977Q	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1034					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CTGATGCTACATGCTGAAGGT	0.413																																					p.H1034Q		Atlas-SNP	.											.	PEX1	102	.	0			c.T3102G						.						127.0	122.0	124.0					7																	92122372		2203	4300	6503	SO:0001583	missense	5189	exon20			TGCTACATGCTGA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3102T>G	chr7.hg19:g.92122372A>C	ENSP00000248633:p.His1034Gln	166.0	0.0		78.0	13.0	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	hg19	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	A	6.505	0.461342	0.12342	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	D;D;D	0.94723	-3.5;-3.5;-3.5	5.78	-5.7	0.02421	.	0.267324	0.43110	D	0.000616	T	0.81498	0.4835	N	0.05441	-0.05	0.42812	D	0.993966	B;P;B	0.42518	0.009;0.782;0.145	B;B;B	0.35813	0.017;0.211;0.031	T	0.74714	-0.3572	10	0.24483	T	0.36	-12.3631	11.2591	0.49071	0.3269:0.0:0.5678:0.1053	.	712;826;1034	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	Q	712;1034;977	ENSP00000410438:H712Q;ENSP00000248633:H1034Q;ENSP00000394413:H977Q	ENSP00000248633:H1034Q	H	-	3	2	PEX1	91960308	0.818000	0.29161	0.906000	0.35671	0.188000	0.23474	0.050000	0.14120	-1.112000	0.02984	-0.481000	0.04817	CAT	.	.		0.413	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
PEX1	5189	hgsc.bcm.edu	37	7	92122387	92122387	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr7:92122387A>G	ENST00000248633.4	-	20	3182	c.3087T>C	c.(3085-3087)gaT>gaC	p.D1029D	AC007566.10_ENST00000441539.1_RNA|AC007566.10_ENST00000427458.1_RNA|PEX1_ENST00000438045.1_Silent_p.D707D|PEX1_ENST00000428214.1_Silent_p.D972D	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1029					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GAAGGTCAACATCATCTGCCA	0.368																																					p.D1029D		Atlas-SNP	.											.	PEX1	102	.	0			c.T3087C						.						117.0	114.0	115.0					7																	92122387		2203	4300	6503	SO:0001819	synonymous_variant	5189	exon20			GTCAACATCATCT	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3087T>C	chr7.hg19:g.92122387A>G		165.0	0.0		81.0	12.0	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	ENST00000248633.4	hg19	CCDS5627.1																																																																																			.	.		0.368	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	
RUNX1T1	862	hgsc.bcm.edu	37	8	93023275	93023275	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:93023275T>A	ENST00000523629.1	-	5	967	c.513A>T	c.(511-513)gaA>gaT	p.E171D	RUNX1T1_ENST00000520724.1_Missense_Mutation_p.E134D|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.E144D|RUNX1T1_ENST00000521553.1_Missense_Mutation_p.E134D|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.E182D|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.E134D|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.E144D|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.E134D|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.E171D	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	171	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			AGTTAGTAGCTTCTTGCAGTT	0.343																																					p.E230D		Atlas-SNP	.											.	RUNX1T1	516	.	0			c.A690T						.						137.0	134.0	135.0					8																	93023275		2203	4300	6503	SO:0001583	missense	862	exon5			AGTAGCTTCTTGC	D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.513A>T	chr8.hg19:g.93023275T>A	ENSP00000428543:p.Glu171Asp	150.0	0.0		126.0	6.0	NM_001198679	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	ENST00000523629.1	hg19	CCDS6256.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.037425	0.75617	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844;ENST00000521553;ENST00000518992;ENST00000521054	T;T;T;T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.87	5.87	0.94306	TAFH/NHR1 (3);	0.000000	0.85682	D	0.000000	T	0.51907	0.1702	L	0.34521	1.04	0.80722	D	1	B;B;B;B;B	0.20261	0.011;0.043;0.025;0.043;0.02	B;B;B;B;B	0.42522	0.052;0.39;0.217;0.16;0.104	T	0.51957	-0.8639	10	0.46703	T	0.11	-14.2221	16.5764	0.84681	0.0:0.0:0.0:1.0	.	182;182;144;171;144	E7EPN4;B7Z4P4;B2R6I9;Q06455;Q06455-2	.;.;.;MTG8_HUMAN;.	D	171;144;171;134;134;134;182;144;134;171;134	ENSP00000428543:E171D;ENSP00000379520:E144D;ENSP00000265814:E171D;ENSP00000353504:E134D;ENSP00000390137:E134D;ENSP00000428742:E134D;ENSP00000402257:E182D;ENSP00000430728:E144D;ENSP00000429728:E134D;ENSP00000431094:E171D;ENSP00000427763:E134D	ENSP00000265814:E171D	E	-	3	2	RUNX1T1	93092451	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.914000	0.69964	2.371000	0.80710	0.533000	0.62120	GAA	.	.		0.343	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377045.3	NM_004349, NM_175635	
NUDCD1	84955	hgsc.bcm.edu	37	8	110283345	110283345	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:110283345A>T	ENST00000239690.4	-	8	1562	c.1188T>A	c.(1186-1188)gaT>gaA	p.D396E	NUDCD1_ENST00000427660.2_Missense_Mutation_p.D367E	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			GTTTTTCTTTATCTGGATTTG	0.294																																					p.D396E		Atlas-SNP	.											.	NUDCD1	58	.	0			c.T1188A						.						108.0	114.0	112.0					8																	110283345		2202	4297	6499	SO:0001583	missense	84955	exon8			TTCTTTATCTGGA	AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.1188T>A	chr8.hg19:g.110283345A>T	ENSP00000239690:p.Asp396Glu	158.0	0.0		243.0	24.0	NM_032869		Missense_Mutation	SNP	ENST00000239690.4	hg19	CCDS6312.1	.	.	.	.	.	.	.	.	.	.	A	8.817	0.936643	0.18206	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	T;T	0.18338	2.22;2.22	5.7	1.99	0.26369	.	0.347524	0.34879	N	0.003613	T	0.05227	0.0139	N	0.04508	-0.205	0.25419	N	0.988283	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.30736	-0.9968	10	0.17369	T	0.5	-5.9605	1.069	0.01617	0.4223:0.2724:0.1571:0.1482	.	309;396;367	Q96RS6-3;Q96RS6;Q96RS6-2	.;NUDC1_HUMAN;.	E	396;367	ENSP00000239690:D396E;ENSP00000410707:D367E	ENSP00000239690:D396E	D	-	3	2	NUDCD1	110352521	0.582000	0.26749	1.000000	0.80357	0.889000	0.51656	-0.341000	0.07811	0.499000	0.27970	0.529000	0.55759	GAT	.	.		0.294	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380996.1	NM_032869	
TNFRSF11B	4982	hgsc.bcm.edu	37	8	119936661	119936661	+	Missense_Mutation	SNP	T	T	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:119936661T>G	ENST00000297350.4	-	5	1536	c.1158A>C	c.(1156-1158)ttA>ttC	p.L386F		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	386					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			CTATCATTTCTAAAAATAACT	0.398																																					p.L386F		Atlas-SNP	.											.	TNFRSF11B	87	.	0			c.A1158C						.						145.0	149.0	148.0					8																	119936661		2203	4300	6503	SO:0001583	missense	4982	exon5			CATTTCTAAAAAT	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.1158A>C	chr8.hg19:g.119936661T>G	ENSP00000297350:p.Leu386Phe	148.0	0.0		230.0	18.0	NM_002546	B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	ENST00000297350.4	hg19	CCDS6326.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741784	0.49151	.	.	ENSG00000164761	ENST00000297350	T	0.78364	-1.17	5.69	2.15	0.27550	.	0.347193	0.24366	N	0.039155	T	0.78013	0.4217	L	0.29908	0.895	0.37574	D	0.919541	D	0.89917	1.0	D	0.85130	0.997	T	0.75377	-0.3339	9	.	.	.	-5.9162	8.6482	0.34018	0.0:0.2149:0.0:0.7851	.	386	O00300	TR11B_HUMAN	F	386	ENSP00000297350:L386F	.	L	-	3	2	TNFRSF11B	120005842	0.914000	0.31030	0.971000	0.41717	0.720000	0.41350	-0.145000	0.10265	0.468000	0.27243	0.533000	0.62120	TTA	.	.		0.398	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1		
TNFRSF11B	4982	hgsc.bcm.edu	37	8	119936888	119936888	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr8:119936888C>G	ENST00000297350.4	-	5	1309	c.931G>C	c.(931-933)Gac>Cac	p.D311H		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	311	Death 2.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			TTTTCAATGTCTTCTGCTCCC	0.478																																					p.D311H		Atlas-SNP	.											TNFRSF11B_ENST00000297350,NS,carcinoma,0,2	TNFRSF11B	87	.	0			c.G931C						.						193.0	151.0	165.0					8																	119936888		2203	4300	6503	SO:0001583	missense	4982	exon5			CAATGTCTTCTGC	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.931G>C	chr8.hg19:g.119936888C>G	ENSP00000297350:p.Asp311His	250.0	0.0		391.0	25.0	NM_002546	B2R9A8|O60236|Q53FX6|Q9UHP4	Missense_Mutation	SNP	ENST00000297350.4	hg19	CCDS6326.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110816	0.56398	.	.	ENSG00000164761	ENST00000297350	D	0.94000	-3.33	5.65	5.65	0.86999	Death (1);	1.453660	0.03646	N	0.240271	D	0.96213	0.8765	L	0.54323	1.7	0.44843	D	0.997855	P	0.46512	0.879	P	0.56398	0.797	D	0.86941	0.2079	9	.	.	.	-14.9045	20.0822	0.97779	0.0:1.0:0.0:0.0	.	311	O00300	TR11B_HUMAN	H	311	ENSP00000297350:D311H	.	D	-	1	0	TNFRSF11B	120006069	1.000000	0.71417	0.988000	0.46212	0.231000	0.25187	5.574000	0.67424	2.826000	0.97356	0.563000	0.77884	GAC	.	.		0.478	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381220.1		
MELK	9833	hgsc.bcm.edu	37	9	36677293	36677293	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:36677293A>C	ENST00000298048.2	+	18	2099	c.1915A>C	c.(1915-1917)Aaa>Caa	p.K639Q	MELK_ENST00000536987.1_Missense_Mutation_p.K508Q|MELK_ENST00000543751.1_Missense_Mutation_p.K607Q|MELK_ENST00000536860.1_Missense_Mutation_p.K591Q|MELK_ENST00000545008.1_Missense_Mutation_p.K568Q|MELK_ENST00000541717.1_Missense_Mutation_p.K598Q|MELK_ENST00000538311.1_Missense_Mutation_p.K445Q|MELK_ENST00000536329.1_Missense_Mutation_p.K568Q	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	639	Autoinhibitory region.|KA1. {ECO:0000255|PROSITE- ProRule:PRU00565}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			CTGGGTTTACAAAAGATTAGT	0.458																																					p.K639Q	Ovarian(82;980 1317 7225 14391 18624)	Atlas-SNP	.											.	MELK	74	.	0			c.A1915C						.						87.0	83.0	84.0					9																	36677293		2203	4300	6503	SO:0001583	missense	9833	exon18			GTTTACAAAAGAT	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1915A>C	chr9.hg19:g.36677293A>C	ENSP00000298048:p.Lys639Gln	70.0	0.0		22.0	17.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	hg19	CCDS6606.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341660	0.81911	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4;0.4;0.4	5.75	5.75	0.90469	Kinase-associated KA1 (4);	0.092179	0.64402	D	0.000001	T	0.74512	0.3726	M	0.82056	2.57	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0;1.0	T	0.78505	-0.2178	10	0.87932	D	0	-13.7741	16.0623	0.80847	1.0:0.0:0.0:0.0	.	559;568;591;598;568;607;639	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	Q	639;445;508;568;591;568;598;607	ENSP00000298048:K639Q;ENSP00000438226:K445Q;ENSP00000439184:K508Q;ENSP00000445452:K568Q;ENSP00000439792:K591Q;ENSP00000443550:K568Q;ENSP00000437804:K598Q;ENSP00000441596:K607Q	ENSP00000298048:K639Q	K	+	1	0	MELK	36667293	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.683000	0.91236	2.195000	0.70347	0.533000	0.62120	AAA	.	.		0.458	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
TNC	3371	hgsc.bcm.edu	37	9	117808755	117808755	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:117808755C>T	ENST00000350763.4	-	17	5470	c.5059G>A	c.(5059-5061)Gaa>Aaa	p.E1687K	TNC_ENST00000423613.2_Intron|TNC_ENST00000341037.4_Missense_Mutation_p.E1505K|TNC_ENST00000346706.3_Missense_Mutation_p.E1141K|TNC_ENST00000345230.3_Intron|TNC_ENST00000340094.3_Missense_Mutation_p.E1323K|TNC_ENST00000535648.1_Missense_Mutation_p.E1232K|TNC_ENST00000537320.1_Intron|TNC_ENST00000481475.1_5'Flank|TNC_ENST00000542877.1_Missense_Mutation_p.E1324K	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1687	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						AGTTCAATTTCGTATTCAGTA	0.443																																					p.E1687K		Atlas-SNP	.											.	TNC	282	.	0			c.G5059A						.						223.0	209.0	214.0					9																	117808755		2203	4300	6503	SO:0001583	missense	3371	exon17			CAATTTCGTATTC		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5059G>A	chr9.hg19:g.117808755C>T	ENSP00000265131:p.Glu1687Lys	334.0	0.0		97.0	76.0	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	hg19	CCDS6811.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.14|12.14	1.847912|1.847912	0.32699|0.32699	.|.	.|.	ENSG00000041982|ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877|ENST00000544972	T;T;T;T;T;T|.	0.58210|.	0.35;0.35;0.35;0.35;0.35;0.35|.	5.81|5.81	4.91|4.91	0.64330|0.64330	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.240480|.	0.41294|.	D|.	0.000913|.	T|T	0.48768|0.48768	0.1518|0.1518	N|N	0.21194|0.21194	0.64|0.64	0.80722|0.80722	D|D	1|1	B|.	0.31519|.	0.327|.	B|.	0.27380|.	0.079|.	T|T	0.42258|0.42258	-0.9462|-0.9462	10|5	0.06099|.	T|.	0.92|.	.|.	11.8032|11.8032	0.52139|0.52139	0.0:0.8588:0.0:0.1412|0.0:0.8588:0.0:0.1412	.|.	1687|.	P24821|.	TENA_HUMAN|.	K|Q	1323;1232;1141;1687;1505;1324|249	ENSP00000344400:E1323K;ENSP00000438152:E1232K;ENSP00000344555:E1141K;ENSP00000265131:E1687K;ENSP00000339553:E1505K;ENSP00000442242:E1324K|.	ENSP00000344400:E1323K|.	E|R	-|-	1|2	0|0	TNC|TNC	116848576|116848576	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.993000|0.993000	0.82548|0.82548	3.744000|3.744000	0.55112|0.55112	1.438000|1.438000	0.47492|0.47492	0.563000|0.563000	0.77884|0.77884	GAA|CGA	.	.		0.443	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
TTF1	7270	hgsc.bcm.edu	37	9	135277159	135277159	+	Silent	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:135277159A>T	ENST00000334270.2	-	2	1089	c.1050T>A	c.(1048-1050)ccT>ccA	p.P350P		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	350					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CGAGGCTCTCAGGCATGGCCA	0.468																																					p.P350P		Atlas-SNP	.											.	TTF1	82	.	0			c.T1050A						.						129.0	124.0	125.0					9																	135277159		2203	4300	6503	SO:0001819	synonymous_variant	7270	exon2			GCTCTCAGGCATG	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1050T>A	chr9.hg19:g.135277159A>T		170.0	0.0		63.0	44.0	NM_007344	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Silent	SNP	ENST00000334270.2	hg19	CCDS6948.1																																																																																			.	.		0.468	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344	
C10orf113	387638	hgsc.bcm.edu	37	10	21435299	21435299	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:21435299C>G	ENST00000534331.1	-	1	189	c.139G>C	c.(139-141)Gct>Cct	p.A47P	NEBL_ENST00000417816.2_Intron|C10orf113_ENST00000377118.4_Missense_Mutation_p.A37P|C10orf113_ENST00000529198.1_Missense_Mutation_p.A47P	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	47										endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						TACATTTCAGCCACACAAGAA	0.433																																					p.A47P		Atlas-SNP	.											.	C10orf113	32	.	0			c.G139C						.						153.0	136.0	142.0					10																	21435299		2203	4300	6503	SO:0001583	missense	387638	exon1			TTTCAGCCACACA		CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.139G>C	chr10.hg19:g.21435299C>G	ENSP00000433646:p.Ala47Pro	94.0	0.0		45.0	27.0	NM_001177483	B9EIM9|E9PRX7	Missense_Mutation	SNP	ENST00000534331.1	hg19	CCDS31162.2	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289650	0.40494	.	.	ENSG00000204683	ENST00000534331;ENST00000529198;ENST00000377118	T;T	0.39406	1.08;1.08	5.44	-7.19	0.01500	.	.	.	.	.	T	0.16428	0.0395	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24368	-1.0162	9	0.87932	D	0	5.4267	2.2927	0.04143	0.321:0.1168:0.3841:0.178	.	47	Q5VZT2	CJ113_HUMAN	P	47;47;37	ENSP00000433646:A47P;ENSP00000366322:A37P	ENSP00000366322:A37P	A	-	1	0	C10orf113	21475305	0.000000	0.05858	0.000000	0.03702	0.117000	0.20001	-0.009000	0.12765	-0.789000	0.04498	-0.950000	0.02660	GCT	.	.		0.433	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047108.3	NM_001010896	
WAC	51322	hgsc.bcm.edu	37	10	28884889	28884889	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:28884889T>C	ENST00000354911.4	+	7	999	c.838T>C	c.(838-840)Ttt>Ctt	p.F280L	WAC_ENST00000428935.1_Missense_Mutation_p.F235L|WAC_ENST00000375646.1_Intron|WAC_ENST00000347934.4_Intron|WAC_ENST00000375664.4_Missense_Mutation_p.F235L	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	280					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						AAAGAAATCATTTGATGCTAA	0.433																																					p.F280L		Atlas-SNP	.											.	WAC	77	.	0			c.T838C						.						131.0	120.0	124.0					10																	28884889		2203	4300	6503	SO:0001583	missense	51322	exon7			AAATCATTTGATG	AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.838T>C	chr10.hg19:g.28884889T>C	ENSP00000346986:p.Phe280Leu	70.0	0.0		42.0	9.0	NM_016628	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	ENST00000354911.4	hg19	CCDS7159.1	.	.	.	.	.	.	.	.	.	.	T	15.20	2.762548	0.49574	.	.	ENSG00000095787	ENST00000375664;ENST00000354911;ENST00000428935;ENST00000424454;ENST00000538000	T;T;T	0.30981	1.99;1.98;1.51	5.41	5.41	0.78517	.	0.307413	0.38897	N	0.001522	T	0.22627	0.0546	L	0.29908	0.895	0.38121	D	0.937842	B;B	0.25272	0.122;0.075	B;B	0.22601	0.04;0.018	T	0.09930	-1.0652	10	0.11794	T	0.64	-9.7218	15.4254	0.75045	0.0:0.0:0.0:1.0	.	235;280	Q9BTA9-2;Q9BTA9	.;WAC_HUMAN	L	235;280;235;235;235	ENSP00000364816:F235L;ENSP00000346986:F280L;ENSP00000399706:F235L	ENSP00000346986:F280L	F	+	1	0	WAC	28924895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.331000	0.59273	2.047000	0.60756	0.454000	0.30748	TTT	.	.		0.433	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1	NM_100264	
PARG	8505	hgsc.bcm.edu	37	10	51027418	51027418	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:51027418C>A	ENST00000402038.3	-	14	1443	c.1444G>T	c.(1444-1446)Gct>Tct	p.A482S		NM_003631.2	NP_003622.2	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase	967					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(ADP-ribose) glycohydrolase activity (GO:0004649)			endometrium(5)|kidney(2)|lung(1)|ovary(2)	10				Epithelial(53;0.213)		GAATGGTCAGCGGTCTCTGCA	0.517																																					p.A967S		Atlas-SNP	.											.	PARG	46	.	0			c.G2899T						.						161.0	142.0	148.0					10																	51027418		692	1591	2283	SO:0001583	missense	8505	exon18			GGTCAGCGGTCTC	AF005043	CCDS73130.1	10q11.23	2012-04-20			ENSG00000227345	ENSG00000227345	3.2.1.143		8605	protein-coding gene	gene with protein product		603501				9115250, 10449915	Standard	NM_003631		Approved		uc001jif.3	Q86W56	OTTHUMG00000018201	ENST00000402038.3:c.1444G>T	chr10.hg19:g.51027418C>A	ENSP00000384408:p.Ala482Ser	152.0	0.0		86.0	30.0	NM_003631	A5YBK3|B2RC24|B4DIU5|B4DYR4|I6RUV3|Q6E4P6|Q6E4P7|Q7Z742|Q9Y4W7	Missense_Mutation	SNP	ENST00000402038.3	hg19		.	.	.	.	.	.	.	.	.	.	C	1.001	-0.691062	0.03303	.	.	ENSG00000227345	ENST00000402038	.	.	.	5.59	-9.35	0.00633	.	.	.	.	.	T	0.04318	0.0119	N	0.00926	-1.1	.	.	.	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.001;0.0;0.001	T	0.23511	-1.0186	7	0.07482	T	0.82	4.2817	0.626	0.00786	0.2909:0.2075:0.1096:0.392	.	885;967;518;235;482;507;967	Q86W56-2;Q86W56;A5YBK3;B4DHS4;Q5SQP4;B4DX76;Q0MQR4	.;PARG_HUMAN;.;.;.;.;.	S	482	.	ENSP00000384408:A482S	A	-	1	0	PARG	50697424	0.094000	0.21725	0.000000	0.03702	0.005000	0.04900	-0.006000	0.12833	-1.398000	0.02066	-0.982000	0.02568	GCT	.	.		0.517	PARG-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048011.2	NM_003631	
ZNF365	22891	hgsc.bcm.edu	37	10	64148261	64148261	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:64148261C>G	ENST00000395254.3	+	3	1130	c.850C>G	c.(850-852)Ctg>Gtg	p.L284V	ZNF365_ENST00000466727.1_3'UTR|ZNF365_ENST00000395255.3_Missense_Mutation_p.L284V|ZNF365_ENST00000410046.3_Missense_Mutation_p.L284V	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					GCGGGTAGAACTGGCGGAGAA	0.567																																					p.L284V		Atlas-SNP	.											.	ZNF365	174	.	0			c.C850G						.						55.0	57.0	56.0					10																	64148261		2203	4300	6503	SO:0001583	missense	22891	exon3			GTAGAACTGGCGG	AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.850C>G	chr10.hg19:g.64148261C>G	ENSP00000378674:p.Leu284Val	58.0	0.0		31.0	9.0	NM_014951		Missense_Mutation	SNP	ENST00000395254.3	hg19	CCDS31209.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.629947	0.67015	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T;T;T	0.35421	1.31;1.31;1.31	5.58	-1.35	0.09114	.	2.215180	0.02118	N	0.055432	T	0.54775	0.1879	M	0.69823	2.125	0.80722	D	1	D;D;P;D	0.69078	0.997;0.986;0.948;0.974	D;P;P;P	0.64042	0.921;0.78;0.706;0.706	T	0.51679	-0.8675	10	0.51188	T	0.08	-5.0613	6.445	0.21871	0.0:0.518:0.1143:0.3677	.	284;284;284;299	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	V	284	ENSP00000378674:L284V;ENSP00000378675:L284V;ENSP00000387091:L284V	ENSP00000378674:L284V	L	+	1	2	ZNF365	63818267	0.002000	0.14202	0.984000	0.44739	0.985000	0.73830	-0.049000	0.11924	-0.201000	0.10284	0.655000	0.94253	CTG	.	.		0.567	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951	
AGAP11	119385	hgsc.bcm.edu	37	10	88768173	88768173	+	RNA	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:88768173C>T	ENST00000444431.1	+	0	2773				RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.10_ENST00000451760.1_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										AACTATTCCTCCTCCATTCCA	0.478																																					p.S55F		Atlas-SNP	.											.	.	.	.	0			c.C164T						.						109.0	113.0	111.0					10																	88768173		2135	4268	6403			119385	exon12			ATTCCTCCTCCAT			10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		chr10.hg19:g.88768173C>T		132.0	0.0		50.0	7.0	NM_133447	B9EIP7|D3DWE4	Missense_Mutation	SNP	ENST00000444431.1	hg19																																																																																				.	.		0.478	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447	
PPAPDC1A	196051	hgsc.bcm.edu	37	10	122334705	122334705	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr10:122334705G>A	ENST00000398250.1	+	6	860	c.508G>A	c.(508-510)Gag>Aag	p.E170K	PPAPDC1A_ENST00000541332.1_Missense_Mutation_p.E170K|PPAPDC1A_ENST00000496437.1_3'UTR|PPAPDC1A_ENST00000369073.3_Missense_Mutation_p.E160K|PPAPDC1A_ENST00000398248.1_Intron|PPAPDC1A_ENST00000439221.1_Missense_Mutation_p.E107K	NM_001030059.1	NP_001025230.1	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1A	170					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phospholipid dephosphorylation (GO:0046839)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)	p.E170K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	20		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		CTGCTTCACCGAGAGTGGGCG	0.577																																					p.E170K		Atlas-SNP	.											PPAPDC1A,colon,carcinoma,0,1	PPAPDC1A	48	.	1	Substitution - Missense(1)	large_intestine(1)	c.G508A						.																																			SO:0001583	missense	196051	exon6			TTCACCGAGAGTG	AK098668	CCDS41573.1	10q26.13	2008-02-05		2005-07-15	ENSG00000203805	ENSG00000203805			23531	protein-coding gene	gene with protein product			"""phosphatidic acid phosphatase type 2 domain containing 1"""	PPAPDC1			Standard	XM_005269592		Approved		uc001lev.1	Q5VZY2	OTTHUMG00000019168	ENST00000398250.1:c.508G>A	chr10.hg19:g.122334705G>A	ENSP00000381302:p.Glu170Lys	159.0	0.0		57.0	6.0	NM_001030059	A2RU82|Q08EQ2|Q0IIP2|Q495B4|Q5VZY1	Missense_Mutation	SNP	ENST00000398250.1	hg19	CCDS41573.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572924	0.45798	.	.	ENSG00000203805	ENST00000439221;ENST00000398250;ENST00000427079;ENST00000541332;ENST00000369073	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.52	5.52	0.82312	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.092240	0.64402	D	0.000001	T	0.28732	0.0712	N	0.24115	0.695	0.80722	D	1	P;D;B	0.57899	0.676;0.981;0.023	B;B;B	0.39738	0.294;0.308;0.005	T	0.09840	-1.0656	10	0.08179	T	0.78	-6.7691	19.441	0.94821	0.0:0.0:1.0:0.0	.	170;107;170	B7Z3R3;Q5VZY2-2;Q5VZY2	.;.;PPC1A_HUMAN	K	107;170;170;170;160	ENSP00000381302:E170K;ENSP00000407979:E170K;ENSP00000440493:E170K;ENSP00000358069:E160K	ENSP00000358069:E160K	E	+	1	0	PPAPDC1A	122324695	1.000000	0.71417	0.967000	0.41034	0.997000	0.91878	9.785000	0.99042	2.603000	0.88011	0.655000	0.94253	GAG	.	.		0.577	PPAPDC1A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_113641	
ZNF195	7748	hgsc.bcm.edu	37	11	3381365	3381365	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:3381365C>T	ENST00000399602.4	-	6	999	c.873G>A	c.(871-873)gaG>gaA	p.E291E	ZNF195_ENST00000354599.6_Silent_p.E219E|ZNF195_ENST00000005082.9_Silent_p.E268E|ZNF195_ENST00000343338.7_Silent_p.E223E|ZNF195_ENST00000526601.1_Silent_p.E272E|ZNF195_ENST00000528796.1_Intron|ZNF195_ENST00000438262.2_3'UTR|ZNF195_ENST00000429541.2_Silent_p.E223E	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		TGTCAATGTTCTCAGGTTCAG	0.378																																					p.E291E		Atlas-SNP	.											.	ZNF195	77	.	0			c.G873A						.						97.0	93.0	94.0					11																	3381365		1904	4155	6059	SO:0001819	synonymous_variant	7748	exon6			AATGTTCTCAGGT		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.873G>A	chr11.hg19:g.3381365C>T		142.0	0.0		81.0	16.0	NM_001130520	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	ENST00000399602.4	hg19	CCDS44522.1																																																																																			.	.		0.378	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032321.2		
MRVI1	10335	hgsc.bcm.edu	37	11	10613101	10613101	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:10613101A>G	ENST00000436272.1	-	17	2231	c.2153T>C	c.(2152-2154)tTg>tCg	p.L718S	MRVI1_ENST00000424001.1_Missense_Mutation_p.L430S|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000423302.2_Missense_Mutation_p.L745S|MRVI1_ENST00000527509.2_Missense_Mutation_p.L654S|MRVI1_ENST00000531107.1_Missense_Mutation_p.L737S|MRVI1_ENST00000541483.1_Missense_Mutation_p.L539S|MRVI1_ENST00000547195.1_Missense_Mutation_p.L654S|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000552103.1_Missense_Mutation_p.L654S|MRVI1_ENST00000534266.2_Missense_Mutation_p.L430S|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000545852.1_Missense_Mutation_p.L430S|MRVI1_ENST00000421747.1_Missense_Mutation_p.L736S|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000558540.1_Missense_Mutation_p.L430S			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	718					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		TTACTTTTCCAAAAGTGCAGG	0.443																																					p.L745S		Atlas-SNP	.											.	MRVI1	113	.	0			c.T2234C						.						51.0	49.0	50.0					11																	10613101		1915	4136	6051	SO:0001583	missense	10335	exon18			TTTTCCAAAAGTG	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.2153T>C	chr11.hg19:g.10613101A>G	ENSP00000412229:p.Leu718Ser	87.0	0.0		35.0	12.0	NM_130385	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	ENST00000436272.1	hg19		.	.	.	.	.	.	.	.	.	.	A	24.6	4.546730	0.86022	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38;2.38;2.38;2.38	5.37	5.37	0.77165	.	0.187718	0.35124	N	0.003430	T	0.36193	0.0958	L	0.51422	1.61	0.42507	D	0.992953	P;D;D;D	0.76494	0.774;0.999;0.999;0.999	P;D;D;D	0.75484	0.465;0.986;0.986;0.976	T	0.04767	-1.0928	10	0.51188	T	0.08	-6.0099	15.204	0.73162	1.0:0.0:0.0:0.0	.	539;718;737;736	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	S	736;719;718;654;654;430;430;745;539;737;654	ENSP00000414598:L736S;ENSP00000412229:L718S;ENSP00000448278:L654S;ENSP00000446764:L654S;ENSP00000441971:L430S;ENSP00000401205:L430S;ENSP00000412130:L745S;ENSP00000437784:L539S;ENSP00000432436:L737S;ENSP00000432067:L654S	ENSP00000307885:L719S	L	-	2	0	MRVI1	10569677	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.682000	0.68182	2.254000	0.74563	0.533000	0.62120	TTG	.	.		0.443	MRVI1-203	KNOWN	basic	protein_coding	protein_coding		NM_001098579	
CEP57	9702	hgsc.bcm.edu	37	11	95560987	95560987	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:95560987A>C	ENST00000325542.5	+	9	1161	c.923A>C	c.(922-924)cAg>cCg	p.Q308P	CEP57_ENST00000537677.1_Missense_Mutation_p.Q281P|CEP57_ENST00000541150.1_Missense_Mutation_p.Q299P|CEP57_ENST00000325486.5_Missense_Mutation_p.Q282P	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	308	Mediates interaction with microtubules. {ECO:0000250}.				fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GCCAATGTTCAGCTTGTCTTG	0.403									Mosaic Variegated Aneuploidy Syndrome																												p.Q308P		Atlas-SNP	.											.	CEP57	40	.	0			c.A923C						.						146.0	134.0	138.0					11																	95560987		2201	4298	6499	SO:0001583	missense	9702	exon9	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	ATGTTCAGCTTGT	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.923A>C	chr11.hg19:g.95560987A>C	ENSP00000317902:p.Gln308Pro	105.0	0.0		63.0	11.0	NM_014679	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	ENST00000325542.5	hg19	CCDS8304.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.180260	0.78677	.	.	ENSG00000166037	ENST00000537677;ENST00000325542;ENST00000325486;ENST00000541150;ENST00000537093	T;T;T;T;T	0.60040	0.37;0.3;0.94;0.31;0.22	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	T	0.76997	0.4066	M	0.79258	2.445	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.97110	0.994;1.0;0.986	T	0.80221	-0.1472	10	0.87932	D	0	-3.107	15.9926	0.80217	1.0:0.0:0.0:0.0	.	299;282;308	F5H5F7;Q86XR8-2;Q86XR8	.;.;CEP57_HUMAN	P	281;308;282;299;67	ENSP00000441392:Q281P;ENSP00000317902:Q308P;ENSP00000317487:Q282P;ENSP00000443436:Q299P;ENSP00000444749:Q67P	ENSP00000317487:Q282P	Q	+	2	0	CEP57	95200635	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	7.705000	0.84606	2.185000	0.69588	0.260000	0.18958	CAG	.	.		0.403	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395983.1	NM_014679	
GRIA4	2893	hgsc.bcm.edu	37	11	105804564	105804564	+	Missense_Mutation	SNP	A	A	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:105804564A>T	ENST00000530497.1	+	13	2163	c.2163A>T	c.(2161-2163)aaA>aaT	p.K721N	AP000673.1_ENST00000583628.1_RNA|GRIA4_ENST00000282499.5_Missense_Mutation_p.K721N|GRIA4_ENST00000393127.2_Missense_Mutation_p.K721N|GRIA4_ENST00000525187.1_Missense_Mutation_p.K721N			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	721					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		CCAAGGGCAAATTTGCCTTTC	0.468																																					p.K721N		Atlas-SNP	.											.	GRIA4	380	.	0			c.A2163T						.						90.0	79.0	83.0					11																	105804564		2202	4299	6501	SO:0001583	missense	2893	exon14			GGGCAAATTTGCC	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2163A>T	chr11.hg19:g.105804564A>T	ENSP00000435775:p.Lys721Asn	154.0	0.0		74.0	12.0	NM_001077243	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.388945	0.61956	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187;ENST00000539249	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	5.51	3.19	0.36642	Ionotropic glutamate receptor (2);	0.000000	0.64402	D	0.000001	T	0.46737	0.1408	L	0.43554	1.36	0.58432	D	0.999995	D;D	0.89917	0.972;1.0	P;D	0.91635	0.896;0.999	T	0.20009	-1.0288	10	0.33940	T	0.23	.	8.8697	0.35309	0.6549:0.0:0.3451:0.0	.	721;721	P48058;G3V164	GRIA4_HUMAN;.	N	721;721;721;721;26	ENSP00000282499:K721N;ENSP00000376835:K721N;ENSP00000435775:K721N;ENSP00000432180:K721N	ENSP00000282499:K721N	K	+	3	2	GRIA4	105309774	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.552000	0.45828	0.390000	0.25115	0.482000	0.46254	AAA	.	.		0.468	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		
TRAPPC4	51399	hgsc.bcm.edu	37	11	118889521	118889521	+	Missense_Mutation	SNP	G	G	A	rs372565482		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr11:118889521G>A	ENST00000533632.1	+	1	380	c.16G>A	c.(16-18)Gtg>Atg	p.V6M	MIR3656_ENST00000577421.1_RNA|RPS25_ENST00000528547.1_5'Flank|RPS25_ENST00000527673.1_5'Flank|TRAPPC4_ENST00000434101.2_Missense_Mutation_p.V6M|TRAPPC4_ENST00000525303.1_Missense_Mutation_p.V6M|TRAPPC4_ENST00000528230.1_Missense_Mutation_p.V6M|TRAPPC4_ENST00000359005.4_Missense_Mutation_p.V6M|TRAPPC4_ENST00000533058.1_Missense_Mutation_p.V6M	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4	6					dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		GATTTTTAGTGTGTATGTGGT	0.577																																					p.V6M		Atlas-SNP	.											.	TRAPPC4	8	.	0			c.G16A						.	G	MET/VAL	0,4400		0,0,2200	139.0	133.0	135.0		16	5.9	1.0	11		135	1,8589	1.2+/-3.3	0,1,4294	no	missense	TRAPPC4	NM_016146.4	21	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	6/220	118889521	1,12989	2200	4295	6495	SO:0001583	missense	51399	exon1			TTTAGTGTGTATG	AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296		ENST00000533632.1:c.16G>A	chr11.hg19:g.118889521G>A	ENSP00000436005:p.Val6Met	91.0	0.0		61.0	12.0	NM_016146	A8K3A5|B4DME1	Missense_Mutation	SNP	ENST00000533632.1	hg19	CCDS8407.1	.	.	.	.	.	.	.	.	.	.	G	36	5.850332	0.97023	0.0	1.16E-4	ENSG00000196655	ENST00000533632;ENST00000528230;ENST00000525303;ENST00000434101;ENST00000359005;ENST00000533058	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.86	5.86	0.93980	Longin-like (1);	0.052096	0.85682	D	0.000000	D	0.91462	0.7305	M	0.80982	2.52	0.80722	D	1	P;D;D;D	0.67145	0.946;0.996;0.985;0.994	P;D;P;P	0.64506	0.694;0.926;0.801;0.881	D	0.91756	0.5416	10	0.87932	D	0	-20.6589	20.1796	0.98194	0.0:0.0:1.0:0.0	.	6;6;6;6	B4DF86;B4DME1;Q9Y296;B4DF36	.;.;TPPC4_HUMAN;.	M	6	ENSP00000436005:V6M;ENSP00000436827:V6M;ENSP00000435339:V6M;ENSP00000405033:V6M;ENSP00000351896:V6M;ENSP00000432920:V6M	ENSP00000351896:V6M	V	+	1	0	TRAPPC4	118394731	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.408000	0.97327	2.784000	0.95788	0.655000	0.94253	GTG	.	.		0.577	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389332.1	NM_016146	
KLRC2	3822	hgsc.bcm.edu	37	12	10584707	10584707	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:10584707A>G	ENST00000381902.2	-	5	588	c.582T>C	c.(580-582)caT>caC	p.H194H	NKG2-E_ENST00000539033.1_Intron|KLRC2_ENST00000536833.2_Silent_p.H135H|KLRC2_ENST00000381901.1_Silent_p.H194H	NM_002260.3	NP_002251.2	P26717	NKG2C_HUMAN	killer cell lectin-like receptor subfamily C, member 2	194	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11						GAACTTACTTATGTTTGAAAG	0.318																																					p.H194H		Atlas-SNP	.											.	KLRC2	29	.	0			c.T582C						.						56.0	54.0	55.0					12																	10584707		2046	4138	6184	SO:0001819	synonymous_variant	3822	exon5			TTACTTATGTTTG	X54869	CCDS31745.1	12p13	2009-12-03				ENSG00000205809		"""Killer cell lectin-like receptors"", ""CD molecules"""	6375	protein-coding gene	gene with protein product		602891				9598306	Standard	NM_002260		Approved	NKG2-C, CD159c		P26717		ENST00000381902.2:c.582T>C	chr12.hg19:g.10584707A>G		377.0	0.0		157.0	24.0	NM_002260	O43802|Q52M74|Q9NR42	Silent	SNP	ENST00000381902.2	hg19	CCDS31745.1	.	.	.	.	.	.	.	.	.	.	a	0.022	-1.408978	0.01155	.	.	ENSG00000205809	ENST00000537017	.	.	.	1.72	-3.44	0.04796	.	.	.	.	.	T	0.37046	0.0989	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33548	-0.9864	4	.	.	.	.	0.5812	0.00712	0.231:0.1467:0.1671:0.4551	.	.	.	.	T	72	.	.	I	-	2	0	KLRC2	10475974	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.234000	0.02931	-2.238000	0.00712	-1.801000	0.00618	ATA	.	.		0.318	KLRC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400111.1	NM_002260	
C2CD5	9847	hgsc.bcm.edu	37	12	22610088	22610088	+	Silent	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:22610088T>A	ENST00000333957.4	-	23	2796	c.2541A>T	c.(2539-2541)acA>acT	p.T847T	C2CD5_ENST00000536386.1_Silent_p.T900T|C2CD5_ENST00000542676.1_Silent_p.T898T|C2CD5_ENST00000446597.1_Silent_p.T898T|C2CD5_ENST00000544930.1_Silent_p.T703T|C2CD5_ENST00000396028.2_Silent_p.T889T|C2CD5_ENST00000545552.1_Silent_p.T901T	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	847					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CTTTTTCAACTGTCATGGCTA	0.413																																					p.T847T		Atlas-SNP	.											.	.	.	.	0			c.A2541T						.						86.0	79.0	81.0					12																	22610088		2203	4300	6503	SO:0001819	synonymous_variant	9847	exon23			TTCAACTGTCATG	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.2541A>T	chr12.hg19:g.22610088T>A		183.0	0.0		90.0	16.0	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	ENST00000333957.4	hg19	CCDS31758.1	.	.	.	.	.	.	.	.	.	.	T	5.333	0.246717	0.10130	.	.	ENSG00000111731	ENST00000539615	.	.	.	4.96	-0.673	0.11373	.	.	.	.	.	T	0.42223	0.1193	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22382	-1.0218	4	.	.	.	-20.7239	2.6175	0.04907	0.238:0.0694:0.3488:0.3438	.	.	.	.	L	148	.	.	Q	-	2	0	KIAA0528	22501355	0.847000	0.29606	0.966000	0.40874	0.882000	0.50991	-0.013000	0.12678	-0.267000	0.09325	-0.316000	0.08728	CAG	.	.		0.413	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
ITPR2	3709	hgsc.bcm.edu	37	12	26647155	26647155	+	Silent	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:26647155A>G	ENST00000381340.3	-	39	5717	c.5301T>C	c.(5299-5301)aaT>aaC	p.N1767N		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1767					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AAATTCTGTCATTTTTGGTGT	0.388																																					p.N1767N		Atlas-SNP	.											.	ITPR2	270	.	0			c.T5301C						.						109.0	96.0	100.0					12																	26647155		1866	4105	5971	SO:0001819	synonymous_variant	3709	exon39			TCTGTCATTTTTG	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5301T>C	chr12.hg19:g.26647155A>G		91.0	0.0		22.0	10.0	NM_002223	O94773	Silent	SNP	ENST00000381340.3	hg19	CCDS41764.1																																																																																			.	.		0.388	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
KRT18	3875	hgsc.bcm.edu	37	12	53345925	53345925	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:53345925T>A	ENST00000388835.3	+	6	1181	c.971T>A	c.(970-972)cTg>cAg	p.L324Q	KRT8_ENST00000549198.1_5'Flank|AC107016.2_ENST00000581256.1_RNA|KRT18_ENST00000550600.1_Missense_Mutation_p.L324Q|KRT8_ENST00000552551.1_5'Flank|KRT18_ENST00000388837.2_Missense_Mutation_p.L324Q|KRT8_ENST00000546897.1_5'Flank	NM_000224.2	NP_000215.1	P05783	K1C18_HUMAN	keratin 18	324	Coil 2.|Interaction with DNAJB6.|Necessary for interaction with PNN.|Rod.				anatomical structure morphogenesis (GO:0009653)|cell cycle (GO:0007049)|extrinsic apoptotic signaling pathway (GO:0097191)|Golgi to plasma membrane CFTR protein transport (GO:0043000)|hepatocyte apoptotic process (GO:0097284)|intermediate filament cytoskeleton organization (GO:0045104)|negative regulation of apoptotic process (GO:0043066)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell periphery (GO:0071944)|centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			central_nervous_system(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	11						GAGAACAGCCTGAGGGAGGTG	0.612																																					p.L324Q		Atlas-SNP	.											.	KRT18	31	.	0			c.T971A						.						13.0	15.0	14.0					12																	53345925		2193	4282	6475	SO:0001583	missense	3875	exon6			ACAGCCTGAGGGA		CCDS31809.1	12q13	2013-01-16			ENSG00000111057	ENSG00000111057		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6430	protein-coding gene	gene with protein product		148070				1705144, 16831889	Standard	NM_000224		Approved		uc001sbg.3	P05783	OTTHUMG00000169882	ENST00000388835.3:c.971T>A	chr12.hg19:g.53345925T>A	ENSP00000373487:p.Leu324Gln	39.0	0.0		15.0	6.0	NM_000224	Q53G38|Q5U0N8|Q9BW26	Missense_Mutation	SNP	ENST00000388835.3	hg19	CCDS31809.1	.	.	.	.	.	.	.	.	.	.	t	21.0	4.084436	0.76642	.	.	ENSG00000111057	ENST00000388837;ENST00000550600;ENST00000388835	D;D;D	0.90788	-2.73;-2.73;-2.73	4.0	4.0	0.46444	Filament (1);	0.142260	0.29980	N	0.010713	D	0.96658	0.8909	H	0.98388	4.22	0.44825	D	0.997838	P;P	0.51057	0.941;0.92	P;P	0.61940	0.751;0.896	D	0.97270	0.9910	10	0.87932	D	0	.	11.5011	0.50437	0.0:0.0:0.0:1.0	.	324;324	F8VZY9;P05783	.;K1C18_HUMAN	Q	324	ENSP00000373489:L324Q;ENSP00000447278:L324Q;ENSP00000373487:L324Q	ENSP00000373487:L324Q	L	+	2	0	KRT18	51632192	0.991000	0.36638	1.000000	0.80357	0.955000	0.61496	7.682000	0.84083	2.049000	0.60858	0.459000	0.35465	CTG	.	.		0.612	KRT18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406405.1	NM_199187	
MARS	4141	hgsc.bcm.edu	37	12	57910051	57910051	+	Silent	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:57910051A>C	ENST00000262027.5	+	20	2621	c.2487A>C	c.(2485-2487)gcA>gcC	p.A829A	MIR616_ENST00000385293.1_RNA|MARS_ENST00000315473.5_3'UTR|RN7SL312P_ENST00000582079.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	829					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CGAAGCCAGCAGTTGTAGAGA	0.463																																					p.A829A		Atlas-SNP	.											.	MARS	84	.	0			c.A2487C						.						67.0	63.0	64.0					12																	57910051		2203	4300	6503	SO:0001819	synonymous_variant	4141	exon20			GCCAGCAGTTGTA	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2487A>C	chr12.hg19:g.57910051A>C		161.0	0.0		67.0	35.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Silent	SNP	ENST00000262027.5	hg19	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	A	8.087	0.773576	0.16051	.	.	ENSG00000166986	ENST00000547665	.	.	.	4.84	2.33	0.28932	.	.	.	.	.	T	0.57403	0.2051	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49844	-0.8896	4	.	.	.	-4.0E-4	8.4778	0.33023	0.6898:0.0:0.0:0.3101	.	.	.	.	R	95	.	.	S	+	1	0	MARS	56196318	0.009000	0.17119	0.759000	0.31340	0.015000	0.08874	0.255000	0.18333	0.371000	0.24564	0.459000	0.35465	AGT	.	.		0.463	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
PHLDA1	22822	hgsc.bcm.edu	37	12	76425490	76425490	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:76425490A>C	ENST00000266671.5	-	1	2222	c.32T>G	c.(31-33)tTg>tGg	p.L11W	PHLDA1_ENST00000602540.1_5'Flank|RP11-290L1.2_ENST00000547721.1_RNA|RP11-290L1.3_ENST00000552367.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	11					apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				GCCCAGCTCCAAGAGGCGCTC	0.692																																					p.L11W		Atlas-SNP	.											.	PHLDA1	39	.	0			c.T32G						.						2.0	3.0	3.0					12																	76425490		1614	3601	5215	SO:0001583	missense	22822	exon1			AGCTCCAAGAGGC	Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.32T>G	chr12.hg19:g.76425490A>C	ENSP00000266671:p.Leu11Trp	70.0	0.0		36.0	18.0	NM_007350	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Missense_Mutation	SNP	ENST00000266671.5	hg19	CCDS31861.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.678249	0.29783	.	.	ENSG00000139289	ENST00000266671	T	0.46451	0.87	4.71	2.87	0.33458	.	.	.	.	.	T	0.23766	0.0575	N	0.08118	0	0.09310	N	1	P	0.34757	0.467	B	0.35688	0.208	T	0.14952	-1.0454	9	0.87932	D	0	-2.3085	7.7246	0.28753	0.0897:0.1629:0.7474:0.0	.	11	Q8WV24	PHLA1_HUMAN	W	11	ENSP00000266671:L11W	ENSP00000266671:L11W	L	-	2	0	PHLDA1	74711757	0.000000	0.05858	0.352000	0.25734	0.299000	0.27559	0.161000	0.16481	0.583000	0.29574	-0.374000	0.07098	TTG	.	.		0.692	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405846.2	NM_007350	
ATP2B1	490	hgsc.bcm.edu	37	12	89992431	89992431	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:89992431T>C	ENST00000359142.3	-	20	3665	c.3441A>G	c.(3439-3441)gtA>gtG	p.V1147V	ATP2B1_ENST00000348959.3_Intron|ATP2B1_ENST00000393164.2_Intron|ATP2B1_ENST00000261173.2_Intron|ATP2B1_ENST00000428670.3_Intron	NM_001001323.1	NP_001001323.1	P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	1147					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						AAATATTTGTTACATCATGAT	0.453																																					p.V1147V		Atlas-SNP	.											.	ATP2B1	191	.	0			c.A3441G						.						198.0	197.0	198.0					12																	89992431		1980	4164	6144	SO:0001819	synonymous_variant	490	exon20			ATTTGTTACATCA	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000359142.3:c.3441A>G	chr12.hg19:g.89992431T>C		106.0	0.0		50.0	5.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	ENST00000359142.3	hg19	CCDS41817.1																																																																																			.	.		0.453	ATP2B1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000406652.1	NM_001682	
NR2C1	7181	hgsc.bcm.edu	37	12	95451647	95451647	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:95451647T>C	ENST00000333003.5	-	6	882	c.552A>G	c.(550-552)caA>caG	p.Q184Q	NR2C1_ENST00000393101.3_Silent_p.Q184Q|NR2C1_ENST00000330677.7_Silent_p.Q184Q|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	184					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						TTCTTTCACATTGGACAGCTA	0.348																																					p.Q184Q		Atlas-SNP	.											.	NR2C1	56	.	0			c.A552G						.						86.0	89.0	88.0					12																	95451647		2203	4300	6503	SO:0001819	synonymous_variant	7181	exon6			TTCACATTGGACA	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.552A>G	chr12.hg19:g.95451647T>C		135.0	0.0		75.0	20.0	NM_001032287	A8K5K4|Q15625|Q15626	Silent	SNP	ENST00000333003.5	hg19	CCDS9051.1																																																																																			.	.		0.348	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	NM_003297	
ANKS1B	56899	hgsc.bcm.edu	37	12	99638191	99638191	+	Splice_Site	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:99638191A>G	ENST00000547776.2	-	14	2347	c.2348T>C	c.(2347-2349)aTt>aCt	p.I783T	ANKS1B_ENST00000547010.1_Splice_Site_p.I363T|ANKS1B_ENST00000329257.7_Splice_Site_p.I783T|ANKS1B_ENST00000550833.1_5'Flank	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	783						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TATTTTGTCAATCTGTAAGAA	0.299																																					p.I783T		Atlas-SNP	.											.	ANKS1B	180	.	0			c.T2348C						.						153.0	137.0	142.0					12																	99638191		1830	4069	5899	SO:0001630	splice_region_variant	56899	exon14			TTGTCAATCTGTA	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2347-1T>C	chr12.hg19:g.99638191A>G		104.0	0.0		61.0	9.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	hg19	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	A	19.59	3.857087	0.71834	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702	T;T;T	0.71817	-0.0;-0.6;0.0	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.80934	0.4719	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;0.981	D;D	0.97110	1.0;0.966	T	0.80417	-0.1391	9	.	.	.	-8.7181	14.3914	0.66981	1.0:0.0:0.0:0.0	.	363;783	Q7Z6G8-6;Q7Z6G8	.;ANS1B_HUMAN	T	783;363;783;362	ENSP00000449629:I783T;ENSP00000448512:I363T;ENSP00000331381:I783T	.	I	-	2	0	ANKS1B	98162322	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.543000	0.82106	2.192000	0.70111	0.459000	0.35465	ATT	.	.		0.299	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	Missense_Mutation
ANKS1B	56899	hgsc.bcm.edu	37	12	99793570	99793570	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:99793570A>G	ENST00000547776.2	-	12	1594	c.1595T>C	c.(1594-1596)aTt>aCt	p.I532T	ANKS1B_ENST00000547010.1_Missense_Mutation_p.I112T|ANKS1B_ENST00000329257.7_Missense_Mutation_p.I532T	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	532						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		AGAAGACACAATGGATGTTCG	0.388																																					p.I532T		Atlas-SNP	.											.	ANKS1B	180	.	0			c.T1595C						.						156.0	164.0	162.0					12																	99793570		1887	4113	6000	SO:0001583	missense	56899	exon12			GACACAATGGATG	AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1595T>C	chr12.hg19:g.99793570A>G	ENSP00000449629:p.Ile532Thr	125.0	0.0		75.0	14.0	NM_152788	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	ENST00000547776.2	hg19	CCDS55872.1	.	.	.	.	.	.	.	.	.	.	A	17.15	3.316865	0.60524	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702;ENST00000549866	T;T;T;T	0.61980	0.83;0.06;0.83;0.52	5.73	5.73	0.89815	.	0.266741	0.30879	N	0.008699	T	0.51432	0.1674	N	0.22421	0.69	0.80722	D	1	P;P;B	0.37330	0.59;0.59;0.18	B;B;B	0.41332	0.266;0.354;0.076	T	0.49960	-0.8883	9	.	.	.	-10.4795	13.5328	0.61631	1.0:0.0:0.0:0.0	.	498;112;532	F8VVQ4;Q7Z6G8-6;Q7Z6G8	.;.;ANS1B_HUMAN	T	532;112;532;111;498	ENSP00000449629:I532T;ENSP00000448512:I112T;ENSP00000331381:I532T;ENSP00000449894:I498T	.	I	-	2	0	ANKS1B	98317701	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	6.278000	0.72614	2.184000	0.69523	0.477000	0.44152	ATT	.	.		0.388	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000408421.3	NM_020140	
ATP6V0A2	23545	hgsc.bcm.edu	37	12	124229432	124229432	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:124229432C>A	ENST00000330342.3	+	13	1766	c.1518C>A	c.(1516-1518)gaC>gaA	p.D506E		NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	506					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		GTTACAGTGACAGCGTCGTTA	0.522																																					p.D506E		Atlas-SNP	.											.	ATP6V0A2	68	.	0			c.C1518A						.						176.0	147.0	157.0					12																	124229432		2203	4300	6503	SO:0001583	missense	23545	exon13			CAGTGACAGCGTC	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.1518C>A	chr12.hg19:g.124229432C>A	ENSP00000332247:p.Asp506Glu	106.0	0.0		40.0	17.0	NM_012463	A8K026|Q6NUM0	Missense_Mutation	SNP	ENST00000330342.3	hg19	CCDS9254.1	.	.	.	.	.	.	.	.	.	.	C	2.760	-0.258082	0.05791	.	.	ENSG00000185344	ENST00000330342	D	0.84146	-1.81	5.32	4.37	0.52481	.	0.625902	0.18375	N	0.143130	T	0.69806	0.3152	N	0.21240	0.645	0.37146	D	0.901955	B	0.06786	0.001	B	0.12837	0.008	T	0.61964	-0.6954	10	0.02654	T	1	-34.0027	7.9518	0.30019	0.1624:0.7527:0.0:0.0849	.	506	Q9Y487	VPP2_HUMAN	E	506	ENSP00000332247:D506E	ENSP00000332247:D506E	D	+	3	2	ATP6V0A2	122795385	0.031000	0.19500	0.937000	0.37676	0.018000	0.09664	0.737000	0.26144	2.503000	0.84419	0.555000	0.69702	GAC	.	.		0.522	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36041819	36041819	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:36041819T>C	ENST00000389698.3	-	37	6187	c.5797A>G	c.(5797-5799)Ata>Gta	p.I1933V	RALGAPA1_ENST00000258840.6_Missense_Mutation_p.I1980V|RALGAPA1_ENST00000382366.3_Missense_Mutation_p.I1946V|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.I1933V	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	1933	Minimal domain that binds to TCF3/E12. {ECO:0000250}.|Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATTGGATATATTACAATAAGG	0.333																																					p.I1933V		Atlas-SNP	.											.	RALGAPA1	289	.	0			c.A5797G						.						97.0	99.0	98.0					14																	36041819		2203	4298	6501	SO:0001583	missense	253959	exon37			GATATATTACAAT	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.5797A>G	chr14.hg19:g.36041819T>C	ENSP00000374348:p.Ile1933Val	82.0	0.0		31.0	11.0	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	hg19	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.257074	0.80246	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000554259;ENST00000382366;ENST00000553892	D;D;D;D;D;D	0.92545	-3.06;-3.06;-3.06;-3.06;-3.06;-3.06	5.15	5.15	0.70609	Rap/ran-GAP (2);	0.000000	0.85682	D	0.000000	D	0.94241	0.8151	L	0.49640	1.575	0.53005	D	0.999965	D;D;P;P	0.71674	0.958;0.998;0.926;0.846	D;D;P;P	0.91635	0.966;0.999;0.879;0.759	D	0.93300	0.6676	10	0.33141	T	0.24	-15.3646	14.9932	0.71406	0.0:0.0:0.0:1.0	.	1980;1946;1933;1933	Q6GYQ0-6;B9EK38;Q6GYQ0-2;Q6GYQ0	.;.;.;RGPA1_HUMAN	V	1933;1933;1933;1980;571;1946;1980	ENSP00000374348:I1933V;ENSP00000302647:I1933V;ENSP00000258840:I1980V;ENSP00000451133:I571V;ENSP00000371803:I1946V;ENSP00000451877:I1980V	ENSP00000258840:I1980V	I	-	1	0	RALGAPA1	35111570	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	1.947000	0.56498	0.377000	0.23210	ATA	.	.		0.333	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
KTN1	3895	hgsc.bcm.edu	37	14	56078888	56078888	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:56078888A>G	ENST00000395314.3	+	2	190	c.122A>G	c.(121-123)cAg>cGg	p.Q41R	KTN1_ENST00000416613.1_Missense_Mutation_p.Q41R|KTN1_ENST00000395309.3_Missense_Mutation_p.Q41R|KTN1_ENST00000438792.2_Missense_Mutation_p.Q41R|KTN1_ENST00000395311.1_Missense_Mutation_p.Q41R|KTN1_ENST00000395308.1_Missense_Mutation_p.Q41R|KTN1_ENST00000413890.2_Missense_Mutation_p.Q41R	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	41					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						CTTGCAAAACAGAAAAGAGAA	0.284			T	RET	papillary thryoid																																p.Q41R		Atlas-SNP	.		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	.	KTN1	147	.	0			c.A122G						.						35.0	37.0	37.0					14																	56078888		2202	4297	6499	SO:0001583	missense	3895	exon2			CAAAACAGAAAAG		CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.122A>G	chr14.hg19:g.56078888A>G	ENSP00000378725:p.Gln41Arg	212.0	0.0		98.0	33.0	NM_004986	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	ENST00000395314.3	hg19	CCDS41957.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.106183	0.77096	.	.	ENSG00000126777	ENST00000557267;ENST00000413890;ENST00000395309;ENST00000555498;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613	D;D;D;D;D;D;D;D;D	0.98937	-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25	5.49	5.49	0.81192	.	0.130124	0.34879	N	0.003603	D	0.97660	0.9233	L	0.59436	1.845	0.54753	D	0.999987	P;P;P;P	0.40834	0.64;0.73;0.64;0.561	B;B;B;B	0.42625	0.393;0.22;0.393;0.329	D	0.98010	1.0365	10	0.49607	T	0.09	-2.9399	15.5747	0.76368	1.0:0.0:0.0:0.0	.	41;41;41;41	B4DZ88;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;KTN1_HUMAN	R	41	ENSP00000451641:Q41R;ENSP00000394992:Q41R;ENSP00000378720:Q41R;ENSP00000451878:Q41R;ENSP00000391964:Q41R;ENSP00000378725:Q41R;ENSP00000378719:Q41R;ENSP00000378722:Q41R;ENSP00000388807:Q41R	ENSP00000378719:Q41R	Q	+	2	0	KTN1	55148641	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.596000	0.90844	2.074000	0.62210	0.482000	0.46254	CAG	.	.		0.284	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276912.2		
SNW1	22938	hgsc.bcm.edu	37	14	78198864	78198864	+	Silent	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:78198864G>A	ENST00000261531.7	-	9	917	c.855C>T	c.(853-855)gcC>gcT	p.A285A	SNW1_ENST00000555761.1_Silent_p.A285A|SNW1_ENST00000554775.1_Silent_p.A123A|SLIRP_ENST00000557431.1_Intron	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	285	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)			NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CTGCCAATTTGGCGAAATTTT	0.383																																					p.A285A		Atlas-SNP	.											.	SNW1	44	.	0			c.C855T						.						118.0	111.0	113.0					14																	78198864		2203	4300	6503	SO:0001819	synonymous_variant	22938	exon9			CAATTTGGCGAAA	AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.855C>T	chr14.hg19:g.78198864G>A		106.0	0.0		35.0	17.0	NM_012245	A8K8A9|Q13483|Q32N03|Q5D0D6	Silent	SNP	ENST00000261531.7	hg19	CCDS9867.1																																																																																			.	.		0.383	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413912.1	NM_012245	
ZC3H14	79882	hgsc.bcm.edu	37	14	89034417	89034418	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr14:89034417_89034418GG>TT	ENST00000251038.5	+	3	339_340	c.114_115GG>TT	c.(112-117)gtGGcc>gtTTcc	p.A39S	ZC3H14_ENST00000359301.3_Missense_Mutation_p.A5S|ZC3H14_ENST00000302216.8_Missense_Mutation_p.A39S|ZC3H14_ENST00000555755.1_Missense_Mutation_p.A39S|ZC3H14_ENST00000336693.4_Missense_Mutation_p.A5S|ZC3H14_ENST00000393514.5_Missense_Mutation_p.A39S|ZC3H14_ENST00000556945.1_Missense_Mutation_p.A39S|ZC3H14_ENST00000557607.1_Intron	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	39						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						TGGTGATGGTGGCCAACAAGAA	0.371																																					p.V38V|p.A39S		Atlas-SNP	.											.	ZC3H14	71	.	0			c.G114T|c.G115T						.																																			SO:0001583	missense	79882	exon3			GATGGTGGCCAAC|ATGGTGGCCAACA	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	Exception_encountered	chr14.hg19:g.89034417_89034418delinsTT	ENSP00000251038:p.Ala39Ser	158.0|157.0	0.0		51.0	11.0	NM_001160104	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Silent|Missense_Mutation	SNP	ENST00000251038.5	hg19	CCDS32133.1																																																																																			.	.		0.371	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
EIF2AK4	440275	hgsc.bcm.edu	37	15	40321621	40321621	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr15:40321621A>G	ENST00000263791.5	+	34	4560	c.4517A>G	c.(4516-4518)aAt>aGt	p.N1506S	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.N1478S	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	1506					cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GCTTCCGATAATCTTGCAGTG	0.323																																					p.N1506S		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.A4517G						.						119.0	116.0	117.0					15																	40321621		1836	4074	5910	SO:0001583	missense	440275	exon34			CCGATAATCTTGC	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.4517A>G	chr15.hg19:g.40321621A>G	ENSP00000263791:p.Asn1506Ser	135.0	0.0		65.0	19.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	hg19	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	A	9.610	1.131109	0.21041	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.40756	1.02;1.02	5.83	4.71	0.59529	Serine/threonine-protein kinase GCN2, anticodon binding domain (1);	0.092562	0.85682	D	0.000000	T	0.15825	0.0381	N	0.02916	-0.46	0.41036	D	0.985193	B;B	0.13145	0.006;0.007	B;B	0.15052	0.007;0.012	T	0.16247	-1.0409	10	0.05436	T	0.98	-28.7942	9.7267	0.40337	0.9215:0.0:0.0785:0.0	.	1478;1506	Q9P2K8-2;Q9P2K8	.;E2AK4_HUMAN	S	1506;1478	ENSP00000263791:N1506S;ENSP00000372174:N1478S	ENSP00000263791:N1506S	N	+	2	0	EIF2AK4	38108913	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.756000	0.38390	2.212000	0.71576	0.533000	0.62120	AAT	.	.		0.323	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
FBN1	2200	hgsc.bcm.edu	37	15	48808530	48808530	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr15:48808530T>C	ENST00000316623.5	-	11	1632	c.1177A>G	c.(1177-1179)Atg>Gtg	p.M393V		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	393					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GGAATTACCATAGGAACAGAG	0.483																																					p.M393V		Atlas-SNP	.											.	FBN1	310	.	0			c.A1177G						.						66.0	69.0	68.0					15																	48808530		2197	4296	6493	SO:0001583	missense	2200	exon11			TTACCATAGGAAC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1177A>G	chr15.hg19:g.48808530T>C	ENSP00000325527:p.Met393Val	27.0	0.0		14.0	4.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	6.334	0.429725	0.11987	.	.	ENSG00000166147	ENST00000316623	T	0.80566	-1.39	5.54	-3.06	0.05379	Matrix fibril-associated (1);	0.827694	0.11605	N	0.547342	T	0.51635	0.1686	N	0.08118	0	0.21020	N	0.999809	B	0.02656	0.0	B	0.01281	0.0	T	0.38394	-0.9663	10	0.14656	T	0.56	.	2.0393	0.03546	0.1465:0.1959:0.4312:0.2265	.	393	P35555	FBN1_HUMAN	V	393	ENSP00000325527:M393V	ENSP00000325527:M393V	M	-	1	0	FBN1	46595822	0.789000	0.28775	0.957000	0.39632	0.797000	0.45037	0.226000	0.17776	-0.387000	0.07809	-0.316000	0.08728	ATG	.	.		0.483	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
PGPEP1L	145814	hgsc.bcm.edu	37	15	99512764	99512764	+	Silent	SNP	C	C	A	rs572947532	byFrequency	TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr15:99512764C>A	ENST00000378919.6	-	4	466	c.261G>T	c.(259-261)gtG>gtT	p.V87V	PGPEP1L_ENST00000535714.1_Silent_p.V33V|RP11-654A16.3_ENST00000559468.1_RNA	NM_001102612.2	NP_001096082.2	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase I-like	87							cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|stomach(1)	14						CAGGTAGGCACACGCCGCCCT	0.632																																					p.V87V		Atlas-SNP	.											.	PGPEP1L	26	.	0			c.G261T						.						105.0	112.0	110.0					15																	99512764		2194	4293	6487	SO:0001819	synonymous_variant	145814	exon4			TAGGCACACGCCG		CCDS53977.1, CCDS58400.1	15q26.3	2010-02-16			ENSG00000183571	ENSG00000183571			27080	protein-coding gene	gene with protein product							Standard	NM_001102612		Approved		uc002bum.3	A6NFU8		ENST00000378919.6:c.261G>T	chr15.hg19:g.99512764C>A		58.0	0.0		45.0	17.0	NM_001102612	H0YF86	Silent	SNP	ENST00000378919.6	hg19	CCDS53977.1																																																																																			.	.		0.632	PGPEP1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415703.1	NM_001102612.2	
MYH11	4629	hgsc.bcm.edu	37	16	15931900	15931900	+	Silent	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:15931900C>A	ENST00000300036.5	-	2	319	c.210G>T	c.(208-210)acG>acT	p.T70T	MYH11_ENST00000452625.2_Silent_p.T70T|MYH11_ENST00000396324.3_Silent_p.T70T|MYH11_ENST00000576790.2_Silent_p.T70T	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	70					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						CTTTCCCAACCGTGACCTTCT	0.577			T	CBFB	AML																																p.T70T		Atlas-SNP	.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	520	.	0			c.G210T						.						310.0	261.0	277.0					16																	15931900		2197	4300	6497	SO:0001819	synonymous_variant	4629	exon2			CCCAACCGTGACC	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.210G>T	chr16.hg19:g.15931900C>A		103.0	0.0		53.0	12.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	hg19	CCDS10565.1																																																																																			.	.		0.577	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
FHOD1	29109	hgsc.bcm.edu	37	16	67267989	67267989	+	Silent	SNP	G	G	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:67267989G>T	ENST00000258201.4	-	13	1864	c.1617C>A	c.(1615-1617)ctC>ctA	p.L539L		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	539	FH1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CCCCAATAGAGAGCCTGGGTG	0.592																																					p.L539L		Atlas-SNP	.											.	FHOD1	86	.	0			c.C1617A						.						86.0	92.0	90.0					16																	67267989		2198	4300	6498	SO:0001819	synonymous_variant	29109	exon13			AATAGAGAGCCTG	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.1617C>A	chr16.hg19:g.67267989G>T		65.0	0.0		30.0	10.0	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	hg19	CCDS10834.1																																																																																			.	.		0.592	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
AP1G1	164	hgsc.bcm.edu	37	16	71772938	71772938	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:71772938A>C	ENST00000299980.4	-	21	2616	c.2175T>G	c.(2173-2175)aaT>aaG	p.N725K	AP1G1_ENST00000393512.3_Missense_Mutation_p.N728K|AP1G1_ENST00000423132.2_Missense_Mutation_p.N728K|AP1G1_ENST00000433195.2_Missense_Mutation_p.N748K|AP1G1_ENST00000569748.1_Missense_Mutation_p.N725K|AP1G1_ENST00000564155.1_Missense_Mutation_p.N150K	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	725	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TGGGGTTGGTATTTGACCGTT	0.433																																					p.N728K		Atlas-SNP	.											.	AP1G1	83	.	0			c.T2184G						.						251.0	221.0	231.0					16																	71772938		2198	4300	6498	SO:0001583	missense	164	exon22			GTTGGTATTTGAC	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2175T>G	chr16.hg19:g.71772938A>C	ENSP00000299980:p.Asn725Lys	325.0	0.0		159.0	61.0	NM_001030007	O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	ENST00000299980.4	hg19	CCDS32480.1	.	.	.	.	.	.	.	.	.	.	A	12.37	1.919106	0.33908	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.29	0.176	0.15049	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, gamma-adaptin, appendage (2);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);	0.040642	0.85682	D	0.000000	T	0.29061	0.0722	L	0.40543	1.245	0.50171	D	0.999855	B;B;B	0.18741	0.008;0.03;0.013	B;B;B	0.22386	0.039;0.039;0.023	T	0.07578	-1.0765	10	0.20519	T	0.43	-12.3069	9.006	0.36111	0.3551:0.0:0.6449:0.0	.	725;748;728	O43747;B3KXW5;O43747-2	AP1G1_HUMAN;.;.	K	725;728;728;748	ENSP00000299980:N725K;ENSP00000377148:N728K;ENSP00000409153:N728K;ENSP00000403259:N748K	ENSP00000299980:N725K	N	-	3	2	AP1G1	70330439	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	1.178000	0.31981	-0.224000	0.09928	0.528000	0.53228	AAT	.	.		0.433	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
OSGIN1	29948	hgsc.bcm.edu	37	16	83994227	83994227	+	Silent	SNP	C	C	T	rs201580564		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:83994227C>T	ENST00000343939.2	+	5	890	c.507C>T	c.(505-507)gcC>gcT	p.A169A	OSGIN1_ENST00000565123.1_Silent_p.A86A|OSGIN1_ENST00000393306.1_Silent_p.A86A|OSGIN1_ENST00000361711.3_Silent_p.A86A			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	169					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						GCCCCGTGGCCCTGCTCTTTG	0.642																																					p.A86A		Atlas-SNP	.											.	OSGIN1	33	.	0			c.C258T						.						63.0	59.0	60.0					16																	83994227		2200	4300	6500	SO:0001819	synonymous_variant	29948	exon4			CGTGGCCCTGCTC	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.507C>T	chr16.hg19:g.83994227C>T		44.0	0.0		20.0	10.0	NM_182981	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Silent	SNP	ENST00000343939.2	hg19																																																																																				.	C|0.999;G|0.001		0.642	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
ADAD2	161931	hgsc.bcm.edu	37	16	84230532	84230532	+	Silent	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr16:84230532C>T	ENST00000315906.5	+	10	1756	c.1704C>T	c.(1702-1704)ggC>ggT	p.G568G	RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000268624.3_Silent_p.G650G	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	568	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						ACCAGCAGGGCCTGGGGGCTT	0.667																																					p.G650G		Atlas-SNP	.											.	ADAD2	46	.	0			c.C1950T						.						10.0	12.0	11.0					16																	84230532		2187	4289	6476	SO:0001819	synonymous_variant	161931	exon11			GCAGGGCCTGGGG	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1704C>T	chr16.hg19:g.84230532C>T		97.0	0.0		58.0	16.0	NM_139174	B2RCL6|Q8NA94	Silent	SNP	ENST00000315906.5	hg19	CCDS45536.1																																																																																			.	.		0.667	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
TP53	7157	hgsc.bcm.edu	37	17	7578410	7578410	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:7578410T>A	ENST00000269305.4	-	5	709	c.520A>T	c.(520-522)Agg>Tgg	p.R174W	TP53_ENST00000420246.2_Missense_Mutation_p.R174W|TP53_ENST00000455263.2_Missense_Mutation_p.R174W|TP53_ENST00000413465.2_Missense_Mutation_p.R174W|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R174W|TP53_ENST00000445888.2_Missense_Mutation_p.R174W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	174	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|R -> M (in sporadic cancers; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in a sporadic cancer; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R174W(12)|p.0?(8)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V172_R174delVVR(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R81W(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*73(1)|p.R174fs*70(1)|p.R174G(1)|p.R42W(1)|p.E171_H179delEVVRRCPHH(1)|p.S149fs*72(1)|p.R174fs*3(1)|p.R174fs*7(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAGCGCCTCACAACCTCC	0.657		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R174W	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,+1,1	TP53	33396	.	43	Substitution - Missense(15)|Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(6)|Insertion - Frameshift(1)	liver(11)|breast(7)|lung(4)|oesophagus(4)|bone(4)|large_intestine(3)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|ovary(1)|prostate(1)	c.A520T	GRCh37	CM942119	TP53	M		.						50.0	50.0	50.0					17																	7578410		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGCGCCTCACAAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.520A>T	chr17.hg19:g.7578410T>A	ENSP00000269305:p.Arg174Trp	86.0	0.0		28.0	19.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919495	0.73098	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99820	-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93;-6.93	5.59	1.97	0.26223	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.297542	0.32190	N	0.006445	D	0.99764	0.9904	M	0.84585	2.705	0.39545	D	0.968872	D;D;D;D;D;D;D	0.89917	1.0;0.996;0.998;1.0;0.997;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.998;0.978;0.977;0.999;0.997;0.987;0.998	D	0.98344	1.0540	10	0.87932	D	0	-14.7463	12.0783	0.53657	0.0:0.0:0.417:0.583	.	135;174;174;81;174;174;174	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	W	174;174;174;174;174;174;163;81;42;81;42	ENSP00000410739:R174W;ENSP00000352610:R174W;ENSP00000269305:R174W;ENSP00000398846:R174W;ENSP00000391127:R174W;ENSP00000391478:R174W;ENSP00000425104:R42W;ENSP00000423862:R81W	ENSP00000269305:R174W	R	-	1	2	TP53	7519135	0.002000	0.14202	0.176000	0.23000	0.618000	0.37518	1.330000	0.33781	0.094000	0.17404	0.533000	0.62120	AGG	.	.		0.657	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRT12	3859	hgsc.bcm.edu	37	17	39017949	39017949	+	Silent	SNP	G	G	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:39017949G>C	ENST00000251643.4	-	8	1472	c.1449C>G	c.(1447-1449)gtC>gtG	p.V483V	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	483	Tail.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	CTTGAGATGAGACCACCTCAC	0.378																																					p.V483V		Atlas-SNP	.											.	KRT12	53	.	0			c.C1449G						.						137.0	135.0	136.0					17																	39017949		2203	4300	6503	SO:0001819	synonymous_variant	3859	exon8			AGATGAGACCACC		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1449C>G	chr17.hg19:g.39017949G>C		204.0	0.0		91.0	21.0	NM_000223	B2R9E0	Silent	SNP	ENST00000251643.4	hg19	CCDS11378.1																																																																																			.	.		0.378	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
GPATCH8	23131	hgsc.bcm.edu	37	17	42476641	42476641	+	Missense_Mutation	SNP	T	T	C	rs542607889		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:42476641T>C	ENST00000591680.1	-	8	2834	c.2804A>G	c.(2803-2805)tAt>tGt	p.Y935C	GPATCH8_ENST00000434000.1_Missense_Mutation_p.Y857C	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	935	Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		ACTGAGGCTATAGTCATCATC	0.542													T|||	1	0.000199681	0.0008	0.0	5008	,	,		17745	0.0		0.0	False		,,,				2504	0.0				p.Y935C		Atlas-SNP	.											.	GPATCH8	114	.	0			c.A2804G						.						95.0	94.0	94.0					17																	42476641		2203	4300	6503	SO:0001583	missense	23131	exon8			AGGCTATAGTCAT	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.2804A>G	chr17.hg19:g.42476641T>C	ENSP00000467556:p.Tyr935Cys	181.0	0.0		101.0	17.0	NM_001002909	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	hg19	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.559071	0.27827	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.12465	2.68	5.2	5.2	0.72013	.	0.000000	0.64402	D	0.000003	T	0.21962	0.0529	N	0.19112	0.55	0.41506	D	0.988317	D	0.76494	0.999	D	0.80764	0.994	T	0.03887	-1.0995	10	0.39692	T	0.17	-14.2362	13.4516	0.61174	0.0:0.0:0.0:1.0	.	935	Q9UKJ3	GPTC8_HUMAN	C	935;857	ENSP00000395016:Y857C	ENSP00000335486:Y935C	Y	-	2	0	GPATCH8	39832167	1.000000	0.71417	0.998000	0.56505	0.747000	0.42532	3.731000	0.55013	2.190000	0.69967	0.454000	0.30748	TAT	.	.		0.542	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
EFCAB13	124989	hgsc.bcm.edu	37	17	45518054	45518054	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:45518054A>G	ENST00000331493.2	+	25	3307	c.2896A>G	c.(2896-2898)Aag>Gag	p.K966E		NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	966						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AAATATTGCTAAGCTTAACCC	0.274																																					p.K966E		Atlas-SNP	.											.	.	.	.	0			c.A2896G						.						63.0	69.0	67.0					17																	45518054		2201	4287	6488	SO:0001583	missense	124989	exon25			ATTGCTAAGCTTA	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.2896A>G	chr17.hg19:g.45518054A>G	ENSP00000332111:p.Lys966Glu	263.0	0.0		159.0	61.0	NM_152347	G3V128|Q49AG9	Missense_Mutation	SNP	ENST00000331493.2	hg19	CCDS11512.1	.	.	.	.	.	.	.	.	.	.	.	11.74	1.729799	0.30684	.	.	ENSG00000178852	ENST00000331493	T	0.61510	0.1	1.77	1.77	0.24775	.	.	.	.	.	T	0.50274	0.1606	N	0.08118	0	0.09310	N	0.999995	D	0.60575	0.988	D	0.65010	0.931	T	0.33624	-0.9861	9	0.87932	D	0	.	5.6013	0.17355	1.0:0.0:0.0:0.0	.	966	Q8IY85	CQ057_HUMAN	E	966	ENSP00000332111:K966E	ENSP00000332111:K966E	K	+	1	0	C17orf57	42873053	0.006000	0.16342	0.005000	0.12908	0.279000	0.26890	0.557000	0.23454	1.066000	0.40716	0.255000	0.18592	AAG	.	.		0.274	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380147.4	NM_152347	
SMARCD2	6603	hgsc.bcm.edu	37	17	61914891	61914891	+	Missense_Mutation	SNP	C	C	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:61914891C>T	ENST00000448276.2	-	2	576	c.311G>A	c.(310-312)cGa>cAa	p.R104Q	SMARCD2_ENST00000323347.10_Missense_Mutation_p.R56Q|RN7SL805P_ENST00000581353.1_RNA|SMARCD2_ENST00000225742.9_Missense_Mutation_p.R29Q	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	104	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)	p.R48L(1)		central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						CATGCCAGGTCGAAGCGGAGC	0.657																																					p.R104Q		Atlas-SNP	.											SMARCD2,NS,carcinoma,0,2	SMARCD2	29	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.G311A						.						44.0	53.0	50.0					17																	61914891		1995	4159	6154	SO:0001583	missense	6603	exon2			CCAGGTCGAAGCG	U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.311G>A	chr17.hg19:g.61914891C>T	ENSP00000392617:p.Arg104Gln	70.0	0.0		39.0	17.0	NM_001098426	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Missense_Mutation	SNP	ENST00000448276.2	hg19	CCDS45756.1	.	.	.	.	.	.	.	.	.	.	.	18.48	3.632781	0.67015	.	.	ENSG00000108604	ENST00000448276;ENST00000450364;ENST00000323347	T;T	0.46451	0.87;0.91	5.17	5.17	0.71159	.	0.059356	0.64402	D	0.000002	T	0.57592	0.2064	L	0.46741	1.465	0.80722	D	1	D;D;D	0.71674	0.998;0.995;0.995	D;P;P	0.72982	0.979;0.623;0.743	T	0.55872	-0.8072	10	0.51188	T	0.08	0.9492	16.2004	0.82067	0.0:1.0:0.0:0.0	.	56;67;104	Q92925-3;B9EGA3;Q92925	.;.;SMRD2_HUMAN	Q	104;67;56	ENSP00000392617:R104Q;ENSP00000318451:R56Q	ENSP00000318451:R56Q	R	-	2	0	SMARCD2	59268623	0.990000	0.36364	1.000000	0.80357	0.938000	0.57974	6.846000	0.75399	2.702000	0.92279	0.491000	0.48974	CGA	.	.		0.657	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444544.1	NM_001098426	
HGS	9146	hgsc.bcm.edu	37	17	79663472	79663473	+	Nonsense_Mutation	DNP	GA	GA	TT			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr17:79663472_79663473GA>TT	ENST00000329138.4	+	16	1614_1615	c.1479_1480GA>TT	c.(1477-1482)gaGAag>gaTTag	p.493_494EK>D*		NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	493	Interaction with NF2.|Interaction with SNAP25 and TRAK2. {ECO:0000250}.|Interaction with SNX1. {ECO:0000250}.|Interaction with STAM1. {ECO:0000250}.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			AGCACCGGGAGAAGCTTCGCCG	0.658																																					p.E493D|p.K494X		Atlas-SNP	.											.	HGS	54	.	0			c.G1479T|c.A1480T						.																																			SO:0001587	stop_gained	9146	exon16			CCGGGAGAAGCTT|CGGGAGAAGCTTC	D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		Exception_encountered	chr17.hg19:g.79663472_79663473delinsTT	ENSP00000331201:p.E493_K494delinsD*	34.0|33.0	0.0		20.0	11.0|10.0	NM_004712	Q9NR36	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000329138.4	hg19	CCDS11784.1																																																																																			.	.		0.658	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440541.1	NM_004712	
THEG	51298	hgsc.bcm.edu	37	19	367179	367179	+	Missense_Mutation	SNP	G	G	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:367179G>A	ENST00000342640.4	-	7	841	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	THEG_ENST00000346878.2_Missense_Mutation_p.R243W	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	267			R -> Q (in dbSNP:rs2278287).		cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)				NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGGATCCGCGAGCTGGGG	0.572																																					p.R267W		Atlas-SNP	.											.	THEG	58	.	0			c.C799T						.						81.0	85.0	84.0					19																	367179		2203	4300	6503	SO:0001583	missense	51298	exon7			GGATCCGCGAGCT	AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.799C>T	chr19.hg19:g.367179G>A	ENSP00000340088:p.Arg267Trp	127.0	0.0		40.0	11.0	NM_016585	A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	hg19	CCDS12025.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.323748	0.24080	.	.	ENSG00000105549	ENST00000342640;ENST00000346878	T;T	0.60548	0.18;0.18	3.32	2.28	0.28536	.	0.128748	0.34802	N	0.003662	T	0.71178	0.3309	M	0.79123	2.44	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.59478	-0.7447	10	0.87932	D	0	-10.9218	7.1811	0.25774	0.0:0.0:0.664:0.336	.	243;267	Q9P2T0-2;Q9P2T0	.;THEG_HUMAN	W	267;243	ENSP00000340088:R267W;ENSP00000264820:R243W	ENSP00000340088:R267W	R	-	1	2	THEG	318179	0.928000	0.31464	0.007000	0.13788	0.004000	0.04260	1.648000	0.37271	0.882000	0.36016	0.555000	0.69702	CGG	.	.		0.572	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2		
RAD23A	5886	hgsc.bcm.edu	37	19	13056794	13056794	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:13056794A>C	ENST00000586534.1	+	1	93	c.32A>C	c.(31-33)cAg>cCg	p.Q11P	RAD23A_ENST00000541222.1_5'UTR|RAD23A_ENST00000592268.1_Missense_Mutation_p.Q11P|RAD23A_ENST00000316856.3_Missense_Mutation_p.Q11P|CTC-425F1.4_ENST00000589120.1_RNA			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	11	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						AAAACGCTGCAGCAGCAGACC	0.711								Nucleotide excision repair (NER)																													p.Q11P		Atlas-SNP	.											.	RAD23A	29	.	0			c.A32C						.						19.0	22.0	21.0					19																	13056794		2188	4282	6470	SO:0001583	missense	5886	exon1			CGCTGCAGCAGCA		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.32A>C	chr19.hg19:g.13056794A>C	ENSP00000467024:p.Gln11Pro	75.0	0.0		27.0	12.0	NM_005053	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	hg19	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.574783	0.86542	.	.	ENSG00000179262	ENST00000316856	T	0.74421	-0.84	4.8	4.8	0.61643	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	D	0.85575	0.5728	M	0.87328	2.875	0.80722	D	1	B;D;B	0.56287	0.097;0.975;0.356	B;P;P	0.61940	0.204;0.896;0.478	D	0.87677	0.2545	10	0.66056	D	0.02	-15.5005	11.8748	0.52541	1.0:0.0:0.0:0.0	.	11;28;11	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	P	11	ENSP00000321365:Q11P	ENSP00000321365:Q11P	Q	+	2	0	RAD23A	12917794	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.613000	0.67688	1.806000	0.52798	0.533000	0.62120	CAG	.	.		0.711	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	
RAD23A	5886	hgsc.bcm.edu	37	19	13056800	13056800	+	Missense_Mutation	SNP	A	A	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:13056800A>C	ENST00000586534.1	+	1	99	c.38A>C	c.(37-39)cAg>cCg	p.Q13P	RAD23A_ENST00000541222.1_5'UTR|RAD23A_ENST00000592268.1_Missense_Mutation_p.Q13P|RAD23A_ENST00000316856.3_Missense_Mutation_p.Q13P|CTC-425F1.4_ENST00000589120.1_RNA			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	13	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						CTGCAGCAGCAGACCTTCAAG	0.726								Nucleotide excision repair (NER)																													p.Q13P		Atlas-SNP	.											.	RAD23A	29	.	0			c.A38C						.						19.0	21.0	21.0					19																	13056800		2187	4282	6469	SO:0001583	missense	5886	exon1			AGCAGCAGACCTT		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.38A>C	chr19.hg19:g.13056800A>C	ENSP00000467024:p.Gln13Pro	72.0	0.0		24.0	11.0	NM_005053	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	hg19	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	a	19.23	3.788158	0.70337	.	.	ENSG00000179262	ENST00000316856	T	0.73789	-0.78	4.77	4.77	0.60923	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.64402	D	0.000001	D	0.88658	0.6496	M	0.93678	3.445	0.80722	D	1	B;D;B	0.53619	0.058;0.961;0.24	B;D;B	0.77557	0.156;0.99;0.305	D	0.90490	0.4466	10	0.59425	D	0.04	-12.34	11.8288	0.52282	1.0:0.0:0.0:0.0	.	13;30;13	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	P	13	ENSP00000321365:Q13P	ENSP00000321365:Q13P	Q	+	2	0	RAD23A	12917800	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.602000	0.67612	1.795000	0.52594	0.520000	0.50463	CAG	.	.		0.726	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452752.1	NM_005053	
GDF15	9518	hgsc.bcm.edu	37	19	18499150	18499150	+	Missense_Mutation	SNP	C	C	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:18499150C>G	ENST00000252809.3	+	2	364	c.332C>G	c.(331-333)cCc>cGc	p.P111R	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	111					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						GCCGCCCTTCCCGAGGGGCTC	0.697											OREG0025363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P111R		Atlas-SNP	.											.	GDF15	31	.	0			c.C332G						.						17.0	21.0	20.0					19																	18499150		2173	4281	6454	SO:0001583	missense	9518	exon2			CCCTTCCCGAGGG	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.332C>G	chr19.hg19:g.18499150C>G	ENSP00000252809:p.Pro111Arg	118.0	0.0	726	57.0	11.0	NM_004864	O14629|P78360|Q9BWA0|Q9NRT0	Missense_Mutation	SNP	ENST00000252809.3	hg19	CCDS12376.1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269549	0.40095	.	.	ENSG00000130513	ENST00000252809	T	0.81415	-1.49	4.31	-1.01	0.10169	.	1.302550	0.05372	N	0.535644	T	0.65386	0.2686	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.46911	-0.9157	10	0.21014	T	0.42	-1.9864	7.2446	0.26115	0.0:0.3754:0.5197:0.1049	.	111	Q99988	GDF15_HUMAN	R	111	ENSP00000252809:P111R	ENSP00000252809:P111R	P	+	2	0	GDF15	18360150	0.000000	0.05858	0.001000	0.08648	0.111000	0.19643	0.641000	0.24720	-0.005000	0.14395	0.305000	0.20034	CCC	.	.		0.697	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
VN1R2	317701	hgsc.bcm.edu	37	19	53762414	53762414	+	Nonsense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:53762414T>A	ENST00000341702.3	+	1	870	c.786T>A	c.(784-786)taT>taA	p.Y262*		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	262					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		AGTCAGTATATGCAGCATTGA	0.448																																					p.Y262X		Atlas-SNP	.											.	VN1R2	71	.	0			c.T786A						.						151.0	139.0	143.0					19																	53762414		2203	4300	6503	SO:0001587	stop_gained	317701	exon1			AGTATATGCAGCA	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.786T>A	chr19.hg19:g.53762414T>A	ENSP00000351244:p.Tyr262*	124.0	0.0		71.0	24.0	NM_173856	A1L411|Q8TDU4	Nonsense_Mutation	SNP	ENST00000341702.3	hg19	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	T	16.39	3.111238	0.56398	.	.	ENSG00000196131	ENST00000341702	.	.	.	2.94	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.3225	0.07056	0.0:0.1296:0.2441:0.6263	.	.	.	.	X	262	.	ENSP00000351244:Y262X	Y	+	3	2	VN1R2	58454226	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.271000	0.18626	0.529000	0.28599	0.486000	0.48141	TAT	.	.		0.448	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
VSTM1	284415	hgsc.bcm.edu	37	19	54554674	54554674	+	Silent	SNP	T	T	A	rs566804822		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:54554674T>A	ENST00000338372.2	-	4	559	c.384A>T	c.(382-384)tcA>tcT	p.S128S	VSTM1_ENST00000425006.2_Silent_p.S128S|VSTM1_ENST00000366170.2_Silent_p.S40S|VSTM1_ENST00000376626.1_Silent_p.S128S	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	128					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CTGTTTTCATTGAGGGAGCTT	0.383																																					p.S128S		Atlas-SNP	.											.	VSTM1	30	.	0			c.A384T						.						130.0	118.0	122.0					19																	54554674		2203	4300	6503	SO:0001819	synonymous_variant	284415	exon4			TTTCATTGAGGGA	AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.384A>T	chr19.hg19:g.54554674T>A		150.0	0.0		61.0	26.0	NM_198481	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Silent	SNP	ENST00000338372.2	hg19	CCDS12872.1																																																																																			.	.		0.383	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481	
LILRB1	10859	hgsc.bcm.edu	37	19	55143685	55143685	+	Missense_Mutation	SNP	C	C	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:55143685C>A	ENST00000396331.1	+	6	1015	c.658C>A	c.(658-660)Cta>Ata	p.L220I	LILRB1_ENST00000396327.3_Missense_Mutation_p.L220I|LILRB1_ENST00000427581.2_Missense_Mutation_p.L256I|LILRB1_ENST00000396315.1_Missense_Mutation_p.L220I|LILRB1_ENST00000418536.2_Missense_Mutation_p.L220I|LILRB1_ENST00000324602.7_Missense_Mutation_p.L220I|LILRB1_ENST00000448689.1_Missense_Mutation_p.L220I|LILRB1_ENST00000396321.2_Missense_Mutation_p.L220I|LILRB1_ENST00000396332.4_Missense_Mutation_p.L220I|AC009892.1_ENST00000578908.1_RNA|LILRB1_ENST00000434867.2_Missense_Mutation_p.L220I|LILRB1_ENST00000396317.1_Missense_Mutation_p.L220I	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	220	Ig-like C2-type 2.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GCTCCTGGTCCTAGGTGAGAA	0.582										HNSCC(37;0.09)																											p.L220I		Atlas-SNP	.											.	LILRB1	140	.	0			c.C658A						.						100.0	105.0	103.0					19																	55143685		2203	4300	6503	SO:0001583	missense	10859	exon5			CTGGTCCTAGGTG	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.658C>A	chr19.hg19:g.55143685C>A	ENSP00000379622:p.Leu220Ile	105.0	0.0		24.0	9.0	NM_001081637	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	hg19	CCDS42617.1	.	.	.	.	.	.	.	.	.	.	C	9.730	1.162140	0.21538	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96	1.57	-2.74	0.05932	Immunoglobulin-like fold (1);	1.296060	0.05569	N	0.570701	T	0.11580	0.0282	N	0.11789	0.175	0.09310	N	1	B;B;B;B;B	0.12013	0.001;0.005;0.003;0.0;0.003	B;B;B;B;B	0.17433	0.008;0.018;0.008;0.001;0.008	T	0.36817	-0.9732	10	0.66056	D	0.02	.	5.8156	0.18490	0.0:0.3467:0.0:0.6533	.	220;220;220;220;220	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	I	220;220;220;220;220;220;220;220;256;220;220	ENSP00000379614:L220I;ENSP00000391514:L220I;ENSP00000409968:L220I;ENSP00000379622:L220I;ENSP00000379618:L220I;ENSP00000315997:L220I;ENSP00000405243:L220I;ENSP00000379623:L220I;ENSP00000395004:L256I;ENSP00000379610:L220I;ENSP00000379608:L220I	ENSP00000315997:L220I	L	+	1	2	LILRB1	59835497	0.000000	0.05858	0.011000	0.14972	0.344000	0.29017	-1.684000	0.01932	-0.860000	0.04099	0.184000	0.17185	CTA	.	.		0.582	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
ZNF211	10520	hgsc.bcm.edu	37	19	58152694	58152694	+	Silent	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr19:58152694T>C	ENST00000347302.3	+	3	1019	c.840T>C	c.(838-840)agT>agC	p.S280S	ZNF211_ENST00000420680.1_Silent_p.S284S|ZNF211_ENST00000254182.7_Silent_p.S271S|ZNF211_ENST00000541801.1_Silent_p.S271S|ZNF211_ENST00000240731.4_Silent_p.S293S|ZNF211_ENST00000391703.3_Silent_p.S219S|ZNF211_ENST00000544273.1_Silent_p.S292S|ZNF211_ENST00000299871.5_Silent_p.S345S	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		AAGTCCACAGTGAAGAAAGGC	0.408																																					p.S345S		Atlas-SNP	.											.	ZNF211	78	.	0			c.T1035C						.						121.0	113.0	116.0					19																	58152694		2203	4300	6503	SO:0001819	synonymous_variant	10520	exon5			CCACAGTGAAGAA	U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.840T>C	chr19.hg19:g.58152694T>C		59.0	0.0		17.0	6.0	NM_001265597	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Silent	SNP	ENST00000347302.3	hg19	CCDS12957.1	.	.	.	.	.	.	.	.	.	.	T	8.553	0.876040	0.17395	.	.	ENSG00000121417	ENST00000407202	.	.	.	3.27	3.27	0.37495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9252	0.24412	0.2057:0.0:0.0:0.7943	.	.	.	.	R	284	.	.	X	+	1	0	ZNF211	62844506	0.000000	0.05858	0.172000	0.22920	0.998000	0.95712	-0.704000	0.05058	1.486000	0.48398	0.472000	0.43445	TGA	.	.		0.408	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1		
CSRP2BP	57325	hgsc.bcm.edu	37	20	18165423	18165423	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr20:18165423A>G	ENST00000435364.3	+	9	2503	c.2162A>G	c.(2161-2163)tAt>tGt	p.Y721C	CSRP2BP_ENST00000377681.3_Missense_Mutation_p.Y720C|CSRP2BP_ENST00000489634.2_Missense_Mutation_p.Y593C	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	721	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						TTCATGATCTATCATCTGATT	0.443																																					p.Y721C		Atlas-SNP	.											.	CSRP2BP	80	.	0			c.A2162G						.						175.0	142.0	154.0					20																	18165423		2203	4300	6503	SO:0001583	missense	57325	exon9			TGATCTATCATCT	AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.2162A>G	chr20.hg19:g.18165423A>G	ENSP00000392318:p.Tyr721Cys	87.0	0.0		59.0	8.0	NM_020536	A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Missense_Mutation	SNP	ENST00000435364.3	hg19	CCDS13133.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.421144	0.83559	.	.	ENSG00000149474	ENST00000278816;ENST00000377681;ENST00000435364;ENST00000489634	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	5.99	5.99	0.97316	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.30759	0.0775	N	0.12471	0.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.31052	-0.9957	10	0.87932	D	0	-15.7416	16.4943	0.84223	1.0:0.0:0.0:0.0	.	593;721	Q9H8E8-2;Q9H8E8	.;CSR2B_HUMAN	C	721;720;721;593	ENSP00000278816:Y721C;ENSP00000366909:Y720C;ENSP00000392318:Y721C;ENSP00000425909:Y593C	ENSP00000278816:Y721C	Y	+	2	0	CSRP2BP	18113423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.228000	0.95250	2.291000	0.77112	0.533000	0.62120	TAT	.	.		0.443	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078152.5	NM_020536	
ITSN1	6453	hgsc.bcm.edu	37	21	35134244	35134244	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr21:35134244A>G	ENST00000381318.3	+	9	1030	c.742A>G	c.(742-744)Att>Gtt	p.I248V	ITSN1_ENST00000399338.4_Missense_Mutation_p.I248V|ITSN1_ENST00000399349.1_Missense_Mutation_p.I248V|ITSN1_ENST00000488166.1_3'UTR|ITSN1_ENST00000399367.3_Missense_Mutation_p.I248V|ITSN1_ENST00000379960.5_Missense_Mutation_p.I248V|ITSN1_ENST00000381291.4_Missense_Mutation_p.I248V|AP000304.12_ENST00000429238.1_Intron|ITSN1_ENST00000381285.4_Missense_Mutation_p.I248V|ITSN1_ENST00000399326.3_Missense_Mutation_p.I248V|ITSN1_ENST00000437442.2_Missense_Mutation_p.I248V|ITSN1_ENST00000399355.2_Missense_Mutation_p.I248V|ITSN1_ENST00000399352.1_Missense_Mutation_p.I248V|ITSN1_ENST00000399353.1_Missense_Mutation_p.I211V	NM_003024.2	NP_003015.2	Q15811	ITSN1_HUMAN	intersectin 1 (SH3 domain protein)	248	EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				apoptotic signaling pathway (GO:0097190)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|kinase activator activity (GO:0019209)|proline-rich region binding (GO:0070064)|protein complex scaffold (GO:0032947)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(26)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	67						AGCAAGAACTATTCTTATGCA	0.433																																					p.I248V		Atlas-SNP	.											.	ITSN1	166	.	0			c.A742G						.						220.0	192.0	201.0					21																	35134244		2203	4300	6503	SO:0001583	missense	6453	exon9			AGAACTATTCTTA	AF064244	CCDS33545.1, CCDS33546.1	21q22.1-q22.2	2013-01-10			ENSG00000205726	ENSG00000205726		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	6183	protein-coding gene	gene with protein product	"""SH3 domain protein-1A"", ""human intersectin-SH3 domain-containing protein SH3P17"", ""Src homology 3 domain-containing protein"", ""intersectin 1 short form variant, 11"", ""intersectin 1 short form variant 3"", ""intersectin short variant 12"""	602442		SH3D1A, ITSN		9799604, 9813051	Standard	NM_003024		Approved	SH3P17, MGC134948, MGC134949	uc002yta.1	Q15811	OTTHUMG00000065284	ENST00000381318.3:c.742A>G	chr21.hg19:g.35134244A>G	ENSP00000370719:p.Ile248Val	216.0	0.0		98.0	6.0	NM_001001132	A7Y322|A8CTX8|A8CTY3|A8CTY7|A8D7D0|A8DCP3|B4DTM2|E7ERJ1|E9PE44|E9PG01|E9PHV2|O95216|Q0PW94|Q0PW95|Q0PW97|Q14BD3|Q1ED40|Q20BK3|Q9UET5|Q9UK60|Q9UNK1|Q9UNK2|Q9UQ92	Missense_Mutation	SNP	ENST00000381318.3	hg19	CCDS33545.1	.	.	.	.	.	.	.	.	.	.	A	14.16	2.453537	0.43531	.	.	ENSG00000205726	ENST00000399353;ENST00000381318;ENST00000381291;ENST00000381285;ENST00000381288;ENST00000381289;ENST00000399367;ENST00000399352;ENST00000399355;ENST00000399349;ENST00000381283;ENST00000399338;ENST00000437442;ENST00000399326;ENST00000379960	T;T;T;T;T;T;T;T;T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82;1.82	6.03	6.03	0.97812	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.28014	0.82	0.58432	D	0.999998	B;B;B;B;B;P;B;B;B;B	0.40000	0.418;0.418;0.418;0.127;0.365;0.698;0.127;0.127;0.365;0.418	B;B;B;B;B;D;B;B;B;B	0.67231	0.353;0.353;0.353;0.159;0.24;0.95;0.118;0.118;0.24;0.353	T	0.05068	-1.0908	10	0.02654	T	1	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	211;211;211;248;248;248;248;248;248;211	A8D7D0;A7XZY7;A8CTY7;A8CTY3;F8W7U0;E7ERJ1;A8CTX8;Q15811;Q15811-3;E7ERJ0	.;.;.;.;.;.;.;ITSN1_HUMAN;.;.	V	211;248;248;248;248;248;248;248;248;248;188;248;248;248;248	ENSP00000382290:I211V;ENSP00000370719:I248V;ENSP00000370691:I248V;ENSP00000370685:I248V;ENSP00000382301:I248V;ENSP00000382289:I248V;ENSP00000382292:I248V;ENSP00000382286:I248V;ENSP00000370683:I188V;ENSP00000382275:I248V;ENSP00000387377:I248V;ENSP00000382265:I248V;ENSP00000369294:I248V	ENSP00000369294:I248V	I	+	1	0	ITSN1	34056114	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.031000	0.76491	2.302000	0.77476	0.533000	0.62120	ATT	.	.		0.433	ITSN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000140070.4	NM_003024	
TTC28	23331	hgsc.bcm.edu	37	22	28378235	28378235	+	Missense_Mutation	SNP	T	T	C			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr22:28378235T>C	ENST00000397906.2	-	23	7561	c.7420A>G	c.(7420-7422)Aga>Gga	p.R2474G	TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000424161.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2474					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GGGAAAAATCTTCCTGGAGAC	0.592																																					p.R2474G		Atlas-SNP	.											.	TTC28	84	.	0			c.A7420G						.						10.0	11.0	11.0					22																	28378235		691	1587	2278	SO:0001583	missense	23331	exon23			AAAATCTTCCTGG	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.7420A>G	chr22.hg19:g.28378235T>C	ENSP00000381003:p.Arg2474Gly	125.0	0.0		60.0	6.0	NM_001145418	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	ENST00000397906.2	hg19	CCDS46678.1	.	.	.	.	.	.	.	.	.	.	T	17.90	3.500918	0.64298	.	.	ENSG00000100154	ENST00000397906	D	0.90788	-2.73	5.23	2.99	0.34606	.	0.000000	0.85682	D	0.000000	D	0.91081	0.7193	L	0.29908	0.895	0.53688	D	0.999976	D	0.63880	0.993	D	0.72338	0.977	D	0.90051	0.4149	10	0.72032	D	0.01	-18.8902	11.391	0.49815	0.0:0.0:0.2887:0.7113	.	2474	Q96AY4	TTC28_HUMAN	G	2474	ENSP00000381003:R2474G	ENSP00000381003:R2474G	R	-	1	2	TTC28	26708235	1.000000	0.71417	0.878000	0.34440	0.996000	0.88848	3.493000	0.53266	0.348000	0.23949	0.533000	0.62120	AGA	.	.		0.592	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000320930.2	XM_929318	
TTC38	55020	hgsc.bcm.edu	37	22	46671305	46671305	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr22:46671305A>G	ENST00000381031.3	+	5	602	c.526A>G	c.(526-528)Atc>Gtc	p.I176V	TTC38_ENST00000445282.2_Intron	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	176						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						GACACCTGACATCCCCCTAAG	0.443																																					p.I176V		Atlas-SNP	.											.	TTC38	40	.	0			c.A526G						.						100.0	99.0	99.0					22																	46671305		1882	4098	5980	SO:0001583	missense	55020	exon5			CCTGACATCCCCC		CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.526A>G	chr22.hg19:g.46671305A>G	ENSP00000370419:p.Ile176Val	90.0	0.0		28.0	11.0	NM_017931	Q8WV27|Q9NWP8	Missense_Mutation	SNP	ENST00000381031.3	hg19	CCDS43030.1	.	.	.	.	.	.	.	.	.	.	A	2.428	-0.331558	0.05314	.	.	ENSG00000075234	ENST00000381031;ENST00000421359	T	0.38240	1.15	5.93	-3.47	0.04753	.	0.605314	0.18640	N	0.135310	T	0.18551	0.0445	N	0.25485	0.75	0.29617	N	0.846493	B	0.09022	0.002	B	0.06405	0.002	T	0.20273	-1.0280	9	.	.	.	-19.539	8.1272	0.31005	0.4056:0.1836:0.4108:0.0	.	176	Q5R3I4	TTC38_HUMAN	V	176	ENSP00000370419:I176V	.	I	+	1	0	TTC38	45049969	0.001000	0.12720	0.016000	0.15963	0.829000	0.46940	0.033000	0.13754	-0.310000	0.08766	0.533000	0.62120	ATC	.	.		0.443	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000318469.1	NM_017931	
CCNB3	85417	hgsc.bcm.edu	37	X	50037976	50037976	+	Missense_Mutation	SNP	T	T	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chrX:50037976T>A	ENST00000376042.1	+	5	616	c.318T>A	c.(316-318)aaT>aaA	p.N106K	CCNB3_ENST00000276014.7_Missense_Mutation_p.N106K|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	106					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CCAAAAAGAATAAGCGGAATC	0.393																																					p.N106K		Atlas-SNP	.											.	CCNB3	367	.	0			c.T318A						.						121.0	103.0	109.0					X																	50037976		2203	4300	6503	SO:0001583	missense	85417	exon4			AAAGAATAAGCGG	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.318T>A	chrX.hg19:g.50037976T>A	ENSP00000365210:p.Asn106Lys	107.0	0.0		31.0	16.0	NM_033031	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	hg19	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	T	9.444	1.088815	0.20390	.	.	ENSG00000147082	ENST00000376042;ENST00000396540;ENST00000276014	T;T	0.11063	2.81;2.81	3.83	1.31	0.21738	.	18.892400	0.00166	N	0.000002	T	0.10594	0.0259	L	0.43152	1.355	0.09310	N	1	B	0.18461	0.028	B	0.11329	0.006	T	0.27739	-1.0065	9	.	.	.	.	3.3901	0.07286	0.0:0.1305:0.2346:0.6349	.	106	Q8WWL7	CCNB3_HUMAN	K	106	ENSP00000365210:N106K;ENSP00000276014:N106K	.	N	+	3	2	CCNB3	50054716	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	0.994000	0.29693	0.065000	0.16485	0.478000	0.44815	AAT	.	.		0.393	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1		
PCDH11Y	83259	hgsc.bcm.edu	37	Y	4968005	4968005	+	Missense_Mutation	SNP	A	A	G			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chrY:4968005A>G	ENST00000333703.4	+	5	2866	c.2353A>G	c.(2353-2355)Agt>Ggt	p.S785G	PCDH11Y_ENST00000362095.5_Missense_Mutation_p.S796G|PCDH11Y_ENST00000215473.6_Missense_Mutation_p.S796G	NM_001278619.1|NM_032971.2	NP_001265548.1|NP_116753.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	796	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTCTCTCTTCAGTGTTGTAAT	0.418																																					p.S796G		Atlas-SNP	.											.	PCDH11Y	163	.	0			c.A2386G						.																																			SO:0001583	missense	83259	exon2			CTCTTCAGTGTTG	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000333703.4:c.2353A>G	chrY.hg19:g.4968005A>G	ENSP00000330552:p.Ser785Gly	201.0	0.0		65.0	39.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Missense_Mutation	SNP	ENST00000333703.4	hg19	CCDS14776.1																																																																																			.	.		0.418	PCDH11Y-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084979.2	NM_032973	
LMBRD1	55788	hgsc.bcm.edu	37	6	70408942	70408944	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:70408942_70408944delAAG	ENST00000370577.3	-	13	1558_1560	c.1329_1331delCTT	c.(1327-1332)tactta>taa	p.443_444YL>*	LMBRD1_ENST00000370570.1_In_Frame_Del_p.370_371YL>*	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	443					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)	p.Y443*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						TACCTCTATTAAGTAATTTTGGC	0.281																																					p.444_444del		Atlas-Indel,Pindel	.											.	LMBRD1	61	.	1	Substitution - Nonsense(1)	endometrium(1)	c.1330_1332del						.																																			SO:0001651	inframe_deletion	55788	exon13			.	AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.1329_1331delCTT	chr6.hg19:g.70408942_70408944delAAG	ENSP00000359609:p.Tyr443_Leu444delins*	46.0	0.0		45.0	14.0	NM_018368	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	In_Frame_Del	DEL	ENST00000370577.3	hg19	CCDS4969.1																																																																																			.	.		0.281	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041124.1	NM_018368	
TNR	7143	hgsc.bcm.edu	37	1	175306706	175306707	+	Frame_Shift_Ins	INS	-	-	A			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr1:175306706_175306707insA	ENST00000367674.2	-	19	4199_4200	c.3491_3492insT	c.(3490-3492)ttafs	p.L1164fs	TNR_ENST00000263525.2_Frame_Shift_Ins_p.L1164fs|RP3-518E13.2_ENST00000569593.1_RNA			Q92752	TENR_HUMAN	tenascin R	1164	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					AGTACACTTGTAATTTCTGGCT	0.505																																					p.L1164fs		Atlas-Indel,Pindel	.											.	TNR	399	.	0			c.3492_3493insT						.																																			SO:0001589	frameshift_variant	7143	exon19			.	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3492dupT	chr1.hg19:g.175306708_175306708dupA	ENSP00000356646:p.Leu1164fs	100.0	0.0		46.0	15.0	NM_003285	C9J563|Q15568|Q5R3G0	Frame_Shift_Ins	INS	ENST00000367674.2	hg19	CCDS1318.1																																																																																			.	.		0.505	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
SEC24A	10802	hgsc.bcm.edu	37	5	134039534	134039535	+	Frame_Shift_Ins	INS	-	-	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr5:134039534_134039535insT	ENST00000398844.2	+	16	2640_2641	c.2352_2353insT	c.(2353-2355)tatfs	p.Y785fs	RNU6-1164P_ENST00000364428.1_RNA	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	785					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAGACGCTGGGTATGCAGTACA	0.416																																					p.G784fs		Atlas-Indel,Pindel	.											.	SEC24A	77	.	0			c.2352_2353insT						.																																			SO:0001589	frameshift_variant	10802	exon16			.	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.2353dupT	chr5.hg19:g.134039535_134039535dupT	ENSP00000381823:p.Tyr785fs	259.0	0.0		146.0	59.0	NM_021982	A8MVW3|Q8WUV2|Q96GP7	Frame_Shift_Ins	INS	ENST00000398844.2	hg19	CCDS43363.1																																																																																			.	.		0.416	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
MELK	9833	hgsc.bcm.edu	37	9	36677291	36677291	+	Frame_Shift_Del	DEL	A	A	-			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:36677291delA	ENST00000298048.2	+	18	2097	c.1913delA	c.(1912-1914)tacfs	p.Y638fs	MELK_ENST00000536987.1_Frame_Shift_Del_p.Y507fs|MELK_ENST00000543751.1_Frame_Shift_Del_p.Y606fs|MELK_ENST00000536860.1_Frame_Shift_Del_p.Y590fs|MELK_ENST00000545008.1_Frame_Shift_Del_p.Y567fs|MELK_ENST00000541717.1_Frame_Shift_Del_p.Y597fs|MELK_ENST00000538311.1_Frame_Shift_Del_p.Y444fs|MELK_ENST00000536329.1_Frame_Shift_Del_p.Y567fs	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	638	Autoinhibitory region.|KA1. {ECO:0000255|PROSITE- ProRule:PRU00565}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GCCTGGGTTTACAAAAGATTA	0.463																																					p.Y638fs	Ovarian(82;980 1317 7225 14391 18624)	Atlas-INDEL	.											.	MELK	74	.	0			c.1912delT						.						90.0	86.0	87.0					9																	36677291		2203	4300	6503	SO:0001589	frameshift_variant	9833	exon18			.	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1913delA	chr9.hg19:g.36677291delA	ENSP00000298048:p.Tyr638fs	70.0	0.0		22.0	16.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Frame_Shift_Del	DEL	ENST00000298048.2	hg19	CCDS6606.1																																																																																			.	.		0.463	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
CAND1	55832	hgsc.bcm.edu	37	12	67699601	67699602	+	Frame_Shift_Ins	INS	-	-	T			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr12:67699601_67699602insT	ENST00000545606.1	+	10	2590_2591	c.2153_2154insT	c.(2152-2157)actttgfs	p.L719fs		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	719					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		TTTCTTACCACTTTGGCAAAAG	0.436																																					p.T718fs		Atlas-Indel,Pindel	.											.	CAND1	100	.	0			c.2153_2154insT						.																																			SO:0001589	frameshift_variant	55832	exon10			.		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2156dupT	chr12.hg19:g.67699604_67699604dupT	ENSP00000442318:p.Leu719fs	108.0	0.0		54.0	32.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Frame_Shift_Ins	INS	ENST00000545606.1	hg19	CCDS8977.1																																																																																			.	.		0.436	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
TAAR5	9038	hgsc.bcm.edu	37	6	132910065	132910065	+	Frame_Shift_Del	DEL	A	A	-	rs138145315		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:132910065delA	ENST00000258034.2	-	1	812	c.761delT	c.(760-762)ctgfs	p.L254fs		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	254					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		AGCAATGCCCAGGGTCTTGGC	0.527																																					p.L254fs		Atlas-INDEL	.											.	TAAR5	53	.	0			c.762delG						.						64.0	65.0	65.0					6																	132910065		2203	4300	6503	SO:0001589	frameshift_variant	9038	exon1			.	AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.761delT	chr6.hg19:g.132910065delA	ENSP00000258034:p.Leu254fs	60.0	0.0		34.0	12.0	NM_003967	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Frame_Shift_Del	DEL	ENST00000258034.2	hg19	CCDS5156.1																																																																																			.	.		0.527	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042257.1	NM_003967	
TAAR5	9038	hgsc.bcm.edu	37	6	132910065	132910066	+	Frame_Shift_Del	DEL	AG	AG	-	rs138145315		TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr6:132910065_132910066delAG	ENST00000258034.2	-	1	811_812	c.760_761delCT	c.(760-762)ctgfs	p.L254fs		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	254					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		AGCAATGCCCAGGGTCTTGGCA	0.53																																					p.254_254del		Pindel	.											.	TAAR5	53	.	0			c.761_762del						.																																			SO:0001589	frameshift_variant	9038	exon1			.	AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.760_761delCT	chr6.hg19:g.132910065_132910066delAG	ENSP00000258034:p.Leu254fs	62.0	0.0		35.0	10.0	NM_003967	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Frame_Shift_Del	DEL	ENST00000258034.2	hg19	CCDS5156.1																																																																																			.	.		0.530	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042257.1	NM_003967	
MELK	9833	hgsc.bcm.edu	37	9	36677295	36677295	+	Frame_Shift_Del	DEL	A	A	-			TCGA-RC-A7SK-01A-11D-A34Z-10	TCGA-RC-A7SK-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fd7293a-c256-40e8-a1b8-8f8b507f3441	2f8837d8-34ee-463b-bc83-36ab5067c3bd	g.chr9:36677295delA	ENST00000298048.2	+	18	2101	c.1917delA	c.(1915-1917)aaafs	p.K639fs	MELK_ENST00000536987.1_Frame_Shift_Del_p.K508fs|MELK_ENST00000543751.1_Frame_Shift_Del_p.K607fs|MELK_ENST00000536860.1_Frame_Shift_Del_p.K591fs|MELK_ENST00000545008.1_Frame_Shift_Del_p.K568fs|MELK_ENST00000541717.1_Frame_Shift_Del_p.K598fs|MELK_ENST00000538311.1_Frame_Shift_Del_p.K445fs|MELK_ENST00000536329.1_Frame_Shift_Del_p.K568fs	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	639	Autoinhibitory region.|KA1. {ECO:0000255|PROSITE- ProRule:PRU00565}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			GGGTTTACAAAAGATTAGTGG	0.458																																					p.K639fs	Ovarian(82;980 1317 7225 14391 18624)	Pindel	.											.	MELK	74	.	0			c.1916delA						.						87.0	83.0	84.0					9																	36677295		2203	4300	6503	SO:0001589	frameshift_variant	9833	exon18			.	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.1917delA	chr9.hg19:g.36677295delA	ENSP00000298048:p.Lys639fs	68.0	0.0		23.0	15.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Frame_Shift_Del	DEL	ENST00000298048.2	hg19	CCDS6606.1																																																																																			.	.		0.458	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
