#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	hgsc.bcm.edu	37	1	19513738	19513738	+	Missense_Mutation	SNP	T	T	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr1:19513738T>A	ENST00000375254.3	-	13	1579	c.1552A>T	c.(1552-1554)Ata>Tta	p.I518L	UBR4_ENST00000375217.2_Missense_Mutation_p.I518L|UBR4_ENST00000375226.2_Missense_Mutation_p.I518L|UBR4_ENST00000375267.2_Missense_Mutation_p.I518L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	518					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ATCCTCTGTATGGAGGTGCTC	0.493																																					p.I518L		Atlas-SNP	.											.	UBR4	415	.	0			c.A1552T						.						92.0	80.0	84.0					1																	19513738		2203	4300	6503	SO:0001583	missense	23352	exon13			TCTGTATGGAGGT	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1552A>T	chr1.hg19:g.19513738T>A	ENSP00000364403:p.Ile518Leu	60.0	0.0		82.0	19.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	hg19	CCDS189.1	.	.	.	.	.	.	.	.	.	.	T	9.020	0.984550	0.18889	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.97	4.84	0.62591	.	0.105878	0.64402	N	0.000008	T	0.08714	0.0216	N	0.05078	-0.115	0.80722	D	1	B	0.26002	0.139	B	0.16722	0.016	T	0.12142	-1.0559	10	0.02654	T	1	.	12.5388	0.56156	0.0:0.0:0.1394:0.8606	.	518	Q5T4S7	UBR4_HUMAN	L	518	ENSP00000364403:I518L;ENSP00000364416:I518L;ENSP00000364365:I518L;ENSP00000364374:I518L	ENSP00000364365:I518L	I	-	1	0	UBR4	19386325	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.756000	0.68757	1.073000	0.40885	-0.264000	0.10439	ATA	.	.		0.493	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
HMGB4	127540	hgsc.bcm.edu	37	1	34329977	34329977	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr1:34329977C>A	ENST00000522796.1	+	4	2090	c.185C>A	c.(184-186)gCc>gAc	p.A62D	HMGB4_ENST00000425537.1_3'UTR|HMGB4_ENST00000519684.1_Missense_Mutation_p.A62D|CSMD2_ENST00000373381.4_Intron			Q8WW32	HMGB4_HUMAN	high mobility group box 4	62						chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				AAATATGAAGCCCTGGCCAAA	0.463																																					p.A62D		Atlas-SNP	.											.	HMGB4	27	.	0			c.C185A						.						120.0	135.0	130.0					1																	34329977		2203	4300	6503	SO:0001583	missense	127540	exon2			ATGAAGCCCTGGC		CCDS30668.1	1p35.1	2011-07-01	2011-04-05		ENSG00000176256	ENSG00000176256		"""High-mobility group / Canonical"""	24954	protein-coding gene	gene with protein product			"""high-mobility group box 4"""				Standard	NR_033264		Approved	FLJ40388	uc001bxp.3	Q8WW32	OTTHUMG00000013143	ENST00000522796.1:c.185C>A	chr1.hg19:g.34329977C>A	ENSP00000430919:p.Ala62Asp	88.0	0.0		117.0	18.0	NM_145205	B2R4X7|Q0QWA4	Missense_Mutation	SNP	ENST00000522796.1	hg19	CCDS30668.1	.	.	.	.	.	.	.	.	.	.	C	6.856	0.527267	0.13066	.	.	ENSG00000176256	ENST00000519684;ENST00000522796	T;T	0.12774	2.65;2.65	5.58	0.467	0.16721	.	0.232725	0.37053	N	0.002268	T	0.09423	0.0232	L	0.28192	0.835	0.33964	D	0.646037	P	0.47034	0.889	P	0.50896	0.653	T	0.31194	-0.9952	10	0.02654	T	1	.	4.817	0.13372	0.4359:0.4072:0.0:0.1569	.	62	B2R4X7	.	D	62	ENSP00000429214:A62D;ENSP00000430919:A62D	ENSP00000429214:A62D	A	+	2	0	HMGB4	34102564	0.991000	0.36638	0.082000	0.20525	0.854000	0.48673	2.434000	0.44802	-0.049000	0.13379	-0.192000	0.12808	GCC	.	.		0.463	HMGB4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375773.1	NM_145205	
MSH4	4438	hgsc.bcm.edu	37	1	76262910	76262910	+	Silent	SNP	T	T	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr1:76262910T>G	ENST00000263187.3	+	1	344	c.240T>G	c.(238-240)gcT>gcG	p.A80A		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	80					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						CCCGGCCAGCTCAAGGCAAGG	0.647								Mismatch excision repair (MMR)																													p.A80A		Atlas-SNP	.											.	MSH4	147	.	0			c.T240G						.						9.0	10.0	10.0					1																	76262910		2188	4281	6469	SO:0001819	synonymous_variant	4438	exon1			GCCAGCTCAAGGC	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.240T>G	chr1.hg19:g.76262910T>G		28.0	0.0		36.0	12.0	NM_002440	Q5T4U6|Q8NEB3|Q9UNP8	Silent	SNP	ENST00000263187.3	hg19	CCDS670.1																																																																																			.	.		0.647	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
BIRC6	57448	hgsc.bcm.edu	37	2	32842852	32842852	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:32842852C>A	ENST00000421745.2	+	74	14589	c.14455C>A	c.(14455-14457)Cct>Act	p.P4819T		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4819					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGGCTTGGATCCTGACACTGA	0.527																																					p.P4819T	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.C14455A						.						118.0	91.0	100.0					2																	32842852		2203	4300	6503	SO:0001583	missense	57448	exon74			TTGGATCCTGACA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.14455C>A	chr2.hg19:g.32842852C>A	ENSP00000393596:p.Pro4819Thr	51.0	0.0		85.0	30.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262068	0.23051	.	.	ENSG00000115760	ENST00000421745	T	0.73681	-0.77	5.76	5.76	0.90799	.	0.059335	0.64402	D	0.000002	T	0.62853	0.2462	L	0.34521	1.04	0.58432	D	0.999997	P	0.37781	0.608	B	0.32090	0.14	T	0.61451	-0.7060	10	0.10377	T	0.69	.	19.9664	0.97271	0.0:1.0:0.0:0.0	.	4819	Q9NR09	BIRC6_HUMAN	T	4819	ENSP00000393596:P4819T	ENSP00000393596:P4819T	P	+	1	0	BIRC6	32696356	1.000000	0.71417	0.997000	0.53966	0.466000	0.32739	5.558000	0.67319	2.718000	0.92993	0.655000	0.94253	CCT	.	.		0.527	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
LTBP1	4052	hgsc.bcm.edu	37	2	33413881	33413881	+	Missense_Mutation	SNP	A	A	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:33413881A>G	ENST00000404816.2	+	7	2017	c.1664A>G	c.(1663-1665)cAg>cGg	p.Q555R	LTBP1_ENST00000390003.4_Missense_Mutation_p.Q229R|LTBP1_ENST00000418533.2_Missense_Mutation_p.Q229R|LTBP1_ENST00000354476.3_Missense_Mutation_p.Q555R|LTBP1_ENST00000407925.1_Missense_Mutation_p.Q229R|LTBP1_ENST00000404525.1_Missense_Mutation_p.Q229R|LTBP1_ENST00000402934.1_Missense_Mutation_p.Q229R			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	555					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GCTAAGACACAGCTTGGCCGG	0.502																																					p.Q555R		Atlas-SNP	.											.	LTBP1	317	.	0			c.A1664G						.						122.0	122.0	122.0					2																	33413881		2203	4300	6503	SO:0001583	missense	4052	exon7			AGACACAGCTTGG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1664A>G	chr2.hg19:g.33413881A>G	ENSP00000386043:p.Gln555Arg	84.0	0.0		103.0	35.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	hg19	CCDS33177.2	.	.	.	.	.	.	.	.	.	.	A	16.58	3.162808	0.57368	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925	D;D;D;D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87;-2.87;-2.87;-2.87	5.73	5.73	0.89815	Matrix fibril-associated (2);	.	.	.	.	D	0.92358	0.7575	L	0.44542	1.39	0.80722	D	1	D;D;B;D;D;D	0.69078	0.99;0.995;0.094;0.979;0.997;0.994	P;D;B;P;D;D	0.78314	0.844;0.991;0.07;0.798;0.99;0.925	D	0.89456	0.3733	9	0.11794	T	0.64	.	16.0283	0.80558	1.0:0.0:0.0:0.0	.	555;229;229;229;229;555	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	R	555;555;229;229;229;229;229	ENSP00000386043:Q555R;ENSP00000346467:Q555R;ENSP00000374653:Q229R;ENSP00000393057:Q229R;ENSP00000384373:Q229R;ENSP00000385359:Q229R;ENSP00000384091:Q229R	ENSP00000346467:Q555R	Q	+	2	0	LTBP1	33267385	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.548000	0.73896	2.199000	0.70637	0.459000	0.35465	CAG	.	.		0.502	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
CCT7	10574	hgsc.bcm.edu	37	2	73479859	73479859	+	Missense_Mutation	SNP	A	A	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:73479859A>G	ENST00000258091.5	+	12	1643	c.1502A>G	c.(1501-1503)aAt>aGt	p.N501S	CCT7_ENST00000398422.2_Missense_Mutation_p.N297S|CCT7_ENST00000540468.1_Missense_Mutation_p.N414S|CCT7_ENST00000537131.1_Missense_Mutation_p.N401S|CCT7_ENST00000538797.1_Missense_Mutation_p.N373S|CCT7_ENST00000539919.1_Missense_Mutation_p.N457S	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	501					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						GTGCGGATCAATGCGCTGACA	0.542																																					p.N501S		Atlas-SNP	.											.	CCT7	60	.	0			c.A1502G						.						73.0	79.0	77.0					2																	73479859		2055	4198	6253	SO:0001583	missense	10574	exon12			GGATCAATGCGCT	AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.1502A>G	chr2.hg19:g.73479859A>G	ENSP00000258091:p.Asn501Ser	119.0	0.0		198.0	83.0	NM_006429	A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Missense_Mutation	SNP	ENST00000258091.5	hg19	CCDS46336.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.407098	0.83230	.	.	ENSG00000135624	ENST00000540468;ENST00000539919;ENST00000258091;ENST00000398422;ENST00000537131;ENST00000538797;ENST00000409081	T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.84451	0.5475	L	0.49778	1.585	0.80722	D	1	D;D;D;D;P;D	0.89917	0.999;0.96;0.982;1.0;0.835;1.0	D;P;P;D;P;D	0.91635	0.994;0.847;0.838;0.999;0.694;0.999	D	0.85659	0.1287	10	0.62326	D	0.03	-27.3315	14.2361	0.65927	1.0:0.0:0.0:0.0	.	414;373;401;459;297;501	B7Z4Z7;B7Z1C9;F5GZK5;B8ZZC9;A8MWI8;Q99832	.;.;.;.;.;TCPH_HUMAN	S	414;457;501;297;401;373;459	ENSP00000442058:N414S;ENSP00000437824:N457S;ENSP00000258091:N501S;ENSP00000381456:N297S;ENSP00000444379:N401S;ENSP00000438462:N373S	ENSP00000258091:N501S	N	+	2	0	CCT7	73333367	1.000000	0.71417	0.992000	0.48379	0.948000	0.59901	8.822000	0.92013	2.198000	0.70561	0.533000	0.62120	AAT	.	.		0.542	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327714.2		
NAT8	9027	hgsc.bcm.edu	37	2	73868638	73868638	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:73868638G>T	ENST00000272425.3	-	2	267	c.118C>A	c.(118-120)Cct>Act	p.P40T		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)											breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						AGGGTTCGAGGCAGCTTCAGC	0.627																																					p.P40T		Atlas-SNP	.											.	NAT8	26	.	0			c.C118A						.						78.0	91.0	87.0					2																	73868638		2203	4300	6503	SO:0001583	missense	9027	exon2			TTCGAGGCAGCTT	AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.118C>A	chr2.hg19:g.73868638G>T	ENSP00000272425:p.Pro40Thr	68.0	0.0		86.0	36.0	NM_003960		Missense_Mutation	SNP	ENST00000272425.3	hg19	CCDS1926.1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628136	0.66901	.	.	ENSG00000144035	ENST00000272425	T	0.34472	1.36	3.86	2.87	0.33458	.	0.193112	0.43919	D	0.000504	T	0.53514	0.1801	M	0.73217	2.22	0.43628	D	0.996013	D	0.76494	0.999	D	0.66847	0.947	T	0.57046	-0.7878	10	0.56958	D	0.05	-52.0712	10.9497	0.47321	0.0:0.1925:0.8075:0.0	.	40	Q9UHE5	NAT8_HUMAN	T	40	ENSP00000272425:P40T	ENSP00000272425:P40T	P	-	1	0	NAT8	73722146	0.960000	0.32886	0.526000	0.27913	0.167000	0.22549	1.518000	0.35877	2.110000	0.64415	0.644000	0.83932	CCT	.	.		0.627	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327854.1	NM_003960	
C2orf68	388969	hgsc.bcm.edu	37	2	85836186	85836186	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:85836186T>C	ENST00000306336.5	-	4	427	c.383A>G	c.(382-384)gAt>gGt	p.D128G	C2orf68_ENST00000478626.1_5'Flank|USP39_ENST00000459775.1_Intron	NM_001013649.3	NP_001013671.2	Q2NKX9	CB068_HUMAN	chromosome 2 open reading frame 68	128										breast(1)|central_nervous_system(1)|endometrium(1)	3						TCCTGGGTCATCACCCTACGT	0.552																																					p.D128G		Atlas-SNP	.											.	C2orf68	5	.	0			c.A383G						.						75.0	74.0	74.0					2																	85836186		2016	4196	6212	SO:0001583	missense	388969	exon4			GGGTCATCACCCT		CCDS42704.1	2p11.2	2008-07-18			ENSG00000168887	ENSG00000168887			34353	protein-coding gene	gene with protein product							Standard	NM_001013649		Approved		uc002sqc.2	Q2NKX9	OTTHUMG00000153088	ENST00000306336.5:c.383A>G	chr2.hg19:g.85836186T>C	ENSP00000304410:p.Asp128Gly	71.0	0.0		93.0	35.0	NM_001013649	B4DT10|Q4G0J7|Q6ZVA6	Missense_Mutation	SNP	ENST00000306336.5	hg19	CCDS42704.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.974795	0.74360	.	.	ENSG00000168887	ENST00000306336	.	.	.	5.41	5.41	0.78517	.	1.609690	0.03730	N	0.253372	T	0.71333	0.3327	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.54456	-0.8291	9	0.72032	D	0.01	-8.3227	11.7613	0.51905	0.0:0.0:0.0:1.0	.	128	Q2NKX9	CB068_HUMAN	G	128	.	ENSP00000304410:D128G	D	-	2	0	C2orf68	85689697	1.000000	0.71417	0.999000	0.59377	0.916000	0.54674	4.805000	0.62561	2.281000	0.76405	0.533000	0.62120	GAT	.	.		0.552	C2orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329451.1	NM_001013649	
OLA1	29789	hgsc.bcm.edu	37	2	175111522	175111522	+	Missense_Mutation	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:175111522C>T	ENST00000409546.1	-	2	712	c.82G>A	c.(82-84)Gat>Aat	p.D28N	OLA1_ENST00000344357.5_Intron|OLA1_ENST00000284719.3_Missense_Mutation_p.D8N|OLA1_ENST00000428402.2_Missense_Mutation_p.D8N					Obg-like ATPase 1											breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						TTAATTCCATCACCTCCCTTT	0.393																																					p.D8N		Atlas-SNP	.											.	OLA1	37	.	0			c.G22A						.						63.0	63.0	63.0					2																	175111522		2203	4300	6503	SO:0001583	missense	29789	exon2			TTCCATCACCTCC		CCDS2255.1, CCDS42779.1	2q31.1	2014-06-24	2007-07-27	2007-07-27	ENSG00000138430	ENSG00000138430			28833	protein-coding gene	gene with protein product		611175	"""GTP-binding protein 9 (putative)"""	GTPBP9		17430889, 24486488	Standard	NM_013341		Approved	PTD004	uc002uih.3	Q9NTK5	OTTHUMG00000132335	ENST00000409546.1:c.82G>A	chr2.hg19:g.175111522C>T	ENSP00000386350:p.Asp28Asn	138.0	0.0		288.0	30.0	NM_013341		Missense_Mutation	SNP	ENST00000409546.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.52	3.843015	0.71488	.	.	ENSG00000138430	ENST00000284719;ENST00000428402;ENST00000409546;ENST00000427472	T;T;T;T	0.43688	0.97;0.95;0.94;0.96	5.53	4.65	0.58169	.	0.150654	0.64402	D	0.000013	T	0.30230	0.0758	N	0.19112	0.55	0.58432	D	0.999999	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.07558	-1.0766	10	0.66056	D	0.02	.	13.4888	0.61382	0.0:0.923:0.0:0.0769	.	8;8;8	Q9NTK5-3;D7EHM2;Q9NTK5	.;.;OLA1_HUMAN	N	8;8;28;8	ENSP00000284719:D8N;ENSP00000410385:D8N;ENSP00000386350:D28N;ENSP00000414568:D8N	ENSP00000284719:D8N	D	-	1	0	OLA1	174819768	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.551000	0.73909	1.316000	0.45131	0.561000	0.74099	GAT	.	.		0.393	OLA1-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333877.1	NM_013341	
ERBB4	2066	hgsc.bcm.edu	37	2	212576873	212576873	+	Missense_Mutation	SNP	C	C	G	rs149272231	byFrequency	TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:212576873C>G	ENST00000342788.4	-	9	1336	c.1026G>C	c.(1024-1026)ttG>ttC	p.L342F	ERBB4_ENST00000436443.1_Missense_Mutation_p.L342F|ERBB4_ENST00000402597.1_Missense_Mutation_p.L342F	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	342					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GAGCTGACATCAATGATCCTG	0.383										TSP Lung(8;0.080)																											p.L342F		Atlas-SNP	.											.	ERBB4	480	.	0			c.G1026C						.						103.0	94.0	97.0					2																	212576873		2203	4300	6503	SO:0001583	missense	2066	exon9			TGACATCAATGAT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1026G>C	chr2.hg19:g.212576873C>G	ENSP00000342235:p.Leu342Phe	134.0	0.0		140.0	73.0	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	hg19	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.90|14.90	2.673978|2.673978	0.47781|0.47781	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	T;T;T|.	0.77877|.	-1.13;-1.13;-1.13|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.61173|.	0.2326|.	L|L	0.46741|0.46741	1.465|1.465	0.58432|0.58432	D|D	0.999999|0.999999	D;P;D;D;D|.	0.89917|.	1.0;0.63;1.0;1.0;1.0|.	D;B;D;D;D|.	0.91635|.	0.999;0.199;0.999;0.999;0.998|.	T|.	0.58109|.	-0.7694|.	10|.	0.33141|.	T|.	0.24|.	.|.	13.9538|13.9538	0.64135|0.64135	0.0:0.9242:0.0:0.0758|0.0:0.9242:0.0:0.0758	.|.	342;342;201;342;342|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	F|S	342|342	ENSP00000342235:L342F;ENSP00000403204:L342F;ENSP00000385565:L342F|.	ENSP00000342235:L342F|.	L|X	-|-	3|2	2|2	ERBB4|ERBB4	212285118|212285118	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.988000|0.988000	0.76386|0.76386	0.837000|0.837000	0.27558|0.27558	2.386000|2.386000	0.81285|0.81285	0.467000|0.467000	0.42956|0.42956	TTG|TGA	.	C|1.000;T|0.000		0.383	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
HDAC4	9759	hgsc.bcm.edu	37	2	240158361	240158361	+	Splice_Site	SNP	C	C	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr2:240158361C>G	ENST00000345617.3	-	3	814		c.e3-1			NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GAAAGTCCATCTGGAGAACAG	0.567																																					.		Atlas-SNP	.											.	HDAC4	127	.	0			c.23-1G>C						.						50.0	41.0	44.0					2																	240158361		1912	3610	5522	SO:0001630	splice_region_variant	9759	exon4			GTCCATCTGGAGA	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.23-1G>C	chr2.hg19:g.240158361C>G		144.0	0.0		169.0	86.0	NM_006037	Q9UND6	Splice_Site	SNP	ENST00000345617.3	hg19	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784086	0.49997	.	.	ENSG00000068024	ENST00000345617;ENST00000544989	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.479	0.61324	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HDAC4	239823298	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.795000	0.55499	2.317000	0.78254	0.655000	0.94253	.	.	.		0.567	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	Intron
TRIM71	131405	hgsc.bcm.edu	37	3	32932669	32932669	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr3:32932669G>A	ENST00000383763.5	+	4	2036	c.1973G>A	c.(1972-1974)gGc>gAc	p.G658D		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	658					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CGACCAGCCGGCGTGGCCTGT	0.622																																					p.G658D		Atlas-SNP	.											.	TRIM71	73	.	0			c.G1973A						.						37.0	40.0	39.0					3																	32932669		2085	4204	6289	SO:0001583	missense	131405	exon4			CAGCCGGCGTGGC		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1973G>A	chr3.hg19:g.32932669G>A	ENSP00000373272:p.Gly658Asp	28.0	0.0		51.0	17.0	NM_001039111		Missense_Mutation	SNP	ENST00000383763.5	hg19	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924620	0.73213	.	.	ENSG00000206557	ENST00000383763	T	0.80738	-1.41	5.73	5.73	0.89815	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.89972	0.6870	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88515	0.3092	10	0.36615	T	0.2	-37.7996	18.4419	0.90669	0.0:0.0:1.0:0.0	.	658	Q2Q1W2	LIN41_HUMAN	D	658	ENSP00000373272:G658D	ENSP00000373272:G658D	G	+	2	0	TRIM71	32907673	1.000000	0.71417	0.982000	0.44146	0.875000	0.50365	9.727000	0.98787	2.708000	0.92522	0.650000	0.86243	GGC	.	.		0.622	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	
SLC22A14	9389	hgsc.bcm.edu	37	3	38347895	38347895	+	Silent	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr3:38347895C>T	ENST00000273173.4	+	1	469	c.378C>T	c.(376-378)ggC>ggT	p.G126G	SLC22A14_ENST00000448498.1_Silent_p.G126G|RNU6-235P_ENST00000362644.1_RNA	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	126					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		CACCCAATGGCAGTTTCCTGA	0.527																																					p.G126G		Atlas-SNP	.											.	SLC22A14	64	.	0			c.C378T						.						142.0	127.0	132.0					3																	38347895		2203	4300	6503	SO:0001819	synonymous_variant	9389	exon1			CAATGGCAGTTTC	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.378C>T	chr3.hg19:g.38347895C>T		122.0	0.0		114.0	24.0	NM_004803	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Silent	SNP	ENST00000273173.4	hg19	CCDS2677.1																																																																																			.	.		0.527	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253742.3	NM_004803	
RAD54L2	23132	hgsc.bcm.edu	37	3	51661661	51661661	+	Missense_Mutation	SNP	C	C	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr3:51661661C>G	ENST00000409535.2	+	3	357	c.232C>G	c.(232-234)Cag>Gag	p.Q78E	RAD54L2_ENST00000296477.3_5'Flank	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	78						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		TACCTCATCTCAGTCTGAGCC	0.567																																					p.Q78E		Atlas-SNP	.											.	RAD54L2	94	.	0			c.C232G						.						63.0	59.0	60.0					3																	51661661		692	1591	2283	SO:0001583	missense	23132	exon3			TCATCTCAGTCTG	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.232C>G	chr3.hg19:g.51661661C>G	ENSP00000386520:p.Gln78Glu	93.0	0.0		113.0	34.0	NM_015106	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	hg19	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188590	0.78789	.	.	ENSG00000164080	ENST00000409535	T	0.18960	2.18	6.06	6.06	0.98353	.	.	.	.	.	T	0.13457	0.0326	N	0.14661	0.345	0.80722	D	1	B	0.30193	0.272	B	0.24394	0.053	T	0.16041	-1.0416	9	0.17832	T	0.49	-5.4575	17.7768	0.88511	0.0:1.0:0.0:0.0	.	78	Q9Y4B4	ARIP4_HUMAN	E	78	ENSP00000386520:Q78E	ENSP00000386520:Q78E	Q	+	1	0	RAD54L2	51636701	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.324000	0.59228	2.882000	0.98803	0.655000	0.94253	CAG	.	.		0.567	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
BCHE	590	hgsc.bcm.edu	37	3	165548695	165548695	+	Missense_Mutation	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr3:165548695C>T	ENST00000264381.3	-	2	293	c.127G>A	c.(127-129)Ggg>Agg	p.G43R	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	43					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	AAGTTCATCCCTCTGACTTTT	0.418																																					p.G43R		Atlas-SNP	.											.	BCHE	136	.	0			c.G127A						.						104.0	95.0	98.0					3																	165548695		2203	4300	6503	SO:0001583	missense	590	exon2			TCATCCCTCTGAC	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.127G>A	chr3.hg19:g.165548695C>T	ENSP00000264381:p.Gly43Arg	168.0	0.0		216.0	26.0	NM_000055	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	hg19	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838994	0.51057	.	.	ENSG00000114200	ENST00000264381	D	0.99843	-7.11	5.81	5.81	0.92471	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.99902	0.9953	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96542	0.9401	10	0.72032	D	0.01	.	19.0644	0.93104	0.0:1.0:0.0:0.0	.	43	P06276	CHLE_HUMAN	R	43	ENSP00000264381:G43R	ENSP00000264381:G43R	G	-	1	0	BCHE	167031389	1.000000	0.71417	0.993000	0.49108	0.089000	0.18198	5.627000	0.67784	2.756000	0.94617	0.655000	0.94253	GGG	.	.		0.418	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
HES1	3280	hgsc.bcm.edu	37	3	193854425	193854425	+	Missense_Mutation	SNP	A	A	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr3:193854425A>T	ENST00000232424.3	+	2	364	c.128A>T	c.(127-129)gAg>gTg	p.E43V		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		CCTATTATGGAGAAAAGACGA	0.438																																					p.E43V		Atlas-SNP	.											.	HES1	23	.	0			c.A128T						.						66.0	72.0	70.0					3																	193854425		2203	4300	6503	SO:0001583	missense	3280	exon2			TTATGGAGAAAAG	L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.128A>T	chr3.hg19:g.193854425A>T	ENSP00000232424:p.Glu43Val	137.0	0.0		190.0	87.0	NM_005524	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000232424.3	hg19	CCDS3305.1	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898497	0.72639	.	.	ENSG00000114315	ENST00000232424	D	0.99732	-6.57	5.57	4.41	0.53225	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99809	0.9917	H	0.98133	4.155	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.97110	0.981;1.0	D	0.97424	1.0011	10	0.87932	D	0	-3.8107	10.3317	0.43827	0.9219:0.0:0.078:0.0	.	43;43	B4DU36;Q14469	.;HES1_HUMAN	V	43	ENSP00000232424:E43V	ENSP00000232424:E43V	E	+	2	0	HES1	195337119	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.051000	0.93849	0.946000	0.37632	0.533000	0.62120	GAG	.	.		0.438	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342632.1		
MUC4	4585	hgsc.bcm.edu	37	3	195518119	195518119	+	Missense_Mutation	SNP	A	A	T	rs201789760		TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr3:195518119A>T	ENST00000463781.3	-	2	791	c.332T>A	c.(331-333)aTg>aAg	p.M111K	MUC4_ENST00000475231.1_Missense_Mutation_p.M111K|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	111					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGCTGTCTCCATCACATTGTG	0.463																																					p.M111K		Atlas-SNP	.											.	MUC4	1505	.	0			c.T332A						.						173.0	151.0	158.0					3																	195518119		2001	4135	6136	SO:0001583	missense	4585	exon2			GTCTCCATCACAT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.332T>A	chr3.hg19:g.195518119A>T	ENSP00000417498:p.Met111Lys	128.0	0.0		218.0	26.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	3.439	-0.114540	0.06881	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.32023	1.47;1.47	3.35	-0.681	0.11342	.	2.861300	0.01499	N	0.017426	T	0.13372	0.0324	N	0.08118	0	0.09310	N	1	B	0.27997	0.197	B	0.27500	0.08	T	0.14035	-1.0487	10	0.05959	T	0.93	0.0033	3.9454	0.09346	0.3204:0.1801:0.4995:0.0	.	111	E7ESK3	.	K	111;111;85	ENSP00000417498:M111K;ENSP00000420243:M111K	ENSP00000376209:M85K	M	-	2	0	MUC4	197002514	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.773000	0.01786	-0.150000	0.11195	-1.819000	0.00600	ATG	.	.		0.463	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CDH10	1008	hgsc.bcm.edu	37	5	24487960	24487960	+	Missense_Mutation	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr5:24487960C>T	ENST00000264463.4	-	12	2686	c.2179G>A	c.(2179-2181)Gca>Aca	p.A727T	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	727					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TAGGGGGGTGCGGTGGGGTCA	0.458										HNSCC(23;0.051)																											p.A727T		Atlas-SNP	.											CDH10,NS,carcinoma,0,1	CDH10	391	.	0			c.G2179A						.																																			SO:0001583	missense	1008	exon12			GGGGTGCGGTGGG	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.2179G>A	chr5.hg19:g.24487960C>T	ENSP00000264463:p.Ala727Thr	88.0	0.0		114.0	14.0	NM_006727	Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	hg19	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.657163	0.88154	.	.	ENSG00000040731	ENST00000264463	T	0.78924	-1.22	5.92	5.92	0.95590	Cadherin, cytoplasmic domain (1);	0.089346	0.85682	D	0.000000	D	0.87966	0.6311	M	0.76838	2.35	0.58432	D	0.999997	D	0.76494	0.999	D	0.63793	0.918	D	0.88078	0.2805	10	0.62326	D	0.03	.	19.3088	0.94175	0.0:1.0:0.0:0.0	.	727	Q9Y6N8	CAD10_HUMAN	T	727	ENSP00000264463:A727T	ENSP00000264463:A727T	A	-	1	0	CDH10	24523717	1.000000	0.71417	0.364000	0.25888	0.917000	0.54804	7.702000	0.84576	2.809000	0.96659	0.655000	0.94253	GCA	.	.		0.458	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2	NM_006727	
CRHBP	1393	hgsc.bcm.edu	37	5	76249897	76249897	+	Silent	SNP	C	C	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr5:76249897C>G	ENST00000274368.4	+	3	641	c.219C>G	c.(217-219)acC>acG	p.T73T	CRHBP_ENST00000506501.1_Silent_p.T73T	NM_001882.3	NP_001873.2	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	73					behavioral response to ethanol (GO:0048149)|cellular response to calcium ion (GO:0071277)|cellular response to cAMP (GO:0071320)|cellular response to cocaine (GO:0071314)|cellular response to drug (GO:0035690)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to potassium ion (GO:0035865)|cellular response to stress (GO:0033554)|cellular response to tumor necrosis factor (GO:0071356)|female pregnancy (GO:0007565)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|inflammatory response (GO:0006954)|learning or memory (GO:0007611)|maternal aggressive behavior (GO:0002125)|negative regulation of corticotropin secretion (GO:0051460)|negative regulation of corticotropin-releasing hormone receptor activity (GO:1900011)|regulated secretory pathway (GO:0045055)|regulation of corticotropin secretion (GO:0051459)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|synaptic transmission, dopaminergic (GO:0001963)	axon terminus (GO:0043679)|dendrite (GO:0030425)|dense core granule (GO:0031045)|extracellular space (GO:0005615)|intracellular (GO:0005622)|microtubule (GO:0005874)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|perikaryon (GO:0043204)|secondary lysosome (GO:0005767)|secretory granule (GO:0030141)|varicosity (GO:0043196)	corticotropin-releasing hormone binding (GO:0051424)|peptide binding (GO:0042277)	p.T73T(1)		kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		TCACCTTCACCGCCGACCGGC	0.662																																					p.T73T		Atlas-SNP	.											CRHBP,NS,carcinoma,0,1	CRHBP	46	.	1	Substitution - coding silent(1)	lung(1)	c.C219G						.						53.0	58.0	57.0					5																	76249897		2203	4300	6503	SO:0001819	synonymous_variant	1393	exon3			CTTCACCGCCGAC	X58022	CCDS4034.1	5q	2008-07-18	2001-11-28		ENSG00000145708	ENSG00000145708			2356	protein-coding gene	gene with protein product		122559	"""corticotropin releasing hormone-binding protein"""			8198617	Standard	NM_001882		Approved	CRF-BP, CRFBP	uc003ker.3	P24387	OTTHUMG00000102133	ENST00000274368.4:c.219C>G	chr5.hg19:g.76249897C>G		74.0	0.0		99.0	35.0	NM_001882	Q53F32|Q6FHT5	Silent	SNP	ENST00000274368.4	hg19	CCDS4034.1																																																																																			.	.		0.662	CRHBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219972.2	NM_001882	
LNPEP	4012	hgsc.bcm.edu	37	5	96360250	96360250	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr5:96360250G>A	ENST00000231368.5	+	15	3279	c.2587G>A	c.(2587-2589)Gtg>Atg	p.V863M	LNPEP_ENST00000395770.3_Missense_Mutation_p.V849M	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	863					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CATGACAACTGTGTTCAAAGT	0.403																																					p.V863M		Atlas-SNP	.											.	LNPEP	80	.	0			c.G2587A						.						96.0	90.0	92.0					5																	96360250		2203	4300	6503	SO:0001583	missense	4012	exon15			ACAACTGTGTTCA	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2587G>A	chr5.hg19:g.96360250G>A	ENSP00000231368:p.Val863Met	56.0	0.0		74.0	8.0	NM_005575	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	ENST00000231368.5	hg19	CCDS4087.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945678	0.73672	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.09723	2.95;2.95	5.96	5.96	0.96718	.	0.051645	0.85682	D	0.000000	T	0.31827	0.0809	M	0.74467	2.265	0.58432	D	0.999999	D	0.69078	0.997	D	0.76071	0.987	T	0.01152	-1.1435	10	0.87932	D	0	.	11.6873	0.51494	0.11:0.0:0.89:0.0	.	863	Q9UIQ6	LCAP_HUMAN	M	863;849	ENSP00000231368:V863M;ENSP00000379117:V849M	ENSP00000231368:V863M	V	+	1	0	LNPEP	96386006	1.000000	0.71417	0.998000	0.56505	0.820000	0.46376	5.380000	0.66202	2.832000	0.97577	0.655000	0.94253	GTG	.	.		0.403	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250624.1	NM_005575	
ACSL6	23305	hgsc.bcm.edu	37	5	131298318	131298318	+	Silent	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr5:131298318C>T	ENST00000379240.1	-	18	1845	c.1692G>A	c.(1690-1692)caG>caA	p.Q564Q	ACSL6_ENST00000431707.1_Silent_p.Q544Q|ACSL6_ENST00000379244.1_Silent_p.Q564Q|ACSL6_ENST00000379264.2_Silent_p.Q589Q|ACSL6_ENST00000379272.2_Silent_p.Q579Q|ACSL6_ENST00000543479.1_Silent_p.Q564Q|ACSL6_ENST00000379249.3_Silent_p.Q564Q|ACSL6_ENST00000296869.4_Silent_p.Q589Q|ACSL6_ENST00000379255.1_Silent_p.Q489Q|ACSL6_ENST00000544770.1_Silent_p.Q473Q|AC034228.4_ENST00000446275.1_RNA|ACSL6_ENST00000357096.1_Silent_p.Q489Q|ACSL6_ENST00000379246.1_Silent_p.Q575Q			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	564					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CATATTCTCCCTGAGCAAGTT	0.438																																					p.Q589Q		Atlas-SNP	.											.	ACSL6	169	.	0			c.G1767A						.						98.0	92.0	94.0					5																	131298318		2203	4300	6503	SO:0001819	synonymous_variant	23305	exon18			TTCTCCCTGAGCA	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1692G>A	chr5.hg19:g.131298318C>T		122.0	0.0		155.0	8.0	NM_001009185	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Silent	SNP	ENST00000379240.1	hg19																																																																																				.	.		0.438	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
PCDHA5	56143	hgsc.bcm.edu	37	5	140203515	140203515	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr5:140203515G>A	ENST00000529859.1	+	1	2155	c.2155G>A	c.(2155-2157)Gcg>Acg	p.A719T	PCDHA5_ENST00000378126.3_Missense_Mutation_p.A719T|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.A719T	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	719					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A719T(4)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGTACACCGCGCTGCGGTG	0.667																																					p.A719T		Atlas-SNP	.											PCDHA5_ENST00000529859,NS,carcinoma,0,4	PCDHA5	361	.	4	Substitution - Missense(4)	prostate(4)	c.G2155A						.						53.0	51.0	52.0					5																	140203515		2203	4299	6502	SO:0001583	missense	56143	exon1			TACACCGCGCTGC	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.2155G>A	chr5.hg19:g.140203515G>A	ENSP00000436557:p.Ala719Thr	92.0	0.0		135.0	16.0	NM_018908	O75284|Q8N4R3	Missense_Mutation	SNP	ENST00000529859.1	hg19	CCDS54917.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930880	0.73327	.	.	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.17528	2.27;2.27;2.27	4.17	4.17	0.49024	.	.	.	.	.	T	0.49932	0.1586	M	0.92122	3.275	0.24834	N	0.992508	D;D;D	0.71674	0.994;0.998;0.998	P;P;P	0.62491	0.734;0.903;0.903	T	0.53301	-0.8458	9	0.87932	D	0	.	16.4493	0.83974	0.0:0.0:1.0:0.0	.	719;719;719	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	T	719	ENSP00000433416:A719T;ENSP00000436557:A719T;ENSP00000367366:A719T	ENSP00000367366:A719T	A	+	1	0	PCDHA5	140183699	0.790000	0.28787	0.981000	0.43875	0.381000	0.30169	4.288000	0.59007	2.046000	0.60703	0.491000	0.48974	GCG	.	.		0.667	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372883.2	NM_018908	
COL23A1	91522	hgsc.bcm.edu	37	5	177673419	177673419	+	Silent	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr5:177673419C>A	ENST00000390654.3	-	23	1689	c.1332G>T	c.(1330-1332)tcG>tcT	p.S444S		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	444	Collagen-like 4.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		CTCTCTCACCCGACGCACCCT	0.547																																					p.S444S		Atlas-SNP	.											.	COL23A1	47	.	0			c.G1332T						.						24.0	28.0	27.0					5																	177673419		1985	4167	6152	SO:0001819	synonymous_variant	91522	exon23			CTCACCCGACGCA	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1332G>T	chr5.hg19:g.177673419C>A		60.0	0.0		87.0	35.0	NM_173465	Q8IVR4|Q9NT93	Silent	SNP	ENST00000390654.3	hg19	CCDS4436.1																																																																																			.	.		0.547	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178541106	178541106	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr5:178541106C>A	ENST00000251582.7	-	22	3499	c.3398G>T	c.(3397-3399)cGg>cTg	p.R1133L		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1133					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R1133Q(1)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGGTGATGGCCGCACCTCCAT	0.582																																					p.R1133L		Atlas-SNP	.											ADAMTS2,rectum,carcinoma,0,1	ADAMTS2	190	.	1	Substitution - Missense(1)	large_intestine(1)	c.G3398T						.						177.0	156.0	163.0					5																	178541106		2203	4300	6503	SO:0001583	missense	9509	exon22			GATGGCCGCACCT	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3398G>T	chr5.hg19:g.178541106C>A	ENSP00000251582:p.Arg1133Leu	192.0	0.0		241.0	111.0	NM_014244		Missense_Mutation	SNP	ENST00000251582.7	hg19	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	0.554	-0.847963	0.02651	.	.	ENSG00000087116	ENST00000251582	T	0.58940	0.3	5.05	-0.641	0.11490	.	0.828579	0.10123	N	0.713134	T	0.27832	0.0685	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16808	-1.0390	10	0.15066	T	0.55	.	2.372	0.04333	0.1227:0.2188:0.4194:0.239	.	1133	O95450	ATS2_HUMAN	L	1133	ENSP00000251582:R1133L	ENSP00000251582:R1133L	R	-	2	0	ADAMTS2	178473712	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.844000	0.04345	-0.046000	0.13446	-1.762000	0.00668	CGG	.	.		0.582	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
SRPK1	6732	hgsc.bcm.edu	37	6	35806150	35806150	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr6:35806150C>A	ENST00000373825.2	-	15	2032	c.1747G>T	c.(1747-1749)Gca>Tca	p.A583S	SRPK1_ENST00000373822.1_Intron|SRPK1_ENST00000423325.2_Missense_Mutation_p.A567S					SRSF protein kinase 1											endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						TATTTTCCTGCCACAATGAGC	0.388																																					p.A583S	NSCLC(31;67 978 16289 24856 26454)	Atlas-SNP	.											.	SRPK1	61	.	0			c.G1747T						.						34.0	35.0	35.0					6																	35806150		1833	4101	5934	SO:0001583	missense	6732	exon15			TTCCTGCCACAAT	U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1747G>T	chr6.hg19:g.35806150C>A	ENSP00000362931:p.Ala583Ser	64.0	0.0		98.0	38.0	NM_003137		Missense_Mutation	SNP	ENST00000373825.2	hg19	CCDS47415.1	.	.	.	.	.	.	.	.	.	.	C	6.790	0.514683	0.12944	.	.	ENSG00000096063	ENST00000373825;ENST00000361690;ENST00000423325	T;T;T	0.64618	-0.11;-0.11;-0.11	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.27832	0.0685	N	0.01188	-0.97	0.80722	D	1	B;B	0.32051	0.001;0.354	B;P	0.44897	0.018;0.463	T	0.47711	-0.9096	9	0.02654	T	1	-13.5964	20.5827	0.99408	0.0:1.0:0.0:0.0	.	567;583	B4DS61;Q96SB4	.;SRPK1_HUMAN	S	583;599;567	ENSP00000362931:A583S;ENSP00000354674:A599S;ENSP00000391069:A567S	ENSP00000354674:A599S	A	-	1	0	SRPK1	35914128	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.707000	0.47143	2.941000	0.99782	0.655000	0.94253	GCA	.	.		0.388	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040319.3	NM_003137	
MAPK14	1432	hgsc.bcm.edu	37	6	36075327	36075327	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr6:36075327G>A	ENST00000229794.4	+	11	1325	c.937G>A	c.(937-939)Gat>Aat	p.D313N	MAPK14_ENST00000310795.4_Silent_p.T286T|MAPK14_ENST00000229795.3_Missense_Mutation_p.D313N|MAPK14_ENST00000468133.1_Missense_Mutation_p.D236N	NM_139012.2|NM_139014.2	NP_620581.1|NP_620583.1	Q16539	MK14_HUMAN	mitogen-activated protein kinase 14	313					3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cartilage condensation (GO:0001502)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to ionizing radiation (GO:0071479)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|chemotaxis (GO:0006935)|chondrocyte differentiation (GO:0002062)|DNA damage checkpoint (GO:0000077)|fatty acid oxidation (GO:0019395)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoclast differentiation (GO:0030316)|p38MAPK cascade (GO:0038066)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myoblast fusion (GO:1901741)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to muramyl dipeptide (GO:0032495)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|signal transduction in response to DNA damage (GO:0042770)|skeletal muscle tissue development (GO:0007519)|stress-activated MAPK cascade (GO:0051403)|stress-induced premature senescence (GO:0090400)|striated muscle cell differentiation (GO:0051146)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|MAP kinase kinase activity (GO:0004708)|NFAT protein binding (GO:0051525)|protein serine/threonine kinase activity (GO:0004674)	p.D313N(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|stomach(1)	16						TCAGTACCACGATCCTGATGA	0.468																																					p.D313N	Pancreas(20;8 363 26997 32430 36377 43317 49243 50560 51947)|Colon(176;951 1093 20177 30266 32328 34418 35271 44052 51610)	Atlas-SNP	.											MAPK14_ENST00000229794,NS,carcinoma,0,3	MAPK14	75	.	1	Substitution - Missense(1)	large_intestine(1)	c.G937A						.						147.0	133.0	138.0					6																	36075327		2203	4300	6503	SO:0001583	missense	1432	exon11			TACCACGATCCTG	L35263	CCDS4815.1, CCDS4816.1, CCDS4817.1	6p21.3-p21.2	2011-06-09			ENSG00000112062	ENSG00000112062		"""Mitogen-activated protein kinase cascade / Kinases"""	6876	protein-coding gene	gene with protein product	"""p38 MAP kinase"""	600289		CSPB1, CSBP1, CSBP2		7997261	Standard	NM_139012		Approved	PRKM14, p38, Mxi2, PRKM15	uc003olq.3	Q16539	OTTHUMG00000159806	ENST00000229794.4:c.937G>A	chr6.hg19:g.36075327G>A	ENSP00000229794:p.Asp313Asn	80.0	0.0		128.0	50.0	NM_139012	A6ZJ92|A8K6P4|B0LPH0|B5TY32|O60776|Q13083|Q14084|Q8TDX0	Missense_Mutation	SNP	ENST00000229794.4	hg19	CCDS4816.1	.	.	.	.	.	.	.	.	.	.	G	36	5.785652	0.96937	.	.	ENSG00000112062	ENST00000229795;ENST00000229794;ENST00000468133	T;T;T	0.13778	2.56;2.56;2.56	5.96	5.96	0.96718	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.35770	0.0943	.	.	.	0.80722	D	1	D;P	0.89917	1.0;0.89	D;B	0.91635	0.999;0.374	T	0.09037	-1.0693	9	0.87932	D	0	-10.6888	20.4192	0.99033	0.0:0.0:1.0:0.0	.	313;313	Q16539;Q16539-2	MK14_HUMAN;.	N	313;313;236	ENSP00000229795:D313N;ENSP00000229794:D313N;ENSP00000419837:D236N	ENSP00000229794:D313N	D	+	1	0	MAPK14	36183305	1.000000	0.71417	0.943000	0.38184	0.992000	0.81027	9.869000	0.99810	2.831000	0.97527	0.650000	0.86243	GAT	.	.		0.468	MAPK14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000357450.1	NM_001315	
MACC1	346389	hgsc.bcm.edu	37	7	20198542	20198542	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:20198542T>C	ENST00000400331.5	-	5	1750	c.1442A>G	c.(1441-1443)cAc>cGc	p.H481R	MACC1_ENST00000589011.1_Missense_Mutation_p.H481R|MACC1_ENST00000332878.4_Missense_Mutation_p.H481R	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	481					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						ATCAAACAAGTGCATCTCTCT	0.393																																					p.H481R		Atlas-SNP	.											.	MACC1	99	.	0			c.A1442G						.						79.0	72.0	75.0					7																	20198542		2203	4300	6503	SO:0001583	missense	346389	exon5			AACAAGTGCATCT		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.1442A>G	chr7.hg19:g.20198542T>C	ENSP00000383185:p.His481Arg	98.0	0.0		121.0	54.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	hg19	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	T	7.275	0.608017	0.14002	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.09538	2.97;2.97	5.84	5.84	0.93424	.	0.204155	0.48767	D	0.000173	T	0.11707	0.0285	M	0.72118	2.19	0.32648	N	0.519819	P	0.44734	0.842	B	0.39531	0.302	T	0.04178	-1.0971	10	0.06494	T	0.89	-13.3536	10.5348	0.44998	0.0:0.0719:0.0:0.9281	.	481	Q6ZN28	MACC1_HUMAN	R	481	ENSP00000383185:H481R;ENSP00000328410:H481R	ENSP00000328410:H481R	H	-	2	0	MACC1	20165067	1.000000	0.71417	1.000000	0.80357	0.012000	0.07955	2.127000	0.42035	2.226000	0.72624	0.482000	0.46254	CAC	.	.		0.393	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
ABCA13	154664	hgsc.bcm.edu	37	7	48319312	48319312	+	Missense_Mutation	SNP	A	A	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:48319312A>G	ENST00000435803.1	+	18	8545	c.8521A>G	c.(8521-8523)Aca>Gca	p.T2841A		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2841					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GATAACTTCCACAAGAACTTT	0.353																																					p.T2841A		Atlas-SNP	.											.	ABCA13	1192	.	0			c.A8521G						.						92.0	95.0	94.0					7																	48319312		1817	4077	5894	SO:0001583	missense	154664	exon18			ACTTCCACAAGAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8521A>G	chr7.hg19:g.48319312A>G	ENSP00000411096:p.Thr2841Ala	112.0	0.0		154.0	57.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	A	10.64	1.407867	0.25378	.	.	ENSG00000179869	ENST00000435803	T	0.53423	0.62	5.4	-1.31	0.09230	.	0.639625	0.13996	N	0.348493	T	0.23965	0.0580	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09751	-1.0660	10	0.38643	T	0.18	.	4.4728	0.11720	0.4836:0.0:0.3664:0.15	.	2841	Q86UQ4	ABCAD_HUMAN	A	2841	ENSP00000411096:T2841A	ENSP00000411096:T2841A	T	+	1	0	ABCA13	48289858	0.000000	0.05858	0.000000	0.03702	0.124000	0.20399	-1.328000	0.02680	-0.490000	0.06707	-0.280000	0.10049	ACA	.	.		0.353	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
AUTS2	26053	hgsc.bcm.edu	37	7	69583171	69583171	+	Silent	SNP	A	A	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:69583171A>T	ENST00000342771.4	+	3	897	c.576A>T	c.(574-576)ggA>ggT	p.G192G	AUTS2_ENST00000403018.2_Silent_p.G192G|AUTS2_ENST00000406775.2_Silent_p.G192G	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	192										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GTGCCAGTGGAGAATCCAAGG	0.418																																					p.G192G		Atlas-SNP	.											.	AUTS2	173	.	0			c.A576T						.						57.0	60.0	59.0					7																	69583171		2203	4300	6503	SO:0001819	synonymous_variant	26053	exon3			CAGTGGAGAATCC	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.576A>T	chr7.hg19:g.69583171A>T		158.0	0.0		194.0	62.0	NM_001127231	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	ENST00000342771.4	hg19	CCDS5539.1																																																																																			.	.		0.418	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
MLXIPL	51085	hgsc.bcm.edu	37	7	73009991	73009991	+	Silent	SNP	C	C	A	rs370481859		TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:73009991C>A	ENST00000313375.3	-	15	2333	c.2286G>T	c.(2284-2286)acG>acT	p.T762T	MLXIPL_ENST00000414749.2_Silent_p.T760T|MLXIPL_ENST00000434326.1_Silent_p.T668T|MLXIPL_ENST00000354613.1_Silent_p.T741T|MLXIPL_ENST00000429400.2_Silent_p.T743T|MLXIPL_ENST00000395189.1_Silent_p.T669T	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	762					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				AGTTGTGCAGCGTACGGGTTC	0.622																																					p.T762T		Atlas-SNP	.											.	MLXIPL	54	.	0			c.G2286T						.						124.0	113.0	117.0					7																	73009991		2203	4300	6503	SO:0001819	synonymous_variant	51085	exon15			GTGCAGCGTACGG	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.2286G>T	chr7.hg19:g.73009991C>A		90.0	0.0		126.0	50.0	NM_032951	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	Silent	SNP	ENST00000313375.3	hg19	CCDS5553.1																																																																																			.	.		0.622	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
SEMA3A	10371	hgsc.bcm.edu	37	7	83606504	83606504	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:83606504C>A	ENST00000265362.4	-	15	1975	c.1661G>T	c.(1660-1662)aGa>aTa	p.R554I	SEMA3A_ENST00000436949.1_Missense_Mutation_p.R554I	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	554					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						ATCTTGTCGTCTTGTGCGTCT	0.343																																					p.R554I		Atlas-SNP	.											SEMA3A,colon,carcinoma,0,1	SEMA3A	121	.	0			c.G1661T						.						239.0	211.0	220.0					7																	83606504		2203	4300	6503	SO:0001583	missense	10371	exon15			TGTCGTCTTGTGC	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1661G>T	chr7.hg19:g.83606504C>A	ENSP00000265362:p.Arg554Ile	324.0	0.0		345.0	133.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	hg19	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281947	0.80692	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.21734	1.99;1.99	5.01	4.13	0.48395	.	0.043132	0.85682	D	0.000000	T	0.36552	0.0971	M	0.79693	2.465	0.80722	D	1	D	0.56035	0.974	P	0.51701	0.677	T	0.24225	-1.0166	10	0.29301	T	0.29	.	13.1439	0.59450	0.0:0.9217:0.0:0.0783	.	554	Q14563	SEM3A_HUMAN	I	554	ENSP00000265362:R554I;ENSP00000415260:R554I	ENSP00000265362:R554I	R	-	2	0	SEMA3A	83444440	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.618000	0.83043	1.110000	0.41699	0.585000	0.79938	AGA	.	.		0.343	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
ZNF804B	219578	hgsc.bcm.edu	37	7	88847522	88847522	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:88847522C>A	ENST00000333190.4	+	2	771	c.162C>A	c.(160-162)aaC>aaA	p.N54K		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	54							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TAAAGGCAAACTTTTACTGTG	0.363										HNSCC(36;0.09)																											p.N54K		Atlas-SNP	.											.	ZNF804B	322	.	0			c.C162A						.						96.0	93.0	94.0					7																	88847522		2203	4300	6503	SO:0001583	missense	219578	exon2			GGCAAACTTTTAC	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.162C>A	chr7.hg19:g.88847522C>A	ENSP00000329638:p.Asn54Lys	83.0	0.0		114.0	41.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	hg19	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.474955	0.63737	.	.	ENSG00000182348	ENST00000333190	T	0.06218	3.33	5.31	3.5	0.40072	.	0.071450	0.52532	D	0.000075	T	0.17746	0.0426	L	0.54323	1.7	0.44175	D	0.996989	D	0.89917	1.0	D	0.97110	1.0	T	0.00247	-1.1881	10	0.87932	D	0	-14.9041	9.3807	0.38311	0.0:0.7805:0.0:0.2195	.	54	A4D1E1	Z804B_HUMAN	K	54	ENSP00000329638:N54K	ENSP00000329638:N54K	N	+	3	2	ZNF804B	88685458	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.539000	0.36104	0.808000	0.34231	0.484000	0.47621	AAC	.	.		0.363	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ATXN7L1	222255	hgsc.bcm.edu	37	7	105248313	105248313	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:105248313T>C	ENST00000419735.3	-	12	2617	c.2572A>G	c.(2572-2574)Agg>Ggg	p.R858G	ATXN7L1_ENST00000477775.1_Missense_Mutation_p.R735G	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1	858										endometrium(1)|large_intestine(4)|lung(5)	10						GGAAGAGTCCTTATCCTGCCC	0.468																																					p.R858G		Atlas-SNP	.											.	ATXN7L1	56	.	0			c.A2572G						.						340.0	281.0	299.0					7																	105248313		692	1591	2283	SO:0001583	missense	222255	exon12			GAGTCCTTATCCT	AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.2572A>G	chr7.hg19:g.105248313T>C	ENSP00000410759:p.Arg858Gly	150.0	0.0		220.0	73.0	NM_020725	A4D0Q2|B4DTS1|Q8N2T0	Missense_Mutation	SNP	ENST00000419735.3	hg19	CCDS47682.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.200656	0.79015	.	.	ENSG00000146776	ENST00000419735;ENST00000477775	T;T	0.19250	2.19;2.16	5.69	5.69	0.88448	.	0.864252	0.10138	N	0.711273	T	0.34716	0.0907	N	0.19112	0.55	0.80722	D	1	D;D	0.67145	0.996;0.981	D;D	0.77557	0.99;0.966	T	0.08452	-1.0721	10	0.87932	D	0	.	14.5238	0.67873	0.0:0.0:0.0:1.0	.	735;858	Q9ULK2-3;Q9ULK2	.;AT7L1_HUMAN	G	858;735	ENSP00000410759:R858G;ENSP00000418476:R735G	ENSP00000410759:R858G	R	-	1	2	ATXN7L1	105035549	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.952000	0.40343	2.173000	0.68751	0.533000	0.62120	AGG	.	.		0.468	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349037.2		
LAMB4	22798	hgsc.bcm.edu	37	7	107704317	107704317	+	Missense_Mutation	SNP	A	A	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:107704317A>G	ENST00000388781.3	-	22	3033	c.2950T>C	c.(2950-2952)Tgc>Cgc	p.C984R	LAMB4_ENST00000205386.4_Missense_Mutation_p.C984R|LAMB4_ENST00000388780.3_Missense_Mutation_p.C984R	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	984	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ACCCGGCTGCAGGACTCTGGA	0.502																																					p.C984R		Atlas-SNP	.											.	LAMB4	253	.	0			c.T2950C						.						175.0	160.0	165.0					7																	107704317		2203	4300	6503	SO:0001583	missense	22798	exon22			GGCTGCAGGACTC	AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.2950T>C	chr7.hg19:g.107704317A>G	ENSP00000373433:p.Cys984Arg	183.0	0.0		242.0	92.0	NM_007356	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	ENST00000388781.3	hg19	CCDS34732.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.963016	0.74016	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	D;D;D;D	0.94330	-3.4;-3.4;-3.4;-3.4	5.11	3.97	0.46021	EGF-like, laminin (3);	0.000000	0.56097	D	0.000029	D	0.97420	0.9156	H	0.96208	3.785	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.97292	0.9925	10	0.87932	D	0	.	10.6398	0.45586	0.9251:0.0:0.0748:0.0	.	984	A4D0S4	LAMB4_HUMAN	R	984;984;10;984	ENSP00000205386:C984R;ENSP00000373433:C984R;ENSP00000416562:C10R;ENSP00000373432:C984R	ENSP00000205386:C984R	C	-	1	0	LAMB4	107491553	1.000000	0.71417	0.958000	0.39756	0.963000	0.63663	5.600000	0.67599	0.979000	0.38497	0.460000	0.39030	TGC	.	.		0.502	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337442.1	XM_209857	
ARF5	381	hgsc.bcm.edu	37	7	127230141	127230141	+	Missense_Mutation	SNP	A	A	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:127230141A>G	ENST00000000233.5	+	4	434	c.280A>G	c.(280-282)Agt>Ggt	p.S94G	GCC1_ENST00000497650.1_Intron	NM_001662.3	NP_001653.1	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	94					GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			cervix(2)|kidney(1)|lung(10)|ovary(1)	14						TGTGGTGGACAGTAATGACCG	0.542																																					p.S94G		Atlas-SNP	.											.	ARF5	20	.	0			c.A280G						.						116.0	123.0	121.0					7																	127230141		2203	4300	6503	SO:0001583	missense	381	exon4			GTGGACAGTAATG		CCDS34745.1	7q31.3	2008-07-18			ENSG00000004059	ENSG00000004059		"""ADP-ribosylation factors"""	658	protein-coding gene	gene with protein product		103188				1993656	Standard	NM_001662		Approved		uc003vmb.2	P84085	OTTHUMG00000023246	ENST00000000233.5:c.280A>G	chr7.hg19:g.127230141A>G	ENSP00000000233:p.Ser94Gly	33.0	0.0		48.0	17.0	NM_001662	P26437	Missense_Mutation	SNP	ENST00000000233.5	hg19	CCDS34745.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.828541	0.90955	.	.	ENSG00000004059	ENST00000000233;ENST00000415666	T;T	0.69306	-0.39;-0.39	5.31	5.31	0.75309	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.86986	0.6065	H	0.98238	4.18	0.58432	D	0.999996	D	0.76494	0.999	P	0.62740	0.906	D	0.91390	0.5134	10	0.87932	D	0	-11.4494	13.2158	0.59859	1.0:0.0:0.0:0.0	.	94	P84085	ARF5_HUMAN	G	94	ENSP00000000233:S94G;ENSP00000412701:S94G	ENSP00000000233:S94G	S	+	1	0	ARF5	127017377	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.222000	0.95196	2.012000	0.59069	0.397000	0.26171	AGT	.	.		0.542	ARF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059567.2	NM_001662	
PIP	5304	hgsc.bcm.edu	37	7	142836665	142836665	+	Missense_Mutation	SNP	C	C	T	rs148216903	byFrequency	TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:142836665C>T	ENST00000291009.3	+	4	411	c.371C>T	c.(370-372)cCt>cTt	p.P124L		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	124					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		GGCATCTGCCCTGATGATGCT	0.468																																					p.P124L		Atlas-SNP	.											.	PIP	34	.	0			c.C371T						.						174.0	168.0	170.0					7																	142836665		2203	4299	6502	SO:0001583	missense	5304	exon4			TCTGCCCTGATGA		CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.371C>T	chr7.hg19:g.142836665C>T	ENSP00000291009:p.Pro124Leu	158.0	0.0		240.0	18.0	NM_002652	A0A963|A0A9C3|A0A9F3|A4D2I1	Missense_Mutation	SNP	ENST00000291009.3	hg19	CCDS34768.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847859	0.51164	.	.	ENSG00000159763	ENST00000291009	T	0.16196	2.36	4.63	4.63	0.57726	.	0.000000	0.44688	D	0.000436	T	0.40272	0.1110	M	0.71581	2.175	0.48975	D	0.999735	D	0.89917	1.0	D	0.78314	0.991	T	0.26018	-1.0115	10	0.87932	D	0	.	13.7047	0.62631	0.0:1.0:0.0:0.0	.	124	P12273	PIP_HUMAN	L	124	ENSP00000291009:P124L	ENSP00000291009:P124L	P	+	2	0	PIP	142546787	0.765000	0.28485	0.935000	0.37517	0.088000	0.18126	1.912000	0.39946	2.474000	0.83562	0.655000	0.94253	CCT	.	C|0.997;G|0.003		0.468	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327089.1	NM_002652	
SLC24A2	25769	hgsc.bcm.edu	37	9	19576992	19576992	+	Silent	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr9:19576992G>T	ENST00000341998.2	-	5	1219	c.1158C>A	c.(1156-1158)ctC>ctA	p.L386L	SLC24A2_ENST00000286344.3_Silent_p.L369L	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	386					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CGATCTTGTGGAGAATTGAAG	0.502																																					p.L386L		Atlas-SNP	.											.	SLC24A2	93	.	0			c.C1158A						.						194.0	166.0	175.0					9																	19576992		2203	4300	6503	SO:0001819	synonymous_variant	25769	exon5			CTTGTGGAGAATT	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.1158C>A	chr9.hg19:g.19576992G>T		118.0	0.0		104.0	64.0	NM_020344	B7ZLL8|Q9NTN5|Q9NZQ4	Silent	SNP	ENST00000341998.2	hg19	CCDS6493.1																																																																																			.	.		0.502	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
OR13A1	79290	hgsc.bcm.edu	37	10	45799382	45799382	+	Silent	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr10:45799382G>T	ENST00000553795.1	-	4	797	c.489C>A	c.(487-489)gcC>gcA	p.A163A	OR13A1_ENST00000374401.2_Silent_p.A163A|OR13A1_ENST00000536058.1_Silent_p.A163A	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	163						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						ACACGGCTGTGGCCAGCCCGC	0.592																																					p.A163A		Atlas-SNP	.											.	OR13A1	49	.	0			c.C489A						.						33.0	34.0	34.0					10																	45799382		2193	4274	6467	SO:0001819	synonymous_variant	79290	exon4			GGCTGTGGCCAGC	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.489C>A	chr10.hg19:g.45799382G>T		37.0	0.0		57.0	15.0	NM_001004297	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Silent	SNP	ENST00000553795.1	hg19	CCDS31188.1																																																																																			.	.		0.592	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047779.2	NM_001004297	
C10orf71	118461	hgsc.bcm.edu	37	10	50530973	50530973	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr10:50530973T>C	ENST00000374144.3	+	3	671	c.383T>C	c.(382-384)gTg>gCg	p.V128A	C10orf71_ENST00000323868.4_Missense_Mutation_p.V128A			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	128										endometrium(1)	1						AGACTGGAGGTGCCAGTTTCC	0.542																																					p.V128A		Atlas-SNP	.											.	C10orf71	179	.	0			c.T383C						.						82.0	96.0	91.0					10																	50530973		1941	4135	6076	SO:0001583	missense	118461	exon3			TGGAGGTGCCAGT	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.383T>C	chr10.hg19:g.50530973T>C	ENSP00000363259:p.Val128Ala	54.0	0.0		89.0	36.0	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	hg19	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451858	0.63290	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.19532	2.14;3.27	5.12	5.12	0.69794	.	0.355426	0.20380	N	0.093469	T	0.19685	0.0473	L	0.52364	1.645	0.32662	N	0.517892	B	0.32753	0.383	B	0.29716	0.106	T	0.28364	-1.0046	10	0.72032	D	0.01	.	9.4587	0.38772	0.0:0.0797:0.0:0.9203	.	128	Q711Q0-3	.	A	128	ENSP00000318713:V128A;ENSP00000363259:V128A	ENSP00000318713:V128A	V	+	2	0	C10orf71	50200979	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.702000	0.54800	1.936000	0.56123	0.379000	0.24179	GTG	.	.		0.542	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
C10orf76	79591	hgsc.bcm.edu	37	10	103783452	103783452	+	Missense_Mutation	SNP	T	T	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr10:103783452T>A	ENST00000370033.4	-	7	681	c.562A>T	c.(562-564)Ata>Tta	p.I188L		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	188						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		GCTTCAAATATGCTGTTGATC	0.393																																					p.I188L		Atlas-SNP	.											.	C10orf76	48	.	0			c.A562T						.						232.0	213.0	219.0					10																	103783452		1868	4119	5987	SO:0001583	missense	79591	exon7			CAAATATGCTGTT	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.562A>T	chr10.hg19:g.103783452T>A	ENSP00000359050:p.Ile188Leu	159.0	0.0		207.0	52.0	NM_024541	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	hg19	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	T	14.78	2.636807	0.47049	.	.	ENSG00000120029	ENST00000370033	T	0.63580	-0.05	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.50377	0.1612	L	0.40543	1.245	0.80722	D	1	B	0.23540	0.087	B	0.23716	0.048	T	0.47971	-0.9075	10	0.05351	T	0.99	-17.6356	15.6377	0.76966	0.0:0.0:0.0:1.0	.	188	Q5T2E6	CJ076_HUMAN	L	188	ENSP00000359050:I188L	ENSP00000359050:I188L	I	-	1	0	C10orf76	103773442	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.663000	0.83820	2.101000	0.63845	0.460000	0.39030	ATA	.	.		0.393	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
OR5L2	26338	hgsc.bcm.edu	37	11	55594866	55594866	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr11:55594866C>A	ENST00000378397.1	+	1	172	c.172C>A	c.(172-174)Ccc>Acc	p.P58T		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	58						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				GCTCCACACCCCCGTGTACTT	0.468										HNSCC(27;0.073)																											p.P58T		Atlas-SNP	.											.	OR5L2	135	.	0			c.C172A						.						254.0	233.0	240.0					11																	55594866		2200	4296	6496	SO:0001583	missense	26338	exon1			CACACCCCCGTGT	AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.172C>A	chr11.hg19:g.55594866C>A	ENSP00000367650:p.Pro58Thr	252.0	0.0		269.0	109.0	NM_001004739	Q6IF66|Q96RB2	Missense_Mutation	SNP	ENST00000378397.1	hg19	CCDS31511.1	.	.	.	.	.	.	.	.	.	.	.	13.55	2.271855	0.40194	.	.	ENSG00000205030	ENST00000378397	T	0.02032	4.49	5.31	4.4	0.53042	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000172	T	0.21509	0.0518	H	0.97707	4.06	0.43435	D	0.995608	D	0.89917	1.0	D	0.97110	1.0	T	0.31336	-0.9947	10	0.72032	D	0.01	-36.8392	13.1571	0.59524	0.0:0.9219:0.0:0.0781	.	58	Q8NGL0	OR5L2_HUMAN	T	58	ENSP00000367650:P58T	ENSP00000367650:P58T	P	+	1	0	OR5L2	55351442	1.000000	0.71417	0.940000	0.37924	0.055000	0.15305	5.604000	0.67626	1.421000	0.47157	-0.169000	0.13324	CCC	.	.		0.468	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391516.1	NM_001004739	
LRRC55	219527	hgsc.bcm.edu	37	11	56949612	56949612	+	Missense_Mutation	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr11:56949612C>T	ENST00000497933.1	+	1	392	c.245C>T	c.(244-246)cCc>cTc	p.P82L		NM_001005210.2	NP_001005210.1	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	52					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|skin(2)	25						ACCAGCTGCCCCGTCCTTTGC	0.647																																					p.P82L		Atlas-SNP	.											.	LRRC55	52	.	0			c.C245T						.						49.0	52.0	51.0					11																	56949612		2201	4296	6497	SO:0001583	missense	219527	exon1			GCTGCCCCGTCCT		CCDS31539.1	11q12.1	2008-02-05			ENSG00000183908	ENSG00000183908			32324	protein-coding gene	gene with protein product		615213					Standard	NM_001005210		Approved	FLJ45686	uc001njl.2	Q6ZSA7	OTTHUMG00000159309	ENST00000497933.1:c.245C>T	chr11.hg19:g.56949612C>T	ENSP00000419542:p.Pro82Leu	60.0	0.0		90.0	36.0	NM_001005210	A7E2U7|B2RN81	Missense_Mutation	SNP	ENST00000497933.1	hg19	CCDS31539.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709813	0.89018	.	.	ENSG00000183908	ENST00000497933	D	0.98044	-4.68	5.8	5.8	0.92144	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.64402	D	0.000013	D	0.98982	0.9653	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99620	1.0983	10	0.87932	D	0	.	16.9798	0.86324	0.0:1.0:0.0:0.0	.	52	Q6ZSA7	LRC55_HUMAN	L	82	ENSP00000419542:P82L	ENSP00000419542:P82L	P	+	2	0	LRRC55	56706188	1.000000	0.71417	0.953000	0.39169	0.828000	0.46876	6.640000	0.74319	2.735000	0.93741	0.655000	0.94253	CCC	.	.		0.647	LRRC55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354503.2	NM_001005210	
SPTBN2	6712	hgsc.bcm.edu	37	11	66475653	66475653	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr11:66475653G>A	ENST00000533211.1	-	12	1640	c.1309C>T	c.(1309-1311)Cgg>Tgg	p.R437W	SPTBN2_ENST00000529997.1_Missense_Mutation_p.R437W|SPTBN2_ENST00000309996.2_Missense_Mutation_p.R437W			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	437					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CAGGTCTCCCGCATGGCAGCC	0.657																																					p.R437W		Atlas-SNP	.											.	SPTBN2	188	.	0			c.C1309T						.						42.0	44.0	43.0					11																	66475653		2200	4294	6494	SO:0001583	missense	6712	exon11			TCTCCCGCATGGC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1309C>T	chr11.hg19:g.66475653G>A	ENSP00000432568:p.Arg437Trp	103.0	0.0		146.0	34.0	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	hg19	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.786587	0.70337	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262	T;T;T	0.50277	0.75;0.75;0.75	4.62	4.62	0.57501	.	0.000000	0.64402	D	0.000001	T	0.74321	0.3701	M	0.94021	3.485	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.80400	-0.1398	10	0.72032	D	0.01	.	11.6095	0.51052	0.0:0.0:0.8219:0.1781	.	437	O15020	SPTN2_HUMAN	W	437	ENSP00000432568:R437W;ENSP00000311489:R437W;ENSP00000433593:R437W	ENSP00000311489:R437W	R	-	1	2	SPTBN2	66232229	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	0.636000	0.24644	2.388000	0.81334	0.561000	0.74099	CGG	.	.		0.657	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
MMP13	4322	hgsc.bcm.edu	37	11	102816423	102816423	+	Missense_Mutation	SNP	C	C	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr11:102816423C>G	ENST00000260302.3	-	9	1295	c.1267G>C	c.(1267-1269)Gac>Cac	p.D423H	MMP13_ENST00000340273.4_Missense_Mutation_p.D423H	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	423	Interaction with collagen.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	CCTGGGAAGTCTTCTTCTATT	0.333																																					p.D423H		Atlas-SNP	.											.	MMP13	75	.	0			c.G1267C						.						144.0	149.0	147.0					11																	102816423		2202	4298	6500	SO:0001583	missense	4322	exon9			GGAAGTCTTCTTC	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.1267G>C	chr11.hg19:g.102816423C>G	ENSP00000260302:p.Asp423His	67.0	0.0		76.0	23.0	NM_002427	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	hg19	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363525	0.41902	.	.	ENSG00000137745	ENST00000260302;ENST00000340273	T;T	0.02606	4.23;4.23	6.16	6.16	0.99307	Hemopexin/matrixin (2);	0.317736	0.38326	N	0.001726	T	0.12518	0.0304	M	0.64404	1.975	0.20926	N	0.999828	P	0.37015	0.578	P	0.51297	0.665	T	0.00449	-1.1732	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	423	P45452	MMP13_HUMAN	H	423	ENSP00000260302:D423H;ENSP00000339672:D423H	ENSP00000260302:D423H	D	-	1	0	MMP13	102321633	0.015000	0.18098	0.417000	0.26559	0.020000	0.10135	1.824000	0.39072	2.937000	0.99478	0.650000	0.86243	GAC	.	.		0.333	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	
MMP13	4322	hgsc.bcm.edu	37	11	102816459	102816459	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr11:102816459T>C	ENST00000260302.3	-	9	1259	c.1231A>G	c.(1231-1233)Att>Gtt	p.I411V	MMP13_ENST00000340273.4_Missense_Mutation_p.I411V	NM_002427.3	NP_002418.1	P45452	MMP13_HUMAN	matrix metallopeptidase 13 (collagenase 3)	411	Interaction with collagen.				bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|skin(1)|stomach(1)	27		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0144)	Marimastat(DB00786)	TTATCCATAATATGGTTAGTA	0.299																																					p.I411V		Atlas-SNP	.											.	MMP13	75	.	0			c.A1231G						.						108.0	110.0	109.0					11																	102816459		2202	4298	6500	SO:0001583	missense	4322	exon9			CCATAATATGGTT	X75308	CCDS8324.1	11q22.3	2014-01-30	2005-08-08		ENSG00000137745	ENSG00000137745		"""Endogenous ligands"""	7159	protein-coding gene	gene with protein product	"""collagenase 3"""	600108	"""matrix metalloproteinase 13 (collagenase 3)"""			8207000	Standard	NM_002427		Approved	CLG3	uc001phl.3	P45452	OTTHUMG00000165850	ENST00000260302.3:c.1231A>G	chr11.hg19:g.102816459T>C	ENSP00000260302:p.Ile411Val	61.0	0.0		74.0	23.0	NM_002427	A8K846|B2RCZ3|Q6NWN6	Missense_Mutation	SNP	ENST00000260302.3	hg19	CCDS8324.1	.	.	.	.	.	.	.	.	.	.	T	7.504	0.653329	0.14580	.	.	ENSG00000137745	ENST00000260302;ENST00000340273	T;T	0.02301	4.35;4.35	6.16	-3.26	0.05064	Hemopexin/matrixin (2);	1.456600	0.03973	N	0.291993	T	0.00998	0.0033	N	0.01284	-0.91	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48885	-0.8995	10	0.10111	T	0.7	.	10.1171	0.42598	0.0:0.4868:0.1092:0.404	.	411	P45452	MMP13_HUMAN	V	411	ENSP00000260302:I411V;ENSP00000339672:I411V	ENSP00000260302:I411V	I	-	1	0	MMP13	102321669	0.000000	0.05858	0.000000	0.03702	0.764000	0.43329	-0.550000	0.06034	-0.894000	0.03925	-0.256000	0.11100	ATT	.	.		0.299	MMP13-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386648.1	NM_002427	
NTF3	4908	hgsc.bcm.edu	37	12	5604082	5604082	+	Silent	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:5604082C>T	ENST00000331010.6	+	1	785	c.702C>T	c.(700-702)ctC>ctT	p.L234L	NTF3_ENST00000535299.1_Intron|NTF3_ENST00000423158.3_Silent_p.L247L	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	234					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						ACAATAAACTCGTGGGCTGGC	0.453																																					p.L247L	GBM(194;1104 2182 8339 9578 18493)	Atlas-SNP	.											.	NTF3	50	.	0			c.C741T						.						64.0	52.0	56.0					12																	5604082		2203	4300	6503	SO:0001819	synonymous_variant	4908	exon2			TAAACTCGTGGGC		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.702C>T	chr12.hg19:g.5604082C>T		76.0	0.0		55.0	34.0	NM_001102654	B7Z1T5|Q6FH50	Silent	SNP	ENST00000331010.6	hg19	CCDS8538.1																																																																																			.	.		0.453	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1		
PTPRO	5800	hgsc.bcm.edu	37	12	15739913	15739913	+	Missense_Mutation	SNP	G	G	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:15739913G>C	ENST00000281171.4	+	24	3668	c.3338G>C	c.(3337-3339)aGt>aCt	p.S1113T	PTPRO_ENST00000542557.1_Missense_Mutation_p.S274T|PTPRO_ENST00000442921.2_Missense_Mutation_p.S302T|PTPRO_ENST00000348962.2_Missense_Mutation_p.S1085T|PTPRO_ENST00000544244.1_Missense_Mutation_p.S274T|PTPRO_ENST00000445537.2_Missense_Mutation_p.S302T	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	1113	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GCTGCAGAAAGTATCCTGCAG	0.453																																					p.S1113T		Atlas-SNP	.											.	PTPRO	148	.	0			c.G3338C						.						169.0	139.0	149.0					12																	15739913		2203	4300	6503	SO:0001583	missense	5800	exon24			CAGAAAGTATCCT	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.3338G>C	chr12.hg19:g.15739913G>C	ENSP00000281171:p.Ser1113Thr	120.0	0.0		91.0	25.0	NM_030667	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	hg19	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.193564	0.58017	.	.	ENSG00000151490	ENST00000281171;ENST00000348962;ENST00000442921;ENST00000542557;ENST00000445537;ENST00000544244;ENST00000535322	D;D;D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86;-1.86;-1.86	5.07	5.07	0.68467	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000008	D	0.85526	0.5717	N	0.17800	0.525	0.54753	D	0.999981	B;D;D	0.63046	0.196;0.99;0.992	B;D;D	0.74023	0.179;0.97;0.982	T	0.80231	-0.1468	10	0.09338	T	0.73	.	18.6382	0.91385	0.0:0.0:1.0:0.0	.	274;1085;1113	Q9UBT5;Q16827-2;Q16827	.;.;PTPRO_HUMAN	T	1113;1085;302;274;302;274;92	ENSP00000281171:S1113T;ENSP00000343434:S1085T;ENSP00000404188:S302T;ENSP00000437571:S274T;ENSP00000393449:S302T;ENSP00000439234:S274T;ENSP00000446201:S92T	ENSP00000281171:S1113T	S	+	2	0	PTPRO	15631180	1.000000	0.71417	0.177000	0.23020	0.900000	0.52787	9.456000	0.97628	2.623000	0.88846	0.650000	0.86243	AGT	.	.		0.453	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
KRT1	3848	hgsc.bcm.edu	37	12	53069229	53069229	+	Silent	SNP	G	G	A	rs540699806|rs267607656	byFrequency	TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:53069229G>A	ENST00000252244.3	-	9	1741	c.1683C>T	c.(1681-1683)tcC>tcT	p.S561S		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	561	Gly/Ser-rich.|Tail.		Missing (in allele 1B). {ECO:0000269|PubMed:1281859}.		complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tgccacctccggagccgtagc	0.692																																					p.S561S		Atlas-SNP	.											.	KRT1	110	.	0			c.C1683T						.						4.0	4.0	4.0					12																	53069229		1797	3656	5453	SO:0001819	synonymous_variant	3848	exon9			ACCTCCGGAGCCG	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1683C>T	chr12.hg19:g.53069229G>A		2.0	0.0		29.0	4.0	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	ENST00000252244.3	hg19	CCDS8836.1																																																																																			.	.		0.692	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
HNF1A	6927	hgsc.bcm.edu	37	12	121416684	121416684	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:121416684T>C	ENST00000257555.6	+	1	339	c.113T>C	c.(112-114)cTg>cCg	p.L38P	HNF1A-AS1_ENST00000537361.1_RNA|HNF1A-AS1_ENST00000433033.2_RNA|HNF1A-AS1_ENST00000535301.1_RNA|HNF1A_ENST00000544413.1_Missense_Mutation_p.L38P|HNF1A_ENST00000541395.1_Missense_Mutation_p.L38P|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000543427.1_Intron|HNF1A_ENST00000400024.2_Missense_Mutation_p.L38P|HNF1A_ENST00000402929.1_Missense_Mutation_p.L38P			P20823	HNF1A_HUMAN	HNF1 homeobox A	38					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Y36fs*107(1)|p.?(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CCCTACCTCCTGGCTGGAGAA	0.701									Hepatic Adenoma, Familial Clustering of																												p.L38P		Atlas-SNP	.											.	HNF1A	302	.	2	Unknown(1)|Complex - frameshift(1)	liver(1)|endometrium(1)	c.T113C						.						18.0	21.0	20.0					12																	121416684		2203	4300	6503	SO:0001583	missense	6927	exon1	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	ACCTCCTGGCTGG	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.113T>C	chr12.hg19:g.121416684T>C	ENSP00000257555:p.Leu38Pro	112.0	0.0		127.0	44.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	hg19	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	T	4.025	0.002126	0.07819	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D	0.98419	-4.92;-4.92;-4.92	4.45	4.45	0.53987	Hepatocyte nuclear factor 1, N-terminal (1);	0.674499	0.13192	N	0.406604	D	0.95111	0.8416	N	0.22421	0.69	0.20703	N	0.999861	B;B;B;B	0.06786	0.0;0.0;0.001;0.001	B;B;B;B	0.12156	0.002;0.002;0.007;0.003	D	0.88962	0.3394	10	0.32370	T	0.25	-1.994	12.8999	0.58119	0.0:0.0:0.0:1.0	.	38;38;38;38	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	P	38	ENSP00000257555:L38P;ENSP00000443112:L38P;ENSP00000438804:L38P	ENSP00000257555:L38P	L	+	2	0	HNF1A	119901067	0.999000	0.42202	0.972000	0.41901	0.473000	0.32948	3.441000	0.52893	1.637000	0.50538	0.482000	0.46254	CTG	.	.		0.701	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
PITPNM2	57605	hgsc.bcm.edu	37	12	123498529	123498529	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:123498529G>A	ENST00000542749.1	-	2	202	c.139C>T	c.(139-141)Ccg>Tcg	p.P47S	PITPNM2_ENST00000320201.4_Missense_Mutation_p.P47S|PITPNM2_ENST00000546049.1_Missense_Mutation_p.P47S|PITPNM2_ENST00000451868.2_5'UTR|RN7SL133P_ENST00000585256.1_RNA|PITPNM2_ENST00000280562.5_Missense_Mutation_p.P47S|PITPNM2_ENST00000392428.1_Splice_Site_p.P47S			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	47					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TCTGTGTACGGCCGGTTCTCC	0.592																																					p.P47S		Atlas-SNP	.											.	PITPNM2	105	.	0			c.C139T						.						132.0	112.0	119.0					12																	123498529		2203	4300	6503	SO:0001583	missense	57605	exon3			TGTACGGCCGGTT	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.139C>T	chr12.hg19:g.123498529G>A	ENSP00000437611:p.Pro47Ser	115.0	0.0		141.0	64.0	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	hg19	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027800	0.93518	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.60171	0.21;0.21;0.21;0.21	4.42	4.42	0.53409	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.80116	0.4564	M	0.89214	3.015	0.41659	D	0.989173	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;0.999;0.987	D	0.85306	0.1076	10	0.72032	D	0.01	-23.5877	17.4015	0.87461	0.0:0.0:1.0:0.0	.	47;47;47	A5D8U3;Q9BZ72-2;Q9BZ72	.;.;PITM2_HUMAN	S	47	ENSP00000280562:P47S;ENSP00000322218:P47S;ENSP00000376223:P47S;ENSP00000437611:P47S	ENSP00000280562:P47S	P	-	1	0	PITPNM2	122064482	1.000000	0.71417	0.988000	0.46212	0.944000	0.59088	9.620000	0.98373	2.168000	0.68352	0.655000	0.94253	CCG	.	.		0.592	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
AACS	65985	hgsc.bcm.edu	37	12	125561142	125561142	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:125561142G>T	ENST00000316519.6	+	3	549	c.343G>T	c.(343-345)Gcc>Tcc	p.A115S	AACS_ENST00000261686.6_Missense_Mutation_p.A115S	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	115					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TGACAGAGTTGCCCTTTACAT	0.502																																					p.A115S		Atlas-SNP	.											.	AACS	59	.	0			c.G343T						.						123.0	117.0	119.0					12																	125561142		2203	4300	6503	SO:0001583	missense	65985	exon3			AGAGTTGCCCTTT	AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.343G>T	chr12.hg19:g.125561142G>T	ENSP00000324842:p.Ala115Ser	60.0	0.0		78.0	31.0	NM_023928	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	ENST00000316519.6	hg19	CCDS9263.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523561	0.64747	.	.	ENSG00000081760	ENST00000316519;ENST00000536752;ENST00000261686	T;T;T	0.60299	0.2;2.46;0.2	5.28	5.28	0.74379	Acyl-CoA synthase, domain of unknown function DUF3448 (1);	0.000000	0.85682	D	0.000000	D	0.84552	0.5497	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.89555	0.3802	10	0.72032	D	0.01	.	18.0317	0.89286	0.0:0.0:1.0:0.0	.	115;115	Q86V21-2;Q86V21	.;AACS_HUMAN	S	115	ENSP00000324842:A115S;ENSP00000442691:A115S;ENSP00000261686:A115S	ENSP00000261686:A115S	A	+	1	0	AACS	124127095	1.000000	0.71417	0.948000	0.38648	0.079000	0.17450	8.072000	0.89496	2.632000	0.89209	0.591000	0.81541	GCC	.	.		0.502	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400202.1	NM_023928	
PROSER1	80209	hgsc.bcm.edu	37	13	39586338	39586338	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr13:39586338G>T	ENST00000352251.3	-	12	3427	c.2594C>A	c.(2593-2595)tCt>tAt	p.S865Y	PROSER1_ENST00000350125.3_Missense_Mutation_p.S843Y|PROSER1_ENST00000484434.3_Intron	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	865																	TGGAAAAACAGAACTGCCTGC	0.428																																					p.S865Y		Atlas-SNP	.											.	.	.	.	0			c.C2594A						.						134.0	152.0	146.0					13																	39586338		2203	4300	6503	SO:0001583	missense	80209	exon12			AAAACAGAACTGC	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.2594C>A	chr13.hg19:g.39586338G>T	ENSP00000332034:p.Ser865Tyr	144.0	0.0		191.0	74.0	NM_025138	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	ENST00000352251.3	hg19	CCDS9368.2	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388781	0.42308	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.41400	1.0;1.0	6.06	4.33	0.51752	.	.	.	.	.	T	0.23611	0.0571	N	0.08118	0	0.34830	D	0.73962	B;B	0.33212	0.009;0.402	B;B	0.33521	0.02;0.165	T	0.27020	-1.0086	8	.	.	.	-21.7819	12.5871	0.56424	0.0:0.127:0.7407:0.1323	.	843;865	A6NJ97;Q86XN7	.;PRSR1_HUMAN	Y	865;843	ENSP00000332034:S865Y;ENSP00000339123:S843Y	.	S	-	2	0	PROSER1	38484338	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	4.674000	0.61612	0.882000	0.36016	-0.156000	0.13503	TCT	.	.		0.428	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
ABCC4	10257	hgsc.bcm.edu	37	13	95858910	95858910	+	Missense_Mutation	SNP	A	A	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr13:95858910A>T	ENST00000376887.4	-	8	1151	c.1037T>A	c.(1036-1038)aTc>aAc	p.I346N	ABCC4_ENST00000412704.1_Missense_Mutation_p.I346N|ABCC4_ENST00000536256.1_Missense_Mutation_p.I271N|ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000431522.1_Missense_Mutation_p.I346N	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	346	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	GCTGGCTGTGATCACACTGCC	0.547																																					p.I346N		Atlas-SNP	.											.	ABCC4	248	.	0			c.T1037A						.						126.0	108.0	114.0					13																	95858910		2203	4300	6503	SO:0001583	missense	10257	exon8			GCTGTGATCACAC	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1037T>A	chr13.hg19:g.95858910A>T	ENSP00000366084:p.Ile346Asn	57.0	0.0		72.0	28.0	NM_005845	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	hg19	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	A	16.98	3.270550	0.59540	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.95447	-3.14;-3.14;-3.71;-3.14	5.34	5.34	0.76211	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.288637	0.39834	N	0.001256	D	0.98105	0.9375	M	0.92219	3.285	0.58432	D	0.999999	D;D;P;D;D	0.71674	0.967;0.997;0.942;0.998;0.977	D;D;P;D;D	0.70935	0.934;0.964;0.873;0.971;0.964	D	0.99250	1.0887	10	0.87932	D	0	.	14.9671	0.71201	1.0:0.0:0.0:0.0	.	271;346;346;346;346	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	N	346;346;271;346	ENSP00000388657:I346N;ENSP00000366084:I346N;ENSP00000442024:I271N;ENSP00000398562:I346N	ENSP00000366084:I346N	I	-	2	0	ABCC4	94656911	1.000000	0.71417	0.995000	0.50966	0.051000	0.14879	8.579000	0.90781	1.999000	0.58509	0.533000	0.62120	ATC	.	.		0.547	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
CRIP2	1397	hgsc.bcm.edu	37	14	105945934	105945934	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr14:105945934G>T	ENST00000329146.4	+	8	1284	c.571G>T	c.(571-573)Ggt>Tgt	p.G191C	CRIP2_ENST00000483017.3_Missense_Mutation_p.G265C|CRIP2_ENST00000548989.1_3'UTR	NM_001312.3	NP_001303.1	P52943	CRIP2_HUMAN	cysteine-rich protein 2	191	Gly-rich.				hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)	cell cortex (GO:0005938)	zinc ion binding (GO:0008270)			lung(2)	2		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.235)		AGTGAACACCGGTGCGGTGGG	0.657																																					p.G265C		Atlas-SNP	.											.	CRIP2	7	.	0			c.G793T						.						76.0	70.0	72.0					14																	105945934		2195	4292	6487	SO:0001583	missense	1397	exon8			AACACCGGTGCGG		CCDS10003.1, CCDS59246.1	14q32.3	2008-08-11			ENSG00000182809	ENSG00000182809			2361	protein-coding gene	gene with protein product		601183				8843343, 10681529	Standard	NM_001312		Approved	CRP2, ESP1	uc031qqr.1	P52943	OTTHUMG00000029906	ENST00000329146.4:c.571G>T	chr14.hg19:g.105945934G>T	ENSP00000328521:p.Gly191Cys	60.0	0.0		79.0	34.0	NM_001270837	A1A4U1|B7Z6C0|E9PD13	Missense_Mutation	SNP	ENST00000329146.4	hg19	CCDS10003.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.79|15.79	2.935998|2.935998	0.52972|0.52972	.|.	.|.	ENSG00000182809|ENSG00000182809	ENST00000483017;ENST00000329146|ENST00000550577;ENST00000538259	D;D|.	0.94931|.	-3.56;-3.56|.	4.06|4.06	4.06|4.06	0.47325|0.47325	.|.	0.000000|.	0.42682|.	U|.	0.000676|.	D|D	0.85353|0.85353	0.5677|0.5677	M|M	0.94021|0.94021	3.485|3.485	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.77557|.	0.99;0.99;0.97|.	D|D	0.89694|0.89694	0.3900|0.3900	10|5	0.87932|.	D|.	0|.	-28.7221|-28.7221	14.9374|14.9374	0.70967|0.70967	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	265;191;191|.	B7Z6C0;Q53FN1;P52943|.	.;.;CRIP2_HUMAN|.	C|L	265;191|86;174	ENSP00000426119:G265C;ENSP00000328521:G191C|.	ENSP00000328521:G191C|.	G|R	+|+	1|2	0|0	CRIP2|CRIP2	105016979|105016979	1.000000|1.000000	0.71417|0.71417	0.286000|0.286000	0.24833|0.24833	0.072000|0.072000	0.16883|0.16883	8.351000|8.351000	0.90072|0.90072	2.082000|2.082000	0.62665|0.62665	0.313000|0.313000	0.20887|0.20887	GGT|CGG	.	.		0.657	CRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074597.3	NM_001312	
GABPB1	2553	hgsc.bcm.edu	37	15	50596296	50596296	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:50596296T>C	ENST00000220429.8	-	3	311	c.143A>G	c.(142-144)tAt>tGt	p.Y48C	GABPB1_ENST00000396464.3_Missense_Mutation_p.Y48C|GABPB1_ENST00000380877.3_Missense_Mutation_p.Y48C|GABPB1_ENST00000359031.4_Missense_Mutation_p.Y48C|GABPB1_ENST00000429662.2_Missense_Mutation_p.Y48C|GABPB1_ENST00000543881.1_5'UTR|GABPB1_ENST00000560825.1_Missense_Mutation_p.Y48C			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1	48					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						ATAATGACCATACTGTGCTGC	0.423																																					p.Y48C		Atlas-SNP	.											.	GABPB1	33	.	0			c.A143G						.						156.0	127.0	137.0					15																	50596296		2196	4295	6491	SO:0001583	missense	2553	exon3			TGACCATACTGTG	D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.143A>G	chr15.hg19:g.50596296T>C	ENSP00000220429:p.Tyr48Cys	87.0	0.0		121.0	44.0	NM_016654	A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Missense_Mutation	SNP	ENST00000220429.8	hg19	CCDS32239.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.052124	0.75960	.	.	ENSG00000104064	ENST00000220429;ENST00000380877;ENST00000396464;ENST00000429662;ENST00000359031	T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94	5.45	5.45	0.79879	Ankyrin repeat-containing domain (3);	0.068964	0.64402	D	0.000011	T	0.50837	0.1639	N	0.21194	0.64	0.49798	D	0.999825	D;D;D;D;D	0.71674	0.993;0.995;0.991;0.998;0.991	D;D;P;D;P	0.87578	0.934;0.937;0.781;0.998;0.781	T	0.50857	-0.8778	10	0.40728	T	0.16	-2.9296	15.7997	0.78443	0.0:0.0:0.0:1.0	.	48;48;48;48;48	B7Z726;Q06547-3;Q06547-4;Q06547;Q06547-2	.;.;.;GABP1_HUMAN;.	C	48	ENSP00000220429:Y48C;ENSP00000370259:Y48C;ENSP00000379728:Y48C;ENSP00000395771:Y48C;ENSP00000351923:Y48C	ENSP00000220429:Y48C	Y	-	2	0	GABPB1	48383588	1.000000	0.71417	0.993000	0.49108	0.972000	0.66771	8.040000	0.89188	2.189000	0.69895	0.460000	0.39030	TAT	.	.		0.423	GABPB1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000418294.1		
CGNL1	84952	hgsc.bcm.edu	37	15	57730244	57730244	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:57730244G>T	ENST00000281282.5	+	2	125	c.47G>T	c.(46-48)gGg>gTg	p.G16V		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	16	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		CAGGAATATGGGGTCCATCTG	0.483																																					p.G16V		Atlas-SNP	.											.	CGNL1	125	.	0			c.G47T						.						201.0	210.0	206.0					15																	57730244		2192	4292	6484	SO:0001583	missense	84952	exon2			AATATGGGGTCCA	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.47G>T	chr15.hg19:g.57730244G>T	ENSP00000281282:p.Gly16Val	23.0	0.0		47.0	20.0	NM_032866	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	hg19	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208272	0.58343	.	.	ENSG00000128849	ENST00000281282	T	0.06933	3.24	4.71	4.71	0.59529	.	0.000000	0.44285	D	0.000468	T	0.25121	0.0610	M	0.71581	2.175	0.53688	D	0.999974	D	0.76494	0.999	D	0.68353	0.957	T	0.00350	-1.1797	10	0.72032	D	0.01	-14.7537	11.7728	0.51968	0.092:0.0:0.908:0.0	.	16	Q0VF96	CGNL1_HUMAN	V	16	ENSP00000281282:G16V	ENSP00000281282:G16V	G	+	2	0	CGNL1	55517536	1.000000	0.71417	0.448000	0.26945	0.958000	0.62258	4.120000	0.57897	2.443000	0.82685	0.561000	0.74099	GGG	.	.		0.483	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
HERC1	8925	hgsc.bcm.edu	37	15	63988457	63988457	+	Nonsense_Mutation	SNP	T	T	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:63988457T>A	ENST00000443617.2	-	27	5074	c.4987A>T	c.(4987-4989)Aga>Tga	p.R1663*	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1663					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						GAACTCAATCTGCTTCCTGCC	0.478																																					p.R1663X		Atlas-SNP	.											.	HERC1	624	.	0			c.A4987T						.						88.0	85.0	86.0					15																	63988457		1965	4158	6123	SO:0001587	stop_gained	8925	exon27			TCAATCTGCTTCC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4987A>T	chr15.hg19:g.63988457T>A	ENSP00000390158:p.Arg1663*	112.0	0.0		147.0	58.0	NM_003922	Q8IW65	Nonsense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	44	11.006778	0.99502	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	.	.	.	5.54	4.4	0.53042	.	0.065589	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1874	0.54247	0.0:0.0:0.4533:0.5466	.	.	.	.	X	1663;647	.	ENSP00000389613:R647X	R	-	1	2	HERC1	61775510	0.773000	0.28580	0.987000	0.45799	0.917000	0.54804	0.759000	0.26461	0.900000	0.36469	0.528000	0.53228	AGA	.	.		0.478	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
CLK3	1198	hgsc.bcm.edu	37	15	74919878	74919878	+	Splice_Site	SNP	A	A	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:74919878A>G	ENST00000395066.3	+	9	1817		c.e9-1		CLK3_ENST00000348245.3_Splice_Site|CLK3_ENST00000345005.4_Splice_Site|CLK3_ENST00000352989.5_Splice_Site	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3						protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						CTTGCCTTTCAGAGCTGTGAG	0.577																																					.	Ovarian(133;694 1754 28950 29027 31859)	Atlas-SNP	.											.	CLK3	78	.	0			c.913-2A>G						.						105.0	97.0	99.0					15																	74919878		2197	4296	6493	SO:0001630	splice_region_variant	1198	exon9			CCTTTCAGAGCTG	L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.1357-1A>G	chr15.hg19:g.74919878A>G		83.0	0.0		105.0	37.0	NM_003992	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Splice_Site	SNP	ENST00000395066.3	hg19	CCDS45304.1	.	.	.	.	.	.	.	.	.	.	A	17.63	3.438315	0.62955	.	.	ENSG00000179335	ENST00000345005;ENST00000395066;ENST00000454830;ENST00000352989	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4674	0.75412	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CLK3	72706931	1.000000	0.71417	0.997000	0.53966	0.649000	0.38597	9.228000	0.95250	2.142000	0.66516	0.459000	0.35465	.	.	.		0.577	CLK3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390442.3		Intron
PSTPIP1	9051	hgsc.bcm.edu	37	15	77310567	77310567	+	Missense_Mutation	SNP	A	A	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:77310567A>T	ENST00000558012.1	+	2	604	c.115A>T	c.(115-117)Atg>Ttg	p.M39L	PSTPIP1_ENST00000267939.5_Missense_Mutation_p.M38L|PSTPIP1_ENST00000379595.3_Missense_Mutation_p.M39L|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.M39L	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	39	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GTGCAAAGACATGGAGGAGCT	0.627																																					p.M39L		Atlas-SNP	.											.	PSTPIP1	50	.	0			c.A115T						.						32.0	38.0	36.0					15																	77310567		2158	4239	6397	SO:0001583	missense	9051	exon2			AAAGACATGGAGG	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.115A>T	chr15.hg19:g.77310567A>T	ENSP00000452746:p.Met39Leu	53.0	0.0		77.0	31.0	NM_003978	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	hg19	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	A	7.267	0.606391	0.14002	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.32988	1.43;2.55	4.35	2.24	0.28232	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.324058	0.30020	N	0.010620	T	0.11281	0.0275	N	0.04880	-0.145	0.29385	N	0.863015	B;B;B;B	0.22909	0.0;0.023;0.077;0.001	B;B;B;B	0.22601	0.002;0.02;0.04;0.007	T	0.36601	-0.9741	10	0.02654	T	1	-12.4902	8.3338	0.32202	0.2252:0.0:0.7748:0.0	.	39;38;39;39	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	L	39;38	ENSP00000368914:M39L;ENSP00000267939:M38L	ENSP00000267939:M38L	M	+	1	0	PSTPIP1	75097622	0.998000	0.40836	0.989000	0.46669	0.993000	0.82548	1.843000	0.39259	0.276000	0.22118	0.402000	0.26972	ATG	.	.		0.627	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	
ARNT2	9915	hgsc.bcm.edu	37	15	80873588	80873588	+	Silent	SNP	A	A	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:80873588A>T	ENST00000303329.4	+	17	1926	c.1761A>T	c.(1759-1761)ccA>ccT	p.P587P	ARNT2_ENST00000533983.1_Silent_p.P576P|ARNT2_ENST00000527771.1_Silent_p.P576P|RP11-379K22.3_ENST00000603875.1_RNA|hsa-mir-5572_ENST00000583188.1_RNA	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	587					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			AGCAAATCCCATCTCAGTCCA	0.587																																					p.P587P		Atlas-SNP	.											.	ARNT2	88	.	0			c.A1761T						.						120.0	94.0	102.0					15																	80873588		2203	4300	6503	SO:0001819	synonymous_variant	9915	exon17			AATCCCATCTCAG	AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.1761A>T	chr15.hg19:g.80873588A>T		161.0	0.0		193.0	83.0	NM_014862	B4DIS7|O15024|Q8IYC2	Silent	SNP	ENST00000303329.4	hg19	CCDS32307.1																																																																																			.	.		0.587	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384389.2		
AP3B2	8120	hgsc.bcm.edu	37	15	83330629	83330629	+	Silent	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:83330629C>T	ENST00000261722.3	-	24	3114	c.2907G>A	c.(2905-2907)ggG>ggA	p.G969G	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535359.1_Silent_p.G988G|AP3B2_ENST00000535348.1_Silent_p.G937G	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	969					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CCATCAGCTCCCCAACAGGTG	0.542																																					p.G969G		Atlas-SNP	.											.	AP3B2	103	.	0			c.G2907A						.						58.0	60.0	59.0					15																	83330629		1962	4150	6112	SO:0001819	synonymous_variant	8120	exon24			CAGCTCCCCAACA	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2907G>A	chr15.hg19:g.83330629C>T		87.0	0.0		108.0	50.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	hg19	CCDS45331.1																																																																																			.	.		0.542	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
PDZD9	255762	hgsc.bcm.edu	37	16	21995863	21995863	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr16:21995863G>A	ENST00000424898.2	-	4	582	c.520C>T	c.(520-522)Cac>Tac	p.H174Y	PDZD9_ENST00000537222.2_Missense_Mutation_p.H114Y|PDZD9_ENST00000286143.6_Missense_Mutation_p.H112Y			Q8IXQ8	PDZD9_HUMAN	PDZ domain containing 9	174										breast(3)|endometrium(2)|lung(3)|pancreas(1)	9						CTTGCAGGGTGATGCACAGTT	0.368																																					p.H114Y		Atlas-SNP	.											.	PDZD9	18	.	0			c.C340T						.						134.0	131.0	132.0					16																	21995863		2198	4300	6498	SO:0001583	missense	255762	exon3			CAGGGTGATGCAC	BC039562	CCDS10602.1, CCDS10602.2	16p12.1	2010-04-14	2010-04-14	2010-04-14	ENSG00000155714	ENSG00000155714			28740	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 65"""	C16orf65		12477932	Standard	NM_173806		Approved	MGC50721	uc021ter.1	Q8IXQ8	OTTHUMG00000131586	ENST00000424898.2:c.520C>T	chr16.hg19:g.21995863G>A	ENSP00000400514:p.His174Tyr	261.0	0.0		247.0	56.0	NM_173806	F5GWW8	Missense_Mutation	SNP	ENST00000424898.2	hg19		.	.	.	.	.	.	.	.	.	.	G	2.979	-0.210741	0.06140	.	.	ENSG00000155714	ENST00000424898;ENST00000537222;ENST00000286143;ENST00000521513	T	0.44482	0.92	4.96	-4.5	0.03493	.	1.035960	0.07611	N	0.925322	T	0.17534	0.0421	N	0.10809	0.05	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14924	-1.0455	10	0.32370	T	0.25	0.0719	1.8611	0.03189	0.435:0.1303:0.3019:0.1328	.	112	Q8IXQ8-2	.	Y	174;114;112;114	ENSP00000400514:H174Y	ENSP00000286143:H112Y	H	-	1	0	PDZD9	21903364	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	-0.147000	0.10234	-0.779000	0.04560	-0.244000	0.11960	CAC	.	.		0.368	PDZD9-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000381652.1	NM_173806	
MVP	9961	hgsc.bcm.edu	37	16	29848051	29848051	+	Silent	SNP	G	G	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr16:29848051G>C	ENST00000357402.5	+	7	819	c.681G>C	c.(679-681)ctG>ctC	p.L227L	MVP_ENST00000395353.1_Silent_p.L227L|MVP_ENST00000452209.2_Missense_Mutation_p.A42P	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein	227					cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						AGACAGCCCTGCACCTCCGGG	0.622																																					p.L227L		Atlas-SNP	.											.	MVP	80	.	0			c.G681C						.						36.0	41.0	39.0					16																	29848051		2197	4300	6497	SO:0001819	synonymous_variant	9961	exon7			AGCCCTGCACCTC	X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.681G>C	chr16.hg19:g.29848051G>C		27.0	0.0		43.0	10.0	NM_017458	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Silent	SNP	ENST00000357402.5	hg19	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159666	0.57368	.	.	ENSG00000013364	ENST00000452209	.	.	.	5.47	4.51	0.55191	.	.	.	.	.	T	0.53594	0.1806	.	.	.	0.22639	N	0.998904	.	.	.	.	.	.	T	0.50268	-0.8848	5	0.87932	D	0	-9.4381	12.2321	0.54495	0.0834:0.0:0.9166:0.0	.	.	.	.	P	42	.	ENSP00000387916:A42P	A	+	1	0	MVP	29755552	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.125000	0.31332	1.424000	0.47217	0.462000	0.41574	GCA	.	.		0.622	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115	
ASPHD1	253982	hgsc.bcm.edu	37	16	29912699	29912699	+	Missense_Mutation	SNP	C	C	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr16:29912699C>A	ENST00000308748.5	+	1	659	c.407C>A	c.(406-408)cCc>cAc	p.P136H	ASPHD1_ENST00000483405.1_Intron|SEZ6L2_ENST00000308713.5_5'Flank|SEZ6L2_ENST00000537485.1_5'Flank|SEZ6L2_ENST00000350527.3_5'Flank|SEZ6L2_ENST00000346932.5_5'Flank	NM_181718.3	NP_859069.2	Q5U4P2	ASPH1_HUMAN	aspartate beta-hydroxylase domain containing 1	136	Gly-rich.				peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)	dioxygenase activity (GO:0051213)			endometrium(4)|large_intestine(2)|lung(1)|prostate(1)	8						CCTGGGGATCCCGGGGAAGGA	0.706																																					p.P136H		Atlas-SNP	.											.	ASPHD1	28	.	0			c.C407A						.						19.0	24.0	22.0					16																	29912699		2179	4283	6462	SO:0001583	missense	253982	exon1			GGGATCCCGGGGA	AF070642	CCDS10660.1	16p11.2	2008-02-05			ENSG00000174939	ENSG00000174939			27380	protein-coding gene	gene with protein product							Standard	NM_181718		Approved		uc002dut.3	Q5U4P2	OTTHUMG00000132121	ENST00000308748.5:c.407C>A	chr16.hg19:g.29912699C>A	ENSP00000311447:p.Pro136His	31.0	0.0		35.0	16.0	NM_181718	A0AVE3|B7ZLZ3|Q8IW63|Q8N316|Q96H00	Missense_Mutation	SNP	ENST00000308748.5	hg19	CCDS10660.1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.656395	0.29425	.	.	ENSG00000174939	ENST00000414952;ENST00000308748	T;T	0.42900	0.96;0.96	4.91	1.63	0.23807	.	0.442730	0.21939	N	0.066908	T	0.23926	0.0579	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.15752	-1.0426	10	0.66056	D	0.02	0.7085	3.949	0.09361	0.2667:0.5394:0.0:0.1938	.	136	Q5U4P2	ASPH1_HUMAN	H	136	ENSP00000388036:P136H;ENSP00000311447:P136H	ENSP00000311447:P136H	P	+	2	0	ASPHD1	29820200	0.002000	0.14202	0.021000	0.16686	0.055000	0.15305	1.503000	0.35715	0.572000	0.29383	0.462000	0.41574	CCC	.	.		0.706	ASPHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255163.2	NM_181718	
TP53	7157	hgsc.bcm.edu	37	17	7578290	7578290	+	Splice_Site	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr17:7578290C>T	ENST00000269305.4	-	6	749		c.e6-1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(40)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGACCTAAGAGCAAT	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											.	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,colon,carcinoma,+2,71	TP53	33396	.	54	Unknown(40)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(11)|lung(9)|large_intestine(6)|central_nervous_system(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|oesophagus(2)|breast(2)|stomach(1)|genital_tract(1)|eye(1)	c.560-1G>A	GRCh37	CD043957|CS011574|CS083991	TP53	D|S		.						82.0	74.0	76.0					17																	7578290		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CCAGACCTAAGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-1G>A	chr17.hg19:g.7578290C>T		87.0	0.0		71.0	41.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	9.113	1.007143	0.19199	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.89	0.79291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519015	1.000000	0.71417	0.995000	0.50966	0.031000	0.12232	3.449000	0.52950	2.539000	0.85634	0.655000	0.94253	.	.	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
MED13	9969	hgsc.bcm.edu	37	17	60088411	60088411	+	Silent	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr17:60088411G>A	ENST00000397786.2	-	9	1543	c.1467C>T	c.(1465-1467)gaC>gaT	p.D489D		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	489					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						CTGAATCTGCGTCCATGCCAA	0.448																																					p.D489D		Atlas-SNP	.											.	MED13	181	.	0			c.C1467T						.						119.0	115.0	117.0					17																	60088411		2049	4203	6252	SO:0001819	synonymous_variant	9969	exon9			ATCTGCGTCCATG	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.1467C>T	chr17.hg19:g.60088411G>A		287.0	0.0		351.0	34.0	NM_005121	B2RU05|O60334	Silent	SNP	ENST00000397786.2	hg19	CCDS42366.1																																																																																			.	.		0.448	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
USP36	57602	hgsc.bcm.edu	37	17	76814798	76814798	+	Missense_Mutation	SNP	G	G	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr17:76814798G>C	ENST00000542802.3	-	10	1417	c.974C>G	c.(973-975)aCc>aGc	p.T325S	USP36_ENST00000312010.6_Missense_Mutation_p.T325S|USP36_ENST00000449938.2_Missense_Mutation_p.T25S|USP36_ENST00000588467.1_5'UTR			Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	325	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	34			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			GAGGGAAAGGGTTAAGACGTT	0.522																																					p.T325S		Atlas-SNP	.											.	USP36	243	.	0			c.C974G						.						210.0	184.0	193.0					17																	76814798		2203	4300	6503	SO:0001583	missense	57602	exon10			GAAAGGGTTAAGA	AB040886	CCDS32755.1	17q25.3	2008-02-05	2005-08-08			ENSG00000055483		"""Ubiquitin-specific peptidases"""	20062	protein-coding gene	gene with protein product		612543	"""ubiquitin specific protease 36"""			12838346	Standard	NM_025090		Approved	KIAA1453, FLJ12851	uc002jvz.1	Q9P275		ENST00000542802.3:c.974C>G	chr17.hg19:g.76814798G>C	ENSP00000441214:p.Thr325Ser	138.0	0.0		162.0	55.0	NM_025090	Q05C98|Q05DD0|Q6IQ38|Q8NDM8|Q9NVC8	Missense_Mutation	SNP	ENST00000542802.3	hg19	CCDS32755.1	.	.	.	.	.	.	.	.	.	.	G	17.32	3.359959	0.61403	.	.	ENSG00000055483	ENST00000312010;ENST00000449938;ENST00000542802;ENST00000432878	T;T;T	0.05855	3.38;3.38;3.38	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.19644	0.0472	L	0.49699	1.58	0.58432	D	0.999999	D	0.60160	0.987	D	0.64595	0.927	T	0.00346	-1.1800	10	0.62326	D	0.03	-32.4734	17.7609	0.88464	0.0:0.0:1.0:0.0	.	325	Q9P275-2	.	S	325;25;325;325	ENSP00000310590:T325S;ENSP00000401119:T25S;ENSP00000441214:T325S	ENSP00000310590:T325S	T	-	2	0	USP36	74326393	1.000000	0.71417	0.042000	0.18584	0.124000	0.20399	9.064000	0.93933	2.288000	0.76882	0.563000	0.77884	ACC	.	.		0.522	USP36-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437472.3	NM_025090	
CCBE1	147372	hgsc.bcm.edu	37	18	57363935	57363935	+	Silent	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr18:57363935G>A	ENST00000439986.4	-	2	175	c.138C>T	c.(136-138)atC>atT	p.I46I	RP11-2N1.2_ENST00000588946.1_RNA	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	46					lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				TCTCTGAGCAGATTTCTCTAT	0.582											OREG0025022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I46I	NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)	Atlas-SNP	.											.	CCBE1	59	.	0			c.C138T						.						91.0	95.0	93.0					18																	57363935		2203	4300	6503	SO:0001819	synonymous_variant	147372	exon2			TGAGCAGATTTCT	AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.138C>T	chr18.hg19:g.57363935G>A		113.0	0.0	1022	115.0	34.0	NM_133459	Q6MZX5|Q86SS2|Q8TF19	Silent	SNP	ENST00000439986.4	hg19	CCDS32838.1																																																																																			.	.		0.582	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449685.2	NM_133459	
CEBPA	1050	hgsc.bcm.edu	37	19	33792919	33792919	+	Silent	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr19:33792919C>T	ENST00000498907.2	-	1	551	c.402G>A	c.(400-402)gcG>gcA	p.A134A	CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.7_ENST00000587312.1_RNA|CTD-2540B15.11_ENST00000589932.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	134					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A134A(2)|p.Q87fs*32(2)|p.L78_A174del(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					AGCCGGCGGCCGCGCAGCCGT	0.811			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.A134A		Atlas-SNP	.		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	CEBPA,NS,haematopoietic_neoplasm,0,2	CEBPA	986	.	5	Deletion - Frameshift(2)|Substitution - coding silent(2)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(5)	c.G402A						.						1.0	1.0	1.0					19																	33792919		103	303	406	SO:0001819	synonymous_variant	1050	exon1	Familial Cancer Database	Familial AML	GGCGGCCGCGCAG	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.402G>A	chr19.hg19:g.33792919C>T		4.0	1.0		14.0	9.0	NM_004364	A7LNP2|P78319|Q05CA4	Silent	SNP	ENST00000498907.2	hg19	CCDS54243.1																																																																																			.	.		0.811	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365012.1	NM_004364	
HAMP	57817	hgsc.bcm.edu	37	19	35775694	35775694	+	Silent	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr19:35775694G>A	ENST00000598398.1	+	3	389	c.93G>A	c.(91-93)acG>acA	p.T31T	HAMP_ENST00000222304.3_Silent_p.T31T	NM_021175.2	NP_066998.1	P81172	HEPC_HUMAN	hepcidin antimicrobial peptide	31				T -> M (in Ref. 3; AAK14912). {ECO:0000305}.	cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to fungus (GO:0050832)|immune response (GO:0006955)|killing of cells of other organism (GO:0031640)	apical cortex (GO:0045179)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TTTCACAGACGGGACAACTTG	0.622																																					p.T31T		Atlas-SNP	.											.	HAMP	14	.	0			c.G93A						.						72.0	72.0	72.0					19																	35775694		2203	4300	6503	SO:0001819	synonymous_variant	57817	exon2			ACAGACGGGACAA	AF309489	CCDS12454.1	19q13.1	2014-09-17				ENSG00000105697			15598	protein-coding gene	gene with protein product		606464				11034317, 11113132	Standard	NM_021175		Approved	LEAP-1, HEPC, HFE2B, LEAP1	uc002nyw.3	P81172		ENST00000598398.1:c.93G>A	chr19.hg19:g.35775694G>A		74.0	0.0		113.0	41.0	NM_021175	Q1HE14|Q9BY68	Silent	SNP	ENST00000598398.1	hg19	CCDS12454.1																																																																																			.	.		0.622	HAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466067.1	NM_021175	
ARHGAP33	115703	hgsc.bcm.edu	37	19	36273524	36273524	+	Missense_Mutation	SNP	A	A	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr19:36273524A>G	ENST00000007510.4	+	14	1400	c.1256A>G	c.(1255-1257)gAg>gGg	p.E419G	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.E419G|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.E283G			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	419	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CCTGGGGAGGAGGAGCGTCTG	0.657																																					p.E419G		Atlas-SNP	.											.	ARHGAP33	102	.	0			c.A1256G						.						39.0	35.0	37.0					19																	36273524		2203	4300	6503	SO:0001583	missense	115703	exon14			GGGAGGAGGAGCG	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.1256A>G	chr19.hg19:g.36273524A>G	ENSP00000007510:p.Glu419Gly	38.0	0.0		53.0	20.0	NM_052948	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	hg19		.	.	.	.	.	.	.	.	.	.	a	25.4	4.638024	0.87760	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.21031	2.03;2.03;2.03	5.19	5.19	0.71726	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.063750	0.64402	D	0.000014	T	0.40322	0.1112	M	0.77103	2.36	0.58432	D	0.999993	P;P;D	0.54772	0.738;0.524;0.968	B;B;P	0.53912	0.349;0.334;0.737	T	0.41980	-0.9478	10	0.87932	D	0	.	14.0346	0.64638	1.0:0.0:0.0:0.0	.	419;283;419	O14559;O14559-10;O14559-11	RHG33_HUMAN;.;.	G	419;419;283	ENSP00000007510:E419G;ENSP00000320038:E419G;ENSP00000368227:E283G	ENSP00000007510:E419G	E	+	2	0	ARHGAP33	40965364	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	6.045000	0.71020	1.976000	0.57569	0.456000	0.33151	GAG	.	.		0.657	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
PRX	57716	hgsc.bcm.edu	37	19	40902988	40902988	+	Missense_Mutation	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr19:40902988G>A	ENST00000324001.7	-	7	1541	c.1271C>T	c.(1270-1272)tCc>tTc	p.S424F	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	424					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GATGCCAAGGGAGGGCATCTT	0.602																																					p.S424F		Atlas-SNP	.											.	PRX	151	.	0			c.C1271T						.						55.0	60.0	58.0					19																	40902988		2203	4299	6502	SO:0001583	missense	57716	exon7			CCAAGGGAGGGCA	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1271C>T	chr19.hg19:g.40902988G>A	ENSP00000326018:p.Ser424Phe	85.0	0.0		139.0	52.0	NM_181882	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	hg19	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870556	0.72065	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.02345	4.33	4.65	4.65	0.58169	.	0.142496	0.32802	N	0.005639	T	0.12475	0.0303	M	0.75447	2.3	0.80722	D	1	D	0.57571	0.98	P	0.58331	0.837	T	0.00383	-1.1774	10	0.72032	D	0.01	-16.8049	16.4602	0.84033	0.0:0.0:1.0:0.0	.	424	Q9BXM0	PRAX_HUMAN	F	424	ENSP00000326018:S424F	ENSP00000326018:S424F	S	-	2	0	PRX	45594828	0.799000	0.28903	0.992000	0.48379	0.717000	0.41224	2.458000	0.45014	2.408000	0.81797	0.655000	0.94253	TCC	.	.		0.602	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
CYP2A7	1549	hgsc.bcm.edu	37	19	41386034	41386034	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr19:41386034G>T	ENST00000301146.4	-	4	1150	c.609C>A	c.(607-609)agC>agA	p.S203R	CTC-490E21.12_ENST00000601627.1_Intron|CYP2A7_ENST00000291764.3_Missense_Mutation_p.S152R	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	203						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			CTAGCATCATGCTCAGCAGTG	0.567																																					p.S203R		Atlas-SNP	.											.	CYP2A7	71	.	0			c.C609A						.						166.0	138.0	147.0					19																	41386034		2203	4300	6503	SO:0001583	missense	1549	exon4			CATCATGCTCAGC	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.609C>A	chr19.hg19:g.41386034G>T	ENSP00000301146:p.Ser203Arg	74.0	0.0		108.0	46.0	NM_000764	Q13121	Missense_Mutation	SNP	ENST00000301146.4	hg19	CCDS12569.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.362909	0.00212	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.67698	-0.28;-0.28	1.95	-3.89	0.04193	.	0.977016	0.08403	N	0.951060	T	0.28001	0.0690	N	0.02111	-0.68	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.08513	-1.0718	10	0.09843	T	0.71	.	0.6051	0.00751	0.2064:0.286:0.1348:0.3728	.	203;152;203	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	R	203;152	ENSP00000301146:S203R;ENSP00000291764:S152R	ENSP00000291764:S152R	S	-	3	2	CYP2A7	46077874	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-3.349000	0.00502	-2.394000	0.00583	0.175000	0.17021	AGC	.	.		0.567	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	
IGFL4	444882	hgsc.bcm.edu	37	19	46543655	46543655	+	Silent	SNP	G	G	A			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr19:46543655G>A	ENST00000377697.1	-	3	143	c.90C>T	c.(88-90)tgC>tgT	p.C30C	IGFL4_ENST00000595006.1_5'UTR|IGFL4_ENST00000601672.1_5'UTR	NM_001002923.1	NP_001002923.1	Q6B9Z1	IGFL4_HUMAN	IGF-like family member 4	30						extracellular space (GO:0005615)				cervix(1)|kidney(1)|lung(1)	3		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		GCGCTGGCTGGCATAGCCACA	0.602																																					p.C30C		Atlas-SNP	.											.	IGFL4	13	.	0			c.C90T						.						84.0	75.0	78.0					19																	46543655		2203	4300	6503	SO:0001819	synonymous_variant	444882	exon3			TGGCTGGCATAGC	AY672114	CCDS33057.1	19q13.32	2006-07-14							32931	protein-coding gene	gene with protein product		610547				14702039	Standard	NM_001002923		Approved		uc002pdy.1	Q6B9Z1		ENST00000377697.1:c.90C>T	chr19.hg19:g.46543655G>A		65.0	0.0		101.0	45.0	NM_001002923		Silent	SNP	ENST00000377697.1	hg19	CCDS33057.1																																																																																			.	.		0.602	IGFL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461698.1	NM_001002923	
NCOA6	23054	hgsc.bcm.edu	37	20	33329069	33329069	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr20:33329069G>T	ENST00000374796.2	-	12	7561	c.4991C>A	c.(4990-4992)tCc>tAc	p.S1664Y	NCOA6_ENST00000359003.2_Missense_Mutation_p.S1664Y			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	1664	EP300/CRSP3-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						AATTATTGAGGATGAATTGAT	0.488																																					p.S1664Y		Atlas-SNP	.											.	NCOA6	219	.	0			c.C4991A						.						111.0	109.0	110.0					20																	33329069		2203	4300	6503	SO:0001583	missense	23054	exon11			ATTGAGGATGAAT	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.4991C>A	chr20.hg19:g.33329069G>T	ENSP00000363929:p.Ser1664Tyr	82.0	0.0		113.0	31.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244413	0.59103	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.28255	1.62;1.62	5.46	3.44	0.39384	.	0.076753	0.56097	D	0.000029	T	0.20861	0.0502	N	0.24115	0.695	0.36143	D	0.846958	B	0.24823	0.112	B	0.24541	0.054	T	0.20009	-1.0288	10	0.51188	T	0.08	-7.8052	11.341	0.49533	0.0687:0.1263:0.8051:0.0	.	1664	Q14686	NCOA6_HUMAN	Y	1664	ENSP00000363929:S1664Y;ENSP00000351894:S1664Y	ENSP00000351894:S1664Y	S	-	2	0	NCOA6	32792730	1.000000	0.71417	0.999000	0.59377	0.913000	0.54294	4.883000	0.63128	1.554000	0.49487	-0.229000	0.12294	TCC	.	.		0.488	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
BID	637	hgsc.bcm.edu	37	22	18256445	18256445	+	Intron	SNP	C	C	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr22:18256445C>T	ENST00000399774.3	-	1	112				BID_ENST00000473439.1_Intron|BID_ENST00000342111.5_Intron|BID_ENST00000399765.1_Intron|BID_ENST00000551952.1_Intron|BID_ENST00000399767.1_Intron|BID_ENST00000317361.7_Missense_Mutation_p.G4D	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)			large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		GACCCCAGCACCGCTGCACAT	0.637																																					p.G4D		Atlas-SNP	.											.	BID	18	.	0			c.G11A						.						34.0	36.0	35.0					22																	18256445		2203	4300	6503	SO:0001627	intron_variant	637	exon1			CCAGCACCGCTGC	AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.57+701G>A	chr22.hg19:g.18256445C>T		72.0	0.0		31.0	24.0	NM_197966	Q549M7|Q71T04|Q7Z4M9|Q8IY86	Missense_Mutation	SNP	ENST00000399774.3	hg19	CCDS13748.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.312375	0.23908	.	.	ENSG00000015475	ENST00000317361	T	0.28255	1.62	2.66	1.54	0.23209	.	.	.	.	.	T	0.16214	0.0390	N	0.08118	0	0.18873	N	0.999989	B	0.20780	0.048	B	0.25291	0.059	T	0.26677	-1.0096	9	0.87932	D	0	.	6.9407	0.24490	0.2741:0.7259:0.0:0.0	.	4	P55957-2	.	D	4	ENSP00000318822:G4D	ENSP00000318822:G4D	G	-	2	0	BID	16636445	0.003000	0.15002	0.001000	0.08648	0.005000	0.04900	1.163000	0.31798	0.371000	0.24564	0.313000	0.20887	GGT	.	.		0.637	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316178.1	NM_197966	
MYO18B	84700	hgsc.bcm.edu	37	22	26422950	26422950	+	Missense_Mutation	SNP	C	C	G			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr22:26422950C>G	ENST00000407587.2	+	43	7182	c.7013C>G	c.(7012-7014)aCa>aGa	p.T2338R	MYO18B_ENST00000536101.1_Missense_Mutation_p.T2337R|MYO18B_ENST00000335473.7_Missense_Mutation_p.T2337R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2337						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GTTGGGGGCACAACCCTACTC	0.557																																					p.T2337R		Atlas-SNP	.											.	MYO18B	322	.	0			c.C7010G						.						51.0	59.0	57.0					22																	26422950		1921	4132	6053	SO:0001583	missense	84700	exon43			GGGGCACAACCCT	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7013C>G	chr22.hg19:g.26422950C>G	ENSP00000386096:p.Thr2338Arg	23.0	0.0		34.0	22.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.186|9.186	1.024779|1.024779	0.19433|0.19433	.|.	.|.	ENSG00000133454|ENSG00000133454	ENST00000543971|ENST00000536101;ENST00000335473;ENST00000407587	.|D;D;D	.|0.86956	.|-2.17;-2.17;-2.19	4.89|4.89	-2.39|-2.39	0.06602|0.06602	.|.	.|1.684560	.|0.03287	.|N	.|0.187077	D|D	0.82440|0.82440	0.5037|0.5037	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	.|P;P;P;P;P	.|0.49559	.|0.773;0.877;0.877;0.925;0.925	.|B;B;B;B;B	.|0.42422	.|0.387;0.216;0.216;0.387;0.387	T|T	0.73078|0.73078	-0.4096|-0.4096	5|10	.|0.52906	.|T	.|0.07	.|.	5.8496|5.8496	0.18685|0.18685	0.0:0.4647:0.1337:0.4016|0.0:0.4647:0.1337:0.4016	.|.	.|1850;2339;2337;2338;2337	.|Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.|.;.;MY18B_HUMAN;.;.	E|R	287|2337;2337;2338	.|ENSP00000441229:T2337R;ENSP00000334563:T2337R;ENSP00000386096:T2338R	.|ENSP00000334563:T2337R	Q|T	+|+	1|2	0|0	MYO18B|MYO18B	24752950|24752950	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.003000|-0.003000	0.12901|0.12901	-0.119000|-0.119000	0.11830|0.11830	-0.368000|-0.368000	0.07277|0.07277	CAA|ACA	.	.		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
PRKX	5613	hgsc.bcm.edu	37	X	3533926	3533926	+	Missense_Mutation	SNP	G	G	T			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chrX:3533926G>T	ENST00000262848.5	-	7	1235	c.881C>A	c.(880-882)gCg>gAg	p.A294E	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	294	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				CACATCATTCGCCCCGTTCTT	0.438																																					p.A294E		Atlas-SNP	.											.	PRKX	29	.	0			c.C881A						.						116.0	76.0	90.0					X																	3533926		2202	4300	6502	SO:0001583	missense	5613	exon7			TCATTCGCCCCGT		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.881C>A	chrX.hg19:g.3533926G>T	ENSP00000262848:p.Ala294Glu	112.0	0.0		39.0	4.0	NM_005044		Missense_Mutation	SNP	ENST00000262848.5	hg19	CCDS14125.1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043275	0.36085	.	.	ENSG00000183943	ENST00000262848	T	0.70399	-0.48	3.69	3.69	0.42338	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.056822	0.64402	D	0.000001	D	0.83631	0.5296	M	0.85777	2.775	0.80722	D	1	D	0.65815	0.995	D	0.66602	0.945	D	0.86437	0.1764	10	0.62326	D	0.03	-13.8201	13.6885	0.62531	0.0:0.0:1.0:0.0	.	294	P51817	PRKX_HUMAN	E	294	ENSP00000262848:A294E	ENSP00000262848:A294E	A	-	2	0	PRKX	3543926	1.000000	0.71417	0.039000	0.18376	0.018000	0.09664	5.443000	0.66581	1.479000	0.48272	0.589000	0.80489	GCG	.	.		0.438	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
MT-ND2	4536	hgsc.bcm.edu	37	M	5329	5329	+	Missense_Mutation	SNP	T	T	C			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chrM:5329T>C	ENST00000361453.3	+	1	860	c.860T>C	c.(859-861)cTc>cCc	p.L287P	MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	287					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CACCATCACCCTCCTTAACCT	0.443																																					p.L287P		Atlas-SNP	.											.	.	.	.	0			c.T860C						.																																			SO:0001583	missense	0	exon1			TCACCCTCCTTAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.860T>C	chrM.hg19:g.5329T>C	ENSP00000355046:p.Leu287Pro	43.0	0.0		53.0	4.0	ENST00000361453	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	hg19																																																																																				.	.		0.443	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024027	
ILDR1	286676	hgsc.bcm.edu	37	3	121712300	121712300	+	Frame_Shift_Del	DEL	C	C	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr3:121712300delC	ENST00000344209.5	-	7	1422	c.1296delG	c.(1294-1296)tggfs	p.W432fs	ILDR1_ENST00000393631.1_Frame_Shift_Del_p.W343fs|ILDR1_ENST00000273691.3_Frame_Shift_Del_p.W388fs|ILDR1_ENST00000462014.1_Frame_Shift_Del_p.W400fs|ILDR1_ENST00000460554.1_5'UTR	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	432	Arg-rich.				positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		GGCTCGGCCGCCAGCGTGCCT	0.662																																					p.R433fs		Atlas-Indel,Pindel	.											.	ILDR1	120	.	0			c.1297delC						.						37.0	34.0	35.0					3																	121712300		2203	4300	6503	SO:0001589	frameshift_variant	286676	exon7			.	BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.1296delG	chr3.hg19:g.121712300delC	ENSP00000345667:p.Trp432fs	66.0	0.0		109.0	47.0	NM_001199799	Q6ZP61|Q7Z578	Frame_Shift_Del	DEL	ENST00000344209.5	hg19	CCDS56271.1																																																																																			.	.		0.662	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355666.1	NM_175924	
TJP1	7082	hgsc.bcm.edu	37	15	30000996	30000997	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:30000996_30000997delAA	ENST00000346128.6	-	25	5090_5091	c.4616_4617delTT	c.(4615-4617)tttfs	p.F1539fs	TJP1_ENST00000356107.6_Frame_Shift_Del_p.F1539fs|TJP1_ENST00000400011.2_Frame_Shift_Del_p.F1463fs|TJP1_ENST00000545208.2_Frame_Shift_Del_p.F1459fs	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1539					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ACTTGCGTTCAAATGGTCGGGC	0.401																																					p.1539_1540del	Melanoma(77;681 1843 6309 6570)	Atlas-Indel,Pindel	.											.	TJP1	140	.	0			c.4617_4618del						.																																			SO:0001589	frameshift_variant	7082	exon25			.		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.4616_4617delTT	chr15.hg19:g.30000996_30000997delAA	ENSP00000281537:p.Phe1539fs	187.0	0.0		288.0	107.0	NM_003257	B4E3K1|Q2NKP3|Q4ZGJ6	Frame_Shift_Del	DEL	ENST00000346128.6	hg19	CCDS42007.1																																																																																			.	.		0.401	TJP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268237.3	NM_003257	
CLK3	1198	hgsc.bcm.edu	37	15	74919883	74919895	+	Frame_Shift_Del	DEL	TGTGAGGAGAAGT	TGTGAGGAGAAGT	-	rs149199059		TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	TGTGAGGAGAAGT	TGTGAGGAGAAGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr15:74919883_74919895delTGTGAGGAGAAGT	ENST00000395066.3	+	9	1821_1833	c.1360_1372delTGTGAGGAGAAGT	c.(1360-1374)tgtgaggagaagtcafs	p.CEEKS454fs	CLK3_ENST00000348245.3_3'UTR|CLK3_ENST00000345005.4_Frame_Shift_Del_p.CEEKS306fs|CLK3_ENST00000352989.5_Frame_Shift_Del_p.CEEKS283fs	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	454	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.E308E(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						CTTTCAGAGCTGTGAGGAGAAGTCAGTGAAGAA	0.587																																					p.453_457del	Ovarian(133;694 1754 28950 29027 31859)	Atlas-Indel,Pindel	.											.	CLK3	78	.	1	Substitution - coding silent(1)	breast(1)	c.1359_1371del						.																																			SO:0001589	frameshift_variant	1198	exon9			.	L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.1360_1372delTGTGAGGAGAAGT	chr15.hg19:g.74919883_74919895delTGTGAGGAGAAGT	ENSP00000378505:p.Cys454fs	83.0	0.0		105.0	38.0	NM_001130028	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Frame_Shift_Del	DEL	ENST00000395066.3	hg19	CCDS45304.1																																																																																			.	.		0.587	CLK3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390442.3		
GCN1L1	10985	hgsc.bcm.edu	37	12	120589173	120589174	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:120589173_120589174delCA	ENST00000300648.6	-	34	4096_4097	c.4084_4085delTG	c.(4084-4086)tgcfs	p.C1362fs		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1362					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGTGGCAAGCAGCTGGCTACG	0.594																																					p.1362_1362del		Atlas-INDEL	.											.	GCN1L1	207	.	0			c.4085_4086del						.																																			SO:0001589	frameshift_variant	10985	exon34			.	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4084_4085delTG	chr12.hg19:g.120589173_120589174delCA	ENSP00000300648:p.Cys1362fs	63.0	0.0		66.0	22.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Frame_Shift_Del	DEL	ENST00000300648.6	hg19	CCDS41847.1																																																																																			.	.		0.594	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
RELN	5649	hgsc.bcm.edu	37	7	103198496	103198496	+	Splice_Site	DEL	C	C	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr7:103198496delC	ENST00000428762.1	-	37	5689	c.5530delG	c.(5530-5532)gaa>aa	p.E1844fs	RELN_ENST00000343529.5_Splice_Site_p.E1844fs|RELN_ENST00000424685.2_Splice_Site_p.E1844fs	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1844					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTTAGTCCTTCCTGAAAATAA	0.274																																					p.E1844fs	NSCLC(146;835 1944 15585 22231 52158)	Atlas-Indel,Pindel	.											.	RELN	593	.	0			c.5531delA						.						61.0	61.0	61.0					7																	103198496		2199	4292	6491	SO:0001630	splice_region_variant	5649	exon37			.		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.5530-1G>-	chr7.hg19:g.103198496delC		191.0	0.0		284.0	105.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Frame_Shift_Del	DEL	ENST00000428762.1	hg19	CCDS47680.1																																																																																			.	.		0.274	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	Frame_Shift_Del
GCN1L1	10985	hgsc.bcm.edu	37	12	120589170	120589171	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:120589170_120589171delAA	ENST00000300648.6	-	34	4099_4100	c.4087_4088delTT	c.(4087-4089)ttgfs	p.L1363fs		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1363					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGGGGTGGCAAGCAGCTGGCT	0.604																																					p.1363_1363del		Atlas-INDEL	.											.	GCN1L1	207	.	0			c.4088_4089del						.																																			SO:0001589	frameshift_variant	10985	exon34			.	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4087_4088delTT	chr12.hg19:g.120589170_120589171delAA	ENSP00000300648:p.Leu1363fs	65.0	0.0		69.0	22.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Frame_Shift_Del	DEL	ENST00000300648.6	hg19	CCDS41847.1																																																																																			.	.		0.604	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
PRKX	5613	hgsc.bcm.edu	37	X	3533925	3533925	+	Frame_Shift_Del	DEL	C	C	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chrX:3533925delC	ENST00000262848.5	-	7	1236	c.882delG	c.(880-882)gcgfs	p.A294fs	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	294	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				TCACATCATTCGCCCCGTTCT	0.438																																					p.N295fs		Atlas-INDEL	.											.	PRKX	29	.	0			c.883delA						.						119.0	78.0	92.0					X																	3533925		2202	4300	6502	SO:0001589	frameshift_variant	5613	exon7			.		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.882delG	chrX.hg19:g.3533925delC	ENSP00000262848:p.Ala294fs	114.0	0.0		141.0	102.0	NM_005044		Frame_Shift_Del	DEL	ENST00000262848.5	hg19	CCDS14125.1																																																																																			.	.		0.438	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
PRKX	5613	hgsc.bcm.edu	37	X	3533930	3533930	+	Frame_Shift_Del	DEL	C	C	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chrX:3533930delC	ENST00000262848.5	-	7	1231	c.877delG	c.(877-879)gggfs	p.G293fs	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	293	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				TCATTCGCCCCGTTCTTCAAA	0.438																																					p.G293fs		Pindel	.											.	PRKX	29	.	0			c.878delG						.						112.0	75.0	88.0					X																	3533930		2202	4300	6502	SO:0001589	frameshift_variant	5613	exon7			.		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.877delG	chrX.hg19:g.3533930delC	ENSP00000262848:p.Gly293fs	112.0	0.0		144.0	37.0	NM_005044		Frame_Shift_Del	DEL	ENST00000262848.5	hg19	CCDS14125.1																																																																																			.	.		0.438	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
PRKX	5613	hgsc.bcm.edu	37	X	3533925	3533926	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chrX:3533925_3533926delCG	ENST00000262848.5	-	7	1235_1236	c.881_882delCG	c.(880-882)gcgfs	p.A294fs	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	294	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				TCACATCATTCGCCCCGTTCTT	0.436																																					p.294_295del		Pindel	.											.	PRKX	29	.	0			c.882_883del						.																																			SO:0001589	frameshift_variant	5613	exon7			.		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.881_882delCG	chrX.hg19:g.3533925_3533926delCG	ENSP00000262848:p.Ala294fs	113.0	0.0		143.0	17.0	NM_005044		Frame_Shift_Del	DEL	ENST00000262848.5	hg19	CCDS14125.1																																																																																			.	.		0.436	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
GCN1L1	10985	hgsc.bcm.edu	37	12	120589170	120589174	+	Frame_Shift_Del	DEL	AAGCA	AAGCA	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	AAGCA	AAGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr12:120589170_120589174delAAGCA	ENST00000300648.6	-	34	4096_4100	c.4084_4088delTGCTT	c.(4084-4089)tgcttgfs	p.CL1362fs		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1362					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AAGGGGTGGCAAGCAGCTGGCTACG	0.6																																					p.1362_1363del		Pindel	.											.	GCN1L1	207	.	0			c.4085_4089del						.																																			SO:0001589	frameshift_variant	10985	exon34			.	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.4084_4088delTGCTT	chr12.hg19:g.120589170_120589174delAAGCA	ENSP00000300648:p.Cys1362fs	65.0	0.0		68.0	22.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Frame_Shift_Del	DEL	ENST00000300648.6	hg19	CCDS41847.1																																																																																			.	.		0.600	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
CACNA1G	8913	hgsc.bcm.edu	37	17	48653551	48653551	+	Frame_Shift_Del	DEL	C	C	-			TCGA-T1-A6J8-01A-11D-A32G-10	TCGA-T1-A6J8-10A-01D-A32G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a537d6e4-82a8-4627-a88b-5173d666e2f1	b3cc3039-470f-4d68-9bd1-f2fb51d0d468	g.chr17:48653551delC	ENST00000359106.5	+	8	1788	c.1788delC	c.(1786-1788)agcfs	p.S596fs	CACNA1G_ENST00000507510.2_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000514079.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000354983.4_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000513689.2_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000507336.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000507609.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000503485.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000352832.5_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000512389.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000360761.4_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000515411.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000513964.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000515165.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000510115.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000507896.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000429973.2_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000442258.2_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000514717.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000502264.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000515765.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000416767.4_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000510366.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000514181.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000505165.1_Frame_Shift_Del_p.S596fs|CACNA1G_ENST00000358244.5_Frame_Shift_Del_p.S596fs	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	596					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGCACACCAGCCCTCCACCGG	0.667																																					p.S596fs		Pindel	.											.	CACNA1G	659	.	0			c.1787delG						.						16.0	20.0	19.0					17																	48653551		2058	4194	6252	SO:0001589	frameshift_variant	8913	exon8			.	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.1788delC	chr17.hg19:g.48653551delC	ENSP00000352011:p.Ser596fs	79.0	0.0		111.0	36.0	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Frame_Shift_Del	DEL	ENST00000359106.5	hg19	CCDS45730.1																																																																																			.	.		0.667	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
