#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PER3	8863	hgsc.bcm.edu	37	1	7887311	7887311	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:7887311C>T	ENST00000361923.2	+	17	2473	c.2298C>T	c.(2296-2298)aaC>aaT	p.N766N	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Silent_p.N774N	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	766					circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		CGCATCAGAACGCACAGCCCT	0.692																																					p.N766N		Atlas-SNP	.											.	PER3	95	.	0			c.C2298T						.						37.0	43.0	41.0					1																	7887311		2203	4299	6502	SO:0001819	synonymous_variant	8863	exon17			TCAGAACGCACAG	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.2298C>T	chr1.hg19:g.7887311C>T		158.0	0.0		115.0	23.0	NM_016831	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Silent	SNP	ENST00000361923.2	hg19	CCDS89.1																																																																																			.	.		0.692	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
TMEM51	55092	hgsc.bcm.edu	37	1	15541785	15541785	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:15541785G>A	ENST00000428417.1	+	2	648	c.202G>A	c.(202-204)Gtg>Atg	p.V68M	TMEM51_ENST00000434578.2_Missense_Mutation_p.V68M|TMEM51_ENST00000376014.3_Missense_Mutation_p.V68M|TMEM51_ENST00000376008.2_Missense_Mutation_p.V68M|TMEM51_ENST00000400796.3_Missense_Mutation_p.V68M	NM_001136217.1	NP_001129689.1	Q9NW97	TMM51_HUMAN	transmembrane protein 51	68						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(3)|large_intestine(2)|lung(5)|prostate(2)	14		Renal(390;0.00145)|Breast(348;0.00186)|Colorectal(325;0.00215)|all_lung(284;0.00459)|Lung NSC(340;0.0104)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;2.07e-06)|COAD - Colon adenocarcinoma(227;7.14e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000175)|KIRC - Kidney renal clear cell carcinoma(229;0.00141)|STAD - Stomach adenocarcinoma(313;0.00644)|READ - Rectum adenocarcinoma(331;0.0751)		TGTGGCCTACGTGCTGGTCGG	0.627																																					p.V68M		Atlas-SNP	.											.	TMEM51	28	.	0			c.G202A						.						123.0	115.0	117.0					1																	15541785		2203	4300	6503	SO:0001583	missense	55092	exon2			GCCTACGTGCTGG	AK098467	CCDS154.1	1p36.21	2008-02-05	2005-05-22	2005-05-22	ENSG00000171729	ENSG00000171729			25488	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 72"""	C1orf72		12477932	Standard	NM_018022		Approved	FLJ10199	uc001avx.3	Q9NW97	OTTHUMG00000002046	ENST00000428417.1:c.202G>A	chr1.hg19:g.15541785G>A	ENSP00000394899:p.Val68Met	64.0	0.0		50.0	6.0	NM_018022	A8K819	Missense_Mutation	SNP	ENST00000428417.1	hg19	CCDS154.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.863707	0.91511	.	.	ENSG00000171729	ENST00000428417;ENST00000376014;ENST00000451326;ENST00000434578;ENST00000400796;ENST00000376008;ENST00000303840	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75673	-0.3236	10	0.87932	D	0	-1.7495	18.2265	0.89918	0.0:0.0:1.0:0.0	.	68;68	Q9BSA0;Q9NW97	.;TMM51_HUMAN	M	68	ENSP00000394899:V68M;ENSP00000365182:V68M;ENSP00000412298:V68M;ENSP00000409665:V68M;ENSP00000383600:V68M;ENSP00000365176:V68M	ENSP00000303666:V68M	V	+	1	0	TMEM51	15414372	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	8.744000	0.91596	2.564000	0.86499	0.655000	0.94253	GTG	.	.		0.627	TMEM51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005699.3	NM_018022	
RSRP1	57035	hgsc.bcm.edu	37	1	25571731	25571731	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:25571731G>A	ENST00000243189.7	-	3	858	c.582C>T	c.(580-582)aaC>aaT	p.N194N	C1orf63_ENST00000417642.2_Silent_p.N187N|RP3-465N24.6_ENST00000607698.1_lincRNA|C1orf63_ENST00000431849.2_Silent_p.N194N	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		194										breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCAAGTCAATGTTGGTTGTTC	0.378																																					p.N194N		Atlas-SNP	.											.	C1orf63	17	.	0			c.C582T						.						150.0	135.0	140.0					1																	25571731		2203	4300	6503	SO:0001819	synonymous_variant	57035	exon3			GTCAATGTTGGTT																												ENST00000243189.7:c.582C>T	chr1.hg19:g.25571731G>A		67.0	0.0		55.0	7.0	NM_020317	A8K917|Q49AA4|Q5TH71|Q9GZP6	Silent	SNP	ENST00000243189.7	hg19	CCDS260.1																																																																																			.	.		0.378	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000101966.2		
SLC9A1	6548	hgsc.bcm.edu	37	1	27440501	27440501	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:27440501G>A	ENST00000263980.3	-	2	1204	c.629C>T	c.(628-630)gCc>gTc	p.A210V	SLC9A1_ENST00000545949.1_Intron|SLC9A1_ENST00000374086.3_Missense_Mutation_p.A210V	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	210					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CAGGCACACGGCGTACATGAG	0.627																																					p.A210V		Atlas-SNP	.											.	SLC9A1	68	.	0			c.C629T						.						94.0	77.0	83.0					1																	27440501		2203	4300	6503	SO:0001583	missense	6548	exon2			CACACGGCGTACA	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.629C>T	chr1.hg19:g.27440501G>A	ENSP00000263980:p.Ala210Val	87.0	0.0		93.0	25.0	NM_003047	B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	ENST00000263980.3	hg19	CCDS295.1	.	.	.	.	.	.	.	.	.	.	G	32	5.150636	0.94645	.	.	ENSG00000090020	ENST00000263980;ENST00000374086	T;T	0.15139	2.45;2.45	5.8	5.8	0.92144	Cation/H+ exchanger (1);	0.045679	0.85682	D	0.000000	T	0.36690	0.0976	M	0.65498	2.005	0.80722	D	1	P;P	0.48764	0.915;0.784	P;B	0.54889	0.763;0.213	T	0.01349	-1.1378	10	0.51188	T	0.08	.	19.0453	0.93018	0.0:0.0:1.0:0.0	.	210;210	P19634-2;P19634	.;SL9A1_HUMAN	V	210	ENSP00000263980:A210V;ENSP00000363199:A210V	ENSP00000263980:A210V	A	-	2	0	SLC9A1	27313088	0.998000	0.40836	0.999000	0.59377	0.883000	0.51084	2.429000	0.44758	2.751000	0.94390	0.655000	0.94253	GCC	.	.		0.627	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
BAI2	576	hgsc.bcm.edu	37	1	32202242	32202242	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:32202242G>A	ENST00000373658.3	-	21	3403	c.3062C>T	c.(3061-3063)tCc>tTc	p.S1021F	BAI2_ENST00000373655.2_Missense_Mutation_p.S1021F|BAI2_ENST00000398556.3_Missense_Mutation_p.S969F|BAI2_ENST00000465256.1_5'UTR|BAI2_ENST00000398538.1_Missense_Mutation_p.S1009F|BAI2_ENST00000527361.1_Missense_Mutation_p.S1021F|BAI2_ENST00000398547.1_Missense_Mutation_p.S954F|BAI2_ENST00000398542.1_Missense_Mutation_p.S954F|BAI2_ENST00000257070.4_Missense_Mutation_p.S1021F|BAI2_ENST00000440175.2_Missense_Mutation_p.S663F	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	1021					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		AGCCAGGTAGGACTGCCAGGC	0.632																																					p.S1021F		Atlas-SNP	.											.	BAI2	128	.	0			c.C3062T						.						80.0	66.0	71.0					1																	32202242		2203	4300	6503	SO:0001583	missense	576	exon21			AGGTAGGACTGCC	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.3062C>T	chr1.hg19:g.32202242G>A	ENSP00000362762:p.Ser1021Phe	168.0	0.0		133.0	10.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	hg19	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265003	0.80358	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538	T;T;T;T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22;1.22	4.66	4.66	0.58398	GPCR, family 2-like (1);	0.000000	0.40385	N	0.001110	T	0.52901	0.1763	L	0.43923	1.385	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.997;1.0;0.999	T	0.51276	-0.8726	10	0.42905	T	0.14	.	17.5532	0.87882	0.0:0.0:1.0:0.0	.	1021;1009;663;1021;1021	O60241-4;O60241-3;B4DKC3;O60241-2;O60241	.;.;.;.;BAI2_HUMAN	F	969;954;1021;1021;954;1021;1021;663;1009	ENSP00000381564:S969F;ENSP00000381555:S954F;ENSP00000362762:S1021F;ENSP00000362759:S1021F;ENSP00000381550:S954F;ENSP00000257070:S1021F;ENSP00000435397:S1021F;ENSP00000391071:S663F;ENSP00000381548:S1009F	ENSP00000257070:S1021F	S	-	2	0	BAI2	31974829	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.864000	0.99589	2.312000	0.78011	0.462000	0.41574	TCC	.	.		0.632	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
NDC1	55706	hgsc.bcm.edu	37	1	54269665	54269665	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:54269665G>T	ENST00000371429.3	-	10	1600	c.1002C>A	c.(1000-1002)gaC>gaA	p.D334E	NDC1_ENST00000537333.1_5'UTR|NDC1_ENST00000234725.8_Missense_Mutation_p.D219E|NDC1_ENST00000540001.1_Missense_Mutation_p.D334E	NM_001168551.1|NM_018087.4	NP_001162023.1|NP_060557.3	Q9BTX1	NDC1_HUMAN	NDC1 transmembrane nucleoporin	334					mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore distribution (GO:0031081)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)										GCAACATCAGGTCCTGCAAGG	0.338																																					p.D334E		Atlas-SNP	.											.	TMEM48	47	.	0			c.C1002A						.						150.0	153.0	152.0					1																	54269665		2203	4300	6503	SO:0001583	missense	55706	exon10			CATCAGGTCCTGC	AL354613	CCDS583.1	1p32.3	2014-01-28	2013-05-23	2013-05-23	ENSG00000058804	ENSG00000058804			25525	protein-coding gene	gene with protein product	"""nuclear division cycle 1 homolog (S. cerevisiae)"""	610115	"""transmembrane protein 48"""	TMEM48		16779818, 12958361	Standard	NR_033142		Approved	FLJ10407, NET3		Q9BTX1	OTTHUMG00000008073	ENST00000371429.3:c.1002C>A	chr1.hg19:g.54269665G>T	ENSP00000360483:p.Asp334Glu	216.0	0.0		163.0	54.0	NM_018087	B4DHA3|B4DQQ5|G3XA81|Q8NB76|Q9H9T6|Q9NSG3|Q9NSG4|Q9NVZ7	Missense_Mutation	SNP	ENST00000371429.3	hg19	CCDS583.1	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854563	0.71719	.	.	ENSG00000058804	ENST00000371429;ENST00000360494;ENST00000540001;ENST00000234725	T;T;T	0.28895	1.59;1.59;1.59	5.62	3.73	0.42828	.	0.044992	0.85682	D	0.000000	T	0.45657	0.1353	M	0.73962	2.25	0.52099	D	0.999945	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.56456	-0.7976	10	0.02654	T	1	.	8.8221	0.35032	0.2294:0.0:0.7706:0.0	.	294;334	B4DHA3;Q9BTX1	.;NDC1_HUMAN	E	334;334;334;219	ENSP00000360483:D334E;ENSP00000440873:D334E;ENSP00000234725:D219E	ENSP00000234725:D219E	D	-	3	2	TMEM48	54042253	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.577000	0.46042	1.381000	0.46364	0.543000	0.68304	GAC	.	.		0.338	NDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022101.1	NM_018087	
JUN	3725	hgsc.bcm.edu	37	1	59247776	59247776	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:59247776T>C	ENST00000371222.2	-	1	2009	c.967A>G	c.(967-969)Atg>Gtg	p.M323V		NM_002228.3	NP_002219.1	P05412	JUN_HUMAN	jun proto-oncogene	323					aging (GO:0007568)|angiogenesis (GO:0001525)|axon regeneration (GO:0031103)|cellular response to calcium ion (GO:0071277)|cellular response to potassium ion starvation (GO:0051365)|circadian rhythm (GO:0007623)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leading edge cell differentiation (GO:0035026)|learning (GO:0007612)|liver development (GO:0001889)|membrane depolarization (GO:0051899)|microglial cell activation (GO:0001774)|monocyte differentiation (GO:0030224)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA binding (GO:0043392)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990441)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA replication (GO:0045740)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|SMAD protein import into nucleus (GO:0007184)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nuclear chromosome (GO:0000228)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|R-SMAD binding (GO:0070412)|Rho GTPase activator activity (GO:0005100)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|kidney(2)|lung(5)|skin(1)	10	all_cancers(7;8.55e-07)				Arsenic trioxide(DB01169)|Irbesartan(DB01029)|Pseudoephedrine(DB00852)|Vinblastine(DB00570)	TGCGTTAGCATGAGTTGGCAC	0.498			A		sarcoma						OREG0013518	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M323V		Atlas-SNP	.		Dom	yes		1	1p32-p31	3725	jun oncogene		M	.	JUN	26	.	0			c.A967G						.						114.0	111.0	112.0					1																	59247776		2203	4300	6503	SO:0001583	missense	3725	exon1			TTAGCATGAGTTG	AY217548	CCDS610.1	1p32-p31	2013-01-10	2010-08-27		ENSG00000177606	ENSG00000177606		"""basic leucine zipper proteins"""	6204	protein-coding gene	gene with protein product		165160	"""v-jun avian sarcoma virus 17 oncogene homolog"", ""v-jun sarcoma virus 17 oncogene homolog (avian)"", ""jun oncogene"""			3194415	Standard	NM_002228		Approved	c-Jun, AP-1	uc001cze.3	P05412	OTTHUMG00000008376	ENST00000371222.2:c.967A>G	chr1.hg19:g.59247776T>C	ENSP00000360266:p.Met323Val	131.0	0.0	1037	87.0	33.0	NM_002228	Q6FHM7|Q96G93	Missense_Mutation	SNP	ENST00000371222.2	hg19	CCDS610.1	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463108	0.43736	.	.	ENSG00000177606	ENST00000371222	T	0.22945	1.93	4.09	4.09	0.47781	.	0.045766	0.85682	D	0.000000	T	0.30039	0.0752	L	0.54323	1.7	0.58432	D	0.999993	P	0.37985	0.613	B	0.41466	0.358	T	0.16276	-1.0408	10	0.72032	D	0.01	-20.9304	13.2541	0.60068	0.0:0.0:0.0:1.0	.	323	P05412	JUN_HUMAN	V	323	ENSP00000360266:M323V	ENSP00000360266:M323V	M	-	1	0	JUN	59020364	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.044000	0.71012	1.713000	0.51359	0.459000	0.35465	ATG	.	.		0.498	JUN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023042.1	NM_002228	
C1orf87	127795	hgsc.bcm.edu	37	1	60506733	60506733	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:60506733C>A	ENST00000371201.3	-	4	520	c.413G>T	c.(412-414)gGc>gTc	p.G138V	C1orf87_ENST00000450089.2_Intron	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	138							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						CCTGGGAATGCCATGCACATA	0.483																																					p.G138V	NSCLC(75;811 1386 4923 13371 51772)	Atlas-SNP	.											.	C1orf87	55	.	0			c.G413T						.						141.0	121.0	128.0					1																	60506733		2203	4300	6503	SO:0001583	missense	127795	exon4			GGAATGCCATGCA	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.413G>T	chr1.hg19:g.60506733C>A	ENSP00000360244:p.Gly138Val	205.0	0.0		177.0	79.0	NM_152377	Q6ZU07|Q8IVS0	Missense_Mutation	SNP	ENST00000371201.3	hg19	CCDS614.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.534068	0.45073	.	.	ENSG00000162598	ENST00000371201	T	0.22743	1.94	5.25	4.33	0.51752	.	0.215706	0.33040	N	0.005349	T	0.34803	0.0910	L	0.56769	1.78	0.80722	D	1	D	0.57257	0.979	P	0.61658	0.892	T	0.09796	-1.0658	10	0.72032	D	0.01	-7.3235	7.2841	0.26328	0.0:0.7404:0.1704:0.0892	.	138	Q8N0U7	CA087_HUMAN	V	138	ENSP00000360244:G138V	ENSP00000360244:G138V	G	-	2	0	C1orf87	60279321	0.959000	0.32827	0.915000	0.36163	0.292000	0.27327	0.389000	0.20751	1.445000	0.47624	0.305000	0.20034	GGC	.	.		0.483	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024943.1	NM_152377	
IL12RB2	3595	hgsc.bcm.edu	37	1	67852322	67852322	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:67852322G>A	ENST00000262345.1	+	14	2556	c.1916G>A	c.(1915-1917)gGc>gAc	p.G639D	IL12RB2_ENST00000371000.1_Missense_Mutation_p.G639D|IL12RB2_ENST00000544434.1_Missense_Mutation_p.G553D|IL12RB2_ENST00000541374.1_Missense_Mutation_p.G639D|IL12RB2_ENST00000465396.1_3'UTR	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	639					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						ATCATGGTGGGCATTTTCTCA	0.418																																					p.G639D		Atlas-SNP	.											.	IL12RB2	94	.	0			c.G1916A						.						227.0	192.0	204.0					1																	67852322		2203	4300	6503	SO:0001583	missense	3595	exon14			TGGTGGGCATTTT	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1916G>A	chr1.hg19:g.67852322G>A	ENSP00000262345:p.Gly639Asp	172.0	0.0		123.0	54.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	hg19	CCDS638.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.095174	0.76870	.	.	ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434	T;T;T;T	0.46063	0.88;1.01;1.01;1.55	4.96	4.96	0.65561	.	0.348277	0.34291	N	0.004086	T	0.52158	0.1717	M	0.67953	2.075	0.40844	D	0.983698	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.993;0.982;0.995	T	0.48811	-0.9002	10	0.35671	T	0.21	-21.2028	14.0762	0.64891	0.0:0.0:1.0:0.0	.	553;639;639	F5H7L6;Q99665-2;Q99665	.;.;I12R2_HUMAN	D	639;639;639;553	ENSP00000262345:G639D;ENSP00000360039:G639D;ENSP00000445276:G639D;ENSP00000442443:G553D	ENSP00000262345:G639D	G	+	2	0	IL12RB2	67624910	0.989000	0.36119	0.987000	0.45799	0.983000	0.72400	1.871000	0.39539	2.469000	0.83416	0.551000	0.68910	GGC	.	.		0.418	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
HS2ST1	9653	hgsc.bcm.edu	37	1	87563588	87563588	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:87563588C>A	ENST00000370550.5	+	5	1019	c.656C>A	c.(655-657)cCg>cAg	p.P219Q	RP5-1052I5.2_ENST00000370548.2_Missense_Mutation_p.P193Q|HS2ST1_ENST00000370551.4_Missense_Mutation_p.P219Q|HS2ST1_ENST00000356813.4_Missense_Mutation_p.P193Q	NM_012262.3	NP_036394.1	Q7LGA3	HS2ST_HUMAN	heparan sulfate 2-O-sulfotransferase 1	219					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	sulfotransferase activity (GO:0008146)	p.P219L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)	9		Lung NSC(277;0.153)		all cancers(265;0.00699)|Epithelial(280;0.0261)		CTTCAAATCCCGTTCTTCTGT	0.453																																					p.P219Q		Atlas-SNP	.											HS2ST1_ENST00000370548,NS,malignant_melanoma,+1,1	HS2ST1	43	.	1	Substitution - Missense(1)	large_intestine(1)	c.C656A						.						152.0	144.0	147.0					1																	87563588		2203	4300	6503	SO:0001583	missense	9653	exon5			AAATCCCGTTCTT	AB007917	CCDS711.1, CCDS44171.1	1p22.3	2008-02-05			ENSG00000153936	ENSG00000153936		"""Sulfotransferases, membrane-bound"""	5193	protein-coding gene	gene with protein product		604844				9455484	Standard	NM_012262		Approved	KIAA0448	uc010osk.2	Q7LGA3	OTTHUMG00000010255	ENST00000370550.5:c.656C>A	chr1.hg19:g.87563588C>A	ENSP00000359581:p.Pro219Gln	103.0	0.0		166.0	33.0	NM_012262	D3DT22|O75036|Q32NB5|Q8TAC5|Q9H441|Q9NUJ9	Missense_Mutation	SNP	ENST00000370550.5	hg19	CCDS711.1	.	.	.	.	.	.	.	.	.	.	C	34	5.342786	0.95783	.	.	ENSG00000153936	ENST00000370551;ENST00000370550;ENST00000370548;ENST00000356813	D;D;D	0.81739	-1.53;-1.53;-1.53	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.87819	0.6273	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;0.987	D;P	0.78314	0.991;0.891	D	0.85234	0.1034	10	0.35671	T	0.21	-34.4699	19.6092	0.95599	0.0:1.0:0.0:0.0	.	219;193	Q7LGA3;Q7LGA3-2	HS2ST_HUMAN;.	Q	219;219;193;193	ENSP00000359581:P219Q;ENSP00000359579:P193Q;ENSP00000349268:P193Q	ENSP00000349268:P193Q	P	+	2	0	HS2ST1	87336176	1.000000	0.71417	0.983000	0.44433	0.964000	0.63967	7.776000	0.85560	2.693000	0.91896	0.655000	0.94253	CCG	.	.		0.453	HS2ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028279.2	NM_012262	
GBP7	388646	hgsc.bcm.edu	37	1	89615112	89615112	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:89615112C>T	ENST00000294671.2	-	7	1153	c.1015G>A	c.(1015-1017)Gcc>Acc	p.A339T		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	339						membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		ACTTGCTGGGCCATCTGCTGG	0.562																																					p.A339T		Atlas-SNP	.											.	GBP7	57	.	0			c.G1015A						.						122.0	109.0	113.0					1																	89615112		2203	4300	6503	SO:0001583	missense	388646	exon7			GCTGGGCCATCTG	AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.1015G>A	chr1.hg19:g.89615112C>T	ENSP00000294671:p.Ala339Thr	113.0	0.0		151.0	11.0	NM_207398		Missense_Mutation	SNP	ENST00000294671.2	hg19	CCDS720.1	.	.	.	.	.	.	.	.	.	.	C	7.777	0.708730	0.15239	.	.	ENSG00000213512	ENST00000294671	T	0.02140	4.43	3.37	1.38	0.22167	Guanylate-binding protein, C-terminal (3);	0.444655	0.24647	N	0.036752	T	0.00724	0.0024	L	0.38733	1.17	0.27072	N	0.963298	B	0.26672	0.156	B	0.29267	0.1	T	0.48163	-0.9059	10	0.38643	T	0.18	.	5.773	0.18263	0.0:0.6276:0.0:0.3724	.	339	Q8N8V2	GBP7_HUMAN	T	339	ENSP00000294671:A339T	ENSP00000294671:A339T	A	-	1	0	GBP7	89387700	0.022000	0.18835	0.997000	0.53966	0.056000	0.15407	0.010000	0.13242	0.629000	0.30376	0.390000	0.25778	GCC	.	.		0.562	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398	
BARHL2	343472	hgsc.bcm.edu	37	1	91182580	91182580	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:91182580A>G	ENST00000370445.4	-	1	214	c.173T>C	c.(172-174)gTa>gCa	p.V58A		NM_020063.1	NP_064447.1	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	58					cell fate determination (GO:0001709)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|positive regulation of translation (GO:0045727)|regulation of axon extension (GO:0030516)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			cervix(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		CGCCGTCCCTACGGTATCAAT	0.607																																					p.V58A	GBM(199;3561 4100 22440)	Atlas-SNP	.											.	BARHL2	62	.	0			c.T173C						.						69.0	77.0	74.0					1																	91182580		2203	4300	6503	SO:0001583	missense	343472	exon1			GTCCCTACGGTAT	AJ251753	CCDS730.1	1p22.2	2011-07-08	2007-07-09		ENSG00000143032	ENSG00000143032		"""Homeoboxes / ANTP class : NKL subclass"""	954	protein-coding gene	gene with protein product		605212	"""BarH (Drosophila)-like 2"""				Standard	NM_020063		Approved		uc001dns.3	Q9NY43	OTTHUMG00000010020	ENST00000370445.4:c.173T>C	chr1.hg19:g.91182580A>G	ENSP00000359474:p.Val58Ala	137.0	0.0		253.0	23.0	NM_020063	A0AVP2|Q7Z4N7	Missense_Mutation	SNP	ENST00000370445.4	hg19	CCDS730.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.728580	0.89390	.	.	ENSG00000143032	ENST00000370445	D	0.94000	-3.33	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.89908	0.6851	N	0.24115	0.695	0.58432	D	0.999997	D	0.58970	0.984	D	0.68192	0.956	D	0.87867	0.2668	10	0.08837	T	0.75	.	14.3156	0.66450	1.0:0.0:0.0:0.0	.	58	Q9NY43	BARH2_HUMAN	A	58	ENSP00000359474:V58A	ENSP00000359474:V58A	V	-	2	0	BARHL2	90955168	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	8.097000	0.89539	2.267000	0.75376	0.528000	0.53228	GTA	.	.		0.607	BARHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027728.2		
CDC7	8317	hgsc.bcm.edu	37	1	91985737	91985737	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:91985737C>T	ENST00000428239.1	+	11	1490	c.1231C>T	c.(1231-1233)Cga>Tga	p.R411*	CDC7_ENST00000234626.6_Nonsense_Mutation_p.R411*|CDC7_ENST00000430031.2_Nonsense_Mutation_p.R383*	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	411	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		GCTTAGTGGACGATATCCATT	0.328																																					p.R411X		Atlas-SNP	.											.	CDC7	74	.	0			c.C1231T						.						120.0	121.0	121.0					1																	91985737		2203	4300	6503	SO:0001587	stop_gained	8317	exon11			AGTGGACGATATC	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.1231C>T	chr1.hg19:g.91985737C>T	ENSP00000393139:p.Arg411*	104.0	0.0		167.0	33.0	NM_001134419	D3DT31|O00558|Q5T5U5	Nonsense_Mutation	SNP	ENST00000428239.1	hg19	CCDS734.1	.	.	.	.	.	.	.	.	.	.	C	37	6.097844	0.97281	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	.	.	.	5.69	3.82	0.43975	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.5105	8.5322	0.33342	0.2741:0.6567:0.0:0.0693	.	.	.	.	X	383;411;411	.	ENSP00000234626:R411X	R	+	1	2	CDC7	91758325	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	2.718000	0.47236	0.758000	0.33059	0.455000	0.32223	CGA	.	.		0.328	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
CHI3L2	1117	hgsc.bcm.edu	37	1	111773538	111773538	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:111773538A>G	ENST00000445067.2	+	5	1016	c.245A>G	c.(244-246)tAc>tGc	p.Y82C	CHI3L2_ENST00000369744.2_Missense_Mutation_p.Y72C|CHI3L2_ENST00000369748.4_Missense_Mutation_p.Y82C|CHI3L2_ENST00000466741.1_Missense_Mutation_p.Y3C|CHI3L2_ENST00000524472.1_Missense_Mutation_p.Y3C			Q15782	CH3L2_HUMAN	chitinase 3-like 2	82					carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)	extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(1)	19		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		GTGATGCTCTACCAGACCATC	0.448																																					p.Y82C		Atlas-SNP	.											.	CHI3L2	38	.	0			c.A245G						.						72.0	59.0	63.0					1																	111773538		2203	4300	6503	SO:0001583	missense	1117	exon3			TGCTCTACCAGAC	U49835	CCDS30802.1, CCDS30803.1, CCDS41367.1	1p13.3	2008-02-05			ENSG00000064886	ENSG00000064886			1933	protein-coding gene	gene with protein product		601526				8702629	Standard	NM_001025197		Approved	YKL-39, YKL39	uc001eam.3	Q15782	OTTHUMG00000012174	ENST00000445067.2:c.245A>G	chr1.hg19:g.111773538A>G	ENSP00000437082:p.Tyr82Cys	100.0	0.0		100.0	18.0	NM_004000	A6NNY3|B4DPR7|Q15749|Q15783|Q5VUV7|Q96F97	Missense_Mutation	SNP	ENST00000445067.2	hg19	CCDS30802.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.71|14.71	2.616037|2.616037	0.46631|0.46631	.|.	.|.	ENSG00000064886|ENSG00000064886	ENST00000533831|ENST00000445067;ENST00000528451;ENST00000486561;ENST00000369744;ENST00000369748;ENST00000474304;ENST00000466741;ENST00000477185;ENST00000467038;ENST00000497587;ENST00000524472	.|T;T;T;T;T;T;T;T;T;T	.|0.15487	.|3.33;3.33;3.33;3.33;3.33;3.33;3.33;2.42;3.33;3.33	3.77|3.77	1.37|1.37	0.22104|0.22104	.|Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.|0.874363	.|0.09496	.|N	.|0.794310	T|T	0.36496|0.36496	0.0969|0.0969	H|H	0.96833|0.96833	3.89|3.89	0.20821|0.20821	N|N	0.999849|0.999849	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.81914	.|0.995;0.995;0.995	T|T	0.09037|0.09037	-1.0693|-1.0693	5|10	.|0.87932	.|D	.|0	0.5251|0.5251	5.0021|5.0021	0.14269|0.14269	0.711:0.1847:0.1043:0.0|0.711:0.1847:0.1043:0.0	.|.	.|3;72;82	.|B4DPR7;A6NNY3;Q15782	.|.;.;CH3L2_HUMAN	A|C	51|82;82;82;72;82;82;3;3;3;3;3	.|ENSP00000437082:Y82C;ENSP00000436077:Y82C;ENSP00000431968:Y82C;ENSP00000358759:Y72C;ENSP00000358763:Y82C;ENSP00000437086:Y3C;ENSP00000436272:Y3C;ENSP00000431978:Y3C;ENSP00000436006:Y3C;ENSP00000432049:Y3C	.|ENSP00000358759:Y72C	T|Y	+|+	1|2	0|0	CHI3L2|CHI3L2	111575061|111575061	0.992000|0.992000	0.36948|0.36948	0.003000|0.003000	0.11579|0.11579	0.054000|0.054000	0.15201|0.15201	4.154000|4.154000	0.58125|0.58125	0.068000|0.068000	0.16574|0.16574	0.533000|0.533000	0.62120|0.62120	ACC|TAC	.	.		0.448	CHI3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033669.4	NM_004000	
HSD3B1	3283	hgsc.bcm.edu	37	1	120057162	120057162	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:120057162C>T	ENST00000369413.3	+	4	1161	c.1016C>T	c.(1015-1017)gCg>gTg	p.A339V	HSD3B1_ENST00000235547.6_Missense_Mutation_p.A341V|HSD3B1_ENST00000528909.1_Missense_Mutation_p.A339V			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	339					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)	p.A339V(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	CGAGATCTGGCGTATAAGCCA	0.512																																					p.A339V		Atlas-SNP	.											HSD3B1,caecum,carcinoma,0,1	HSD3B1	53	.	1	Substitution - Missense(1)	large_intestine(1)	c.C1016T						.						84.0	74.0	77.0					1																	120057162		2203	4300	6503	SO:0001583	missense	3283	exon4			ATCTGGCGTATAA	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.1016C>T	chr1.hg19:g.120057162C>T	ENSP00000358421:p.Ala339Val	260.0	0.0		194.0	100.0	NM_000862	A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	ENST00000369413.3	hg19	CCDS903.1	.	.	.	.	.	.	.	.	.	.	C	9.829	1.187937	0.21954	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	D;D;D	0.88201	-2.35;-2.35;-2.35	3.26	2.32	0.28847	.	0.049786	0.85682	D	0.000000	T	0.80391	0.4614	L	0.50333	1.59	0.28587	N	0.909855	B;D	0.56287	0.135;0.975	B;P	0.46825	0.019;0.528	T	0.74247	-0.3727	10	0.66056	D	0.02	-8.2779	10.0193	0.42033	0.0:0.2225:0.7774:0.0	.	341;339	Q5TDG2;P14060	.;3BHS1_HUMAN	V	339;341;339	ENSP00000358421:A339V;ENSP00000235547:A341V;ENSP00000432268:A339V	ENSP00000235547:A341V	A	+	2	0	HSD3B1	119858685	1.000000	0.71417	0.548000	0.28192	0.070000	0.16714	7.202000	0.77856	0.673000	0.31224	0.313000	0.20887	GCG	.	.		0.512	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	NM_000862	
HMGCS2	3158	hgsc.bcm.edu	37	1	120298061	120298061	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:120298061C>T	ENST00000369406.3	-	6	1225	c.1176G>A	c.(1174-1176)tcG>tcA	p.S392S	HMGCS2_ENST00000476640.1_5'Flank|HMGCS2_ENST00000544913.2_Silent_p.S350S	NM_005518.3	NP_005509.1	P54868	HMCS2_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 2 (mitochondrial)	392					cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|ketone body biosynthetic process (GO:0046951)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxymethylglutaryl-CoA synthase activity (GO:0004421)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		GGGACAGAAGCGAGGCCAGGC	0.562																																					p.S392S		Atlas-SNP	.											.	HMGCS2	58	.	0			c.G1176A						.						275.0	258.0	264.0					1																	120298061		2203	4300	6503	SO:0001819	synonymous_variant	3158	exon6			CAGAAGCGAGGCC	BC044217	CCDS905.1, CCDS53353.1	1p13-p12	2014-09-17	2010-04-30		ENSG00000134240	ENSG00000134240			5008	protein-coding gene	gene with protein product		600234	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 (mitochondrial)"""			7851882, 7893153	Standard	NM_005518		Approved		uc001eid.3	P54868	OTTHUMG00000012101	ENST00000369406.3:c.1176G>A	chr1.hg19:g.120298061C>T		132.0	0.0		126.0	22.0	NM_005518	B7Z8R3|D3Y5K6|Q5SZU2|Q6IBF4	Silent	SNP	ENST00000369406.3	hg19	CCDS905.1																																																																																			.	.		0.562	HMGCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033469.2	NM_005518	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144882534	144882534	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:144882534T>C	ENST00000369354.3	-	24	3674	c.3485A>G	c.(3484-3486)cAc>cGc	p.H1162R	PDE4DIP_ENST00000530740.1_Missense_Mutation_p.H1299R|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.H1299R|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.H1162R|PDE4DIP_ENST00000313382.9_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1162					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTCCTCTTGGTGTTGGTGCTT	0.527			T	PDGFRB	MPD																																p.H1162R		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.A3485G						.						131.0	123.0	125.0					1																	144882534		2203	4296	6499	SO:0001583	missense	9659	exon24			TCTTGGTGTTGGT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3485A>G	chr1.hg19:g.144882534T>C	ENSP00000358360:p.His1162Arg	165.0	0.0		199.0	17.0	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	T	9.618	1.132980	0.21041	.	.	ENSG00000178104	ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	T;T;T;T	0.01359	4.98;4.98;4.98;4.98	5.14	-9.43	0.00607	.	.	.	.	.	T	0.00271	0.0008	L	0.36672	1.1	0.09310	N	1	B	0.31730	0.337	B	0.19666	0.026	T	0.49899	-0.8890	9	0.06757	T	0.87	.	5.7034	0.17895	0.1023:0.5721:0.1031:0.2225	.	1162	Q5VU43	MYOME_HUMAN	R	1162;1162;1299;1299	ENSP00000358360:H1162R;ENSP00000358363:H1162R;ENSP00000435654:H1299R;ENSP00000358366:H1299R	ENSP00000358360:H1162R	H	-	2	0	PDE4DIP	143593891	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-1.438000	0.02416	-1.600000	0.01603	-0.250000	0.11733	CAC	.	.		0.527	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PLEKHO1	51177	hgsc.bcm.edu	37	1	150131092	150131092	+	Missense_Mutation	SNP	T	T	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:150131092T>G	ENST00000369124.4	+	6	882	c.604T>G	c.(604-606)Tct>Gct	p.S202A	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.S168A|PLEKHO1_ENST00000479194.1_3'UTR|PLEKHO1_ENST00000369126.1_Missense_Mutation_p.S19A	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	202	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGAACCAACCTCTTGTGCTGA	0.607																																					p.S202A		Atlas-SNP	.											.	PLEKHO1	37	.	0			c.T604G						.						85.0	83.0	84.0					1																	150131092		2203	4300	6503	SO:0001583	missense	51177	exon6			CCAACCTCTTGTG	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.604T>G	chr1.hg19:g.150131092T>G	ENSP00000358120:p.Ser202Ala	122.0	0.0		157.0	28.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	hg19	CCDS945.1	.	.	.	.	.	.	.	.	.	.	T	18.58	3.653815	0.67472	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124;ENST00000441340	T;T;T	0.46063	0.88;1.86;1.86	4.97	4.97	0.65823	.	0.504521	0.21728	N	0.070020	T	0.17450	0.0419	L	0.54323	1.7	0.32880	D	0.510442	B	0.30406	0.278	B	0.27887	0.084	T	0.08006	-1.0743	10	0.18710	T	0.47	-16.4123	8.1287	0.31014	0.2811:0.0:0.0:0.7189	.	202	Q53GL0	PKHO1_HUMAN	A	19;168;202;82	ENSP00000025469:S168A;ENSP00000358120:S202A;ENSP00000409060:S82A	ENSP00000025469:S168A	S	+	1	0	PLEKHO1	148397716	0.793000	0.28825	0.888000	0.34837	0.973000	0.67179	2.704000	0.47118	2.083000	0.62718	0.533000	0.62120	TCT	.	.		0.607	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
CA14	23632	hgsc.bcm.edu	37	1	150234003	150234003	+	Silent	SNP	C	C	A	rs373006346		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:150234003C>A	ENST00000369111.4	+	3	1192	c.222C>A	c.(220-222)acC>acA	p.T74T	snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	74					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	AGCCTGGCACCGAGCCTTTGG	0.522																																					p.T74T		Atlas-SNP	.											.	CA14	37	.	0			c.C222A						.						98.0	76.0	84.0					1																	150234003		2203	4300	6503	SO:0001819	synonymous_variant	23632	exon3			TGGCACCGAGCCT	AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.222C>A	chr1.hg19:g.150234003C>A		76.0	0.0		102.0	6.0	NM_012113	Q5TB24|Q8NCF4	Silent	SNP	ENST00000369111.4	hg19	CCDS947.1																																																																																			.	.		0.522	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035064.2	NM_012113	
RPRD2	23248	hgsc.bcm.edu	37	1	150444476	150444476	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:150444476C>T	ENST00000369068.4	+	11	3056	c.3052C>T	c.(3052-3054)Cgt>Tgt	p.R1018C	RPRD2_ENST00000539519.1_3'UTR|RPRD2_ENST00000401000.4_Missense_Mutation_p.R992C|RPRD2_ENST00000492220.1_3'UTR	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	1018						DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AAACGCCTCACGTAAGCCCTC	0.537																																					p.R1018C		Atlas-SNP	.											.	RPRD2	189	.	0			c.C3052T						.						200.0	201.0	201.0					1																	150444476		1983	4166	6149	SO:0001583	missense	23248	exon11			GCCTCACGTAAGC	BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.3052C>T	chr1.hg19:g.150444476C>T	ENSP00000358064:p.Arg1018Cys	204.0	0.0		286.0	33.0	NM_015203	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Missense_Mutation	SNP	ENST00000369068.4	hg19	CCDS44216.1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.979642	0.53827	.	.	ENSG00000163125	ENST00000401000;ENST00000369068	T;T	0.61742	0.08;0.09	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000002	T	0.56746	0.2006	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.948;0.977	T	0.63368	-0.6653	10	0.87932	D	0	-6.6907	16.0135	0.80420	0.0:0.8659:0.1341:0.0	.	1018;992	Q5VT52;Q5VT52-3	RPRD2_HUMAN;.	C	992;1018	ENSP00000383785:R992C;ENSP00000358064:R1018C	ENSP00000358064:R1018C	R	+	1	0	RPRD2	148711100	0.992000	0.36948	0.957000	0.39632	0.991000	0.79684	3.558000	0.53749	2.702000	0.92279	0.655000	0.94253	CGT	.	.		0.537	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000035844.1	NM_015203	
KPRP	448834	hgsc.bcm.edu	37	1	152732288	152732288	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:152732288A>G	ENST00000606109.1	+	1	252	c.224A>G	c.(223-225)cAg>cGg	p.Q75R	KPRP_ENST00000368773.1_Missense_Mutation_p.Q75R			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	75	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGAAGTGCCAGTCTAAGACC	0.537																																					p.Q75R		Atlas-SNP	.											.	KPRP	152	.	0			c.A224G						.						185.0	159.0	168.0					1																	152732288		2203	4300	6503	SO:0001583	missense	448834	exon2			AGTGCCAGTCTAA	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.224A>G	chr1.hg19:g.152732288A>G	ENSP00000475216:p.Gln75Arg	150.0	0.0		229.0	44.0	NM_001025231		Missense_Mutation	SNP	ENST00000606109.1	hg19	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	A	10.04	1.241963	0.22796	.	.	ENSG00000203786	ENST00000368773	T	0.19105	2.17	4.71	2.11	0.27256	.	0.000000	0.37393	N	0.002117	T	0.13200	0.0320	L	0.55481	1.735	0.09310	N	1	D	0.58268	0.982	P	0.52481	0.7	T	0.04737	-1.0930	10	0.72032	D	0.01	-0.3361	4.9542	0.14031	0.6222:0.1925:0.0:0.1853	.	75	Q5T749	KPRP_HUMAN	R	75	ENSP00000357762:Q75R	ENSP00000357762:Q75R	Q	+	2	0	KPRP	150998912	0.021000	0.18746	0.018000	0.16275	0.388000	0.30384	1.492000	0.35594	0.869000	0.35703	0.533000	0.62120	CAG	.	.		0.537	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
IVL	3713	hgsc.bcm.edu	37	1	152882316	152882316	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:152882316C>A	ENST00000368764.3	+	2	107	c.43C>A	c.(43-45)Ctc>Atc	p.L15I	IVL_ENST00000392667.2_5'UTR			P07476	INVO_HUMAN	involucrin	15					isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTCCCCTGCCCTCAGTCAGGA	0.547																																					p.L15I		Atlas-SNP	.											.	IVL	100	.	0			c.C43A						.						86.0	73.0	78.0					1																	152882316		2203	4300	6503	SO:0001583	missense	3713	exon2			CCTGCCCTCAGTC	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.43C>A	chr1.hg19:g.152882316C>A	ENSP00000357753:p.Leu15Ile	77.0	0.0		131.0	27.0	NM_005547	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	hg19	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984475	0.35036	.	.	ENSG00000163207	ENST00000368764	T	0.13307	2.6	4.5	-0.0113	0.13993	Involucrin, N-terminal (1);	.	.	.	.	T	0.08846	0.0219	M	0.65498	2.005	0.09310	N	0.999998	P	0.41624	0.757	P	0.50934	0.654	T	0.24119	-1.0169	9	0.44086	T	0.13	-0.0874	2.2448	0.04029	0.2302:0.3287:0.3349:0.1062	.	15	P07476	INVO_HUMAN	I	15	ENSP00000357753:L15I	ENSP00000357753:L15I	L	+	1	0	IVL	151148940	0.000000	0.05858	0.001000	0.08648	0.840000	0.47671	-0.452000	0.06787	0.123000	0.18342	0.561000	0.74099	CTC	.	.		0.547	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
INTS3	65123	hgsc.bcm.edu	37	1	153744418	153744418	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:153744418G>A	ENST00000318967.2	+	26	3267	c.2699G>A	c.(2698-2700)aGc>aAc	p.S900N	INTS3_ENST00000512605.1_Missense_Mutation_p.S694N|INTS3_ENST00000435409.2_Missense_Mutation_p.S900N|SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000456435.1_Missense_Mutation_p.S694N|INTS3_ENST00000476843.1_3'UTR	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	901					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAGAACAACAGCCTGCCTCGC	0.602											OREG0013827	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S900N		Atlas-SNP	.											.	INTS3	83	.	0			c.G2699A						.						79.0	59.0	66.0					1																	153744418		2203	4300	6503	SO:0001583	missense	65123	exon26			ACAACAGCCTGCC	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2699G>A	chr1.hg19:g.153744418G>A	ENSP00000318641:p.Ser900Asn	75.0	0.0	1757	109.0	11.0	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	ENST00000318967.2	hg19	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	G	13.62	2.290761	0.40494	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.52	4.52	0.55395	.	0.101407	0.64402	D	0.000002	T	0.24736	0.0600	N	0.12182	0.205	0.39135	D	0.961937	B;B;B	0.09022	0.002;0.0;0.001	B;B;B	0.06405	0.002;0.0;0.001	T	0.06935	-1.0799	9	0.35671	T	0.21	.	14.7903	0.69837	0.0:0.0:1.0:0.0	.	694;901;900	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	N	900;694;900;694	.	ENSP00000318641:S900N	S	+	2	0	INTS3	152011042	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.391000	0.59652	2.341000	0.79615	0.563000	0.77884	AGC	.	.		0.602	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	
SHC1	6464	hgsc.bcm.edu	37	1	154942720	154942720	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:154942720C>T	ENST00000368445.5	-	1	497	c.283G>A	c.(283-285)Gta>Ata	p.V95I	SHC1_ENST00000368450.1_Intron|SHC1_ENST00000606391.1_Intron|SHC1_ENST00000448116.2_Missense_Mutation_p.V95I|SHC1_ENST00000368449.4_Intron|SHC1_ENST00000368453.4_Intron	NM_183001.4	NP_892113.4	P29353	SHC1_HUMAN	SHC (Src homology 2 domain containing) transforming protein 1	95				V -> D (in Ref. 2; AAB49972). {ECO:0000305}.	actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|Ras protein signal transduction (GO:0007265)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of growth (GO:0040008)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|Shc-EGFR complex (GO:0070435)	ephrin receptor binding (GO:0046875)|epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phospholipid binding (GO:0005543)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	20	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCTGCCCCTACGATCCCCTCC	0.687																																					p.V95I	NSCLC(4;32 234 1864 2492 3259 13747 17376)	Atlas-SNP	.											SHC1_ENST00000448116,NS,carcinoma,0,1	SHC1	91	.	0			c.G283A						.						27.0	33.0	31.0					1																	154942720		2203	4299	6502	SO:0001583	missense	6464	exon1			CCCCTACGATCCC	U73377	CCDS1076.1, CCDS30881.1, CCDS44233.1, CCDS44234.1	1q21	2013-02-14	2002-01-14		ENSG00000160691	ENSG00000160691		"""SH2 domain containing"""	10840	protein-coding gene	gene with protein product		600560	"""SHC (Src homology 2 domain-containing) transforming protein 1"""	SHC		1623525	Standard	NM_003029		Approved	p66	uc001ffw.3	P29353	OTTHUMG00000037295	ENST00000368445.5:c.283G>A	chr1.hg19:g.154942720C>T	ENSP00000357430:p.Val95Ile	209.0	0.0		294.0	33.0	NM_183001	B5BU19|D3DV78|O15290|Q5T180|Q5T183|Q5T184|Q5T185|Q5T186|Q8N4K5|Q96CL1	Missense_Mutation	SNP	ENST00000368445.5	hg19	CCDS30881.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625547	0.28889	.	.	ENSG00000160691	ENST00000368445;ENST00000448116;ENST00000368443	T;T	0.63417	-0.04;-0.04	4.06	-3.1	0.05315	.	2.000660	0.02576	N	0.098336	T	0.12603	0.0306	N	0.03608	-0.345	0.09310	N	1	B;B	0.26318	0.011;0.146	B;B	0.14578	0.001;0.011	T	0.03335	-1.1047	10	0.30854	T	0.27	.	3.8341	0.08886	0.262:0.337:0.0:0.4011	.	95;95	P29353-6;P29353	.;SHC1_HUMAN	I	95;95;31	ENSP00000357430:V95I;ENSP00000401303:V95I	ENSP00000357428:V31I	V	-	1	0	SHC1	153209344	0.000000	0.05858	0.001000	0.08648	0.981000	0.71138	-0.336000	0.07863	-0.785000	0.04522	0.555000	0.69702	GTA	.	.		0.687	SHC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090781.2	NM_183001	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155922509	155922509	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:155922509C>T	ENST00000361247.4	-	15	1993	c.1894G>A	c.(1894-1896)Gcc>Acc	p.A632T	ARHGEF2_ENST00000313695.7_Missense_Mutation_p.A604T|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.A677T|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.A631T|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.A604T|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.A633T|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	632					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTGGGCAGGGCCATCCCACTG	0.652																																					p.A632T	Melanoma(178;35 2768 6610 28839)	Atlas-SNP	.											ARHGEF2,NS,carcinoma,0,1	ARHGEF2	81	.	0			c.G1894A						.						91.0	84.0	86.0					1																	155922509		2203	4300	6503	SO:0001583	missense	9181	exon15			GCAGGGCCATCCC	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1894G>A	chr1.hg19:g.155922509C>T	ENSP00000354837:p.Ala632Thr	184.0	0.0		226.0	43.0	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	hg19	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	C	9.381	1.072961	0.20147	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000313667	T;T;T;T;T	0.63580	-0.05;0.08;0.07;-0.05;-0.05	5.14	-3.25	0.05079	.	0.855362	0.09933	N	0.736904	T	0.08802	0.0218	N	0.02539	-0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.21861	-1.0233	10	0.15952	T	0.53	-7.9738	1.977	0.03418	0.3165:0.3538:0.2132:0.1165	.	676;632;631	D3DVA5;Q92974;Q92974-2	.;ARHG2_HUMAN;.	T	604;632;633;604;631	ENSP00000315325:A604T;ENSP00000354837:A632T;ENSP00000357298:A633T;ENSP00000357299:A604T;ENSP00000314787:A631T	ENSP00000314787:A631T	A	-	1	0	ARHGEF2	154189133	0.016000	0.18221	0.226000	0.23910	0.870000	0.49936	0.042000	0.13949	-0.704000	0.05042	-1.289000	0.01358	GCC	.	.		0.652	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
NES	10763	hgsc.bcm.edu	37	1	156640020	156640020	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:156640020C>T	ENST00000368223.3	-	4	4092	c.3960G>A	c.(3958-3960)agG>agA	p.R1320R		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1320	Tail.			DPTGEQRPPPQG -> TPLESRGHPLK (in Ref. 1; CAA46780). {ECO:0000305}.	brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGGGGGTGGCCTCTGCTCTC	0.662																																					p.R1320R		Atlas-SNP	.											.	NES	196	.	0			c.G3960A						.						53.0	64.0	60.0					1																	156640020		2203	4299	6502	SO:0001819	synonymous_variant	10763	exon4			GGGTGGCCTCTGC	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3960G>A	chr1.hg19:g.156640020C>T		46.0	0.0		97.0	6.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Silent	SNP	ENST00000368223.3	hg19	CCDS1151.1																																																																																			.	.		0.662	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
IGSF9	57549	hgsc.bcm.edu	37	1	159901663	159901663	+	Missense_Mutation	SNP	C	C	T	rs376059608		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:159901663C>T	ENST00000368094.1	-	11	1498	c.1301G>A	c.(1300-1302)cGg>cAg	p.R434Q	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.R418Q	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	434	Ig-like 5.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGCAGCTCCCGCCCTACTTC	0.592																																					p.R434Q		Atlas-SNP	.											.	IGSF9	123	.	0			c.G1301A						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	65.0	62.0		1301,1253	4.4	1.0	1		62	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IGSF9	NM_001135050.1,NM_020789.3	43,43	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	434/1180,418/1164	159901663	2,13004	2203	4300	6503	SO:0001583	missense	57549	exon11			AGCTCCCGCCCTA	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.1301G>A	chr1.hg19:g.159901663C>T	ENSP00000357073:p.Arg434Gln	54.0	0.0		68.0	17.0	NM_001135050		Missense_Mutation	SNP	ENST00000368094.1	hg19	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401258	0.83120	2.27E-4	1.16E-4	ENSG00000085552	ENST00000361509;ENST00000368094;ENST00000198587	T;T	0.77229	-1.08;-1.08	4.41	4.41	0.53225	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35677	N	0.003043	T	0.69584	0.3127	N	0.25060	0.705	0.40030	D	0.975525	D;P	0.63046	0.992;0.898	P;B	0.59889	0.865;0.432	T	0.70626	-0.4820	9	.	.	.	-16.1096	14.5219	0.67856	0.0:1.0:0.0:0.0	.	434;434	Q9P2J2;C9JI81	TUTLA_HUMAN;.	Q	418;434;434	ENSP00000355049:R418Q;ENSP00000357073:R434Q	.	R	-	2	0	IGSF9	158168287	1.000000	0.71417	0.999000	0.59377	0.549000	0.35272	7.083000	0.76859	2.003000	0.58678	0.561000	0.74099	CGG	.	.		0.592	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
IGSF8	93185	hgsc.bcm.edu	37	1	160062224	160062224	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:160062224C>T	ENST00000368086.1	-	5	1790	c.1574G>A	c.(1573-1575)cGa>cAa	p.R525Q	IGSF8_ENST00000460351.1_5'Flank|IGSF8_ENST00000314485.7_Missense_Mutation_p.R525Q			Q969P0	IGSF8_HUMAN	immunoglobulin superfamily, member 8	525	Ig-like C2-type 4.				cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|nervous system development (GO:0007399)|single fertilization (GO:0007338)|skeletal muscle tissue development (GO:0007519)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(19)|pancreas(1)|prostate(1)|skin(1)	33	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCGATGGCTTCGGGGCCCCAC	0.672																																					p.R525Q		Atlas-SNP	.											.	IGSF8	59	.	0			c.G1574A						.						37.0	40.0	39.0					1																	160062224		2203	4299	6502	SO:0001583	missense	93185	exon5			TGGCTTCGGGGCC	AF407274	CCDS1195.1	1q23.1	2013-01-11			ENSG00000162729	ENSG00000162729		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17813	protein-coding gene	gene with protein product		606644				11504738, 11673522	Standard	NM_001206665		Approved	CD81P3, EWI2, PGRL, CD316	uc009wtf.3	Q969P0	OTTHUMG00000024075	ENST00000368086.1:c.1574G>A	chr1.hg19:g.160062224C>T	ENSP00000357065:p.Arg525Gln	103.0	0.0		147.0	42.0	NM_052868	Q8NG09|Q96DP4|Q9BTG9	Missense_Mutation	SNP	ENST00000368086.1	hg19	CCDS1195.1	.	.	.	.	.	.	.	.	.	.	C	6.973	0.549573	0.13374	.	.	ENSG00000162729	ENST00000314485;ENST00000368086	T;T	0.22336	1.96;1.96	3.06	2.13	0.27403	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.233450	0.06182	U	0.679576	T	0.03095	0.0091	N	0.19112	0.55	0.22684	N	0.998852	B	0.15473	0.013	B	0.06405	0.002	T	0.41680	-0.9495	10	0.13470	T	0.59	0.5119	2.6959	0.05135	0.2261:0.5172:0.0:0.2567	.	525	Q969P0	IGSF8_HUMAN	Q	525	ENSP00000316664:R525Q;ENSP00000357065:R525Q	ENSP00000316664:R525Q	R	-	2	0	IGSF8	158328848	0.030000	0.19436	0.999000	0.59377	0.993000	0.82548	-0.243000	0.08915	0.477000	0.27464	0.400000	0.26472	CGA	.	.		0.672	IGSF8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060636.1	NM_052868	
FCER1G	2207	hgsc.bcm.edu	37	1	161188700	161188700	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:161188700C>T	ENST00000289902.1	+	5	253	c.228C>T	c.(226-228)taC>taT	p.Y76Y	AL590714.1_ENST00000594609.1_5'Flank|FCER1G_ENST00000490414.1_3'UTR|FCER1G_ENST00000367992.3_Intron	NM_004106.1	NP_004097.1	P30273	FCERG_HUMAN	Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide	76	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|negative regulation of mast cell apoptotic process (GO:0033026)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|phagocytosis, engulfment (GO:0006911)|platelet activation (GO:0030168)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I hypersensitivity (GO:0001812)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|protein localization to plasma membrane (GO:0072659)|regulation of platelet activation (GO:0010543)|serotonin secretion by platelet (GO:0002554)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			endometrium(1)|lung(5)	6	all_cancers(52;1.35e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Benzylpenicilloyl Polylysine(DB00895)	AGGAGACTTACGAGACTCTGA	0.542																																					p.Y76Y		Atlas-SNP	.											.	FCER1G	11	.	0			c.C228T						.						113.0	114.0	114.0					1																	161188700		2203	4300	6503	SO:0001819	synonymous_variant	2207	exon5			GACTTACGAGACT		CCDS1225.1	1q23	2008-02-05			ENSG00000158869	ENSG00000158869			3611	protein-coding gene	gene with protein product		147139				2138619	Standard	NM_004106		Approved		uc001fyz.1	P30273	OTTHUMG00000034343	ENST00000289902.1:c.228C>T	chr1.hg19:g.161188700C>T		113.0	0.0		157.0	21.0	NM_004106	Q5VTW4	Silent	SNP	ENST00000289902.1	hg19	CCDS1225.1																																																																																			.	.		0.542	FCER1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083012.1	NM_004106	
ILDR2	387597	hgsc.bcm.edu	37	1	166890453	166890453	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:166890453G>A	ENST00000271417.3	-	9	1430	c.1375C>T	c.(1375-1377)Cgc>Tgc	p.R459C	ILDR2_ENST00000469934.2_Intron|ILDR2_ENST00000526687.1_Missense_Mutation_p.R351C|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000528703.1_Missense_Mutation_p.R400C|ILDR2_ENST00000525740.1_Missense_Mutation_p.R332C|ILDR2_ENST00000529071.1_Missense_Mutation_p.R440C	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	459					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						GACTCCGAGCGCTCGAAGCGG	0.706																																					p.R459C		Atlas-SNP	.											.	ILDR2	79	.	0			c.C1375T						.						5.0	7.0	6.0					1																	166890453		1724	3545	5269	SO:0001583	missense	387597	exon9			CCGAGCGCTCGAA	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1375C>T	chr1.hg19:g.166890453G>A	ENSP00000271417:p.Arg459Cys	37.0	0.0		76.0	28.0	NM_199351		Missense_Mutation	SNP	ENST00000271417.3	hg19	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056137	0.36277	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T	0.79554	0.37;-1.28;0.37;-1.27;-0.26	4.28	3.24	0.37175	.	0.652062	0.14351	N	0.325100	T	0.72423	0.3458	L	0.58101	1.795	0.35681	D	0.814095	D	0.59767	0.986	P	0.46339	0.513	T	0.73388	-0.3998	10	0.44086	T	0.13	.	13.2225	0.59896	0.0:0.0:0.7277:0.2723	.	459	Q71H61	ILDR2_HUMAN	C	459;332;440;351;400	ENSP00000271417:R459C;ENSP00000436120:R332C;ENSP00000436882:R440C;ENSP00000434273:R351C;ENSP00000432750:R400C	ENSP00000271417:R459C	R	-	1	0	ILDR2	165157077	0.998000	0.40836	0.972000	0.41901	0.034000	0.12701	1.073000	0.30691	1.922000	0.55676	0.558000	0.71614	CGC	.	.		0.706	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351	
ASTN1	460	hgsc.bcm.edu	37	1	176926868	176926868	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:176926868G>A	ENST00000367654.3	-	11	2068	c.1857C>T	c.(1855-1857)tgC>tgT	p.C619C	ASTN1_ENST00000424564.2_Silent_p.C611C|ASTN1_ENST00000361833.2_Silent_p.C611C|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000367657.3_Silent_p.C611C	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	619	EGF-like 2.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						AATTCTTACTGCAGCCCCCGT	0.532																																					p.C611C		Atlas-SNP	.											.	ASTN1	314	.	0			c.C1833T						.						81.0	77.0	78.0					1																	176926868		2203	4300	6503	SO:0001819	synonymous_variant	460	exon11			CTTACTGCAGCCC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1857C>T	chr1.hg19:g.176926868G>A		186.0	0.0		262.0	32.0	NM_004319	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	ENST00000367654.3	hg19																																																																																				.	.		0.532	ASTN1-201	KNOWN	basic	protein_coding	protein_coding		NM_004319	
SEC16B	89866	hgsc.bcm.edu	37	1	177902746	177902746	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:177902746C>T	ENST00000308284.6	-	21	2686	c.2597G>A	c.(2596-2598)aGt>aAt	p.S866N	RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000495165.1_5'UTR	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	866					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CTCAGAAATACTTCGTGGTCT	0.468																																					p.S866N		Atlas-SNP	.											.	SEC16B	92	.	0			c.G2597A						.						61.0	61.0	61.0					1																	177902746		1910	4129	6039	SO:0001583	missense	89866	exon21			GAAATACTTCGTG	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2597G>A	chr1.hg19:g.177902746C>T	ENSP00000308339:p.Ser866Asn	83.0	0.0		90.0	15.0	NM_033127	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	ENST00000308284.6	hg19	CCDS44281.1	.	.	.	.	.	.	.	.	.	.	C	8.850	0.944302	0.18356	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.15256	2.44	5.65	-11.3	0.00108	.	1.426080	0.03897	N	0.279737	T	0.06690	0.0171	N	0.04768	-0.165	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.06405	0.002;0.001;0.001;0.001	T	0.25710	-1.0124	10	0.34782	T	0.22	0.3745	8.471	0.32986	0.0:0.2047:0.3889:0.4063	.	421;867;866;563	B1AM07;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	N	866;550;581	ENSP00000308339:S866N	ENSP00000239472:S581N	S	-	2	0	AL359075.1	176169369	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.568000	0.05909	-2.888000	0.00316	-0.137000	0.14449	AGT	.	.		0.468	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127	
TOR3A	64222	hgsc.bcm.edu	37	1	179054904	179054904	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:179054904G>A	ENST00000367627.3	+	3	1267	c.515G>A	c.(514-516)gGc>gAc	p.G172D	TOR3A_ENST00000352445.6_Missense_Mutation_p.G172D	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	172					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TCTGGCACAGGCAAGAACTTC	0.572																																					p.G172D		Atlas-SNP	.											.	TOR3A	28	.	0			c.G515A						.						94.0	74.0	80.0					1																	179054904		2203	4300	6503	SO:0001583	missense	64222	exon3			GCACAGGCAAGAA	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.515G>A	chr1.hg19:g.179054904G>A	ENSP00000356599:p.Gly172Asp	89.0	0.0		93.0	32.0	NM_022371	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	hg19	CCDS1329.1	.	.	.	.	.	.	.	.	.	.	G	34	5.388732	0.95988	.	.	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445;ENST00000447595	D;T;D;D	0.92048	-2.96;-0.32;-2.96;-2.96	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.97451	0.9166	H	0.95365	3.66	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98406	1.0570	10	0.87932	D	0	-31.3179	18.4682	0.90763	0.0:0.0:1.0:0.0	.	172	Q9H497	TOR3A_HUMAN	D	172;125;172;64	ENSP00000356599:G172D;ENSP00000356597:G125D;ENSP00000335351:G172D;ENSP00000410195:G64D	ENSP00000335351:G172D	G	+	2	0	TOR3A	177321527	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.606000	0.88127	0.655000	0.94253	GGC	.	.		0.572	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
TDRD5	163589	hgsc.bcm.edu	37	1	179609580	179609580	+	Splice_Site	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:179609580G>T	ENST00000367614.1	+	11	2159	c.1800G>T	c.(1798-1800)gaG>gaT	p.E600D	TDRD5_ENST00000294848.8_Splice_Site_p.E600D|TDRD5_ENST00000444136.1_Splice_Site_p.E600D	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	600					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						GACCAGTAGAGGTATGTTTGC	0.403																																					p.E600D		Atlas-SNP	.											.	TDRD5	149	.	0			c.G1800T						.						185.0	150.0	162.0					1																	179609580		2203	4300	6503	SO:0001630	splice_region_variant	163589	exon11			AGTAGAGGTATGT	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1800+1G>T	chr1.hg19:g.179609580G>T		79.0	0.0		126.0	15.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339404	0.60963	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.32753	2.67;2.67;2.83;1.44	5.82	5.82	0.92795	.	0.434585	0.24889	N	0.034781	T	0.30759	0.0775	L	0.59436	1.845	0.54753	D	0.999986	P;B	0.39903	0.694;0.376	B;B	0.34779	0.189;0.067	T	0.04495	-1.0947	10	0.26408	T	0.33	-10.4851	16.8044	0.85622	0.0:0.0:1.0:0.0	.	600;600	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	D	600;600;600;56	ENSP00000356586:E600D;ENSP00000294848:E600D;ENSP00000406052:E600D;ENSP00000410744:E56D	ENSP00000294848:E600D	E	+	3	2	TDRD5	177876203	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	6.688000	0.74557	2.752000	0.94435	0.655000	0.94253	GAG	.	.		0.403	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	Missense_Mutation
HMCN1	83872	hgsc.bcm.edu	37	1	186076037	186076037	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:186076037A>G	ENST00000271588.4	+	70	11021	c.10792A>G	c.(10792-10794)Aca>Gca	p.T3598A	HMCN1_ENST00000367492.2_Missense_Mutation_p.T3598A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3598	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.T3598S(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGGAAGATATACATGTCTGGC	0.333																																					p.T3598A		Atlas-SNP	.											HMCN1,colon,carcinoma,-2,1	HMCN1	797	.	1	Substitution - Missense(1)	ovary(1)	c.A10792G						.						188.0	188.0	188.0					1																	186076037		2203	4300	6503	SO:0001583	missense	83872	exon70			AGATATACATGTC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10792A>G	chr1.hg19:g.186076037A>G	ENSP00000271588:p.Thr3598Ala	87.0	0.0		123.0	19.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	19.41	3.822714	0.71028	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.80033	-1.33;-1.33	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.142752	0.64402	D	0.000007	D	0.85682	0.5753	M	0.64567	1.98	0.40244	D	0.977999	D	0.69078	0.997	D	0.69142	0.962	D	0.84838	0.0806	10	0.33940	T	0.23	.	9.8489	0.41043	0.9233:0.0:0.0767:0.0	.	3598	Q96RW7	HMCN1_HUMAN	A	3598	ENSP00000271588:T3598A;ENSP00000356462:T3598A	ENSP00000271588:T3598A	T	+	1	0	HMCN1	184342660	0.994000	0.37717	0.241000	0.24154	0.865000	0.49528	5.594000	0.67557	2.042000	0.60477	0.397000	0.26171	ACA	.	.		0.333	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMCN1	83872	hgsc.bcm.edu	37	1	186135392	186135392	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:186135392C>A	ENST00000271588.4	+	99	15625	c.15396C>A	c.(15394-15396)tgC>tgA	p.C5132*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.C5132*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5132	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ACTGCTCCTGCCCTAAAGGCC	0.453																																					p.C5132X		Atlas-SNP	.											.	HMCN1	797	.	0			c.C15396A						.						98.0	82.0	87.0					1																	186135392		2203	4300	6503	SO:0001587	stop_gained	83872	exon99			CTCCTGCCCTAAA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15396C>A	chr1.hg19:g.186135392C>A	ENSP00000271588:p.Cys5132*	82.0	0.0		100.0	7.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	56	26.144844	0.99967	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.44	-1.17	0.09648	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.1066	0.25366	0.0:0.4605:0.1095:0.43	.	.	.	.	X	5132	.	ENSP00000271588:C5132X	C	+	3	2	HMCN1	184402015	0.910000	0.30920	0.244000	0.24202	0.660000	0.38997	0.026000	0.13599	-0.539000	0.06273	0.650000	0.86243	TGC	.	.		0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
KCNT2	343450	hgsc.bcm.edu	37	1	196274397	196274397	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:196274397G>T	ENST00000294725.9	-	22	3477	c.2562C>A	c.(2560-2562)gaC>gaA	p.D854E	KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_Intron|KCNT2_ENST00000609185.1_Missense_Mutation_p.D780E|KCNT2_ENST00000367433.5_Missense_Mutation_p.D830E|KCNT2_ENST00000367431.4_Missense_Mutation_p.D780E			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	854					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GAGAGTAACAGTCTTTGGCTC	0.353																																					p.D854E		Atlas-SNP	.											.	KCNT2	243	.	0			c.C2562A						.						136.0	126.0	129.0					1																	196274397		2203	4300	6503	SO:0001583	missense	343450	exon22			GTAACAGTCTTTG	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2562C>A	chr1.hg19:g.196274397G>T	ENSP00000294725:p.Asp854Glu	85.0	0.0		137.0	8.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	hg19	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929055	0.73327	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.80653	-1.4;-1.4;-1.4	4.56	3.63	0.41609	.	0.192749	0.36234	N	0.002716	D	0.86322	0.5905	M	0.62154	1.92	0.80722	D	1	D;D;D;D;D	0.71674	0.985;0.996;0.998;0.991;0.985	P;D;D;P;P	0.72982	0.826;0.954;0.979;0.885;0.826	D	0.86851	0.2023	10	0.87932	D	0	-9.8673	10.7182	0.46026	0.1584:0.0:0.8416:0.0	.	854;812;830;780;854	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	E	830;780;854	ENSP00000356403:D830E;ENSP00000356401:D780E;ENSP00000294725:D854E	ENSP00000294725:D854E	D	-	3	2	KCNT2	194541020	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.675000	0.61619	1.241000	0.43820	0.650000	0.86243	GAC	.	.		0.353	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
DENND1B	163486	hgsc.bcm.edu	37	1	197704811	197704811	+	Intron	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:197704811G>A	ENST00000367396.3	-	3	252				DENND1B_ENST00000477581.1_5'UTR|DENND1B_ENST00000235453.4_5'UTR|DENND1B_ENST00000400967.2_5'Flank	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B						positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						GGTCTACCCCGGACACGGGAG	0.542																																					p.S66S		Atlas-SNP	.											.	DENND1B	108	.	0			c.C198T						.						36.0	37.0	37.0					1																	197704811		2173	4292	6465	SO:0001627	intron_variant	163486	exon3			TACCCCGGACACG	BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.83-20607C>T	chr1.hg19:g.197704811G>A		66.0	0.0		85.0	17.0	NM_001195216	B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Silent	SNP	ENST00000367396.3	hg19	CCDS41452.2																																																																																			.	.		0.542	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086539.1	NM_144977	
CD55	1604	hgsc.bcm.edu	37	1	207495135	207495135	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:207495135C>T	ENST00000367064.3	+	1	283	c.25C>T	c.(25-27)Ccc>Tcc	p.P9S	CD55_ENST00000367063.2_Missense_Mutation_p.P9S|CD55_ENST00000367062.4_Missense_Mutation_p.P9S|CD55_ENST00000367065.5_Missense_Mutation_p.P9S|CD55_ENST00000391920.4_Missense_Mutation_p.P9S|CD55_ENST00000391921.4_Missense_Mutation_p.P9S|CD55_ENST00000367067.4_Missense_Mutation_p.P9S|CD55_ENST00000314754.8_Missense_Mutation_p.P9S	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	9					CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	GCCGAGCGTGCCCGCGGCGCT	0.771											OREG0031708	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																									p.P9S		Atlas-SNP	.											.	CD55	55	.	0			c.C25T						.						2.0	2.0	2.0					1																	207495135		1155	2320	3475	SO:0001583	missense	1604	exon1			AGCGTGCCCGCGG	BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.25C>T	chr1.hg19:g.207495135C>T	ENSP00000356031:p.Pro9Ser	41.0	0.0	2168	86.0	14.0	NM_001114752	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	ENST00000367064.3	hg19	CCDS31006.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217896	0.58560	.	.	ENSG00000196352	ENST00000367064;ENST00000367063;ENST00000391921;ENST00000367067;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	T;T;T;T;T;T;T;T	0.37411	1.25;1.46;1.6;3.66;1.33;1.32;1.2;1.24	3.38	1.39	0.22231	.	0.517672	0.17471	N	0.173092	T	0.34803	0.0910	N	0.24115	0.695	0.09310	N	1	D;P;P;P;B	0.54601	0.967;0.799;0.518;0.663;0.384	D;B;B;B;B	0.65140	0.932;0.169;0.162;0.098;0.078	T	0.10590	-1.0623	10	0.33940	T	0.23	.	3.6887	0.08338	0.2419:0.6247:0.0:0.1334	.	9;9;9;9;9	B1AP15;Q14UF4;P08174-2;P08174;B1AP13	.;.;.;DAF_HUMAN;.	S	9	ENSP00000356031:P9S;ENSP00000356030:P9S;ENSP00000375788:P9S;ENSP00000356034:P9S;ENSP00000316333:P9S;ENSP00000356032:P9S;ENSP00000375787:P9S;ENSP00000356029:P9S	ENSP00000316333:P9S	P	+	1	0	CD55	205561758	0.006000	0.16342	0.000000	0.03702	0.001000	0.01503	1.129000	0.31381	0.133000	0.18654	-0.258000	0.10820	CCC	.	.		0.771	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574	
GPATCH2	55105	hgsc.bcm.edu	37	1	217784290	217784290	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:217784290G>T	ENST00000366935.3	-	4	1069	c.959C>A	c.(958-960)cCt>cAt	p.P320H	GPATCH2_ENST00000366934.3_Missense_Mutation_p.P320H	NM_018040.2	NP_060510.1	Q9NW75	GPTC2_HUMAN	G patch domain containing 2	320					negative regulation of phosphatase activity (GO:0010923)		nucleic acid binding (GO:0003676)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)	35				OV - Ovarian serous cystadenocarcinoma(81;0.0397)|all cancers(67;0.0744)|GBM - Glioblastoma multiforme(131;0.0872)		TTCAAAGACAGGATCTGGTAC	0.448																																					p.P320H		Atlas-SNP	.											.	GPATCH2	53	.	0			c.C959A						.						160.0	143.0	149.0					1																	217784290		2203	4300	6503	SO:0001583	missense	55105	exon4			AAGACAGGATCTG	AK001114	CCDS1518.1, CCDS73031.1	1q41	2013-01-28		2006-12-13	ENSG00000092978	ENSG00000092978		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""G patch domain containing"""	25499	protein-coding gene	gene with protein product	"""cancer/testis antigen 110"", ""protein phosphatase 1, regulatory subunit 30"""			GPATC2		19432882, 15375528	Standard	XM_005273174		Approved	FLJ10252, CT110, PPP1R30	uc001hlf.1	Q9NW75	OTTHUMG00000000527	ENST00000366935.3:c.959C>A	chr1.hg19:g.217784290G>T	ENSP00000355902:p.Pro320His	112.0	0.0		140.0	17.0	NM_018040	Q5VYK7|Q5VYK8|Q86YE7	Missense_Mutation	SNP	ENST00000366935.3	hg19	CCDS1518.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856738	0.91433	.	.	ENSG00000092978	ENST00000366935;ENST00000366934	T;T	0.57907	0.37;0.37	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.74543	0.3730	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.76564	-0.2913	10	0.87932	D	0	-15.1347	19.7375	0.96212	0.0:0.0:1.0:0.0	.	320;320	Q9NW75-2;Q9NW75	.;GPTC2_HUMAN	H	320	ENSP00000355902:P320H;ENSP00000355901:P320H	ENSP00000355901:P320H	P	-	2	0	GPATCH2	215850913	1.000000	0.71417	0.971000	0.41717	0.998000	0.95712	9.458000	0.97634	2.649000	0.89929	0.591000	0.81541	CCT	.	.		0.448	GPATCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001272.1	NM_018040	
RAB3GAP2	25782	hgsc.bcm.edu	37	1	220330778	220330778	+	Missense_Mutation	SNP	G	G	A	rs369410531		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:220330778G>A	ENST00000358951.2	-	31	3505	c.3389C>T	c.(3388-3390)gCg>gTg	p.A1130V		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	1130					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		GGAGAGCCACGCATCCTCAGT	0.502																																					p.A1130V		Atlas-SNP	.											RAB3GAP2,NS,carcinoma,+1,1	RAB3GAP2	120	.	0			c.C3389T						.	G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	111.0	99.0	103.0		3389	3.6	0.1	1		103	0,8600		0,0,4300	no	missense	RAB3GAP2	NM_012414.3	64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	1130/1394	220330778	1,13005	2203	4300	6503	SO:0001583	missense	25782	exon31			AGCCACGCATCCT	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.3389C>T	chr1.hg19:g.220330778G>A	ENSP00000351832:p.Ala1130Val	144.0	0.0		189.0	28.0	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	hg19	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	G	7.358	0.624306	0.14193	2.27E-4	0.0	ENSG00000118873	ENST00000358951	T	0.33438	1.41	5.47	3.6	0.41247	.	0.278782	0.39834	N	0.001253	T	0.18800	0.0451	L	0.29908	0.895	0.49299	D	0.999779	B;B	0.34372	0.451;0.451	B;B	0.34242	0.178;0.178	T	0.03840	-1.0999	10	0.02654	T	1	.	11.9408	0.52899	0.1413:0.0:0.8587:0.0	.	1130;1130	Q9H2M9;A6H8V0	RBGPR_HUMAN;.	V	1130	ENSP00000351832:A1130V	ENSP00000351832:A1130V	A	-	2	0	RAB3GAP2	218397401	0.997000	0.39634	0.071000	0.20095	0.988000	0.76386	3.624000	0.54231	0.678000	0.31325	0.655000	0.94253	GCG	.	.		0.502	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
HHIPL2	79802	hgsc.bcm.edu	37	1	222721145	222721145	+	Missense_Mutation	SNP	C	C	T	rs377410734		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:222721145C>T	ENST00000343410.6	-	1	300	c.242G>A	c.(241-243)cGg>cAg	p.R81Q		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	81					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GTCCCAGTACCGGGCAGCGAT	0.517																																					p.R81Q		Atlas-SNP	.											.	HHIPL2	122	.	0			c.G242A						.						61.0	62.0	61.0					1																	222721145		1975	4142	6117	SO:0001583	missense	79802	exon1			CAGTACCGGGCAG	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.242G>A	chr1.hg19:g.222721145C>T	ENSP00000342118:p.Arg81Gln	137.0	0.0		180.0	16.0	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	hg19	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	9.510	1.105474	0.20632	.	.	ENSG00000143512	ENST00000343410	T	0.55760	0.5	4.93	3.06	0.35304	Folate receptor-like (1);	0.255249	0.33364	N	0.004981	T	0.46983	0.1421	L	0.51853	1.615	0.09310	N	1	P	0.42757	0.789	P	0.45449	0.481	T	0.28964	-1.0027	10	0.32370	T	0.25	-8.9264	6.5416	0.22382	0.0:0.5772:0.0:0.4228	.	81	Q6UWX4	HIPL2_HUMAN	Q	81	ENSP00000342118:R81Q	ENSP00000342118:R81Q	R	-	2	0	HHIPL2	220787768	0.002000	0.14202	0.443000	0.26883	0.008000	0.06430	0.864000	0.27926	0.482000	0.27582	-0.140000	0.14226	CGG	.	.		0.517	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
PARP1	142	hgsc.bcm.edu	37	1	226570848	226570848	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:226570848C>T	ENST00000366794.5	-	8	1191	c.1048G>A	c.(1048-1050)Gtt>Att	p.V350I		NM_001618.3	NP_001609.2	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase 1	350					base-excision repair (GO:0006284)|cellular response to insulin stimulus (GO:0032869)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|gene expression (GO:0010467)|macrophage differentiation (GO:0030225)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|protein ADP-ribosylation (GO:0006471)|protein autoprocessing (GO:0016540)|protein poly-ADP-ribosylation (GO:0070212)|regulation of growth rate (GO:0040009)|signal transduction involved in regulation of gene expression (GO:0023019)|telomere maintenance (GO:0000723)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NAD binding (GO:0051287)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(4)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	44	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)		TGTTTTTTAACCTTCAATTTC	0.502								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.V350I		Atlas-SNP	.											.	PARP1	100	.	0			c.G1048A						.						110.0	137.0	128.0					1																	226570848		2203	4300	6503	SO:0001583	missense	142	exon8			TTTTAACCTTCAA	BC037545	CCDS1554.1	1q41-q42	2010-02-16	2008-07-28	2004-08-26	ENSG00000143799	ENSG00000143799	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	270	protein-coding gene	gene with protein product		173870	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)"", ""poly (ADP-ribose) polymerase family, member 1"""	PPOL, ADPRT		10964595	Standard	NM_001618		Approved	PARP	uc001hqd.4	P09874	OTTHUMG00000037556	ENST00000366794.5:c.1048G>A	chr1.hg19:g.226570848C>T	ENSP00000355759:p.Val350Ile	105.0	0.0		140.0	18.0	NM_001618	B1ANJ4|Q8IUZ9	Missense_Mutation	SNP	ENST00000366794.5	hg19	CCDS1554.1	.	.	.	.	.	.	.	.	.	.	C	13.28	2.189165	0.38707	.	.	ENSG00000143799	ENST00000366794	T	0.08984	3.03	5.27	-9.98	0.00438	.	0.427152	0.29515	N	0.011930	T	0.02119	0.0066	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40590	-0.9555	10	0.22706	T	0.39	-14.2178	2.8665	0.05603	0.1672:0.4042:0.078:0.3506	.	350	P09874	PARP1_HUMAN	I	350	ENSP00000355759:V350I	ENSP00000355759:V350I	V	-	1	0	PARP1	224637471	1.000000	0.71417	0.736000	0.30914	0.770000	0.43624	1.122000	0.31295	-1.426000	0.01994	-0.258000	0.10820	GTT	.	.		0.502	PARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091519.1	NM_001618	
OBSCN	84033	hgsc.bcm.edu	37	1	228547615	228547615	+	Intron	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:228547615C>T	ENST00000422127.1	+	80	18705				OBSCN_ENST00000366709.4_Missense_Mutation_p.P3460L|OBSCN_ENST00000284548.11_Missense_Mutation_p.P6341L|OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000570156.2_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AAGATGGGCCCGCAGGGTGTG	0.662																																					p.P6341L		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C19022T						.						19.0	23.0	22.0					1																	228547615		1928	4121	6049	SO:0001627	intron_variant	84033	exon81			TGGGCCCGCAGGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18662-2662C>T	chr1.hg19:g.228547615C>T		313.0	0.0		441.0	52.0	NM_052843	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969036	0.34754	.	.	ENSG00000154358	ENST00000284548;ENST00000366709	T;T	0.56776	0.44;0.58	4.71	0.316	0.15857	.	.	.	.	.	T	0.27900	0.0687	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.16808	-1.0390	9	0.35671	T	0.21	.	6.1206	0.20151	0.2851:0.493:0.0:0.2219	.	6341	Q5VST9-3	.	L	6341;3460	ENSP00000284548:P6341L;ENSP00000355670:P3460L	ENSP00000284548:P6341L	P	+	2	0	OBSCN	226614238	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.089000	0.11180	0.211000	0.20683	-0.254000	0.11334	CCG	.	.		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ABCB10	23456	hgsc.bcm.edu	37	1	229666151	229666151	+	Silent	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:229666151C>A	ENST00000344517.4	-	8	1482	c.1440G>T	c.(1438-1440)ggG>ggT	p.G480G		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	480					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TTAAGATGACCCCCTCTGAAA	0.413																																					p.G480G		Atlas-SNP	.											.	ABCB10	71	.	0			c.G1440T						.						78.0	86.0	83.0					1																	229666151		2203	4300	6503	SO:0001819	synonymous_variant	23456	exon8			GATGACCCCCTCT	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1440G>T	chr1.hg19:g.229666151C>A		73.0	0.0		82.0	14.0	NM_012089	Q13040|Q6P1Q8|Q9H3V0	Silent	SNP	ENST00000344517.4	hg19	CCDS1580.1																																																																																			.	.		0.413	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095240.1	NM_012089	
FMN2	56776	hgsc.bcm.edu	37	1	240492397	240492397	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:240492397G>A	ENST00000319653.9	+	9	4467	c.4237G>A	c.(4237-4239)Gaa>Aaa	p.E1413K	FMN2_ENST00000545751.1_Missense_Mutation_p.E9K	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1413	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGACGAACTCGAAAAAATAGA	0.378																																					p.E1413K		Atlas-SNP	.											.	FMN2	451	.	0			c.G4237A						.						91.0	90.0	91.0					1																	240492397		2203	4300	6503	SO:0001583	missense	56776	exon9			GAACTCGAAAAAA	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4237G>A	chr1.hg19:g.240492397G>A	ENSP00000318884:p.Glu1413Lys	237.0	0.0		341.0	34.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591412	0.46214	.	.	ENSG00000155816	ENST00000319653;ENST00000441342;ENST00000545751;ENST00000537355	T;T;T	0.16324	2.35;2.35;2.35	5.41	5.41	0.78517	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000009	T	0.41190	0.1148	M	0.66506	2.035	0.80722	D	1	P;B;D;D	0.89917	0.512;0.085;1.0;0.975	B;B;D;P	0.75020	0.243;0.062;0.985;0.766	T	0.05241	-1.0897	10	0.28530	T	0.3	.	19.2064	0.93732	0.0:0.0:1.0:0.0	.	9;59;42;1413	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	K	1413;59;9;40	ENSP00000318884:E1413K;ENSP00000388922:E59K;ENSP00000437918:E9K	ENSP00000318884:E1413K	E	+	1	0	FMN2	238559020	1.000000	0.71417	1.000000	0.80357	0.396000	0.30629	9.814000	0.99346	2.523000	0.85059	0.655000	0.94253	GAA	.	.		0.378	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
OR1C1	26188	hgsc.bcm.edu	37	1	247921056	247921056	+	Missense_Mutation	SNP	T	T	C	rs546878207		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:247921056T>C	ENST00000408896.2	-	1	926	c.653A>G	c.(652-654)tAt>tGt	p.Y218C		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	218					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GATAAGTCCATAAGATACGAG	0.488																																					p.Y218C		Atlas-SNP	.											.	OR1C1	86	.	0			c.A653G						.						55.0	54.0	54.0					1																	247921056		2025	4192	6217	SO:0001583	missense	26188	exon1			AGTCCATAAGATA	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.653A>G	chr1.hg19:g.247921056T>C	ENSP00000386138:p.Tyr218Cys	128.0	0.0		160.0	40.0	NM_012353	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	hg19	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	T	9.224	1.034033	0.19590	.	.	ENSG00000221888	ENST00000408896	T	0.00520	6.85	3.22	3.22	0.36961	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03871	0.0109	H	0.98721	4.31	0.09310	N	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.15350	-1.0440	9	0.87932	D	0	.	11.6139	0.51078	0.0:0.0:0.0:1.0	.	218	Q15619	OR1C1_HUMAN	C	218	ENSP00000386138:Y218C	ENSP00000386138:Y218C	Y	-	2	0	OR1C1	245987679	0.957000	0.32711	0.274000	0.24659	0.110000	0.19582	1.681000	0.37618	1.466000	0.48025	0.482000	0.46254	TAT	.	.		0.488	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1		
OR2T4	127074	hgsc.bcm.edu	37	1	248525091	248525091	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:248525091C>T	ENST00000366475.1	+	1	209	c.209C>T	c.(208-210)gCg>gTg	p.A70V		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCCTGATGGCGTTGTCTGGA	0.468																																					p.A70V		Atlas-SNP	.											.	OR2T4	126	.	0			c.C209T						.						316.0	255.0	276.0					1																	248525091		2203	4300	6503	SO:0001583	missense	127074	exon1			TGATGGCGTTGTC	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.209C>T	chr1.hg19:g.248525091C>T	ENSP00000355431:p.Ala70Val	459.0	0.0		643.0	74.0	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	hg19	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324466	0.41197	.	.	ENSG00000196944	ENST00000366475	T	0.00281	8.32	3.48	1.5	0.22942	.	0.151835	0.30611	N	0.009244	T	0.00241	0.0007	L	0.41961	1.31	0.09310	N	1	P	0.35551	0.509	B	0.40677	0.337	T	0.38067	-0.9678	10	0.72032	D	0.01	.	8.9727	0.35917	0.0:0.805:0.0:0.195	.	70	Q8NH00	OR2T4_HUMAN	V	70	ENSP00000355431:A70V	ENSP00000355431:A70V	A	+	2	0	OR2T4	246591714	0.000000	0.05858	0.719000	0.30619	0.041000	0.13682	0.002000	0.13061	0.435000	0.26365	0.485000	0.47835	GCG	.	.		0.468	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
TRAPPC12	51112	hgsc.bcm.edu	37	2	3392013	3392013	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:3392013A>G	ENST00000324266.5	+	2	814	c.619A>G	c.(619-621)Agc>Ggc	p.S207G	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.S207G	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	207					vesicle-mediated transport (GO:0016192)												CCCCAGCCTCAGCACGTTCTT	0.667																																					p.S207G		Atlas-SNP	.											.	.	.	.	0			c.A619G						.						32.0	39.0	37.0					2																	3392013		2203	4300	6503	SO:0001583	missense	51112	exon2			AGCCTCAGCACGT	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.619A>G	chr2.hg19:g.3392013A>G	ENSP00000324318:p.Ser207Gly	102.0	0.0		87.0	5.0	NM_016030	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	ENST00000324266.5	hg19	CCDS1652.1	.	.	.	.	.	.	.	.	.	.	A	18.49	3.635691	0.67130	.	.	ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266	T;T	0.58506	0.33;0.33	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.73666	0.3616	M	0.71581	2.175	0.58432	D	0.999999	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.85130	0.985;0.97;0.997	T	0.76688	-0.2867	10	0.72032	D	0.01	.	12.9248	0.58254	1.0:0.0:0.0:0.0	.	190;207;207	E7ENL7;Q8WVT3;Q53S18	.;TPC12_HUMAN;.	G	207;190;207	ENSP00000371544:S207G;ENSP00000324318:S207G	ENSP00000303612:S190G	S	+	1	0	TTC15	3371020	1.000000	0.71417	0.956000	0.39512	0.234000	0.25298	8.571000	0.90752	2.232000	0.73038	0.533000	0.62120	AGC	.	.		0.667	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
CAD	790	hgsc.bcm.edu	37	2	27454347	27454347	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:27454347G>A	ENST00000403525.1	+	15	2254	c.2110G>A	c.(2110-2112)Ggc>Agc	p.G704S	CAD_ENST00000464159.1_3'UTR|CAD_ENST00000264705.4_Missense_Mutation_p.G767S			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAAGTCATGGGCATTGGGCG	0.502																																					p.G767S		Atlas-SNP	.											.	CAD	199	.	0			c.G2299A						.						143.0	121.0	129.0					2																	27454347		2203	4300	6503	SO:0001583	missense	790	exon16			GTCATGGGCATTG	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2110G>A	chr2.hg19:g.27454347G>A	ENSP00000384510:p.Gly704Ser	55.0	0.0		63.0	23.0	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	hg19		.	.	.	.	.	.	.	.	.	.	G	11.27	1.588724	0.28357	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97352	-4.35;-4.35	5.46	5.46	0.80206	ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthase, large subunit, CPS-domain (1);	0.214234	0.48286	D	0.000183	D	0.90521	0.7030	N	0.05608	-0.01	0.49483	D	0.999796	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	D	0.86395	0.1738	10	0.08599	T	0.76	-0.4809	13.2374	0.59976	0.0:0.0:0.8411:0.1589	.	704;767	F8VPD4;P27708	.;PYR1_HUMAN	S	767;704	ENSP00000264705:G767S;ENSP00000384510:G704S	ENSP00000264705:G767S	G	+	1	0	CAD	27307851	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.222000	0.78025	2.733000	0.93635	0.655000	0.94253	GGC	.	.		0.502	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
CEBPZ	10153	hgsc.bcm.edu	37	2	37449694	37449694	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:37449694C>T	ENST00000234170.5	-	4	2039	c.1894G>A	c.(1894-1896)Gaa>Aaa	p.E632K		NM_005760.2	NP_005751.2	Q03701	CEBPZ_HUMAN	CCAAT/enhancer binding protein (C/EBP), zeta	632					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|endometrium(2)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28		all_hematologic(82;0.21)				AAATTTTCTTCATCATCAGAC	0.328																																					p.E632K		Atlas-SNP	.											.	CEBPZ	68	.	0			c.G1894A						.						84.0	79.0	81.0					2																	37449694		2202	4300	6502	SO:0001583	missense	10153	exon4			TTTCTTCATCATC	M37197	CCDS1787.1	2p22.3	2008-09-03	2008-09-03		ENSG00000115816	ENSG00000115816			24218	protein-coding gene	gene with protein product		612828				2247079, 12534345	Standard	NM_005760		Approved	CBF2, CTF2	uc002rpz.3	Q03701	OTTHUMG00000100960	ENST00000234170.5:c.1894G>A	chr2.hg19:g.37449694C>T	ENSP00000234170:p.Glu632Lys	54.0	0.0		54.0	8.0	NM_005760	Q8NE75	Missense_Mutation	SNP	ENST00000234170.5	hg19	CCDS1787.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345188	0.82022	.	.	ENSG00000115816	ENST00000234170;ENST00000545744	T	0.15834	2.39	5.2	5.2	0.72013	Armadillo-type fold (1);CCAAT-binding factor (1);	0.045272	0.85682	D	0.000000	T	0.40015	0.1100	L	0.61387	1.9	0.52099	D	0.999942	D	0.76494	0.999	D	0.71870	0.975	T	0.16453	-1.0402	10	0.87932	D	0	.	16.8847	0.86072	0.0:1.0:0.0:0.0	.	632	Q03701	CEBPZ_HUMAN	K	632	ENSP00000234170:E632K	ENSP00000234170:E632K	E	-	1	0	CEBPZ	37303198	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.633000	0.61318	2.573000	0.86826	0.650000	0.86243	GAA	.	.		0.328	CEBPZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218569.2	NM_005760	
SRBD1	55133	hgsc.bcm.edu	37	2	45829136	45829136	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:45829136G>T	ENST00000263736.4	-	3	229	c.167C>A	c.(166-168)cCc>cAc	p.P56H		NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	56					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			GGATTCCTTGGGAGGGGGCTG	0.493																																					p.P56H		Atlas-SNP	.											.	SRBD1	107	.	0			c.C167A						.						159.0	161.0	160.0					2																	45829136		2203	4300	6503	SO:0001583	missense	55133	exon3			TCCTTGGGAGGGG	AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.167C>A	chr2.hg19:g.45829136G>T	ENSP00000263736:p.Pro56His	95.0	0.0		112.0	21.0	NM_018079	Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	ENST00000263736.4	hg19	CCDS1823.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658543	0.47467	.	.	ENSG00000068784	ENST00000263736	T	0.24350	1.86	5.7	3.82	0.43975	.	1.121610	0.06649	N	0.762340	T	0.20251	0.0487	N	0.14661	0.345	0.80722	D	1	B	0.32918	0.39	B	0.33196	0.159	T	0.03750	-1.1007	10	0.87932	D	0	.	12.8924	0.58080	0.0:0.3098:0.6902:0.0	.	56	Q8N5C6	SRBD1_HUMAN	H	56	ENSP00000263736:P56H	ENSP00000263736:P56H	P	-	2	0	SRBD1	45682640	0.965000	0.33210	0.929000	0.37066	0.854000	0.48673	1.578000	0.36525	1.384000	0.46424	0.557000	0.71058	CCC	.	.		0.493	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250747.3	NM_018079	
CNRIP1	25927	hgsc.bcm.edu	37	2	68521038	68521038	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:68521038C>T	ENST00000263655.3	-	3	1056	c.451G>A	c.(451-453)Gag>Aag	p.E151K	CNRIP1_ENST00000409559.3_Intron|CNRIP1_ENST00000481714.1_5'UTR	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	151										kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						CTGCGTGTCTCGTTGGGCTTG	0.468																																					p.E151K		Atlas-SNP	.											.	CNRIP1	45	.	0			c.G451A						.						147.0	117.0	127.0					2																	68521038		2203	4300	6503	SO:0001583	missense	25927	exon3			GTGTCTCGTTGGG	AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.451G>A	chr2.hg19:g.68521038C>T	ENSP00000263655:p.Glu151Lys	110.0	0.0		108.0	14.0	NM_015463	B2R4D0|Q49AN4|Q9UFZ0	Missense_Mutation	SNP	ENST00000263655.3	hg19	CCDS1886.1	.	.	.	.	.	.	.	.	.	.	C	36	5.650642	0.96714	.	.	ENSG00000119865	ENST00000263655	.	.	.	5.68	5.68	0.88126	.	0.240456	0.48286	D	0.000186	T	0.63558	0.2521	L	0.55990	1.75	0.80722	D	1	D	0.60160	0.987	P	0.48304	0.573	T	0.67225	-0.5724	9	0.72032	D	0.01	-8.2808	19.8015	0.96509	0.0:1.0:0.0:0.0	.	151	Q96F85	CNRP1_HUMAN	K	151	.	ENSP00000263655:E151K	E	-	1	0	CNRIP1	68374542	1.000000	0.71417	0.963000	0.40424	0.935000	0.57460	7.818000	0.86416	2.678000	0.91216	0.650000	0.86243	GAG	.	.		0.468	CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251758.1	NM_015463	
ASPRV1	151516	hgsc.bcm.edu	37	2	70188363	70188363	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:70188363A>G	ENST00000320256.4	-	1	1034	c.458T>C	c.(457-459)cTc>cCc	p.L153P	PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						CTGGGGACTGAGCCTATTGTA	0.562																																					p.L153P		Atlas-SNP	.											.	ASPRV1	41	.	0			c.T458C						.						42.0	44.0	43.0					2																	70188363		2203	4300	6503	SO:0001583	missense	151516	exon1			GGACTGAGCCTAT	AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.458T>C	chr2.hg19:g.70188363A>G	ENSP00000315383:p.Leu153Pro	67.0	0.0		69.0	11.0	NM_152792		Missense_Mutation	SNP	ENST00000320256.4	hg19	CCDS1897.1	.	.	.	.	.	.	.	.	.	.	A	12.30	1.895339	0.33442	.	.	ENSG00000244617	ENST00000320256	T	0.61627	0.09	5.99	5.99	0.97316	.	0.155181	0.28760	N	0.014238	T	0.65481	0.2695	L	0.29908	0.895	0.46678	D	0.999159	D	0.89917	1.0	D	0.85130	0.997	T	0.68739	-0.5329	10	0.87932	D	0	-15.2793	12.8861	0.58045	1.0:0.0:0.0:0.0	.	153	Q53RT3	APRV1_HUMAN	P	153	ENSP00000315383:L153P	ENSP00000315383:L153P	L	-	2	0	ASPRV1	70041867	0.975000	0.34042	0.104000	0.21259	0.018000	0.09664	4.811000	0.62606	2.291000	0.77112	0.533000	0.62120	CTC	.	.		0.562	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334161.1	NM_152792	
SEMA4F	10505	hgsc.bcm.edu	37	2	74902504	74902504	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:74902504G>A	ENST00000357877.2	+	10	1514	c.1365G>A	c.(1363-1365)ctG>ctA	p.L455L	SEMA4F_ENST00000339773.5_Silent_p.L300L|SEMA4F_ENST00000473350.1_Intron	NM_004263.3	NP_004254.2	O95754	SEM4F_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F	455	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|negative regulation of axon extension (GO:0030517)|nervous system development (GO:0007399)|retinal ganglion cell axon guidance (GO:0031290)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)			biliary_tract(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	45						TGCTCTACCTGGGGACAGGTA	0.517											OREG0014721	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L455L		Atlas-SNP	.											.	SEMA4F	89	.	0			c.G1365A						.						36.0	37.0	37.0					2																	74902504		2203	4300	6503	SO:0001819	synonymous_variant	10505	exon10			CTACCTGGGGACA	AF038652	CCDS1955.1, CCDS62942.1, CCDS74529.1	2p13.1	2008-05-21			ENSG00000135622	ENSG00000135622		"""Semaphorins"""	10734	protein-coding gene	gene with protein product	"""m-Sema M"""	603706		SEMAM		10051670	Standard	NM_004263		Approved	SEMAW	uc002sna.2	O95754	OTTHUMG00000129952	ENST00000357877.2:c.1365G>A	chr2.hg19:g.74902504G>A		93.0	0.0	1156	88.0	14.0	NM_004263	Q542Y7|Q9NS35	Silent	SNP	ENST00000357877.2	hg19	CCDS1955.1																																																																																			.	.		0.517	SEMA4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252214.2	NM_004263	
ADRA2B	151	hgsc.bcm.edu	37	2	96781723	96781723	+	Missense_Mutation	SNP	C	C	T	rs370956755		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:96781723C>T	ENST00000409345.3	-	1	261	c.166G>A	c.(166-168)Gcc>Acc	p.A56T		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	56					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)			endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATGTCGGCGGCGGCCAGCGAC	0.627																																					p.A56T		Atlas-SNP	.											.	ADRA2B	115	.	0			c.G166A						.	A	THR/ALA	0,4404		0,0,2202	37.0	45.0	42.0		166	4.5	1.0	2		42	1,8597		0,1,4298	no	missense	ADRA2B	NM_000682.5	58	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	56/448	96781723	1,13001	2202	4299	6501	SO:0001583	missense	151	exon1			CGGCGGCGGCCAG	M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.166G>A	chr2.hg19:g.96781723C>T	ENSP00000387281:p.Ala56Thr	236.0	0.0		213.0	33.0	NM_000682	Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	SNP	ENST00000409345.3	hg19	CCDS56129.1	.	.	.	.	.	.	.	.	.	.	c	22.1	4.250248	0.80024	0.0	1.16E-4	ENSG00000222040	ENST00000409345	T	0.19669	2.13	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.32645	0.0836	M	0.70903	2.155	0.54753	D	0.999986	D	0.56746	0.977	P	0.48552	0.581	T	0.17868	-1.0355	9	0.54805	T	0.06	.	14.755	0.69557	0.0:1.0:0.0:0.0	.	56	P18089	ADA2B_HUMAN	T	56	ENSP00000387281:A56T	ENSP00000387281:A56T	A	-	1	0	ADRA2B	96145450	0.978000	0.34361	0.994000	0.49952	0.990000	0.78478	2.592000	0.46171	2.334000	0.79466	0.450000	0.29827	GCC	.	.		0.627	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334990.1		
AFF3	3899	hgsc.bcm.edu	37	2	100289003	100289003	+	Missense_Mutation	SNP	T	T	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:100289003T>A	ENST00000409236.2	-	10	1252	c.1140A>T	c.(1138-1140)gaA>gaT	p.E380D	AFF3_ENST00000356421.2_Missense_Mutation_p.E405D|AFF3_ENST00000409579.1_Missense_Mutation_p.E405D|AFF3_ENST00000317233.4_Missense_Mutation_p.E380D			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	380					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						ATCTTACCTGTTCATTCTCCT	0.438																																					p.E405D		Atlas-SNP	.											.	AFF3	164	.	0			c.A1215T						.						215.0	190.0	199.0					2																	100289003		2203	4300	6503	SO:0001583	missense	3899	exon11			TACCTGTTCATTC	U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1140A>T	chr2.hg19:g.100289003T>A	ENSP00000387207:p.Glu380Asp	100.0	0.0		69.0	8.0	NM_001025108	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	ENST00000409236.2	hg19	CCDS42723.1	.	.	.	.	.	.	.	.	.	.	T	11.28	1.592804	0.28357	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.35	-2.21	0.06973	.	0.275556	0.27185	N	0.020528	T	0.32436	0.0829	N	0.05124	-0.11	0.29734	N	0.837622	B;B;B	0.33964	0.434;0.018;0.041	B;B;B	0.34418	0.182;0.028;0.016	T	0.37126	-0.9719	10	0.22109	T	0.4	.	8.655	0.34058	0.0:0.5008:0.1342:0.365	.	534;380;405	B7Z4I6;P51826;P51826-2	.;AFF3_HUMAN;.	D	380;405;405;380;380;534;405	ENSP00000317421:E380D;ENSP00000348793:E405D;ENSP00000386834:E405D;ENSP00000387207:E380D	ENSP00000317421:E380D	E	-	3	2	AFF3	99655435	0.332000	0.24722	0.997000	0.53966	0.994000	0.84299	-0.854000	0.04299	-0.165000	0.10908	0.533000	0.62120	GAA	.	.		0.438	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328982.3	NM_002285	
TGFBRAP1	9392	hgsc.bcm.edu	37	2	105924248	105924248	+	Missense_Mutation	SNP	G	G	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:105924248G>C	ENST00000393359.2	-	2	937	c.511C>G	c.(511-513)Ctc>Gtc	p.L171V	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.L171V			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	171	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						GCCACAGCGAGGGGCTGCTCG	0.557																																					p.L171V	Esophageal Squamous(183;794 2019 9730 21801 48859)	Atlas-SNP	.											.	TGFBRAP1	70	.	0			c.C511G						.						119.0	119.0	119.0					2																	105924248		2203	4300	6503	SO:0001583	missense	9392	exon2			CAGCGAGGGGCTG	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.511C>G	chr2.hg19:g.105924248G>C	ENSP00000377027:p.Leu171Val	85.0	0.0		89.0	24.0	NM_004257	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	hg19	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	G	4.431	0.079691	0.08533	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.04758	3.56;3.56	5.32	3.28	0.37604	Citron-like (2);	0.231473	0.44285	N	0.000463	T	0.02230	0.0069	N	0.11560	0.145	0.32097	N	0.591051	B	0.09022	0.002	B	0.20384	0.029	T	0.33163	-0.9879	10	0.16420	T	0.52	-10.6698	2.2192	0.03968	0.3909:0.3106:0.2985:0.0	.	171	Q8WUH2	TGFA1_HUMAN	V	171	ENSP00000377027:L171V;ENSP00000258449:L171V	ENSP00000258449:L171V	L	-	1	0	TGFBRAP1	105290680	1.000000	0.71417	0.348000	0.25681	0.853000	0.48598	3.881000	0.56152	0.684000	0.31448	0.655000	0.94253	CTC	.	.		0.557	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
SULT1C3	442038	hgsc.bcm.edu	37	2	108881280	108881280	+	Splice_Site	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:108881280G>T	ENST00000329106.2	+	6	621		c.e6-1			NM_001008743.1	NP_001008743.1	Q6IMI6	ST1C3_HUMAN	sulfotransferase family, cytosolic, 1C, member 3						sulfur compound metabolic process (GO:0006790)	cytoplasm (GO:0005737)	alcohol sulfotransferase activity (GO:0004027)|aryl sulfotransferase activity (GO:0004062)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(4)	16						TCCACATACAGGACCCAAAGC	0.393																																					.		Atlas-SNP	.											.	SULT1C3	53	.	0			c.622-1G>T						.						57.0	56.0	56.0					2																	108881280		2203	4300	6503	SO:0001630	splice_region_variant	442038	exon6			CATACAGGACCCA	BC146362	CCDS33267.1	2q12.3	2007-07-26			ENSG00000196228	ENSG00000196228		"""Sulfotransferases, cytosolic"""	33543	protein-coding gene	gene with protein product						14676822, 17425406	Standard	NM_001008743		Approved		uc010ywo.2	Q6IMI6	OTTHUMG00000153227	ENST00000329106.2:c.622-1G>T	chr2.hg19:g.108881280G>T		159.0	0.0		150.0	13.0	NM_001008743	Q6IMI5	Splice_Site	SNP	ENST00000329106.2	hg19	CCDS33267.1	.	.	.	.	.	.	.	.	.	.	g	21.4	4.144370	0.77888	.	.	ENSG00000196228	ENST00000329106	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2242	0.86965	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SULT1C3	108247712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.905000	0.69893	2.534000	0.85438	0.655000	0.94253	.	.	.		0.393	SULT1C3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330255.1	NM_001008743	Intron
SH3RF3	344558	hgsc.bcm.edu	37	2	110049067	110049067	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:110049067C>T	ENST00000309415.6	+	6	1514	c.1514C>T	c.(1513-1515)gCg>gTg	p.A505V		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	505	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						TTCAAGGGGGCGTCTCTGAGG	0.617																																					p.A505V		Atlas-SNP	.											.	SH3RF3	62	.	0			c.C1514T						.						36.0	42.0	40.0					2																	110049067		1999	4174	6173	SO:0001583	missense	344558	exon6			AGGGGGCGTCTCT	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.1514C>T	chr2.hg19:g.110049067C>T	ENSP00000309186:p.Ala505Val	126.0	0.0		84.0	8.0	NM_001099289	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	hg19		.	.	.	.	.	.	.	.	.	.	C	20.5	3.993756	0.74703	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.28255	1.62;1.62	4.9	4.01	0.46588	Src homology-3 domain (4);	0.101080	0.64402	D	0.000002	T	0.21718	0.0523	.	.	.	0.35910	D	0.83105	B	0.15473	0.013	B	0.18263	0.021	T	0.15009	-1.0452	9	0.21014	T	0.42	-6.2418	13.4773	0.61316	0.0:0.924:0.0:0.076	.	505	Q8TEJ3	SH3R3_HUMAN	V	505	ENSP00000414997:A505V;ENSP00000309186:A505V	ENSP00000309186:A505V	A	+	2	0	SH3RF3	109415499	0.998000	0.40836	0.043000	0.18650	0.952000	0.60782	4.566000	0.60843	1.399000	0.46721	0.561000	0.74099	GCG	.	.		0.617	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
SLC20A1	6574	hgsc.bcm.edu	37	2	113418726	113418726	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:113418726A>G	ENST00000272542.3	+	10	2340	c.1801A>G	c.(1801-1803)Agt>Ggt	p.S601G		NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	601					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						TAGTGGCTTCAGTATTGAACT	0.413																																					p.S601G		Atlas-SNP	.											.	SLC20A1	59	.	0			c.A1801G						.						121.0	109.0	113.0					2																	113418726		2203	4300	6503	SO:0001583	missense	6574	exon10			GGCTTCAGTATTG		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.1801A>G	chr2.hg19:g.113418726A>G	ENSP00000272542:p.Ser601Gly	73.0	0.0		77.0	9.0	NM_005415	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	ENST00000272542.3	hg19	CCDS2099.1	.	.	.	.	.	.	.	.	.	.	A	31	5.066537	0.93898	.	.	ENSG00000144136	ENST00000272542	D	0.91295	-2.82	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.95401	0.8507	M	0.90595	3.13	0.80722	D	1	D	0.60575	0.988	P	0.60886	0.88	D	0.96110	0.9076	10	0.87932	D	0	-12.8881	13.8691	0.63608	1.0:0.0:0.0:0.0	.	601	Q8WUM9	S20A1_HUMAN	G	601	ENSP00000272542:S601G	ENSP00000272542:S601G	S	+	1	0	SLC20A1	113135197	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.207000	0.95064	2.168000	0.68352	0.528000	0.53228	AGT	.	.		0.413	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254086.2	NM_005415	
SCTR	6344	hgsc.bcm.edu	37	2	120199162	120199162	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:120199162G>A	ENST00000019103.5	-	12	1421	c.1154C>T	c.(1153-1155)gCc>gTc	p.A385V		NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor	385					digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	GTAGAGGACGGCCACCACCAG	0.602																																					p.A385V		Atlas-SNP	.											.	SCTR	45	.	0			c.C1154T						.						82.0	68.0	73.0					2																	120199162		2203	4300	6503	SO:0001583	missense	6344	exon12			AGGACGGCCACCA		CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407	ENST00000019103.5:c.1154C>T	chr2.hg19:g.120199162G>A	ENSP00000019103:p.Ala385Val	87.0	0.0		81.0	28.0	NM_002980	Q12961|Q13213|Q53T00	Missense_Mutation	SNP	ENST00000019103.5	hg19	CCDS2127.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866985	0.91511	.	.	ENSG00000080293	ENST00000019103	T	0.37235	1.21	4.78	4.78	0.61160	GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	0.000000	0.56097	D	0.000031	T	0.64080	0.2566	M	0.84585	2.705	0.58432	D	0.999999	D	0.63046	0.992	D	0.70716	0.97	T	0.70414	-0.4878	10	0.66056	D	0.02	.	16.5385	0.84378	0.0:0.0:1.0:0.0	.	385	P47872	SCTR_HUMAN	V	385	ENSP00000019103:A385V	ENSP00000019103:A385V	A	-	2	0	SCTR	119915632	1.000000	0.71417	0.983000	0.44433	0.928000	0.56348	9.216000	0.95154	2.467000	0.83353	0.655000	0.94253	GCC	.	.		0.602	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254198.2		
TMEM163	81615	hgsc.bcm.edu	37	2	135470783	135470783	+	Silent	SNP	C	C	T	rs543616754		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:135470783C>T	ENST00000281924.6	-	2	373	c.309G>A	c.(307-309)gcG>gcA	p.A103A		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	103						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		AGGCAGCCACCGCGAGGGCCA	0.517																																					p.A103A		Atlas-SNP	.											TMEM163,caecum,adenoma,0,1	TMEM163	34	.	0			c.G309A						.						170.0	142.0	151.0					2																	135470783		2203	4300	6503	SO:0001819	synonymous_variant	81615	exon2			AGCCACCGCGAGG		CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.309G>A	chr2.hg19:g.135470783C>T		100.0	0.0		93.0	15.0	NM_030923	Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Silent	SNP	ENST00000281924.6	hg19	CCDS2172.1																																																																																			.	.		0.517	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254631.2	NM_030923	
ZRANB3	84083	hgsc.bcm.edu	37	2	135985392	135985392	+	Missense_Mutation	SNP	C	C	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:135985392C>G	ENST00000264159.6	-	14	2264	c.2148G>C	c.(2146-2148)caG>caC	p.Q716H	ZRANB3_ENST00000401392.1_Missense_Mutation_p.Q716H|ZRANB3_ENST00000536680.1_Missense_Mutation_p.Q716H|ZRANB3_ENST00000412849.1_5'UTR	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	716					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		CATTACCTGGCTGGGATGTAA	0.388																																					p.Q716H		Atlas-SNP	.											.	ZRANB3	109	.	0			c.G2148C						.						128.0	110.0	116.0					2																	135985392		1857	4090	5947	SO:0001583	missense	84083	exon14			ACCTGGCTGGGAT	AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.2148G>C	chr2.hg19:g.135985392C>G	ENSP00000264159:p.Gln716His	95.0	0.0		88.0	13.0	NM_032143	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Missense_Mutation	SNP	ENST00000264159.6	hg19	CCDS46419.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539003	0.27475	.	.	ENSG00000121988	ENST00000538542;ENST00000283060;ENST00000401392;ENST00000264159;ENST00000536680	D;D;D	0.91011	-2.76;-2.77;-2.74	4.84	2.08	0.27032	.	0.808984	0.11441	N	0.563767	D	0.88078	0.6340	L	0.57536	1.79	0.09310	N	1	P;P	0.44309	0.832;0.697	P;P	0.44477	0.45;0.451	T	0.77558	-0.2543	10	0.36615	T	0.2	-19.4711	6.3648	0.21449	0.0:0.7008:0.0:0.2992	.	716;716	Q5FWF4;Q5FWF4-3	ZRAB3_HUMAN;.	H	181;181;716;716;716	ENSP00000383979:Q716H;ENSP00000264159:Q716H;ENSP00000441320:Q716H	ENSP00000264159:Q716H	Q	-	3	2	ZRANB3	135701862	0.826000	0.29277	0.095000	0.20976	0.447000	0.32167	0.681000	0.25320	0.755000	0.32990	-0.300000	0.09419	CAG	.	.		0.388	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318254.1	NM_032143	
LRP1B	53353	hgsc.bcm.edu	37	2	141299487	141299487	+	Missense_Mutation	SNP	A	A	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:141299487A>T	ENST00000389484.3	-	44	8219	c.7248T>A	c.(7246-7248)aaT>aaA	p.N2416K		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2416					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGAATATATAATTGTCATAAA	0.373										TSP Lung(27;0.18)																											p.N2416K	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.T7248A						.						81.0	78.0	79.0					2																	141299487		2203	4299	6502	SO:0001583	missense	53353	exon44			TATATAATTGTCA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.7248T>A	chr2.hg19:g.141299487A>T	ENSP00000374135:p.Asn2416Lys	140.0	0.0		117.0	22.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.161377	0.57368	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91237	-2.81	5.46	3.12	0.35913	Six-bladed beta-propeller, TolB-like (1);	0.206592	0.40728	U	0.001025	D	0.83115	0.5184	L	0.42744	1.35	0.32782	N	0.502422	B	0.24258	0.1	B	0.15870	0.014	T	0.78768	-0.2075	10	0.35671	T	0.21	.	4.8781	0.13665	0.5622:0.1514:0.2864:0.0	.	2416	Q9NZR2	LRP1B_HUMAN	K	2416;2354	ENSP00000374135:N2416K	ENSP00000374135:N2416K	N	-	3	2	LRP1B	141015957	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	2.012000	0.40932	0.905000	0.36596	0.402000	0.26972	AAT	.	.		0.373	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRP1B	53353	hgsc.bcm.edu	37	2	141709436	141709436	+	Silent	SNP	G	G	A	rs146639012		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:141709436G>A	ENST00000389484.3	-	19	3932	c.2961C>T	c.(2959-2961)tgC>tgT	p.C987C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	987	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCCAGAGTCGCAGTGCCATT	0.453										TSP Lung(27;0.18)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		18933	0.0		0.0	False		,,,				2504	0.0				p.C987C	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.C2961T						.	G		1,4405	2.1+/-5.4	0,1,2202	172.0	138.0	149.0		2961	-4.9	0.9	2	dbSNP_134	149	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	LRP1B	NM_018557.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		987/4600	141709436	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	53353	exon19			AGAGTCGCAGTGC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2961C>T	chr2.hg19:g.141709436G>A		107.0	0.0		86.0	11.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Silent	SNP	ENST00000389484.3	hg19	CCDS2182.1																																																																																			.	G|1.000;A|0.000		0.453	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SCN3A	6328	hgsc.bcm.edu	37	2	166032889	166032889	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:166032889A>G	ENST00000360093.3	-	3	507	c.16T>C	c.(16-18)Ttg>Ctg	p.L6L	SCN3A_ENST00000283254.7_Silent_p.L6L|SCN3A_ENST00000409101.3_Silent_p.L6L	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	6					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGGGGTACCAACAGTGCCTGT	0.423																																					p.L6L		Atlas-SNP	.											.	SCN3A	544	.	0			c.T16C						.						100.0	99.0	99.0					2																	166032889		2203	4299	6502	SO:0001819	synonymous_variant	6328	exon3			GTACCAACAGTGC	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.16T>C	chr2.hg19:g.166032889A>G		61.0	0.0		65.0	30.0	NM_001081676	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Silent	SNP	ENST00000360093.3	hg19																																																																																				.	.		0.423	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
LRP2	4036	hgsc.bcm.edu	37	2	170033019	170033019	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:170033019G>A	ENST00000263816.3	-	54	10758	c.10473C>T	c.(10471-10473)tgC>tgT	p.C3491C	LRP2_ENST00000461418.1_5'Flank	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3491	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CTGGACACTCGCAAGTGAACC	0.512																																					p.C3491C		Atlas-SNP	.											LRP2,NS,carcinoma,0,1	LRP2	751	.	0			c.C10473T						.						174.0	134.0	148.0					2																	170033019		2203	4300	6503	SO:0001819	synonymous_variant	4036	exon54			ACACTCGCAAGTG		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10473C>T	chr2.hg19:g.170033019G>A		97.0	0.0		107.0	5.0	NM_004525	O00711|Q16215	Silent	SNP	ENST00000263816.3	hg19	CCDS2232.1																																																																																			.	.		0.512	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
TTN	7273	hgsc.bcm.edu	37	2	179588283	179588283	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:179588283G>A	ENST00000591111.1	-	72	20817	c.20593C>T	c.(20593-20595)Cgg>Tgg	p.R6865W	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R7182W|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.R5938W|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12456	Ig-like 50.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTTGCACCGGTCTCCTTTC	0.428																																					p.R7182W		Atlas-SNP	.											.	TTN	18412	.	0			c.C21544T						.						81.0	77.0	78.0					2																	179588283		1869	4097	5966	SO:0001583	missense	7273	exon74			TGCACCGGTCTCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.20593C>T	chr2.hg19:g.179588283G>A	ENSP00000465570:p.Arg6865Trp	107.0	0.0		132.0	23.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	6.070	0.381286	0.11466	.	.	ENSG00000155657	ENST00000342992	T	0.53206	0.63	6.16	0.56	0.17279	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54870	0.1885	M	0.88979	2.995	0.23515	N	0.997517	P	0.51057	0.941	B	0.43360	0.417	T	0.54036	-0.8353	9	0.87932	D	0	.	10.5719	0.45204	0.0961:0.0:0.245:0.6589	.	6865	Q8WZ42	TITIN_HUMAN	W	5938	ENSP00000343764:R5938W	ENSP00000343764:R5938W	R	-	1	2	TTN	179296528	0.000000	0.05858	0.512000	0.27736	0.723000	0.41478	0.901000	0.28445	0.207000	0.20607	-0.188000	0.12872	CGG	.	.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ALS2	57679	hgsc.bcm.edu	37	2	202622187	202622187	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:202622187A>G	ENST00000264276.6	-	5	1781	c.1409T>C	c.(1408-1410)aTc>aCc	p.I470T		NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	470					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TTCTTCTCTGATATCCACAAG	0.443																																					p.I470T		Atlas-SNP	.											.	ALS2	172	.	0			c.T1409C						.						207.0	193.0	197.0					2																	202622187		1874	4097	5971	SO:0001583	missense	57679	exon5			TCTCTGATATCCA	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1409T>C	chr2.hg19:g.202622187A>G	ENSP00000264276:p.Ile470Thr	122.0	0.0		123.0	15.0	NM_020919	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	ENST00000264276.6	hg19	CCDS42800.1	.	.	.	.	.	.	.	.	.	.	A	18.79	3.699875	0.68501	.	.	ENSG00000003393	ENST00000264276	T	0.58358	0.34	5.9	5.9	0.94986	.	0.107189	0.64402	D	0.000007	T	0.58119	0.2100	N	0.17082	0.46	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.984	D;D;P	0.83275	0.996;0.917;0.835	T	0.59273	-0.7485	10	0.34782	T	0.22	.	16.3318	0.83023	1.0:0.0:0.0:0.0	.	470;470;470	Q96Q42-3;Q6IQ41;Q96Q42	.;.;ALS2_HUMAN	T	470	ENSP00000264276:I470T	ENSP00000264276:I470T	I	-	2	0	ALS2	202330432	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	8.283000	0.89909	2.248000	0.74166	0.460000	0.39030	ATC	.	.		0.443	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
SPEG	10290	hgsc.bcm.edu	37	2	220313610	220313610	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:220313610C>T	ENST00000312358.7	+	4	1862	c.1730C>T	c.(1729-1731)gCg>gTg	p.A577V	SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396698.1_Missense_Mutation_p.A473V|SPEG_ENST00000396695.2_5'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	577	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CGCGGGCCGGCGGGCAGGACA	0.751																																					p.A577V		Atlas-SNP	.											.	SPEG	272	.	0			c.C1730T						.						2.0	3.0	3.0					2																	220313610		1369	3172	4541	SO:0001583	missense	10290	exon4			GGCCGGCGGGCAG	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.1730C>T	chr2.hg19:g.220313610C>T	ENSP00000311684:p.Ala577Val	39.0	0.0		29.0	9.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.536243	0.00942	.	.	ENSG00000072195	ENST00000312358;ENST00000265327;ENST00000396698	T;T	0.64085	-0.08;0.3	3.9	-1.25	0.09405	.	1.254290	0.06059	N	0.657967	T	0.39963	0.1098	N	0.14661	0.345	0.20307	N	0.999918	B	0.09022	0.002	B	0.04013	0.001	T	0.13335	-1.0513	10	0.26408	T	0.33	.	4.6178	0.12435	0.0:0.4452:0.3509:0.2039	.	577	Q15772	SPEG_HUMAN	V	577;577;473	ENSP00000311684:A577V;ENSP00000379926:A473V	ENSP00000265327:A577V	A	+	2	0	SPEG	220021854	0.002000	0.14202	0.035000	0.18076	0.055000	0.15305	-1.633000	0.02022	-0.485000	0.06754	-0.379000	0.06801	GCG	.	.		0.751	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
SP110	3431	hgsc.bcm.edu	37	2	231033882	231033882	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:231033882A>G	ENST00000358662.4	-	18	2106	c.2028T>C	c.(2026-2028)ggT>ggC	p.G676G	AC009950.2_ENST00000454058.1_RNA|SP110_ENST00000258381.6_Silent_p.G700G|AC009950.2_ENST00000594622.1_RNA|AC009950.2_ENST00000595586.2_RNA|AC009950.2_ENST00000600787.1_RNA|AC009950.2_ENST00000445199.1_RNA|AC009950.2_ENST00000609120.1_RNA	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	676	Bromo.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		CTTCATGAAAACCGAGCACGT	0.468																																					p.G700G		Atlas-SNP	.											.	SP110	105	.	0			c.T2100C						.						185.0	191.0	189.0					2																	231033882		2203	4300	6503	SO:0001819	synonymous_variant	3431	exon19			ATGAAAACCGAGC	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.2028T>C	chr2.hg19:g.231033882A>G		66.0	0.0		68.0	11.0	NM_080424	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Silent	SNP	ENST00000358662.4	hg19	CCDS2474.1																																																																																			.	.		0.468	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000332414.1	NM_080424	
ESPNL	339768	hgsc.bcm.edu	37	2	239039675	239039675	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:239039675C>T	ENST00000343063.3	+	9	2583	c.2320C>T	c.(2320-2322)Cgg>Tgg	p.R774W	ESPNL_ENST00000409169.1_Missense_Mutation_p.R730W|ESPNL_ENST00000477241.1_3'UTR|ESPNL_ENST00000409506.1_Missense_Mutation_p.R406W	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	774										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CGCGGGGTTGCGGGGCCAGGA	0.716																																					p.R774W		Atlas-SNP	.											.	ESPNL	63	.	0			c.C2320T						.						2.0	2.0	2.0					2																	239039675		1412	3156	4568	SO:0001583	missense	339768	exon9			GGGTTGCGGGGCC	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.2320C>T	chr2.hg19:g.239039675C>T	ENSP00000339115:p.Arg774Trp	67.0	0.0		76.0	17.0	NM_194312	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	hg19	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	C	6.914	0.538302	0.13188	.	.	ENSG00000144488	ENST00000343063;ENST00000409169;ENST00000409506	T;T;T	0.63913	-0.07;1.04;0.62	4.08	-1.1	0.09872	.	0.695284	0.12220	N	0.488437	T	0.51381	0.1671	L	0.44542	1.39	0.09310	N	1	D;D	0.65815	0.995;0.992	P;B	0.46975	0.533;0.332	T	0.44667	-0.9313	10	0.44086	T	0.13	-11.6203	4.8088	0.13333	0.629:0.2175:0.0:0.1535	.	730;774	Q6ZVH7-2;Q6ZVH7	.;ESPNL_HUMAN	W	774;730;406	ENSP00000339115:R774W;ENSP00000386577:R730W;ENSP00000386579:R406W	ENSP00000339115:R774W	R	+	1	2	ESPNL	238704414	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.379000	0.02554	0.140000	0.18849	0.313000	0.20887	CGG	.	.		0.716	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
HDAC4	9759	hgsc.bcm.edu	37	2	240056341	240056341	+	Splice_Site	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:240056341T>C	ENST00000345617.3	-	10	1770		c.e10-2		HDAC4_ENST00000553145.1_Splice_Site|HDAC4_ENST00000543185.1_Splice_Site|HDAC4_ENST00000541256.1_Splice_Site	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		CAAACTCGTCTGGGGACAGAA	0.532																																					.		Atlas-SNP	.											.	HDAC4	127	.	0			c.979-2A>G						.						110.0	103.0	106.0					2																	240056341		2203	4300	6503	SO:0001630	splice_region_variant	9759	exon11			CTCGTCTGGGGAC	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.979-2A>G	chr2.hg19:g.240056341T>C		73.0	0.0		79.0	11.0	NM_006037	Q9UND6	Splice_Site	SNP	ENST00000345617.3	hg19	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178223	0.57692	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000541256;ENST00000393621;ENST00000445704	.	.	.	4.32	4.32	0.51571	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2038	0.65721	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HDAC4	239721278	1.000000	0.71417	0.984000	0.44739	0.602000	0.36980	7.571000	0.82399	1.896000	0.54893	0.459000	0.35465	.	.	.		0.532	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	Intron
OR6B2	389090	hgsc.bcm.edu	37	2	240969782	240969782	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:240969782C>T	ENST00000402971.2	-	1	124	c.65G>A	c.(64-66)gGg>gAg	p.G22E		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	22						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		GTACTGCAGCCCTGGGGCCGT	0.592																																					p.G22E		Atlas-SNP	.											.	OR6B2	30	.	0			c.G65A						.						42.0	46.0	45.0					2																	240969782		2016	4183	6199	SO:0001583	missense	389090	exon1			TGCAGCCCTGGGG		CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.65G>A	chr2.hg19:g.240969782C>T	ENSP00000384563:p.Gly22Glu	191.0	0.0		156.0	47.0	NM_001005853	B2RPR3|Q8NGW0	Missense_Mutation	SNP	ENST00000402971.2	hg19	CCDS46559.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-2.963569	0.00049	.	.	ENSG00000182083	ENST00000402971	T	0.00421	7.46	4.28	0.271	0.15640	.	1.961550	0.02720	N	0.113895	T	0.00144	0.0004	N	0.01515	-0.825	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35101	-0.9802	10	0.02654	T	1	.	4.1485	0.10227	0.1622:0.5469:0.0:0.2909	.	22	Q6IFH4	OR6B2_HUMAN	E	22	ENSP00000384563:G22E	ENSP00000384563:G22E	G	-	2	0	OR6B2	240618455	0.000000	0.05858	0.023000	0.16930	0.024000	0.10985	-0.703000	0.05063	-0.072000	0.12864	-0.225000	0.12378	GGG	.	.		0.592	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326079.1	NM_001005853	
TATDN2	9797	hgsc.bcm.edu	37	3	10312434	10312434	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:10312434G>A	ENST00000287652.4	+	4	2619	c.1568G>A	c.(1567-1569)aGc>aAc	p.S523N	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Missense_Mutation_p.S523N	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	523					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						AAAATTTACAGCAGCTCCTTC	0.478																																					p.S523N		Atlas-SNP	.											.	TATDN2	59	.	0			c.G1568A						.						77.0	82.0	80.0					3																	10312434		2203	4300	6503	SO:0001583	missense	9797	exon4			TTTACAGCAGCTC	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.1568G>A	chr3.hg19:g.10312434G>A	ENSP00000287652:p.Ser523Asn	100.0	0.0		122.0	30.0	NM_014760	Q3MIL9|Q5BKU0	Missense_Mutation	SNP	ENST00000287652.4	hg19	CCDS33698.1	.	.	.	.	.	.	.	.	.	.	G	12.83	2.056096	0.36277	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.25085	1.82;1.82	5.0	4.11	0.48088	.	0.440605	0.22282	N	0.062102	T	0.15825	0.0381	N	0.13235	0.315	0.23669	N	0.997159	B	0.29212	0.237	B	0.35353	0.201	T	0.10800	-1.0614	10	0.59425	D	0.04	-12.6026	6.6027	0.22708	0.0956:0.1842:0.7202:0.0	.	523	Q93075	TATD2_HUMAN	N	523	ENSP00000287652:S523N;ENSP00000408736:S523N	ENSP00000287652:S523N	S	+	2	0	TATDN2	10287434	0.996000	0.38824	0.997000	0.53966	0.996000	0.88848	2.704000	0.47118	2.494000	0.84150	0.644000	0.83932	AGC	.	.		0.478	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339641.1	XM_376203	
METTL6	131965	hgsc.bcm.edu	37	3	15455608	15455608	+	Missense_Mutation	SNP	A	A	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:15455608A>C	ENST00000443029.1	-	5	833	c.593T>G	c.(592-594)cTt>cGt	p.L198R	METTL6_ENST00000450816.2_Missense_Mutation_p.L153R|METTL6_ENST00000383790.3_Missense_Mutation_p.L198R			Q8TCB7	METL6_HUMAN	methyltransferase like 6	198							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(9)|lung(3)|prostate(1)	15						TTTAAACCTAAGCATGGCATG	0.388																																					p.L198R		Atlas-SNP	.											.	METTL6	27	.	0			c.T593G						.						127.0	117.0	120.0					3																	15455608		1868	4102	5970	SO:0001583	missense	131965	exon5			AACCTAAGCATGG	AK057791	CCDS43056.1	3p25.1	2005-11-02			ENSG00000206562	ENSG00000206562			28343	protein-coding gene	gene with protein product						12477932	Standard	NM_152396		Approved	MGC24132	uc003bzs.1	Q8TCB7	OTTHUMG00000156431	ENST00000443029.1:c.593T>G	chr3.hg19:g.15455608A>C	ENSP00000407613:p.Leu198Arg	109.0	0.0		140.0	23.0	NM_152396	Q96LU4	Missense_Mutation	SNP	ENST00000443029.1	hg19	CCDS43056.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.783999	0.90282	.	.	ENSG00000206562	ENST00000383790;ENST00000450816	T;T	0.38240	1.59;1.15	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.68284	0.2984	M	0.91196	3.185	0.80722	D	1	D;P	0.76494	0.999;0.85	D;B	0.76575	0.988;0.378	T	0.75665	-0.3239	10	0.62326	D	0.03	-17.4123	16.0504	0.80755	1.0:0.0:0.0:0.0	.	153;198	B4DDX3;Q8TCB7	.;METL6_HUMAN	R	198;153	ENSP00000373300:L198R;ENSP00000410726:L153R	ENSP00000373300:L198R	L	-	2	0	METTL6	15430612	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.303000	0.78871	2.330000	0.79161	0.477000	0.44152	CTT	.	.		0.388	METTL6-007	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346373.1	NM_152396	
CDHR4	389118	hgsc.bcm.edu	37	3	49833197	49833197	+	Splice_Site	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:49833197G>A	ENST00000412678.2	-	7	719	c.711C>T	c.(709-711)ctC>ctT	p.L237L	CDHR4_ENST00000462108.1_5'Flank	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	237	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						GAGCCTGCTCGCTGGACCAAA	0.617																																					p.L237L		Atlas-SNP	.											.	CDHR4	37	.	0			c.C711T						.						46.0	52.0	50.0					3																	49833197		692	1591	2283	SO:0001630	splice_region_variant	389118	exon7			CTGCTCGCTGGAC		CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.711-1C>T	chr3.hg19:g.49833197G>A		114.0	0.0		113.0	56.0	NM_001007540	Q6UXT0	Silent	SNP	ENST00000412678.2	hg19	CCDS46829.1																																																																																			.	.		0.617	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350387.1	NM_001007540	Silent
IFRD2	7866	hgsc.bcm.edu	37	3	50326695	50326695	+	Silent	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:50326695C>A	ENST00000429673.2	-	8	1067	c.1068G>T	c.(1066-1068)cgG>cgT	p.R356R	IFRD2_ENST00000336089.4_Silent_p.R458R|IFRD2_ENST00000417626.2_Silent_p.R292R|IFRD2_ENST00000436390.1_Silent_p.R292R|IFRD2_ENST00000484043.1_5'Flank			Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2	356						nucleus (GO:0005634)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCTCAAGGTCCCGGGCAAGCT	0.602																																					p.R356R		Atlas-SNP	.											.	IFRD2	34	.	0			c.G1068T						.						30.0	32.0	31.0					3																	50326695		1988	4162	6150	SO:0001819	synonymous_variant	7866	exon8			AAGGTCCCGGGCA	U09585		3p21.3	2008-07-18			ENSG00000214706	ENSG00000214706			5457	protein-coding gene	gene with protein product	"""interferon-related protein"""	602725				9050919	Standard	NM_006764		Approved	SKMc15, SM15, IFNRP	uc011bdp.2	Q12894	OTTHUMG00000156935	ENST00000429673.2:c.1068G>T	chr3.hg19:g.50326695C>A		217.0	1.0		180.0	99.0	NM_006764	Q9BVB4|Q9UJ88	Silent	SNP	ENST00000429673.2	hg19	CCDS46831.1																																																																																			.	.		0.602	IFRD2-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006764	
ARL6	84100	hgsc.bcm.edu	37	3	97487017	97487017	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:97487017C>T	ENST00000463745.1	+	2	543	c.66C>T	c.(64-66)tgC>tgT	p.C22C	ARL6_ENST00000496713.1_3'UTR|ARL6_ENST00000335979.2_Silent_p.C22C|ARL6_ENST00000394206.1_Silent_p.C22C	NM_001278293.1	NP_001265222.1	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	22					cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|melanosome transport (GO:0032402)|protein polymerization (GO:0051258)|protein targeting to membrane (GO:0006612)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	axonemal microtubule (GO:0005879)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane coat (GO:0030117)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)			large_intestine(1)|lung(4)	5		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		ATGTTTTGTGCCTTGGGCTAG	0.358																																					p.C22C		Atlas-SNP	.											.	ARL6	19	.	0			c.C66T						.						126.0	122.0	123.0					3																	97487017		2203	4300	6503	SO:0001819	synonymous_variant	84100	exon3			TTTGTGCCTTGGG	BC024239	CCDS2928.1	3q11.2	2014-05-09			ENSG00000113966	ENSG00000113966		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	13210	protein-coding gene	gene with protein product		608845		BBS3		15258860, 15314642, 21282186	Standard	NM_032146		Approved	RP55	uc003drv.3	Q9H0F7	OTTHUMG00000159189	ENST00000463745.1:c.66C>T	chr3.hg19:g.97487017C>T		140.0	0.0		115.0	44.0	NM_177976	A8KA93|D3DN31	Silent	SNP	ENST00000463745.1	hg19	CCDS2928.1																																																																																			.	.		0.358	ARL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353756.1	NM_032146	
OR5H14	403273	hgsc.bcm.edu	37	3	97869067	97869067	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:97869067G>T	ENST00000437310.1	+	1	898	c.838G>T	c.(838-840)Gtc>Ttc	p.V280F	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						ATTTTACACTGTCATAGTTCC	0.383																																					p.V280F		Atlas-SNP	.											.	OR5H14	56	.	0			c.G838T						.						51.0	49.0	50.0					3																	97869067		2203	4297	6500	SO:0001583	missense	403273	exon1			TACACTGTCATAG		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.838G>T	chr3.hg19:g.97869067G>T	ENSP00000401706:p.Val280Phe	130.0	0.0		156.0	17.0	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	hg19	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606806	0.28623	.	.	ENSG00000236032	ENST00000437310	T	0.00307	8.17	2.49	-1.94	0.07571	GPCR, rhodopsin-like superfamily (1);	0.747131	0.11450	N	0.562910	T	0.00496	0.0016	M	0.79011	2.435	0.09310	N	1	D	0.59767	0.986	D	0.65874	0.939	T	0.41378	-0.9512	10	0.54805	T	0.06	.	7.3162	0.26501	0.5215:0.0:0.4785:0.0	.	280	A6NHG9	O5H14_HUMAN	F	280	ENSP00000401706:V280F	ENSP00000401706:V280F	V	+	1	0	OR5H14	99351757	0.000000	0.05858	0.256000	0.24389	0.653000	0.38743	-2.644000	0.00862	-0.417000	0.07461	0.195000	0.17529	GTC	.	.		0.383	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
ZXDC	79364	hgsc.bcm.edu	37	3	126180881	126180881	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:126180881C>T	ENST00000389709.3	-	6	1677	c.1624G>A	c.(1624-1626)Gtc>Atc	p.V542I	ZXDC_ENST00000336332.5_Missense_Mutation_p.V542I	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	542					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		ACAGAAGTGACGTCAATAGTC	0.552																																					p.V542I		Atlas-SNP	.											.	ZXDC	87	.	0			c.G1624A						.						57.0	64.0	61.0					3																	126180881		2055	4210	6265	SO:0001583	missense	79364	exon6			AAGTGACGTCAAT	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.1624G>A	chr3.hg19:g.126180881C>T	ENSP00000374359:p.Val542Ile	98.0	0.0		122.0	7.0	NM_025112	C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	ENST00000389709.3	hg19	CCDS43145.1	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444415	0.63178	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.09817	2.94;2.94	5.15	5.15	0.70609	.	0.205390	0.41712	D	0.000824	T	0.14527	0.0351	M	0.68593	2.085	0.25411	N	0.988358	D;P	0.55800	0.973;0.954	B;B	0.39935	0.314;0.166	T	0.21109	-1.0255	10	0.39692	T	0.17	-17.6845	16.4671	0.84083	0.0:1.0:0.0:0.0	.	542;542	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	I	542	ENSP00000374359:V542I;ENSP00000337694:V542I	ENSP00000337694:V542I	V	-	1	0	ZXDC	127663571	1.000000	0.71417	0.141000	0.22245	0.987000	0.75469	4.504000	0.60414	2.548000	0.85928	0.591000	0.81541	GTC	.	.		0.552	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370327.2	NM_025112	
CHST13	166012	hgsc.bcm.edu	37	3	126261099	126261099	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:126261099C>T	ENST00000319340.2	+	3	754	c.704C>T	c.(703-705)cCg>cTg	p.P235L		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	235					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		CTGCTGGACCCGCGCACGCGG	0.741																																					p.P235L		Atlas-SNP	.											.	CHST13	21	.	0			c.C704T						.						4.0	5.0	5.0					3																	126261099		1938	3886	5824	SO:0001583	missense	166012	exon3			TGGACCCGCGCAC	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.704C>T	chr3.hg19:g.126261099C>T	ENSP00000317404:p.Pro235Leu	29.0	0.0		24.0	5.0	NM_152889	Q3SYA3|Q3SYA5	Missense_Mutation	SNP	ENST00000319340.2	hg19	CCDS3039.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.951223	0.73787	.	.	ENSG00000180767	ENST00000319340	T	0.71934	-0.61	4.44	4.44	0.53790	.	0.000000	0.85682	U	0.000000	D	0.84955	0.5587	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87865	0.2667	10	0.87932	D	0	-34.7611	14.5206	0.67847	0.0:1.0:0.0:0.0	.	235	Q8NET6	CHSTD_HUMAN	L	235	ENSP00000317404:P235L	ENSP00000317404:P235L	P	+	2	0	CHST13	127743789	1.000000	0.71417	0.998000	0.56505	0.316000	0.28119	7.404000	0.79996	2.006000	0.58801	0.297000	0.19635	CCG	.	.		0.741	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889	
ABTB1	80325	hgsc.bcm.edu	37	3	127395229	127395229	+	Missense_Mutation	SNP	C	C	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:127395229C>G	ENST00000232744.8	+	5	521	c.435C>G	c.(433-435)gaC>gaG	p.D145E	ABTB1_ENST00000393363.3_Missense_Mutation_p.D3E|ABTB1_ENST00000468137.1_Missense_Mutation_p.D3E|ABTB1_ENST00000453791.2_Missense_Mutation_p.D3E					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						ACATGCTGGACACCAAATGGA	0.572																																					p.D145E		Atlas-SNP	.											.	ABTB1	36	.	0			c.C435G						.						165.0	124.0	138.0					3																	127395229		2203	4300	6503	SO:0001583	missense	80325	exon5			GCTGGACACCAAA	AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.435C>G	chr3.hg19:g.127395229C>G	ENSP00000232744:p.Asp145Glu	116.0	0.0		117.0	35.0	NM_172027		Missense_Mutation	SNP	ENST00000232744.8	hg19	CCDS3045.1	.	.	.	.	.	.	.	.	.	.	C	0.023	-1.400469	0.01165	.	.	ENSG00000114626	ENST00000393363;ENST00000232744;ENST00000453791;ENST00000468137	T;T;T;T	0.65549	0.28;-0.16;0.28;0.28	4.73	0.527	0.17084	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.055795	0.64402	D	0.000001	T	0.24967	0.0606	N	0.02357	-0.585	0.28472	N	0.915398	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.32613	-0.9900	10	0.02654	T	1	-16.0659	5.8792	0.18846	0.0:0.4144:0.3003:0.2853	.	145;120	Q969K4;Q969K4-3	ABTB1_HUMAN;.	E	3;145;3;3	ENSP00000377030:D3E;ENSP00000232744:D145E;ENSP00000412684:D3E;ENSP00000417366:D3E	ENSP00000232744:D145E	D	+	3	2	ABTB1	128877919	0.984000	0.35163	1.000000	0.80357	0.026000	0.11368	0.111000	0.15458	0.419000	0.25927	0.561000	0.74099	GAC	.	.		0.572	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356595.1	NM_172027	
PAQR9	344838	hgsc.bcm.edu	37	3	142681759	142681759	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:142681759G>A	ENST00000340634.3	-	1	419	c.420C>T	c.(418-420)caC>caT	p.H140H	RP11-372E1.6_ENST00000608686.1_RNA|RP11-372E1.6_ENST00000598139.1_RNA|RP11-372E1.6_ENST00000593321.1_RNA|RP11-372E1.6_ENST00000493825.1_RNA|RP11-372E1.6_ENST00000594095.1_RNA|RP11-372E1.6_ENST00000478823.1_RNA|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000598787.1_RNA|RP11-372E1.6_ENST00000608349.1_RNA|RP11-372E1.6_ENST00000607937.1_RNA|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA	NM_198504.2	NP_940906.1	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	140						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(7)|lung(12)|prostate(1)	22						AGCTGAACACGTGCGCCGTGC	0.652																																					p.H140H		Atlas-SNP	.											.	PAQR9	57	.	0			c.C420T						.						48.0	47.0	47.0					3																	142681759		2203	4300	6503	SO:0001819	synonymous_variant	344838	exon1			GAACACGTGCGCC	AY424287	CCDS3128.1	3q23	2008-05-02			ENSG00000188582	ENSG00000188582			30131	protein-coding gene	gene with protein product		614580					Standard	NM_198504		Approved	FLJ41938	uc003evg.3	Q6ZVX9	OTTHUMG00000159313	ENST00000340634.3:c.420C>T	chr3.hg19:g.142681759G>A		89.0	0.0		96.0	19.0	NM_198504	Q147T6	Silent	SNP	ENST00000340634.3	hg19	CCDS3128.1																																																																																			.	.		0.652	PAQR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354538.1	NM_198504	
CP	1356	hgsc.bcm.edu	37	3	148925301	148925301	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:148925301G>A	ENST00000264613.6	-	5	1147	c.885C>T	c.(883-885)caC>caT	p.H295H		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	295	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	AGAAAGCTGCGTGCACATCAA	0.448																																					p.H295H		Atlas-SNP	.											.	CP	112	.	0			c.C885T						.						131.0	116.0	121.0					3																	148925301		2203	4300	6503	SO:0001819	synonymous_variant	1356	exon5			AGCTGCGTGCACA	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.885C>T	chr3.hg19:g.148925301G>A		139.0	0.0		166.0	25.0	NM_000096	Q14063|Q2PP18|Q9UKS4	Silent	SNP	ENST00000264613.6	hg19	CCDS3141.1																																																																																			.	.		0.448	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
MBNL1	4154	hgsc.bcm.edu	37	3	152164531	152164531	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:152164531G>T	ENST00000463374.1	+	5	1357	c.846G>T	c.(844-846)gaG>gaT	p.E282D	MBNL1_ENST00000355460.2_Intron|MBNL1_ENST00000485910.1_Intron|MBNL1_ENST00000357472.3_Intron|MBNL1_ENST00000324196.5_Intron|MBNL1_ENST00000282488.7_Intron|MBNL1_ENST00000545754.1_Intron|MBNL1_ENST00000324210.5_Intron|MBNL1_ENST00000498502.1_Missense_Mutation_p.E282D|MBNL1_ENST00000282486.6_Missense_Mutation_p.E282D|MBNL1_ENST00000492948.1_Intron|MBNL1_ENST00000493459.1_Missense_Mutation_p.E225D|Y_RNA_ENST00000364347.1_RNA|MBNL1_ENST00000485509.1_Intron	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	282					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GACCCCTCGAGGCAACCTTTG	0.418																																					p.E282D		Atlas-SNP	.											.	MBNL1	100	.	0			c.G846T						.						116.0	100.0	106.0					3																	152164531		2203	4300	6503	SO:0001583	missense	4154	exon5			CCTCGAGGCAACC	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.846G>T	chr3.hg19:g.152164531G>T	ENSP00000418108:p.Glu282Asp	81.0	0.0		81.0	19.0	NM_207293	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Missense_Mutation	SNP	ENST00000463374.1	hg19	CCDS3165.1	.	.	.	.	.	.	.	.	.	.	G	9.076	0.998188	0.19043	.	.	ENSG00000152601	ENST00000282486;ENST00000493459;ENST00000498502;ENST00000463374	.	.	.	5.47	5.47	0.80525	.	0.138889	0.46145	D	0.000305	T	0.41488	0.1161	N	0.12182	0.205	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.15052	0.012;0.003	T	0.26326	-1.0106	9	0.15952	T	0.53	.	18.9468	0.92625	0.0:0.0:1.0:0.0	.	282;225	Q9NR56;Q86VM6	MBNL1_HUMAN;.	D	282;225;282;282	.	ENSP00000282486:E282D	E	+	3	2	MBNL1	153647221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.384000	0.79751	2.558000	0.86282	0.563000	0.77884	GAG	.	.		0.418	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038	
PLCH1	23007	hgsc.bcm.edu	37	3	155198960	155198960	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:155198960T>C	ENST00000340059.7	-	23	4878	c.4879A>G	c.(4879-4881)Aat>Gat	p.N1627D	PLCH1_ENST00000414191.1_Missense_Mutation_p.N1589D|PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000334686.6_Missense_Mutation_p.N1589D|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000460012.1_Missense_Mutation_p.N1589D	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1627					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			GAGTGGCGATTCACTGCAGGG	0.582																																					p.N1627D		Atlas-SNP	.											.	PLCH1	406	.	0			c.A4879G						.						97.0	99.0	98.0					3																	155198960		2203	4300	6503	SO:0001583	missense	23007	exon23			GGCGATTCACTGC	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4879A>G	chr3.hg19:g.155198960T>C	ENSP00000345988:p.Asn1627Asp	133.0	0.0		113.0	21.0	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	hg19	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.954627	0.73902	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.39056	1.1;1.12;1.1;1.1	5.26	5.26	0.73747	.	0.660669	0.16452	N	0.213785	T	0.49253	0.1546	M	0.62723	1.935	0.53005	D	0.999968	P;P	0.49559	0.925;0.877	P;B	0.46585	0.521;0.321	T	0.54397	-0.8300	10	0.72032	D	0.01	.	14.8434	0.70243	0.0:0.0:0.0:1.0	.	1589;1627	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	D	1589;1627;1589;1589	ENSP00000417502:N1589D;ENSP00000345988:N1627D;ENSP00000335469:N1589D;ENSP00000412977:N1589D	ENSP00000335469:N1589D	N	-	1	0	PLCH1	156681654	1.000000	0.71417	0.631000	0.29282	0.707000	0.40811	5.738000	0.68613	1.979000	0.57680	0.533000	0.62120	AAT	.	.		0.582	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
ZBBX	79740	hgsc.bcm.edu	37	3	167000188	167000188	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:167000188T>C	ENST00000392766.2	-	19	2315	c.1975A>G	c.(1975-1977)Aga>Gga	p.R659G	ZBBX_ENST00000455345.2_Missense_Mutation_p.R698G|ZBBX_ENST00000307529.5_Missense_Mutation_p.R698G|ZBBX_ENST00000392764.1_Missense_Mutation_p.R630G|ZBBX_ENST00000392767.2_Missense_Mutation_p.R659G	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	659	Ser-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						GCTGCACTTCTTGATCGAGGA	0.388																																					p.R698G		Atlas-SNP	.											.	ZBBX	299	.	0			c.A2092G						.						143.0	135.0	137.0					3																	167000188		1850	4086	5936	SO:0001583	missense	79740	exon20			CACTTCTTGATCG	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1975A>G	chr3.hg19:g.167000188T>C	ENSP00000376519:p.Arg659Gly	286.0	0.0		294.0	42.0	NM_001199201	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	hg19	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	T	6.910	0.537550	0.13188	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.14766	2.65;2.65;2.65;2.65;2.48	5.28	4.05	0.47172	.	0.250823	0.37623	N	0.002007	T	0.12987	0.0315	L	0.38175	1.15	0.19945	N	0.999942	B;B	0.30634	0.288;0.19	B;B	0.36244	0.22;0.07	T	0.15954	-1.0419	10	0.46703	T	0.11	-4.0714	10.0579	0.42257	0.0:0.0:0.1689:0.8311	.	698;659	A8MT70-2;A8MT70	.;ZBBX_HUMAN	G	659;659;698;698;630	ENSP00000376519:R659G;ENSP00000376520:R659G;ENSP00000390232:R698G;ENSP00000305065:R698G;ENSP00000376517:R630G	ENSP00000305065:R698G	R	-	1	2	ZBBX	168482882	1.000000	0.71417	0.039000	0.18376	0.019000	0.09904	2.284000	0.43478	1.995000	0.58328	0.528000	0.53228	AGA	.	.		0.388	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
ACTL6A	86	hgsc.bcm.edu	37	3	179294051	179294051	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:179294051A>G	ENST00000429709.2	+	6	736	c.523A>G	c.(523-525)Act>Gct	p.T175A	ACTL6A_ENST00000450518.2_Missense_Mutation_p.T133A|ACTL6A_ENST00000392662.1_Missense_Mutation_p.T133A|ACTL6A_ENST00000467615.1_3'UTR	NM_004301.3	NP_004292.1	O96019	ACL6A_HUMAN	actin-like 6A	175					ATP-dependent chromatin remodeling (GO:0043044)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|nervous system development (GO:0007399)|neural retina development (GO:0003407)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|npBAF complex (GO:0071564)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	21	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)			CAGTGGAGCCACTCATACCAC	0.388																																					p.T175A		Atlas-SNP	.											.	ACTL6A	43	.	0			c.A523G						.						167.0	165.0	166.0					3																	179294051		2203	4300	6503	SO:0001583	missense	86	exon6			GGAGCCACTCATA	AK098691	CCDS3231.1, CCDS43174.1	3q26.33	2011-07-06			ENSG00000136518	ENSG00000136518		"""INO80 complex subunits"""	24124	protein-coding gene	gene with protein product	"""BAF complex 53 kDa subunit"", ""BRG1-associated factor"", ""actin-related protein 4"", ""INO80 complex subunit K"""	604958				9845365, 10380635	Standard	NM_004301		Approved	Actl6, BAF53A, Arp4, Baf53a, INO80K	uc003fjw.3	O96019	OTTHUMG00000157782	ENST00000429709.2:c.523A>G	chr3.hg19:g.179294051A>G	ENSP00000397552:p.Thr175Ala	92.0	0.0		100.0	22.0	NM_004301	B3KMN1|D3DNR9|Q8TAE5|Q9BVS8|Q9H0W6	Missense_Mutation	SNP	ENST00000429709.2	hg19	CCDS3231.1	.	.	.	.	.	.	.	.	.	.	A	29.4	5.004762	0.93287	.	.	ENSG00000136518	ENST00000429709;ENST00000450518;ENST00000392662	D;D;D	0.97430	-4.38;-4.38;-4.38	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.96664	0.8911	L	0.39566	1.225	0.80722	D	1	D	0.54047	0.964	P	0.57846	0.828	D	0.95832	0.8859	10	0.29301	T	0.29	.	15.322	0.74129	1.0:0.0:0.0:0.0	.	175	O96019	ACL6A_HUMAN	A	175;133;133	ENSP00000397552:T175A;ENSP00000394014:T133A;ENSP00000376430:T133A	ENSP00000376430:T133A	T	+	1	0	ACTL6A	180776745	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.339000	0.96797	2.019000	0.59389	0.528000	0.53228	ACT	.	.		0.388	ACTL6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349599.1	NM_004301	
NDUFB5	4711	hgsc.bcm.edu	37	3	179336273	179336273	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:179336273C>T	ENST00000259037.3	+	5	527	c.413C>T	c.(412-414)gCc>gTc	p.A138V	NDUFB5_ENST00000493866.1_Missense_Mutation_p.A86V|NDUFB5_ENST00000473500.1_3'UTR|NDUFB5_ENST00000472629.1_Missense_Mutation_p.A126V	NM_002492.3	NP_002483.1	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa	138					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|lung(6)|skin(1)	8	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			AGAACAATGGCCGTCCTTCAG	0.388																																					p.A138V		Atlas-SNP	.											.	NDUFB5	22	.	0			c.C413T						.						77.0	77.0	77.0					3																	179336273		2203	4300	6503	SO:0001583	missense	4711	exon5			CAATGGCCGTCCT	AF047181	CCDS3234.1, CCDS56297.1, CCDS75054.1	3q27.1	2011-07-04	2002-08-29		ENSG00000136521	ENSG00000136521		"""Mitochondrial respiratory chain complex / Complex I"""	7700	protein-coding gene	gene with protein product	"""complex I SGDH subunit"""	603841	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (16kD, SGDH)"""			9425316	Standard	NM_002492		Approved	SGDH, CI-SGDH, MGC12314	uc003fkc.3	O43674	OTTHUMG00000157480	ENST00000259037.3:c.413C>T	chr3.hg19:g.179336273C>T	ENSP00000259037:p.Ala138Val	117.0	0.0		130.0	20.0	NM_002492	Q561V6	Missense_Mutation	SNP	ENST00000259037.3	hg19	CCDS3234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.83|17.83	3.484529|3.484529	0.63962|0.63962	.|.	.|.	ENSG00000136521|ENSG00000136521	ENST00000259037;ENST00000493866;ENST00000472629|ENST00000482604	T;T;T|.	0.50548|.	0.74;0.74;0.74|.	5.97|5.97	5.05|5.05	0.67936|0.67936	.|.	0.099668|.	0.64402|.	D|.	0.000002|.	T|T	0.78660|0.78660	0.4318|0.4318	M|M	0.85859|0.85859	2.78|2.78	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.69078|.	0.997;0.993|.	D;D|.	0.72625|.	0.978;0.942|.	T|T	0.80367|0.80367	-0.1412|-0.1412	10|5	0.46703|.	T|.	0.11|.	-21.1701|-21.1701	14.9473|14.9473	0.71042|0.71042	0.1436:0.8564:0.0:0.0|0.1436:0.8564:0.0:0.0	.|.	86;138|.	Q561V6;O43674|.	.;NDUB5_HUMAN|.	V|S	138;86;126|155	ENSP00000259037:A138V;ENSP00000419656:A86V;ENSP00000419248:A126V|.	ENSP00000259037:A138V|.	A|P	+|+	2|1	0|0	NDUFB5|NDUFB5	180818967|180818967	0.997000|0.997000	0.39634|0.39634	0.997000|0.997000	0.53966|0.53966	0.122000|0.122000	0.20287|0.20287	3.877000|3.877000	0.56123|0.56123	2.831000|2.831000	0.97527|0.97527	0.643000|0.643000	0.83706|0.83706	GCC|CCG	.	.		0.388	NDUFB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348937.2	NM_002492	
CHRD	8646	hgsc.bcm.edu	37	3	184105204	184105204	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:184105204C>T	ENST00000204604.1	+	19	2636	c.2390C>T	c.(2389-2391)aCg>aTg	p.T797M	EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000450923.1_Missense_Mutation_p.T797M|CHRD_ENST00000545352.1_Missense_Mutation_p.T339M|CHRD_ENST00000348986.3_Missense_Mutation_p.T757M	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	797	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCAGCGGGTACGCGGTGGCAC	0.597																																					p.T797M		Atlas-SNP	.											CHRD,NS,carcinoma,0,1	CHRD	149	.	0			c.C2390T						.						43.0	39.0	40.0					3																	184105204		2203	4300	6503	SO:0001583	missense	8646	exon19			CGGGTACGCGGTG	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.2390C>T	chr3.hg19:g.184105204C>T	ENSP00000204604:p.Thr797Met	76.0	0.0		61.0	18.0	NM_003741	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	hg19	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789368	0.90367	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.15	5.15	0.70609	von Willebrand factor, type C (2);	0.000000	0.85682	D	0.000000	T	0.76659	0.4018	M	0.61703	1.905	0.36095	D	0.843706	D;D;D;D	0.89917	1.0;0.999;0.992;1.0	D;D;P;D	0.74023	0.982;0.941;0.746;0.976	T	0.81549	-0.0882	10	0.49607	T	0.09	-16.0676	17.1933	0.86886	0.0:1.0:0.0:0.0	.	339;757;797;797	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	M	797;797;757;339	ENSP00000204604:T797M;ENSP00000408972:T797M;ENSP00000334036:T757M;ENSP00000442948:T339M	ENSP00000204604:T797M	T	+	2	0	CHRD	185587898	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.089000	0.76909	2.402000	0.81655	0.563000	0.77884	ACG	.	.		0.597	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280432.1	NM_003741	
ETV5	2119	hgsc.bcm.edu	37	3	185797806	185797806	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:185797806A>G	ENST00000306376.5	-	7	696	c.450T>C	c.(448-450)ttT>ttC	p.F150F	ETV5_ENST00000537818.1_Silent_p.F192F|ETV5_ENST00000434744.1_Silent_p.F150F|ETV5-AS1_ENST00000453370.1_RNA	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	150					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GAGGTGGGGGAAATAGGGGAT	0.607			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.F150F		Atlas-SNP	.		Dom	yes		3	3q28	2119	ets variant gene 5		E	.	ETV5	106	.	0			c.T450C						.						19.0	24.0	23.0					3																	185797806		2179	4288	6467	SO:0001819	synonymous_variant	2119	exon7			TGGGGGAAATAGG	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.450T>C	chr3.hg19:g.185797806A>G		61.0	0.0		76.0	9.0	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Silent	SNP	ENST00000306376.5	hg19	CCDS33906.1																																																																																			.	.		0.607	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
GMNC	647309	hgsc.bcm.edu	37	3	190575656	190575656	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:190575656T>C	ENST00000442080.1	-	4	299	c.300A>G	c.(298-300)gaA>gaG	p.E100E	GMNC_ENST00000479491.1_5'UTR	NM_001146686.2	NP_001140158.1	A6NCL1	GEMC1_HUMAN	geminin coiled-coil domain containing	100					cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication initiation (GO:0006270)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(3)|skin(1)	5						ACCTGGCGAGTTCTTCTTCCT	0.413																																					p.E100E		Atlas-SNP	.											.	GMNC	12	.	0			c.A300G						.						272.0	208.0	227.0					3																	190575656		692	1591	2283	SO:0001819	synonymous_variant	647309	exon4			GGCGAGTTCTTCT	BC031680	CCDS54697.1	3q28	2011-08-19	2011-08-19		ENSG00000205835	ENSG00000205835			40049	protein-coding gene	gene with protein product		614448				20383140, 20855966	Standard	NM_001146686		Approved	GEMC1	uc011bsl.1	A6NCL1	OTTHUMG00000156195	ENST00000442080.1:c.300A>G	chr3.hg19:g.190575656T>C		121.0	0.0		136.0	18.0	NM_001146686		Silent	SNP	ENST00000442080.1	hg19	CCDS54697.1																																																																																			.	.		0.413	GMNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343364.1	NM_001146686	
SLC26A1	10861	hgsc.bcm.edu	37	4	985227	985227	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:985227C>T	ENST00000361661.2	-	3	642	c.265G>A	c.(265-267)Gcc>Acc	p.A89T	SLC26A1_ENST00000398520.2_Missense_Mutation_p.A89T|SLC26A1_ENST00000398516.2_Missense_Mutation_p.A89T|SLC26A1_ENST00000513138.1_5'Flank|IDUA_ENST00000453894.1_Intron|IDUA_ENST00000247933.4_Intron	NM_213613.2	NP_998778.1	Q9H2B4	S26A1_HUMAN	solute carrier family 26 (anion exchanger), member 1	89					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(1)|endometrium(4)|pancreas(1)|prostate(1)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			AATGAGTAGGCGATGGCCTGC	0.632																																					p.A89T		Atlas-SNP	.											.	SLC26A1	44	.	0			c.G265A						.						99.0	93.0	95.0					4																	985227		2203	4300	6503	SO:0001583	missense	10861	exon2			AGTAGGCGATGGC	AF297659	CCDS33933.1, CCDS33934.1	4p16.3	2013-07-18	2013-07-18		ENSG00000145217	ENSG00000145217		"""Solute carriers"""	10993	protein-coding gene	gene with protein product		610130	"""solute carrier family 26 (sulfate transporter), member 1"""				Standard	NM_213613		Approved	SAT-1, EDM4	uc003gcc.3	Q9H2B4	OTTHUMG00000160003	ENST00000361661.2:c.265G>A	chr4.hg19:g.985227C>T	ENSP00000354721:p.Ala89Thr	164.0	0.0		203.0	21.0	NM_022042	A8K9N2|Q7Z5R3|Q96BK0	Missense_Mutation	SNP	ENST00000361661.2	hg19	CCDS33934.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.525832	0.85600	.	.	ENSG00000145217	ENST00000398520;ENST00000361661;ENST00000398516	D;D;D	0.95103	-3.61;-3.61;-3.61	4.99	4.99	0.66335	.	0.052718	0.85682	D	0.000000	D	0.98330	0.9446	H	0.97940	4.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.993	D	0.99482	1.0948	10	0.62326	D	0.03	.	15.7529	0.78001	0.0:1.0:0.0:0.0	.	89;89	Q9H2B4;Q96BK0	S26A1_HUMAN;.	T	89	ENSP00000381532:A89T;ENSP00000354721:A89T;ENSP00000381528:A89T	ENSP00000354721:A89T	A	-	1	0	SLC26A1	975227	1.000000	0.71417	1.000000	0.80357	0.350000	0.29205	5.955000	0.70306	2.299000	0.77371	0.313000	0.20887	GCC	.	.		0.632	SLC26A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358783.1	NM_022042, NM_134425	
ADD1	118	hgsc.bcm.edu	37	4	2910332	2910332	+	Splice_Site	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:2910332G>A	ENST00000398129.1	+	11	1625		c.e11+1		ADD1_ENST00000398123.2_Splice_Site|ADD1_ENST00000503455.2_Splice_Site|ADD1_ENST00000264758.7_Splice_Site|ADD1_ENST00000513328.2_Splice_Site|ADD1_ENST00000355842.3_Splice_Site|ADD1_ENST00000446856.1_Splice_Site|ADD1_ENST00000398125.1_Splice_Site			P35611	ADDA_HUMAN	adducin 1 (alpha)						actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCTCGTCCAGGTGAGAGCCCA	0.512																																					.	Esophageal Squamous(71;505 1201 20414 34538 37449)	Atlas-SNP	.											.	ADD1	56	.	0			c.1698+1G>A						.						142.0	110.0	121.0					4																	2910332		2203	4300	6503	SO:0001630	splice_region_variant	118	exon12			GTCCAGGTGAGAG	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1605+1G>A	chr4.hg19:g.2910332G>A		103.0	0.0		101.0	26.0	NM_176801	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Splice_Site	SNP	ENST00000398129.1	hg19	CCDS43205.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.907462	0.92107	.	.	ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398125;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129;ENST00000514940;ENST00000536424	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3052	0.98627	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADD1	2880130	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.271000	0.95698	2.808000	0.96608	0.655000	0.94253	.	.	.		0.512	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	Intron
HTT	3064	hgsc.bcm.edu	37	4	3162106	3162106	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:3162106A>G	ENST00000355072.5	+	29	3996	c.3851A>G	c.(3850-3852)cAg>cGg	p.Q1284R		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1284					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCCACACTGCAGGACATTGGG	0.507																																					p.Q1284R		Atlas-SNP	.											.	HTT	221	.	0			c.A3851G						.						210.0	202.0	204.0					4																	3162106		1983	4119	6102	SO:0001583	missense	3064	exon29			CACTGCAGGACAT	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3851A>G	chr4.hg19:g.3162106A>G	ENSP00000347184:p.Gln1284Arg	104.0	0.0		110.0	26.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	hg19	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	A	11.64	1.699900	0.30142	.	.	ENSG00000197386	ENST00000355072	T	0.66280	-0.2	4.27	4.27	0.50696	.	0.248990	0.40908	D	0.000993	T	0.50548	0.1622	L	0.46157	1.445	0.29864	N	0.827429	P	0.35656	0.514	B	0.33521	0.165	T	0.50972	-0.8764	10	0.26408	T	0.33	.	9.6577	0.39936	0.8246:0.1754:0.0:0.0	.	1284	P42858	HD_HUMAN	R	1284	ENSP00000347184:Q1284R	ENSP00000347184:Q1284R	Q	+	2	0	HTT	3131904	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	6.402000	0.73260	1.681000	0.50988	0.460000	0.39030	CAG	.	.		0.507	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
HGFAC	3083	hgsc.bcm.edu	37	4	3444865	3444865	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:3444865C>T	ENST00000382774.3	+	3	502	c.387C>T	c.(385-387)caC>caT	p.H129H	HGFAC_ENST00000511533.1_Silent_p.H129H	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	129	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		GCAGTGCACACAGGAAGTGGT	0.697																																					p.H129H		Atlas-SNP	.											.	HGFAC	69	.	0			c.C387T						.						14.0	18.0	17.0					4																	3444865		2180	4272	6452	SO:0001819	synonymous_variant	3083	exon3			TGCACACAGGAAG	D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.387C>T	chr4.hg19:g.3444865C>T		80.0	0.0		110.0	27.0	NM_001528	Q14726|Q2M1W7|Q53X47	Silent	SNP	ENST00000382774.3	hg19	CCDS3369.1																																																																																			.	.		0.697	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206607.3		
KIAA0232	9778	hgsc.bcm.edu	37	4	6865898	6865898	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:6865898A>G	ENST00000307659.5	+	7	4244	c.3789A>G	c.(3787-3789)ggA>ggG	p.G1263G	KIAA0232_ENST00000425103.1_Silent_p.G1263G	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	1263							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TTTCTTCGGGACAGCTGGAAG	0.393																																					p.G1263G		Atlas-SNP	.											.	KIAA0232	102	.	0			c.A3789G						.						81.0	74.0	76.0					4																	6865898		1867	4112	5979	SO:0001819	synonymous_variant	9778	exon7			TTCGGGACAGCTG	D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.3789A>G	chr4.hg19:g.6865898A>G		124.0	0.0		126.0	14.0	NM_014743	A7E2D2	Silent	SNP	ENST00000307659.5	hg19	CCDS43209.1																																																																																			.	.		0.393	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359102.2	NM_014743	
LCORL	254251	hgsc.bcm.edu	37	4	17910804	17910804	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:17910804T>C	ENST00000382226.5	-	5	703	c.595A>G	c.(595-597)Aat>Gat	p.N199D	LCORL_ENST00000539056.1_Missense_Mutation_p.N112D|LCORL_ENST00000326877.4_Missense_Mutation_p.N199D|LCORL_ENST00000382224.1_Missense_Mutation_p.N115D	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	199					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						TCTGCTTGATTCATTTGGATA	0.373																																					p.N199D		Atlas-SNP	.											.	LCORL	60	.	0			c.A595G						.						186.0	177.0	180.0					4																	17910804		2203	4300	6503	SO:0001583	missense	254251	exon5			CTTGATTCATTTG		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.595A>G	chr4.hg19:g.17910804T>C	ENSP00000371661:p.Asn199Asp	159.0	0.0		181.0	47.0	NM_001166139	Q96NK1	Missense_Mutation	SNP	ENST00000382226.5	hg19	CCDS54749.1	.	.	.	.	.	.	.	.	.	.	T	18.03	3.533469	0.64972	.	.	ENSG00000178177	ENST00000326877;ENST00000539056;ENST00000382224;ENST00000382226	.	.	.	5.43	5.43	0.79202	.	0.257812	0.38381	N	0.001714	T	0.48892	0.1525	L	0.29908	0.895	0.31446	N	0.671323	D;P	0.55385	0.971;0.557	P;B	0.53062	0.717;0.297	T	0.55250	-0.8170	9	0.38643	T	0.18	.	15.4731	0.75456	0.0:0.0:0.0:1.0	.	112;199	B4DSW0;Q8N3X6-3	.;.	D	199;112;115;199	.	ENSP00000317566:N199D	N	-	1	0	LCORL	17519902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.505000	0.66981	2.066000	0.61787	0.482000	0.46254	AAT	.	.		0.373	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_153686	
DHX15	1665	hgsc.bcm.edu	37	4	24578249	24578249	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:24578249G>A	ENST00000336812.4	-	2	280	c.124C>T	c.(124-126)Cga>Tga	p.R42*		NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	42					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				TCACGTTCTCGGTCTCGATCT	0.423																																					p.R42X		Atlas-SNP	.											.	DHX15	69	.	0			c.C124T						.						142.0	123.0	130.0					4																	24578249		2203	4300	6503	SO:0001587	stop_gained	1665	exon2			GTTCTCGGTCTCG	AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.124C>T	chr4.hg19:g.24578249G>A	ENSP00000336741:p.Arg42*	92.0	0.0		102.0	29.0	NM_001358	Q9NQT7	Nonsense_Mutation	SNP	ENST00000336812.4	hg19	CCDS33966.1	.	.	.	.	.	.	.	.	.	.	G	31	5.079828	0.94050	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	.	.	.	5.59	3.67	0.42095	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5456	11.1918	0.48690	0.0:0.0:0.4959:0.5041	.	.	.	.	X	42;31	.	ENSP00000336741:R42X	R	-	1	2	DHX15	24187347	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.474000	0.60203	1.369000	0.46134	0.650000	0.86243	CGA	.	.		0.423	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358	
TLR6	10333	hgsc.bcm.edu	37	4	38829083	38829083	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:38829083A>G	ENST00000381950.1	-	1	2077	c.2012T>C	c.(2011-2013)aTt>aCt	p.I671T	TLR6_ENST00000436693.2_Missense_Mutation_p.I671T			Q9Y2C9	TLR6_HUMAN	toll-like receptor 6	671	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|defense response to bacterium (GO:0042742)|detection of diacyl bacterial lipopeptide (GO:0042496)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of JUN kinase activity (GO:0043507)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 6 signaling pathway (GO:0034150)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopeptide binding (GO:0071723)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATGAAGACAAATCTGTATATC	0.373																																					p.I671T		Atlas-SNP	.											.	TLR6	67	.	0			c.T2012C						.						107.0	111.0	109.0					4																	38829083		2203	4300	6503	SO:0001583	missense	10333	exon2			AGACAAATCTGTA		CCDS3446.1	4p16.1	2009-11-23			ENSG00000174130	ENSG00000174130		"""CD molecules"""	16711	protein-coding gene	gene with protein product		605403				10231569	Standard	NM_006068		Approved	CD286	uc010ifg.2	Q9Y2C9	OTTHUMG00000128579	ENST00000381950.1:c.2012T>C	chr4.hg19:g.38829083A>G	ENSP00000371376:p.Ile671Thr	107.0	0.0		116.0	16.0	NM_006068	B3Y640|B6CH35|B6RFS4|B6RFS5|Q2NKL3	Missense_Mutation	SNP	ENST00000381950.1	hg19	CCDS3446.1	.	.	.	.	.	.	.	.	.	.	A	11.63	1.695387	0.30052	.	.	ENSG00000174130	ENST00000436693;ENST00000381950	T;T	0.07216	3.21;3.21	4.55	4.55	0.56014	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.489229	0.19928	N	0.102939	T	0.26085	0.0636	L	0.61387	1.9	0.36695	D	0.879788	D	0.63046	0.992	D	0.83275	0.996	T	0.12502	-1.0545	10	0.87932	D	0	.	13.7108	0.62667	1.0:0.0:0.0:0.0	.	671	Q9Y2C9	TLR6_HUMAN	T	671	ENSP00000389600:I671T;ENSP00000371376:I671T	ENSP00000371376:I671T	I	-	2	0	TLR6	38505478	1.000000	0.71417	0.773000	0.31616	0.047000	0.14425	9.073000	0.93992	1.913000	0.55393	0.459000	0.35465	ATT	.	.		0.373	TLR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250431.1		
PPAT	5471	hgsc.bcm.edu	37	4	57269502	57269502	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:57269502C>T	ENST00000264220.2	-	4	605	c.468G>A	c.(466-468)gcG>gcA	p.A156A	PPAT_ENST00000507648.1_5'UTR	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	156	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	GAGGGGTATACGCCAGTAACT	0.428																																					p.A156A		Atlas-SNP	.											.	PPAT	41	.	0			c.G468A						.						84.0	80.0	81.0					4																	57269502		2203	4300	6503	SO:0001819	synonymous_variant	5471	exon4			GGTATACGCCAGT		CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.468G>A	chr4.hg19:g.57269502C>T		80.0	0.0		59.0	11.0	NM_002703		Silent	SNP	ENST00000264220.2	hg19	CCDS3505.1																																																																																			.	.		0.428	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250781.2	NM_002703	
GRSF1	2926	hgsc.bcm.edu	37	4	71702012	71702012	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:71702012A>G	ENST00000254799.6	-	2	494	c.377T>C	c.(376-378)cTg>cCg	p.L126P	GRSF1_ENST00000439371.1_5'UTR|GRSF1_ENST00000502323.1_5'UTR|GRSF1_ENST00000508091.1_5'UTR|GRSF1_ENST00000545193.1_Missense_Mutation_p.L8P	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1	126	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			AAGGTCTTCCAGGTAAGTAGT	0.398																																					p.L126P		Atlas-SNP	.											.	GRSF1	35	.	0			c.T377C						.						80.0	81.0	81.0					4																	71702012		1838	4086	5924	SO:0001583	missense	2926	exon2			TCTTCCAGGTAAG	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.377T>C	chr4.hg19:g.71702012A>G	ENSP00000254799:p.Leu126Pro	263.0	0.0		193.0	41.0	NM_002092	B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	Missense_Mutation	SNP	ENST00000254799.6	hg19	CCDS47069.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.46|14.46	2.542465|2.542465	0.45280|0.45280	.|.	.|.	ENSG00000132463|ENSG00000132463	ENST00000254799;ENST00000540657;ENST00000499044;ENST00000545193|ENST00000514161	T;T;T|.	0.19669|.	2.17;2.14;2.13|.	4.51|4.51	3.32|3.32	0.38043|0.38043	RNA recognition motif domain (1);|.	0.619363|.	0.13459|.	N|.	0.386308|.	T|T	0.42585|0.42585	0.1209|0.1209	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	B;B|.	0.09022|.	0.001;0.002|.	B;B|.	0.08055|.	0.001;0.003|.	T|T	0.20874|0.20874	-1.0262|-1.0262	10|5	0.72032|.	D|.	0.01|.	-4.6671|-4.6671	3.7749|3.7749	0.08656|0.08656	0.6121:0.0:0.0959:0.292|0.6121:0.0:0.0959:0.292	.|.	39;126|.	B7Z5F9;Q12849|.	.;GRSF1_HUMAN|.	P|R	126;58;99;8|63	ENSP00000254799:L126P;ENSP00000427354:L99P;ENSP00000443380:L8P|.	ENSP00000254799:L126P|.	L|W	-|-	2|1	0|0	GRSF1|GRSF1	71920876|71920876	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.710000|0.710000	0.40934|0.40934	3.033000|3.033000	0.49743|0.49743	0.754000|0.754000	0.32968|0.32968	0.533000|0.533000	0.62120|0.62120	CTG|TGG	.	.		0.398	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362642.1	NM_002092	
SPRY1	10252	hgsc.bcm.edu	37	4	124323492	124323492	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:124323492C>T	ENST00000394339.2	+	2	1086	c.746C>T	c.(745-747)tCa>tTa	p.S249L	SPRY1_ENST00000339241.1_Missense_Mutation_p.S249L	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	249	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						TGCTCCTGTTCACAATCACAC	0.458																																					p.S249L		Atlas-SNP	.											.	SPRY1	28	.	0			c.C746T						.						279.0	236.0	251.0					4																	124323492		2203	4300	6503	SO:0001583	missense	10252	exon2			CCTGTTCACAATC	AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.746C>T	chr4.hg19:g.124323492C>T	ENSP00000377871:p.Ser249Leu	70.0	0.0		53.0	14.0	NM_001258039	D3DNX6|Q6PNE0	Missense_Mutation	SNP	ENST00000394339.2	hg19	CCDS3731.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235710	0.79800	.	.	ENSG00000164056	ENST00000339241;ENST00000394339	T;T	0.64438	-0.1;-0.1	4.91	4.91	0.64330	.	0.176335	0.38897	N	0.001525	T	0.64527	0.2606	L	0.58101	1.795	0.58432	D	0.999996	P	0.38300	0.626	B	0.42625	0.393	T	0.63541	-0.6614	9	.	.	.	-7.9347	17.9168	0.88954	0.0:1.0:0.0:0.0	.	249	O43609	SPY1_HUMAN	L	249	ENSP00000343785:S249L;ENSP00000377871:S249L	.	S	+	2	0	SPRY1	124542942	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.245000	0.65405	2.541000	0.85698	0.561000	0.74099	TCA	.	.		0.458	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256711.1		
ABCE1	6059	hgsc.bcm.edu	37	4	146030397	146030397	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:146030397A>G	ENST00000296577.4	+	5	916	c.401A>G	c.(400-402)tAc>tGc	p.Y134C	OTUD4_ENST00000455611.2_5'Flank|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	134	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					CTTGGAAAGTACGATGTATGT	0.308																																					p.Y134C		Atlas-SNP	.											.	ABCE1	47	.	0			c.A401G						.						65.0	65.0	65.0					4																	146030397		2203	4300	6503	SO:0001583	missense	6059	exon5			GAAAGTACGATGT	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.401A>G	chr4.hg19:g.146030397A>G	ENSP00000296577:p.Tyr134Cys	50.0	0.0		45.0	24.0	NM_002940	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	ENST00000296577.4	hg19	CCDS34071.1	.	.	.	.	.	.	.	.	.	.	A	17.05	3.289314	0.59976	.	.	ENSG00000164163	ENST00000296577;ENST00000502586	D;D	0.93712	-3.27;-3.27	5.86	5.86	0.93980	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.155822	0.64402	D	0.000016	D	0.96178	0.8754	M	0.77486	2.375	0.58432	D	0.999997	D	0.58970	0.984	P	0.61275	0.886	D	0.96416	0.9308	10	0.66056	D	0.02	-30.1932	16.5602	0.84551	1.0:0.0:0.0:0.0	.	134	P61221	ABCE1_HUMAN	C	134	ENSP00000296577:Y134C;ENSP00000421250:Y134C	ENSP00000296577:Y134C	Y	+	2	0	ABCE1	146249847	1.000000	0.71417	0.996000	0.52242	0.857000	0.48899	4.586000	0.60984	2.367000	0.80283	0.528000	0.53228	TAC	.	.		0.308	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	
NR2F1	7025	hgsc.bcm.edu	37	5	92923806	92923806	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:92923806T>C	ENST00000327111.3	+	2	2334	c.647T>C	c.(646-648)aTc>aCc	p.I216T	NR2F1-AS1_ENST00000513055.1_RNA	NM_005654.4	NP_005645.1	P10589	COT1_HUMAN	nuclear receptor subfamily 2, group F, member 1	216					cerebral cortex regionalization (GO:0021796)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|retinoic acid-responsive element binding (GO:0044323)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|large_intestine(6)|lung(2)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	21		all_cancers(142;1.62e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0416)|all cancers(79;9.57e-18)		ATTATGGGCATCGAGAACATC	0.647																																					p.I216T		Atlas-SNP	.											.	NR2F1	56	.	0			c.T647C						.						79.0	77.0	78.0					5																	92923806		2203	4300	6503	SO:0001583	missense	7025	exon2			TGGGCATCGAGAA	BC004154	CCDS4068.1	5q14	2013-01-16			ENSG00000175745	ENSG00000175745		"""Nuclear hormone receptors"""	7975	protein-coding gene	gene with protein product		132890		ERBAL3, TFCOUP1		8530078	Standard	NM_005654		Approved	EAR-3, COUP-TFI, TCFCOUP1, SVP44	uc003kkj.3	P10589	OTTHUMG00000119079	ENST00000327111.3:c.647T>C	chr5.hg19:g.92923806T>C	ENSP00000325819:p.Ile216Thr	133.0	0.0		118.0	17.0	NM_005654		Missense_Mutation	SNP	ENST00000327111.3	hg19	CCDS4068.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.130539	0.77549	.	.	ENSG00000175745	ENST00000327111	T	0.52295	0.67	4.47	4.47	0.54385	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.056958	0.64402	D	0.000002	T	0.62672	0.2447	L	0.56769	1.78	0.80722	D	1	D	0.59767	0.986	D	0.65573	0.936	T	0.67019	-0.5776	10	0.87932	D	0	.	13.8968	0.63778	0.0:0.0:0.0:1.0	.	216	P10589	COT1_HUMAN	T	216	ENSP00000325819:I216T	ENSP00000325819:I216T	I	+	2	0	NR2F1	92949562	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.780000	0.85658	1.857000	0.53885	0.334000	0.21626	ATC	.	.		0.647	NR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239293.2	NM_005654	
WDR36	134430	hgsc.bcm.edu	37	5	110456746	110456746	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:110456746T>C	ENST00000513710.2	+	19	2227	c.2223T>C	c.(2221-2223)taT>taC	p.Y741Y	WDR36_ENST00000506538.2_Silent_p.Y741Y			Q8NI36	WDR36_HUMAN	WD repeat domain 36	741					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TGATAGAATATGATTCGCCAG	0.303																																					p.Y741Y		Atlas-SNP	.											.	WDR36	111	.	0			c.T2223C						.						131.0	146.0	141.0					5																	110456746		2202	4299	6501	SO:0001819	synonymous_variant	134430	exon19			AGAATATGATTCG	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2223T>C	chr5.hg19:g.110456746T>C		206.0	0.0		207.0	47.0	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Silent	SNP	ENST00000513710.2	hg19	CCDS4102.1																																																																																			.	.		0.303	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
FTMT	94033	hgsc.bcm.edu	37	5	121187928	121187928	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:121187928G>A	ENST00000321339.1	+	1	279	c.270G>A	c.(268-270)gcG>gcA	p.A90A		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	90	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)	p.A90A(2)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		AGCTCTATGCGTCCTACGTGT	0.617																																					p.A90A		Atlas-SNP	.											FTMT,NS,carcinoma,0,2	FTMT	71	.	2	Substitution - coding silent(2)	lung(1)|endometrium(1)	c.G270A						.						86.0	68.0	74.0					5																	121187928		2203	4300	6503	SO:0001819	synonymous_variant	94033	exon1			CTATGCGTCCTAC	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.270G>A	chr5.hg19:g.121187928G>A		113.0	1.0		150.0	43.0	NM_177478		Silent	SNP	ENST00000321339.1	hg19	CCDS4128.1																																																																																			.	.		0.617	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
ADAMTS19	171019	hgsc.bcm.edu	37	5	129039961	129039961	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:129039961T>C	ENST00000274487.4	+	21	3316	c.3171T>C	c.(3169-3171)cgT>cgC	p.R1057R	CTC-575N7.1_ENST00000503616.1_RNA|ADAMTS19_ENST00000509467.1_3'UTR	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1057	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AAGGCATACGTCATCGGACCG	0.423																																					p.R1057R		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.T3171C						.						240.0	216.0	224.0					5																	129039961		2203	4300	6503	SO:0001819	synonymous_variant	171019	exon21			CATACGTCATCGG	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3171T>C	chr5.hg19:g.129039961T>C		141.0	0.0		149.0	16.0	NM_133638		Silent	SNP	ENST00000274487.4	hg19	CCDS4146.1																																																																																			.	.		0.423	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
VDAC1	7416	hgsc.bcm.edu	37	5	133311575	133311575	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:133311575T>C	ENST00000265333.3	-	7	933	c.689A>G	c.(688-690)gAc>gGc	p.D230G	VDAC1_ENST00000395044.3_Missense_Mutation_p.D230G|VDAC1_ENST00000395047.2_Missense_Mutation_p.D230G	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	230					anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GAAGCAGGCGTCAGGGTCAAT	0.512																																					p.D230G	NSCLC(127;1776 1806 35523 41489 48154)	Atlas-SNP	.											.	VDAC1	17	.	0			c.A689G						.						159.0	154.0	156.0					5																	133311575		2203	4300	6503	SO:0001583	missense	7416	exon7			CAGGCGTCAGGGT		CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.689A>G	chr5.hg19:g.133311575T>C	ENSP00000265333:p.Asp230Gly	141.0	0.0		158.0	21.0	NM_003374	B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	Missense_Mutation	SNP	ENST00000265333.3	hg19	CCDS4168.1	.	.	.	.	.	.	.	.	.	.	T	18.99	3.739223	0.69304	.	.	ENSG00000213585	ENST00000265333;ENST00000395044;ENST00000395047	T;T;T	0.43294	0.95;0.95;0.95	5.54	5.54	0.83059	.	0.090614	0.64402	D	0.000001	T	0.50480	0.1618	M	0.62266	1.93	0.80722	D	1	B	0.24618	0.107	B	0.38264	0.269	T	0.50338	-0.8840	10	0.48119	T	0.1	.	15.9731	0.80036	0.0:0.0:0.0:1.0	.	230	P21796	VDAC1_HUMAN	G	230	ENSP00000265333:D230G;ENSP00000378484:D230G;ENSP00000378487:D230G	ENSP00000265333:D230G	D	-	2	0	VDAC1	133339474	1.000000	0.71417	0.920000	0.36463	0.980000	0.70556	7.959000	0.87885	2.234000	0.73211	0.472000	0.43445	GAC	.	.		0.512	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259208.1		
WDR55	54853	hgsc.bcm.edu	37	5	140049100	140049100	+	Missense_Mutation	SNP	G	G	A	rs367668945		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:140049100G>A	ENST00000358337.5	+	7	1250	c.1013G>A	c.(1012-1014)cGc>cAc	p.R338H	WDR55_ENST00000520764.1_3'UTR	NM_017706.4	NP_060176	Q9H6Y2	WDR55_HUMAN	WD repeat domain 55	338					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)		p.R338H(1)		NS(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACCGTCGGCGCAAAAAAAAG	0.592																																					p.R338H		Atlas-SNP	.											WDR55,NS,carcinoma,0,2	WDR55	27	.	1	Substitution - Missense(1)	prostate(1)	c.G1013A						.	G	HIS/ARG	0,4406		0,0,2203	43.0	45.0	45.0		1013	5.3	1.0	5		45	1,8599	1.2+/-3.3	0,1,4299	no	missense	WDR55	NM_017706.4	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	338/384	140049100	1,13005	2203	4300	6503	SO:0001583	missense	54853	exon7			GTCGGCGCAAAAA	AK000202	CCDS4235.1	5q31.3	2013-01-09			ENSG00000120314	ENSG00000120314		"""WD repeat domain containing"""	25971	protein-coding gene	gene with protein product						12477932	Standard	NM_017706		Approved	FLJ20195, FLJ21702	uc003lgr.4	Q9H6Y2	OTTHUMG00000129506	ENST00000358337.5:c.1013G>A	chr5.hg19:g.140049100G>A	ENSP00000351100:p.Arg338His	255.0	0.0		322.0	36.0	NM_017706	Q9NXK4	Missense_Mutation	SNP	ENST00000358337.5	hg19	CCDS4235.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923002	0.92319	0.0	1.16E-4	ENSG00000120314	ENST00000358337	T	0.30714	1.52	5.28	5.28	0.74379	.	0.184033	0.35903	N	0.002909	T	0.36468	0.0968	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	P	0.54140	0.743	T	0.02885	-1.1098	10	0.30854	T	0.27	-11.5367	16.4095	0.83703	0.0:0.0:1.0:0.0	.	338	Q9H6Y2	WDR55_HUMAN	H	338	ENSP00000351100:R338H	ENSP00000351100:R338H	R	+	2	0	WDR55	140029284	1.000000	0.71417	0.999000	0.59377	0.914000	0.54420	7.329000	0.79170	2.473000	0.83533	0.467000	0.42956	CGC	.	.		0.592	WDR55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251680.3	NM_017706	
PCDHB15	56121	hgsc.bcm.edu	37	5	140625888	140625888	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:140625888G>A	ENST00000231173.3	+	1	742	c.742G>A	c.(742-744)Gag>Aag	p.E248K		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	248	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCGCTCTACGAGGTGCAGGT	0.562																																					p.E248K		Atlas-SNP	.											.	PCDHB15	138	.	0			c.G742A						.						35.0	37.0	36.0					5																	140625888		2203	4300	6503	SO:0001583	missense	56121	exon1			CTCTACGAGGTGC	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.742G>A	chr5.hg19:g.140625888G>A	ENSP00000231173:p.Glu248Lys	107.0	0.0		125.0	38.0	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	hg19	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	G	0.089	-1.169992	0.01660	.	.	ENSG00000113248	ENST00000231173	T	0.52295	0.67	5.13	-0.955	0.10356	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.27489	0.0675	N	0.16130	0.375	0.09310	N	1	B	0.16166	0.016	B	0.18263	0.021	T	0.20940	-1.0260	9	0.39692	T	0.17	.	7.9624	0.30079	0.3911:0.4786:0.1302:0.0	.	248	Q9Y5E8	PCDBF_HUMAN	K	248	ENSP00000231173:E248K	ENSP00000231173:E248K	E	+	1	0	PCDHB15	140606072	0.000000	0.05858	0.083000	0.20561	0.023000	0.10783	0.025000	0.13577	-0.030000	0.13804	-0.339000	0.08088	GAG	.	.		0.562	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
CSNK1A1	1452	hgsc.bcm.edu	37	5	148929723	148929723	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:148929723A>G	ENST00000377843.2	-	2	624	c.145T>C	c.(145-147)Tct>Cct	p.S49P	CSNK1A1_ENST00000504676.1_5'UTR|CSNK1A1_ENST00000515435.1_5'UTR|CSNK1A1_ENST00000515748.2_Missense_Mutation_p.S49P|CSNK1A1_ENST00000261798.5_Missense_Mutation_p.S49P|CSNK1A1_ENST00000515768.1_Missense_Mutation_p.S49P	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1	49	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		GCCTTCTGAGATTCTAGCTTC	0.517																																					p.S49P	Colon(5;64 69 1309 10383)	Atlas-SNP	.											.	CSNK1A1	63	.	0			c.T145C						.						111.0	117.0	115.0					5																	148929723		2183	4300	6483	SO:0001583	missense	1452	exon2			TCTGAGATTCTAG	AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.145T>C	chr5.hg19:g.148929723A>G	ENSP00000367074:p.Ser49Pro	65.0	0.0		79.0	11.0	NM_001025105	D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	Missense_Mutation	SNP	ENST00000377843.2	hg19	CCDS47303.1	.	.	.	.	.	.	.	.	.	.	A	17.53	3.411939	0.62511	.	.	ENSG00000113712	ENST00000261798;ENST00000377843;ENST00000322237;ENST00000515768;ENST00000515748	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000001	T	0.49270	0.1547	N	0.16602	0.42	0.80722	D	1	B;B;B	0.19445	0.001;0.013;0.036	B;B;B	0.26310	0.013;0.068;0.059	T	0.44651	-0.9314	10	0.39692	T	0.17	.	15.36	0.74464	1.0:0.0:0.0:0.0	.	49;49;49	Q71TU5;P48729;P48729-2	.;KC1A_HUMAN;.	P	49	ENSP00000261798:S49P;ENSP00000367074:S49P;ENSP00000421689:S49P;ENSP00000421268:S49P	ENSP00000261798:S49P	S	-	1	0	CSNK1A1	148909916	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.973000	0.93428	2.026000	0.59711	0.459000	0.35465	TCT	.	.		0.517	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001892	
PPARGC1B	133522	hgsc.bcm.edu	37	5	149219652	149219652	+	Silent	SNP	C	C	T	rs566927619		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:149219652C>T	ENST00000309241.5	+	9	2699	c.2667C>T	c.(2665-2667)caC>caT	p.H889H	PPARGC1B_ENST00000394320.3_Silent_p.H889H|PPARGC1B_ENST00000403750.1_Silent_p.H825H|PPARGC1B_ENST00000360453.4_Silent_p.H850H	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	889					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			GCATCCGGCACGCCAGGAAGC	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19045	0.0		0.0	False		,,,				2504	0.001				p.H889H		Atlas-SNP	.											.	PPARGC1B	74	.	0			c.C2667T						.						61.0	56.0	58.0					5																	149219652		2203	4300	6503	SO:0001819	synonymous_variant	133522	exon9			CCGGCACGCCAGG	AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2667C>T	chr5.hg19:g.149219652C>T		68.0	0.0		89.0	23.0	NM_133263	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Silent	SNP	ENST00000309241.5	hg19	CCDS4298.1	.	.	.	.	.	.	.	.	.	.	C	7.591	0.670805	0.14776	.	.	ENSG00000155846	ENST00000434684	.	.	.	5.05	-10.1	0.00402	.	.	.	.	.	T	0.35941	0.0949	.	.	.	0.28343	N	0.921242	.	.	.	.	.	.	T	0.42310	-0.9459	4	.	.	.	-4.1421	13.7315	0.62789	0.0:0.1706:0.1338:0.6957	.	.	.	.	C	576	.	.	R	+	1	0	PPARGC1B	149199845	0.000000	0.05858	0.136000	0.22124	0.973000	0.67179	-3.459000	0.00464	-2.092000	0.00857	-0.379000	0.06801	CGC	.	.		0.582	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252334.1	NM_133263	
PDE6A	5145	hgsc.bcm.edu	37	5	149262997	149262997	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:149262997G>A	ENST00000255266.5	-	17	2249	c.2130C>T	c.(2128-2130)atC>atT	p.I710I		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	710					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	CTCACATAACGATTTCCTTCC	0.488																																					p.I710I		Atlas-SNP	.											.	PDE6A	98	.	0			c.C2130T						.						238.0	166.0	191.0					5																	149262997		2203	4300	6503	SO:0001819	synonymous_variant	5145	exon17			CATAACGATTTCC		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.2130C>T	chr5.hg19:g.149262997G>A		99.0	0.0		104.0	34.0	NM_000440	Q0P638	Silent	SNP	ENST00000255266.5	hg19	CCDS4299.1																																																																																			.	.		0.488	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
CCNG1	900	hgsc.bcm.edu	37	5	162869465	162869465	+	Missense_Mutation	SNP	A	A	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:162869465A>C	ENST00000340828.2	+	6	1006	c.782A>C	c.(781-783)aAt>aCt	p.N261T	CCNG1_ENST00000510664.1_Missense_Mutation_p.N133T|CCNG1_ENST00000393929.1_Missense_Mutation_p.N261T|CCNG1_ENST00000504553.1_Intron|CCNG1_ENST00000512163.1_Missense_Mutation_p.N127T|CCNG1_ENST00000511683.2_Missense_Mutation_p.N127T|AC112205.1_ENST00000599797.1_Intron	NM_004060.3	NP_004051.1	P51959	CCNG1_HUMAN	cyclin G1	261					brain development (GO:0007420)|cell growth (GO:0016049)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to organonitrogen compound (GO:0010243)|syncytium formation (GO:0006949)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0597)|OV - Ovarian serous cystadenocarcinoma(192;0.107)|Epithelial(171;0.164)		TCCAAACCAAATGTTCAGAAG	0.378																																					p.N261T		Atlas-SNP	.											.	CCNG1	28	.	0			c.A782C						.						117.0	116.0	116.0					5																	162869465		2203	4300	6503	SO:0001583	missense	900	exon7			AACCAAATGTTCA	D78341	CCDS4360.1	5q32-q34	2010-11-15			ENSG00000113328	ENSG00000113328			1592	protein-coding gene	gene with protein product		601578		CCNG		8954786, 8806701	Standard	NM_004060		Approved		uc003lzb.3	P51959	OTTHUMG00000130380	ENST00000340828.2:c.782A>C	chr5.hg19:g.162869465A>C	ENSP00000344635:p.Asn261Thr	131.0	0.0		148.0	35.0	NM_199246	B2R7B2|B4DLW7|D3DQK7|Q15757|Q96L32	Missense_Mutation	SNP	ENST00000340828.2	hg19	CCDS4360.1	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750760	0.69533	.	.	ENSG00000113328	ENST00000512163;ENST00000393929;ENST00000340828;ENST00000511683;ENST00000510664	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.79	5.79	0.91817	.	0.042274	0.85682	D	0.000000	T	0.35770	0.0943	L	0.46157	1.445	0.80722	D	1	P	0.48294	0.908	B	0.41374	0.355	T	0.20974	-1.0259	10	0.56958	D	0.05	6.1324	16.1376	0.81497	1.0:0.0:0.0:0.0	.	261	P51959	CCNG1_HUMAN	T	127;261;261;127;133	ENSP00000424315:N127T;ENSP00000377506:N261T;ENSP00000344635:N261T;ENSP00000424141:N127T;ENSP00000422379:N133T	ENSP00000344635:N261T	N	+	2	0	CCNG1	162802043	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.360000	0.66086	2.212000	0.71576	0.533000	0.62120	AAT	.	.		0.378	CCNG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252750.3	NM_004060	
TENM2	57451	hgsc.bcm.edu	37	5	167626887	167626887	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:167626887G>A	ENST00000518659.1	+	17	3220	c.3181G>A	c.(3181-3183)Gag>Aag	p.E1061K	TENM2_ENST00000519204.1_Missense_Mutation_p.E940K|TENM2_ENST00000520394.1_Missense_Mutation_p.E829K|TENM2_ENST00000403607.2_Missense_Mutation_p.E885K|TENM2_ENST00000545108.1_Missense_Mutation_p.E1061K	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1061					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TGAAGAAATCGAGCTCCCTGG	0.493																																					p.E1052K		Atlas-SNP	.											ODZ2_ENST00000519204,NS,carcinoma,-1,3	.	.	.	0			c.G3154A						.						165.0	159.0	161.0					5																	167626887		1934	4150	6084	SO:0001583	missense	57451	exon17			GAAATCGAGCTCC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3181G>A	chr5.hg19:g.167626887G>A	ENSP00000429430:p.Glu1061Lys	57.0	0.0		82.0	11.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	hg19		.	.	.	.	.	.	.	.	.	.	G	10.77	1.444277	0.25987	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89196	-2.01;-2.0;-2.11;-2.47;-2.48	5.05	5.05	0.67936	.	0.199119	0.52532	D	0.000078	D	0.91616	0.7351	L	0.40543	1.245	0.49483	D	0.999793	B;B;D	0.71674	0.331;0.223;0.998	B;B;D	0.73380	0.036;0.016;0.98	D	0.90017	0.4125	10	0.28530	T	0.3	.	18.4354	0.90643	0.0:0.0:1.0:0.0	.	1061;1061;829	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	K	1061;1061;940;829;885	ENSP00000429430:E1061K;ENSP00000438635:E1061K;ENSP00000428964:E940K;ENSP00000427874:E829K;ENSP00000384905:E885K	ENSP00000384905:E885K	E	+	1	0	ODZ2	167559465	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	8.031000	0.88826	2.338000	0.79540	0.561000	0.74099	GAG	.	.		0.493	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
FGFR4	2264	hgsc.bcm.edu	37	5	176518089	176518089	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:176518089G>A	ENST00000292408.4	+	5	832	c.587G>A	c.(586-588)cGc>cAc	p.R196H	FGFR4_ENST00000393637.1_Missense_Mutation_p.R196H|FGFR4_ENST00000502906.1_Missense_Mutation_p.R196H|FGFR4_ENST00000393648.2_Missense_Mutation_p.R196H|FGFR4_ENST00000292410.3_Missense_Mutation_p.R196H	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	196	Ig-like C2-type 2.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	GGGGAGAACCGCATTGGAGGC	0.562										TSP Lung(9;0.080)																											p.R196H		Atlas-SNP	.											.	FGFR4	174	.	0			c.G587A						.						68.0	63.0	64.0					5																	176518089		2203	4300	6503	SO:0001583	missense	2264	exon4			AGAACCGCATTGG	AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.587G>A	chr5.hg19:g.176518089G>A	ENSP00000292408:p.Arg196His	85.0	0.0		83.0	21.0	NM_022963	G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	ENST00000292408.4	hg19	CCDS4410.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699222	0.88830	.	.	ENSG00000160867	ENST00000292408;ENST00000503708;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	T;T;T;T;T;T	0.72051	1.19;-0.62;1.19;1.19;1.19;1.19	4.74	4.74	0.60224	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84889	0.5572	M	0.79805	2.47	0.51233	D	0.999919	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.996;0.999	D	0.87125	0.2193	10	0.72032	D	0.01	.	17.5207	0.87786	0.0:0.0:1.0:0.0	.	196;196;196;196	B5A965;B4DVP5;P22455-2;P22455	.;.;.;FGFR4_HUMAN	H	196;196;196;196;196;196;308	ENSP00000292408:R196H;ENSP00000424905:R196H;ENSP00000377259:R196H;ENSP00000424960:R196H;ENSP00000292410:R196H;ENSP00000377254:R196H	ENSP00000292408:R196H	R	+	2	0	FGFR4	176450695	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.569000	0.98170	2.470000	0.83445	0.561000	0.74099	CGC	.	.		0.562	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253410.1		
PDLIM7	9260	hgsc.bcm.edu	37	5	176916601	176916601	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:176916601C>T	ENST00000355841.2	-	9	728	c.662G>A	c.(661-663)cGc>cAc	p.R221H	PDLIM7_ENST00000356618.4_Silent_p.P200P|PDLIM7_ENST00000393551.1_Silent_p.P200P|PDLIM7_ENST00000359895.2_Missense_Mutation_p.R187H	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)	221					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.R221H(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCAGGGCGGGCGGCTGGTAGG	0.711																																					p.R221H		Atlas-SNP	.											PDLIM7,NS,haematopoietic_neoplasm,0,1	PDLIM7	32	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.G662A						.						10.0	14.0	13.0					5																	176916601		2188	4272	6460	SO:0001583	missense	9260	exon9			GGCGGGCGGCTGG	BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.662G>A	chr5.hg19:g.176916601C>T	ENSP00000348099:p.Arg221His	66.0	0.0		98.0	33.0	NM_005451	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Missense_Mutation	SNP	ENST00000355841.2	hg19	CCDS4422.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.282994	0.59867	.	.	ENSG00000196923	ENST00000359895;ENST00000355841	T;T	0.52526	0.76;0.66	5.23	5.23	0.72850	.	0.085883	0.44285	N	0.000467	T	0.45316	0.1336	M	0.68317	2.08	0.80722	D	1	B;P	0.35192	0.358;0.489	B;B	0.26094	0.04;0.066	T	0.49952	-0.8884	10	0.48119	T	0.1	.	15.9056	0.79427	0.0:0.8649:0.1351:0.0	.	221;187	Q9NR12;Q9NR12-2	PDLI7_HUMAN;.	H	187;221	ENSP00000352964:R187H;ENSP00000348099:R221H	ENSP00000348099:R221H	R	-	2	0	PDLIM7	176849207	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.660000	0.83776	2.431000	0.82371	0.555000	0.69702	CGC	.	.		0.711	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253423.1	NM_005451	
N4BP3	23138	hgsc.bcm.edu	37	5	177548875	177548875	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:177548875A>G	ENST00000274605.5	+	5	1867	c.1508A>G	c.(1507-1509)tAc>tGc	p.Y503C		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	503						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGCTGCGCTACCAGCGGGAG	0.677																																					p.Y503C		Atlas-SNP	.											.	N4BP3	25	.	0			c.A1508G						.						15.0	20.0	18.0					5																	177548875		2200	4294	6494	SO:0001583	missense	23138	exon5			TGCGCTACCAGCG	AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.1508A>G	chr5.hg19:g.177548875A>G	ENSP00000274605:p.Tyr503Cys	67.0	0.0		80.0	8.0	NM_015111	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	ENST00000274605.5	hg19	CCDS34307.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.386752	0.82902	.	.	ENSG00000145911	ENST00000274605	T	0.64618	-0.11	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.78898	0.4356	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81607	-0.0856	10	0.72032	D	0.01	-19.9832	13.6226	0.62146	1.0:0.0:0.0:0.0	.	503	O15049	N4BP3_HUMAN	C	503	ENSP00000274605:Y503C	ENSP00000274605:Y503C	Y	+	2	0	N4BP3	177481481	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.311000	0.96282	2.115000	0.64714	0.379000	0.24179	TAC	.	.		0.677	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373552.2	NM_015111	
COL23A1	91522	hgsc.bcm.edu	37	5	177669109	177669109	+	Silent	SNP	G	G	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:177669109G>C	ENST00000390654.3	-	27	1872	c.1515C>G	c.(1513-1515)ggC>ggG	p.G505G		NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	505	Collagen-like 5.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		CTCCTTTCCGGCCGGGGACCC	0.652																																					p.G505G		Atlas-SNP	.											.	COL23A1	47	.	0			c.C1515G						.						16.0	20.0	18.0					5																	177669109		1910	4073	5983	SO:0001819	synonymous_variant	91522	exon27			TTTCCGGCCGGGG	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.1515C>G	chr5.hg19:g.177669109G>C		97.0	0.0		97.0	32.0	NM_173465	Q8IVR4|Q9NT93	Silent	SNP	ENST00000390654.3	hg19	CCDS4436.1																																																																																			.	.		0.652	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	
NUP153	9972	hgsc.bcm.edu	37	6	17629463	17629463	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:17629463T>C	ENST00000262077.2	-	18	2966	c.2967A>G	c.(2965-2967)ttA>ttG	p.L989L	NUP153_ENST00000537253.1_Silent_p.L1020L	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	989					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			CTGGGTTGCTTAAACCAGAAG	0.343																																					p.L989L		Atlas-SNP	.											.	NUP153	116	.	0			c.A2967G						.						46.0	49.0	48.0					6																	17629463		2199	4300	6499	SO:0001819	synonymous_variant	9972	exon18			GTTGCTTAAACCA	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2967A>G	chr6.hg19:g.17629463T>C		175.0	0.0		196.0	63.0	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Silent	SNP	ENST00000262077.2	hg19	CCDS4541.1																																																																																			.	.		0.343	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
FAM65B	9750	hgsc.bcm.edu	37	6	24850823	24850823	+	Splice_Site	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:24850823A>G	ENST00000259698.4	-	10	974		c.e10+1		FAM65B_ENST00000378023.4_Splice_Site|FAM65B_ENST00000538035.1_Splice_Site|FAM65B_ENST00000540914.1_Splice_Site|FAM65B_ENST00000510784.2_Splice_Site	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B						cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						ACAATACTGTACCTTGATGGA	0.507																																					.		Atlas-SNP	.											.	FAM65B	134	.	0			c.798+2T>C						.						121.0	129.0	126.0					6																	24850823		2040	4196	6236	SO:0001630	splice_region_variant	9750	exon11			TACTGTACCTTGA	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.798+1T>C	chr6.hg19:g.24850823A>G		59.0	0.0		66.0	8.0	NM_014722	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Splice_Site	SNP	ENST00000259698.4	hg19	CCDS47383.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.523496	0.85600	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5984	0.76606	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM65B	24958802	1.000000	0.71417	0.963000	0.40424	0.965000	0.64279	8.962000	0.93254	2.139000	0.66308	0.454000	0.30748	.	.	.		0.507	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		Intron
HIST1H2BF	8343	hgsc.bcm.edu	37	6	26199792	26199792	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:26199792T>C	ENST00000359985.1	+	1	45	c.6T>C	c.(4-6)ccT>ccC	p.P2P	HIST1H3D_ENST00000377831.5_5'Flank|HIST1H2AD_ENST00000341023.1_5'Flank|HIST1H3D_ENST00000356476.2_5'Flank	NM_003522.3	NP_003513.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	2					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(7)|upper_aerodigestive_tract(3)	17		all_hematologic(11;0.196)				TTATCATGCCTGAACCTGCTA	0.488																																					p.P2P		Atlas-SNP	.											.	HIST1H2BF	25	.	0			c.T6C						.						85.0	83.0	84.0					6																	26199792		2203	4300	6503	SO:0001819	synonymous_variant	8343	exon1			CATGCCTGAACCT	Z80779	CCDS4592.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197846	ENSG00000277224		"""Histones / Replication-dependent"""	4752	protein-coding gene	gene with protein product		602804	"""H2B histone family, member G"", ""histone 1, H2bf"""	H2BFG		9119399, 12408966	Standard	NM_003522		Approved	H2B/g	uc003ngx.3	P62807	OTTHUMG00000014445	ENST00000359985.1:c.6T>C	chr6.hg19:g.26199792T>C		106.0	0.0		121.0	15.0	NM_003522	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	ENST00000359985.1	hg19	CCDS4592.1																																																																																			.	.		0.488	HIST1H2BF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040108.1	NM_003522	
ZSCAN16	80345	hgsc.bcm.edu	37	6	28097499	28097499	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:28097499T>C	ENST00000340487.4	+	4	967	c.818T>C	c.(817-819)tTc>tCc	p.F273S	ZSCAN16-AS1_ENST00000602810.1_RNA|ZSCAN16-AS1_ENST00000600652.1_RNA	NM_025231.1	NP_079507.1	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	273					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|liver(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GGAAAAGCCTTCATTCAGCGC	0.443																																					p.F273S		Atlas-SNP	.											.	ZSCAN16	24	.	0			c.T818C						.						85.0	83.0	84.0					6																	28097499		2203	4300	6503	SO:0001583	missense	80345	exon4			AAGCCTTCATTCA	AK025844	CCDS4644.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000196812	ENSG00000196812		"""-"", ""Zinc fingers, C2H2-type"""	20813	protein-coding gene	gene with protein product			"""zinc finger protein 392"", ""zinc finger protein 435"""	ZNF392, ZNF435			Standard	NM_025231		Approved	FLJ22191, dJ265C24.3	uc003nkm.3	Q9H4T2	OTTHUMG00000014509	ENST00000340487.4:c.818T>C	chr6.hg19:g.28097499T>C	ENSP00000366527:p.Phe273Ser	92.0	0.0		111.0	10.0	NM_025231	Q9H6K2	Missense_Mutation	SNP	ENST00000340487.4	hg19	CCDS4644.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.707692	0.89018	.	.	ENSG00000196812	ENST00000340487	T	0.44482	0.92	5.08	5.08	0.68730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36338	N	0.002645	T	0.63022	0.2476	M	0.89353	3.025	0.45594	D	0.998535	D	0.89917	1.0	D	0.97110	1.0	T	0.72340	-0.4323	10	0.87932	D	0	.	13.8354	0.63406	0.0:0.0:0.0:1.0	.	273	Q9H4T2	ZSC16_HUMAN	S	273	ENSP00000366527:F273S	ENSP00000366527:F273S	F	+	2	0	ZSCAN16	28205478	1.000000	0.71417	0.971000	0.41717	0.999000	0.98932	5.718000	0.68455	1.922000	0.55676	0.533000	0.62120	TTC	.	.		0.443	ZSCAN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040177.1	NM_025231	
UBD	10537	hgsc.bcm.edu	37	6	29523920	29523920	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:29523920T>A	ENST00000377050.4	-	2	458	c.235A>T	c.(235-237)Aaa>Taa	p.K79*	GABBR1_ENST00000355973.3_3'UTR	NM_006398.3	NP_006389.2	O15205	UBD_HUMAN	ubiquitin D	79	Ubiquitin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00214}.				aggresome assembly (GO:0070842)|myeloid dendritic cell differentiation (GO:0043011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein modification by small protein conjugation (GO:0032446)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to organonitrogen compound (GO:0010243)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	proteasome binding (GO:0070628)			kidney(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6						TTCACCACTTTCAGGGTAAGG	0.527																																					p.K79X		Atlas-SNP	.											.	UBD	13	.	0			c.A235T						.						65.0	69.0	68.0					6																	29523920		1510	2709	4219	SO:0001587	stop_gained	10537	exon2			CCACTTTCAGGGT	Y12653	CCDS4662.1	6p21.3	2008-04-11			ENSG00000213886	ENSG00000213886			18795	protein-coding gene	gene with protein product		606050				9368598, 8662070	Standard	NM_006398		Approved	FAT10	uc003nmo.3	O15205	OTTHUMG00000031289	ENST00000377050.4:c.235A>T	chr6.hg19:g.29523920T>A	ENSP00000366249:p.Lys79*	193.0	0.0		218.0	52.0	NM_006398	B0UZT6|Q5STL2|Q5SUK2|Q96EC7	Nonsense_Mutation	SNP	ENST00000377050.4	hg19	CCDS4662.1	.	.	.	.	.	.	.	.	.	.	T	36	5.640803	0.96693	.	.	ENSG00000213886	ENST00000377050	.	.	.	5.16	3.97	0.46021	.	0.000000	0.38164	U	0.001782	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-19.6413	9.032	0.36264	0.0:0.0:0.1864:0.8136	.	.	.	.	X	79	.	ENSP00000366249:K79X	K	-	1	0	UBD	29631899	1.000000	0.71417	0.998000	0.56505	0.823000	0.46562	3.262000	0.51538	0.768000	0.33290	0.496000	0.49642	AAA	.	.		0.527	UBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076628.3		
DDR1	780	hgsc.bcm.edu	37	6	30863232	30863232	+	Missense_Mutation	SNP	G	G	A	rs145280414		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:30863232G>A	ENST00000324771.8	+	14	2113	c.1565G>A	c.(1564-1566)cGt>cAt	p.R522H	DDR1_ENST00000452441.1_Missense_Mutation_p.R522H|DDR1_ENST00000508312.1_Intron|DDR1_ENST00000376575.3_Missense_Mutation_p.R522H|DDR1_ENST00000376567.2_Intron|DDR1_ENST00000376570.4_Intron|DDR1_ENST00000446312.1_Intron|DDR1_ENST00000361741.4_Missense_Mutation_p.V226I|DDR1_ENST00000376569.3_Intron|DDR1_ENST00000454612.2_Intron|DDR1_ENST00000418800.2_Intron|DDR1_ENST00000513240.1_Missense_Mutation_p.R522H|DDR1_ENST00000376568.3_Missense_Mutation_p.R522H			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	522	Gly/Pro-rich.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.R522H(2)		central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	ACTTACGCCCGTCCCCCTCGA	0.677																																					p.R522H		Atlas-SNP	.											DDR1_ENST00000376575,caecum,carcinoma,0,4	DDR1	213	.	2	Substitution - Missense(2)	ovary(2)	c.G1565A						.	G	,,,,HIS/ARG,HIS/ARG	0,4406		0,0,2203	113.0	123.0	120.0		,,,,1565,1565	4.9	1.0	6	dbSNP_134	120	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,intron,intron,missense,missense	DDR1	NM_001202521.1,NM_001202522.1,NM_001202523.1,NM_001954.4,NM_013993.2,NM_013994.2	,,,,29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,probably-damaging,probably-damaging	,,,,522/914,522/920	30863232	1,13005	2203	4300	6503	SO:0001583	missense	780	exon11			ACGCCCGTCCCCC	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.1565G>A	chr6.hg19:g.30863232G>A	ENSP00000318217:p.Arg522His	46.0	0.0		51.0	9.0	NM_013994	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	hg19	CCDS34385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.32|18.32	3.598772|3.598772	0.66332|0.66332	0.0|0.0	1.16E-4|1.16E-4	ENSG00000204580|ENSG00000204580	ENST00000324771;ENST00000376575;ENST00000376568;ENST00000452441;ENST00000513240|ENST00000417521;ENST00000361741	D;D;D;D;D|T;T	0.85629|0.79554	-1.86;-2.01;-1.86;-1.86;-2.01|-1.21;-1.28	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.49541|0.49541	0.1563|0.1563	N|N	0.19112|0.19112	0.55|0.55	0.18873|0.18873	N|N	0.999988|0.999988	D;D|B	0.71674|0.17852	0.998;0.974|0.024	P;B|B	0.58660|0.10450	0.843;0.32|0.005	T|T	0.26052|0.26052	-1.0114|-1.0114	10|9	0.46703|0.22109	T|T	0.11|0.4	.|.	10.9028|10.9028	0.47062|0.47062	0.0:0.0:0.8123:0.1876|0.0:0.0:0.8123:0.1876	.|.	522;522|291	Q08345-5;Q08345|A2ABM8	.;DDR1_HUMAN|.	H|I	522|291;226	ENSP00000318217:R522H;ENSP00000365759:R522H;ENSP00000365752:R522H;ENSP00000405039:R522H;ENSP00000427552:R522H|ENSP00000398682:V291I;ENSP00000354844:V226I	ENSP00000318217:R522H|ENSP00000354844:V226I	R|V	+|+	2|1	0|0	DDR1|DDR1	30971211|30971211	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.137000|3.137000	0.50562|0.50562	2.303000|2.303000	0.77524|0.77524	0.460000|0.460000	0.39030|0.39030	CGT|GTC	.	G|1.000;A|0.000		0.677	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994	
VWA7	80737	hgsc.bcm.edu	37	6	31741028	31741028	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:31741028T>C	ENST00000375688.4	-	6	1108	c.908A>G	c.(907-909)gAt>gGt	p.D303G	VWA7_ENST00000447450.1_Missense_Mutation_p.D303G|VWA7_ENST00000467576.1_5'UTR|VWA7_ENST00000375686.3_Missense_Mutation_p.D303G			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	303						extracellular region (GO:0005576)											CCTGGAGAAATCCCTGTCTCC	0.632																																					p.D303G		Atlas-SNP	.											.	.	.	.	0			c.A908G						.						23.0	23.0	23.0					6																	31741028		2203	4299	6502	SO:0001583	missense	80737	exon6			GAGAAATCCCTGT		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.908A>G	chr6.hg19:g.31741028T>C	ENSP00000364840:p.Asp303Gly	48.0	0.0		57.0	10.0	NM_025258	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	ENST00000375688.4	hg19	CCDS4721.2	.	.	.	.	.	.	.	.	.	.	T	0.671	-0.801756	0.02841	.	.	ENSG00000204396	ENST00000375688;ENST00000375686;ENST00000447450	T;T;T	0.31769	2.75;2.5;1.48	5.92	-1.56	0.08532	.	0.797000	0.12050	N	0.504198	T	0.03477	0.0100	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.13108	T	0.6	7.0E-4	5.7662	0.18227	0.0:0.2613:0.3738:0.3649	.	303	Q9Y334	G7C_HUMAN	G	303	ENSP00000364840:D303G;ENSP00000364838:D303G;ENSP00000390554:D303G	ENSP00000364838:D303G	D	-	2	0	C6orf27	31849007	0.000000	0.05858	0.001000	0.08648	0.362000	0.29581	-1.518000	0.02246	-0.379000	0.07906	-1.267000	0.01435	GAT	.	.		0.632	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076233.2	NM_025258	
VARS	7407	hgsc.bcm.edu	37	6	31749894	31749894	+	Silent	SNP	A	A	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:31749894A>C	ENST00000375663.3	-	18	2651	c.2211T>G	c.(2209-2211)acT>acG	p.T737T	VARS_ENST00000444930.2_3'UTR|VARS_ENST00000482996.1_5'UTR	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	737					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	GGTCACTGACAGTGACAAAGT	0.622																																					p.T737T		Atlas-SNP	.											.	VARS	76	.	0			c.T2211G						.						49.0	53.0	52.0					6																	31749894		2203	4300	6503	SO:0001819	synonymous_variant	7407	exon18			ACTGACAGTGACA	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.2211T>G	chr6.hg19:g.31749894A>C		127.0	0.0		138.0	14.0	NM_006295	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Silent	SNP	ENST00000375663.3	hg19	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	A	0.678	-0.799216	0.02841	.	.	ENSG00000204394	ENST00000428445	.	.	.	5.24	-8.01	0.01122	.	.	.	.	.	T	0.35537	0.0935	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	T	0.55909	-0.8066	4	.	.	.	-21.1472	11.1581	0.48499	0.144:0.0:0.6465:0.2095	.	.	.	.	G	55	.	.	C	-	1	0	VARS	31857873	0.001000	0.12720	0.025000	0.17156	0.169000	0.22640	-1.935000	0.01550	-1.600000	0.01603	-0.376000	0.06991	TGT	.	.		0.622	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
VPS52	6293	hgsc.bcm.edu	37	6	33239413	33239413	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:33239413G>A	ENST00000445902.2	-	1	258	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	RPS18_ENST00000439602.2_5'Flank|VPS52_ENST00000478934.1_Intron|VPS52_ENST00000436044.2_Intron|VPS52_ENST00000482399.1_Silent_p.L14L|RPS18_ENST00000474973.1_5'Flank	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	14					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						CGCAACACCAGTTCCCGGGCC	0.672																																					p.L14L		Atlas-SNP	.											.	VPS52	56	.	0			c.C40T						.						18.0	20.0	19.0					6																	33239413		2201	4299	6500	SO:0001819	synonymous_variant	6293	exon1			ACACCAGTTCCCG	AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.40C>T	chr6.hg19:g.33239413G>A		139.0	0.0		149.0	17.0	NM_022553	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Silent	SNP	ENST00000445902.2	hg19	CCDS4770.2																																																																																			.	.		0.672	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
TEAD3	7005	hgsc.bcm.edu	37	6	35443844	35443844	+	Missense_Mutation	SNP	A	A	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:35443844A>T	ENST00000402886.3	-	8	725	c.572T>A	c.(571-573)aTc>aAc	p.I191N	TEAD3_ENST00000338863.7_Missense_Mutation_p.I251N			Q99594	TEAD3_HUMAN	TEA domain family member 3	251	Pro-rich.|Transcriptional activation. {ECO:0000255}.				female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						CGTCTGGCCGATGTGCACAAA	0.597																																					p.I251N		Atlas-SNP	.											.	TEAD3	52	.	0			c.T752A						.						35.0	35.0	35.0					6																	35443844		1934	4158	6092	SO:0001583	missense	7005	exon10			TGGCCGATGTGCA	X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.572T>A	chr6.hg19:g.35443844A>T	ENSP00000384577:p.Ile191Asn	62.0	0.0		93.0	10.0	NM_003214	O95910|Q5BJG7|Q8N6Y4	Missense_Mutation	SNP	ENST00000402886.3	hg19		.	.	.	.	.	.	.	.	.	.	A	22.0	4.226010	0.79576	.	.	ENSG00000007866	ENST00000338863;ENST00000402886;ENST00000373905;ENST00000433586	T;T;T	0.41065	1.01;1.01;1.01	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.67887	0.2941	M	0.93808	3.46	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.78157	-0.2313	10	0.87932	D	0	-29.7681	14.723	0.69323	1.0:0.0:0.0:0.0	.	191;267;251	B5MCM0;Q7Z6V0;Q99594	.;.;TEAD3_HUMAN	N	251;191;267;162	ENSP00000345772:I251N;ENSP00000384577:I191N;ENSP00000416400:I162N	ENSP00000345772:I251N	I	-	2	0	TEAD3	35551822	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.188000	0.94921	2.078000	0.62432	0.459000	0.35465	ATC	.	.		0.597	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316961.2		
DAAM2	23500	hgsc.bcm.edu	37	6	39867871	39867871	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:39867871C>T	ENST00000398904.2	+	23	2880	c.2698C>T	c.(2698-2700)Cgc>Tgc	p.R900C	DAAM2_ENST00000538976.1_Missense_Mutation_p.R899C|RP11-61I13.3_ENST00000437947.1_RNA|RP11-61I13.3_ENST00000430595.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|RP11-61I13.3_ENST00000606829.1_RNA|DAAM2_ENST00000274867.4_Missense_Mutation_p.R900C			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	900	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GTATCAGAGGCGCCAGGTACG	0.577																																					p.R900C		Atlas-SNP	.											.	DAAM2	101	.	0			c.C2698T						.						33.0	36.0	35.0					6																	39867871		2032	4181	6213	SO:0001583	missense	23500	exon23			CAGAGGCGCCAGG	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2698C>T	chr6.hg19:g.39867871C>T	ENSP00000381876:p.Arg900Cys	77.0	0.0		95.0	11.0	NM_001201427	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	hg19	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795680	0.50208	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.17854	2.25;2.25;2.26	5.13	5.13	0.70059	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.549954	0.19539	N	0.111855	T	0.07234	0.0183	L	0.34521	1.04	0.80722	D	1	B;B	0.10296	0.001;0.003	B;B	0.11329	0.005;0.006	T	0.05146	-1.0903	10	0.59425	D	0.04	.	11.4076	0.49906	0.2964:0.7036:0.0:0.0	.	899;900	G5EA45;Q86T65	.;DAAM2_HUMAN	C	900;900;899	ENSP00000274867:R900C;ENSP00000381876:R900C;ENSP00000437808:R899C	ENSP00000274867:R900C	R	+	1	0	DAAM2	39975849	0.552000	0.26505	0.982000	0.44146	0.961000	0.63080	2.459000	0.45023	2.667000	0.90743	0.561000	0.74099	CGC	.	.		0.577	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
LRFN2	57497	hgsc.bcm.edu	37	6	40360329	40360329	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:40360329C>T	ENST00000338305.6	-	3	2265	c.1723G>A	c.(1723-1725)Gtg>Atg	p.V575M		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	575						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					TGCGAGTACACATTGCTCACG	0.677																																					p.V575M		Atlas-SNP	.											.	LRFN2	133	.	0			c.G1723A						.						37.0	34.0	35.0					6																	40360329		2203	4300	6503	SO:0001583	missense	57497	exon3			AGTACACATTGCT	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1723G>A	chr6.hg19:g.40360329C>T	ENSP00000345985:p.Val575Met	71.0	0.0		57.0	19.0	NM_020737	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	hg19	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	c	14.02	2.410940	0.42817	.	.	ENSG00000156564	ENST00000338305	T	0.60797	0.16	5.41	0.515	0.17013	.	0.291752	0.38272	N	0.001752	T	0.31888	0.0811	L	0.42245	1.32	0.31112	N	0.70984	P	0.37663	0.604	B	0.39840	0.311	T	0.15954	-1.0419	10	0.66056	D	0.02	.	10.9102	0.47103	0.0:0.727:0.0:0.273	.	575	Q9ULH4	LRFN2_HUMAN	M	575	ENSP00000345985:V575M	ENSP00000345985:V575M	V	-	1	0	LRFN2	40468307	0.724000	0.28038	0.973000	0.42090	0.841000	0.47740	0.607000	0.24209	-0.213000	0.10094	0.651000	0.88453	GTG	.	.		0.677	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
GNMT	27232	hgsc.bcm.edu	37	6	42930828	42930828	+	Missense_Mutation	SNP	G	G	A	rs563826316		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:42930828G>A	ENST00000372808.3	+	4	480	c.470G>A	c.(469-471)cGg>cAg	p.R157Q		NM_018960.4	NP_061833.1	Q14749	GNMT_HUMAN	glycine N-methyltransferase	157					cellular protein modification process (GO:0006464)|glycogen metabolic process (GO:0005977)|methionine metabolic process (GO:0006555)|one-carbon metabolic process (GO:0006730)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|S-adenosylmethionine metabolic process (GO:0046500)	cytoplasm (GO:0005737)	folic acid binding (GO:0005542)|glycine binding (GO:0016594)|glycine N-methyltransferase activity (GO:0017174)			kidney(2)|large_intestine(1)|lung(1)	4	Colorectal(47;0.196)		all cancers(41;0.00196)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0461)		Glycine(DB00145)|S-Adenosylmethionine(DB00118)	AGTGAGCACCGGCTGGCGCTG	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		12371	0.0		0.0	False		,,,				2504	0.001				p.R157Q		Atlas-SNP	.											.	GNMT	13	.	0			c.G470A						.						37.0	38.0	37.0					6																	42930828		2203	4300	6503	SO:0001583	missense	27232	exon4			AGCACCGGCTGGC	AF101475	CCDS4876.1	6p12	2008-02-05			ENSG00000124713	ENSG00000124713			4415	protein-coding gene	gene with protein product		606628				10843803, 9495250	Standard	NM_018960		Approved		uc003otd.3	Q14749	OTTHUMG00000014712	ENST00000372808.3:c.470G>A	chr6.hg19:g.42930828G>A	ENSP00000361894:p.Arg157Gln	27.0	0.0		54.0	5.0	NM_018960	Q5T8W2|Q9NNZ1|Q9NS24	Missense_Mutation	SNP	ENST00000372808.3	hg19	CCDS4876.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710368	0.48517	.	.	ENSG00000124713	ENST00000372808	T	0.66638	-0.22	5.6	0.992	0.19819	.	0.175951	0.48767	N	0.000162	T	0.31358	0.0794	L	0.41124	1.26	0.37147	D	0.901973	B	0.18166	0.026	B	0.19666	0.026	T	0.07083	-1.0791	10	0.15952	T	0.53	-5.393	8.0625	0.30642	0.5244:0.0:0.4756:0.0	.	157	Q14749	GNMT_HUMAN	Q	157	ENSP00000361894:R157Q	ENSP00000361894:R157Q	R	+	2	0	GNMT	43038806	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	2.794000	0.47853	0.259000	0.21709	-0.367000	0.07326	CGG	.	.		0.622	GNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040568.1	NM_018960	
CUL9	23113	hgsc.bcm.edu	37	6	43172484	43172484	+	Splice_Site	SNP	A	A	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:43172484A>C	ENST00000252050.4	+	22	4423		c.e22-1		CUL9_ENST00000354495.3_Splice_Site|CUL9_ENST00000372647.2_Splice_Site	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9						microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CTGTCTCTACAGTCAGCAAGA	0.597																																					.		Atlas-SNP	.											.	CUL9	248	.	0			c.4340-2A>C						.						70.0	77.0	75.0					6																	43172484		2203	4300	6503	SO:0001630	splice_region_variant	23113	exon22			CTCTACAGTCAGC	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.4340-1A>C	chr6.hg19:g.43172484A>C		85.0	0.0		100.0	28.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Splice_Site	SNP	ENST00000252050.4	hg19	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	A	19.49	3.837526	0.71373	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1747	0.59619	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CUL9	43280462	1.000000	0.71417	0.990000	0.47175	0.895000	0.52256	6.605000	0.74155	1.861000	0.53984	0.459000	0.35465	.	.	.		0.597	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	Intron
CUL9	23113	hgsc.bcm.edu	37	6	43192000	43192000	+	Silent	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:43192000C>A	ENST00000252050.4	+	41	7455	c.7371C>A	c.(7369-7371)tcC>tcA	p.S2457S	CUL9_ENST00000354495.3_Silent_p.S2347S|CUL9_ENST00000372647.2_Silent_p.S2429S|RP3-330M21.5_ENST00000500590.1_RNA	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2457					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCCAGGCCTCCTCAGGGCCAG	0.607																																					p.S2457S		Atlas-SNP	.											.	CUL9	248	.	0			c.C7371A						.						66.0	59.0	61.0					6																	43192000		2203	4300	6503	SO:0001819	synonymous_variant	23113	exon41			GGCCTCCTCAGGG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.7371C>A	chr6.hg19:g.43192000C>A		105.0	0.0		123.0	14.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Silent	SNP	ENST00000252050.4	hg19	CCDS4890.1																																																																																			.	.		0.607	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
GTPBP2	54676	hgsc.bcm.edu	37	6	43593198	43593198	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:43593198G>A	ENST00000307126.5	-	5	606	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W	GTPBP2_ENST00000307114.7_Missense_Mutation_p.R115W|GTPBP2_ENST00000476510.1_5'UTR	NM_019096.3	NP_061969.3			GTP binding protein 2											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			AGCCGAGCCCGGCCCCGCCCA	0.597																																					p.R203W	GBM(116;405 1620 28302 32150 44768)	Atlas-SNP	.											.	GTPBP2	39	.	0			c.C607T						.						86.0	88.0	87.0					6																	43593198		2203	4300	6503	SO:0001583	missense	54676	exon5			GAGCCCGGCCCCG	AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.607C>T	chr6.hg19:g.43593198G>A	ENSP00000303997:p.Arg203Trp	104.0	0.0		147.0	25.0	NM_019096		Missense_Mutation	SNP	ENST00000307126.5	hg19	CCDS4903.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.902242	0.52227	.	.	ENSG00000172432	ENST00000307126;ENST00000307114;ENST00000452781	T;T;T	0.72051	-0.62;-0.62;0.77	4.38	2.34	0.29019	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.86268	2.805	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.986	T	0.82615	-0.0370	10	0.49607	T	0.09	-14.4158	13.6858	0.62515	0.0:0.0:0.647:0.353	.	195;203	Q9BX10-4;Q9BX10	.;GTPB2_HUMAN	W	203;115;195	ENSP00000303997:R203W;ENSP00000304893:R115W;ENSP00000410676:R195W	ENSP00000304893:R115W	R	-	1	2	GTPBP2	43701176	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.434000	0.44802	1.009000	0.39289	0.462000	0.41574	CGG	.	.		0.597	GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040679.1		
TFAP2D	83741	hgsc.bcm.edu	37	6	50740417	50740417	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:50740417C>T	ENST00000008391.3	+	8	1427	c.1199C>T	c.(1198-1200)aCa>aTa	p.T400I		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.T400K(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACTTTCCAAACAGTTCTCAGT	0.458																																					p.T400I		Atlas-SNP	.											TFAP2D,NS,carcinoma,0,2	TFAP2D	144	.	1	Substitution - Missense(1)	lung(1)	c.C1199T						.						66.0	64.0	65.0					6																	50740417		2203	4300	6503	SO:0001583	missense	83741	exon8			TCCAAACAGTTCT	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1199C>T	chr6.hg19:g.50740417C>T	ENSP00000008391:p.Thr400Ile	129.0	1.0		126.0	24.0	NM_172238		Missense_Mutation	SNP	ENST00000008391.3	hg19	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446102	0.63178	.	.	ENSG00000008197	ENST00000008391	D	0.96885	-4.16	5.46	5.46	0.80206	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90858	0.7128	N	0.14661	0.345	0.80722	D	1	B	0.30146	0.27	B	0.34346	0.18	D	0.90275	0.4310	10	0.87932	D	0	-21.0128	19.3034	0.94151	0.0:1.0:0.0:0.0	.	400	Q7Z6R9	AP2D_HUMAN	I	400	ENSP00000008391:T400I	ENSP00000008391:T400I	T	+	2	0	TFAP2D	50848376	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.577000	0.86979	0.467000	0.42956	ACA	.	.		0.458	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
EYS	346007	hgsc.bcm.edu	37	6	65707487	65707487	+	Missense_Mutation	SNP	T	T	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:65707487T>G	ENST00000370621.3	-	14	2773	c.2247A>C	c.(2245-2247)aaA>aaC	p.K749N	EYS_ENST00000503581.1_Missense_Mutation_p.K749N|EYS_ENST00000370616.2_Missense_Mutation_p.K749N			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	749	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GATGCAGGTCTTTGCAGGTAG	0.398																																					p.K749N		Atlas-SNP	.											.	EYS	527	.	0			c.A2247C						.						128.0	101.0	109.0					6																	65707487		692	1591	2283	SO:0001583	missense	346007	exon14			CAGGTCTTTGCAG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2247A>C	chr6.hg19:g.65707487T>G	ENSP00000359655:p.Lys749Asn	220.0	0.0		251.0	36.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	T	6.608	0.480623	0.12581	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.88431	-2.38;-2.38;-2.38	5.5	4.3	0.51218	.	0.769944	0.10661	N	0.648727	T	0.68851	0.3046	N	0.13352	0.335	0.54753	D	0.999987	P	0.49090	0.919	P	0.45506	0.483	T	0.64050	-0.6498	10	0.25751	T	0.34	.	4.6221	0.12460	0.3205:0.0814:0.0:0.5981	.	749	Q5T1H1-1	.	N	749	ENSP00000424243:K749N;ENSP00000359655:K749N;ENSP00000359650:K749N	ENSP00000359650:K749N	K	-	3	2	EYS	65764208	0.998000	0.40836	0.003000	0.11579	0.720000	0.41350	3.163000	0.50763	0.878000	0.35920	0.533000	0.62120	AAA	.	.		0.398	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
SMAP1	60682	hgsc.bcm.edu	37	6	71546688	71546688	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:71546688C>T	ENST00000370455.3	+	7	869	c.621C>T	c.(619-621)agC>agT	p.S207S	SMAP1_ENST00000370452.3_Silent_p.S180S|SMAP1_ENST00000316999.5_Silent_p.S180S	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	207					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						AAAGTACCAGCCCTAAAAAAG	0.323																																					p.S207S		Atlas-SNP	.											.	SMAP1	77	.	0			c.C621T						.						40.0	43.0	42.0					6																	71546688		2203	4300	6503	SO:0001819	synonymous_variant	60682	exon7			TACCAGCCCTAAA	AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.621C>T	chr6.hg19:g.71546688C>T		316.0	1.0		446.0	152.0	NM_001044305	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Silent	SNP	ENST00000370455.3	hg19	CCDS43478.1	.	.	.	.	.	.	.	.	.	.	C	0.347	-0.946911	0.02304	.	.	ENSG00000112305	ENST00000439432	.	.	.	5.12	3.28	0.37604	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34502	-0.9826	4	.	.	.	-25.5792	5.5114	0.16882	0.1832:0.6566:0.0:0.1602	.	.	.	.	S	82	.	.	P	+	1	0	SMAP1	71603409	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	2.741000	0.47426	1.257000	0.44085	0.655000	0.94253	CCC	.	.		0.323	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041149.1	NM_001044305	
SYNCRIP	10492	hgsc.bcm.edu	37	6	86350164	86350164	+	Splice_Site	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:86350164C>T	ENST00000369622.3	-	3	767	c.267G>A	c.(265-267)caG>caA	p.Q89Q	SYNCRIP_ENST00000355238.6_Splice_Site_p.Q89Q	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	89					cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		TTAACATTACCTGAACATGAG	0.289																																					p.Q89Q		Atlas-SNP	.											.	SYNCRIP	80	.	0			c.G267A						.						88.0	88.0	88.0					6																	86350164		2203	4298	6501	SO:0001630	splice_region_variant	10492	exon3			CATTACCTGAACA	AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.267+1G>A	chr6.hg19:g.86350164C>T		92.0	0.0		93.0	54.0	NM_006372	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Silent	SNP	ENST00000369622.3	hg19	CCDS5005.1																																																																																			.	.		0.289	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372	Silent
MMS22L	253714	hgsc.bcm.edu	37	6	97681837	97681837	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:97681837T>C	ENST00000275053.4	-	12	1467	c.1202A>G	c.(1201-1203)cAa>cGa	p.Q401R	MMS22L_ENST00000369251.2_Intron	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	401					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CATTCGTAATTGTTCTTCTAG	0.328																																					p.Q401R		Atlas-SNP	.											.	MMS22L	102	.	0			c.A1202G						.						93.0	96.0	95.0					6																	97681837		2203	4298	6501	SO:0001583	missense	253714	exon12			CGTAATTGTTCTT		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.1202A>G	chr6.hg19:g.97681837T>C	ENSP00000275053:p.Gln401Arg	208.0	0.0		202.0	83.0	NM_198468	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	hg19	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.018412	0.54576	.	.	ENSG00000146263	ENST00000275053;ENST00000510018	T;T	0.35236	1.32;1.32	5.39	5.39	0.77823	.	0.130571	0.52532	D	0.000062	T	0.21590	0.0520	M	0.64997	1.995	0.80722	D	1	P	0.35656	0.514	B	0.30855	0.121	T	0.04427	-1.0952	10	0.27082	T	0.32	-6.1107	15.6977	0.77512	0.0:0.0:0.0:1.0	.	401	Q6ZRQ5	MMS22_HUMAN	R	401;289	ENSP00000275053:Q401R;ENSP00000427288:Q289R	ENSP00000275053:Q401R	Q	-	2	0	MMS22L	97788558	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.212000	0.65225	2.169000	0.68431	0.533000	0.62120	CAA	.	.		0.328	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
ASCC3	10973	hgsc.bcm.edu	37	6	101247376	101247376	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:101247376T>C	ENST00000369162.2	-	7	1544	c.1200A>G	c.(1198-1200)atA>atG	p.I400M	ASCC3_ENST00000522650.1_Missense_Mutation_p.I400M	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	400					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GGGGATAATGTATTTTTTCAA	0.383																																					p.I400M		Atlas-SNP	.											.	ASCC3	205	.	0			c.A1200G						.						131.0	130.0	130.0					6																	101247376		2202	4300	6502	SO:0001583	missense	10973	exon7			ATAATGTATTTTT	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.1200A>G	chr6.hg19:g.101247376T>C	ENSP00000358159:p.Ile400Met	39.0	0.0		48.0	24.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	hg19	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	T	10.87	1.473820	0.26423	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	T;T	0.58506	0.45;0.33	5.32	-7.77	0.01227	.	0.258915	0.37669	N	0.001993	T	0.28863	0.0716	L	0.36672	1.1	0.80722	D	1	D;P	0.54047	0.964;0.855	P;B	0.53912	0.737;0.143	T	0.51309	-0.8722	10	0.45353	T	0.12	.	0.579	0.00709	0.3995:0.1501:0.1667:0.2837	.	400;400	E7EW23;Q8N3C0	.;HELC1_HUMAN	M	400	ENSP00000358159:I400M;ENSP00000430769:I400M	ENSP00000358159:I400M	I	-	3	3	ASCC3	101354097	1.000000	0.71417	0.592000	0.28758	0.221000	0.24807	0.661000	0.25023	-0.975000	0.03546	0.383000	0.25322	ATA	.	.		0.383	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
FBXO5	26271	hgsc.bcm.edu	37	6	153296638	153296638	+	Silent	SNP	G	G	A	rs143943044		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:153296638G>A	ENST00000229758.3	-	2	280	c.222C>T	c.(220-222)taC>taT	p.Y74Y	FBXO5_ENST00000477822.1_5'Flank|FBXO5_ENST00000367241.3_Silent_p.Y28Y	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5	74					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		ATGCAGGGGTGTAGGAAACTA	0.403																																					p.Y74Y	NSCLC(121;372 1757 17721 17977 29669)	Atlas-SNP	.											.	FBXO5	40	.	0			c.C222T						.	G	,	2,4404	4.2+/-10.8	0,2,2201	113.0	117.0	115.0		84,222	-2.2	0.0	6	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	FBXO5	NM_001142522.1,NM_012177.3	,	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	,	28/402,74/448	153296638	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	26271	exon2			AGGGGTGTAGGAA	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.222C>T	chr6.hg19:g.153296638G>A		72.0	0.0		87.0	24.0	NM_012177	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	Silent	SNP	ENST00000229758.3	hg19	CCDS5242.1																																																																																			.	G|1.000;A|0.000		0.403	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042757.1		
ZDHHC14	79683	hgsc.bcm.edu	37	6	158014023	158014023	+	Missense_Mutation	SNP	T	T	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:158014023T>A	ENST00000359775.5	+	3	1299	c.410T>A	c.(409-411)aTc>aAc	p.I137N	ZDHHC14_ENST00000341375.8_3'UTR|ZDHHC14_ENST00000414563.2_Missense_Mutation_p.I137N			Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14	137					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	17		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		TCCACAGATATCGCAAACGGC	0.572																																					p.I137N		Atlas-SNP	.											.	ZDHHC14	39	.	0			c.T410A						.						76.0	76.0	76.0					6																	158014023		2203	4296	6499	SO:0001583	missense	79683	exon3			CAGATATCGCAAA	AF542388	CCDS5252.1, CCDS47510.1	6q25.3	2008-05-02			ENSG00000175048	ENSG00000175048		"""Zinc fingers, DHHC-type"""	20341	protein-coding gene	gene with protein product							Standard	NM_024630		Approved	FLJ20984, NEW1CP	uc003qqt.3	Q8IZN3	OTTHUMG00000015896	ENST00000359775.5:c.410T>A	chr6.hg19:g.158014023T>A	ENSP00000352821:p.Ile137Asn	170.0	0.0		167.0	21.0	NM_024630	A6NDB7|Q5JS07|Q5JS08|Q6PHS4|Q8IZN2|Q9H7F1	Missense_Mutation	SNP	ENST00000359775.5	hg19	CCDS5252.1	.	.	.	.	.	.	.	.	.	.	T	13.30	2.197250	0.38806	.	.	ENSG00000175048	ENST00000359775;ENST00000414563;ENST00000538483	T;T	0.23552	1.9;1.9	5.71	5.71	0.89125	.	0.226100	0.31358	N	0.007799	T	0.06962	0.0177	N	0.05050	-0.12	0.25921	N	0.983111	B;P;B	0.38455	0.001;0.632;0.015	B;B;B	0.41764	0.012;0.366;0.026	T	0.42666	-0.9438	10	0.38643	T	0.18	-18.6663	15.9869	0.80160	0.0:0.0:0.0:1.0	.	141;137;137	A4FVA9;Q8IZN3;Q8IZN3-2	.;ZDH14_HUMAN;.	N	137;137;141	ENSP00000352821:I137N;ENSP00000410713:I137N	ENSP00000352821:I137N	I	+	2	0	ZDHHC14	157934011	1.000000	0.71417	0.293000	0.24932	0.726000	0.41606	3.821000	0.55700	-0.685000	0.05177	-0.140000	0.14226	ATC	.	.		0.572	ZDHHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042841.2	NM_153746	
FAM120B	84498	hgsc.bcm.edu	37	6	170697398	170697398	+	Silent	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:170697398C>A	ENST00000476287.1	+	7	2415	c.2307C>A	c.(2305-2307)gcC>gcA	p.A769A	FAM120B_ENST00000537664.1_Silent_p.A792A|FAM120B_ENST00000252510.9_Silent_p.A101A|FAM120B_ENST00000540480.1_Silent_p.A781A	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	769					cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		ACCCCAGAGCCGTGCAGCTGG	0.537																																					p.A769A		Atlas-SNP	.											.	FAM120B	108	.	0			c.C2307A						.						65.0	56.0	59.0					6																	170697398		2203	4300	6503	SO:0001819	synonymous_variant	84498	exon7			CAGAGCCGTGCAG	AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.2307C>A	chr6.hg19:g.170697398C>A		88.0	0.0		84.0	13.0	NM_032448	B4DL34|Q86V68|Q96JI9	Silent	SNP	ENST00000476287.1	hg19	CCDS5314.1																																																																																			.	.		0.537	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000043259.2	NM_032448	
TNRC18	84629	hgsc.bcm.edu	37	7	5427704	5427704	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:5427704G>A	ENST00000430969.1	-	5	2099	c.1751C>T	c.(1750-1752)gCc>gTc	p.A584V	TNRC18_ENST00000399537.4_Missense_Mutation_p.A584V	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	584							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCTCTGCATGGCCGAGGCCTC	0.687																																					p.A584V		Atlas-SNP	.											.	TNRC18	311	.	0			c.C1751T						.						6.0	8.0	8.0					7																	5427704		1916	4044	5960	SO:0001583	missense	84629	exon5			TGCATGGCCGAGG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.1751C>T	chr7.hg19:g.5427704G>A	ENSP00000395538:p.Ala584Val	100.0	0.0		161.0	44.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	g	16.63	3.176940	0.57692	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.45668	0.91;0.89	4.81	4.81	0.61882	.	.	.	.	.	T	0.61763	0.2373	M	0.63843	1.955	0.45822	D	0.998694	D	0.76494	0.999	D	0.66084	0.941	T	0.66658	-0.5868	9	0.87932	D	0	.	17.921	0.88966	0.0:0.0:1.0:0.0	.	584	O15417	TNC18_HUMAN	V	584	ENSP00000382452:A584V;ENSP00000395538:A584V	ENSP00000382452:A584V	A	-	2	0	TNRC18	5394230	1.000000	0.71417	0.998000	0.56505	0.906000	0.53458	8.654000	0.91092	2.217000	0.71921	0.550000	0.68814	GCC	.	.		0.687	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
OSBPL3	26031	hgsc.bcm.edu	37	7	24859857	24859857	+	Splice_Site	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:24859857C>T	ENST00000313367.2	-	17	2336	c.1885G>A	c.(1885-1887)Gtc>Atc	p.V629I	OSBPL3_ENST00000353930.1_Splice_Site_p.V593I|OSBPL3_ENST00000352860.1_Splice_Site_p.V598I|OSBPL3_ENST00000396431.1_Splice_Site_p.V598I|OSBPL3_ENST00000396429.1_Splice_Site_p.V593I|OSBPL3_ENST00000409069.1_Splice_Site_p.V562I|OSBPL3_ENST00000431825.2_Splice_Site_p.V562I	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	629					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						TGGTGGCTGACCTGATGGAAA	0.398											OREG0017898	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V629I		Atlas-SNP	.											.	OSBPL3	100	.	0			c.G1885A						.						93.0	86.0	89.0					7																	24859857		2203	4300	6503	SO:0001630	splice_region_variant	26031	exon17			GGCTGACCTGATG	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.1885-1G>A	chr7.hg19:g.24859857C>T		417.0	1.0	774	524.0	159.0	NM_015550	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Missense_Mutation	SNP	ENST00000313367.2	hg19	CCDS5390.1	.	.	.	.	.	.	.	.	.	.	C	34	5.407932	0.96051	.	.	ENSG00000070882	ENST00000313367;ENST00000352860;ENST00000353930;ENST00000431825;ENST00000396431;ENST00000396429;ENST00000409069	T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.69	5.69	0.88448	Oxysterol-binding protein, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.78817	0.4343	M	0.88241	2.94	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;0.999	T	0.82184	-0.0583	10	0.87932	D	0	-16.6111	19.8097	0.96542	0.0:1.0:0.0:0.0	.	562;598;593;629	Q9H4L5-4;Q9H4L5-2;Q9H4L5-3;Q9H4L5	.;.;.;OSBL3_HUMAN	I	629;598;593;562;598;593;562	ENSP00000315410:V629I;ENSP00000315331:V598I;ENSP00000315277:V593I;ENSP00000389779:V562I;ENSP00000379708:V598I;ENSP00000379706:V593I;ENSP00000386953:V562I	ENSP00000315410:V629I	V	-	1	0	OSBPL3	24826382	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.744000	0.85034	2.685000	0.91497	0.484000	0.47621	GTC	.	.		0.398	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		Missense_Mutation
ADCYAP1R1	117	hgsc.bcm.edu	37	7	31123783	31123783	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:31123783C>T	ENST00000304166.4	+	7	645	c.356C>T	c.(355-357)aCg>aTg	p.T119M	ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.T119M|ADCYAP1R1_ENST00000409363.1_Missense_Mutation_p.T98M|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.T119M	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	119					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						CGGAACTGCACGGAGGATGGC	0.498																																					p.T119M	Ovarian(44;225 1186 2158 11092)	Atlas-SNP	.											.	ADCYAP1R1	78	.	0			c.C356T						.						168.0	162.0	164.0					7																	31123783		2203	4300	6503	SO:0001583	missense	117	exon7			ACTGCACGGAGGA		CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.356C>T	chr7.hg19:g.31123783C>T	ENSP00000306620:p.Thr119Met	127.0	0.0		140.0	26.0	NM_001118	A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	ENST00000304166.4	hg19	CCDS5433.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.004655	0.74932	.	.	ENSG00000078549	ENST00000304166;ENST00000409363;ENST00000396211;ENST00000409489	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.66	5.66	0.87406	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.85682	D	0.000000	D	0.83492	0.5266	M	0.82716	2.605	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.997;0.998	D;D;D;D;D	0.97110	0.998;1.0;1.0;0.923;0.957	D	0.85565	0.1230	10	0.87932	D	0	.	17.2566	0.87059	0.0:1.0:0.0:0.0	.	119;119;119;98;119	B7ZLA7;Q17S10;E9PFU5;B8ZZK3;P41586	.;.;.;.;PACR_HUMAN	M	119;98;119;119	ENSP00000306620:T119M;ENSP00000387335:T98M;ENSP00000379514:T119M;ENSP00000386395:T119M	ENSP00000306620:T119M	T	+	2	0	ADCYAP1R1	31090308	1.000000	0.71417	0.961000	0.40146	0.428000	0.31595	7.429000	0.80309	2.653000	0.90120	0.563000	0.77884	ACG	.	.		0.498	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215041.3	NM_001118	
GLI3	2737	hgsc.bcm.edu	37	7	42017310	42017310	+	Silent	SNP	G	G	A	rs532041527	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:42017310G>A	ENST00000395925.3	-	12	1743	c.1659C>T	c.(1657-1659)tgC>tgT	p.C553C	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	553					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						AGGCCTTTGTGCAACCTTCAA	0.448									Pallister-Hall syndrome;Greig Cephalopolysyndactyly		OREG0018015	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	2	0.000399361	0.0	0.0	5008	,	,		21019	0.0		0.0	False		,,,				2504	0.002				p.C553C		Atlas-SNP	.											.	GLI3	312	.	0			c.C1659T						.						202.0	170.0	181.0					7																	42017310		2203	4300	6503	SO:0001819	synonymous_variant	2737	exon12	Familial Cancer Database	;	CTTTGTGCAACCT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1659C>T	chr7.hg19:g.42017310G>A		174.0	0.0	905	177.0	49.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Silent	SNP	ENST00000395925.3	hg19	CCDS5465.1																																																																																			.	.		0.448	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
PKD1L1	168507	hgsc.bcm.edu	37	7	47925412	47925412	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:47925412G>A	ENST00000289672.2	-	18	3127	c.3077C>T	c.(3076-3078)gCa>gTa	p.A1026V		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1026	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCCCAGGACTGCAGAGTCCCC	0.617																																					p.A1026V		Atlas-SNP	.											.	PKD1L1	328	.	0			c.C3077T						.						71.0	79.0	76.0					7																	47925412		2203	4300	6503	SO:0001583	missense	168507	exon18			AGGACTGCAGAGT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.3077C>T	chr7.hg19:g.47925412G>A	ENSP00000289672:p.Ala1026Val	108.0	0.0		134.0	47.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	hg19	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	7.805	0.714549	0.15306	.	.	ENSG00000158683	ENST00000289672	T	0.21932	1.98	4.78	-1.15	0.09709	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);	2586.730000	0.00166	N	0.000000	T	0.20941	0.0504	L	0.53249	1.67	0.09310	N	1	B	0.14805	0.011	B	0.22386	0.039	T	0.14671	-1.0464	10	0.29301	T	0.29	0.093	4.2287	0.10592	0.4096:0.0:0.436:0.1544	.	1026	Q8TDX9	PK1L1_HUMAN	V	1026	ENSP00000289672:A1026V	ENSP00000289672:A1026V	A	-	2	0	PKD1L1	47891937	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.794000	0.26958	-0.470000	0.06901	-0.931000	0.02705	GCA	.	.		0.617	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
CLDN4	1364	hgsc.bcm.edu	37	7	73245764	73245764	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:73245764A>G	ENST00000435050.1	+	2	2913	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	CLDN4_ENST00000340958.2_Missense_Mutation_p.Q78R|CLDN4_ENST00000431918.1_Missense_Mutation_p.Q78R			O14493	CLD4_HUMAN	claudin 4	78	Interaction with EPHA2.				calcium-independent cell-cell adhesion (GO:0016338)|establishment of skin barrier (GO:0061436)|female pregnancy (GO:0007565)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basal plasma membrane (GO:0009925)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)|transmembrane signaling receptor activity (GO:0004888)			kidney(2)|lung(4)|urinary_tract(1)	7		Lung NSC(55;0.159)				CAGGACCTGCAGGCGGCCCGC	0.637																																					p.Q78R		Atlas-SNP	.											.	CLDN4	10	.	0			c.A233G						.						78.0	70.0	73.0					7																	73245764		2203	4300	6503	SO:0001583	missense	1364	exon1			ACCTGCAGGCGGC	AB000712	CCDS5560.1	7q11.23	2008-07-18			ENSG00000189143	ENSG00000189143		"""Claudins"""	2046	protein-coding gene	gene with protein product	"""Clostridium perfringens enterotoxin receptor 1"", ""Williams-Beuren syndrome chromosomal region 8 protein"""	602909		CPETR, CPETR1		9334247, 9892664	Standard	NM_001305		Approved	CPE-R, WBSCR8, hCPE-R	uc003tzi.4	O14493	OTTHUMG00000023425	ENST00000435050.1:c.233A>G	chr7.hg19:g.73245764A>G	ENSP00000409544:p.Gln78Arg	79.0	0.0		112.0	5.0	NM_001305		Missense_Mutation	SNP	ENST00000435050.1	hg19	CCDS5560.1	.	.	.	.	.	.	.	.	.	.	A	33	5.262208	0.95368	.	.	ENSG00000189143	ENST00000435050;ENST00000431918;ENST00000340958;ENST00000543176	D;D;D	0.89746	-2.56;-2.56;-2.56	5.37	5.37	0.77165	.	0.055575	0.64402	D	0.000001	D	0.94159	0.8126	M	0.86028	2.79	0.53688	D	0.999978	D	0.65815	0.995	D	0.64595	0.927	D	0.94904	0.8059	10	0.87932	D	0	.	13.3146	0.60399	1.0:0.0:0.0:0.0	.	78	O14493	CLD4_HUMAN	R	78;78;78;65	ENSP00000409544:Q78R;ENSP00000388639:Q78R;ENSP00000342445:Q78R	ENSP00000342445:Q78R	Q	+	2	0	CLDN4	72883700	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.045000	0.60652	0.459000	0.35465	CAG	.	.		0.637	CLDN4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348030.1	NM_001305	
TRRAP	8295	hgsc.bcm.edu	37	7	98528292	98528292	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:98528292C>T	ENST00000359863.4	+	25	3639	c.3430C>T	c.(3430-3432)Cgc>Tgc	p.R1144C	TRRAP_ENST00000355540.3_Missense_Mutation_p.R1144C|TRRAP_ENST00000446306.3_Missense_Mutation_p.R1143C	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1144					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CATCGTGGAGCGCCTGTGTGC	0.488																																					p.R1144C		Atlas-SNP	.											.	TRRAP	863	.	0			c.C3430T						.						175.0	174.0	175.0					7																	98528292		2203	4300	6503	SO:0001583	missense	8295	exon25			GTGGAGCGCCTGT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3430C>T	chr7.hg19:g.98528292C>T	ENSP00000352925:p.Arg1144Cys	81.0	0.0		89.0	32.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	hg19	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.043468	0.93685	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.64618	3.56;-0.11	5.53	5.53	0.82687	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78078	0.4227	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70716	0.966;0.91;0.97	T	0.79077	-0.1951	10	0.87932	D	0	.	19.8174	0.96576	0.0:1.0:0.0:0.0	.	1144;858;1144	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	C	1144;1144;1142	ENSP00000352925:R1144C;ENSP00000347733:R1144C	ENSP00000347733:R1144C	R	+	1	0	TRRAP	98366228	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	7.772000	0.85439	2.757000	0.94681	0.591000	0.81541	CGC	.	.		0.488	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
ZNF394	84124	hgsc.bcm.edu	37	7	99092121	99092121	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:99092121A>G	ENST00000337673.6	-	3	920	c.717T>C	c.(715-717)caT>caC	p.H239H	ZNF789_ENST00000494186.1_Intron|ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000426306.2_3'UTR|ZNF394_ENST00000394177.3_5'Flank	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	239					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CCCTGTCCTCATGGGTACTGC	0.498																																					p.H239H	Ovarian(24;589 697 9939 12704 40742)	Atlas-SNP	.											.	ZNF394	48	.	0			c.T717C						.						95.0	96.0	96.0					7																	99092121		2203	4300	6503	SO:0001819	synonymous_variant	84124	exon3			GTCCTCATGGGTA	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.717T>C	chr7.hg19:g.99092121A>G		45.0	0.0		64.0	17.0	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Silent	SNP	ENST00000337673.6	hg19	CCDS5666.1																																																																																			.	.		0.498	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
PRKAR2B	5577	hgsc.bcm.edu	37	7	106685627	106685627	+	Missense_Mutation	SNP	A	A	C	rs368313660		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:106685627A>C	ENST00000265717.4	+	1	534	c.275A>C	c.(274-276)gAg>gCg	p.E92A		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	92	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						GAGGAGGAGGAGGCGGCGCCC	0.756													A|||	1	0.000199681	0.0008	0.0	5008	,	,		8914	0.0		0.0	False		,,,				2504	0.0				p.E92A		Atlas-SNP	.											.	PRKAR2B	34	.	0			c.A275C						.	A	ALA/GLU	1,3291		0,1,1645	2.0	2.0	2.0		275	4.3	1.0	7		2	0,6650		0,0,3325	no	missense	PRKAR2B	NM_002736.2	107	0,1,4970	CC,CA,AA		0.0,0.0304,0.0101	benign	92/419	106685627	1,9941	1646	3325	4971	SO:0001583	missense	5577	exon1			AGGAGGAGGCGGC		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.275A>C	chr7.hg19:g.106685627A>C	ENSP00000265717:p.Glu92Ala	85.0	0.0		111.0	40.0	NM_002736	A4D0R9	Missense_Mutation	SNP	ENST00000265717.4	hg19	CCDS5740.1	.	.	.	.	.	.	.	.	.	.	A	18.81	3.703735	0.68501	3.04E-4	0.0	ENSG00000005249	ENST00000265717;ENST00000543645;ENST00000539794	D	0.82167	-1.58	4.29	4.29	0.51040	.	0.372936	0.27797	N	0.017808	T	0.73737	0.3625	L	0.32530	0.975	0.51482	D	0.999921	P	0.46987	0.888	B	0.38985	0.287	T	0.75673	-0.3236	10	0.42905	T	0.14	-8.6524	13.2761	0.60188	1.0:0.0:0.0:0.0	.	92	P31323	KAP3_HUMAN	A	92;92;79	ENSP00000265717:E92A	ENSP00000265717:E92A	E	+	2	0	PRKAR2B	106472863	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.232000	0.58645	1.813000	0.52934	0.379000	0.24179	GAG	.	.		0.756	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268386.1		
HBP1	26959	hgsc.bcm.edu	37	7	106840668	106840668	+	Silent	SNP	C	C	T	rs538604670		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:106840668C>T	ENST00000222574.4	+	10	1635	c.1449C>T	c.(1447-1449)taC>taT	p.Y483Y	HBP1_ENST00000461963.1_3'UTR|HBP1_ENST00000468410.1_Silent_p.Y483Y|HBP1_ENST00000485846.1_Silent_p.Y483Y	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	483					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						GAAGAATGTACACATTAGAAG	0.358																																					p.Y493Y		Atlas-SNP	.											.	HBP1	31	.	0			c.C1479T						.						132.0	123.0	126.0					7																	106840668		2203	4300	6503	SO:0001819	synonymous_variant	26959	exon10			AATGTACACATTA	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.1449C>T	chr7.hg19:g.106840668C>T		137.0	0.0		202.0	47.0	NM_001244262	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Silent	SNP	ENST00000222574.4	hg19	CCDS5741.1																																																																																			.	.		0.358	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
HYAL4	23553	hgsc.bcm.edu	37	7	123509038	123509038	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:123509038C>T	ENST00000223026.4	+	3	1349	c.711C>T	c.(709-711)tgC>tgT	p.C237C	HYAL4_ENST00000476325.1_Silent_p.C237C	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	237					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						CTGGGTCATGCCCAGAAGACG	0.448																																					p.C237C		Atlas-SNP	.											.	HYAL4	65	.	0			c.C711T						.						79.0	83.0	81.0					7																	123509038		2203	4300	6503	SO:0001819	synonymous_variant	23553	exon3			GTCATGCCCAGAA	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.711C>T	chr7.hg19:g.123509038C>T		125.0	0.0		123.0	14.0	NM_012269	D0VXG1|Q9UL99|Q9Y6T9	Silent	SNP	ENST00000223026.4	hg19	CCDS5789.1																																																																																			.	.		0.448	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348545.1	NM_012269	
SLC35B4	84912	hgsc.bcm.edu	37	7	133979689	133979689	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:133979689G>A	ENST00000378509.4	-	10	1191	c.892C>T	c.(892-894)Ctg>Ttg	p.L298L	SLC35B4_ENST00000466599.1_5'UTR	NM_032826.4	NP_116215.1	Q969S0	S35B4_HUMAN	solute carrier family 35 (UDP-xylose/UDP-N-acetylglucosamine transporter), member B4	298					carbohydrate transport (GO:0008643)|regulation of gluconeogenesis (GO:0006111)|transmembrane transport (GO:0055085)|UDP-N-acetylglucosamine transport (GO:0015788)|UDP-xylose transport (GO:0015790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-N-acetylglucosamine transmembrane transporter activity (GO:0005462)|UDP-xylose transmembrane transporter activity (GO:0005464)			large_intestine(1)|lung(2)|skin(1)|stomach(1)	5						AAGGTGCCCAGCCAGTGCCAC	0.517																																					p.L298L		Atlas-SNP	.											.	SLC35B4	19	.	0			c.C892T						.						153.0	139.0	143.0					7																	133979689		2203	4300	6503	SO:0001819	synonymous_variant	84912	exon10			TGCCCAGCCAGTG	AB052892	CCDS34756.1	7q33	2013-07-17	2013-07-17		ENSG00000205060	ENSG00000205060		"""Solute carriers"""	20584	protein-coding gene	gene with protein product		610923	"""solute carrier family 35, member B4"""				Standard	NM_032826		Approved	FLJ14697, YEA4	uc003vrn.3	Q969S0	OTTHUMG00000155321	ENST00000378509.4:c.892C>T	chr7.hg19:g.133979689G>A		116.0	0.0		119.0	32.0	NM_032826	A4D1P3|A6NNS4|Q53GQ7|Q8TCU7|Q96K33	Silent	SNP	ENST00000378509.4	hg19	CCDS34756.1																																																																																			.	.		0.517	SLC35B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339444.2	NM_032826	
DOK2	9046	hgsc.bcm.edu	37	8	21767272	21767272	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:21767272C>T	ENST00000276420.4	-	5	1047	c.789G>A	c.(787-789)tcG>tcA	p.S263S	DOK2_ENST00000544659.1_Silent_p.S109S	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	263	Pro-rich.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		GCCGGGGCAGCGACGCGGGGA	0.662																																					p.S263S		Atlas-SNP	.											.	DOK2	51	.	0			c.G789A						.						49.0	57.0	54.0					8																	21767272		2203	4299	6502	SO:0001819	synonymous_variant	9046	exon5			GGGCAGCGACGCG	AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.789G>A	chr8.hg19:g.21767272C>T		55.0	0.0		30.0	10.0	NM_003974	Q8N5A4	Silent	SNP	ENST00000276420.4	hg19	CCDS6016.1																																																																																			.	.		0.662	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253735.3	NM_003974	
HR	55806	hgsc.bcm.edu	37	8	21976493	21976493	+	Silent	SNP	G	G	A	rs371739727		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:21976493G>A	ENST00000381418.4	-	16	4663	c.3183C>T	c.(3181-3183)gaC>gaT	p.D1061D	HR_ENST00000312841.8_Silent_p.D1061D	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	1061	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		TGCGCTGGGCGTCCTGTGCCC	0.677																																					p.D1061D		Atlas-SNP	.											HR,NS,carcinoma,0,1	HR	71	.	0			c.C3183T						.	G	,	0,4406		0,0,2203	42.0	47.0	45.0		3183,3183	1.0	1.0	8		45	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	HR	NM_005144.4,NM_018411.4	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	1061/1190,1061/1135	21976493	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55806	exon16			CTGGGCGTCCTGT	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.3183C>T	chr8.hg19:g.21976493G>A		182.0	1.0		129.0	48.0	NM_018411	Q6GS30|Q96H33|Q9NPE1	Silent	SNP	ENST00000381418.4	hg19	CCDS6022.1																																																																																			.	.		0.677	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
PURG	29942	hgsc.bcm.edu	37	8	30889771	30889771	+	Silent	SNP	G	G	A	rs11574152	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:30889771G>A	ENST00000475541.1	-	1	1460	c.528C>T	c.(526-528)atC>atT	p.I176I	WRN_ENST00000298139.5_5'Flank|PURG_ENST00000339382.2_Silent_p.I176I	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	176						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		TGTCCCTCTCGATATAGTCTG	0.527																																					p.I176I		Atlas-SNP	.											.	PURG	79	.	0			c.C528T						.						73.0	76.0	75.0					8																	30889771		2203	4300	6503	SO:0001819	synonymous_variant	29942	exon1			CCTCTCGATATAG	AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.528C>T	chr8.hg19:g.30889771G>A		70.0	0.0		58.0	16.0	NM_013357	Q8TE64	Silent	SNP	ENST00000475541.1	hg19	CCDS6081.1																																																																																			.	G|0.999;T|0.001		0.527	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348565.1	NM_013357	
TTI2	80185	hgsc.bcm.edu	37	8	33357912	33357912	+	Silent	SNP	G	G	A	rs145192530		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:33357912G>A	ENST00000431156.2	-	7	1974	c.1356C>T	c.(1354-1356)agC>agT	p.S452S	MAK16_ENST00000360128.6_3'UTR|TTI2_ENST00000360742.5_Silent_p.S452S|TTI2_ENST00000520636.1_Silent_p.S421S|TTI2_ENST00000519356.1_5'UTR	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	452																	GTAGCAGGGCGCTCTTAACAG	0.512																																					p.S452S		Atlas-SNP	.											.	.	.	.	0			c.C1356T						.	G	,,	1,4405	2.1+/-5.4	0,1,2202	102.0	88.0	93.0		1356,1356,	-10.5	0.0	8	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,utr-3	TTI2,MAK16	NM_001102401.1,NM_025115.2,NM_032509.3	,,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,,	452/509,452/509,	33357912	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	80185	exon7			CAGGGCGCTCTTA	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1356C>T	chr8.hg19:g.33357912G>A		87.0	0.0		86.0	42.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Silent	SNP	ENST00000431156.2	hg19	CCDS6090.1																																																																																			.	G|1.000;A|0.000		0.512	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
IKBKB	3551	hgsc.bcm.edu	37	8	42178286	42178286	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:42178286A>G	ENST00000520810.1	+	16	1798	c.1612A>G	c.(1612-1614)Atg>Gtg	p.M538V	IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000416505.2_Missense_Mutation_p.M479V|IKBKB_ENST00000379708.3_Missense_Mutation_p.M315V|IKBKB_ENST00000520835.1_Missense_Mutation_p.M536V	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	538					B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	AGAACGGATGATGGCTCTGCA	0.567																																					p.M538V		Atlas-SNP	.											.	IKBKB	88	.	0			c.A1612G						.						92.0	94.0	93.0					8																	42178286		2203	4300	6503	SO:0001583	missense	3551	exon16			CGGATGATGGCTC	AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.1612A>G	chr8.hg19:g.42178286A>G	ENSP00000430684:p.Met538Val	83.0	0.0		101.0	12.0	NM_001556	B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	ENST00000520810.1	hg19	CCDS6128.1	.	.	.	.	.	.	.	.	.	.	A	12.96	2.094800	0.36952	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.41026	0.1141	L	0.51422	1.61	0.49213	D	0.999766	D;P;D;B	0.54964	0.969;0.537;0.969;0.22	D;B;D;B	0.63381	0.914;0.219;0.914;0.074	T	0.09751	-1.0660	10	0.19147	T	0.46	.	15.1344	0.72552	1.0:0.0:0.0:0.0	.	479;536;315;538	B4E0U4;O14920-2;B3KRB7;O14920	.;.;.;IKKB_HUMAN	V	538;479;536;315	ENSP00000430684:M538V;ENSP00000404920:M479V;ENSP00000430868:M536V;ENSP00000369030:M315V	ENSP00000369030:M315V	M	+	1	0	IKBKB	42297443	1.000000	0.71417	1.000000	0.80357	0.160000	0.22226	4.907000	0.63300	2.059000	0.61396	0.379000	0.24179	ATG	.	.		0.567	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377214.1		
SNAI2	6591	hgsc.bcm.edu	37	8	49832741	49832741	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:49832741T>C	ENST00000396822.1	-	3	696	c.339A>G	c.(337-339)ctA>ctG	p.L113L	SNAI2_ENST00000020945.1_Silent_p.L113L			O43623	SNAI2_HUMAN	snail family zinc finger 2	113					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GCTTGGACTGTAGTCTTTCCT	0.483																																					p.L113L		Atlas-SNP	.											.	SNAI2	53	.	0			c.A339G						.						164.0	158.0	160.0					8																	49832741		2203	4300	6503	SO:0001819	synonymous_variant	6591	exon2			GGACTGTAGTCTT	U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.339A>G	chr8.hg19:g.49832741T>C		160.0	0.0		190.0	43.0	NM_003068	B2R6P6|Q53FC1	Silent	SNP	ENST00000396822.1	hg19	CCDS6146.1																																																																																			.	.		0.483	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313873.2	NM_003068	
MCMDC2	157777	hgsc.bcm.edu	37	8	67796211	67796211	+	Missense_Mutation	SNP	A	A	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:67796211A>T	ENST00000422365.2	+	9	1226	c.1055A>T	c.(1054-1056)gAt>gTt	p.D352V	MCMDC2_ENST00000541540.1_Missense_Mutation_p.D289V|MCMDC2_ENST00000492775.1_Missense_Mutation_p.D352V|MCMDC2_ENST00000313616.5_Missense_Mutation_p.D352V|MCMDC2_ENST00000396592.3_Missense_Mutation_p.D352V	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	352					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						ATAACAAGTGATACTCTACTC	0.333																																					p.D352V		Atlas-SNP	.											.	MCMDC2	84	.	0			c.A1055T						.						48.0	49.0	49.0					8																	67796211		2203	4300	6503	SO:0001583	missense	157777	exon9			CAAGTGATACTCT	BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.1055A>T	chr8.hg19:g.67796211A>T	ENSP00000413632:p.Asp352Val	50.0	0.0		77.0	13.0	NM_173518	B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Missense_Mutation	SNP	ENST00000422365.2	hg19	CCDS6197.2	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109835	0.77096	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000492775;ENST00000313616;ENST00000541540	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.59418	0.2192	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	T	0.63152	-0.6701	10	0.87932	D	0	-14.3958	15.8218	0.78654	1.0:0.0:0.0:0.0	.	289;352;352;352	Q4G0Z9-4;Q4G0Z9;B4DXX4;G3XAN3	.;CH045_HUMAN;.;.	V	224;352;352;352;352;289	ENSP00000379837:D352V;ENSP00000413632:D352V;ENSP00000428037:D352V;ENSP00000317234:D352V;ENSP00000445629:D289V	ENSP00000317234:D352V	D	+	2	0	C8orf45	67958765	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	8.271000	0.89883	2.201000	0.70794	0.533000	0.62120	GAT	.	.		0.333	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347350.1	NM_173518	
ARFGEF1	10565	hgsc.bcm.edu	37	8	68151115	68151115	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:68151115G>A	ENST00000262215.3	-	21	3382	c.2993C>T	c.(2992-2994)gCa>gTa	p.A998V	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.A452V|ARFGEF1_ENST00000518230.1_5'Flank	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	998					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CTGGACATATGCATCTCTCTC	0.358																																					p.A998V		Atlas-SNP	.											.	ARFGEF1	196	.	0			c.C2993T						.						128.0	113.0	118.0					8																	68151115		2203	4300	6503	SO:0001583	missense	10565	exon21			ACATATGCATCTC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.2993C>T	chr8.hg19:g.68151115G>A	ENSP00000262215:p.Ala998Val	69.0	0.0		124.0	14.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	hg19	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	G	32	5.170752	0.94807	.	.	ENSG00000066777	ENST00000520381;ENST00000262215	T;T	0.64618	-0.11;0.6	5.32	5.32	0.75619	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83298	0.5224	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.957	D	0.86269	0.1660	10	0.87932	D	0	.	19.3677	0.94471	0.0:0.0:1.0:0.0	.	998;452	Q9Y6D6;E5RIF2	BIG1_HUMAN;.	V	452;998	ENSP00000428429:A452V;ENSP00000262215:A998V	ENSP00000262215:A998V	A	-	2	0	ARFGEF1	68313669	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.800000	0.99124	2.628000	0.89032	0.650000	0.86243	GCA	.	.		0.358	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
EYA1	2138	hgsc.bcm.edu	37	8	72267025	72267025	+	Missense_Mutation	SNP	C	C	T	rs267601985		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:72267025C>T	ENST00000340726.3	-	3	755	c.116G>A	c.(115-117)gGc>gAc	p.G39D	EYA1_ENST00000388743.2_Missense_Mutation_p.G39D|EYA1_ENST00000303824.7_Missense_Mutation_p.G39D|EYA1_ENST00000388740.3_Intron|EYA1_ENST00000388742.4_Missense_Mutation_p.G39D|EYA1_ENST00000419131.1_Missense_Mutation_p.G39D|EYA1_ENST00000388741.2_Intron	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	39					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)	p.G39D(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			ACCTTCGGTGCCATTGGGAGT	0.438																																					p.G39D		Atlas-SNP	.											EYA1,NS,carcinoma,0,1	EYA1	108	.	1	Substitution - Missense(1)	ovary(1)	c.G116A						.						142.0	145.0	144.0					8																	72267025		2203	4300	6503	SO:0001583	missense	2138	exon2			TCGGTGCCATTGG	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.116G>A	chr8.hg19:g.72267025C>T	ENSP00000342626:p.Gly39Asp	103.0	0.0		117.0	17.0	NM_172059	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	ENST00000340726.3	hg19	CCDS34906.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.868080	0.91587	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000303824;ENST00000388743;ENST00000419131	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.77363	0.4119	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	1.0;1.0;0.978	T	0.77699	-0.2490	10	0.66056	D	0.02	-15.8674	19.8144	0.96560	0.0:1.0:0.0:0.0	.	39;39;39	A6NCB9;Q99502;G5E9R4	.;EYA1_HUMAN;.	D	39	ENSP00000373394:G39D;ENSP00000342626:G39D;ENSP00000303221:G39D;ENSP00000373395:G39D;ENSP00000410176:G39D	ENSP00000303221:G39D	G	-	2	0	EYA1	72429579	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.814000	0.86154	2.676000	0.91093	0.650000	0.86243	GGC	.	.		0.438	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
GDAP1	54332	hgsc.bcm.edu	37	8	75276245	75276245	+	Silent	SNP	C	C	T	rs367790253		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:75276245C>T	ENST00000220822.7	+	6	800	c.720C>T	c.(718-720)tgC>tgT	p.C240C	GDAP1_ENST00000521096.1_3'UTR|GDAP1_ENST00000434412.2_Silent_p.C172C	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	240	GST C-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			CTTGGCTCTGCGGTGAATCCT	0.517																																					p.C240C		Atlas-SNP	.											.	GDAP1	36	.	0			c.C720T						.	C	,	0,4406		0,0,2203	54.0	53.0	53.0		516,720	-8.3	0.7	8		53	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GDAP1	NM_001040875.1,NM_018972.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	172/291,240/359	75276245	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54332	exon6			GCTCTGCGGTGAA		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.720C>T	chr8.hg19:g.75276245C>T		140.0	0.0		193.0	22.0	NM_018972	A8K957|E7FJF3|E7FJF4	Silent	SNP	ENST00000220822.7	hg19	CCDS34911.1																																																																																			.	.		0.517	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379061.1	NM_018972	
ZFHX4	79776	hgsc.bcm.edu	37	8	77617094	77617094	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:77617094T>C	ENST00000521891.2	+	2	1219	c.771T>C	c.(769-771)ccT>ccC	p.P257P	ZFHX4_ENST00000455469.2_Silent_p.P257P|ZFHX4_ENST00000518282.1_Silent_p.P257P|ZFHX4_ENST00000050961.6_Silent_p.P257P|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	257					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAGATGTCCCTAACAATGTGG	0.418										HNSCC(33;0.089)																											p.P257P		Atlas-SNP	.											.	ZFHX4	878	.	0			c.T771C						.						182.0	178.0	180.0					8																	77617094		2120	4270	6390	SO:0001819	synonymous_variant	79776	exon2			TGTCCCTAACAAT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.771T>C	chr8.hg19:g.77617094T>C		101.0	0.0		117.0	41.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.		0.418	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZFHX4	79776	hgsc.bcm.edu	37	8	77617133	77617133	+	Silent	SNP	C	C	T	rs369214100	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:77617133C>T	ENST00000521891.2	+	2	1258	c.810C>T	c.(808-810)agC>agT	p.S270S	ZFHX4_ENST00000455469.2_Silent_p.S270S|ZFHX4_ENST00000518282.1_Silent_p.S270S|ZFHX4_ENST00000050961.6_Silent_p.S270S|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTTGTGTTAGCGATGGGAAAA	0.413										HNSCC(33;0.089)			C|||	3	0.000599042	0.0023	0.0	5008	,	,		21803	0.0		0.0	False		,,,				2504	0.0				p.S270S		Atlas-SNP	.											.	ZFHX4	878	.	0			c.C810T						.	C		3,4203		0,3,2100	244.0	237.0	239.0		810	2.5	1.0	8		239	0,8518		0,0,4259	no	coding-synonymous	ZFHX4	NM_024721.4		0,3,6359	TT,TC,CC		0.0,0.0713,0.0236		270/3617	77617133	3,12721	2103	4259	6362	SO:0001819	synonymous_variant	79776	exon2			TGTTAGCGATGGG		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.810C>T	chr8.hg19:g.77617133C>T		109.0	0.0		161.0	7.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.		0.413	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
PAG1	55824	hgsc.bcm.edu	37	8	81897456	81897456	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:81897456G>A	ENST00000220597.4	-	7	1141	c.431C>T	c.(430-432)aCc>aTc	p.T144I		NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	144					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			CGTGAGCATGGTATCCACTGC	0.592																																					p.T144I		Atlas-SNP	.											.	PAG1	39	.	0			c.C431T						.						62.0	61.0	62.0					8																	81897456		2203	4300	6503	SO:0001583	missense	55824	exon7			AGCATGGTATCCA	AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.431C>T	chr8.hg19:g.81897456G>A	ENSP00000220597:p.Thr144Ile	101.0	0.0		139.0	36.0	NM_018440	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	ENST00000220597.4	hg19	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464855	0.26335	.	.	ENSG00000076641	ENST00000220597	.	.	.	5.23	2.36	0.29203	.	0.302345	0.32175	N	0.006466	T	0.32526	0.0832	M	0.62723	1.935	0.09310	N	1	P	0.45078	0.85	B	0.40534	0.332	T	0.21827	-1.0234	9	0.66056	D	0.02	-7.1764	7.2214	0.25990	0.0681:0.1242:0.6788:0.129	.	144	Q9NWQ8	PAG1_HUMAN	I	144	.	ENSP00000220597:T144I	T	-	2	0	PAG1	82060011	0.962000	0.33011	0.670000	0.29842	0.316000	0.28119	2.035000	0.41155	0.244000	0.21351	-0.150000	0.13652	ACC	.	.		0.592	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3	NM_018440	
ZHX2	22882	hgsc.bcm.edu	37	8	123965549	123965549	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:123965549A>G	ENST00000314393.4	+	3	2634	c.1799A>G	c.(1798-1800)aAa>aGa	p.K600R		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	600					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			TCTGGCAAAAAAGGCCAAGAT	0.562																																					p.K600R	Esophageal Squamous(94;1056 1388 11767 13799 49639)	Atlas-SNP	.											.	ZHX2	106	.	0			c.A1799G						.						63.0	63.0	63.0					8																	123965549		2203	4300	6503	SO:0001583	missense	22882	exon3			GCAAAAAAGGCCA	AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.1799A>G	chr8.hg19:g.123965549A>G	ENSP00000314709:p.Lys600Arg	108.0	0.0		162.0	17.0	NM_014943		Missense_Mutation	SNP	ENST00000314393.4	hg19	CCDS6336.1	.	.	.	.	.	.	.	.	.	.	A	5.747	0.322283	0.10900	.	.	ENSG00000178764	ENST00000314393	T	0.17691	2.26	5.41	5.41	0.78517	Homeodomain-like (1);	0.338364	0.31438	N	0.007658	T	0.20129	0.0484	N	0.08118	0	0.50632	D	0.99988	D	0.76494	0.999	D	0.80764	0.994	T	0.22906	-1.0203	10	0.15499	T	0.54	-18.8478	14.1764	0.65544	1.0:0.0:0.0:0.0	.	600	Q9Y6X8	ZHX2_HUMAN	R	600	ENSP00000314709:K600R	ENSP00000314709:K600R	K	+	2	0	ZHX2	124034730	0.998000	0.40836	0.992000	0.48379	0.202000	0.24057	4.212000	0.58514	2.279000	0.76181	0.459000	0.35465	AAA	.	.		0.562	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381709.1	NM_014943	
BAI1	575	hgsc.bcm.edu	37	8	143563066	143563066	+	Silent	SNP	C	C	T	rs376677183		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:143563066C>T	ENST00000517894.1	+	11	3018	c.2124C>T	c.(2122-2124)gaC>gaT	p.D708D	BAI1_ENST00000323289.5_Silent_p.D708D			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	708					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCCCTGGGGACGTACAGGTGG	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		19424	0.001		0.0	False		,,,				2504	0.0				p.D708D		Atlas-SNP	.											.	BAI1	146	.	0			c.C2124T						.	C		0,3942		0,0,1971	34.0	39.0	37.0		2124	-7.6	0.7	8		37	1,8239		0,1,4119	no	coding-synonymous	BAI1	NM_001702.2		0,1,6090	TT,TC,CC		0.0121,0.0,0.0082		708/1585	143563066	1,12181	1971	4120	6091	SO:0001819	synonymous_variant	575	exon10			TGGGGACGTACAG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2124C>T	chr8.hg19:g.143563066C>T		48.0	0.0		76.0	5.0	NM_001702		Silent	SNP	ENST00000517894.1	hg19																																																																																				.	.		0.612	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
BAI1	575	hgsc.bcm.edu	37	8	143599549	143599549	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:143599549C>T	ENST00000517894.1	+	19	3762	c.2868C>T	c.(2866-2868)ggC>ggT	p.G956G	BAI1_ENST00000323289.5_Silent_p.G956G			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	956					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGGGCTGTGGCGTGTCCTCTC	0.637																																					p.G956G		Atlas-SNP	.											BAI1,caecum,carcinoma,0,1	BAI1	146	.	0			c.C2868T						.																																			SO:0001819	synonymous_variant	575	exon18			CTGTGGCGTGTCC	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2868C>T	chr8.hg19:g.143599549C>T		62.0	0.0		100.0	12.0	NM_001702		Silent	SNP	ENST00000517894.1	hg19																																																																																				.	.		0.637	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
ZNF696	79943	hgsc.bcm.edu	37	8	144378780	144378780	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:144378780G>A	ENST00000330143.3	+	3	1344	c.935G>A	c.(934-936)cGc>cAc	p.R312H		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	312				R -> C (in Ref. 1; BAB14850). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CGCGAGCACCGCCGCATCCAC	0.736																																					p.R312H		Atlas-SNP	.											.	ZNF696	18	.	0			c.G935A						.						6.0	8.0	7.0					8																	144378780		1911	3821	5732	SO:0001583	missense	79943	exon3			AGCACCGCCGCAT	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.935G>A	chr8.hg19:g.144378780G>A	ENSP00000328515:p.Arg312His	46.0	0.0		51.0	17.0	NM_030895	A0AVE2	Missense_Mutation	SNP	ENST00000330143.3	hg19	CCDS6399.1	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628239	0.46944	.	.	ENSG00000185730	ENST00000330143	T	0.18502	2.21	2.65	1.75	0.24633	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09335	0.0230	L	0.39566	1.225	0.58432	D	0.999993	P	0.40250	0.709	B	0.30855	0.121	T	0.19095	-1.0316	8	.	.	.	.	3.9547	0.09385	0.3233:0.0:0.6767:0.0	.	312	Q9H7X3	ZN696_HUMAN	H	312	ENSP00000328515:R312H	.	R	+	2	0	ZNF696	144450155	0.000000	0.05858	0.998000	0.56505	0.819000	0.46315	-0.938000	0.03938	1.489000	0.48450	0.551000	0.68910	CGC	.	.		0.736	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
MROH6	642475	hgsc.bcm.edu	37	8	144657636	144657636	+	5'Flank	SNP	C	C	T	rs143442304		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:144657636C>T	ENST00000398882.3	-	0	0				RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000449291.2_Silent_p.T416T|NAPRT1_ENST00000276844.7_Silent_p.T416T|NAPRT1_ENST00000435154.3_Silent_p.T416T|NAPRT1_ENST00000426292.3_Silent_p.T416T|NAPRT1_ENST00000460623.1_5'UTR	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6																		TCCCAGGCAACGTCTGCTTCT	0.662																																					p.T416T		Atlas-SNP	.											.	NAPRT1	47	.	0			c.G1248A						.	C		0,4404		0,0,2202	52.0	59.0	56.0		1248	-9.8	0.0	8	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NAPRT1	NM_145201.4		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		416/539	144657636	1,13003	2202	4300	6502	SO:0001631	upstream_gene_variant	93100	exon10			AGGCAACGTCTGC	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164		chr8.hg19:g.144657636C>T	Exception_encountered	196.0	0.0		301.0	62.0	NM_145201	A8MWB1	Silent	SNP	ENST00000398882.3	hg19	CCDS47928.1																																																																																			.	C|1.000;T|0.000		0.662	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
PPP1R16A	84988	hgsc.bcm.edu	37	8	145724317	145724317	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:145724317C>T	ENST00000292539.4	+	4	1266	c.349C>T	c.(349-351)Cga>Tga	p.R117*	CTD-2517M14.5_ENST00000569326.1_RNA|PPP1R16A_ENST00000435887.1_Nonsense_Mutation_p.R117*|CTD-2517M22.14_ENST00000532766.1_RNA			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	117						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGATGATTTCCGAGAGATGGT	0.647																																					p.R117X		Atlas-SNP	.											PPP1R16A,colon,carcinoma,0,1	PPP1R16A	25	.	0			c.C349T						.						66.0	54.0	58.0					8																	145724317		2203	4300	6503	SO:0001587	stop_gained	84988	exon3			GATTTCCGAGAGA		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.349C>T	chr8.hg19:g.145724317C>T	ENSP00000292539:p.Arg117*	55.0	0.0		82.0	6.0	NM_032902	D3DWM5	Nonsense_Mutation	SNP	ENST00000292539.4	hg19	CCDS6429.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.082493|8.082493	0.98646|0.98646	.|.	.|.	ENSG00000255182|ENSG00000160972	ENST00000527086|ENST00000292539;ENST00000435887	.|.	.|.	.|.	5.0|5.0	3.09|3.09	0.35607|0.35607	.|.	0.386006|0.386006	0.25817|0.25817	N|N	0.028101|0.028101	T|.	0.46464|.	0.1394|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.53337|.	-0.8453|.	5|.	0.87932|0.17369	D|T	0|0.5	.|.	12.0623|12.0623	0.53568|0.53568	0.0:0.4491:0.5509:0.0|0.0:0.4491:0.5509:0.0	.|.	.|.	.|.	.|.	Q|X	41|117	.|.	ENSP00000437304:R41Q|ENSP00000292539:R117X	R|R	-|+	2|1	0|2	CTD-2517M22.14|PPP1R16A	145695125|145695125	0.981000|0.981000	0.34729|0.34729	0.998000|0.998000	0.56505|0.56505	0.885000|0.885000	0.51271|0.51271	2.581000|2.581000	0.46077|0.46077	1.061000|1.061000	0.40601|0.40601	0.462000|0.462000	0.41574|0.41574	CGG|CGA	.	.		0.647	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382459.1	NM_032902	
PPP1R16A	84988	hgsc.bcm.edu	37	8	145727136	145727136	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:145727136T>C	ENST00000292539.4	+	11	2354	c.1437T>C	c.(1435-1437)ccT>ccC	p.P479P	CTD-2517M14.5_ENST00000569326.1_RNA|GPT_ENST00000528431.1_5'Flank|GPT_ENST00000394955.2_5'Flank|PPP1R16A_ENST00000435887.1_Silent_p.P479P|CTD-2517M22.14_ENST00000532766.1_RNA			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	479						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CCGAGAGCCCTGAGACAGCTG	0.697																																					p.P479P		Atlas-SNP	.											.	PPP1R16A	25	.	0			c.T1437C						.						25.0	24.0	24.0					8																	145727136		2162	4268	6430	SO:0001819	synonymous_variant	84988	exon10			GAGCCCTGAGACA		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.1437T>C	chr8.hg19:g.145727136T>C		134.0	0.0		171.0	16.0	NM_032902	D3DWM5	Silent	SNP	ENST00000292539.4	hg19	CCDS6429.1	.	.	.	.	.	.	.	.	.	.	T	5.864	0.343643	0.11126	.	.	ENSG00000160972	ENST00000528430	.	.	.	4.13	-8.26	0.01021	.	.	.	.	.	T	0.13884	0.0336	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.22347	-1.0219	4	.	.	.	.	0.4524	0.00503	0.2289:0.2853:0.2134:0.2724	.	.	.	.	P	147	.	.	L	+	2	0	PPP1R16A	145697944	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.505000	0.00035	-1.318000	0.02289	-1.271000	0.01417	CTG	.	.		0.697	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382459.1	NM_032902	
KCNV2	169522	hgsc.bcm.edu	37	9	2718843	2718843	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:2718843C>T	ENST00000382082.3	+	1	1342	c.1104C>T	c.(1102-1104)agC>agT	p.S368S		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	368					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		CGGTGGGCAGCGTGGGTAAGG	0.662																																					p.S368S		Atlas-SNP	.											.	KCNV2	72	.	0			c.C1104T						.						94.0	80.0	84.0					9																	2718843		2203	4298	6501	SO:0001819	synonymous_variant	169522	exon1			GGGCAGCGTGGGT	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.1104C>T	chr9.hg19:g.2718843C>T		45.0	0.0		48.0	9.0	NM_133497	Q5T6X0	Silent	SNP	ENST00000382082.3	hg19	CCDS6447.1	.	.	.	.	.	.	.	.	.	.	C	5.598	0.295110	0.10622	.	.	ENSG00000168263	ENST00000423608	.	.	.	4.79	-2.35	0.06684	.	.	.	.	.	T	0.54303	0.1850	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57423	-0.7814	5	0.87932	D	0	.	2.9204	0.05767	0.1006:0.2427:0.4078:0.2489	.	.	.	.	C	319	.	ENSP00000409635:R319C	R	+	1	0	KCNV2	2708843	0.998000	0.40836	0.997000	0.53966	0.668000	0.39293	0.311000	0.19380	-0.160000	0.11002	-0.300000	0.09419	CGT	.	.		0.662	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
KDM4C	23081	hgsc.bcm.edu	37	9	7174674	7174674	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:7174674T>C	ENST00000381309.3	+	22	3681	c.3116T>C	c.(3115-3117)gTa>gCa	p.V1039A	KDM4C_ENST00000442236.2_Missense_Mutation_p.V784A|KDM4C_ENST00000428870.2_Missense_Mutation_p.V726A	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	1039			V -> I (in dbSNP:rs913588). {ECO:0000269|PubMed:15489334}.		histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GCCGACCCTGTATACCGCACT	0.468																																					p.V1039A		Atlas-SNP	.											.	KDM4C	186	.	0			c.T3116C						.						165.0	170.0	168.0					9																	7174674		2203	4300	6503	SO:0001583	missense	23081	exon22			ACCCTGTATACCG	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.3116T>C	chr9.hg19:g.7174674T>C	ENSP00000370710:p.Val1039Ala	162.0	0.0		141.0	9.0	NM_015061	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	hg19	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	T	6.736	0.504562	0.12822	.	.	ENSG00000107077	ENST00000381309;ENST00000442236;ENST00000428870	T;T;T	0.34667	1.35;1.35;1.35	5.69	3.16	0.36331	.	0.240620	0.33005	N	0.005393	T	0.14184	0.0343	N	0.08118	0	0.23341	N	0.99787	B;B	0.30406	0.278;0.07	B;B	0.24974	0.057;0.024	T	0.24977	-1.0145	10	0.08599	T	0.76	-13.4956	7.9865	0.30216	0.1135:0.0:0.3183:0.5682	.	784;1039	E7EV17;Q9H3R0	.;KDM4C_HUMAN	A	1039;784;726	ENSP00000370710:V1039A;ENSP00000409353:V784A;ENSP00000405739:V726A	ENSP00000370710:V1039A	V	+	2	0	KDM4C	7164674	0.430000	0.25538	0.997000	0.53966	0.872000	0.50106	1.312000	0.33574	0.942000	0.37525	0.482000	0.46254	GTA	.	.		0.468	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
TOPORS	10210	hgsc.bcm.edu	37	9	32544180	32544180	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:32544180A>G	ENST00000360538.2	-	3	459	c.343T>C	c.(343-345)Tac>Cac	p.Y115H	TOPORS_ENST00000379858.1_Missense_Mutation_p.Y50H	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	115	E3 ubiquitin-protein ligase activity.|Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		CGATCTAAGTAAGACACATTA	0.403																																					p.Y115H		Atlas-SNP	.											.	TOPORS	127	.	0			c.T343C						.						111.0	109.0	110.0					9																	32544180		2203	4300	6503	SO:0001583	missense	10210	exon3			CTAAGTAAGACAC	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.343T>C	chr9.hg19:g.32544180A>G	ENSP00000353735:p.Tyr115His	1704.0	0.0		1442.0	140.0	NM_005802	O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	ENST00000360538.2	hg19	CCDS6527.1	.	.	.	.	.	.	.	.	.	.	A	15.05	2.718341	0.48622	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.67698	-0.28;-0.28	5.6	5.6	0.85130	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.45606	D	0.000341	T	0.43033	0.1229	N	0.03903	-0.33	0.36841	D	0.887385	P	0.41475	0.751	B	0.40375	0.327	T	0.55140	-0.8187	10	0.39692	T	0.17	-12.7378	9.5859	0.39517	0.9205:0.0:0.0795:0.0	.	115	Q9NS56	TOPRS_HUMAN	H	115;50	ENSP00000353735:Y115H;ENSP00000369187:Y50H	ENSP00000353735:Y115H	Y	-	1	0	TOPORS	32534180	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.075000	0.64407	2.263000	0.75096	0.533000	0.62120	TAC	.	.		0.403	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052007.1	NM_005802	
RPP25L	138716	hgsc.bcm.edu	37	9	34611031	34611031	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:34611031C>T	ENST00000297613.4	-	2	543	c.263G>A	c.(262-264)cGt>cAt	p.R88H	RPP25L_ENST00000378959.4_Missense_Mutation_p.R88H|DCTN3_ENST00000479399.1_5'Flank	NM_148179.2	NP_680545.1	Q8N5L8	RP25L_HUMAN	ribonuclease P/MRP 25kDa subunit-like	88						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)										CTGAAGGAAACGTAGCTTGGT	0.622																																					p.R88H		Atlas-SNP	.											.	.	.	.	0			c.G263A						.						64.0	55.0	58.0					9																	34611031		2203	4300	6503	SO:0001583	missense	138716	exon2			AGGAAACGTAGCT	BC032136	CCDS6559.1	9p11.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164967	ENSG00000164967			19909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 23"""	C9orf23		16998185	Standard	NM_148178		Approved	bA296L22.5, MGC29635	uc003zuv.3	Q8N5L8	OTTHUMG00000000443	ENST00000297613.4:c.263G>A	chr9.hg19:g.34611031C>T	ENSP00000297613:p.Arg88His	87.0	0.0		84.0	15.0	NM_148179	D3DRM5	Missense_Mutation	SNP	ENST00000297613.4	hg19	CCDS6559.1	.	.	.	.	.	.	.	.	.	.	C	9.879	1.201092	0.22121	.	.	ENSG00000164967	ENST00000378959;ENST00000297613	.	.	.	4.72	3.74	0.42951	.	0.657220	0.16033	N	0.232780	T	0.24812	0.0602	L	0.27053	0.805	0.21762	N	0.999557	B	0.20671	0.047	B	0.14023	0.01	T	0.09930	-1.0652	9	0.15066	T	0.55	-30.2489	6.9321	0.24447	0.19:0.7091:0.0:0.1009	.	88	Q8N5L8	CI023_HUMAN	H	88	.	ENSP00000297613:R88H	R	-	2	0	C9orf23	34601031	0.001000	0.12720	0.895000	0.35142	0.844000	0.47949	-0.669000	0.05262	2.448000	0.82819	0.643000	0.83706	CGT	.	.		0.622	RPP25L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001130.1	NM_148179	
SHB	6461	hgsc.bcm.edu	37	9	37919975	37919975	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:37919975T>C	ENST00000377707.3	-	6	1938	c.1373A>G	c.(1372-1374)aAa>aGa	p.K458R	RP11-613M10.9_ENST00000540557.1_Intron	NM_003028.2	NP_003019.2	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein B	458	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(4)|lung(1)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)	11		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		TTTGGCCAGTTTCATGTGCAT	0.512																																					p.K458R		Atlas-SNP	.											.	SHB	31	.	0			c.A1373G						.						120.0	122.0	121.0					9																	37919975		1949	4154	6103	SO:0001583	missense	6461	exon6			GCCAGTTTCATGT		CCDS43806.1	9p13.2	2013-09-23	2005-05-24		ENSG00000107338	ENSG00000107338		"""SH2 domain containing"""	10838	protein-coding gene	gene with protein product		600314	"""SHB adaptor protein (a Src homology 2 protein)"", ""SHB (Src homology 2 domain containing) adaptor protein B"""			7713524	Standard	NM_003028		Approved		uc004aax.3	Q15464	OTTHUMG00000019936	ENST00000377707.3:c.1373A>G	chr9.hg19:g.37919975T>C	ENSP00000366936:p.Lys458Arg	99.0	0.0		117.0	25.0	NM_003028	B9EGM0|D3DRQ5|Q504U5|Q5VUM8	Missense_Mutation	SNP	ENST00000377707.3	hg19	CCDS43806.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.431847	0.83776	.	.	ENSG00000107338	ENST00000377707	T	0.57752	0.38	5.51	5.51	0.81932	SH2 motif (4);	0.000000	0.64402	D	0.000008	T	0.55986	0.1955	L	0.31065	0.9	0.80722	D	1	D	0.59767	0.986	P	0.61800	0.894	T	0.51309	-0.8722	10	0.23302	T	0.38	-8.4246	13.5872	0.61937	0.0:0.0:0.0:1.0	.	458	Q15464	SHB_HUMAN	R	458	ENSP00000366936:K458R	ENSP00000366936:K458R	K	-	2	0	SHB	37909975	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.686000	0.84128	2.080000	0.62538	0.533000	0.62120	AAA	.	.		0.512	SHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052490.1		
PRKACG	5568	hgsc.bcm.edu	37	9	71628335	71628335	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:71628335A>G	ENST00000377276.2	-	1	704	c.674T>C	c.(673-675)cTa>cCa	p.L225P		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	225	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GAGCACCCCTAGGGCCCACCA	0.612																																					p.L225P	Esophageal Squamous(110;2236 2623 32146)	Atlas-SNP	.											PRKACG,middle_lobe,carcinoma,0,1	PRKACG	65	.	0			c.T674C						.						66.0	64.0	65.0					9																	71628335		2203	4300	6503	SO:0001583	missense	5568	exon1			ACCCCTAGGGCCC	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.674T>C	chr9.hg19:g.71628335A>G	ENSP00000366488:p.Leu225Pro	82.0	0.0		89.0	12.0	NM_002732	O60850|Q5VZ02|Q86YI1	Missense_Mutation	SNP	ENST00000377276.2	hg19	CCDS6625.1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.479836	0.44044	.	.	ENSG00000165059	ENST00000377276	T	0.11930	2.73	1.16	1.16	0.20824	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.25881	U	0.027688	T	0.46541	0.1398	H	0.98155	4.16	0.52501	D	0.999956	D	0.89917	1.0	D	0.85130	0.997	T	0.48625	-0.9019	10	0.87932	D	0	.	6.0938	0.20008	1.0:0.0:0.0:0.0	.	225	P22612	KAPCG_HUMAN	P	225	ENSP00000366488:L225P	ENSP00000366488:L225P	L	-	2	0	PRKACG	70818155	0.018000	0.18449	0.004000	0.12327	0.004000	0.04260	2.762000	0.47597	0.470000	0.27294	0.460000	0.39030	CTA	.	.		0.612	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052559.1		
SECISBP2	79048	hgsc.bcm.edu	37	9	91940370	91940370	+	Missense_Mutation	SNP	T	T	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:91940370T>G	ENST00000375807.3	+	3	282	c.211T>G	c.(211-213)Ttt>Gtt	p.F71V	SECISBP2_ENST00000534113.2_Missense_Mutation_p.F3V|SECISBP2_ENST00000470305.1_3'UTR|SECISBP2_ENST00000339901.4_Intron	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	71					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						AGACATGGCCTTTGGAGCTTC	0.348																																					p.F71V		Atlas-SNP	.											.	SECISBP2	64	.	0			c.T211G						.						106.0	97.0	100.0					9																	91940370		2203	4300	6503	SO:0001583	missense	79048	exon3			ATGGCCTTTGGAG	AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.211T>G	chr9.hg19:g.91940370T>G	ENSP00000364965:p.Phe71Val	82.0	0.0		91.0	5.0	NM_024077	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	ENST00000375807.3	hg19	CCDS6683.1	.	.	.	.	.	.	.	.	.	.	T	13.51	2.258034	0.39896	.	.	ENSG00000187742	ENST00000375807;ENST00000395669;ENST00000534113	T;T	0.78707	-0.68;-1.2	4.17	3.05	0.35203	.	0.319059	0.27700	N	0.018207	T	0.63034	0.2477	L	0.29908	0.895	0.24874	N	0.992264	P;P;P	0.48407	0.851;0.91;0.851	B;B;B	0.42462	0.253;0.388;0.253	T	0.59984	-0.7351	10	0.66056	D	0.02	-17.5344	4.4782	0.11753	0.0:0.1565:0.1854:0.6581	.	91;71;71	Q59H19;B4DZC7;Q96T21	.;.;SEBP2_HUMAN	V	71;91;3	ENSP00000364965:F71V;ENSP00000436650:F3V	ENSP00000364965:F71V	F	+	1	0	SECISBP2	91130190	0.076000	0.21285	0.970000	0.41538	0.972000	0.66771	0.169000	0.16641	1.879000	0.54435	0.379000	0.24179	TTT	.	.		0.348	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052990.3	NM_024077	
HSD17B3	3293	hgsc.bcm.edu	37	9	99006674	99006674	+	Silent	SNP	C	C	T	rs560518006		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:99006674C>T	ENST00000375263.3	-	9	656	c.609G>A	c.(607-609)gcG>gcA	p.A203A	HSD17B3_ENST00000464104.1_5'UTR|HSD17B3_ENST00000375262.2_Silent_p.A203A|RP11-240L7.4_ENST00000448857.1_RNA	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	203			A -> V (in MPH). {ECO:0000269|PubMed:8075637}.		androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				CGCACACAAACGCCTGGAGCA	0.537																																					p.A203A		Atlas-SNP	.											.	HSD17B3	32	.	0			c.G609A						.						155.0	139.0	144.0					9																	99006674		2203	4300	6503	SO:0001819	synonymous_variant	3293	exon9			CACAAACGCCTGG		CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.609G>A	chr9.hg19:g.99006674C>T		98.0	0.0		70.0	32.0	NM_000197	Q5U0Q6	Silent	SNP	ENST00000375263.3	hg19	CCDS6716.1																																																																																			.	.		0.537	HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053259.1	NM_000197	
TEX10	54881	hgsc.bcm.edu	37	9	103065915	103065915	+	Splice_Site	SNP	G	G	A	rs371930194		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:103065915G>A	ENST00000374902.4	-	14	2851	c.2675C>T	c.(2674-2676)aCg>aTg	p.T892M	TEX10_ENST00000477648.1_5'UTR|TEX10_ENST00000535814.1_Splice_Site_p.T876M	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	892						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		GCTTCTTACCGTGATATTCTT	0.498																																					p.T892M		Atlas-SNP	.											.	TEX10	99	.	0			c.C2675T						.	G	MET/THR,MET/THR	0,4406		0,0,2203	200.0	194.0	196.0		2627,2675	3.9	1.0	9		196	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice,missense-near-splice	TEX10	NM_001161584.1,NM_017746.3	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	876/914,892/930	103065915	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	54881	exon14			CTTACCGTGATAT	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.2676+1C>T	chr9.hg19:g.103065915G>A		173.0	0.0		166.0	26.0	NM_017746	B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	ENST00000374902.4	hg19	CCDS6748.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375314	0.24857	0.0	1.16E-4	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730	.	.	.	6.02	3.89	0.44902	.	0.207319	0.52532	N	0.000077	T	0.26666	0.0652	N	0.11201	0.11	0.80722	D	1	B;B;B	0.22211	0.01;0.066;0.01	B;B;B	0.11329	0.003;0.006;0.003	T	0.07693	-1.0759	9	0.11794	T	0.64	-0.6483	7.3446	0.26656	0.2708:0.0:0.7292:0.0	.	876;760;892	B4DYV2;E7ERG2;Q9NXF1	.;.;TEX10_HUMAN	M	876;892;760	.	ENSP00000364037:T892M	T	-	2	0	TEX10	102105736	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.672000	0.46850	1.572000	0.49736	0.655000	0.94253	ACG	.	.		0.498	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053416.1	NM_017746	Missense_Mutation
DEC1	50514	hgsc.bcm.edu	37	9	118163488	118163488	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:118163488T>C	ENST00000374016.1	+	7	623	c.104T>C	c.(103-105)cTg>cCg	p.L35P		NM_017418.2	NP_059114.1	Q9P2X7	DEC1_HUMAN	deleted in esophageal cancer 1	35					negative regulation of cell proliferation (GO:0008285)					kidney(1)|large_intestine(1)|ovary(1)	3						ACTGATGCCCTGCACAGAGAG	0.473																																					p.L35P		Atlas-SNP	.											.	DEC1	8	.	0			c.T104C						.						121.0	122.0	122.0					9																	118163488		2203	4300	6503	SO:0001583	missense	50514	exon7			ATGCCCTGCACAG	AB022761	CCDS6812.1	9q32	2008-02-05			ENSG00000173077	ENSG00000173077			23658	protein-coding gene	gene with protein product		604767				8603412, 10612805	Standard	NM_017418		Approved	CTS9	uc004bjk.1	Q9P2X7	OTTHUMG00000020549	ENST00000374016.1:c.104T>C	chr9.hg19:g.118163488T>C	ENSP00000363128:p.Leu35Pro	34.0	0.0		61.0	11.0	NM_017418		Missense_Mutation	SNP	ENST00000374016.1	hg19	CCDS6812.1	.	.	.	.	.	.	.	.	.	.	T	7.210	0.595245	0.13875	.	.	ENSG00000173077	ENST00000374016	T	0.60171	0.21	3.57	2.41	0.29592	.	.	.	.	.	T	0.70159	0.3192	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.56366	-0.7991	8	0.87932	D	0	.	6.2152	0.20651	0.2229:0.0:0.0:0.7771	.	35	Q9P2X7	DEC1_HUMAN	P	35	ENSP00000363128:L35P	ENSP00000363128:L35P	L	+	2	0	DEC1	117203309	0.000000	0.05858	0.001000	0.08648	0.253000	0.25986	-0.022000	0.12480	0.722000	0.32252	0.533000	0.62120	CTG	.	.		0.473	DEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053791.1	NM_017418	
COL5A1	1289	hgsc.bcm.edu	37	9	137687112	137687112	+	Missense_Mutation	SNP	C	C	T	rs375600865		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:137687112C>T	ENST00000371817.3	+	34	3164	c.2750C>T	c.(2749-2751)cCg>cTg	p.P917L		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	917	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.P917L(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GTCCAGGGTCCGAGGGGTGAA	0.632																																					p.P917L		Atlas-SNP	.											COL5A1,NS,carcinoma,0,2	COL5A1	323	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.C2750T						.	C	LEU/PRO	0,4406		0,0,2203	82.0	88.0	86.0		2750	4.2	0.9	9		86	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL5A1	NM_000093.3	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	917/1839	137687112	1,13005	2203	4300	6503	SO:0001583	missense	1289	exon34			AGGGTCCGAGGGG	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2750C>T	chr9.hg19:g.137687112C>T	ENSP00000360882:p.Pro917Leu	69.0	0.0		97.0	12.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000058	0.74818	0.0	1.16E-4	ENSG00000130635	ENST00000371817	D	0.96885	-4.16	4.22	4.22	0.49857	.	0.000000	0.64402	U	0.000001	D	0.95847	0.8648	N	0.21448	0.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94278	0.7517	10	0.19147	T	0.46	.	16.5867	0.84729	0.0:1.0:0.0:0.0	.	917	P20908	CO5A1_HUMAN	L	917	ENSP00000360882:P917L	ENSP00000360882:P917L	P	+	2	0	COL5A1	136826933	1.000000	0.71417	0.871000	0.34182	0.700000	0.40528	7.279000	0.78599	1.904000	0.55121	0.297000	0.19635	CCG	.	.		0.632	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
PPP1R26	9858	hgsc.bcm.edu	37	9	138376419	138376419	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:138376419G>A	ENST00000356818.2	+	4	612	c.63G>A	c.(61-63)ccG>ccA	p.P21P	PPP1R26_ENST00000605660.1_Silent_p.P21P|PPP1R26_ENST00000605286.1_Silent_p.P21P|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000604351.1_Silent_p.P21P|PPP1R26_ENST00000401470.3_Silent_p.P21P	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	21					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CCTTTGGCCCGCCAGGGAGCT	0.632																																					p.P21P		Atlas-SNP	.											.	.	.	.	0			c.G63A						.						40.0	47.0	45.0					9																	138376419		2202	4299	6501	SO:0001819	synonymous_variant	9858	exon4			TGGCCCGCCAGGG	AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.63G>A	chr9.hg19:g.138376419G>A		62.0	0.0		77.0	13.0	NM_014811	Q86WU0|Q8WVV0|Q9Y4D3	Silent	SNP	ENST00000356818.2	hg19	CCDS6988.1																																																																																			.	.		0.632	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811	
PPP1R26	9858	hgsc.bcm.edu	37	9	138376561	138376561	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:138376561G>A	ENST00000356818.2	+	4	754	c.205G>A	c.(205-207)Gca>Aca	p.A69T	PPP1R26_ENST00000605660.1_Missense_Mutation_p.A69T|PPP1R26_ENST00000605286.1_Missense_Mutation_p.A69T|PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000604351.1_Missense_Mutation_p.A69T|PPP1R26_ENST00000401470.3_Missense_Mutation_p.A69T	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	69					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TGAGCGCGCCGCACAGAGGGG	0.706																																					p.A69T		Atlas-SNP	.											.	.	.	.	0			c.G205A						.						23.0	28.0	26.0					9																	138376561		2201	4292	6493	SO:0001583	missense	9858	exon4			CGCGCCGCACAGA	AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.205G>A	chr9.hg19:g.138376561G>A	ENSP00000349274:p.Ala69Thr	25.0	0.0		54.0	10.0	NM_014811	Q86WU0|Q8WVV0|Q9Y4D3	Missense_Mutation	SNP	ENST00000356818.2	hg19	CCDS6988.1	.	.	.	.	.	.	.	.	.	.	g	3.118	-0.181271	0.06380	.	.	ENSG00000196422	ENST00000356818;ENST00000401470	T;T	0.61510	0.1;0.1	5.22	-6.15	0.02105	.	0.818482	0.10476	N	0.670191	T	0.30070	0.0753	N	0.14661	0.345	0.09310	N	1	B	0.20261	0.043	B	0.09377	0.004	T	0.37753	-0.9692	10	0.08179	T	0.78	0.1834	10.7556	0.46234	0.6756:0.2272:0.0972:0.0	.	69	Q5T8A7	PPR26_HUMAN	T	69	ENSP00000349274:A69T;ENSP00000385826:A69T	ENSP00000349274:A69T	A	+	1	0	KIAA0649	137516382	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.739000	0.04866	-1.256000	0.02478	-1.865000	0.00557	GCA	.	.		0.706	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054987.1	NM_014811	
NOTCH1	4851	hgsc.bcm.edu	37	9	139405699	139405699	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:139405699G>A	ENST00000277541.6	-	16	2567	c.2492C>T	c.(2491-2493)gCc>gTc	p.A831V		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	831	EGF-like 22. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGCACACGGGGCCAGCACCAC	0.667			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.A831V		Atlas-SNP	.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1	1980	.	0			c.C2492T						.						23.0	30.0	27.0					9																	139405699		2100	4203	6303	SO:0001583	missense	4851	exon16			CACGGGGCCAGCA	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2492C>T	chr9.hg19:g.139405699G>A	ENSP00000277541:p.Ala831Val	57.0	0.0		63.0	20.0	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	hg19	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461636	0.84425	.	.	ENSG00000148400	ENST00000277541	D	0.87491	-2.26	4.63	4.63	0.57726	Epidermal growth factor-like, type 3 (1);	0.060554	0.64402	D	0.000004	D	0.89480	0.6727	L	0.31207	0.915	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.90107	0.4189	10	0.48119	T	0.1	.	16.4616	0.84056	0.0:0.0:1.0:0.0	.	831	P46531	NOTC1_HUMAN	V	831	ENSP00000277541:A831V	ENSP00000277541:A831V	A	-	2	0	NOTCH1	138525520	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	5.008000	0.63991	2.120000	0.65058	0.462000	0.41574	GCC	.	.		0.667	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
FBXW5	54461	hgsc.bcm.edu	37	9	139835867	139835867	+	Silent	SNP	G	G	A	rs372957829		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:139835867G>A	ENST00000325285.3	-	8	1372	c.1293C>T	c.(1291-1293)gcC>gcT	p.A431A	FBXW5_ENST00000483559.1_5'UTR	NM_018998.3	NP_061871.1	Q969U6	FBXW5_HUMAN	F-box and WD repeat domain containing 5	431					centrosome duplication (GO:0051298)|mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.8e-06)|Epithelial(140;0.000106)		GCATGGGGTCGGCCACCACCG	0.701																																					p.A431A		Atlas-SNP	.											.	FBXW5	36	.	0			c.C1293T						.	G		0,4404		0,0,2202	30.0	32.0	32.0		1293	-6.3	0.9	9		32	1,8591		0,1,4295	no	coding-synonymous	FBXW5	NM_018998.2		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		431/567	139835867	1,12995	2202	4296	6498	SO:0001819	synonymous_variant	54461	exon8			GGGGTCGGCCACC	BC014130	CCDS7014.1	9q34.3	2013-01-09	2007-02-08		ENSG00000159069	ENSG00000159069		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13613	protein-coding gene	gene with protein product		609072	"""F-box and WD-40 domain protein 5"""				Standard	NM_018998		Approved	DKFZP434B205, MGC20962, Fbw5	uc004cjx.3	Q969U6	OTTHUMG00000020967	ENST00000325285.3:c.1293C>T	chr9.hg19:g.139835867G>A		42.0	0.0		56.0	10.0	NM_018998	B2RDZ6|Q59ET5|Q5SPZ8|Q5SPZ9|Q5SQ00|Q5SQ02|Q5SQ03|Q5SQ04|Q8WY79|Q96GJ6|Q9BSU8|Q9H6A8|Q9HBQ6|Q9NSZ3	Silent	SNP	ENST00000325285.3	hg19	CCDS7014.1																																																																																			.	.		0.701	FBXW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055227.1	NM_018998	
FUT7	2529	hgsc.bcm.edu	37	9	139925470	139925470	+	Missense_Mutation	SNP	A	A	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:139925470A>T	ENST00000314412.6	-	2	1739	c.721T>A	c.(721-723)Ttc>Atc	p.F241I	ABCA2_ENST00000341511.6_5'Flank|ABCA2_ENST00000265662.5_5'Flank|C9orf139_ENST00000314330.2_Intron|ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000371605.3_5'Flank	NM_004479.3	NP_004470.1	Q11130	FUT7_HUMAN	fucosyltransferase 7 (alpha (1,3) fucosyltransferase)	241					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|leukocyte migration involved in immune response (GO:0002522)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|lung(4)|ovary(1)|skin(1)	8	all_cancers(76;0.0893)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		TTGCGCCAGAATTTCTCCGTA	0.637																																					p.F241I		Atlas-SNP	.											.	FUT7	24	.	0			c.T721A						.						96.0	113.0	107.0					9																	139925470		2202	4299	6501	SO:0001583	missense	2529	exon2			GCCAGAATTTCTC	X78031, AB012668	CCDS7022.1	9q34.3	2013-02-26			ENSG00000180549	ENSG00000180549		"""Fucosyltransferases"""	4018	protein-coding gene	gene with protein product		602030				8207002, 8182079	Standard	NM_004479		Approved		uc004ckq.2	Q11130	OTTHUMG00000020964	ENST00000314412.6:c.721T>A	chr9.hg19:g.139925470A>T	ENSP00000318142:p.Phe241Ile	138.0	0.0		152.0	13.0	NM_004479	B2R7U7|Q6DK54	Missense_Mutation	SNP	ENST00000314412.6	hg19	CCDS7022.1	.	.	.	.	.	.	.	.	.	.	a	12.87	2.066367	0.36470	.	.	ENSG00000180549	ENST00000314412	T	0.27402	1.67	4.68	-0.255	0.12988	.	0.146210	0.47093	U	0.000241	T	0.31482	0.0798	M	0.78223	2.4	0.34904	D	0.746755	B	0.17268	0.021	B	0.23018	0.043	T	0.35276	-0.9795	10	0.72032	D	0.01	-3.2918	8.0478	0.30559	0.4487:0.0:0.5513:0.0	.	241	Q11130	FUT7_HUMAN	I	241	ENSP00000318142:F241I	ENSP00000318142:F241I	F	-	1	0	FUT7	139045291	1.000000	0.71417	1.000000	0.80357	0.333000	0.28666	3.899000	0.56288	0.182000	0.20032	0.370000	0.22315	TTC	.	.		0.637	FUT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055220.1	NM_004479	
ITIH5	80760	hgsc.bcm.edu	37	10	7697622	7697622	+	Missense_Mutation	SNP	G	G	T	rs139355305	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:7697622G>T	ENST00000256861.6	-	2	185	c.107C>A	c.(106-108)cCg>cAg	p.P36Q	ITIH5_ENST00000397146.2_Missense_Mutation_p.P36Q|ITIH5_ENST00000397145.2_Missense_Mutation_p.P36Q|ITIH5_ENST00000446830.2_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	36	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						GACTTGCCTCGGGACCCTGAG	0.403																																					p.P36Q		Atlas-SNP	.											ITIH5_ENST00000397145,right_lower_lobe,carcinoma,0,2	ITIH5	343	.	0			c.C107A						.						81.0	84.0	83.0					10																	7697622		2203	4300	6503	SO:0001583	missense	80760	exon2			TGCCTCGGGACCC			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.107C>A	chr10.hg19:g.7697622G>T	ENSP00000256861:p.Pro36Gln	67.0	0.0		53.0	9.0	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	hg19		.	.	.	.	.	.	.	.	.	.	G	13.53	2.265276	0.40095	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000397145	T;T;T	0.03386	4.6;3.95;3.96	4.76	4.76	0.60689	Vault protein inter-alpha-trypsin (1);	0.473535	0.22228	N	0.062845	T	0.12433	0.0302	.	.	.	0.38942	D	0.958168	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.23940	-1.0174	9	0.19147	T	0.46	-25.5494	13.627	0.62170	0.0:0.0:1.0:0.0	.	36;36	G5E9D8;Q86UX2	.;ITIH5_HUMAN	Q	36	ENSP00000256861:P36Q;ENSP00000380333:P36Q;ENSP00000380332:P36Q	ENSP00000256861:P36Q	P	-	2	0	ITIH5	7737628	0.991000	0.36638	0.936000	0.37596	0.111000	0.19643	4.289000	0.59013	2.355000	0.79922	0.650000	0.86243	CCG	.	G|1.000;A|0.000		0.403	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
CUBN	8029	hgsc.bcm.edu	37	10	17126368	17126368	+	Missense_Mutation	SNP	C	C	T	rs370770104		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:17126368C>T	ENST00000377833.4	-	17	2268	c.2203G>A	c.(2203-2205)Gtc>Atc	p.V735I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	735	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATCATATAGACGCATTGCCTG	0.502																																					p.V735I		Atlas-SNP	.											.	CUBN	515	.	0			c.G2203A						.	C	ILE/VAL	0,4406		0,0,2203	130.0	112.0	118.0		2203	-6.4	0.0	10		118	1,8599	1.2+/-3.3	0,1,4299	no	missense	CUBN	NM_001081.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	735/3624	17126368	1,13005	2203	4300	6503	SO:0001583	missense	8029	exon17			TATAGACGCATTG	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2203G>A	chr10.hg19:g.17126368C>T	ENSP00000367064:p.Val735Ile	134.0	0.0		128.0	18.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.579104	0.00879	0.0	1.16E-4	ENSG00000107611	ENST00000377833	T	0.28895	1.59	5.69	-6.42	0.01932	CUB (5);	0.796683	0.10415	N	0.677428	T	0.13329	0.0323	N	0.11870	0.19	0.80722	D	1	B	0.10296	0.003	B	0.09377	0.004	T	0.47947	-0.9077	10	0.02654	T	1	.	15.8666	0.79069	0.0:0.5151:0.0:0.4849	.	735	O60494	CUBN_HUMAN	I	735	ENSP00000367064:V735I	ENSP00000367064:V735I	V	-	1	0	CUBN	17166374	0.001000	0.12720	0.007000	0.13788	0.009000	0.06853	-0.181000	0.09740	-1.199000	0.02666	-1.648000	0.00760	GTC	.	.		0.502	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
HNRNPF	3185	hgsc.bcm.edu	37	10	43883054	43883054	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:43883054C>T	ENST00000544000.1	-	4	686	c.279G>A	c.(277-279)atG>atA	p.M93I	HNRNPF_ENST00000337970.3_Missense_Mutation_p.M93I|HNRNPF_ENST00000357065.4_Missense_Mutation_p.M93I|HNRNPF_ENST00000498176.1_5'Flank|HNRNPF_ENST00000443950.2_Missense_Mutation_p.M93I|HNRNPF_ENST00000356053.3_Missense_Mutation_p.M93I	NM_001098207.1	NP_001091677.1	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	93					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|urinary_tract(1)	19						ACACCCAATCCATCTCGGTTC	0.502																																					p.M93I		Atlas-SNP	.											.	HNRNPF	57	.	0			c.G279A						.						193.0	149.0	164.0					10																	43883054		2203	4300	6503	SO:0001583	missense	3185	exon4			CCAATCCATCTCG		CCDS7204.1	10q11.21	2013-02-12		2008-04-18	ENSG00000169813	ENSG00000169813		"""RNA binding motif (RRM) containing"""	5039	protein-coding gene	gene with protein product		601037		HNRPF		7499401	Standard	NM_001098208		Approved		uc001jas.2	P52597	OTTHUMG00000018029	ENST00000544000.1:c.279G>A	chr10.hg19:g.43883054C>T	ENSP00000438061:p.Met93Ile	72.0	0.0		72.0	29.0	NM_001098204	B3KM84|Q5T0N2|Q96AU2	Missense_Mutation	SNP	ENST00000544000.1	hg19	CCDS7204.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.167713	0.38315	.	.	ENSG00000169813	ENST00000544000;ENST00000443950;ENST00000356053;ENST00000357065;ENST00000337970;ENST00000540544	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	4.04	2.19	0.27852	.	0.076118	0.85682	N	0.000000	T	0.34948	0.0915	M	0.72576	2.205	0.58432	D	0.999993	B	0.19706	0.038	B	0.33690	0.168	T	0.23868	-1.0176	10	0.56958	D	0.05	-12.2548	8.5719	0.33574	0.0:0.8047:0.0:0.1953	.	93	P52597	HNRPF_HUMAN	I	93;93;93;93;93;16	ENSP00000438061:M93I;ENSP00000400433:M93I;ENSP00000348345:M93I;ENSP00000349573:M93I;ENSP00000338477:M93I	ENSP00000338477:M93I	M	-	3	0	HNRNPF	43203060	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.318000	0.65829	0.668000	0.31126	-0.136000	0.14681	ATG	.	.		0.502	HNRNPF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047705.2		
ARHGAP22	58504	hgsc.bcm.edu	37	10	49659075	49659075	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:49659075C>A	ENST00000249601.4	-	9	1393	c.1097G>T	c.(1096-1098)tGc>tTc	p.C366F	ARHGAP22_ENST00000435790.2_Missense_Mutation_p.C372F|ARHGAP22_ENST00000477708.2_Missense_Mutation_p.C199F|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.C382F|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.C207F|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.C257F|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.C276F	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	366					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCCCACTGCGCATTGCAGGCC	0.721																																					p.C382F		Atlas-SNP	.											.	ARHGAP22	94	.	0			c.G1145T						.						8.0	10.0	9.0					10																	49659075		2012	4091	6103	SO:0001583	missense	58504	exon9			ACTGCGCATTGCA	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1097G>T	chr10.hg19:g.49659075C>A	ENSP00000249601:p.Cys366Phe	117.0	0.0		108.0	17.0	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	hg19	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	C	8.408	0.843478	0.16963	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000477708;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T;T	0.24350	2.93;2.61;1.86;2.26;2.6;2.89;2.94	4.95	4.95	0.65309	.	0.347798	0.27749	N	0.018020	T	0.39627	0.1085	M	0.61703	1.905	0.09310	N	1	P;P;P;P;P;D	0.71674	0.592;0.829;0.907;0.899;0.817;0.998	B;B;B;B;P;P	0.58820	0.285;0.332;0.346;0.332;0.477;0.846	T	0.21861	-1.0233	10	0.27785	T	0.31	.	10.9701	0.47434	0.0:0.9091:0.0:0.0909	.	372;366;382;366;276;199	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3;D6R9V6	.;.;.;RHG22_HUMAN;.;.	F	366;257;207;199;276;372;382	ENSP00000249601:C366F;ENSP00000363287:C257F;ENSP00000363285:C207F;ENSP00000422868:C199F;ENSP00000410054:C276F;ENSP00000416701:C372F;ENSP00000412461:C382F	ENSP00000249601:C366F	C	-	2	0	ARHGAP22	49329081	0.928000	0.31464	0.064000	0.19789	0.032000	0.12392	1.901000	0.39838	2.306000	0.77630	0.313000	0.20887	TGC	.	.		0.721	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
OGDHL	55753	hgsc.bcm.edu	37	10	50947771	50947771	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:50947771C>T	ENST00000374103.4	-	17	2340	c.2255G>A	c.(2254-2256)gGc>gAc	p.G752D	OGDHL_ENST00000419399.1_Missense_Mutation_p.G695D|OGDHL_ENST00000432695.1_Missense_Mutation_p.G543D|OGDHL_ENST00000490844.1_5'Flank	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	752					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CTTGGCCTGGCCGGTGCTGAT	0.627																																					p.G752D		Atlas-SNP	.											.	OGDHL	149	.	0			c.G2255A						.						107.0	87.0	94.0					10																	50947771		2203	4300	6503	SO:0001583	missense	55753	exon17			GCCTGGCCGGTGC	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2255G>A	chr10.hg19:g.50947771C>T	ENSP00000363216:p.Gly752Asp	69.0	0.0		65.0	13.0	NM_018245	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	hg19	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690156	0.88735	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.93811	-3.29;-3.29;-3.29	4.48	4.48	0.54585	Transketolase-like, pyrimidine-binding domain (2);	0.056650	0.64402	D	0.000001	D	0.97917	0.9315	H	0.96805	3.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99813	1.1042	10	0.87932	D	0	.	17.1694	0.86825	0.0:1.0:0.0:0.0	.	695;543;752	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	D	752;695;543	ENSP00000363216:G752D;ENSP00000401356:G695D;ENSP00000390240:G543D	ENSP00000363216:G752D	G	-	2	0	OGDHL	50617777	1.000000	0.71417	0.970000	0.41538	0.935000	0.57460	6.060000	0.71141	2.057000	0.61298	0.289000	0.19496	GGC	.	.		0.627	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
SIRT1	23411	hgsc.bcm.edu	37	10	69648662	69648662	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:69648662A>G	ENST00000212015.6	+	3	623	c.570A>G	c.(568-570)caA>caG	p.Q190Q	SIRT1_ENST00000406900.1_5'Flank|SIRT1_ENST00000497639.1_3'UTR|SIRT1_ENST00000432464.1_Intron	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	190	Interaction with CCAR2.|Interaction with HIST1H1E.				angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						TTGTTCAGCAACATCTTATGA	0.358																																					p.Q190Q		Atlas-SNP	.											.	SIRT1	38	.	0			c.A570G						.						138.0	137.0	137.0					10																	69648662		2203	4300	6503	SO:0001819	synonymous_variant	23411	exon3			TCAGCAACATCTT	AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.570A>G	chr10.hg19:g.69648662A>G		59.0	0.0		44.0	12.0	NM_012238	Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Silent	SNP	ENST00000212015.6	hg19	CCDS7273.1																																																																																			.	.		0.358	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048296.1		
LIPK	643414	hgsc.bcm.edu	37	10	90512278	90512278	+	Missense_Mutation	SNP	C	C	T	rs200951684		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:90512278C>T	ENST00000404190.1	+	9	965	c.965C>T	c.(964-966)aCa>aTa	p.T322I		NM_001080518.1	NP_001073987.1	Q5VXJ0	LIPK_HUMAN	lipase, family member K	322					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	12		Colorectal(252;0.0381)		Colorectal(12;7.03e-05)|COAD - Colon adenocarcinoma(12;8.33e-05)		ATTTAGCTTACACCTCCTTTA	0.338																																					p.T322I		Atlas-SNP	.											.	LIPK	50	.	0			c.C965T						.						28.0	25.0	26.0					10																	90512278		1835	4082	5917	SO:0001583	missense	643414	exon9			AGCTTACACCTCC		CCDS44455.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000204021	ENSG00000204021			23444	protein-coding gene	gene with protein product		613922	"""lipase-like, ab-hydrolase domain containing 2"""	LIPL2			Standard	NM_001080518		Approved	bA186O14.2	uc010qmv.2	Q5VXJ0	OTTHUMG00000018693	ENST00000404190.1:c.965C>T	chr10.hg19:g.90512278C>T	ENSP00000383900:p.Thr322Ile	82.0	0.0		86.0	17.0	NM_001080518	A7KIH8	Missense_Mutation	SNP	ENST00000404190.1	hg19	CCDS44455.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675558	0.29783	.	.	ENSG00000204021	ENST00000404190	T	0.61742	0.08	5.65	1.75	0.24633	Alpha/beta hydrolase fold-1 (1);	0.437153	0.21888	N	0.067627	T	0.60222	0.2252	M	0.81942	2.565	0.09310	N	1	P	0.36354	0.549	B	0.42214	0.38	T	0.52823	-0.8524	10	0.38643	T	0.18	-5.2805	8.9719	0.35912	0.0:0.6962:0.0:0.3038	.	322	Q5VXJ0	LIPK_HUMAN	I	322	ENSP00000383900:T322I	ENSP00000383900:T322I	T	+	2	0	LIPK	90502258	0.035000	0.19736	0.060000	0.19600	0.533000	0.34776	0.869000	0.27996	0.503000	0.28060	-0.140000	0.14226	ACA	.	.		0.338	LIPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049253.2	XM_061222	
TCTN3	26123	hgsc.bcm.edu	37	10	97453178	97453178	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:97453178G>A	ENST00000371217.5	-	2	335	c.312C>T	c.(310-312)tgC>tgT	p.C104C	TCTN3_ENST00000430368.2_Silent_p.C104C|TCTN3_ENST00000371209.5_Silent_p.C104C|TCTN3_ENST00000265993.9_Silent_p.C122C			Q6NUS6	TECT3_HUMAN	tectonic family member 3	104	Cys-rich.				apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		CCCTGTCGCAGCAGCAATTTA	0.498											OREG0020392	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C104C		Atlas-SNP	.											.	TCTN3	66	.	0			c.C312T						.						98.0	89.0	92.0					10																	97453178		692	1591	2283	SO:0001819	synonymous_variant	26123	exon2			GTCGCAGCAGCAA	AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.312C>T	chr10.hg19:g.97453178G>A		176.0	0.0	1328	168.0	21.0	NM_015631	A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Silent	SNP	ENST00000371217.5	hg19	CCDS31258.2	.	.	.	.	.	.	.	.	.	.	G	12.15	1.850868	0.32699	.	.	ENSG00000119977	ENST00000424175	.	.	.	5.92	4.06	0.47325	.	.	.	.	.	T	0.59770	0.2218	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57528	-0.7796	4	.	.	.	-17.8507	9.562	0.39376	0.1656:0.0:0.8344:0.0	.	.	.	.	V	84	.	.	A	-	2	0	TCTN3	97443168	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.732000	0.47352	1.520000	0.48965	0.655000	0.94253	GCT	.	.		0.498	TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000471858.1	NM_015631	
CNNM1	26507	hgsc.bcm.edu	37	10	101089165	101089165	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:101089165G>A	ENST00000356713.4	+	1	310	c.21G>A	c.(19-21)gcG>gcA	p.A7A	CNNM1_ENST00000370534.4_5'Flank|CNNM1_ENST00000446890.1_Silent_p.A7A|CNNM1_ENST00000370528.3_Silent_p.A7A	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	7					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		ccgcggcggcggcagcagcgg	0.721																																					p.A7A		Atlas-SNP	.											.	CNNM1	101	.	0			c.G21A						.						2.0	2.0	2.0					10																	101089165		1032	2150	3182	SO:0001819	synonymous_variant	26507	exon1			GGCGGCGGCAGCA	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.21G>A	chr10.hg19:g.101089165G>A		38.0	0.0		43.0	16.0	NM_020348	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Silent	SNP	ENST00000356713.4	hg19	CCDS7478.2																																																																																			.	.		0.721	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049792.2	NM_020348	
FAM178A	55719	hgsc.bcm.edu	37	10	102684351	102684351	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:102684351C>T	ENST00000238961.4	+	5	2135	c.1593C>T	c.(1591-1593)gcC>gcT	p.A531A	FAM178A_ENST00000370269.3_Silent_p.A531A|FAM178A_ENST00000370271.3_Silent_p.A531A	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	531						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											CTAATAAGGCCGATTCTAATG	0.423																																					p.A531A		Atlas-SNP	.											.	FAM178A	9	.	0			c.C1593T						.						98.0	99.0	99.0					10																	102684351		2203	4300	6503	SO:0001819	synonymous_variant	55719	exon5			TAAGGCCGATTCT	AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.1593C>T	chr10.hg19:g.102684351C>T		182.0	0.0		135.0	18.0	NM_001136123	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Silent	SNP	ENST00000238961.4	hg19	CCDS7500.1																																																																																			.	.		0.423	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049897.3		
PSD	5662	hgsc.bcm.edu	37	10	104171962	104171962	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:104171962C>T	ENST00000020673.5	-	7	2297	c.1771G>A	c.(1771-1773)Gct>Act	p.A591T	PSD_ENST00000406432.1_Missense_Mutation_p.A591T	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	591	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		TACTCCCCAGCCACCAGTTTG	0.592																																					p.A591T		Atlas-SNP	.											.	PSD	164	.	0			c.G1771A						.						135.0	155.0	148.0					10																	104171962		2203	4300	6503	SO:0001583	missense	5662	exon8			CCCCAGCCACCAG	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1771G>A	chr10.hg19:g.104171962C>T	ENSP00000020673:p.Ala591Thr	94.0	0.0		99.0	35.0	NM_001270965	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	hg19	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	C	35	5.499076	0.96355	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.54479	0.57;0.57	5.32	5.32	0.75619	SEC7-like (4);	0.059561	0.64402	D	0.000003	T	0.79435	0.4445	M	0.91510	3.215	0.54753	D	0.999985	D	0.71674	0.998	D	0.79108	0.992	D	0.84350	0.0532	10	0.87932	D	0	.	18.9992	0.92826	0.0:1.0:0.0:0.0	.	591	A5PKW4	PSD1_HUMAN	T	591;494;591	ENSP00000020673:A591T;ENSP00000384830:A591T	ENSP00000020673:A591T	A	-	1	0	PSD	104161952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.434000	0.80377	2.500000	0.84329	0.561000	0.74099	GCT	.	.		0.592	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
CYP17A1	1586	hgsc.bcm.edu	37	10	104595102	104595102	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:104595102A>G	ENST00000369887.3	-	2	516	c.345T>C	c.(343-345)gcT>gcC	p.A115A	CYP17A1-AS1_ENST00000369884.4_RNA|CYP17A1_ENST00000489268.1_5'UTR	NM_000102.3	NP_000093.1	P05093	CP17A_HUMAN	cytochrome P450, family 17, subfamily A, polypeptide 1	115					adrenal gland development (GO:0030325)|androgen biosynthetic process (GO:0006702)|biphenyl metabolic process (GO:0018879)|cellular response to antibiotic (GO:0071236)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to lipopolysaccharide (GO:0071222)|dibenzo-p-dioxin metabolic process (GO:0018894)|glucocorticoid biosynthetic process (GO:0006704)|hippocampus development (GO:0021766)|hormone biosynthetic process (GO:0042446)|Leydig cell differentiation (GO:0033327)|ovulation (GO:0030728)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|progesterone metabolic process (GO:0042448)|response to acetate (GO:0010034)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to herbicide (GO:0009635)|response to insecticide (GO:0017085)|response to ionizing radiation (GO:0010212)|response to methylmercury (GO:0051597)|response to nutrient levels (GO:0031667)|response to retinoic acid (GO:0032526)|response to steroid hormone (GO:0048545)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	axon (GO:0030424)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)	17-alpha-hydroxyprogesterone aldolase activity (GO:0047442)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|steroid 17-alpha-monooxygenase activity (GO:0004508)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)	Abiraterone(DB05812)|Aminophenazone(DB01424)|Dexamethasone(DB01234)|Metoclopramide(DB01233)|Progesterone(DB00396)	CGCCAGAGTCAGCGAAGGCGA	0.562											OREG0020487	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A115A		Atlas-SNP	.											.	CYP17A1	48	.	0			c.T345C						.						159.0	123.0	135.0					10																	104595102		2203	4300	6503	SO:0001819	synonymous_variant	1586	exon2			AGAGTCAGCGAAG	M19489	CCDS7541.1	10q24.3	2010-05-04	2003-02-14	2003-02-28	ENSG00000148795	ENSG00000148795	1.14.99.9	"""Cytochrome P450s"""	2593	protein-coding gene	gene with protein product	"""Steroid 17-alpha-monooxygenase"""	609300	"""cytochrome P450, subfamily XVII (steroid 17-alpha-hydroxylase), adrenal hyperplasia"""	CYP17		1347802	Standard	NM_000102		Approved	P450C17, CPT7, S17AH	uc001kwg.3	P05093	OTTHUMG00000018969	ENST00000369887.3:c.345T>C	chr10.hg19:g.104595102A>G		115.0	0.0	172	72.0	10.0	NM_000102	Q5TZV7	Silent	SNP	ENST00000369887.3	hg19	CCDS7541.1																																																																																			.	.		0.562	CYP17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050101.1	NM_000102	
NEURL1	9148	hgsc.bcm.edu	37	10	105344832	105344832	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:105344832G>A	ENST00000369780.4	+	4	1598	c.1189G>A	c.(1189-1191)Gac>Aac	p.D397N	NEURL_ENST00000369777.2_Missense_Mutation_p.D380N	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		397	NHR 2. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		GCACAGCGGCGACATCCTGGG	0.726																																					p.D397N		Atlas-SNP	.											.	NEURL	38	.	0			c.G1189A						.						8.0	8.0	8.0					10																	105344832		2092	4146	6238	SO:0001583	missense	9148	exon4			AGCGGCGACATCC																												ENST00000369780.4:c.1189G>A	chr10.hg19:g.105344832G>A	ENSP00000358795:p.Asp397Asn	18.0	0.0		17.0	6.0	NM_004210	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Missense_Mutation	SNP	ENST00000369780.4	hg19	CCDS7551.1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972686	0.92919	.	.	ENSG00000107954	ENST00000369780;ENST00000369777	.	.	.	4.98	4.98	0.66077	NEUZ (2);	0.000000	0.85682	D	0.000000	T	0.77136	0.4086	L	0.59912	1.85	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79619	-0.1728	9	0.72032	D	0.01	-38.4716	18.2474	0.89991	0.0:0.0:1.0:0.0	.	397	O76050	NEU1A_HUMAN	N	397;380	.	ENSP00000358792:D380N	D	+	1	0	NEURL	105334822	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.870000	0.87175	2.310000	0.77875	0.491000	0.48974	GAC	.	.		0.726	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
ACADSB	36	hgsc.bcm.edu	37	10	124812642	124812642	+	Silent	SNP	C	C	T	rs142095937	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:124812642C>T	ENST00000358776.4	+	10	1208	c.1194C>T	c.(1192-1194)taC>taT	p.Y398Y	ACADSB_ENST00000368869.4_Silent_p.Y296Y	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	398					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	CCAAAGATTACCCTGTGGAGA	0.373																																					p.Y398Y		Atlas-SNP	.											.	ACADSB	45	.	0			c.C1194T						.						116.0	111.0	113.0					10																	124812642		2203	4300	6503	SO:0001819	synonymous_variant	36	exon10			AGATTACCCTGTG	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.1194C>T	chr10.hg19:g.124812642C>T		107.0	0.0		113.0	22.0	NM_001609	B4DQ51|Q5SQN6|Q96CX7	Silent	SNP	ENST00000358776.4	hg19	CCDS7634.1																																																																																			.	C|0.999;G|0.001		0.373	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1	NM_001609	
DHX32	55760	hgsc.bcm.edu	37	10	127526922	127526922	+	Nonsense_Mutation	SNP	A	A	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:127526922A>C	ENST00000284690.3	-	10	2406	c.1916T>G	c.(1915-1917)tTa>tGa	p.L639*	DHX32_ENST00000368721.1_Nonsense_Mutation_p.L263*|BCCIP_ENST00000429863.2_Intron|DHX32_ENST00000284688.6_Nonsense_Mutation_p.L558*|BCCIP_ENST00000299130.3_Intron|BCCIP_ENST00000368759.5_Intron	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	639						mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGTCAGCATTAAGTAGTTACC	0.388																																					p.L639X		Atlas-SNP	.											.	DHX32	67	.	0			c.T1916G						.						130.0	120.0	124.0					10																	127526922		2203	4300	6503	SO:0001587	stop_gained	55760	exon10			AGCATTAAGTAGT		CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1916T>G	chr10.hg19:g.127526922A>C	ENSP00000284690:p.Leu639*	65.0	0.0		47.0	21.0	NM_018180	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Nonsense_Mutation	SNP	ENST00000284690.3	hg19	CCDS7652.1	.	.	.	.	.	.	.	.	.	.	A	43	9.834421	0.99275	.	.	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	.	.	.	4.94	4.94	0.65067	.	0.157768	0.43919	D	0.000508	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.9198	13.8068	0.63238	1.0:0.0:0.0:0.0	.	.	.	.	X	263;639;558	.	ENSP00000284688:L558X	L	-	2	0	DHX32	127516912	1.000000	0.71417	0.919000	0.36401	0.978000	0.69477	9.066000	0.93949	1.851000	0.53745	0.459000	0.35465	TTA	.	.		0.388	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050945.2	NM_018180	
DPYSL4	10570	hgsc.bcm.edu	37	10	134012411	134012411	+	Silent	SNP	G	G	A	rs377151543		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:134012411G>A	ENST00000338492.4	+	8	911	c.747G>A	c.(745-747)ccG>ccA	p.P249P	DPYSL4_ENST00000368627.1_Silent_p.P149P|DPYSL4_ENST00000368629.1_Silent_p.P149P	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	249					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CAAACTGCCCGCTGTACGTCA	0.677																																					p.P249P		Atlas-SNP	.											.	DPYSL4	91	.	0			c.G747A						.	G		0,4406		0,0,2203	86.0	71.0	76.0		747	-6.8	0.4	10		76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DPYSL4	NM_006426.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		249/573	134012411	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10570	exon8			CTGCCCGCTGTAC	AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.747G>A	chr10.hg19:g.134012411G>A		158.0	0.0		134.0	28.0	NM_006426	B2RMQ1|D3DRG5|O00240|Q5T0Q7	Silent	SNP	ENST00000338492.4	hg19	CCDS7665.1																																																																																			.	.		0.677	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051050.2		
FUOM	282969	hgsc.bcm.edu	37	10	135168879	135168879	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:135168879G>T	ENST00000368552.3	-	6	477	c.460C>A	c.(460-462)Ctg>Atg	p.L154M	FUOM_ENST00000465384.1_5'UTR|FUOM_ENST00000368551.1_Missense_Mutation_p.L109M|FUOM_ENST00000447176.1_Missense_Mutation_p.L110M|FUOM_ENST00000278025.4_3'UTR	NM_001098483.1	NP_001091953.1	A2VDF0	FUCM_HUMAN	fucose mutarotase	154					female mating behavior (GO:0060180)|fucose metabolic process (GO:0006004)|fucosylation (GO:0036065)|negative regulation of neuron differentiation (GO:0045665)		fucose binding (GO:0042806)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)										CAGGCCTACAGCAGGGGGTTG	0.647																																					p.L154M		Atlas-SNP	.											C10orf125_ENST00000368552,NS,carcinoma,0,1	.	.	.	0			c.C460A						.						20.0	24.0	23.0					10																	135168879		2194	4291	6485	SO:0001583	missense	282969	exon6			CCTACAGCAGGGG	AK129527	CCDS7680.1	10q26.3	2012-07-10	2012-07-10	2012-07-10	ENSG00000148803	ENSG00000148803	5.1.3.n2		24733	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 125"""	C10orf125		17602138	Standard	NM_001098483		Approved	FLJ26016, FucU, FucM	uc001lmt.2	A2VDF0	OTTHUMG00000019315	ENST00000368552.3:c.460C>A	chr10.hg19:g.135168879G>T	ENSP00000357540:p.Leu154Met	66.0	0.0		44.0	17.0	NM_001098483	A1L300|Q5VWY2|Q5VWY3|Q6ZPD2	Missense_Mutation	SNP	ENST00000368552.3	hg19	CCDS44499.1	.	.	.	.	.	.	.	.	.	.	G	10.59	1.393844	0.25205	.	.	ENSG00000148803	ENST00000447176;ENST00000368551;ENST00000368552	.	.	.	3.1	-2.24	0.06909	.	.	.	.	.	T	0.16257	0.0391	N	0.08118	0	0.09310	N	1	B	0.27853	0.191	B	0.30029	0.11	T	0.22208	-1.0223	8	0.52906	T	0.07	.	3.7475	0.08554	0.3047:0.0:0.485:0.2103	.	154	A2VDF0	FUCM_HUMAN	M	110;109;154	.	ENSP00000357539:L109M	L	-	1	2	C10orf125	135018869	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.150000	0.16263	-0.471000	0.06891	-0.373000	0.07131	CTG	.	.		0.647	FUOM-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_198472	
LRRC56	115399	hgsc.bcm.edu	37	11	551775	551775	+	Silent	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:551775C>A	ENST00000270115.7	+	10	1421	c.921C>A	c.(919-921)ggC>ggA	p.G307G		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	307										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCCTGAAGGCCTGCTTTCTG	0.662																																					p.G307G		Atlas-SNP	.											.	LRRC56	23	.	0			c.C921A						.						34.0	41.0	39.0					11																	551775		2200	4299	6499	SO:0001819	synonymous_variant	115399	exon10			TGAAGGCCTGCTT		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.921C>A	chr11.hg19:g.551775C>A		76.0	0.0		97.0	37.0	NM_198075	Q8N3Q4	Silent	SNP	ENST00000270115.7	hg19	CCDS7700.1																																																																																			.	.		0.662	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254969.1	NM_198075	
SCT	6343	hgsc.bcm.edu	37	11	626447	626447	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:626447G>A	ENST00000176195.3	-	4	349	c.350C>T	c.(349-351)aCc>aTc	p.T117I	CDHR5_ENST00000529337.1_5'Flank|CDHR5_ENST00000397542.2_5'Flank|CDHR5_ENST00000349570.7_5'Flank|CDHR5_ENST00000358353.3_5'Flank	NM_021920.2	NP_068739.1	P09683	SECR_HUMAN	secretin	117					dentate gyrus development (GO:0021542)|negative regulation of neuron apoptotic process (GO:0043524)|neuronal stem cell maintenance (GO:0097150)|pancreatic juice secretion (GO:0030157)|visual learning (GO:0008542)	extracellular region (GO:0005576)	hormone activity (GO:0005179)						all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.17e-27)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGCCGCAAGGTTCCTTCTGC	0.677																																					p.T117I		Atlas-SNP	.											.	SCT	4	.	0			c.C350T						.						29.0	25.0	27.0					11																	626447		2156	4234	6390	SO:0001583	missense	6343	exon4			CGCAAGGTTCCTT	AF244355	CCDS7709.1	11p15.5	2013-02-28			ENSG00000070031	ENSG00000070031		"""Endogenous ligands"""	10607	protein-coding gene	gene with protein product	"""prepro-secretin"""	182099				2315322	Standard	NM_021920		Approved		uc001lqo.1	P09683	OTTHUMG00000133313	ENST00000176195.3:c.350C>T	chr11.hg19:g.626447G>A	ENSP00000176195:p.Thr117Ile	315.0	0.0		385.0	45.0	NM_021920		Missense_Mutation	SNP	ENST00000176195.3	hg19	CCDS7709.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491747	0.44249	.	.	ENSG00000070031	ENST00000176195	T	0.50548	0.74	2.21	2.21	0.28008	.	.	.	.	.	T	0.43122	0.1233	L	0.27053	0.805	0.09310	N	1	P	0.52842	0.956	P	0.50270	0.636	T	0.28650	-1.0037	9	0.72032	D	0.01	.	10.5517	0.45092	0.0:0.0:1.0:0.0	.	117	P09683	SECR_HUMAN	I	117	ENSP00000176195:T117I	ENSP00000176195:T117I	T	-	2	0	SCT	616447	0.018000	0.18449	0.002000	0.10522	0.190000	0.23558	2.293000	0.43558	1.593000	0.50029	0.555000	0.69702	ACC	.	.		0.677	SCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257111.3	NM_021920	
OR51I2	390064	hgsc.bcm.edu	37	11	5475291	5475291	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:5475291T>C	ENST00000341449.2	+	1	654	c.573T>C	c.(571-573)gaT>gaC	p.D191D	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	191					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTGTGCTGATATCAGTATCA	0.453																																					p.D191D		Atlas-SNP	.											.	OR51I2	76	.	0			c.T573C						.						305.0	261.0	276.0					11																	5475291		2201	4297	6498	SO:0001819	synonymous_variant	390064	exon1			TGCTGATATCAGT	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.573T>C	chr11.hg19:g.5475291T>C		64.0	0.0		71.0	10.0	NM_001004754	Q6IF81	Silent	SNP	ENST00000341449.2	hg19	CCDS31383.1																																																																																			.	.		0.453	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
OR52E8	390079	hgsc.bcm.edu	37	11	5878052	5878052	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:5878052G>T	ENST00000537935.1	-	1	912	c.881C>A	c.(880-882)cCt>cAt	p.P294H	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATAGATTACAGGATTGAGGGC	0.418																																					p.P294H		Atlas-SNP	.											.	OR52E8	54	.	0			c.C881A						.						100.0	118.0	112.0					11																	5878052		2143	4296	6439	SO:0001583	missense	390079	exon1			ATTACAGGATTGA	BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.881C>A	chr11.hg19:g.5878052G>T	ENSP00000444054:p.Pro294His	134.0	0.0		179.0	23.0	NM_001005168	B9EH38	Missense_Mutation	SNP	ENST00000537935.1	hg19	CCDS31400.1	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595211	0.46318	.	.	ENSG00000183269	ENST00000537935	T	0.64260	-0.09	4.12	4.12	0.48240	GPCR, rhodopsin-like superfamily (1);	0.121233	0.37178	N	0.002206	T	0.80654	0.4664	H	0.97390	3.995	0.43971	D	0.996654	P	0.52842	0.956	P	0.49829	0.623	D	0.88570	0.3129	10	0.87932	D	0	.	15.4396	0.75173	0.0:0.0:1.0:0.0	.	294	Q6IFG1	O52E8_HUMAN	H	294	ENSP00000444054:P294H	ENSP00000444054:P294H	P	-	2	0	OR52E8	5834628	1.000000	0.71417	0.991000	0.47740	0.312000	0.27988	9.094000	0.94168	2.302000	0.77476	0.549000	0.68633	CCT	.	.		0.418	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401145.1	NM_001005168	
OR52L1	338751	hgsc.bcm.edu	37	11	6007754	6007754	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:6007754A>G	ENST00000332249.4	-	1	461	c.407T>C	c.(406-408)aTg>aCg	p.M136T		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCCAGAGCCATGGCCACAAG	0.537																																					p.M136T	Melanoma(121;653 1666 10547 22796 51255)	Atlas-SNP	.											.	OR52L1	100	.	0			c.T407C						.						43.0	44.0	44.0					11																	6007754		2086	4226	6312	SO:0001583	missense	338751	exon1			AGAGCCATGGCCA	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.407T>C	chr11.hg19:g.6007754A>G	ENSP00000330338:p.Met136Thr	93.0	0.0		132.0	13.0	NM_001005173	B2RPA6|Q6IFK9	Missense_Mutation	SNP	ENST00000332249.4	hg19	CCDS44529.1	.	.	.	.	.	.	.	.	.	.	A	14.72	2.620907	0.46736	.	.	ENSG00000183313	ENST00000332249	T	0.00462	7.26	2.97	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000141	T	0.02193	0.0068	H	0.98089	4.145	0.44207	D	0.997032	D	0.55800	0.973	P	0.61201	0.885	T	0.04041	-1.0982	10	0.87932	D	0	.	10.2936	0.43610	1.0:0.0:0.0:0.0	.	136	Q8NGH7	O52L1_HUMAN	T	136	ENSP00000330338:M136T	ENSP00000330338:M136T	M	-	2	0	OR52L1	5964330	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	8.550000	0.90675	1.357000	0.45904	0.260000	0.18958	ATG	.	.		0.537	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383754.1	NM_001005173	
TEAD1	7003	hgsc.bcm.edu	37	11	12883850	12883850	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:12883850A>G	ENST00000527575.1	+	3	369	c.256A>G	c.(256-258)Acc>Gcc	p.T86A	TEAD1_ENST00000527636.1_Missense_Mutation_p.T86A|TEAD1_ENST00000334310.6_Missense_Mutation_p.T71A|TEAD1_ENST00000361985.2_Missense_Mutation_p.T86A|TEAD1_ENST00000361905.4_Missense_Mutation_p.T71A			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	86					gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		CAAGACGAGGACCAGAAAACA	0.448																																					p.T86A		Atlas-SNP	.											.	TEAD1	40	.	0			c.A256G						.						120.0	106.0	111.0					11																	12883850		2200	4294	6494	SO:0001583	missense	7003	exon4			ACGAGGACCAGAA	X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000527575.1:c.256A>G	chr11.hg19:g.12883850A>G	ENSP00000435977:p.Thr86Ala	119.0	0.0		139.0	35.0	NM_021961	A4FUP2|E7EV65	Missense_Mutation	SNP	ENST00000527575.1	hg19		.	.	.	.	.	.	.	.	.	.	A	29.7	5.024988	0.93518	.	.	ENSG00000187079	ENST00000361905;ENST00000527636;ENST00000527575;ENST00000334310;ENST00000361985	T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	M	0.93594	3.435	0.80722	D	1	P	0.36837	0.571	P	0.46208	0.507	T	0.76465	-0.2949	10	0.87932	D	0	.	15.7943	0.78398	1.0:0.0:0.0:0.0	.	86	P28347	TEAD1_HUMAN	A	71;86;86;71;86	ENSP00000355332:T71A;ENSP00000435233:T86A;ENSP00000435977:T86A;ENSP00000334754:T71A;ENSP00000354588:T86A	ENSP00000334754:T71A	T	+	1	0	TEAD1	12840426	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.208000	0.71279	0.533000	0.62120	ACC	.	.		0.448	TEAD1-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000386888.1	NM_021961	
MRGPRX4	117196	hgsc.bcm.edu	37	11	18195145	18195145	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:18195145C>T	ENST00000314254.3	+	1	762	c.342C>T	c.(340-342)agC>agT	p.S114S	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GTATGCTGAGCGCCATCAGCA	0.567																																					p.S114S		Atlas-SNP	.											MRGPRX4,NS,carcinoma,0,1	MRGPRX4	68	.	0			c.C342T						.						129.0	114.0	119.0					11																	18195145		2199	4293	6492	SO:0001819	synonymous_variant	117196	exon1			GCTGAGCGCCATC	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.342C>T	chr11.hg19:g.18195145C>T		69.0	0.0		96.0	12.0	NM_054032	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Silent	SNP	ENST00000314254.3	hg19	CCDS7831.1																																																																																			.	.		0.567	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389788.1	NM_054032	
KCNA4	3739	hgsc.bcm.edu	37	11	30034166	30034166	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:30034166A>G	ENST00000328224.6	-	2	1293	c.60T>C	c.(58-60)ggT>ggC	p.G20G	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	20					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	GGGCAGCATAACCATAAGGCA	0.597																																					p.G20G		Atlas-SNP	.											.	KCNA4	158	.	0			c.T60C						.						72.0	72.0	72.0					11																	30034166		1946	4136	6082	SO:0001819	synonymous_variant	3739	exon2			AGCATAACCATAA	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.60T>C	chr11.hg19:g.30034166A>G		39.0	0.0		41.0	6.0	NM_002233		Silent	SNP	ENST00000328224.6	hg19	CCDS41629.1																																																																																			.	.		0.597	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
HIPK3	10114	hgsc.bcm.edu	37	11	33309022	33309022	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:33309022T>C	ENST00000303296.4	+	2	1367	c.1062T>C	c.(1060-1062)acT>acC	p.T354T	HIPK3_ENST00000456517.1_Silent_p.T354T|HIPK3_ENST00000525975.1_Silent_p.T354T|HIPK3_ENST00000379016.3_Silent_p.T354T	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	354	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						TATCAAAGACTGTTTGTTCAA	0.378																																					p.T354T		Atlas-SNP	.											.,1	HIPK3	92	.	0			c.T1062C						.						102.0	105.0	104.0					11																	33309022		2202	4298	6500	SO:0001819	synonymous_variant	10114	exon2			AAAGACTGTTTGT	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.1062T>C	chr11.hg19:g.33309022T>C		149.0	0.0		162.0	20.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Silent	SNP	ENST00000303296.4	hg19	CCDS7884.1																																																																																			.	.		0.378	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33566862	33566862	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:33566862C>T	ENST00000321505.4	+	2	2612	c.2432C>T	c.(2431-2433)aCg>aTg	p.T811M	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.T817M|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.T817M			Q6ZVL6	K154L_HUMAN	KIAA1549-like	811						integral component of membrane (GO:0016021)											GCAGTGGTCACGACTGGCAAA	0.532																																					p.T811M		Atlas-SNP	.											.	.	.	.	0			c.C2432T						.						34.0	40.0	38.0					11																	33566862		2135	4255	6390	SO:0001583	missense	25758	exon2			TGGTCACGACTGG	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2432C>T	chr11.hg19:g.33566862C>T	ENSP00000315295:p.Thr811Met	63.0	0.0		73.0	18.0	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	hg19	CCDS44565.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.41|11.41	1.630600|1.630600	0.28978|0.28978	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000526400|ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568	.|.	.|.	.|.	5.81|5.81	4.9|4.9	0.64082|0.64082	.|.	.|0.256102	.|0.38058	.|N	.|0.001828	.|T	.|0.56934	.|0.2019	L|L	0.60455|0.60455	1.87|1.87	0.09310|0.09310	N|N	0.999999|0.999999	.|D;D	.|0.89917	.|0.998;1.0	.|P;D	.|0.69824	.|0.732;0.966	.|T	.|0.51068	.|-0.8752	.|9	.|0.56958	.|D	.|0.05	-4.9075|-4.9075	10.223|10.223	0.43209|0.43209	0.0:0.849:0.0:0.151|0.0:0.849:0.0:0.151	.|.	.|817;817	.|E9PAT2;Q6ZVL6-2	.|.;.	X|M	209|811;817;817;650	.|.	.|ENSP00000265654:T817M	R|T	+|+	1|2	2|0	C11orf41|C11orf41	33523438|33523438	0.901000|0.901000	0.30685|0.30685	0.770000|0.770000	0.31555|0.31555	0.006000|0.006000	0.05464|0.05464	1.813000|1.813000	0.38962|0.38962	1.470000|1.470000	0.48102|0.48102	0.561000|0.561000	0.74099|0.74099	CGA|ACG	.	.		0.532	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
AMBRA1	55626	hgsc.bcm.edu	37	11	46456582	46456582	+	Missense_Mutation	SNP	C	C	T	rs377069728		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:46456582C>T	ENST00000458649.2	-	13	3056	c.2638G>A	c.(2638-2640)Gtg>Atg	p.V880M	AMBRA1_ENST00000314845.3_Missense_Mutation_p.V790M|AMBRA1_ENST00000528950.1_Missense_Mutation_p.V851M|AMBRA1_ENST00000298834.3_Missense_Mutation_p.V820M|AMBRA1_ENST00000533727.1_Missense_Mutation_p.V761M|AMBRA1_ENST00000426438.1_Missense_Mutation_p.V851M|AMBRA1_ENST00000534300.1_Missense_Mutation_p.V820M			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	880					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AGCACATTCACGGAAGCTGCA	0.473																																					p.V883M		Atlas-SNP	.											.	AMBRA1	201	.	0			c.G2647A						.	C	MET/VAL	0,4402		0,0,2201	29.0	27.0	28.0		2368	4.1	1.0	11		28	1,8597	1.2+/-3.3	0,1,4298	no	missense	AMBRA1	NM_017749.2	21	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	benign	790/1209	46456582	1,12999	2201	4299	6500	SO:0001583	missense	55626	exon15			CATTCACGGAAGC	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2638G>A	chr11.hg19:g.46456582C>T	ENSP00000415327:p.Val880Met	79.0	0.0		86.0	10.0	NM_001267782	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	hg19		.	.	.	.	.	.	.	.	.	.	C	19.57	3.851865	0.71719	0.0	1.16E-4	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.71817	-0.49;-0.6;-0.19;-0.32;-0.19;-0.34;-0.32	5.95	4.1	0.47936	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.53254	0.1785	N	0.22421	0.69	0.43156	D	0.994933	B;B;B;B;B;B	0.32968	0.174;0.266;0.266;0.392;0.125;0.392	B;B;B;B;B;B	0.26517	0.032;0.07;0.07;0.07;0.027;0.07	T	0.54827	-0.8235	10	0.62326	D	0.03	.	10.3113	0.43710	0.0:0.7991:0.0:0.2009	.	880;851;820;761;883;790	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	M	790;761;820;851;820;880;851	ENSP00000318313:V790M;ENSP00000433372:V761M;ENSP00000431926:V820M;ENSP00000410899:V851M;ENSP00000298834:V820M;ENSP00000415327:V880M;ENSP00000433945:V851M	ENSP00000298834:V820M	V	-	1	0	AMBRA1	46413158	0.985000	0.35326	1.000000	0.80357	0.994000	0.84299	2.622000	0.46427	0.868000	0.35678	-0.137000	0.14449	GTG	.	.		0.473	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
OR4C13	283092	hgsc.bcm.edu	37	11	49974682	49974682	+	Silent	SNP	T	T	C	rs145221317		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:49974682T>C	ENST00000555099.1	+	1	740	c.708T>C	c.(706-708)tcT>tcC	p.S236S		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						AAGCCCTCTCTACCTGTGTCT	0.463																																					p.S236S		Atlas-SNP	.											.	OR4C13	96	.	0			c.T708C						.						181.0	155.0	164.0					11																	49974682		2201	4296	6497	SO:0001819	synonymous_variant	283092	exon1			CCTCTCTACCTGT	AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.708T>C	chr11.hg19:g.49974682T>C		84.0	0.0		94.0	11.0	NM_001001955	A6NJJ3|B9EH30|Q6IF48|Q96R68	Silent	SNP	ENST00000555099.1	hg19	CCDS31495.1																																																																																			.	T|1.000;C|0.000		0.463	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391103.1	NM_001001955	
OR8J3	81168	hgsc.bcm.edu	37	11	55905120	55905120	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:55905120A>G	ENST00000301529.1	-	1	74	c.75T>C	c.(73-75)atT>atC	p.I25I		NM_001004064.1	NP_001004064.1	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J, member 3	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(38)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	59	Esophageal squamous(21;0.00693)					GGAAGAGGGGAATCTGGAGCT	0.493																																					p.I25I		Atlas-SNP	.											.	OR8J3	112	.	0			c.T75C						.						118.0	118.0	118.0					11																	55905120		2201	4296	6497	SO:0001819	synonymous_variant	81168	exon1			GAGGGGAATCTGG		CCDS31520.1	11q12.2	2012-08-09			ENSG00000167822	ENSG00000167822		"""GPCR / Class A : Olfactory receptors"""	15312	protein-coding gene	gene with protein product							Standard	NM_001004064		Approved		uc010riz.2	Q8NGG0	OTTHUMG00000166834	ENST00000301529.1:c.75T>C	chr11.hg19:g.55905120A>G		127.0	0.0		133.0	22.0	NM_001004064	Q6IFB6|Q96RC2	Silent	SNP	ENST00000301529.1	hg19	CCDS31520.1																																																																																			.	.		0.493	OR8J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391542.1	NM_001004064	
OR5AR1	219493	hgsc.bcm.edu	37	11	56431409	56431409	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:56431409C>T	ENST00000302969.2	+	1	272	c.248C>T	c.(247-249)gCt>gTt	p.A83V		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						AGGATGCTGGCTGACTTCCTA	0.483																																					p.A83V		Atlas-SNP	.											.	OR5AR1	68	.	0			c.C248T						.						211.0	213.0	212.0					11																	56431409		2201	4296	6497	SO:0001583	missense	219493	exon1			TGCTGGCTGACTT	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.248C>T	chr11.hg19:g.56431409C>T	ENSP00000302639:p.Ala83Val	109.0	0.0		115.0	30.0	NM_001004730	Q6IF61	Missense_Mutation	SNP	ENST00000302969.2	hg19	CCDS31535.1	.	.	.	.	.	.	.	.	.	.	C	1.182	-0.637902	0.03557	.	.	ENSG00000172459	ENST00000302969	T	0.02015	4.5	5.04	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000227	T	0.01387	0.0045	N	0.10916	0.065	0.09310	N	0.999992	P	0.52842	0.956	B	0.41764	0.366	T	0.49579	-0.8925	10	0.05436	T	0.98	.	12.6251	0.56626	0.1654:0.8346:0.0:0.0	.	83	Q8NGP9	O5AR1_HUMAN	V	83	ENSP00000302639:A83V	ENSP00000302639:A83V	A	+	2	0	OR5AR1	56187985	0.000000	0.05858	1.000000	0.80357	0.988000	0.76386	-0.699000	0.05087	2.632000	0.89209	0.573000	0.79308	GCT	.	.		0.483	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334434.1	NM_001004730	
CTNND1	1500	hgsc.bcm.edu	37	11	57583392	57583392	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:57583392C>T	ENST00000399050.4	+	20	3350	c.2814C>T	c.(2812-2814)gaC>gaT	p.D938D	CTNND1_ENST00000361796.4_Intron|CTNND1_ENST00000532245.1_Intron|CTNND1_ENST00000529919.1_Intron|CTNND1_ENST00000426142.2_Intron|CTNND1_ENST00000530748.1_Intron|CTNND1_ENST00000524630.1_Intron|CTNND1_ENST00000534579.1_Intron|CTNND1_ENST00000532787.1_Silent_p.D810D|CTNND1_ENST00000415361.2_Silent_p.D837D|CTNND1_ENST00000529873.1_Silent_p.D857D|CTNND1_ENST00000358694.6_Intron|CTNND1_ENST00000526772.1_Intron|CTNND1_ENST00000533667.1_Silent_p.D588D|CTNND1_ENST00000526357.1_Silent_p.D878D|CTNND1_ENST00000532844.1_Silent_p.D884D|CTNND1_ENST00000528232.1_Intron|CTNND1_ENST00000526938.1_Intron|CTNND1_ENST00000530094.1_Silent_p.D831D|CTNND1_ENST00000361332.4_Silent_p.D932D|CTNND1_ENST00000531014.1_Silent_p.D609D|CTNND1_ENST00000528621.1_Intron|CTNND1_ENST00000529526.1_Intron|CTNND1_ENST00000428599.2_Intron|CTNND1_ENST00000527467.1_Silent_p.D615D|CTNND1_ENST00000532649.1_Intron|CTNND1_ENST00000532463.1_Intron|CTNND1_ENST00000525902.1_Intron|CTNND1_ENST00000361391.6_Silent_p.D911D|CTNND1_ENST00000399039.4_Intron|CTNND1_ENST00000360682.6_Silent_p.D917D|CTNND1_ENST00000529986.1_Intron	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	938					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				CACAGCAGGACGAGGGGCAGG	0.478																																					p.D938D		Atlas-SNP	.											.	CTNND1	203	.	0			c.C2814T						.						68.0	72.0	71.0					11																	57583392		1941	4118	6059	SO:0001819	synonymous_variant	1500	exon20			GCAGGACGAGGGG	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2814C>T	chr11.hg19:g.57583392C>T		108.0	0.0		134.0	26.0	NM_001085458	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Silent	SNP	ENST00000399050.4	hg19	CCDS44604.1																																																																																			.	.		0.478	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331	
AHNAK	79026	hgsc.bcm.edu	37	11	62289805	62289805	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:62289805A>G	ENST00000378024.4	-	5	12358	c.12084T>C	c.(12082-12084)ggT>ggC	p.G4028G	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4028					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCTTTAGATCACCTTCCATCT	0.502																																					p.G4028G		Atlas-SNP	.											.	AHNAK	532	.	0			c.T12084C						.						173.0	181.0	179.0					11																	62289805		2202	4299	6501	SO:0001819	synonymous_variant	79026	exon5			TAGATCACCTTCC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.12084T>C	chr11.hg19:g.62289805A>G		118.0	0.0		113.0	12.0	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.		0.502	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
MEN1	4221	hgsc.bcm.edu	37	11	64577275	64577275	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:64577275G>T	ENST00000337652.1	-	2	810	c.307C>A	c.(307-309)Ctg>Atg	p.L103M	MEN1_ENST00000377326.3_Missense_Mutation_p.L103M|MEN1_ENST00000394374.2_Missense_Mutation_p.L103M|MEN1_ENST00000312049.6_Missense_Mutation_p.L103M|MEN1_ENST00000443283.1_Missense_Mutation_p.L103M|MEN1_ENST00000377316.2_Missense_Mutation_p.L103M|MEN1_ENST00000315422.4_Missense_Mutation_p.L103M|MEN1_ENST00000377321.1_Missense_Mutation_p.L103M|MEN1_ENST00000394376.1_Missense_Mutation_p.L103M|MEN1_ENST00000377313.1_Missense_Mutation_p.L103M	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	103					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.D102fs*10(1)|p.I97_L103del(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						TAGAGGGACAGGTCGACGGCG	0.627			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.L103M	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	Atlas-SNP	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1	442	.	2	Deletion - Frameshift(1)|Deletion - In frame(1)	parathyroid(2)	c.C307A	GRCh37	CD972306	MEN1	D		.						41.0	44.0	43.0					11																	64577275		2201	4297	6498	SO:0001583	missense	4221	exon2	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	GGGACAGGTCGAC	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.307C>A	chr11.hg19:g.64577275G>T	ENSP00000337088:p.Leu103Met	119.0	0.0		134.0	24.0	NM_130800	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Missense_Mutation	SNP	ENST00000337652.1	hg19	CCDS8083.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.977103	0.34848	.	.	ENSG00000133895	ENST00000377316;ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873;ENST00000450708;ENST00000413626;ENST00000429702;ENST00000424912	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99445	-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91;-5.91	5.02	2.16	0.27623	.	0.085427	0.49305	D	0.000156	D	0.98673	0.9555	L	0.35341	1.055	0.42496	D	0.992919	D;P;D	0.71674	0.998;0.886;0.998	P;B;D	0.66196	0.904;0.2;0.942	D	0.97439	1.0020	10	0.45353	T	0.12	-21.4809	8.8713	0.35318	0.2473:0.0:0.7527:0.0	.	103;103;103	O00255-2;O00255-3;O00255	.;.;MEN1_HUMAN	M	103	ENSP00000366533:L103M;ENSP00000366538:L103M;ENSP00000366543:L103M;ENSP00000308975:L103M;ENSP00000323747:L103M;ENSP00000337088:L103M;ENSP00000377901:L103M;ENSP00000377899:L103M;ENSP00000396940:L103M;ENSP00000366530:L103M;ENSP00000413944:L103M;ENSP00000394933:L103M;ENSP00000411218:L103M;ENSP00000402752:L103M;ENSP00000388016:L103M	ENSP00000308975:L103M	L	-	1	2	MEN1	64333851	1.000000	0.71417	0.999000	0.59377	0.121000	0.20230	2.763000	0.47605	0.263000	0.21812	-1.036000	0.02392	CTG	.	.		0.627	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
TIGD3	220359	hgsc.bcm.edu	37	11	65123857	65123857	+	Missense_Mutation	SNP	A	A	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:65123857A>C	ENST00000309880.5	+	2	785	c.578A>C	c.(577-579)gAt>gCt	p.D193A		NM_145719.2	NP_663771.1	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	193	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(3)|large_intestine(1)|lung(9)|prostate(2)|skin(2)	17						GGTGCATGTGATCAAGTACAG	0.587																																					p.D193A		Atlas-SNP	.											.	TIGD3	32	.	0			c.A578C						.						103.0	111.0	108.0					11																	65123857		2201	4297	6498	SO:0001583	missense	220359	exon2			CATGTGATCAAGT		CCDS8101.1	11q13.1	2008-07-21				ENSG00000173825			18334	protein-coding gene	gene with protein product							Standard	NM_145719		Approved		uc001odo.4	Q6B0B8		ENST00000309880.5:c.578A>C	chr11.hg19:g.65123857A>C	ENSP00000308354:p.Asp193Ala	36.0	0.0		75.0	22.0	NM_145719		Missense_Mutation	SNP	ENST00000309880.5	hg19	CCDS8101.1	.	.	.	.	.	.	.	.	.	.	A	11.92	1.782219	0.31502	.	.	ENSG00000173825	ENST00000309880	T	0.41400	1.0	4.05	2.92	0.33932	.	0.224065	0.22760	N	0.055971	T	0.38957	0.1060	L	0.59436	1.845	0.09310	N	1	B	0.29936	0.262	B	0.35727	0.209	T	0.36986	-0.9725	10	0.56958	D	0.05	-7.2567	6.3025	0.21121	0.8847:0.0:0.1153:0.0	.	193	Q6B0B8	TIGD3_HUMAN	A	193	ENSP00000308354:D193A	ENSP00000308354:D193A	D	+	2	0	TIGD3	64880433	0.970000	0.33590	0.016000	0.15963	0.950000	0.60333	2.756000	0.47549	0.733000	0.32492	0.374000	0.22700	GAT	.	.		0.587	TIGD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387310.1	NM_145719	
FRMD8	83786	hgsc.bcm.edu	37	11	65156924	65156924	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:65156924G>A	ENST00000317568.5	+	3	341	c.178G>A	c.(178-180)Gct>Act	p.A60T	FRMD8_ENST00000355991.5_Intron|FRMD8_ENST00000416776.2_Missense_Mutation_p.A60T	NM_031904.3	NP_114110.1	Q9BZ67	FRMD8_HUMAN	FERM domain containing 8	60	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|urinary_tract(1)	17						GCTGCACCGCGCTGTCCGCGA	0.642																																					p.A60T		Atlas-SNP	.											.	FRMD8	28	.	0			c.G178A						.						76.0	54.0	62.0					11																	65156924		2201	4297	6498	SO:0001583	missense	83786	exon3			CACCGCGCTGTCC	AK074850	CCDS8102.1, CCDS73320.1	11q13.1	2007-08-14			ENSG00000126391	ENSG00000126391			25462	protein-coding gene	gene with protein product						12477932	Standard	NM_031904		Approved	FLJ90369, FKSG44	uc001odu.4	Q9BZ67	OTTHUMG00000166275	ENST00000317568.5:c.178G>A	chr11.hg19:g.65156924G>A	ENSP00000319726:p.Ala60Thr	38.0	0.0		43.0	10.0	NM_031904	B4E2P1|Q86V56|Q8NCB5	Missense_Mutation	SNP	ENST00000317568.5	hg19	CCDS8102.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496332	0.26861	.	.	ENSG00000126391	ENST00000317568;ENST00000416776;ENST00000526201;ENST00000525156	D;D	0.83075	-1.68;-1.65	5.11	2.09	0.27110	Band 4.1 domain (1);FERM domain (1);	0.498482	0.22461	N	0.059753	T	0.72503	0.3468	L	0.53249	1.67	0.09310	N	1	B;B	0.11235	0.001;0.004	B;B	0.04013	0.0;0.001	T	0.52571	-0.8558	10	0.15066	T	0.55	-8.6362	4.4981	0.11851	0.1712:0.0:0.5344:0.2944	.	60;60	B4E2P1;Q9BZ67	.;FRMD8_HUMAN	T	60;60;52;60	ENSP00000319726:A60T;ENSP00000392111:A60T	ENSP00000319726:A60T	A	+	1	0	FRMD8	64913500	0.000000	0.05858	0.001000	0.08648	0.897000	0.52465	0.535000	0.23114	0.558000	0.29135	0.561000	0.74099	GCT	.	.		0.642	FRMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388833.1	NM_031904	
PCNXL3	399909	hgsc.bcm.edu	37	11	65396885	65396885	+	Splice_Site	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:65396885T>C	ENST00000355703.3	+	25	4538	c.3999T>C	c.(3997-3999)ccT>ccC	p.P1333P		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1333						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						ACAGGAACCCTGGTGTGTACC	0.572																																					p.P1333P		Atlas-SNP	.											.	PCNXL3	140	.	0			c.T3999C						.						54.0	53.0	53.0					11																	65396885		2013	4168	6181	SO:0001630	splice_region_variant	399909	exon25			GAACCCTGGTGTG	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.4000+1T>C	chr11.hg19:g.65396885T>C		122.0	0.0		121.0	14.0	NM_032223	Q6MZN8	Silent	SNP	ENST00000355703.3	hg19	CCDS44650.1																																																																																			.	.		0.572	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390321.1	NM_032223	Silent
CCDC87	55231	hgsc.bcm.edu	37	11	66359567	66359567	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:66359567C>T	ENST00000333861.3	-	1	987	c.920G>A	c.(919-921)cGg>cAg	p.R307Q	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	307					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TTGGCCTCTCCGGAGCTCAGG	0.627																																					p.R307Q		Atlas-SNP	.											.	CCDC87	83	.	0			c.G920A						.						37.0	42.0	40.0					11																	66359567		2199	4295	6494	SO:0001583	missense	55231	exon1			CCTCTCCGGAGCT	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.920G>A	chr11.hg19:g.66359567C>T	ENSP00000328487:p.Arg307Gln	95.0	0.0		82.0	23.0	NM_018219	Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	hg19	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	C	5.973	0.363529	0.11296	.	.	ENSG00000182791	ENST00000333861	T	0.32753	1.44	4.27	-0.612	0.11597	.	1.173640	0.06510	N	0.737917	T	0.11153	0.0272	N	0.03016	-0.435	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.29518	-1.0009	10	0.16896	T	0.51	.	4.052	0.09800	0.0:0.3625:0.2122:0.4253	.	307	Q9NVE4	CCD87_HUMAN	Q	307	ENSP00000328487:R307Q	ENSP00000328487:R307Q	R	-	2	0	CCDC87	66116143	0.000000	0.05858	0.000000	0.03702	0.665000	0.39181	-0.720000	0.04969	-0.094000	0.12374	0.514000	0.50259	CGG	.	.		0.627	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219	
LRP5	4041	hgsc.bcm.edu	37	11	68192642	68192642	+	Silent	SNP	C	C	T	rs141446007	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:68192642C>T	ENST00000294304.7	+	15	3415	c.3309C>T	c.(3307-3309)cgC>cgT	p.R1103R		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1103	Beta-propeller 4.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCACCGAGCGCGAGGTCCTCT	0.657													C|||	2	0.000399361	0.0008	0.0	5008	,	,		17873	0.001		0.0	False		,,,				2504	0.0				p.R1103R		Atlas-SNP	.											.	LRP5	136	.	0			c.C3309T						.	C		4,4396	8.1+/-20.4	0,4,2196	107.0	73.0	84.0		3309	-8.2	0.9	11	dbSNP_134	84	0,8588		0,0,4294	no	coding-synonymous	LRP5	NM_002335.2		0,4,6490	TT,TC,CC		0.0,0.0909,0.0308		1103/1616	68192642	4,12984	2200	4294	6494	SO:0001819	synonymous_variant	4041	exon15			CGAGCGCGAGGTC	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.3309C>T	chr11.hg19:g.68192642C>T		73.0	0.0		79.0	12.0	NM_002335	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	hg19	CCDS8181.1																																																																																			.	C|1.000;T|0.000		0.657	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
LRP5	4041	hgsc.bcm.edu	37	11	68201261	68201261	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:68201261G>A	ENST00000294304.7	+	18	4061	c.3955G>A	c.(3955-3957)Ggc>Agc	p.G1319S		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1319	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCGCTGCGACGGCGAGGCAGA	0.706																																					p.G1319S		Atlas-SNP	.											.	LRP5	136	.	0			c.G3955A						.						38.0	37.0	38.0					11																	68201261		2199	4292	6491	SO:0001583	missense	4041	exon18			TGCGACGGCGAGG	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.3955G>A	chr11.hg19:g.68201261G>A	ENSP00000294304:p.Gly1319Ser	210.0	0.0		194.0	59.0	NM_002335	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	ENST00000294304.7	hg19	CCDS8181.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374237	0.82573	.	.	ENSG00000162337	ENST00000294304	D	0.96774	-4.12	4.39	4.39	0.52855	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.49305	U	0.000149	D	0.97879	0.9303	M	0.85710	2.77	0.80722	D	1	D;D	0.62365	0.991;0.991	P;P	0.60541	0.876;0.876	D	0.98614	1.0664	10	0.62326	D	0.03	.	17.2343	0.86994	0.0:0.0:1.0:0.0	.	1319;1319	Q9UES7;O75197	.;LRP5_HUMAN	S	1319	ENSP00000294304:G1319S	ENSP00000294304:G1319S	G	+	1	0	LRP5	67957837	1.000000	0.71417	0.997000	0.53966	0.552000	0.35366	9.523000	0.98034	2.298000	0.77334	0.456000	0.33151	GGC	.	.		0.706	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
KRTAP5-11	440051	hgsc.bcm.edu	37	11	71293746	71293746	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:71293746G>A	ENST00000398530.1	-	1	175	c.138C>T	c.(136-138)tgC>tgT	p.C46C	KRTAP5-11_ENST00000526239.1_Intron|AP000867.1_ENST00000343767.3_Intron	NM_001005405.2	NP_001005405.1	Q6L8G4	KR511_HUMAN	keratin associated protein 5-11	46	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GCACACAGCAGCACACAGGCT	0.657																																					p.C46C		Atlas-SNP	.											.	KRTAP5-11	36	.	0			c.C138T						.						88.0	107.0	101.0					11																	71293746		2200	4293	6493	SO:0001819	synonymous_variant	440051	exon1			ACAGCAGCACACA	AB126080	CCDS41685.1	11q13.4	2008-11-06			ENSG00000204571	ENSG00000204571		"""Keratin associated proteins"""	23606	protein-coding gene	gene with protein product						15144888	Standard	NM_001005405		Approved	KRTAP5.11, KRTAP5-6	uc001oqu.3	Q6L8G4	OTTHUMG00000057586	ENST00000398530.1:c.138C>T	chr11.hg19:g.71293746G>A		145.0	0.0		153.0	33.0	NM_001005405		Silent	SNP	ENST00000398530.1	hg19	CCDS41685.1																																																																																			.	.		0.657	KRTAP5-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127969.1	NM_001005405	
CHRDL2	25884	hgsc.bcm.edu	37	11	74414512	74414512	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:74414512C>T	ENST00000376332.3	-	8	1280	c.784G>A	c.(784-786)Ggg>Agg	p.G262R	CHRDL2_ENST00000263671.5_Missense_Mutation_p.G262R|CHRDL2_ENST00000534159.1_5'UTR	NM_001278473.1	NP_001265402.1	Q6WN34	CRDL2_HUMAN	chordin-like 2	262	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cartilage development (GO:0051216)|cell differentiation (GO:0030154)|ossification (GO:0001503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)|skin(2)	15	Hepatocellular(1;0.098)					CACACCTCCCCGTGGGAGTAC	0.647																																					p.G262R		Atlas-SNP	.											CHRDL2,NS,malignant_melanoma,0,1	CHRDL2	47	.	0			c.G784A						.						29.0	27.0	28.0					11																	74414512		2200	4293	6493	SO:0001583	missense	25884	exon8			CCTCCCCGTGGGA	AL110168	CCDS8234.1, CCDS60893.1	11q13.4	2013-09-20			ENSG00000054938	ENSG00000054938			24168	protein-coding gene	gene with protein product		613127				12853144, 12975309	Standard	NM_015424		Approved	BNF1	uc001ovh.3	Q6WN34	OTTHUMG00000165623	ENST00000376332.3:c.784G>A	chr11.hg19:g.74414512C>T	ENSP00000365510:p.Gly262Arg	122.0	0.0		110.0	23.0	NM_015424	A5PKU9|Q6WN30|Q6WN31|Q6WN32|Q7Z5J3	Missense_Mutation	SNP	ENST00000376332.3	hg19		.	.	.	.	.	.	.	.	.	.	C	31	5.081673	0.94050	.	.	ENSG00000054938	ENST00000263671;ENST00000376332;ENST00000376323;ENST00000393519	T;T	0.74002	-0.8;-0.8	5.62	5.62	0.85841	von Willebrand factor, type C (3);	0.000000	0.85682	D	0.000000	D	0.85305	0.5666	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86351	0.1711	10	0.87932	D	0	-23.1034	17.1513	0.86779	0.0:1.0:0.0:0.0	.	262;262	Q6WN34;Q6WN34-2	CRDL2_HUMAN;.	R	262;262;148;146	ENSP00000263671:G262R;ENSP00000365510:G262R	ENSP00000263671:G262R	G	-	1	0	CHRDL2	74092160	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.645000	0.89757	0.462000	0.41574	GGG	.	.		0.647	CHRDL2-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000385391.1		
KLHL35	283212	hgsc.bcm.edu	37	11	75140869	75140869	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:75140869C>T	ENST00000539798.1	-	1	805	c.806G>A	c.(805-807)cGc>cAc	p.R269H	KLHL35_ENST00000376292.4_Missense_Mutation_p.R49H	NM_001039548.2	NP_001034637.2	Q6PF15	KLH35_HUMAN	kelch-like family member 35	269										lung(2)|stomach(1)	3						CAGCAGCGGGCGGCACTCGCC	0.736																																					p.R269H	Colon(77;683 1691 18820 23811)	Atlas-SNP	.											.	KLHL35	15	.	0			c.G806A						.						2.0	4.0	3.0					11																	75140869		1341	3145	4486	SO:0001583	missense	283212	exon1			AGCGGGCGGCACT		CCDS44685.1, CCDS44685.2	11q13.4	2013-02-22	2013-02-22		ENSG00000149243	ENSG00000149243		"""Kelch-like"", ""BTB/POZ domain containing"""	26597	protein-coding gene	gene with protein product			"""kelch-like 35 (Drosophila)"""				Standard	NM_001039548		Approved	FLJ33790	uc001owm.2	Q6PF15	OTTHUMG00000133573	ENST00000539798.1:c.806G>A	chr11.hg19:g.75140869C>T	ENSP00000438526:p.Arg269His	28.0	0.0		41.0	8.0	NM_001039548	A2RU06|F5H412|Q86XM7|Q8NBB1	Missense_Mutation	SNP	ENST00000539798.1	hg19	CCDS44685.2	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145285	0.37825	.	.	ENSG00000149243	ENST00000376292;ENST00000539798	T;T	0.71698	-0.59;-0.49	4.89	3.95	0.45737	.	0.345798	0.27891	N	0.017428	T	0.60327	0.2260	L	0.54323	1.7	0.35809	D	0.823696	B	0.14438	0.01	B	0.09377	0.004	T	0.62364	-0.6870	10	0.34782	T	0.22	.	6.4375	0.21831	0.1802:0.7254:0.0:0.0944	.	49	Q6PF15	KLH35_HUMAN	H	49;269	ENSP00000365469:R49H;ENSP00000438526:R269H	ENSP00000365469:R49H	R	-	2	0	KLHL35	74818517	0.635000	0.27199	0.999000	0.59377	0.991000	0.79684	0.824000	0.27379	2.542000	0.85734	0.561000	0.74099	CGC	.	.		0.736	KLHL35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173583	
MTNR1B	4544	hgsc.bcm.edu	37	11	92714946	92714946	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:92714946G>A	ENST00000257068.2	+	2	563	c.557G>A	c.(556-558)cGc>cAc	p.R186H		NM_005959.3	NP_005950.1	P49286	MTR1B_HUMAN	melatonin receptor 1B	186					G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|regulation of insulin secretion (GO:0050796)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|melatonin receptor activity (GO:0008502)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	33		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TACGACCCACGCATCTATTCC	0.617																																					p.R186H		Atlas-SNP	.											MTNR1B,colon,carcinoma,+1,2	MTNR1B	75	.	0			c.G557A						.						91.0	87.0	88.0					11																	92714946		2201	4298	6499	SO:0001583	missense	4544	exon2			ACCCACGCATCTA	AB033598	CCDS8290.1	11q21-q22	2012-08-08			ENSG00000134640	ENSG00000134640		"""GPCR / Class A : Melatonin receptors"""	7464	protein-coding gene	gene with protein product		600804					Standard	NM_005959		Approved		uc001pdk.1	P49286	OTTHUMG00000167364	ENST00000257068.2:c.557G>A	chr11.hg19:g.92714946G>A	ENSP00000257068:p.Arg186His	88.0	0.0		109.0	14.0	NM_005959		Missense_Mutation	SNP	ENST00000257068.2	hg19	CCDS8290.1	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515259	0.64634	.	.	ENSG00000134640	ENST00000257068	T	0.72394	-0.65	4.21	3.28	0.37604	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.79233	0.4411	M	0.87617	2.895	0.58432	D	0.999997	P	0.47409	0.895	P	0.50162	0.633	T	0.81061	-0.1103	10	0.39692	T	0.17	-21.8726	13.6018	0.62024	0.0:0.0:0.8434:0.1566	.	186	P49286	MTR1B_HUMAN	H	186	ENSP00000257068:R186H	ENSP00000257068:R186H	R	+	2	0	MTNR1B	92354594	1.000000	0.71417	0.691000	0.30163	0.603000	0.37013	7.031000	0.76491	1.097000	0.41459	0.491000	0.48974	CGC	.	.		0.617	MTNR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394323.1		
KIAA1731	85459	hgsc.bcm.edu	37	11	93429506	93429506	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:93429506A>G	ENST00000325212.6	+	14	1854	c.1692A>G	c.(1690-1692)tcA>tcG	p.S564S	KIAA1731_ENST00000531700.1_5'UTR|KIAA1731_ENST00000344196.4_5'UTR|KIAA1731_ENST00000411936.1_Silent_p.S564S			Q9C0D2	K1731_HUMAN	KIAA1731	564						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTCCAGCATCATGCCCTGTAA	0.303																																					p.S564S		Atlas-SNP	.											.	KIAA1731	173	.	0			c.A1692G						.						131.0	105.0	113.0					11																	93429506		692	1590	2282	SO:0001819	synonymous_variant	85459	exon14			AGCATCATGCCCT	AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.1692A>G	chr11.hg19:g.93429506A>G		63.0	0.0		50.0	13.0	NM_033395	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Silent	SNP	ENST00000325212.6	hg19	CCDS44708.1	.	.	.	.	.	.	.	.	.	.	A	3.574	-0.086981	0.07097	.	.	ENSG00000166004	ENST00000531877	.	.	.	5.53	-0.924	0.10462	.	.	.	.	.	T	0.23289	0.0563	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.27226	-1.0080	4	.	.	.	-0.6692	4.4815	0.11769	0.5447:0.0:0.3148:0.1406	.	.	.	.	V	125	.	.	M	+	1	0	KIAA1731	93069154	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.333000	0.07894	-0.437000	0.07243	-0.301000	0.09380	ATG	.	.		0.303	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000394640.1	NM_033395	
TAF1D	79101	hgsc.bcm.edu	37	11	93471438	93471438	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:93471438T>C	ENST00000448108.2	-	3	946	c.296A>G	c.(295-297)tAc>tGc	p.Y99C	TAF1D_ENST00000546088.1_5'Flank	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa	99					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						TGTTGGCTGGTACCTCCTCTT	0.363																																					p.Y99C		Atlas-SNP	.											.	TAF1D	18	.	0			c.A296G						.						143.0	150.0	147.0					11																	93471438		2201	4298	6499	SO:0001583	missense	79101	exon3			GGCTGGTACCTCC		CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451	ENST00000448108.2:c.296A>G	chr11.hg19:g.93471438T>C	ENSP00000410409:p.Tyr99Cys	83.0	0.0		75.0	11.0	NM_024116	Q6I9Y6	Missense_Mutation	SNP	ENST00000448108.2	hg19	CCDS8293.1	.	.	.	.	.	.	.	.	.	.	T	12.17	1.857106	0.32791	.	.	ENSG00000166012	ENST00000448108	.	.	.	5.44	4.32	0.51571	.	0.000000	0.64402	D	0.000003	T	0.70404	0.3220	M	0.66939	2.045	0.42256	D	0.991992	D	0.89917	1.0	D	0.91635	0.999	T	0.71464	-0.4585	9	0.66056	D	0.02	-7.3068	8.0462	0.30551	0.0:0.0916:0.0:0.9084	.	99	Q9H5J8	TAF1D_HUMAN	C	99	.	ENSP00000314971:Y99C	Y	-	2	0	TAF1D	93111086	0.963000	0.33076	0.175000	0.22980	0.029000	0.11900	3.759000	0.55227	1.022000	0.39626	0.528000	0.53228	TAC	.	.		0.363	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394662.2	NM_024116	
CNTN5	53942	hgsc.bcm.edu	37	11	100221535	100221535	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:100221535G>A	ENST00000524871.1	+	24	3423	c.3133G>A	c.(3133-3135)Gtt>Att	p.V1045I	CNTN5_ENST00000418526.2_Missense_Mutation_p.V971I|CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000279463.3_Missense_Mutation_p.V1045I|CNTN5_ENST00000528682.1_Missense_Mutation_p.V1045I	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	1045	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TATTATTGAAGTTCGAGCATA	0.393																																					p.V1045I		Atlas-SNP	.											.	CNTN5	324	.	0			c.G3133A						.						129.0	126.0	127.0					11																	100221535		1879	4109	5988	SO:0001583	missense	53942	exon23			ATTGAAGTTCGAG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.3133G>A	chr11.hg19:g.100221535G>A	ENSP00000435637:p.Val1045Ile	127.0	0.0		178.0	35.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	G	3.766	-0.048681	0.07407	.	.	ENSG00000149972	ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51	5.4	4.49	0.54785	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.056281	0.64402	N	0.000001	T	0.56411	0.1983	N	0.25485	0.75	0.54753	D	0.999987	B;B	0.20550	0.011;0.046	B;B	0.20184	0.016;0.028	T	0.49986	-0.8880	9	.	.	.	.	13.0124	0.58739	0.0777:0.0:0.9223:0.0	.	971;1045	O94779-2;O94779	.;CNTN5_HUMAN	I	1045;1045;971;1045	ENSP00000436185:V1045I;ENSP00000435637:V1045I;ENSP00000393229:V971I;ENSP00000279463:V1045I	.	V	+	1	0	CNTN5	99726745	1.000000	0.71417	0.990000	0.47175	0.852000	0.48524	4.260000	0.58835	1.266000	0.44231	0.555000	0.69702	GTT	.	.		0.393	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
CARD18	59082	hgsc.bcm.edu	37	11	105009586	105009586	+	Missense_Mutation	SNP	A	A	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:105009586A>T	ENST00000530950.1	-	2	226	c.227T>A	c.(226-228)cTc>cAc	p.L76H	CARD18_ENST00000532895.1_Missense_Mutation_p.L37H|CARD18_ENST00000526823.1_Missense_Mutation_p.L37H	NM_021571.3	NP_067546.1	P57730	CAR18_HUMAN	caspase recruitment domain family, member 18	76	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				inflammatory response (GO:0006954)|regulation of apoptotic process (GO:0042981)		cysteine-type endopeptidase inhibitor activity (GO:0004869)			central_nervous_system(1)|ovary(1)	2						TTCTTCACAGAGATGCTTGAT	0.423																																					p.L76H		Atlas-SNP	.											.	CARD18	18	.	0			c.T227A						.						236.0	218.0	224.0					11																	105009586		1902	4118	6020	SO:0001583	missense	59082	exon2			TCACAGAGATGCT	AY358231	CCDS53705.1	11q22.3	2008-09-02				ENSG00000255501			28861	protein-coding gene	gene with protein product		605354				11051551	Standard	NM_021571		Approved	UNQ5804, ICEBERG, pseudo-ICE	uc021qpy.1	P57730		ENST00000530950.1:c.227T>A	chr11.hg19:g.105009586A>T	ENSP00000436691:p.Leu76His	173.0	0.0		181.0	11.0	NM_021571	A2RRF8	Missense_Mutation	SNP	ENST00000530950.1	hg19	CCDS53705.1	.	.	.	.	.	.	.	.	.	.	.	12.01	1.809571	0.31961	.	.	ENSG00000255501	ENST00000530950;ENST00000526823;ENST00000532895	T;T;T	0.39056	1.1;1.1;1.1	2.69	1.54	0.23209	DEATH-like (2);Caspase Recruitment (3);	0.500084	0.19225	N	0.119580	T	0.55609	0.1931	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.75484	0.986	T	0.41233	-0.9520	9	0.87932	D	0	.	4.6446	0.12566	0.8456:0.0:0.1544:0.0	.	76	P57730	CAR18_HUMAN	H	76;37;37	ENSP00000436691:L76H;ENSP00000437035:L37H;ENSP00000437187:L37H	ENSP00000437035:L37H	L	-	2	0	CARD18	104514796	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	1.497000	0.35649	0.444000	0.26612	0.456000	0.33151	CTC	.	.		0.423	CARD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388183.2	NM_021571	
MSANTD4	84437	hgsc.bcm.edu	37	11	105880665	105880665	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:105880665A>G	ENST00000301919.4	-	3	2050	c.635T>C	c.(634-636)cTa>cCa	p.L212P	MSANTD4_ENST00000529805.1_5'Flank	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	212						nucleus (GO:0005634)											TTCCAACTCTAGTTTCTGTTT	0.433																																					p.L212P		Atlas-SNP	.											.	.	.	.	0			c.T635C						.						88.0	91.0	90.0					11																	105880665		2201	4299	6500	SO:0001583	missense	84437	exon3			AACTCTAGTTTCT	AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.635T>C	chr11.hg19:g.105880665A>G	ENSP00000304713:p.Leu212Pro	56.0	0.0		60.0	19.0	NM_032424	Q96JK1|Q96JZ3|Q9H2N4	Missense_Mutation	SNP	ENST00000301919.4	hg19	CCDS31663.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.338112	0.41398	.	.	ENSG00000170903	ENST00000301919	.	.	.	5.78	5.78	0.91487	.	0.073082	0.56097	D	0.000033	T	0.50565	0.1623	L	0.27053	0.805	0.49389	D	0.999782	P	0.52463	0.953	P	0.49140	0.601	T	0.55617	-0.8113	9	0.72032	D	0.01	-26.5451	16.1035	0.81203	1.0:0.0:0.0:0.0	.	212	Q8NCY6	K1826_HUMAN	P	212	.	ENSP00000304713:L212P	L	-	2	0	KIAA1826	105385875	0.968000	0.33430	0.094000	0.20943	0.320000	0.28249	8.199000	0.89731	2.207000	0.71202	0.402000	0.26972	CTA	.	.		0.433	MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388619.1	NM_032424	
CWF19L2	143884	hgsc.bcm.edu	37	11	107299544	107299544	+	Missense_Mutation	SNP	T	T	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:107299544T>A	ENST00000282251.5	-	8	1441	c.1414A>T	c.(1414-1416)Aca>Tca	p.T472S	CWF19L2_ENST00000433523.1_Missense_Mutation_p.T472S	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	472							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		GTAGACTTTGTATCCCGTAGA	0.348																																					p.T472S		Atlas-SNP	.											.	CWF19L2	135	.	0			c.A1414T						.						159.0	165.0	163.0					11																	107299544		2201	4298	6499	SO:0001583	missense	143884	exon8			ACTTTGTATCCCG	AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.1414A>T	chr11.hg19:g.107299544T>A	ENSP00000282251:p.Thr472Ser	104.0	0.0		99.0	31.0	NM_152434	A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Missense_Mutation	SNP	ENST00000282251.5	hg19	CCDS8336.2	.	.	.	.	.	.	.	.	.	.	T	4.603	0.112113	0.08831	.	.	ENSG00000152404	ENST00000282251;ENST00000433523	T;T	0.26660	1.72;1.72	5.42	1.7	0.24286	.	1.046460	0.07405	N	0.891416	T	0.18257	0.0438	L	0.46157	1.445	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.37957	-0.9683	10	0.02654	T	1	-1.3545	5.3414	0.15986	0.0:0.1526:0.1481:0.6993	.	472	Q2TBE0	C19L2_HUMAN	S	472	ENSP00000282251:T472S;ENSP00000387533:T472S	ENSP00000282251:T472S	T	-	1	0	CWF19L2	106804754	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.456000	0.21859	0.083000	0.17047	-0.969000	0.02612	ACA	.	.		0.348	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328825.2	NM_152434	
PPP2R1B	5519	hgsc.bcm.edu	37	11	111613287	111613287	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:111613287C>T	ENST00000527614.1	-	13	1722	c.1657G>A	c.(1657-1659)Gcc>Acc	p.A553T	PPP2R1B_ENST00000427203.2_Missense_Mutation_p.A392T|PPP2R1B_ENST00000341980.6_Missense_Mutation_p.A508T|PPP2R1B_ENST00000311129.5_Missense_Mutation_p.A553T|PPP2R1B_ENST00000426998.2_Missense_Mutation_p.A489T|PPP2R1B_ENST00000393055.2_Missense_Mutation_p.A426T	NM_001177562.1|NM_002716.4	NP_001171033.1|NP_002707.3	P30154	2AAB_HUMAN	protein phosphatase 2, regulatory subunit A, beta	553					apoptotic process involved in morphogenesis (GO:0060561)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)	extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|liver(1)|lung(10)|prostate(1)|urinary_tract(2)	22		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|Epithelial(105;2.36e-06)|all cancers(92;3.78e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0761)		AGAGATTTGGCCACATTGAAG	0.368																																					p.A553T		Atlas-SNP	.											.	PPP2R1B	44	.	0			c.G1657A						.						100.0	93.0	96.0					11																	111613287		2201	4297	6498	SO:0001583	missense	5519	exon13			ATTTGGCCACATT	AF087438	CCDS8348.1, CCDS8349.1, CCDS53706.1, CCDS53707.1, CCDS53708.1	11q23.1	2010-06-18	2010-04-14		ENSG00000137713	ENSG00000137713	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9303	protein-coding gene	gene with protein product	"""PP2A-A-beta"", ""protein phosphatase 2A, regulatory subunit A, beta isoform"""	603113	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform"""			2159327, 9795170	Standard	NM_181699		Approved	PR65B, PP2A-Abeta	uc001plw.1	P30154	OTTHUMG00000166741	ENST00000527614.1:c.1657G>A	chr11.hg19:g.111613287C>T	ENSP00000437193:p.Ala553Thr	46.0	0.0		61.0	7.0	NM_002716	A8MY67|B0YJ69|B4DGQ6|B4DK91|B4DWW5|F8W8G1|O75620|Q8NHV8	Missense_Mutation	SNP	ENST00000527614.1	hg19	CCDS8349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.348282|5.348282	0.95807|0.95807	.|.	.|.	ENSG00000137713|ENSG00000137713	ENST00000311129;ENST00000426998;ENST00000527614;ENST00000427203;ENST00000341980;ENST00000393055|ENST00000412902;ENST00000531890	T;T;T;T;T;T|.	0.23348|.	1.91;1.91;1.91;1.91;1.91;1.91|.	5.47|5.47	5.47|5.47	0.80525|0.80525	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.159080|.	0.56097|.	D|.	0.000040|.	D|D	0.86339|0.86339	0.5909|0.5909	M|M	0.93678|0.93678	3.445|3.445	0.80722|0.80722	D|D	1|1	D;D;D;P;P;P|.	0.63880|.	0.993;0.97;0.988;0.952;0.48;0.769|.	D;P;D;P;B;P|.	0.66497|.	0.944;0.887;0.94;0.774;0.354;0.554|.	D|D	0.89457|0.89457	0.3734|0.3734	10|6	0.87932|0.66056	D|D	0|0.02	-9.7494|-9.7494	16.8268|16.8268	0.85933|0.85933	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	426;508;392;489;553;553|.	A8MY67;F8W8G1;B7Z1G3;B4DWW5;P30154;P30154-2|.	.;.;.;.;2AAB_HUMAN;.|.	T|D	553;489;553;392;508;426|425;181	ENSP00000311344:A553T;ENSP00000410671:A489T;ENSP00000437193:A553T;ENSP00000415759:A392T;ENSP00000343317:A508T;ENSP00000376775:A426T|.	ENSP00000311344:A553T|ENSP00000403301:G425D	A|G	-|-	1|2	0|0	PPP2R1B|PPP2R1B	111118497|111118497	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.396000|7.396000	0.79891|0.79891	2.573000|2.573000	0.86826|0.86826	0.555000|0.555000	0.69702|0.69702	GCC|GGC	.	.		0.368	PPP2R1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391298.1	NM_002716	
HYOU1	10525	hgsc.bcm.edu	37	11	118923017	118923017	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:118923017T>C	ENST00000404233.3	-	10	1236	c.1112A>G	c.(1111-1113)gAa>gGa	p.E371G	HYOU1_ENST00000543287.1_Missense_Mutation_p.E284G|HYOU1_ENST00000529972.1_Missense_Mutation_p.E371G|HYOU1_ENST00000525859.1_Missense_Mutation_p.E371G	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	371					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CAGACTCATTTCGGCACTCTG	0.557																																					p.E371G		Atlas-SNP	.											.	HYOU1	88	.	0			c.A1112G						.						111.0	118.0	116.0					11																	118923017		2200	4295	6495	SO:0001583	missense	10525	exon10			CTCATTTCGGCAC	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.1112A>G	chr11.hg19:g.118923017T>C	ENSP00000384144:p.Glu371Gly	52.0	0.0		70.0	23.0	NM_006389	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	hg19	CCDS8408.1	.	.	.	.	.	.	.	.	.	.	T	7.284	0.609761	0.14066	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	5.26	4.14	0.48551	.	0.191701	0.53938	N	0.000048	T	0.13329	0.0323	N	0.05031	-0.125	0.58432	D	0.999996	P;B;B;B	0.36837	0.571;0.057;0.01;0.01	B;B;B;B	0.40410	0.328;0.047;0.009;0.009	T	0.12941	-1.0528	10	0.13853	T	0.58	-11.2552	10.7933	0.46445	0.0:0.0748:0.0:0.9252	.	362;415;371;371	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	G	371;362;371;371;220;371;414;284;371	ENSP00000384144:E371G;ENSP00000437313:E371G;ENSP00000433397:E371G;ENSP00000442727:E284G;ENSP00000431874:E371G	ENSP00000278752:E362G	E	-	2	0	HYOU1	118428227	0.951000	0.32395	0.023000	0.16930	0.283000	0.27025	2.540000	0.45727	1.022000	0.39626	-0.256000	0.11100	GAA	.	.		0.557	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389353.1	NM_006389	
THY1	7070	hgsc.bcm.edu	37	11	119291593	119291593	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:119291593G>A	ENST00000284240.5	-	2	1062	c.23C>T	c.(22-24)gCt>gTt	p.A8V	USP2-AS1_ENST00000498979.2_RNA|USP2-AS1_ENST00000578923.1_RNA|USP2-AS1_ENST00000530002.1_RNA|THY1_ENST00000580275.1_Missense_Mutation_p.A8V|THY1_ENST00000527590.1_Intron|THY1_ENST00000528522.1_Missense_Mutation_p.A8V|USP2-AS1_ENST00000500970.1_RNA|RP11-334E6.12_ENST00000578216.1_RNA	NM_006288.3	NP_006279.2	P04216	THY1_HUMAN	Thy-1 cell surface antigen	8					angiogenesis (GO:0001525)|cytoskeleton organization (GO:0007010)|focal adhesion assembly (GO:0048041)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of GTPase activity (GO:0043547)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell activation (GO:0050870)|retinal cone cell development (GO:0046549)|single organismal cell-cell adhesion (GO:0016337)|T cell receptor signaling pathway (GO:0050852)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|integrin binding (GO:0005178)|Rho GTPase activator activity (GO:0005100)			breast(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.83e-05)		TAGCAGGAGAGCGATGCTGAT	0.597																																					p.A8V		Atlas-SNP	.											.	THY1	21	.	0			c.C23T						.						199.0	176.0	184.0					11																	119291593		2199	4295	6494	SO:0001583	missense	7070	exon2			AGGAGAGCGATGC	M11749	CCDS8424.1	11q23.3	2013-01-14				ENSG00000154096		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11801	protein-coding gene	gene with protein product		188230				2864690	Standard	NM_006288		Approved	CD90	uc001pwr.3	P04216		ENST00000284240.5:c.23C>T	chr11.hg19:g.119291593G>A	ENSP00000284240:p.Ala8Val	88.0	0.0		102.0	27.0	NM_006288	Q16008|Q9NSP1	Missense_Mutation	SNP	ENST00000284240.5	hg19	CCDS8424.1	.	.	.	.	.	.	.	.	.	.	G	8.597	0.885933	0.17540	.	.	ENSG00000154096	ENST00000284240;ENST00000528522;ENST00000524970;ENST00000524659	.	.	.	4.79	2.93	0.34026	Immunoglobulin-like (1);	0.404958	0.26609	N	0.023424	T	0.38852	0.1056	L	0.38175	1.15	0.33419	D	0.579591	B	0.10296	0.003	B	0.08055	0.003	T	0.42241	-0.9463	9	0.38643	T	0.18	-4.7717	8.2006	0.31421	0.1805:0.0:0.8195:0.0	.	8	P04216	THY1_HUMAN	V	8	.	ENSP00000284240:A8V	A	-	2	0	THY1	118796803	1.000000	0.71417	0.260000	0.24451	0.253000	0.25986	2.184000	0.42575	0.639000	0.30564	0.655000	0.94253	GCT	.	.		0.597	THY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388370.2	NM_006288	
CLMP	79827	hgsc.bcm.edu	37	11	122968527	122968527	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:122968527G>A	ENST00000448775.2	-	2	502	c.162C>T	c.(160-162)acC>acT	p.T54T		NM_024769.2	NP_079045.1	Q9H6B4	CLMP_HUMAN	CXADR-like membrane protein	54	Ig-like C2-type 1.				digestive tract development (GO:0048565)	cell surface (GO:0009986)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	14						CTTCATTATCGGTGAGCAGCC	0.488																																					p.T54T		Atlas-SNP	.											.	CLMP	39	.	0			c.C162T						.						162.0	157.0	159.0					11																	122968527		2202	4299	6501	SO:0001819	synonymous_variant	79827	exon2			ATTATCGGTGAGC	BC009371	CCDS8441.1	11q24	2013-01-29			ENSG00000166250	ENSG00000166250		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24039	protein-coding gene	gene with protein product	"""adipocyte-specific adhesion molecule"", ""coxsackie- and adenovirus receptor-like membrane protein"", ""adipocyte adhesion molecule"""	611693				12851705, 14573622	Standard	NM_024769		Approved	ASAM, FLJ22415, ACAM	uc001pyt.3	Q9H6B4		ENST00000448775.2:c.162C>T	chr11.hg19:g.122968527G>A		90.0	0.0		96.0	13.0	NM_024769		Silent	SNP	ENST00000448775.2	hg19	CCDS8441.1																																																																																			.	.		0.488	CLMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387542.1	NM_024769	
CDON	50937	hgsc.bcm.edu	37	11	125893349	125893349	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:125893349A>G	ENST00000392693.3	-	2	150	c.23T>C	c.(22-24)tTa>tCa	p.L8S	CDON_ENST00000263577.7_Missense_Mutation_p.L8S	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	8					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		CAGTGTACATAAGGGTCCAAG	0.448																																					p.L8S		Atlas-SNP	.											.	CDON	137	.	0			c.T23C						.						121.0	117.0	119.0					11																	125893349		2201	4299	6500	SO:0001583	missense	50937	exon2			GTACATAAGGGTC	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.23T>C	chr11.hg19:g.125893349A>G	ENSP00000376458:p.Leu8Ser	72.0	0.0		88.0	20.0	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	hg19	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	A	5.805	0.332750	0.11013	.	.	ENSG00000064309	ENST00000392693;ENST00000263577;ENST00000531586;ENST00000527967;ENST00000534818	T;T;T;T;T	0.78707	-0.48;-0.5;0.08;-0.31;-1.2	5.44	1.87	0.25490	.	0.178360	0.26987	N	0.021499	D	0.82273	0.5001	M	0.72894	2.215	0.09310	N	1	D;P;P	0.76494	0.999;0.567;0.693	D;B;B	0.63488	0.915;0.159;0.302	T	0.72007	-0.4420	10	0.87932	D	0	-1.0854	5.1486	0.14998	0.6341:0.1414:0.2245:0.0	.	8;8;8	E9PRD8;Q4KMG0;Q4KMG0-2	.;CDON_HUMAN;.	S	8	ENSP00000376458:L8S;ENSP00000263577:L8S;ENSP00000434212:L8S;ENSP00000436940:L8S;ENSP00000437176:L8S	ENSP00000263577:L8S	L	-	2	0	CDON	125398559	0.985000	0.35326	0.203000	0.23512	0.005000	0.04900	1.502000	0.35704	0.068000	0.16574	-0.326000	0.08463	TTA	.	.		0.448	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
GLB1L2	89944	hgsc.bcm.edu	37	11	134217281	134217281	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:134217281T>C	ENST00000535456.2	+	5	700	c.512T>C	c.(511-513)gTg>gCg	p.V171A	GLB1L2_ENST00000389881.3_Missense_Mutation_p.V171A|GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Missense_Mutation_p.V171A	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	171					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		ACCGAAGCAGTGGACCTTTAT	0.512																																					p.V171A		Atlas-SNP	.											.	GLB1L2	79	.	0			c.T512C						.						268.0	262.0	264.0					11																	134217281		2201	4297	6498	SO:0001583	missense	89944	exon5			AAGCAGTGGACCT		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.512T>C	chr11.hg19:g.134217281T>C	ENSP00000444628:p.Val171Ala	102.0	0.0		106.0	19.0	NM_138342	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	ENST00000535456.2	hg19	CCDS31724.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.569730	0.86439	.	.	ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881	D;D;D	0.98135	-4.74;-4.74;-4.74	5.93	4.81	0.61882	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.205952	0.41605	D	0.000860	D	0.97929	0.9319	M	0.76938	2.355	0.50467	D	0.999878	P	0.50156	0.932	P	0.55087	0.768	D	0.97510	1.0066	10	0.59425	D	0.04	-19.0472	11.7315	0.51739	0.0:0.0684:0.0:0.9316	.	171	Q8IW92	GLBL2_HUMAN	A	171	ENSP00000344659:V171A;ENSP00000444628:V171A;ENSP00000374531:V171A	ENSP00000344659:V171A	V	+	2	0	GLB1L2	133722491	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	3.891000	0.56227	1.071000	0.40834	0.533000	0.62120	GTG	.	.		0.512	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342	
B4GALNT3	283358	hgsc.bcm.edu	37	12	668587	668587	+	Splice_Site	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:668587G>A	ENST00000266383.5	+	19	2901	c.2888G>A	c.(2887-2889)aGg>aAg	p.R963K		NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3	963					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			CTGCTGGACAGGTGACTGGGA	0.637																																					p.R963K		Atlas-SNP	.											.	B4GALNT3	64	.	0			c.G2888A						.						68.0	71.0	70.0					12																	668587		2203	4300	6503	SO:0001630	splice_region_variant	283358	exon19			TGGACAGGTGACT	AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283	ENST00000266383.5:c.2888+1G>A	chr12.hg19:g.668587G>A		122.0	0.0		148.0	17.0	NM_173593	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	ENST00000266383.5	hg19	CCDS8504.1	.	.	.	.	.	.	.	.	.	.	G	36	5.748106	0.96882	.	.	ENSG00000139044	ENST00000266383	T	0.56103	0.48	4.83	4.83	0.62350	.	0.046006	0.85682	N	0.000000	T	0.70448	0.3225	M	0.62266	1.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70461	-0.4865	10	0.42905	T	0.14	-23.5802	18.2881	0.90120	0.0:0.0:1.0:0.0	.	963	Q6L9W6	B4GN3_HUMAN	K	963	ENSP00000266383:R963K	ENSP00000266383:R963K	R	+	2	0	B4GALNT3	538848	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.745000	0.98856	2.383000	0.81215	0.462000	0.41574	AGG	.	.		0.637	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251406.2	NM_173593	Missense_Mutation
CACNA1C	775	hgsc.bcm.edu	37	12	2719737	2719737	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:2719737C>T	ENST00000347598.4	+	29	3649	c.3649C>T	c.(3649-3651)Cgg>Tgg	p.R1217W	CACNA1C_ENST00000399621.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399597.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399638.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399606.1_Missense_Mutation_p.R1217W|CACNA1C_ENST00000335762.5_Missense_Mutation_p.R1222W|CACNA1C_ENST00000399603.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399649.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000327702.7_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399637.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399629.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399595.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399641.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399591.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000406454.3_Missense_Mutation_p.R1197W|CACNA1C_ENST00000344100.3_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399601.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399644.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000402845.3_Missense_Mutation_p.R1197W|CACNA1C_ENST00000480911.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399617.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399655.1_Missense_Mutation_p.R1197W|CACNA1C_ENST00000399634.1_Missense_Mutation_p.R1197W	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1217					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTCAAGGCCCGGCCCCTGCG	0.592																																					p.R1217W		Atlas-SNP	.											.	CACNA1C	1023	.	0			c.C3649T						.						90.0	98.0	95.0					12																	2719737		2125	4259	6384	SO:0001583	missense	775	exon29			AAGGCCCGGCCCC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3649C>T	chr12.hg19:g.2719737C>T	ENSP00000266376:p.Arg1217Trp	106.0	0.0		151.0	61.0	NM_199460	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	ENST00000347598.4	hg19	CCDS44788.1	.	.	.	.	.	.	.	.	.	.	C	34	5.318408	0.95682	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96716	-4.05;-4.05;-4.08;-4.05;-4.04;-4.04;-4.06;-3.97;-4.0;-4.05;-3.98;-3.98;-4.06;-4.1;-3.97;-3.89;-4.09;-4.06;-4.05;-4.08;-3.99;-4.06;-4.1	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.98375	0.9460	M	0.87682	2.9	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.997;0.997;0.987;0.997;0.997;0.997;0.999;0.994;0.994;0.997;0.996;0.992;0.998;0.993;0.996;0.995;0.998;0.999;0.998;0.997;0.999;0.999;0.997;0.992;0.996	D	0.99274	1.0894	10	0.87932	D	0	.	19.1876	0.93649	0.0:1.0:0.0:0.0	.	1197;1194;1217;1197;1197;1197;1197;1197;1197;1217;1197;1168;1217;1197;1197;1197;1197;1197;1197;1197;1197;1197;1197;1197;1197	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	W	1222;1197;1197;1197;1197;1197;1197;1197;1197;1197;1217;1217;1197;1197;1197;1197;1197;1197;1197;1197;1197;1197;1197;1038	ENSP00000336982:R1222W;ENSP00000382563:R1197W;ENSP00000437936:R1197W;ENSP00000382552:R1197W;ENSP00000382547:R1197W;ENSP00000382506:R1197W;ENSP00000382530:R1197W;ENSP00000382546:R1197W;ENSP00000382500:R1197W;ENSP00000382549:R1197W;ENSP00000266376:R1217W;ENSP00000382515:R1217W;ENSP00000382510:R1197W;ENSP00000341092:R1197W;ENSP00000382537:R1197W;ENSP00000329877:R1197W;ENSP00000382557:R1197W;ENSP00000385724:R1197W;ENSP00000382512:R1197W;ENSP00000382542:R1197W;ENSP00000382526:R1197W;ENSP00000385896:R1197W;ENSP00000382504:R1197W	ENSP00000323129:R1038W	R	+	1	2	CACNA1C	2589998	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.995000	0.70631	2.610000	0.88304	0.655000	0.94253	CGG	.	.		0.592	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317035.1	NM_000719	
PHC1	1911	hgsc.bcm.edu	37	12	9087824	9087824	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:9087824C>T	ENST00000543824.1	+	12	2690	c.2358C>T	c.(2356-2358)agC>agT	p.S786S	PHC1_ENST00000536844.1_Silent_p.S392S|PHC1_ENST00000433083.2_Silent_p.S741S|PHC1_ENST00000544916.1_Silent_p.S786S			P78364	PHC1_HUMAN	polyhomeotic homolog 1 (Drosophila)	786					cellular response to retinoic acid (GO:0071300)|histone ubiquitination (GO:0016574)|multicellular organismal development (GO:0007275)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|large_intestine(8)|liver(2)|lung(3)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	27						GAGTGGACAGCCCATCTGCTG	0.483																																					p.S786S		Atlas-SNP	.											.	PHC1	67	.	0			c.C2358T						.						38.0	36.0	37.0					12																	9087824		2203	4300	6503	SO:0001819	synonymous_variant	1911	exon11			GGACAGCCCATCT	U89277	CCDS8597.1	12p13	2013-01-10	2006-09-12	2002-11-15	ENSG00000111752	ENSG00000111752		"""Sterile alpha motif (SAM) domain containing"""	3182	protein-coding gene	gene with protein product		602978	"""early development regulator 1 (homolog of polyhomeotic 1)"", ""polyhomeotic-like 1 (Drosophila)"""	EDR1		9121482	Standard	XM_005253334		Approved	HPH1, RAE28	uc001qvd.3	P78364	OTTHUMG00000168275	ENST00000543824.1:c.2358C>T	chr12.hg19:g.9087824C>T		53.0	0.0		46.0	8.0	NM_004426	D3DUV4|Q8WVM3|Q9BU63	Silent	SNP	ENST00000543824.1	hg19	CCDS8597.1																																																																																			.	.		0.483	PHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399115.1	NM_004426	
GYS2	2998	hgsc.bcm.edu	37	12	21693401	21693401	+	Silent	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:21693401G>T	ENST00000261195.2	-	14	2006	c.1752C>A	c.(1750-1752)atC>atA	p.I584I		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	584					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TGTTCCTCTGGATAATCCTTT	0.433																																					p.I584I	Colon(149;9 1820 3690 10544 50424)	Atlas-SNP	.											.	GYS2	110	.	0			c.C1752A						.						164.0	168.0	167.0					12																	21693401		2203	4300	6503	SO:0001819	synonymous_variant	2998	exon14			CCTCTGGATAATC		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1752C>A	chr12.hg19:g.21693401G>T		128.0	0.0		119.0	22.0	NM_021957	A0AVD8	Silent	SNP	ENST00000261195.2	hg19	CCDS8690.1																																																																																			.	.		0.433	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
ABCC9	10060	hgsc.bcm.edu	37	12	21960410	21960410	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:21960410G>A	ENST00000261201.4	-	36	4318	c.4319C>T	c.(4318-4320)gCg>gTg	p.A1440V	ABCC9_ENST00000345162.2_Missense_Mutation_p.A1404V|ABCC9_ENST00000261200.4_Missense_Mutation_p.A1440V	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1440	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.A1440G(2)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	AGTGACAACCGCATCTAAATC	0.398																																					p.A1440V		Atlas-SNP	.											ABCC9_ENST00000261201,NS,carcinoma,0,4	ABCC9	411	.	2	Substitution - Missense(2)	lung(2)	c.C4319T						.						96.0	87.0	90.0					12																	21960410		2203	4300	6503	SO:0001583	missense	10060	exon36			ACAACCGCATCTA	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4319C>T	chr12.hg19:g.21960410G>A	ENSP00000261201:p.Ala1440Val	77.0	0.0		101.0	47.0	NM_005691	O60707	Missense_Mutation	SNP	ENST00000261201.4	hg19	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886336	0.72410	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.3	5.02	5.02	0.67125	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.055041	0.64402	D	0.000001	D	0.92841	0.7723	N	0.21508	0.67	0.80722	D	1	D;D	0.69078	0.991;0.997	P;P	0.62184	0.77;0.899	D	0.90464	0.4448	10	0.17832	T	0.49	-15.5615	18.5246	0.90967	0.0:0.0:1.0:0.0	.	1440;1440	O60706;O60706-2	ABCC9_HUMAN;.	V	1440;1067;1440;1404	ENSP00000261200:A1440V;ENSP00000440521:A1067V;ENSP00000261201:A1440V;ENSP00000261202:A1404V	ENSP00000261200:A1440V	A	-	2	0	ABCC9	21851677	1.000000	0.71417	0.958000	0.39756	0.982000	0.71751	9.504000	0.97986	2.585000	0.87301	0.561000	0.74099	GCG	.	.		0.398	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
KLHL42	57542	hgsc.bcm.edu	37	12	27933999	27933999	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:27933999T>C	ENST00000381271.2	+	1	1047	c.736T>C	c.(736-738)Tat>Cat	p.Y246H	RP11-860B13.1_ENST00000545904.1_RNA	NM_020782.1	NP_065833.1	Q9P2K6	KLH42_HUMAN	kelch-like family member 42	246					mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of microtubule-based process (GO:0032886)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											TGTCAGGGGCTATGGGTCTGC	0.597																																					p.Y246H		Atlas-SNP	.											.	.	.	.	0			c.T736C						.						73.0	56.0	62.0					12																	27933999		2203	4300	6503	SO:0001583	missense	57542	exon1			AGGGGCTATGGGT	AB037761	CCDS31763.1	12p11.22	2013-04-24	2013-02-22	2013-01-30	ENSG00000087448	ENSG00000087448		"""Kelch-like"""	29252	protein-coding gene	gene with protein product			"""kelch domain containing 5"""	KLHDC5		19261606	Standard	NM_020782		Approved	KIAA1340, Ctb9	uc001rij.3	Q9P2K6	OTTHUMG00000169217	ENST00000381271.2:c.736T>C	chr12.hg19:g.27933999T>C	ENSP00000370671:p.Tyr246His	90.0	0.0		93.0	17.0	NM_020782	Q2VPK1|Q8N334	Missense_Mutation	SNP	ENST00000381271.2	hg19	CCDS31763.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.0|22.0	4.228854|4.228854	0.79576|0.79576	.|.	.|.	ENSG00000087448|ENSG00000087448	ENST00000543254|ENST00000381271	.|T	.|0.61274	.|0.12	5.25|5.25	4.03|4.03	0.46877|0.46877	.|Kelch-type beta propeller (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.49133|0.49133	0.1539|0.1539	N|N	0.04090|0.04090	-0.28|-0.28	0.49687|0.49687	D|D	0.999813|0.999813	.|D	.|0.76494	.|0.999	.|D	.|0.75020	.|0.985	T|T	0.43750|0.43750	-0.9372|-0.9372	5|10	.|0.16420	.|T	.|0.52	.|.	10.3918|10.3918	0.44175|0.44175	0.1462:0.0:0.0:0.8538|0.1462:0.0:0.0:0.8538	.|.	.|246	.|Q9P2K6	.|KLDC5_HUMAN	P|H	67|246	.|ENSP00000370671:Y246H	.|ENSP00000370671:Y246H	L|Y	+|+	2|1	0|0	KLHDC5|KLHDC5	27825266|27825266	1.000000|1.000000	0.71417|0.71417	0.873000|0.873000	0.34254|0.34254	0.982000|0.982000	0.71751|0.71751	4.871000|4.871000	0.63042|0.63042	1.995000|1.995000	0.58328|0.58328	0.477000|0.477000	0.44152|0.44152	CTA|TAT	.	.		0.597	KLHL42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402904.1	NM_020782	
FMNL3	91010	hgsc.bcm.edu	37	12	50042064	50042064	+	Missense_Mutation	SNP	C	C	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:50042064C>G	ENST00000293590.5	-	22	2821	c.2588G>C	c.(2587-2589)aGc>aCc	p.S863T	FMNL3_ENST00000352151.5_Missense_Mutation_p.S812T|FMNL3_ENST00000335154.5_Missense_Mutation_p.S863T|FMNL3_ENST00000550488.1_Missense_Mutation_p.S863T			Q8IVF7	FMNL3_HUMAN	formin-like 3	863	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						GTCATGGATGCTGCACTCACG	0.597																																					p.S863T		Atlas-SNP	.											.	FMNL3	137	.	0			c.G2588C						.						97.0	102.0	101.0					12																	50042064		2156	4256	6412	SO:0001583	missense	91010	exon22			TGGATGCTGCACT	AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.2588G>C	chr12.hg19:g.50042064C>G	ENSP00000293590:p.Ser863Thr	70.0	0.0		87.0	12.0	NM_175736	B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	ENST00000293590.5	hg19		.	.	.	.	.	.	.	.	.	.	C	10.57	1.386580	0.25031	.	.	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000352151;ENST00000293590	T;T;T;T	0.17054	2.3;2.3;2.3;2.3	4.79	4.79	0.61399	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.193529	0.52532	D	0.000067	T	0.12433	0.0302	N	0.20445	0.575	0.46167	D	0.998907	B;B;B	0.29085	0.041;0.232;0.157	B;B;B	0.33521	0.036;0.147;0.165	T	0.10497	-1.0627	10	0.37606	T	0.19	.	10.6975	0.45907	0.0:0.9109:0.0:0.0891	.	812;863;863	Q8IVF7-2;Q8IVF7-3;Q8IVF7	.;.;FMNL3_HUMAN	T	863;863;812;863	ENSP00000335655:S863T;ENSP00000447479:S863T;ENSP00000344311:S812T;ENSP00000293590:S863T	ENSP00000293590:S863T	S	-	2	0	FMNL3	48328331	0.844000	0.29557	0.980000	0.43619	0.921000	0.55340	0.941000	0.29005	2.655000	0.90218	0.655000	0.94253	AGC	.	.		0.597	FMNL3-201	KNOWN	basic	protein_coding	protein_coding		NM_175736	
KRT79	338785	hgsc.bcm.edu	37	12	53227586	53227586	+	Silent	SNP	G	G	A	rs376301539		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:53227586G>A	ENST00000330553.5	-	1	493	c.459C>T	c.(457-459)ttC>ttT	p.F153F		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	153	Coil 1A.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGAAGGAGGCGAACTTGTTGT	0.607																																					p.F153F		Atlas-SNP	.											KRT79,bladder,carcinoma,0,1	KRT79	78	.	0			c.C459T						.	G		3,4403	6.2+/-15.9	0,3,2200	128.0	126.0	127.0		459	-8.5	0.4	12		127	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KRT79	NM_175834.2		0,4,6499	AA,AG,GG		0.0116,0.0681,0.0308		153/536	53227586	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	338785	exon1			GGAGGCGAACTTG	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.459C>T	chr12.hg19:g.53227586G>A		95.0	0.0		91.0	22.0	NM_175834	Q6P465|Q7Z793	Silent	SNP	ENST00000330553.5	hg19	CCDS8839.1																																																																																			.	.		0.607	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
PTPRB	5787	hgsc.bcm.edu	37	12	70983909	70983909	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:70983909G>A	ENST00000261266.5	-	6	1260	c.1231C>T	c.(1231-1233)Cta>Tta	p.L411L	PTPRB_ENST00000451516.2_Intron|PTPRB_ENST00000550358.1_Silent_p.L629L|PTPRB_ENST00000538708.1_Silent_p.L411L|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000334414.6_Silent_p.L629L|PTPRB_ENST00000550857.1_Intron|PTPRB_ENST00000551525.1_Silent_p.L628L	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	411	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TTGAAGAGTAGGATCCGATAC	0.507											OREG0021990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L629L		Atlas-SNP	.											.	PTPRB	676	.	0			c.C1885T						.						129.0	130.0	130.0					12																	70983909		2007	4194	6201	SO:0001819	synonymous_variant	5787	exon8			AGAGTAGGATCCG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1231C>T	chr12.hg19:g.70983909G>A		141.0	0.0	1126	146.0	14.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	hg19	CCDS44944.1																																																																																			.	.		0.507	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
PTPRB	5787	hgsc.bcm.edu	37	12	70983921	70983921	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:70983921G>A	ENST00000261266.5	-	6	1248	c.1219C>T	c.(1219-1221)Cag>Tag	p.Q407*	PTPRB_ENST00000451516.2_Intron|PTPRB_ENST00000550358.1_Nonsense_Mutation_p.Q625*|PTPRB_ENST00000538708.1_Nonsense_Mutation_p.Q407*|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000334414.6_Nonsense_Mutation_p.Q625*|PTPRB_ENST00000550857.1_Intron|PTPRB_ENST00000551525.1_Nonsense_Mutation_p.Q624*	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	407	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			ATCCGATACTGCTCCCAGTCT	0.507											OREG0021990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q625X		Atlas-SNP	.											.	PTPRB	676	.	0			c.C1873T						.						122.0	122.0	122.0					12																	70983921		1998	4193	6191	SO:0001587	stop_gained	5787	exon8			GATACTGCTCCCA	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1219C>T	chr12.hg19:g.70983921G>A	ENSP00000261266:p.Gln407*	146.0	0.0	1126	148.0	13.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Nonsense_Mutation	SNP	ENST00000261266.5	hg19	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	G	36	5.602099	0.96614	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000538708;ENST00000261266;ENST00000551525;ENST00000548122	.	.	.	5.63	2.76	0.32466	.	0.581795	0.18753	N	0.132136	.	.	.	.	.	.	0.30472	N	0.773229	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	7.2451	0.26117	0.1333:0.0:0.5032:0.3634	.	.	.	.	X	625;625;625;407;407;624;504	.	ENSP00000261266:Q407X	Q	-	1	0	PTPRB	69270188	0.439000	0.25610	0.976000	0.42696	0.976000	0.68499	1.263000	0.33004	0.709000	0.31976	0.655000	0.94253	CAG	.	.		0.507	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
CAPS2	84698	hgsc.bcm.edu	37	12	75678791	75678791	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:75678791G>A	ENST00000409445.3	-	16	1718	c.1522C>T	c.(1522-1524)Cgt>Tgt	p.R508C	RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000442339.2_Missense_Mutation_p.R98C|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000409799.1_Missense_Mutation_p.R426C|CAPS2_ENST00000393284.3_Missense_Mutation_p.R276C	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	508	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						ATAATACCACGTTTGAATTCT	0.313																																					p.R508C		Atlas-SNP	.											CAPS2_ENST00000409445,colon,carcinoma,0,2	CAPS2	96	.	0			c.C1522T						.						131.0	118.0	122.0					12																	75678791		2203	4300	6503	SO:0001583	missense	84698	exon16			TACCACGTTTGAA	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1522C>T	chr12.hg19:g.75678791G>A	ENSP00000386959:p.Arg508Cys	53.0	0.0		79.0	16.0	NM_032606	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	ENST00000409445.3	hg19	CCDS9008.2	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413460	0.25465	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284;ENST00000442339	T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59	5.53	4.64	0.57946	EF-hand-like domain (1);	0.221670	0.38837	N	0.001548	T	0.66665	0.2812	M	0.71581	2.175	0.58432	D	0.999991	P;B;P;B;B	0.43412	0.456;0.084;0.806;0.394;0.211	B;B;B;B;B	0.34931	0.089;0.021;0.192;0.076;0.052	T	0.70292	-0.4912	10	0.44086	T	0.13	-6.2187	14.4315	0.67254	0.0707:0.0:0.9293:0.0	.	98;276;244;508;426	A2RRN2;Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;.;CAYP2_HUMAN;.	C	426;508;244;276;98	ENSP00000386977:R426C;ENSP00000386959:R508C;ENSP00000376963:R276C;ENSP00000389633:R98C	ENSP00000367975:R244C	R	-	1	0	CAPS2	73965058	0.987000	0.35691	0.958000	0.39756	0.027000	0.11550	3.983000	0.56916	1.471000	0.48121	0.650000	0.86243	CGT	.	.		0.313	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327880.2		
PLXNC1	10154	hgsc.bcm.edu	37	12	94543433	94543433	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:94543433C>T	ENST00000258526.4	+	1	935	c.686C>T	c.(685-687)gCg>gTg	p.A229V		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	229	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TGCGAGGGCGCGGGCAGCCTG	0.692																																					p.A229V		Atlas-SNP	.											.	PLXNC1	135	.	0			c.C686T						.						25.0	30.0	28.0					12																	94543433		2160	4277	6437	SO:0001583	missense	10154	exon1			AGGGCGCGGGCAG	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.686C>T	chr12.hg19:g.94543433C>T	ENSP00000258526:p.Ala229Val	86.0	0.0		109.0	16.0	NM_005761	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	hg19	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717256	0.30413	.	.	ENSG00000136040	ENST00000258526	T	0.04454	3.62	5.04	0.625	0.17665	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	1.228560	0.05696	N	0.593164	T	0.04724	0.0128	L	0.40543	1.245	0.31950	N	0.609752	B	0.14012	0.009	B	0.06405	0.002	T	0.38714	-0.9648	10	0.54805	T	0.06	.	1.6628	0.02796	0.2562:0.3207:0.2776:0.1455	.	229	O60486	PLXC1_HUMAN	V	229	ENSP00000258526:A229V	ENSP00000258526:A229V	A	+	2	0	PLXNC1	93067564	0.099000	0.21834	0.268000	0.24571	0.995000	0.86356	0.320000	0.19540	0.118000	0.18165	0.561000	0.74099	GCG	.	.		0.692	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
MAPKAPK5	8550	hgsc.bcm.edu	37	12	112327908	112327908	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:112327908C>T	ENST00000551404.2	+	13	1395	c.1287C>T	c.(1285-1287)tgC>tgT	p.C429C	MAPKAPK5_ENST00000550735.2_Silent_p.C427C			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	429					activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(11)|ovary(1)	13						ACCGGGAATGCAAACTCCTAA	0.428																																					p.C429C		Atlas-SNP	.											.	MAPKAPK5	56	.	0			c.C1287T						.						66.0	64.0	65.0					12																	112327908		1896	4121	6017	SO:0001819	synonymous_variant	8550	exon13			GGAATGCAAACTC	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.1287C>T	chr12.hg19:g.112327908C>T		105.0	0.0		102.0	22.0	NM_139078	B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Silent	SNP	ENST00000551404.2	hg19	CCDS44975.1																																																																																			.	.		0.428	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078	
HECTD4	283450	hgsc.bcm.edu	37	12	112613605	112613605	+	Silent	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:112613605G>T	ENST00000430131.2	-	65	11408	c.10263C>A	c.(10261-10263)gcC>gcA	p.A3421A	HECTD4_ENST00000377560.5_Silent_p.A3671A|HECTD4_ENST00000550722.1_Silent_p.A3697A			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3421					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TATCTTGCCTGGCTCGGTCAA	0.502																																					p.A3709A		Atlas-SNP	.											.	.	.	.	0			c.C11127A						.						67.0	71.0	70.0					12																	112613605		1939	4134	6073	SO:0001819	synonymous_variant	283450	exon66			TTGCCTGGCTCGG	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.10263C>A	chr12.hg19:g.112613605G>T		135.0	0.0		115.0	5.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	ENST00000430131.2	hg19																																																																																				.	.		0.502	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
DTX1	1840	hgsc.bcm.edu	37	12	113534661	113534661	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:113534661G>A	ENST00000257600.3	+	9	2283	c.1780G>A	c.(1780-1782)Ggc>Agc	p.G594S	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	594					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CACGGGCCACGGCTACCCGGA	0.627																																					p.G594S		Atlas-SNP	.											.	DTX1	83	.	0			c.G1780A						.						79.0	56.0	64.0					12																	113534661		2203	4300	6503	SO:0001583	missense	1840	exon9			GGCCACGGCTACC	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1780G>A	chr12.hg19:g.113534661G>A	ENSP00000257600:p.Gly594Ser	66.0	0.0		48.0	10.0	NM_004416	O60630|Q9BS04	Missense_Mutation	SNP	ENST00000257600.3	hg19	CCDS9164.1	.	.	.	.	.	.	.	.	.	.	G	34	5.331477	0.95733	.	.	ENSG00000135144	ENST00000257600	T	0.49139	0.79	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.71392	0.3334	M	0.87097	2.86	0.80722	D	1	D	0.71674	0.998	D	0.64776	0.929	T	0.76372	-0.2983	10	0.51188	T	0.08	-0.4624	17.065	0.86556	0.0:0.0:1.0:0.0	.	594	Q86Y01	DTX1_HUMAN	S	594	ENSP00000257600:G594S	ENSP00000257600:G594S	G	+	1	0	DTX1	112019044	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	9.790000	0.99075	2.306000	0.77630	0.561000	0.74099	GGC	.	.		0.627	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405045.2		
RBM19	9904	hgsc.bcm.edu	37	12	114392958	114392958	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:114392958C>A	ENST00000545145.2	-	7	977	c.899G>T	c.(898-900)gGa>gTa	p.G300V	RBM19_ENST00000392561.3_Missense_Mutation_p.G300V|RBM19_ENST00000261741.5_Missense_Mutation_p.G300V	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	300	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					GAACGGGGCTCCCCGCAGCTT	0.577																																					p.G300V		Atlas-SNP	.											.	RBM19	117	.	0			c.G899T						.						146.0	130.0	136.0					12																	114392958		2203	4300	6503	SO:0001583	missense	9904	exon7			GGGGCTCCCCGCA	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.899G>T	chr12.hg19:g.114392958C>A	ENSP00000442053:p.Gly300Val	93.0	0.0		72.0	9.0	NM_001146699	A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	ENST00000545145.2	hg19	CCDS9172.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728349	0.89390	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.12361	2.69;2.69;2.69	5.05	5.05	0.67936	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.53318	0.1789	H	0.97186	3.955	0.80722	D	1	D	0.64830	0.994	D	0.73380	0.98	T	0.70995	-0.4720	10	0.62326	D	0.03	-12.6066	17.9972	0.89187	0.0:1.0:0.0:0.0	.	300	Q9Y4C8	RBM19_HUMAN	V	300	ENSP00000442053:G300V;ENSP00000376344:G300V;ENSP00000261741:G300V	ENSP00000261741:G300V	G	-	2	0	RBM19	112877341	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.141000	0.77330	2.353000	0.79882	0.655000	0.94253	GGA	.	.		0.577	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	
MLXIP	22877	hgsc.bcm.edu	37	12	122625584	122625584	+	Silent	SNP	G	G	A	rs561027162	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:122625584G>A	ENST00000319080.7	+	16	2724	c.2592G>A	c.(2590-2592)gcG>gcA	p.A864A	MLXIP_ENST00000538698.1_Silent_p.A471A					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		ACCGGACGGCGCTCTCCTGGC	0.622													G|||	2	0.000399361	0.0	0.0	5008	,	,		18872	0.001		0.001	False		,,,				2504	0.0				p.A864A	Esophageal Squamous(105;787 1493 16200 18566 52466)	Atlas-SNP	.											.	MLXIP	46	.	0			c.G2592A						.						55.0	56.0	55.0					12																	122625584		2114	4222	6336	SO:0001819	synonymous_variant	22877	exon16			GACGGCGCTCTCC	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2592G>A	chr12.hg19:g.122625584G>A		47.0	0.0		41.0	20.0	NM_014938		Silent	SNP	ENST00000319080.7	hg19																																																																																				.	.		0.622	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938	
PITPNM2	57605	hgsc.bcm.edu	37	12	123481370	123481370	+	Silent	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:123481370G>T	ENST00000542749.1	-	10	1623	c.1560C>A	c.(1558-1560)tcC>tcA	p.S520S	PITPNM2_ENST00000392428.1_Silent_p.S241S|PITPNM2_ENST00000280562.5_Silent_p.S520S|PITPNM2_ENST00000320201.4_Silent_p.S520S			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	520					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		ACTGGGGGGAGGAGGTGGCCA	0.627																																					p.S520S		Atlas-SNP	.											.	PITPNM2	105	.	0			c.C1560A						.						49.0	50.0	50.0					12																	123481370		2202	4300	6502	SO:0001819	synonymous_variant	57605	exon11			GGGGGAGGAGGTG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.1560C>A	chr12.hg19:g.123481370G>T		119.0	0.0		102.0	56.0	NM_020845	Q9P271	Silent	SNP	ENST00000542749.1	hg19	CCDS9242.1																																																																																			.	.		0.627	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
TMEM132D	121256	hgsc.bcm.edu	37	12	130015679	130015679	+	Missense_Mutation	SNP	T	T	C	rs540786652		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:130015679T>C	ENST00000422113.2	-	3	1366	c.1040A>G	c.(1039-1041)gAg>gGg	p.E347G		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	347					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		ATCCGTGCGCTCCTTGACATC	0.532																																					p.E347G		Atlas-SNP	.											.	TMEM132D	299	.	0			c.A1040G						.						117.0	108.0	111.0					12																	130015679		2203	4300	6503	SO:0001583	missense	121256	exon3			GTGCGCTCCTTGA	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1040A>G	chr12.hg19:g.130015679T>C	ENSP00000408581:p.Glu347Gly	84.0	0.0		103.0	5.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	hg19	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	T	9.282	1.048383	0.19827	.	.	ENSG00000151952	ENST00000422113	T	0.13778	2.56	5.09	2.67	0.31697	.	0.244803	0.27682	N	0.018294	T	0.11665	0.0284	L	0.55481	1.735	0.09310	N	1	B	0.33238	0.403	B	0.30782	0.12	T	0.19582	-1.0301	9	.	.	.	-9.0924	6.6242	0.22820	0.0:0.079:0.1547:0.7663	.	347	Q14C87	T132D_HUMAN	G	347	ENSP00000408581:E347G	.	E	-	2	0	TMEM132D	128581632	0.095000	0.21747	0.003000	0.11579	0.092000	0.18411	1.729000	0.38115	0.263000	0.21812	0.533000	0.62120	GAG	.	.		0.532	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
STX2	2054	hgsc.bcm.edu	37	12	131283121	131283121	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:131283121G>A	ENST00000392373.2	-	9	829	c.735C>T	c.(733-735)caC>caT	p.H245H	STX2_ENST00000261653.6_Silent_p.H245H	NM_194356.2	NP_919337.1	P32856	STX2_HUMAN	syntaxin 2	245	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				acrosome reaction (GO:0007340)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|intracellular protein transport (GO:0006886)|organ morphogenesis (GO:0009887)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|signal transduction (GO:0007165)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)	calcium-dependent protein binding (GO:0048306)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)	16	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		CTTCTTTAGCGTGTTCTACAT	0.333																																					p.H245H		Atlas-SNP	.											.	STX2	66	.	0			c.C735T						.						304.0	265.0	278.0					12																	131283121		2202	4299	6501	SO:0001819	synonymous_variant	2054	exon9			TTTAGCGTGTTCT	D14582	CCDS9269.1, CCDS9270.1	12q24	2008-02-05	2006-04-25	2006-04-25	ENSG00000111450	ENSG00000111450			3403	protein-coding gene	gene with protein product		132350	"""epimorphin"""	STX2B, STX2C, STX2A, EPIM		8938452, 15943887	Standard	NM_001980		Approved	EPM	uc001uio.4	P32856	OTTHUMG00000168365	ENST00000392373.2:c.735C>T	chr12.hg19:g.131283121G>A		67.0	0.0		75.0	7.0	NM_194356	Q86VW8	Silent	SNP	ENST00000392373.2	hg19	CCDS9270.1																																																																																			.	.		0.333	STX2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399455.2	NM_194356	
TPTE2	93492	hgsc.bcm.edu	37	13	20004677	20004677	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:20004677A>G	ENST00000400230.2	-	17	1277	c.1233T>C	c.(1231-1233)tgT>tgC	p.C411C	TPTE2_ENST00000255310.6_Silent_p.C334C|TPTE2_ENST00000457266.2_Silent_p.C300C|TPTE2_ENST00000390680.2_Silent_p.C334C|TPTE2_ENST00000400103.2_Silent_p.C300C|TPTE2_ENST00000382977.4_Silent_p.C411C|TPTE2_ENST00000382978.1_Silent_p.C371C|TPTE2_ENST00000382975.4_Silent_p.C371C			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	411	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CTTTTAGATCACATACATCAC	0.318																																					p.C411C		Atlas-SNP	.											.	TPTE2	225	.	0			c.T1233C						.						64.0	57.0	60.0					13																	20004677		2202	4298	6500	SO:0001819	synonymous_variant	93492	exon18			TAGATCACATACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1233T>C	chr13.hg19:g.20004677A>G		267.0	0.0		238.0	73.0	NM_199254	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	ENST00000400230.2	hg19	CCDS45014.1																																																																																			.	.		0.318	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
CENPJ	55835	hgsc.bcm.edu	37	13	25480425	25480425	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:25480425G>A	ENST00000381884.4	-	7	1936	c.1751C>T	c.(1750-1752)gCt>gTt	p.A584V	CENPJ_ENST00000545981.1_Missense_Mutation_p.A584V	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	584					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		TTCATCAGCAGCTTGTTCTAA	0.358																																					p.A584V		Atlas-SNP	.											.	CENPJ	116	.	0			c.C1751T						.						49.0	55.0	53.0					13																	25480425		2203	4300	6503	SO:0001583	missense	55835	exon7			TCAGCAGCTTGTT	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.1751C>T	chr13.hg19:g.25480425G>A	ENSP00000371308:p.Ala584Val	95.0	0.0		86.0	28.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	ENST00000381884.4	hg19	CCDS9310.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729922	0.89390	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.70516	-0.49;0.04	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	D	0.85331	0.5672	M	0.78637	2.42	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	D	0.85703	0.1314	10	0.72032	D	0.01	.	19.3185	0.94226	0.0:0.0:1.0:0.0	.	584	Q9HC77	CENPJ_HUMAN	V	584	ENSP00000371308:A584V;ENSP00000441090:A584V	ENSP00000371308:A584V	A	-	2	0	CENPJ	24378425	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.983000	0.70540	2.850000	0.98022	0.650000	0.86243	GCT	.	.		0.358	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
DCLK1	9201	hgsc.bcm.edu	37	13	36700191	36700191	+	Silent	SNP	G	G	A	rs373323934		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:36700191G>A	ENST00000360631.3	-	2	295	c.84C>T	c.(82-84)aaC>aaT	p.N28N	DCLK1_ENST00000379892.4_Silent_p.N28N|DCLK1_ENST00000255448.4_Silent_p.N28N			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	28					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TCGGCAGGCCGTTCACCCGCG	0.612																																					p.N28N		Atlas-SNP	.											DCLK1_ENST00000255448,colon,carcinoma,0,6	DCLK1	350	.	0			c.C84T						.	G		0,4406		0,0,2203	65.0	64.0	64.0		84	-3.9	1.0	13		64	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DCLK1	NM_004734.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		28/730	36700191	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9201	exon2			CAGGCCGTTCACC	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.84C>T	chr13.hg19:g.36700191G>A		48.0	0.0		63.0	18.0	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Silent	SNP	ENST00000360631.3	hg19																																																																																				.	.		0.612	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
SOHLH2	54937	hgsc.bcm.edu	37	13	36765969	36765969	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:36765969C>T	ENST00000379881.3	-	5	581	c.493G>A	c.(493-495)Gaa>Aaa	p.E165K	SOHLH2_ENST00000317764.6_Missense_Mutation_p.E165K|SOHLH2_ENST00000554962.1_Missense_Mutation_p.E242K|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.E242K	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	165					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		CCCAGGTGTTCGCTGTAGGAC	0.378																																					p.E242K		Atlas-SNP	.											.	.	.	.	0			c.G724A						.						119.0	123.0	122.0					13																	36765969		2203	4300	6503	SO:0001583	missense	100526761	exon10			GGTGTTCGCTGTA	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.493G>A	chr13.hg19:g.36765969C>T	ENSP00000369210:p.Glu165Lys	208.0	0.0		179.0	29.0	NM_001198910	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	hg19	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	c	16.25	3.070052	0.55539	.	.	ENSG00000120669;ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000317764;ENST00000511166	T;T;T;T	0.50001	1.34;1.33;0.76;1.33	5.12	3.41	0.39046	.	0.329961	0.26345	N	0.024918	T	0.27384	0.0672	L	0.29908	0.895	0.09310	N	0.999997	P;P	0.43169	0.58;0.8	B;B	0.29077	0.098;0.098	T	0.18587	-1.0332	10	0.59425	D	0.04	0.7929	8.0186	0.30395	0.0:0.8168:0.0:0.1832	.	242;165	B4DX90;Q9NX45	.;SOLH2_HUMAN	K	165;242;165;242	ENSP00000369210:E165K;ENSP00000451542:E242K;ENSP00000326838:E165K;ENSP00000421868:E242K	ENSP00000421868:E242K	E	-	1	0	CCDC169-SOHLH2;SOHLH2	35663969	0.872000	0.30054	0.344000	0.25628	0.060000	0.15804	1.817000	0.39002	0.875000	0.35847	-0.213000	0.12676	GAA	.	.		0.378	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
TRIM13	10206	hgsc.bcm.edu	37	13	50586446	50586446	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:50586446A>G	ENST00000378182.3	+	2	1108	c.370A>G	c.(370-372)Acc>Gcc	p.T124A	TRIM13_ENST00000478111.1_Intron|TRIM13_ENST00000420995.2_Missense_Mutation_p.T124A|KCNRG_ENST00000312942.1_5'Flank|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000298772.5_Missense_Mutation_p.T127A|TRIM13_ENST00000356017.4_Missense_Mutation_p.T127A|TRIM13_ENST00000457662.2_Missense_Mutation_p.T124A	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	124					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		TGGGGAGCACACCAAACATGT	0.507																																					p.T127A		Atlas-SNP	.											.	TRIM13	30	.	0			c.A379G						.						141.0	128.0	132.0					13																	50586446		2203	4300	6503	SO:0001583	missense	10206	exon4			GAGCACACCAAAC	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.370A>G	chr13.hg19:g.50586446A>G	ENSP00000367424:p.Thr124Ala	144.0	0.0		112.0	23.0	NM_001007278	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Missense_Mutation	SNP	ENST00000378182.3	hg19	CCDS9423.1	.	.	.	.	.	.	.	.	.	.	A	11.44	1.640375	0.29157	.	.	ENSG00000204977	ENST00000442421;ENST00000378183;ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.4	4.22	0.49857	Zinc finger, B-box (3);	0.166402	0.51477	N	0.000081	T	0.28034	0.0691	N	0.19112	0.55	0.26035	N	0.981682	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.003	T	0.17623	-1.0363	10	0.48119	T	0.1	-1.196	10.9053	0.47076	0.9261:0.0:0.0739:0.0	.	124;127	O60858;O60858-3	TRI13_HUMAN;.	A	124;124;124;124;127;124;127	ENSP00000404586:T124A;ENSP00000367425:T124A;ENSP00000412943:T124A;ENSP00000367424:T124A;ENSP00000348299:T127A;ENSP00000399206:T124A;ENSP00000298772:T127A	ENSP00000298772:T127A	T	+	1	0	TRIM13	49484447	0.988000	0.35896	0.998000	0.56505	0.957000	0.61999	3.432000	0.52824	0.889000	0.36185	0.533000	0.62120	ACC	.	.		0.507	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
THSD1	55901	hgsc.bcm.edu	37	13	52952234	52952234	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:52952234A>G	ENST00000258613.4	-	5	2049	c.1871T>C	c.(1870-1872)cTg>cCg	p.L624P	THSD1_ENST00000544466.1_Missense_Mutation_p.L245P|THSD1_ENST00000349258.4_Missense_Mutation_p.L571P	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	624					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CTTGCGGATCAGAGTCTGGCT	0.617																																					p.L624P		Atlas-SNP	.											.	THSD1	89	.	0			c.T1871C						.						49.0	48.0	49.0					13																	52952234		2203	4300	6503	SO:0001583	missense	55901	exon5			CGGATCAGAGTCT	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1871T>C	chr13.hg19:g.52952234A>G	ENSP00000258613:p.Leu624Pro	68.0	0.0		43.0	18.0	NM_018676	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	ENST00000258613.4	hg19	CCDS9432.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715188	0.48622	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.36340	1.98;1.26;2.16	5.34	5.34	0.76211	.	0.294110	0.28262	N	0.015981	T	0.54398	0.1856	L	0.53249	1.67	0.40322	D	0.978834	D;D	0.76494	0.988;0.999	P;D	0.68192	0.885;0.956	T	0.59037	-0.7529	10	0.87932	D	0	-7.7746	14.5637	0.68159	1.0:0.0:0.0:0.0	.	571;624	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	P	571;245;624	ENSP00000340650:L571P;ENSP00000438512:L245P;ENSP00000258613:L624P	ENSP00000258613:L624P	L	-	2	0	THSD1	51850235	0.907000	0.30839	0.075000	0.20258	0.554000	0.35429	3.938000	0.56583	2.030000	0.59900	0.451000	0.29950	CTG	.	.		0.617	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3		
KLF12	11278	hgsc.bcm.edu	37	13	74289619	74289619	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:74289619G>A	ENST00000377669.2	-	6	939	c.913C>T	c.(913-915)Cgg>Tgg	p.R305W	KLF12_ENST00000377666.4_Missense_Mutation_p.R305W	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	305					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		GATTCAGACCGTCTCTGGCGT	0.463																																					p.R305W		Atlas-SNP	.											.	KLF12	42	.	0			c.C913T						.						142.0	127.0	132.0					13																	74289619		2203	4300	6503	SO:0001583	missense	11278	exon7			CAGACCGTCTCTG	AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.913C>T	chr13.hg19:g.74289619G>A	ENSP00000366897:p.Arg305Trp	138.0	0.0		137.0	15.0	NM_007249	A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Missense_Mutation	SNP	ENST00000377669.2	hg19	CCDS9449.1	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595308	0.66219	.	.	ENSG00000118922	ENST00000377669;ENST00000342812;ENST00000377666	T;T	0.06849	3.25;3.25	5.81	4.01	0.46588	.	0.054133	0.64402	D	0.000001	T	0.21921	0.0528	M	0.75085	2.285	0.51482	D	0.999925	D	0.89917	1.0	P	0.56278	0.795	T	0.00964	-1.1498	10	0.37606	T	0.19	.	13.6405	0.62249	0.0:0.0:0.4399:0.5601	.	305	Q9Y4X4	KLF12_HUMAN	W	305	ENSP00000366897:R305W;ENSP00000366894:R305W	ENSP00000344057:R305W	R	-	1	2	KLF12	73187620	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	2.547000	0.45786	0.719000	0.32188	0.655000	0.94253	CGG	.	.		0.463	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045271.2	NM_007249	
TUBGCP3	10426	hgsc.bcm.edu	37	13	113212590	113212590	+	Silent	SNP	G	G	A	rs541731896	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr13:113212590G>A	ENST00000261965.3	-	5	654	c.468C>T	c.(466-468)agC>agT	p.S156S	TUBGCP3_ENST00000375669.3_Silent_p.S156S	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	156					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					TGCTGCCCACGCTGCCGGAGC	0.627													G|||	4	0.000798722	0.0	0.0	5008	,	,		17009	0.004		0.0	False		,,,				2504	0.0				p.S156S		Atlas-SNP	.											.	TUBGCP3	74	.	0			c.C468T						.						72.0	71.0	71.0					13																	113212590		2203	4300	6503	SO:0001819	synonymous_variant	10426	exon5			GCCCACGCTGCCG	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.468C>T	chr13.hg19:g.113212590G>A		108.0	0.0		103.0	16.0	NM_006322	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Silent	SNP	ENST00000261965.3	hg19	CCDS9525.1																																																																																			.	.		0.627	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045825.2	NM_006322	
NYNRIN	57523	hgsc.bcm.edu	37	14	24877347	24877347	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:24877347T>C	ENST00000382554.3	+	3	789	c.471T>C	c.(469-471)gcT>gcC	p.A157A		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	157					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TCTGGGAGGCTGAGGTGACCC	0.672																																					p.A157A		Atlas-SNP	.											.	NYNRIN	120	.	0			c.T471C						.						15.0	19.0	18.0					14																	24877347		1922	4105	6027	SO:0001819	synonymous_variant	57523	exon3			GGAGGCTGAGGTG	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.471T>C	chr14.hg19:g.24877347T>C		38.0	0.0		21.0	6.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Silent	SNP	ENST00000382554.3	hg19	CCDS45090.1																																																																																			.	.		0.672	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
SIX4	51804	hgsc.bcm.edu	37	14	61190367	61190367	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:61190367T>C	ENST00000216513.4	-	1	485	c.426A>G	c.(424-426)ctA>ctG	p.L142L		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	142					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		CGTTGCCACGTAGCAGGTCGC	0.687																																					p.L142L		Atlas-SNP	.											.	SIX4	69	.	0			c.A426G						.						8.0	9.0	9.0					14																	61190367		2178	4268	6446	SO:0001819	synonymous_variant	51804	exon1			GCCACGTAGCAGG	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.426A>G	chr14.hg19:g.61190367T>C		113.0	0.0		86.0	19.0	NM_017420	Q4QQH5|Q4V764	Silent	SNP	ENST00000216513.4	hg19	CCDS9749.2																																																																																			.	.		0.687	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
HEATR4	399671	hgsc.bcm.edu	37	14	73945440	73945440	+	Silent	SNP	G	G	A	rs78875724	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:73945440G>A	ENST00000553558.1	-	18	3273	c.2952C>T	c.(2950-2952)ccC>ccT	p.P984P	HEATR4_ENST00000560393.1_Silent_p.P937P|HEATR4_ENST00000566478.1_5'UTR|RP1-240K6.3_ENST00000515412.2_RNA|HEATR4_ENST00000334988.2_Silent_p.P984P	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	984										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TCCTTTTCTCGGGGGAGGTGC	0.478																																					p.P984P		Atlas-SNP	.											.	HEATR4	126	.	0			c.C2952T						.						136.0	124.0	128.0					14																	73945440		2203	4300	6503	SO:0001819	synonymous_variant	399671	exon17			TTTCTCGGGGGAG	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2952C>T	chr14.hg19:g.73945440G>A		173.0	0.0		170.0	12.0	NM_203309	B7Z7V9|E9KL41	Silent	SNP	ENST00000553558.1	hg19	CCDS9815.2																																																																																			.	G|0.962;T|0.038		0.478	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414422.2	NM_203309	
SAMD15	161394	hgsc.bcm.edu	37	14	77845085	77845085	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:77845085C>T	ENST00000216471.4	+	1	1610	c.1324C>T	c.(1324-1326)Cgt>Tgt	p.R442C	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	442										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GCTAGAGCACCGTGAGCCTAA	0.388																																					p.R442C		Atlas-SNP	.											.	SAMD15	60	.	0			c.C1324T						.						71.0	69.0	70.0					14																	77845085		2203	4300	6503	SO:0001583	missense	161394	exon1			GAGCACCGTGAGC	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1324C>T	chr14.hg19:g.77845085C>T	ENSP00000216471:p.Arg442Cys	178.0	0.0		143.0	41.0	NM_001010860	Q2M3P3	Missense_Mutation	SNP	ENST00000216471.4	hg19	CCDS32126.1	.	.	.	.	.	.	.	.	.	.	C	9.337	1.062073	0.19987	.	.	ENSG00000100583	ENST00000216471	T	0.18657	2.2	4.4	-0.0839	0.13692	.	.	.	.	.	T	0.11580	0.0282	L	0.34521	1.04	0.09310	N	1	P	0.40931	0.733	B	0.27796	0.083	T	0.12837	-1.0532	9	0.56958	D	0.05	1.411	7.7965	0.29150	0.0:0.6192:0.0:0.3808	.	442	Q9P1V8	SAM15_HUMAN	C	442	ENSP00000216471:R442C	ENSP00000216471:R442C	R	+	1	0	SAMD15	76914838	0.005000	0.15991	0.000000	0.03702	0.002000	0.02628	0.121000	0.15667	-0.124000	0.11724	0.555000	0.69702	CGT	.	.		0.388	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
PTPN21	11099	hgsc.bcm.edu	37	14	88970793	88970793	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:88970793A>G	ENST00000556564.1	-	6	847	c.563T>C	c.(562-564)gTg>gCg	p.V188A	PTPN21_ENST00000554628.1_5'UTR|RP11-507K2.2_ENST00000555444.1_RNA|PTPN21_ENST00000328736.3_Missense_Mutation_p.V188A	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	188	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TAGTAAGGCCACTTTTTGGGT	0.333																																					p.V188A		Atlas-SNP	.											.	PTPN21	113	.	0			c.T563C						.						193.0	180.0	185.0					14																	88970793		2203	4299	6502	SO:0001583	missense	11099	exon6			AAGGCCACTTTTT	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.563T>C	chr14.hg19:g.88970793A>G	ENSP00000452414:p.Val188Ala	96.0	0.0		77.0	12.0	NM_007039		Missense_Mutation	SNP	ENST00000556564.1	hg19	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.535202	0.85812	.	.	ENSG00000070778	ENST00000328736;ENST00000556564;ENST00000555243	T;T;T	0.81247	-1.47;-1.47;-1.47	5.3	5.3	0.74995	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.171358	0.40385	N	0.001106	D	0.88373	0.6419	M	0.70275	2.135	0.46823	D	0.999212	B;D	0.65815	0.448;0.995	P;D	0.66716	0.55;0.946	D	0.89778	0.3959	10	0.87932	D	0	.	15.5502	0.76145	1.0:0.0:0.0:0.0	.	188;188	G3V3S6;Q16825	.;PTN21_HUMAN	A	188	ENSP00000330276:V188A;ENSP00000452414:V188A;ENSP00000451401:V188A	ENSP00000330276:V188A	V	-	2	0	PTPN21	88040546	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.882000	0.92420	2.131000	0.65755	0.533000	0.62120	GTG	.	.		0.333	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
DLK1	8788	hgsc.bcm.edu	37	14	101200731	101200731	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:101200731G>A	ENST00000341267.4	+	5	892	c.650G>A	c.(649-651)tGc>tAc	p.C217Y	DLK1_ENST00000331224.6_Missense_Mutation_p.C217Y	NM_003836.5	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog (Drosophila)	217	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|negative regulation of Notch signaling pathway (GO:0045746)|Notch signaling pathway (GO:0007219)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(16)|ovary(2)|prostate(1)|skin(1)	29		Melanoma(154;0.155)				AGCAGCCCGTGCCAGAACGGG	0.657																																					p.C217Y		Atlas-SNP	.											.	DLK1	57	.	0			c.G650A						.						30.0	36.0	34.0					14																	101200731		2203	4300	6503	SO:0001583	missense	8788	exon5			GCCCGTGCCAGAA	U15979	CCDS9963.1	14q32	2011-12-05	2001-12-03			ENSG00000185559			2907	protein-coding gene	gene with protein product		176290	"""delta-like homolog (Drosophila)"""			8095043, 7925474	Standard	NM_003836		Approved	FA1, pG2, Pref-1, ZOG, Delta1	uc001yhs.4	P80370		ENST00000341267.4:c.650G>A	chr14.hg19:g.101200731G>A	ENSP00000340292:p.Cys217Tyr	111.0	0.0		95.0	33.0	NM_003836	P15803|Q96DW5	Missense_Mutation	SNP	ENST00000341267.4	hg19	CCDS9963.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837962	0.50951	.	.	ENSG00000185559	ENST00000341267;ENST00000331224	D;T	0.99992	-12.4;-0.98	4.7	4.7	0.59300	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99994	0.9999	H	0.99619	4.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99996	1.5401	10	0.87932	D	0	.	16.6457	0.85176	0.0:0.0:1.0:0.0	.	217;217	P80370-2;P80370	.;DLK1_HUMAN	Y	217	ENSP00000340292:C217Y;ENSP00000331081:C217Y	ENSP00000331081:C217Y	C	+	2	0	DLK1	100270484	1.000000	0.71417	0.983000	0.44433	0.034000	0.12701	9.853000	0.99521	2.149000	0.67028	0.491000	0.48974	TGC	.	.		0.657	DLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414389.1		
TRAF3	7187	hgsc.bcm.edu	37	14	103371803	103371803	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:103371803C>T	ENST00000560371.1	+	11	1606	c.1389C>T	c.(1387-1389)gaC>gaT	p.D463D	TRAF3_ENST00000347662.4_Silent_p.D438D|TRAF3_ENST00000392745.2_Silent_p.D463D|TRAF3_ENST00000351691.5_Silent_p.D438D|TRAF3_ENST00000539721.1_Silent_p.D380D	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	463	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.D463D(1)		breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		TGAACGGGGACGGGATGGGGA	0.527																																					p.D463D		Atlas-SNP	.											TRAF3,NS,carcinoma,+2,1	TRAF3	60	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1389T						.						208.0	183.0	192.0					14																	103371803		2203	4300	6503	SO:0001819	synonymous_variant	7187	exon12			CGGGGACGGGATG	U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.1389C>T	chr14.hg19:g.103371803C>T		149.0	0.0		89.0	13.0	NM_145725	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Silent	SNP	ENST00000560371.1	hg19	CCDS9975.1																																																																																			.	.		0.527	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415735.1	NM_145725	
OR4M2	390538	hgsc.bcm.edu	37	15	22369119	22369119	+	Missense_Mutation	SNP	A	A	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:22369119A>T	ENST00000332663.2	+	1	642	c.544A>T	c.(544-546)Aca>Tca	p.T182S	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTGTGACATCACACAGGTTGT	0.483																																					p.T182S		Atlas-SNP	.											.	OR4M2	140	.	0			c.A544T						.						285.0	218.0	241.0					15																	22369119		2203	4297	6500	SO:0001583	missense	390538	exon1			GACATCACACAGG	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.544A>T	chr15.hg19:g.22369119A>T	ENSP00000329467:p.Thr182Ser	312.0	0.0		245.0	23.0	NM_001004719	B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	hg19	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	12.64	1.999847	0.35320	.	.	ENSG00000182974	ENST00000332663	T	0.00069	8.77	2.5	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000095	T	0.00109	0.0003	N	0.05230	-0.09	0.24325	N	0.995025	B	0.29955	0.263	B	0.39465	0.3	T	0.17501	-1.0367	10	0.46703	T	0.11	-4.0207	8.5824	0.33637	1.0:0.0:0.0:0.0	.	182	Q8NGB6	OR4M2_HUMAN	S	182	ENSP00000329467:T182S	ENSP00000329467:T182S	T	+	1	0	OR4M2	19870483	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	0.858000	0.27845	1.167000	0.42706	0.368000	0.22195	ACA	.	.		0.483	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1		
GPR176	11245	hgsc.bcm.edu	37	15	40093624	40093624	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:40093624C>T	ENST00000561100.1	-	3	2122	c.1257G>A	c.(1255-1257)gcG>gcA	p.A419A	RP11-37C7.1_ENST00000558616.1_RNA|GPR176_ENST00000560729.1_5'Flank|GPR176_ENST00000299092.3_Silent_p.A418A|GPR176_ENST00000543580.1_Silent_p.A374A	NM_007223.1	NP_009154.1	Q14439	GP176_HUMAN	G protein-coupled receptor 176	419					G-protein coupled receptor signaling pathway (GO:0007186)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)	23		all_cancers(109;4.05e-15)|all_epithelial(112;2.96e-13)|Lung NSC(122;8.53e-11)|all_lung(180;2.71e-09)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;4.4e-06)|BRCA - Breast invasive adenocarcinoma(123;0.123)		GGGCAGAGGGCGCAAACTGTG	0.572																																					p.A419A		Atlas-SNP	.											.	GPR176	41	.	0			c.G1257A						.						139.0	136.0	137.0					15																	40093624		2203	4300	6503	SO:0001819	synonymous_variant	11245	exon3			AGAGGGCGCAAAC	BC067106	CCDS10051.1, CCDS61588.1, CCDS61589.1	15q14-q15.1	2012-08-21			ENSG00000166073	ENSG00000166073		"""GPCR / Class A : Orphans"""	32370	protein-coding gene	gene with protein product		612183				7893747	Standard	NM_007223		Approved	Gm1012	uc010uck.2	Q14439	OTTHUMG00000129873	ENST00000561100.1:c.1257G>A	chr15.hg19:g.40093624C>T		69.0	0.0		36.0	10.0	NM_007223	Q6NXF6	Silent	SNP	ENST00000561100.1	hg19	CCDS10051.1																																																																																			.	.		0.572	GPR176-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252117.2	NM_007223	
RPAP1	26015	hgsc.bcm.edu	37	15	41810241	41810241	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:41810241A>G	ENST00000304330.4	-	23	4051	c.3935T>C	c.(3934-3936)gTc>gCc	p.V1312A	RPAP1_ENST00000561603.1_Missense_Mutation_p.S1060P	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1312						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GAAGCTATTGACATGAGCCAC	0.562																																					p.V1312A		Atlas-SNP	.											.	RPAP1	111	.	0			c.T3935C						.						85.0	80.0	81.0					15																	41810241		2203	4300	6503	SO:0001583	missense	26015	exon23			CTATTGACATGAG	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.3935T>C	chr15.hg19:g.41810241A>G	ENSP00000306123:p.Val1312Ala	86.0	0.0		79.0	5.0	NM_015540	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	ENST00000304330.4	hg19	CCDS10079.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.906068	0.92107	.	.	ENSG00000103932	ENST00000304330	T	0.15834	2.39	5.23	5.23	0.72850	.	0.061949	0.64402	D	0.000005	T	0.23926	0.0579	M	0.66939	2.045	0.44247	D	0.997092	B	0.17038	0.02	B	0.24155	0.051	T	0.03086	-1.1074	10	0.62326	D	0.03	-10.574	15.302	0.73958	1.0:0.0:0.0:0.0	.	1312	Q9BWH6	RPAP1_HUMAN	A	1312	ENSP00000306123:V1312A	ENSP00000306123:V1312A	V	-	2	0	RPAP1	39597533	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	9.139000	0.94554	2.191000	0.70037	0.533000	0.62120	GTC	.	.		0.562	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540	
ZSCAN29	146050	hgsc.bcm.edu	37	15	43656143	43656143	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:43656143G>A	ENST00000396976.2	-	4	1794	c.1660C>T	c.(1660-1662)Cgt>Tgt	p.R554C	ZSCAN29_ENST00000562072.1_Intron|ZSCAN29_ENST00000568898.1_Intron|ZSCAN29_ENST00000396972.1_Intron	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	554					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		ACTGGAGCACGGGTTATGACA	0.443																																					p.R554C		Atlas-SNP	.											.	ZSCAN29	57	.	0			c.C1660T						.						79.0	70.0	73.0					15																	43656143		2201	4299	6500	SO:0001583	missense	146050	exon4			GAGCACGGGTTAT	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.1660C>T	chr15.hg19:g.43656143G>A	ENSP00000380174:p.Arg554Cys	104.0	0.0		109.0	11.0	NM_152455	B3KVB9|Q32M75|Q32M76|Q8NA40	Missense_Mutation	SNP	ENST00000396976.2	hg19	CCDS10095.2	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804248	0.50315	.	.	ENSG00000140265	ENST00000396976	T	0.08102	3.13	5.63	3.65	0.41850	.	0.536676	0.19852	N	0.104612	T	0.09512	0.0234	M	0.62723	1.935	0.80722	D	1	D	0.63880	0.993	B	0.41299	0.353	T	0.14924	-1.0455	10	0.37606	T	0.19	-1.332	8.3678	0.32397	0.0823:0.0:0.7635:0.1542	.	554	Q8IWY8	ZSC29_HUMAN	C	554	ENSP00000380174:R554C	ENSP00000380174:R554C	R	-	1	0	ZSCAN29	41443435	0.976000	0.34144	0.899000	0.35326	0.637000	0.38172	1.859000	0.39418	1.388000	0.46506	0.491000	0.48974	CGT	.	.		0.443	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455	
TRPM7	54822	hgsc.bcm.edu	37	15	50884267	50884267	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:50884267T>C	ENST00000313478.7	-	26	4446	c.4165A>G	c.(4165-4167)Act>Gct	p.T1389A	TRPM7_ENST00000560955.1_Missense_Mutation_p.T1389A	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1389					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		GGTATGCTAGTAGATGAACTG	0.398																																					p.T1389A		Atlas-SNP	.											.	TRPM7	145	.	0			c.A4165G						.						104.0	98.0	100.0					15																	50884267		1809	4082	5891	SO:0001583	missense	54822	exon26			TGCTAGTAGATGA	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.4165A>G	chr15.hg19:g.50884267T>C	ENSP00000320239:p.Thr1389Ala	71.0	0.0		66.0	8.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.301723	0.40694	.	.	ENSG00000092439	ENST00000313478	T	0.49720	0.77	6.04	4.92	0.64577	.	0.752659	0.13497	N	0.383521	T	0.28034	0.0691	N	0.08118	0	0.19575	N	0.999963	B	0.02656	0.0	B	0.01281	0.0	T	0.16541	-1.0399	10	0.20046	T	0.44	-9.5747	11.926	0.52819	0.0:0.0673:0.0:0.9327	.	1389	Q96QT4	TRPM7_HUMAN	A	1389	ENSP00000320239:T1389A	ENSP00000320239:T1389A	T	-	1	0	TRPM7	48671559	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	3.814000	0.55643	1.120000	0.41904	0.529000	0.55759	ACT	.	.		0.398	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	
SPG21	51324	hgsc.bcm.edu	37	15	65268816	65268816	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:65268816A>G	ENST00000204566.2	-	4	598	c.303T>C	c.(301-303)gaT>gaC	p.D101D	SPG21_ENST00000416889.2_Intron|SPG21_ENST00000560564.1_5'UTR|SPG21_ENST00000559199.1_5'UTR|SPG21_ENST00000433215.2_Silent_p.D101D	NM_016630.3	NP_057714.1	Q9NZD8	SPG21_HUMAN	spastic paraplegia 21 (autosomal recessive, Mast syndrome)	101					antigen receptor-mediated signaling pathway (GO:0050851)|cell death (GO:0008219)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network transport vesicle (GO:0030140)	CD4 receptor binding (GO:0042609)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10						TACTCACTTTATCCAATTGTA	0.358																																					p.D101D		Atlas-SNP	.											.	SPG21	29	.	0			c.T303C						.						51.0	52.0	52.0					15																	65268816		2202	4299	6501	SO:0001819	synonymous_variant	51324	exon4			CACTTTATCCAAT	AF208861	CCDS10198.1, CCDS45279.1	15q21-q22	2008-02-05	2007-04-23		ENSG00000090487	ENSG00000090487			20373	protein-coding gene	gene with protein product	"""maspardin"""	608181				11113139, 14564668	Standard	XM_006720564		Approved	ACP33, GL010, BM-019, MAST	uc002aoe.3	Q9NZD8	OTTHUMG00000133098	ENST00000204566.2:c.303T>C	chr15.hg19:g.65268816A>G		252.0	0.0		218.0	45.0	NM_001127889	B4DW44|Q6ZMB6	Silent	SNP	ENST00000204566.2	hg19	CCDS10198.1																																																																																			.	.		0.358	SPG21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256758.3	NM_016630	
ZWILCH	55055	hgsc.bcm.edu	37	15	66821892	66821892	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:66821892G>A	ENST00000307897.5	+	12	1516	c.1136G>A	c.(1135-1137)cGt>cAt	p.R379H	ZWILCH_ENST00000565627.1_Missense_Mutation_p.R265H|ZWILCH_ENST00000535141.2_Missense_Mutation_p.R265H|ZWILCH_ENST00000446801.2_Missense_Mutation_p.R265H	NM_017975.3	NP_060445.3	Q9H900	ZWILC_HUMAN	zwilch kinetochore protein	379					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(1)|lung(6)|ovary(1)	18						AGTCTACAACGTGGTGATATA	0.413																																					p.R379H		Atlas-SNP	.											.	ZWILCH	46	.	0			c.G1136A						.						169.0	157.0	161.0					15																	66821892		2201	4299	6500	SO:0001583	missense	55055	exon12			TACAACGTGGTGA	AK023175	CCDS10219.1, CCDS73746.1	15q22.31	2013-01-17	2012-12-13		ENSG00000174442	ENSG00000174442			25468	protein-coding gene	gene with protein product		609984	"""Zwilch, kinetochore associated, homolog (Drosophila)"""			12686595	Standard	NM_017975		Approved	FLJ10036, KNTC1AP	uc002aqb.3	Q9H900	OTTHUMG00000133194	ENST00000307897.5:c.1136G>A	chr15.hg19:g.66821892G>A	ENSP00000311429:p.Arg379His	71.0	0.0		45.0	9.0	NM_017975	B3KVB8|Q6N049|Q8N404|Q96SY7|Q9NWG7	Missense_Mutation	SNP	ENST00000307897.5	hg19	CCDS10219.1	.	.	.	.	.	.	.	.	.	.	G	7.962	0.747174	0.15710	.	.	ENSG00000174442	ENST00000307897;ENST00000446801;ENST00000535141	T;T;T	0.49432	0.78;0.78;0.78	5.68	3.81	0.43845	.	0.510391	0.23380	N	0.048807	T	0.35799	0.0944	L	0.48362	1.52	0.23120	N	0.998268	B	0.11235	0.004	B	0.06405	0.002	T	0.24333	-1.0163	10	0.12103	T	0.63	-3.5573	9.1237	0.36801	0.2851:0.0:0.7149:0.0	.	379	Q9H900	ZWILC_HUMAN	H	379;265;265	ENSP00000311429:R379H;ENSP00000402217:R265H;ENSP00000437749:R265H	ENSP00000311429:R379H	R	+	2	0	ZWILCH	64608946	0.120000	0.22244	0.696000	0.30242	0.907000	0.53573	0.470000	0.22084	0.754000	0.32968	0.563000	0.77884	CGT	.	.		0.413	ZWILCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256904.4	NM_017975	
REC114	283677	hgsc.bcm.edu	37	15	73832844	73832844	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:73832844G>T	ENST00000331090.6	+	3	296	c.268G>T	c.(268-270)Ggt>Tgt	p.G90C	C15orf60_ENST00000560581.1_Intron	NM_001042367.1	NP_001035826.1	Q7Z4M0	RE114_HUMAN		90					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17						TTCACTCATTGGTAGCAAGGA	0.378																																					p.G90C		Atlas-SNP	.											.	C15orf60	26	.	0			c.G268T						.						324.0	298.0	306.0					15																	73832844		1862	4088	5950	SO:0001583	missense	283677	exon3			CTCATTGGTAGCA																												ENST00000331090.6:c.268G>T	chr15.hg19:g.73832844G>T	ENSP00000328423:p.Gly90Cys	113.0	0.0		95.0	4.0	NM_001042367		Missense_Mutation	SNP	ENST00000331090.6	hg19	CCDS45296.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.943173	0.53079	.	.	ENSG00000183324	ENST00000331090	T	0.50277	0.75	4.97	3.98	0.46160	.	0.593958	0.17972	N	0.155808	T	0.58495	0.2126	L	0.48362	1.52	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.56111	-0.8033	10	0.46703	T	0.11	-9.4765	10.479	0.44682	0.0:0.197:0.803:0.0	.	90	Q7Z4M0	CO060_HUMAN	C	90	ENSP00000328423:G90C	ENSP00000328423:G90C	G	+	1	0	C15orf60	71619897	0.956000	0.32656	0.998000	0.56505	0.889000	0.51656	1.301000	0.33447	2.297000	0.77311	0.563000	0.77884	GGT	.	.		0.378	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419069.1		
C15orf59	388135	hgsc.bcm.edu	37	15	74043430	74043430	+	Silent	SNP	G	G	A	rs146110202		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:74043430G>A	ENST00000569673.1	-	2	1246	c.42C>T	c.(40-42)gaC>gaT	p.D14D	C15orf59_ENST00000379822.4_Silent_p.D14D			Q2T9L4	CO059_HUMAN	chromosome 15 open reading frame 59	14										breast(1)|endometrium(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TGCTGGGGTCGTCACTGGGCT	0.657																																					p.D14D		Atlas-SNP	.											.	C15orf59	38	.	0			c.C42T						.						65.0	58.0	60.0					15																	74043430		2198	4297	6495	SO:0001819	synonymous_variant	388135	exon1			GGGGTCGTCACTG		CCDS32289.1	15q24.1	2012-09-27			ENSG00000205363	ENSG00000205363			33753	protein-coding gene	gene with protein product							Standard	XM_005254369		Approved	MGC131524, LOC388135	uc002avy.3	Q2T9L4	OTTHUMG00000172556	ENST00000569673.1:c.42C>T	chr15.hg19:g.74043430G>A		46.0	0.0		41.0	6.0	NM_001039614		Silent	SNP	ENST00000569673.1	hg19	CCDS32289.1																																																																																			.	G|1.000;C|0.000		0.657	C15orf59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419077.2	NM_001039614	
AP3B2	8120	hgsc.bcm.edu	37	15	83357549	83357549	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:83357549T>C	ENST00000261722.3	-	4	506	c.299A>G	c.(298-300)tAc>tGc	p.Y100C	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Intron|AP3B2_ENST00000535359.1_Missense_Mutation_p.Y100C|AP3B2_ENST00000561455.1_5'UTR|AP3B2_ENST00000542200.1_Missense_Mutation_p.Y100C	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	100					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CTCCTCAGCGTAGCGTACCAG	0.607																																					p.Y100C		Atlas-SNP	.											.	AP3B2	103	.	0			c.A299G						.						77.0	83.0	81.0					15																	83357549		2120	4237	6357	SO:0001583	missense	8120	exon4			TCAGCGTAGCGTA	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.299A>G	chr15.hg19:g.83357549T>C	ENSP00000261722:p.Tyr100Cys	102.0	0.0		81.0	11.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	hg19	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.800788	0.90538	.	.	ENSG00000103723	ENST00000261722;ENST00000535359;ENST00000541693;ENST00000542200;ENST00000535513	T;T;T;T	0.13657	2.57;2.57;2.57;2.57	5.95	5.95	0.96441	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53514	0.1801	H	0.97077	3.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.991;0.997;1.0	T	0.70339	-0.4899	10	0.87932	D	0	-10.8441	16.0639	0.80859	0.0:0.0:0.0:1.0	.	100;100;100	F5H0E6;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	C	100;100;56;100;100	ENSP00000261722:Y100C;ENSP00000440984:Y100C;ENSP00000441961:Y56C;ENSP00000440719:Y100C	ENSP00000261722:Y100C	Y	-	2	0	AP3B2	81154603	1.000000	0.71417	0.879000	0.34478	0.971000	0.66376	7.911000	0.87458	2.268000	0.75426	0.533000	0.62120	TAC	.	.		0.607	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
KIF7	374654	hgsc.bcm.edu	37	15	90192526	90192526	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:90192526G>A	ENST00000394412.3	-	4	678	c.602C>T	c.(601-603)gCg>gTg	p.A201V		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	201	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			GTGCCGCGCCGCGTTGCCCAT	0.701																																					p.A201V		Atlas-SNP	.											.	KIF7	130	.	0			c.C602T						.						1.0	2.0	2.0					15																	90192526		483	1220	1703	SO:0001583	missense	374654	exon4			CGCGCCGCGTTGC	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.602C>T	chr15.hg19:g.90192526G>A	ENSP00000377934:p.Ala201Val	81.0	0.0		64.0	8.0	NM_198525	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	hg19	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	g	27.7	4.857665	0.91433	.	.	ENSG00000166813	ENST00000394412	T	0.75821	-0.97	4.03	4.03	0.46877	Kinesin, motor domain (4);	.	.	.	.	T	0.68403	0.2997	M	0.72576	2.205	0.40517	D	0.980792	P	0.48911	0.917	B	0.38106	0.265	T	0.70073	-0.4972	9	0.29301	T	0.29	.	11.1029	0.48186	0.0938:0.0:0.9062:0.0	.	201	Q2M1P5	KIF7_HUMAN	V	201	ENSP00000377934:A201V	ENSP00000377934:A201V	A	-	2	0	KIF7	87993530	1.000000	0.71417	0.803000	0.32268	0.981000	0.71138	6.325000	0.72901	2.244000	0.73946	0.645000	0.84053	GCG	.	.		0.701	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
GDPGP1	390637	hgsc.bcm.edu	37	15	90784264	90784264	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:90784264C>T	ENST00000558017.1	+	4	544	c.124C>T	c.(124-126)Cag>Tag	p.Q42*	GDPGP1_ENST00000329600.6_Nonsense_Mutation_p.Q42*	NM_001013657.2	NP_001013679.2	Q6ZNW5	GDPP1_HUMAN	GDP-D-glucose phosphorylase 1	42					glucose metabolic process (GO:0006006)	cytoplasm (GO:0005737)	GDP-D-glucose phosphorylase activity (GO:0080048)|guanyl-nucleotide exchange factor activity (GO:0005085)|hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)|nucleotidyltransferase activity (GO:0016779)										AGAAGGGATTCAGTGGCCAAG	0.547																																					p.Q42X		Atlas-SNP	.											.	.	.	.	0			c.C124T						.						170.0	171.0	171.0					15																	90784264		2199	4298	6497	SO:0001587	stop_gained	390637	exon4			GGGATTCAGTGGC		CCDS32327.1	15q26.1	2012-05-04	2012-05-04	2012-05-04	ENSG00000183208	ENSG00000183208	2.7.7.78		34360	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 58"""	C15orf58		21507950	Standard	NM_001013657		Approved		uc002bpc.3	Q6ZNW5		ENST00000558017.1:c.124C>T	chr15.hg19:g.90784264C>T	ENSP00000452793:p.Gln42*	81.0	0.0		56.0	12.0	NM_001013657		Nonsense_Mutation	SNP	ENST00000558017.1	hg19	CCDS32327.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.185852	0.57909	.	.	ENSG00000183208	ENST00000329600	.	.	.	5.35	5.35	0.76521	.	0.370861	0.25648	N	0.029223	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-19.6182	12.1766	0.54188	0.0:0.8286:0.1714:0.0	.	.	.	.	X	42	.	ENSP00000368405:Q42X	Q	+	1	0	C15orf58	88585268	0.996000	0.38824	0.994000	0.49952	0.532000	0.34746	3.731000	0.55013	2.792000	0.96026	0.557000	0.71058	CAG	.	.		0.547	GDPGP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416973.1	NM_001013657	
FURIN	5045	hgsc.bcm.edu	37	15	91424700	91424700	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:91424700C>T	ENST00000268171.3	+	16	2256	c.1977C>T	c.(1975-1977)tgC>tgT	p.C659C	FES_ENST00000328850.3_5'Flank|FES_ENST00000414248.2_5'Flank|FES_ENST00000394302.1_5'Flank	NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)	659					cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TGACAGACTGCCTCAGCTGCC	0.672																																					p.C659C		Atlas-SNP	.											.	FURIN	85	.	0			c.C1977T						.						29.0	32.0	31.0					15																	91424700		2197	4293	6490	SO:0001819	synonymous_variant	5045	exon16			AGACTGCCTCAGC	X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1977C>T	chr15.hg19:g.91424700C>T		81.0	0.0		75.0	11.0	NM_002569	Q14336|Q6LBS3|Q9UCZ5	Silent	SNP	ENST00000268171.3	hg19	CCDS10364.1																																																																																			.	.		0.672	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313492.1	NM_002569	
MCTP2	55784	hgsc.bcm.edu	37	15	94943190	94943190	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:94943190G>A	ENST00000357742.4	+	15	1931	c.1931G>A	c.(1930-1932)cGc>cAc	p.R644H	MCTP2_ENST00000331706.4_Missense_Mutation_p.R232H|MCTP2_ENST00000557742.1_Missense_Mutation_p.R232H|MCTP2_ENST00000451018.3_Missense_Mutation_p.R644H	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	644					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CGGGAAAAGCGCTTTGTTGAA	0.458																																					p.R644H		Atlas-SNP	.											.	MCTP2	122	.	0			c.G1931A						.						93.0	93.0	93.0					15																	94943190		2197	4298	6495	SO:0001583	missense	55784	exon15			AAAAGCGCTTTGT	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1931G>A	chr15.hg19:g.94943190G>A	ENSP00000350377:p.Arg644His	129.0	0.0		108.0	20.0	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	hg19	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605122	0.87157	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.68025	-0.3;-0.04;-0.14	5.22	4.31	0.51392	C2 calcium/lipid-binding domain, CaLB (1);	0.150976	0.64402	N	0.000019	T	0.73860	0.3641	L	0.50333	1.59	0.49582	D	0.999802	D;D;D	0.76494	0.969;0.998;0.999	P;P;P	0.60415	0.635;0.874;0.864	T	0.76664	-0.2876	10	0.87932	D	0	.	13.5101	0.61506	0.0757:0.0:0.9243:0.0	.	644;232;644	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	H	644;232;644	ENSP00000395109:R644H;ENSP00000329646:R232H;ENSP00000350377:R644H	ENSP00000329646:R232H	R	+	2	0	MCTP2	92744194	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	4.154000	0.58125	1.190000	0.43042	0.563000	0.77884	CGC	.	.		0.458	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
FBXL16	146330	hgsc.bcm.edu	37	16	744677	744677	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:744677C>T	ENST00000397621.1	-	5	1579	c.1248G>A	c.(1246-1248)aaG>aaA	p.K416K	FBXL16_ENST00000562585.1_5'UTR|FBXL16_ENST00000562563.1_Silent_p.K204K|FBXL16_ENST00000324361.5_Silent_p.K416K|LA16c-313D11.12_ENST00000566927.1_RNA	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	416										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				CCAGGAGGTGCTTCAGCCCGA	0.647																																					p.K416K		Atlas-SNP	.											.	FBXL16	25	.	0			c.G1248A						.						49.0	45.0	46.0					16																	744677		2194	4295	6489	SO:0001819	synonymous_variant	146330	exon5			GAGGTGCTTCAGC	BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.1248G>A	chr16.hg19:g.744677C>T		119.0	0.0		107.0	39.0	NM_153350	B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	Silent	SNP	ENST00000397621.1	hg19	CCDS10421.1																																																																																			.	.		0.647	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206851.2	NM_153350	
CHTF18	63922	hgsc.bcm.edu	37	16	844174	844174	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:844174T>C	ENST00000262315.9	+	15	1986	c.1923T>C	c.(1921-1923)tcT>tcC	p.S641S	CHTF18_ENST00000317063.6_Silent_p.S850S|CHTF18_ENST00000455171.2_Silent_p.S669S	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	641					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCGCTGCCTCTGCGGGCGAGC	0.687																																					p.S641S		Atlas-SNP	.											.	CHTF18	52	.	0			c.T1923C						.						38.0	46.0	44.0					16																	844174		2174	4274	6448	SO:0001819	synonymous_variant	63922	exon15			TGCCTCTGCGGGC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.1923T>C	chr16.hg19:g.844174T>C		132.0	0.0		105.0	54.0	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Silent	SNP	ENST00000262315.9	hg19	CCDS45371.1																																																																																			.	.		0.687	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
RPS2	6187	hgsc.bcm.edu	37	16	2012581	2012581	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:2012581A>G	ENST00000343262.4	-	6	682	c.626T>C	c.(625-627)gTg>gCg	p.V209A	RPS2_ENST00000530225.1_Intron|SNORA64_ENST00000384674.1_RNA|RPS2_ENST00000526522.1_Missense_Mutation_p.V151A|SNHG9_ENST00000459373.1_lincRNA|SNORA10_ENST00000384084.1_RNA|RPS2_ENST00000529806.1_Missense_Mutation_p.V179A	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	209					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CTTCTTAGGCACAGGTGCGGA	0.622																																					p.V209A		Atlas-SNP	.											.	RPS2	18	.	0			c.T626C						.						22.0	24.0	24.0					16																	2012581		2190	4270	6460	SO:0001583	missense	6187	exon6			TTAGGCACAGGTG	AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.626T>C	chr16.hg19:g.2012581A>G	ENSP00000341885:p.Val209Ala	106.0	0.0		68.0	9.0	NM_002952	B2R5G0|D3DU82|Q3MIB1	Missense_Mutation	SNP	ENST00000343262.4	hg19	CCDS10452.1	.	.	.	.	.	.	.	.	.	.	a	20.9	4.074141	0.76415	.	.	ENSG00000140988	ENST00000526522;ENST00000533186;ENST00000343262;ENST00000529806;ENST00000527302	.	.	.	4.52	4.52	0.55395	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5, C-terminal (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.000000	0.64402	U	0.000007	T	0.52773	0.1755	L	0.58583	1.82	0.80722	D	1	P;B	0.35507	0.506;0.182	B;B	0.34931	0.192;0.147	T	0.53927	-0.8369	9	0.34782	T	0.22	.	13.1915	0.59713	1.0:0.0:0.0:0.0	.	209;151	P15880;E9PQD7	RS2_HUMAN;.	A	151;111;209;179;209	.	ENSP00000341885:V209A	V	-	2	0	RPS2	1952582	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.388000	0.79795	1.716000	0.51395	0.524000	0.50904	GTG	.	.		0.622	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
CREBBP	1387	hgsc.bcm.edu	37	16	3778436	3778436	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:3778436C>T	ENST00000262367.5	-	31	7421	c.6612G>A	c.(6610-6612)caG>caA	p.Q2204Q	CREBBP_ENST00000382070.3_Silent_p.Q2166Q	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2204	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		gttgctgctgctgttgctgct	0.597			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.Q2204Q		Atlas-SNP	.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	546	.	0			c.G6612A						.						33.0	31.0	31.0					16																	3778436		2192	4287	6479	SO:0001819	synonymous_variant	1387	exon31			CTGCTGCTGTTGC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6612G>A	chr16.hg19:g.3778436C>T		68.0	0.0		46.0	18.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	ENST00000262367.5	hg19	CCDS10509.1																																																																																			.	.		0.597	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
VASN	114990	hgsc.bcm.edu	37	16	4432614	4432614	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:4432614C>T	ENST00000304735.3	+	2	1891	c.1736C>T	c.(1735-1737)gCg>gTg	p.A579V	CORO7_ENST00000537233.2_Intron|CORO7_ENST00000539968.1_Intron|CORO7-PAM16_ENST00000572467.1_Intron|CORO7_ENST00000574025.1_Intron|CORO7_ENST00000251166.4_Intron|CORO7_ENST00000423908.2_Intron	NM_138440.2	NP_612449.2	Q6EMK4	VASN_HUMAN	vasorin	579					cellular response to hypoxia (GO:0071456)|cellular response to redox state (GO:0071461)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	transforming growth factor beta binding (GO:0050431)			breast(1)|lung(3)|prostate(1)|skin(1)	6						CTCCTCATTGCGCCCGCCCTG	0.746																																					p.A579V		Atlas-SNP	.											.	VASN	21	.	0			c.C1736T						.						6.0	10.0	8.0					16																	4432614		2021	3964	5985	SO:0001583	missense	114990	exon2			TCATTGCGCCCGC	AY358299	CCDS10514.1	16p13.3	2008-02-05	2006-03-30	2006-03-30	ENSG00000168140	ENSG00000168140			18517	protein-coding gene	gene with protein product		608843	"""slit-like 2 (Drosophila)"""	SLITL2		15247411	Standard	NM_138440		Approved		uc002cwj.1	Q6EMK4	OTTHUMG00000129469	ENST00000304735.3:c.1736C>T	chr16.hg19:g.4432614C>T	ENSP00000306864:p.Ala579Val	135.0	0.0		111.0	24.0	NM_138440	Q6UXL4|Q6UXL5|Q96CX1	Missense_Mutation	SNP	ENST00000304735.3	hg19	CCDS10514.1	.	.	.	.	.	.	.	.	.	.	C	4.589	0.109486	0.08780	.	.	ENSG00000168140	ENST00000304735	T	0.53206	0.63	5.46	4.41	0.53225	.	0.278844	0.35739	N	0.003016	T	0.20941	0.0504	N	0.04880	-0.145	0.36322	D	0.858317	B	0.21452	0.056	B	0.08055	0.003	T	0.17319	-1.0373	10	0.28530	T	0.3	-15.4703	4.2941	0.10892	0.0:0.7068:0.0:0.2932	.	579	Q6EMK4	VASN_HUMAN	V	579	ENSP00000306864:A579V	ENSP00000306864:A579V	A	+	2	0	VASN	4372615	1.000000	0.71417	0.276000	0.24689	0.925000	0.55904	3.874000	0.56101	2.561000	0.86390	0.655000	0.94253	GCG	.	.		0.746	VASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251632.1	NM_138440	
ROGDI	79641	hgsc.bcm.edu	37	16	4851539	4851539	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:4851539G>A	ENST00000322048.7	-	3	543	c.165C>T	c.(163-165)ccC>ccT	p.P55P	ROGDI_ENST00000586336.1_5'UTR	NM_024589.2	NP_078865.1	Q9GZN7	ROGDI_HUMAN	rogdi homolog (Drosophila)	55					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)	intracellular (GO:0005622)|nucleus (GO:0005634)				endometrium(2)|lung(1)|ovary(1)|skin(1)	5						CTTGCTTGGCGGGCCCCTCAG	0.657																																					p.P55P		Atlas-SNP	.											.	ROGDI	11	.	0			c.C165T						.						28.0	31.0	30.0					16																	4851539		2196	4300	6496	SO:0001819	synonymous_variant	79641	exon3			CTTGGCGGGCCCC	AK026039	CCDS10523.1	16p13.3	2014-09-17			ENSG00000067836	ENSG00000067836			29478	protein-coding gene	gene with protein product		614574				11230166	Standard	NM_024589		Approved	FLJ22386	uc002cxv.4	Q9GZN7	OTTHUMG00000129479	ENST00000322048.7:c.165C>T	chr16.hg19:g.4851539G>A		81.0	0.0		61.0	22.0	NM_024589	Q6IA00	Silent	SNP	ENST00000322048.7	hg19	CCDS10523.1																																																																																			.	.		0.657	ROGDI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251643.3	NM_024589	
GRIN2A	2903	hgsc.bcm.edu	37	16	9858337	9858337	+	Missense_Mutation	SNP	G	G	A	rs560057284	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:9858337G>A	ENST00000396573.2	-	14	3373	c.3064C>T	c.(3064-3066)Cgc>Tgc	p.R1022C	GRIN2A_ENST00000535259.1_Missense_Mutation_p.R865C|GRIN2A_ENST00000330684.3_Missense_Mutation_p.R1022C|GRIN2A_ENST00000396575.2_Missense_Mutation_p.R1022C|GRIN2A_ENST00000562109.1_Missense_Mutation_p.R1022C|GRIN2A_ENST00000404927.2_Missense_Mutation_p.R1022C	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1022					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R1022C(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GAATCCTGGCGTATGGAATCC	0.532													G|||	2	0.000399361	0.0	0.0	5008	,	,		16566	0.002		0.0	False		,,,				2504	0.0				p.R1022C		Atlas-SNP	.											GRIN2A,NS,carcinoma,0,1	GRIN2A	366	.	1	Substitution - Missense(1)	endometrium(1)	c.C3064T						.						107.0	113.0	111.0					16																	9858337		2197	4300	6497	SO:0001583	missense	2903	exon14			CCTGGCGTATGGA		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3064C>T	chr16.hg19:g.9858337G>A	ENSP00000379818:p.Arg1022Cys	78.0	0.0		54.0	17.0	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	hg19	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587603	0.66105	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.13196	2.61;2.62;2.62;2.61;2.61	5.33	5.33	0.75918	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.050105	0.85682	D	0.000000	T	0.37404	0.1002	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.964;0.998	T	0.03139	-1.1068	9	.	.	.	.	18.0262	0.89270	0.0:0.0:1.0:0.0	.	865;1022;1022	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	C	1022;1022;865;1022;1022	ENSP00000379818:R1022C;ENSP00000385872:R1022C;ENSP00000441572:R865C;ENSP00000332549:R1022C;ENSP00000379820:R1022C	.	R	-	1	0	GRIN2A	9765838	1.000000	0.71417	0.944000	0.38274	0.803000	0.45373	7.520000	0.81821	2.491000	0.84063	0.655000	0.94253	CGC	.	.		0.532	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
TMC5	79838	hgsc.bcm.edu	37	16	19471655	19471655	+	Splice_Site	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:19471655A>G	ENST00000396229.2	+	6	1896	c.1147A>G	c.(1147-1149)Agg>Ggg	p.R383G	TMC5_ENST00000564959.1_Splice_Site_p.S45G|TMC5_ENST00000219821.5_Splice_Site_p.R137G|TMC5_ENST00000561503.1_Splice_Site_p.R24G|TMC5_ENST00000542583.2_Splice_Site_p.R383G|TMC5_ENST00000541464.1_Splice_Site_p.R383G|TMC5_ENST00000381414.4_Splice_Site_p.R383G	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	383					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						AAGGAACCTTAGGTATGGACT	0.403																																					p.R383G		Atlas-SNP	.											.	TMC5	169	.	0			c.A1147G						.						76.0	67.0	70.0					16																	19471655		2197	4300	6497	SO:0001630	splice_region_variant	79838	exon6			AACCTTAGGTATG	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1148+1A>G	chr16.hg19:g.19471655A>G		444.0	0.0		325.0	125.0	NM_001105249	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	hg19	CCDS45431.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.59|16.59	3.165545|3.165545	0.57476|0.57476	.|.	.|.	ENSG00000103534|ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821|ENST00000440743	T;T;T;T;T|.	0.60797|.	0.16;0.16;0.16;0.16;0.16|.	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	.|.	.|.	.|.	.|.	T|T	0.58652|0.58652	0.2137|0.2137	L|L	0.59436|0.59436	1.845|1.845	0.54753|0.54753	D|D	0.999988|0.999988	D;D;D;P;P|B	0.65815|0.17038	0.985;0.995;0.991;0.954;0.853|0.02	P;P;P;P;P|B	0.62560|0.22386	0.798;0.904;0.804;0.632;0.474|0.039	T|T	0.54622|0.54622	-0.8266|-0.8266	9|7	0.66056|.	D|.	0.02|.	-15.142|-15.142	13.9455|13.9455	0.64082|0.64082	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	383;137;137;383;383|45	F5GYU8;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2|E7EU57	.;.;.;TMC5_HUMAN;.|.	G|G	383;383;383;383;137|45	ENSP00000441227:R383G;ENSP00000370822:R383G;ENSP00000379531:R383G;ENSP00000446274:R383G;ENSP00000219821:R137G|.	ENSP00000219821:R137G|.	R|S	+|+	1|1	2|0	TMC5|TMC5	19379156|19379156	1.000000|1.000000	0.71417|0.71417	0.937000|0.937000	0.37676|0.37676	0.885000|0.885000	0.51271|0.51271	4.615000|4.615000	0.61190|0.61190	2.210000|2.210000	0.71456|0.71456	0.533000|0.533000	0.62120|0.62120	AGG|AGC	.	.		0.403	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	Missense_Mutation
GSG1L	146395	hgsc.bcm.edu	37	16	27895830	27895830	+	Missense_Mutation	SNP	G	G	A	rs141366433		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:27895830G>A	ENST00000447459.2	-	3	611	c.527C>T	c.(526-528)gCg>gTg	p.A176V	GSG1L_ENST00000380897.3_Missense_Mutation_p.A21V|GSG1L_ENST00000569166.1_Missense_Mutation_p.A21V|GSG1L_ENST00000395724.3_Intron|GSG1L_ENST00000380898.2_Missense_Mutation_p.A21V	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	176					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A21V(1)|p.A176V(1)		endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						GAAGACAGCCGCGAAGGCATT	0.577																																					p.A176V		Atlas-SNP	.											GSG1L_ENST00000447459,NS,carcinoma,0,2	GSG1L	82	.	2	Substitution - Missense(2)	endometrium(2)	c.C527T						.	G	VAL/ALA,VAL/ALA	1,4393	2.1+/-5.4	0,1,2196	89.0	80.0	83.0		527,62	5.2	0.8	16	dbSNP_134	83	0,8600		0,0,4300	no	missense,missense	GSG1L	NM_001109763.1,NM_144675.2	64,64	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	possibly-damaging,possibly-damaging	176/332,21/177	27895830	1,12993	2197	4300	6497	SO:0001583	missense	146395	exon3			ACAGCCGCGAAGG	AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.527C>T	chr16.hg19:g.27895830G>A	ENSP00000394954:p.Ala176Val	102.0	0.0		78.0	19.0	NM_001109763	Q7Z6F8|Q8TB81	Missense_Mutation	SNP	ENST00000447459.2	hg19	CCDS45450.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744264	0.89663	2.28E-4	0.0	ENSG00000169181	ENST00000447459;ENST00000380898;ENST00000380897	T;D;D	0.91068	0.9;-2.78;-2.78	5.16	5.16	0.70880	.	.	.	.	.	D	0.93374	0.7887	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	0.996;1.0	P;D	0.75484	0.858;0.986	D	0.92447	0.5967	9	0.37606	T	0.19	.	17.7781	0.88515	0.0:0.0:1.0:0.0	.	21;176	Q6UXU4-4;Q6UXU4	.;GSG1L_HUMAN	V	176;21;21	ENSP00000394954:A176V;ENSP00000370283:A21V;ENSP00000370282:A21V	ENSP00000370282:A21V	A	-	2	0	GSG1L	27803331	1.000000	0.71417	0.816000	0.32577	0.916000	0.54674	9.805000	0.99149	2.551000	0.86045	0.655000	0.94253	GCG	.	G|1.000;A|0.000		0.577	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433832.2	NM_144675	
CORO1A	11151	hgsc.bcm.edu	37	16	30198463	30198463	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:30198463C>T	ENST00000219150.5	+	5	860	c.555C>T	c.(553-555)agC>agT	p.S185S	RP11-455F5.5_ENST00000567153.1_RNA|CORO1A_ENST00000570045.1_Silent_p.S185S|RP11-455F5.5_ENST00000568506.1_RNA|RP11-455F5.5_ENST00000566144.1_RNA|CORO1A_ENST00000565497.1_Silent_p.S185S	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	185					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						TGGACTGGAGCCGAGATGGAG	0.612																																					p.S185S		Atlas-SNP	.											.	CORO1A	36	.	0			c.C555T						.						89.0	77.0	81.0					16																	30198463		2197	4300	6497	SO:0001819	synonymous_variant	11151	exon6			CTGGAGCCGAGAT	X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.555C>T	chr16.hg19:g.30198463C>T		59.0	0.0		39.0	13.0	NM_001193333	B2RBL1|Q2YD73	Silent	SNP	ENST00000219150.5	hg19	CCDS10673.1																																																																																			.	.		0.612	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255195.2	NM_007074	
C16orf70	80262	hgsc.bcm.edu	37	16	67181027	67181027	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:67181027T>C	ENST00000219139.3	+	16	1450	c.1262T>C	c.(1261-1263)cTc>cCc	p.L421P	C16orf70_ENST00000569600.1_Missense_Mutation_p.L421P	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70	421										cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		ACAGCGGAACTCCCCTAGGGA	0.592																																					p.L421P		Atlas-SNP	.											.	C16orf70	38	.	0			c.T1262C						.						146.0	128.0	134.0					16																	67181027		2198	4300	6498	SO:0001583	missense	80262	exon16			CGGAACTCCCCTA	AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510	ENST00000219139.3:c.1262T>C	chr16.hg19:g.67181027T>C	ENSP00000219139:p.Leu421Pro	84.0	0.0		67.0	23.0	NM_025187	Q9HA86	Missense_Mutation	SNP	ENST00000219139.3	hg19	CCDS10828.1	.	.	.	.	.	.	.	.	.	.	T	13.97	2.395201	0.42512	.	.	ENSG00000125149	ENST00000219139	.	.	.	5.93	5.93	0.95920	.	0.136093	0.48286	D	0.000187	T	0.36276	0.0961	N	0.14661	0.345	0.80722	D	1	P	0.44090	0.826	B	0.37943	0.261	T	0.42224	-0.9464	9	0.87932	D	0	-3.1548	13.7675	0.63004	0.0:0.0:0.0:1.0	.	421	Q9BSU1	CP070_HUMAN	P	421	.	ENSP00000219139:L421P	L	+	2	0	C16orf70	65738528	1.000000	0.71417	0.998000	0.56505	0.780000	0.44128	3.892000	0.56235	2.281000	0.76405	0.533000	0.62120	CTC	.	.		0.592	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268829.2	NM_025187	
KIAA0895L	653319	hgsc.bcm.edu	37	16	67214463	67214463	+	Silent	SNP	C	C	T	rs564826051		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:67214463C>T	ENST00000290881.7	-	3	977	c.51G>A	c.(49-51)ccG>ccA	p.P17P	KIAA0895L_ENST00000563831.2_Intron|KIAA0895L_ENST00000563902.1_Silent_p.P17P|KIAA0895L_ENST00000561621.1_Silent_p.P17P			Q68EN5	K895L_HUMAN	KIAA0895-like	17	Pro-rich.									breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|skin(1)	17						GACTGGTAGGCGGGCTGGGGG	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		16828	0.0		0.0	False		,,,				2504	0.001				p.P17P		Atlas-SNP	.											KIAA0895L,NS,carcinoma,0,1	KIAA0895L	32	.	0			c.G51A						.						27.0	32.0	30.0					16																	67214463		1838	3880	5718	SO:0001819	synonymous_variant	653319	exon2			GGTAGGCGGGCTG	AK092303	CCDS42177.1	16q22.1	2008-11-27				ENSG00000196123			34408	protein-coding gene	gene with protein product							Standard	NM_001040715		Approved	LOC653319	uc002ert.3	Q68EN5		ENST00000290881.7:c.51G>A	chr16.hg19:g.67214463C>T		102.0	1.0		62.0	11.0	NM_001040715	A2VCS8|Q8N3H9|Q8NAQ5|Q96IE5	Silent	SNP	ENST00000290881.7	hg19	CCDS42177.1																																																																																			.	.		0.652	KIAA0895L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421193.4	NM_001040715	
RLTPR	146206	hgsc.bcm.edu	37	16	67683458	67683458	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:67683458A>G	ENST00000334583.6	+	20	2183	c.1855A>G	c.(1855-1857)Aac>Gac	p.N619D	RLTPR_ENST00000545661.1_Missense_Mutation_p.N583D	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	619	Tropomodulin-like.				cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		TATCAGCGGCAACGCCATGGG	0.687																																					p.N619D		Atlas-SNP	.											.	RLTPR	124	.	0			c.A1855G						.						25.0	29.0	28.0					16																	67683458		1977	4136	6113	SO:0001583	missense	146206	exon20			AGCGGCAACGCCA	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1855A>G	chr16.hg19:g.67683458A>G	ENSP00000334958:p.Asn619Asp	36.0	0.0		35.0	11.0	NM_001013838	B8X2Z3	Missense_Mutation	SNP	ENST00000334583.6	hg19	CCDS45513.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.926971	0.92319	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.80393	-1.37;-1.37	5.09	3.96	0.45880	.	0.111326	0.64402	D	0.000016	D	0.93141	0.7816	H	0.98466	4.24	0.49483	D	0.999798	D;D	0.76494	0.999;0.999	D;D	0.83275	0.977;0.996	D	0.93755	0.7062	10	0.87932	D	0	-11.1006	11.5317	0.50614	0.8498:0.1502:0.0:0.0	.	583;619	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	D	619;583	ENSP00000334958:N619D;ENSP00000441481:N583D	ENSP00000334958:N619D	N	+	1	0	RLTPR	66240959	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.467000	0.80930	0.749000	0.32854	0.459000	0.35465	AAC	.	.		0.687	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	
SF3B3	23450	hgsc.bcm.edu	37	16	70605061	70605061	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:70605061C>T	ENST00000302516.5	+	25	3683	c.3472C>T	c.(3472-3474)Cgg>Tgg	p.R1158W		NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	1158					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				TCTCTGTGGGCGGGACCACCT	0.522																																					p.R1158W		Atlas-SNP	.											SF3B3,NS,adenocarcinoma,0,1	SF3B3	99	.	0			c.C3472T						.						133.0	122.0	125.0					16																	70605061		2198	4300	6498	SO:0001583	missense	23450	exon25			TGTGGGCGGGACC	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.3472C>T	chr16.hg19:g.70605061C>T	ENSP00000305790:p.Arg1158Trp	90.0	0.0		87.0	36.0	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	hg19	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960641	0.74016	.	.	ENSG00000189091	ENST00000302516	T	0.48522	0.81	5.78	3.61	0.41365	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75781	0.3896	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83820	0.0246	10	0.66056	D	0.02	.	15.5067	0.75745	0.3664:0.6336:0.0:0.0	.	1158	Q15393	SF3B3_HUMAN	W	1158	ENSP00000305790:R1158W	ENSP00000305790:R1158W	R	+	1	2	SF3B3	69162562	0.702000	0.27816	1.000000	0.80357	0.987000	0.75469	1.387000	0.34430	1.405000	0.46838	0.563000	0.77884	CGG	.	.		0.522	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
PIEZO1	9780	hgsc.bcm.edu	37	16	88786942	88786942	+	Splice_Site	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr16:88786942T>C	ENST00000301015.9	-	41	6048		c.e41-2		PIEZO1_ENST00000327397.7_5'Flank|RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCCTGGGCCCTGCGGAAGGGG	0.687																																					.		Atlas-SNP	.											.	PIEZO1	79	.	0			c.5802-2A>G						.						76.0	70.0	72.0					16																	88786942		692	1591	2283	SO:0001630	splice_region_variant	9780	exon42			GGGCCCTGCGGAA	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.5802-2A>G	chr16.hg19:g.88786942T>C		40.0	0.0		41.0	11.0	NM_001142864	A6NHT9|A7E2B7|Q0KKZ9	Splice_Site	SNP	ENST00000301015.9	hg19	CCDS54058.1	.	.	.	.	.	.	.	.	.	.	t	16.34	3.095128	0.56075	.	.	ENSG00000103335	ENST00000301015;ENST00000451779	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2002	0.73130	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM38A	87314443	1.000000	0.71417	0.996000	0.52242	0.584000	0.36387	5.676000	0.68131	2.134000	0.65973	0.454000	0.30748	.	.	.		0.687	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	Intron
ABR	29	hgsc.bcm.edu	37	17	909329	909329	+	Silent	SNP	G	G	A	rs375629677		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:909329G>A	ENST00000302538.5	-	23	2717	c.2571C>T	c.(2569-2571)acC>acT	p.T857T	ABR_ENST00000536794.2_Silent_p.T639T|ABR_ENST00000544583.2_Silent_p.T811T|ABR_ENST00000543210.2_Silent_p.T308T|ABR_ENST00000572441.1_Intron|ABR_ENST00000574437.1_Silent_p.T811T|ABR_ENST00000291107.2_Silent_p.T820T	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	857					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GCTACACGTCGGTGGAGAAGT	0.602																																					p.T857T	Esophageal Squamous(197;2016 2115 4129 29033 46447)	Atlas-SNP	.											.	ABR	119	.	0			c.C2571T						.	G	,,	0,4392		0,0,2196	52.0	38.0	43.0		2460,2433,2571	-11.2	0.1	17		43	1,8571		0,1,4285	no	coding-synonymous,coding-synonymous,coding-synonymous	ABR	NM_001092.3,NM_001159746.1,NM_021962.2	,,	0,1,6481	AA,AG,GG		0.0117,0.0,0.0077	,,	820/823,811/814,857/860	909329	1,12963	2196	4286	6482	SO:0001819	synonymous_variant	29	exon23			CACGTCGGTGGAG	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.2571C>T	chr17.hg19:g.909329G>A		68.0	0.0		57.0	7.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Silent	SNP	ENST00000302538.5	hg19	CCDS10999.1																																																																																			.	.		0.602	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
ATP2A3	489	hgsc.bcm.edu	37	17	3844585	3844585	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:3844585C>T	ENST00000352011.3	-	14	1834	c.1780G>A	c.(1780-1782)Gtg>Atg	p.V594M	ATP2A3_ENST00000309890.7_Missense_Mutation_p.V594M|ATP2A3_ENST00000359983.3_Missense_Mutation_p.V594M|ATP2A3_ENST00000397043.3_Missense_Mutation_p.V594M|ATP2A3_ENST00000397039.1_De_novo_Start_InFrame|ATP2A3_ENST00000397035.3_Missense_Mutation_p.V594M|ATP2A3_ENST00000397041.3_Missense_Mutation_p.V594M			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	594					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		ACGCAGCCCACGAAGGTCAGG	0.662																																					p.V594M	GBM(32;29 774 15719 37967)	Atlas-SNP	.											.	ATP2A3	148	.	0			c.G1780A						.						47.0	46.0	46.0					17																	3844585		2202	4300	6502	SO:0001583	missense	489	exon14			AGCCCACGAAGGT		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.1780G>A	chr17.hg19:g.3844585C>T	ENSP00000301387:p.Val594Met	99.0	0.0		99.0	43.0	NM_174956	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	ENST00000352011.3	hg19	CCDS11041.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620014	0.87460	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D	0.99105	-5.43;-5.43;-5.43;-5.43;-5.43;-5.43	4.16	4.16	0.48862	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.99251	0.9739	M	0.83384	2.64	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.979;0.982;0.979;0.979;0.979	D	0.98797	1.0738	10	0.87932	D	0	.	16.725	0.85419	0.0:1.0:0.0:0.0	.	594;594;594;594;594;594	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	M	594	ENSP00000380236:V594M;ENSP00000301387:V594M;ENSP00000353072:V594M;ENSP00000380234:V594M;ENSP00000312577:V594M;ENSP00000380229:V594M	ENSP00000312577:V594M	V	-	1	0	ATP2A3	3791334	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.562000	0.82300	2.607000	0.88179	0.561000	0.74099	GTG	.	.		0.662	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000438401.1	NM_174953	
CHD3	1107	hgsc.bcm.edu	37	17	7798461	7798461	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:7798461G>A	ENST00000330494.7	+	9	1646	c.1496G>A	c.(1495-1497)cGa>cAa	p.R499Q	CHD3_ENST00000358181.4_Missense_Mutation_p.R499Q|CHD3_ENST00000380358.4_Missense_Mutation_p.R558Q	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	499	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CTGTGTCCCCGATGCACAGTG	0.552																																					p.R558Q		Atlas-SNP	.											.	CHD3	169	.	0			c.G1673A						.						211.0	159.0	177.0					17																	7798461		2203	4300	6503	SO:0001583	missense	1107	exon9			GTCCCCGATGCAC	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1496G>A	chr17.hg19:g.7798461G>A	ENSP00000332628:p.Arg499Gln	104.0	0.0		78.0	14.0	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	hg19	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.210991	0.58343	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	T;T;T	0.21543	2.0;2.0;2.0	5.01	5.01	0.66863	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Chromo domain-like (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.33180	N	0.005184	T	0.47820	0.1466	M	0.70275	2.135	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.80764	0.986;0.992;0.994	T	0.47824	-0.9087	10	0.66056	D	0.02	-6.7131	18.5172	0.90939	0.0:0.0:1.0:0.0	.	499;499;558	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	Q	558;499;499	ENSP00000369716:R558Q;ENSP00000350907:R499Q;ENSP00000332628:R499Q	ENSP00000332628:R499Q	R	+	2	0	CHD3	7739186	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.657000	0.98554	2.611000	0.88343	0.561000	0.74099	CGA	.	.		0.552	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
KCNAB3	9196	hgsc.bcm.edu	37	17	7832645	7832645	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:7832645C>T	ENST00000303790.2	-	1	108	c.109G>A	c.(109-111)Ggc>Agc	p.G37S	CNTROB_ENST00000563694.1_5'Flank|CNTROB_ENST00000380262.3_5'Flank|RP11-1099M24.7_ENST00000573621.1_Intron|CNTROB_ENST00000380255.3_5'Flank	NM_004732.3	NP_004723.2	O43448	KCAB3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 3	37					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	8		Prostate(122;0.157)				TGCCCCCCGCCGGCCGGCCCA	0.741																																					p.G37S		Atlas-SNP	.											.	KCNAB3	30	.	0			c.G109A						.						2.0	3.0	3.0					17																	7832645		1529	3234	4763	SO:0001583	missense	9196	exon1			CCCCGCCGGCCGG	AF016411	CCDS11124.1	17p13.1	2006-11-29			ENSG00000170049	ENSG00000170049		"""Potassium channels"", ""Aldo-keto reductases"""	6230	protein-coding gene	gene with protein product		604111				9857044	Standard	NM_004732		Approved	AKR6A9, KCNA3B	uc002gjm.2	O43448	OTTHUMG00000108170	ENST00000303790.2:c.109G>A	chr17.hg19:g.7832645C>T	ENSP00000302719:p.Gly37Ser	123.0	0.0		117.0	9.0	NM_004732	Q4VAW0	Missense_Mutation	SNP	ENST00000303790.2	hg19	CCDS11124.1	.	.	.	.	.	.	.	.	.	.	C	12.67	2.008717	0.35415	.	.	ENSG00000170049	ENST00000303790	T	0.04758	3.56	4.62	3.62	0.41486	.	0.201092	0.29791	N	0.011188	T	0.03178	0.0093	N	0.22421	0.69	0.31232	N	0.696248	B	0.19200	0.034	B	0.06405	0.002	T	0.17349	-1.0372	10	0.22706	T	0.39	.	7.238	0.26079	0.0:0.8039:0.0:0.1961	.	37	O43448	KCAB3_HUMAN	S	37	ENSP00000302719:G37S	ENSP00000302719:G37S	G	-	1	0	KCNAB3	7773370	0.000000	0.05858	0.985000	0.45067	0.439000	0.31926	0.194000	0.17135	2.404000	0.81709	0.655000	0.94253	GGC	.	.		0.741	KCNAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226974.1	NM_004732	
ELAC2	60528	hgsc.bcm.edu	37	17	12897811	12897811	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:12897811G>A	ENST00000338034.4	-	22	2278	c.2039C>T	c.(2038-2040)gCc>gTc	p.A680V	ELAC2_ENST00000426905.3_Missense_Mutation_p.A640V|ELAC2_ENST00000395962.2_Missense_Mutation_p.A661V	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	680					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						CAGGAGGGTGGCATCTTTCCC	0.552																																					p.A680V		Atlas-SNP	.											.	ELAC2	48	.	0			c.C2039T						.						261.0	217.0	232.0					17																	12897811		2203	4300	6503	SO:0001583	missense	60528	exon22			AGGGTGGCATCTT	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.2039C>T	chr17.hg19:g.12897811G>A	ENSP00000337445:p.Ala680Val	142.0	0.0		98.0	12.0	NM_018127	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	ENST00000338034.4	hg19	CCDS11164.1	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143749	0.57044	.	.	ENSG00000006744	ENST00000426905;ENST00000338034;ENST00000395962	T;T;T	0.77750	-1.12;-1.12;-1.12	5.2	5.2	0.72013	Beta-lactamase-like (1);	0.000000	0.85682	D	0.000000	D	0.85974	0.5822	L	0.59436	1.845	0.80722	D	1	D;P;D;P;D;D;D;P	0.89917	1.0;0.924;1.0;0.875;1.0;1.0;1.0;0.733	D;P;D;P;D;D;D;P	0.97110	1.0;0.842;0.997;0.781;1.0;1.0;0.999;0.58	D	0.86768	0.1971	10	0.72032	D	0.01	-28.4324	16.2815	0.82692	0.0:0.0:1.0:0.0	.	640;663;661;478;680;440;665;308	B4DPL9;E9PGJ0;G5E9D5;E7ES68;Q9BQ52;B3KSU9;B4DT15;Q9BQ52-3	.;.;.;.;RNZ2_HUMAN;.;.;.	V	640;680;661	ENSP00000405223:A640V;ENSP00000337445:A680V;ENSP00000379291:A661V	ENSP00000337445:A680V	A	-	2	0	ELAC2	12838536	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.086000	0.94088	2.713000	0.92767	0.655000	0.94253	GCC	.	.		0.552	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
CDRT1	374286	hgsc.bcm.edu	37	17	15492292	15492292	+	Silent	SNP	C	C	T	rs542008653		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:15492292C>T	ENST00000395906.3	-	12	2255	c.2256G>A	c.(2254-2256)gtG>gtA	p.V752V	CDRT1_ENST00000583965.1_3'UTR|CDRT1_ENST00000354433.3_Silent_p.V252V|RP11-385D13.1_ENST00000455584.2_Intron	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	752										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		CCTGCTGCTACACACCACTGA	0.577													.|||	1	0.000199681	0.0	0.0	5008	,	,		17122	0.0		0.0	False		,,,				2504	0.001				p.V752V		Atlas-SNP	.											.	CDRT1	83	.	0			c.G2256A						.						35.0	35.0	35.0					17																	15492292		2202	4278	6480	SO:0001819	synonymous_variant	374286	exon12			CTGCTACACACCA	U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.2256G>A	chr17.hg19:g.15492292C>T		80.0	0.0		94.0	41.0	NM_006382	O43848|O95611	Silent	SNP	ENST00000395906.3	hg19	CCDS45619.1																																																																																			.	.		0.577	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448127.1	NM_006382	
TP53I13	90313	hgsc.bcm.edu	37	17	27899414	27899414	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:27899414G>A	ENST00000301057.7	+	6	883	c.768G>A	c.(766-768)ccG>ccA	p.P256P	RP11-68I3.4_ENST00000579050.1_RNA|RP11-68I3.2_ENST00000581474.1_RNA	NM_138349.2	NP_612358.3	Q8NBR0	P5I13_HUMAN	tumor protein p53 inducible protein 13	256						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(3;0.236)		CCCTGCTGCCGGGGGCGCCTG	0.652																																					p.P256P		Atlas-SNP	.											.	TP53I13	17	.	0			c.G768A						.						29.0	32.0	31.0					17																	27899414		1972	4114	6086	SO:0001819	synonymous_variant	90313	exon6			GCTGCCGGGGGCG	AK075341	CCDS42289.1	17q11.2	2006-01-16				ENSG00000167543			25102	protein-coding gene	gene with protein product						14767535	Standard	NM_138349		Approved	DSCP1	uc002hee.3	Q8NBR0		ENST00000301057.7:c.768G>A	chr17.hg19:g.27899414G>A		64.0	0.0		82.0	9.0	NM_138349	Q7L5U3	Silent	SNP	ENST00000301057.7	hg19	CCDS42289.1																																																																																			.	.		0.652	TP53I13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447804.2	NM_138349	
RHOT1	55288	hgsc.bcm.edu	37	17	30530945	30530945	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:30530945T>C	ENST00000333942.6	+	16	1608	c.1369T>C	c.(1369-1371)Tat>Cat	p.Y457H	RHOT1_ENST00000394692.2_Missense_Mutation_p.Y457H|RHOT1_ENST00000583994.1_Missense_Mutation_p.Y330H|RHOT1_ENST00000354266.3_Missense_Mutation_p.Y436H|RHOT1_ENST00000581094.1_Missense_Mutation_p.Y457H|RHOT1_ENST00000545287.2_Missense_Mutation_p.Y457H|RHOT1_ENST00000358365.3_Missense_Mutation_p.Y457H	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	457	Miro 2.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TAAATCCTACTATGCGATTAA	0.303																																					p.Y457H		Atlas-SNP	.											.	RHOT1	69	.	0			c.T1369C						.						102.0	102.0	102.0					17																	30530945		2203	4297	6500	SO:0001583	missense	55288	exon16			TCCTACTATGCGA	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1369T>C	chr17.hg19:g.30530945T>C	ENSP00000334724:p.Tyr457His	94.0	0.0		106.0	23.0	NM_001033568	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	ENST00000333942.6	hg19	CCDS32612.1	.	.	.	.	.	.	.	.	.	.	T	15.31	2.796507	0.50208	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942	T;T;T	0.68624	-0.34;-0.34;-0.34	5.7	5.7	0.88788	Mitochondrial Rho-like (1);MIRO (1);	0.000000	0.85682	D	0.000000	T	0.73377	0.3579	M	0.78285	2.405	0.80722	D	1	P;B;P;P	0.35944	0.529;0.234;0.482;0.48	B;B;B;B	0.42959	0.403;0.316;0.333;0.2	T	0.73588	-0.3935	10	0.39692	T	0.17	-13.4029	15.9589	0.79910	0.0:0.0:0.0:1.0	.	457;457;457;457	Q8IXI2-2;Q8IXI2;Q8IXI2-5;Q8IXI2-3	.;MIRO1_HUMAN;.;.	H	457	ENSP00000351132:Y457H;ENSP00000378184:Y457H;ENSP00000334724:Y457H	ENSP00000334724:Y457H	Y	+	1	0	RHOT1	27555058	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.178000	0.69098	0.477000	0.44152	TAT	.	.		0.303	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000447097.1	NM_018307	
MLLT6	4302	hgsc.bcm.edu	37	17	36876002	36876002	+	Splice_Site	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:36876002G>T	ENST00000325718.7	+	14	2100		c.e14-1		CTB-58E17.9_ENST00000579499.1_RNA|MIR4726_ENST00000577947.1_RNA	NM_005937.3	NP_005928	P55198	AF17_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(3)|lung(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8	Breast(7;4.43e-21)					TCTGGCCGCAGGTCCCCCATC	0.682			T	MLL	AL																																.		Atlas-SNP	.		Dom	yes		17	17q21	4302	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 (AF17)"""		L	.	MLLT6	80	.	0			c.2010-1G>T						.						25.0	28.0	27.0					17																	36876002		2202	4300	6502	SO:0001630	splice_region_variant	4302	exon14			GCCGCAGGTCCCC		CCDS11327.1	17q21	2014-04-10	2001-11-28		ENSG00000108292	ENSG00000275023		"""Zinc fingers, PHD-type"""	7138	protein-coding gene	gene with protein product	"""Myeloid/lymphoid or mixed-lineage leukemia, translocated to, 6"", ""trithorax homolog"""	600328	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 6"""			8058765	Standard	NM_005937		Approved	AF17, FLJ23480	uc002hqi.4	P55198	OTTHUMG00000188498	ENST00000325718.7:c.2010-1G>T	chr17.hg19:g.36876002G>T		153.0	0.0		164.0	52.0	NM_005937	Q59F28|Q96IU3|Q9H5F6|Q9UF49	Splice_Site	SNP	ENST00000325718.7	hg19	CCDS11327.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077356	0.36662	.	.	ENSG00000108292	ENST00000325718	.	.	.	4.94	3.98	0.46160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3496	0.55141	0.0834:0.0:0.9166:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MLLT6	34129528	1.000000	0.71417	0.996000	0.52242	0.355000	0.29361	6.187000	0.72039	1.224000	0.43551	0.561000	0.74099	.	.	.		0.682	MLLT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256799.1	NM_005937	Intron
PSMB3	5691	hgsc.bcm.edu	37	17	36912245	36912245	+	Splice_Site	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:36912245T>C	ENST00000225426.4	+	3	387		c.e3+2		RNU6-866P_ENST00000516469.1_RNA	NM_002795.2	NP_002786.2	P49720	PSB3_HUMAN	proteasome (prosome, macropain) subunit, beta type, 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|large_intestine(1)|lung(1)	4						TGAGAAACGGTGAGTGCAAGT	0.468																																					.		Atlas-SNP	.											.	PSMB3	9	.	0			c.296+2T>C						.						103.0	88.0	93.0					17																	36912245		2203	4300	6503	SO:0001630	splice_region_variant	5691	exon3			AAACGGTGAGTGC	BC013008	CCDS11328.1	17q12	2014-05-06			ENSG00000108294	ENSG00000277791		"""Proteasome (prosome, macropain) subunits"""	9540	protein-coding gene	gene with protein product		602176				7918633	Standard	NM_002795		Approved	HC10-II, MGC4147	uc002hqr.3	P49720	OTTHUMG00000188503	ENST00000225426.4:c.296+2T>C	chr17.hg19:g.36912245T>C		81.0	0.0		72.0	23.0	NM_002795	P31147|Q0P6J7|Q96E27	Splice_Site	SNP	ENST00000225426.4	hg19	CCDS11328.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.398092	0.62177	.	.	ENSG00000108294	ENST00000225426	.	.	.	5.04	5.04	0.67666	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7633	0.62979	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PSMB3	34165771	1.000000	0.71417	0.998000	0.56505	0.678000	0.39670	7.677000	0.84024	2.114000	0.64651	0.533000	0.62120	.	.	.		0.468	PSMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256810.2	NM_002795	Intron
TOP2A	7153	hgsc.bcm.edu	37	17	38564371	38564371	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:38564371G>A	ENST00000423485.1	-	12	1506	c.1348C>T	c.(1348-1350)Cga>Tga	p.R450*		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	450			R -> Q (in teniposide (VM-26) resistant cells). {ECO:0000269|PubMed:1652758}.		apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GTGGAGTTTCGGCCCCCtaaa	0.393																																					p.R450X		Atlas-SNP	.											.	TOP2A	124	.	0			c.C1348T						.						29.0	27.0	28.0					17																	38564371		1828	4077	5905	SO:0001587	stop_gained	7153	exon12			AGTTTCGGCCCCC		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.1348C>T	chr17.hg19:g.38564371G>A	ENSP00000411532:p.Arg450*	200.0	0.0		227.0	43.0	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Nonsense_Mutation	SNP	ENST00000423485.1	hg19	CCDS45672.1	.	.	.	.	.	.	.	.	.	.	G	39	7.328321	0.98214	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	.	.	.	5.36	4.34	0.51931	.	0.120978	0.53938	D	0.000042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	10.8116	0.46551	0.0:0.0:0.5751:0.4249	.	.	.	.	X	450;530;473;486	.	ENSP00000269577:R530X	R	-	1	2	TOP2A	35817897	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.902000	0.75699	2.515000	0.84797	0.591000	0.81541	CGA	.	.		0.393	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
KRT12	3859	hgsc.bcm.edu	37	17	39019563	39019563	+	Silent	SNP	G	G	A	rs373922617		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:39019563G>A	ENST00000251643.4	-	6	1151	c.1128C>T	c.(1126-1128)gcC>gcT	p.A376A	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	376	Coil 2.|Rod.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	AATCGCCCTCGGCTTCGGCCA	0.612																																					p.A376A		Atlas-SNP	.											.	KRT12	53	.	0			c.C1128T						.						20.0	18.0	19.0					17																	39019563		2199	4290	6489	SO:0001819	synonymous_variant	3859	exon6			GCCCTCGGCTTCG		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1128C>T	chr17.hg19:g.39019563G>A		140.0	0.0		150.0	55.0	NM_000223	B2R9E0	Silent	SNP	ENST00000251643.4	hg19	CCDS11378.1																																																																																			.	.		0.612	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
KCNH4	23415	hgsc.bcm.edu	37	17	40315341	40315341	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:40315341C>T	ENST00000264661.3	-	14	2821	c.2489G>A	c.(2488-2490)gGc>gAc	p.G830D	KCNH4_ENST00000607371.1_Missense_Mutation_p.G830D	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	830					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GTCCTCAATGCCATCCACTAT	0.632																																					p.G830D	NSCLC(117;707 1703 2300 21308 31858)	Atlas-SNP	.											.	KCNH4	105	.	0			c.G2489A						.						46.0	41.0	43.0					17																	40315341		2203	4300	6503	SO:0001583	missense	23415	exon14			TCAATGCCATCCA	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.2489G>A	chr17.hg19:g.40315341C>T	ENSP00000264661:p.Gly830Asp	52.0	0.0		45.0	12.0	NM_012285		Missense_Mutation	SNP	ENST00000264661.3	hg19	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284845	0.80803	.	.	ENSG00000089558	ENST00000264661	D	0.99270	-5.66	4.27	4.27	0.50696	.	0.000000	0.38326	N	0.001739	D	0.99086	0.9686	M	0.67397	2.05	0.49213	D	0.999768	D	0.89917	1.0	D	0.69307	0.963	D	0.98722	1.0709	10	0.62326	D	0.03	.	12.1652	0.54125	0.0:1.0:0.0:0.0	.	830	Q9UQ05	KCNH4_HUMAN	D	830	ENSP00000264661:G830D	ENSP00000264661:G830D	G	-	2	0	KCNH4	37568867	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.321000	0.65846	2.242000	0.73789	0.552000	0.68991	GGC	.	.		0.632	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
AOC2	314	hgsc.bcm.edu	37	17	41001289	41001289	+	Missense_Mutation	SNP	C	C	T	rs267604890		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:41001289C>T	ENST00000253799.3	+	2	1802	c.1775C>T	c.(1774-1776)gCg>gTg	p.A592V	AOC2_ENST00000452774.2_Missense_Mutation_p.A592V|AOC3_ENST00000308423.2_5'Flank	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	592					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		CAGACTAATGCGTGGGGTCAC	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19136	0.0		0.0	False		,,,				2504	0.0				p.A592V		Atlas-SNP	.											AOC2,colon,carcinoma,0,1	AOC2	61	.	0			c.C1775T						.						80.0	88.0	85.0					17																	41001289		2203	4300	6503	SO:0001583	missense	314	exon2			CTAATGCGTGGGG	AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.1775C>T	chr17.hg19:g.41001289C>T	ENSP00000253799:p.Ala592Val	83.0	0.0		100.0	24.0	NM_009590	A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Missense_Mutation	SNP	ENST00000253799.3	hg19	CCDS11443.1	.	.	.	.	.	.	.	.	.	.	C	11.58	1.681062	0.29872	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	T;T	0.04015	3.73;3.73	5.15	3.14	0.36123	Copper amine oxidase, C-terminal (3);	0.699813	0.14479	N	0.317073	T	0.05547	0.0146	L	0.47716	1.5	0.09310	N	0.999994	P;P	0.42039	0.769;0.727	B;B	0.40199	0.322;0.216	T	0.34625	-0.9821	10	0.34782	T	0.22	-40.0355	7.4503	0.27234	0.4413:0.4786:0.0:0.0801	.	592;592	O75106;O75106-2	AOC2_HUMAN;.	V	592	ENSP00000253799:A592V;ENSP00000406134:A592V	ENSP00000253799:A592V	A	+	2	0	AOC2	38254815	0.202000	0.23423	0.933000	0.37362	0.386000	0.30323	0.856000	0.27818	0.724000	0.32296	0.655000	0.94253	GCG	.	.		0.612	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452442.1	NM_009590, NM_001158	
TMUB2	79089	hgsc.bcm.edu	37	17	42266521	42266521	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:42266521C>T	ENST00000587989.1	+	3	320	c.167C>T	c.(166-168)aCc>aTc	p.T56I	TMUB2_ENST00000589184.1_Intron|ASB16-AS1_ENST00000592897.1_RNA|TMUB2_ENST00000592825.1_Missense_Mutation_p.T36I|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|TMUB2_ENST00000538716.2_Missense_Mutation_p.T56I|TMUB2_ENST00000357984.3_Missense_Mutation_p.T36I|ASB16-AS1_ENST00000585457.1_RNA|TMUB2_ENST00000446571.3_Missense_Mutation_p.T36I|TMUB2_ENST00000587172.1_Missense_Mutation_p.T36I|TMUB2_ENST00000319511.6_Missense_Mutation_p.T36I|TMUB2_ENST00000589785.1_Missense_Mutation_p.T36I|TMUB2_ENST00000589856.1_Missense_Mutation_p.T36I|TMUB2_ENST00000590235.1_Missense_Mutation_p.T36I			Q71RG4	TMUB2_HUMAN	transmembrane and ubiquitin-like domain containing 2	56						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(3)	8		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TGGCTCTCTACCTACGTAGCA	0.582																																					p.T56I		Atlas-SNP	.											.	TMUB2	29	.	0			c.C167T						.						130.0	113.0	119.0					17																	42266521		2203	4300	6503	SO:0001583	missense	79089	exon3			TCTCTACCTACGT		CCDS11479.1, CCDS54134.1	17q21	2006-06-27				ENSG00000168591			28459	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_177441		Approved	MGC3123	uc002ifo.3	Q71RG4		ENST00000587989.1:c.167C>T	chr17.hg19:g.42266521C>T	ENSP00000466971:p.Thr56Ile	80.0	0.0		75.0	11.0	NM_001076674	B3KU81|Q8NDI2|Q9BPZ5|Q9HAG3	Missense_Mutation	SNP	ENST00000587989.1	hg19	CCDS54134.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633878	0.87660	.	.	ENSG00000168591	ENST00000446571;ENST00000357984;ENST00000538716;ENST00000319511	T;T;T;T	0.73047	-0.55;-0.63;-0.71;-0.63	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.83912	0.5357	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.998;0.997	D	0.86293	0.1675	10	0.87932	D	0	.	16.9385	0.86209	0.0:1.0:0.0:0.0	.	36;36;36;56	E7ESS3;Q71RG4-3;Q71RG4-4;Q71RG4	.;.;.;TMUB2_HUMAN	I	36;36;56;36	ENSP00000413127:T36I;ENSP00000350672:T36I;ENSP00000444565:T56I;ENSP00000313214:T36I	ENSP00000313214:T36I	T	+	2	0	TMUB2	39622047	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.384000	0.79751	2.252000	0.74401	0.561000	0.74099	ACC	.	.		0.582	TMUB2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457711.1	NM_177441	
FMNL1	752	hgsc.bcm.edu	37	17	43322423	43322423	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:43322423G>A	ENST00000331495.3	+	21	3012	c.2676G>A	c.(2674-2676)ccG>ccA	p.P892P	MAP3K14-AS1_ENST00000592422.1_RNA|FMNL1_ENST00000328118.3_Silent_p.P892P|MAP3K14-AS1_ENST00000588504.1_RNA|CTD-2020K17.4_ENST00000589518.1_RNA|FMNL1_ENST00000587489.1_Silent_p.P470P|MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|CTD-2020K17.4_ENST00000420431.2_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|CTD-2020K17.4_ENST00000591361.1_RNA	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	892	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						AGAAGTACCCGCAACTCACAG	0.587																																					p.P892P	GBM(164;1247 1997 8702 11086 51972)	Atlas-SNP	.											.	FMNL1	78	.	0			c.G2676A						.						82.0	75.0	77.0					17																	43322423		2203	4300	6503	SO:0001819	synonymous_variant	752	exon21			GTACCCGCAACTC	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.2676G>A	chr17.hg19:g.43322423G>A		107.0	0.0		107.0	18.0	NM_005892	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Silent	SNP	ENST00000331495.3	hg19	CCDS11497.1																																																																																			.	.		0.587	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450198.1	NM_005892	
NSF	4905	hgsc.bcm.edu	37	17	44803929	44803929	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:44803929G>A	ENST00000398238.4	+	16	1883	c.1776G>A	c.(1774-1776)gcG>gcA	p.A592A	NSF_ENST00000575068.1_Silent_p.A587A|NSF_ENST00000225282.8_Silent_p.A498A	NM_006178.3	NP_006169.2	P46459	NSF_HUMAN	N-ethylmaleimide-sensitive factor	592					exocytosis (GO:0006887)|plasma membrane fusion (GO:0045026)|positive regulation of receptor recycling (GO:0001921)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|syntaxin-1 binding (GO:0017075)			kidney(2)|large_intestine(1)|liver(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	14		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		TTGATGATGCGTACAAATCCC	0.383																																					p.A592A	Ovarian(25;472 742 1472 36813 50223)	Atlas-SNP	.											.	NSF	27	.	0			c.G1776A						.						269.0	265.0	266.0					17																	44803929		1975	4157	6132	SO:0001819	synonymous_variant	4905	exon16			TGATGCGTACAAA		CCDS42354.1	17q21	2010-04-21			ENSG00000073969	ENSG00000073969		"""ATPases / AAA-type"""	8016	protein-coding gene	gene with protein product	"""N-ethylmaleimide-sensitive factor-like protein"""	601633				1315316, 8875895	Standard	NM_006178		Approved	SKD2	uc002iku.3	P46459	OTTHUMG00000134315	ENST00000398238.4:c.1776G>A	chr17.hg19:g.44803929G>A		92.0	0.0		94.0	30.0	NM_006178	A8K2D9|B4DFA2|Q8N6D7|Q9UKZ2	Silent	SNP	ENST00000398238.4	hg19	CCDS42354.1																																																																																			.	.		0.383	NSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259348.2	NM_006178	
TMEM92	162461	hgsc.bcm.edu	37	17	48356249	48356249	+	Silent	SNP	G	G	A	rs563916883		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:48356249G>A	ENST00000300433.3	+	5	368	c.258G>A	c.(256-258)ccG>ccA	p.P86P	TMEM92_ENST00000507382.1_Silent_p.P86P|RP11-893F2.9_ENST00000508851.1_RNA|TMEM92_ENST00000511882.1_3'UTR	NM_001168215.1	NP_001161687.1	Q6UXU6	TMM92_HUMAN	transmembrane protein 92	86	Pro-rich.					integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	7						GCAGAGAGCCGGAGCCAGACA	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17169	0.0		0.0	False		,,,				2504	0.0				p.P86P		Atlas-SNP	.											.	TMEM92	13	.	0			c.G258A						.						80.0	89.0	86.0					17																	48356249		2203	4300	6503	SO:0001819	synonymous_variant	162461	exon4			AGAGCCGGAGCCA		CCDS11562.1	17q21.33	2005-12-13							26579	protein-coding gene	gene with protein product						12975309	Standard	NM_153229		Approved	FLJ33318	uc002iqn.2	Q6UXU6		ENST00000300433.3:c.258G>A	chr17.hg19:g.48356249G>A		60.0	0.0		43.0	6.0	NM_153229	Q8NBF0	Silent	SNP	ENST00000300433.3	hg19	CCDS11562.1																																																																																			.	.		0.617	TMEM92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367053.2	NM_153229	
ANKFN1	162282	hgsc.bcm.edu	37	17	54543932	54543932	+	Splice_Site	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:54543932G>T	ENST00000318698.2	+	14	1817	c.1782G>T	c.(1780-1782)caG>caT	p.Q594H	ANKFN1_ENST00000566473.2_Splice_Site_p.Q594H	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	594										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TAACCATCCAGGTATGTAGTT	0.398																																					p.Q594H		Atlas-SNP	.											.	ANKFN1	115	.	0			c.G1782T						.						52.0	48.0	50.0					17																	54543932		2203	4300	6503	SO:0001630	splice_region_variant	162282	exon14			CATCCAGGTATGT	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1782+1G>T	chr17.hg19:g.54543932G>T		90.0	0.0		102.0	11.0	NM_153228		Missense_Mutation	SNP	ENST00000318698.2	hg19	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	g	15.84	2.951644	0.53186	.	.	ENSG00000153930	ENST00000318698	T	0.25085	1.82	5.81	5.81	0.92471	.	0.052171	0.85682	D	0.000000	T	0.22044	0.0531	N	0.25094	0.71	0.80722	D	1	B	0.19073	0.033	B	0.16289	0.015	T	0.02519	-1.1147	10	0.37606	T	0.19	-9.2603	20.0804	0.97772	0.0:0.0:1.0:0.0	.	594	Q8N957	ANKF1_HUMAN	H	594	ENSP00000321627:Q594H	ENSP00000321627:Q594H	Q	+	3	2	ANKFN1	51898931	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.648000	0.83479	2.763000	0.94921	0.651000	0.88453	CAG	.	.		0.398	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	Missense_Mutation
BZRAP1	9256	hgsc.bcm.edu	37	17	56385233	56385233	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:56385233G>A	ENST00000343736.4	-	23	4964	c.4801C>T	c.(4801-4803)Cga>Tga	p.R1601*	BZRAP1_ENST00000268893.6_Nonsense_Mutation_p.R1541*|BZRAP1_ENST00000355701.3_Nonsense_Mutation_p.R1601*			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1601						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGAGGACTCGGACACCTCTC	0.637																																					p.R1601X		Atlas-SNP	.											.	BZRAP1	287	.	0			c.C4801T						.						64.0	55.0	58.0					17																	56385233		2203	4300	6503	SO:0001587	stop_gained	9256	exon23			GGACTCGGACACC	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.4801C>T	chr17.hg19:g.56385233G>A	ENSP00000345824:p.Arg1601*	91.0	0.0		76.0	17.0	NM_004758	O75111|Q8N5W3	Nonsense_Mutation	SNP	ENST00000343736.4	hg19	CCDS11605.1	.	.	.	.	.	.	.	.	.	.	G	43	9.871398	0.99284	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	.	.	.	5.76	3.79	0.43588	.	0.981110	0.08360	N	0.957834	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5512	0.39310	0.1597:0.0:0.8403:0.0	.	.	.	.	X	1601;1601;1541	.	ENSP00000268893:R1541X	R	-	1	2	BZRAP1	53740232	0.064000	0.20934	0.042000	0.18584	0.396000	0.30629	2.398000	0.44486	1.448000	0.47680	0.563000	0.77884	CGA	.	.		0.637	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
MTMR4	9110	hgsc.bcm.edu	37	17	56584581	56584581	+	Missense_Mutation	SNP	A	A	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:56584581A>C	ENST00000323456.5	-	9	889	c.765T>G	c.(763-765)atT>atG	p.I255M	MTMR4_ENST00000579925.1_Missense_Mutation_p.I255M	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	255	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					AGGCTTTAGCAATGGACGTGA	0.612																																					p.I255M		Atlas-SNP	.											.	MTMR4	91	.	0			c.T765G						.						60.0	57.0	58.0					17																	56584581		2203	4300	6503	SO:0001583	missense	9110	exon9			TTTAGCAATGGAC	AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.765T>G	chr17.hg19:g.56584581A>C	ENSP00000325285:p.Ile255Met	97.0	0.0		88.0	27.0	NM_004687	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	ENST00000323456.5	hg19	CCDS11608.1	.	.	.	.	.	.	.	.	.	.	A	19.74	3.884753	0.72410	.	.	ENSG00000108389	ENST00000323456	D	0.94280	-3.39	5.39	-4.8	0.03190	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.062950	0.64402	D	0.000007	D	0.95674	0.8593	M	0.90425	3.115	0.49130	D	0.999751	D	0.89917	1.0	D	0.85130	0.997	D	0.92943	0.6374	10	0.87932	D	0	.	7.643	0.28305	0.5047:0.0:0.3929:0.1024	.	255	Q9NYA4	MTMR4_HUMAN	M	255	ENSP00000325285:I255M	ENSP00000325285:I255M	I	-	3	3	MTMR4	53939580	0.172000	0.23043	0.966000	0.40874	0.991000	0.79684	-0.283000	0.08433	-0.925000	0.03775	-0.462000	0.05337	ATT	.	.		0.612	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444721.1	NM_004687	
TEX2	55852	hgsc.bcm.edu	37	17	62272409	62272409	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:62272409G>A	ENST00000583097.1	-	3	1863	c.1691C>T	c.(1690-1692)gCg>gTg	p.A564V	TEX2_ENST00000258991.3_Missense_Mutation_p.A564V|TEX2_ENST00000584379.1_Missense_Mutation_p.A564V			Q8IWB9	TEX2_HUMAN	testis expressed 2	564					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TGTCAAAGTCGCATGGTAGGT	0.383																																					p.A564V		Atlas-SNP	.											TEX2,NS,carcinoma,+1,1	TEX2	89	.	0			c.C1691T						.						101.0	90.0	93.0					17																	62272409		2203	4300	6503	SO:0001583	missense	55852	exon3			AAAGTCGCATGGT	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.1691C>T	chr17.hg19:g.62272409G>A	ENSP00000462665:p.Ala564Val	98.0	0.0		87.0	8.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	hg19		.	.	.	.	.	.	.	.	.	.	G	16.69	3.192176	0.58017	.	.	ENSG00000136478	ENST00000258991	T	0.39997	1.05	6.07	5.11	0.69529	Pleckstrin homology domain (1);	0.102234	0.64402	D	0.000002	T	0.41511	0.1162	L	0.36672	1.1	0.80722	D	1	D;P	0.58970	0.984;0.802	P;B	0.50896	0.653;0.143	T	0.15350	-1.0440	10	0.11794	T	0.64	-16.78	15.5075	0.75753	0.0661:0.0:0.9339:0.0	.	564;564	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	V	564	ENSP00000258991:A564V	ENSP00000258991:A564V	A	-	2	0	TEX2	59626141	1.000000	0.71417	0.940000	0.37924	0.989000	0.77384	9.338000	0.96553	1.581000	0.49865	0.655000	0.94253	GCG	.	.		0.383	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
BPTF	2186	hgsc.bcm.edu	37	17	65924473	65924473	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:65924473A>G	ENST00000321892.4	+	18	6193	c.6132A>G	c.(6130-6132)aaA>aaG	p.K2044K	BPTF_ENST00000335221.5_Silent_p.K2044K|BPTF_ENST00000306378.6_Silent_p.K1918K|BPTF_ENST00000424123.3_Silent_p.K1905K			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2044					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTTTTTAGAAACGACTGGAGC	0.418																																					p.K2044K		Atlas-SNP	.											.	BPTF	415	.	0			c.A6132G						.						45.0	42.0	43.0					17																	65924473		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon18			TTAGAAACGACTG	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.6132A>G	chr17.hg19:g.65924473A>G		222.0	0.0		217.0	24.0	NM_004459	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	hg19																																																																																				.	.		0.418	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
ABCA9	10350	hgsc.bcm.edu	37	17	67029868	67029868	+	Splice_Site	SNP	G	G	A	rs146940647		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:67029868G>A	ENST00000340001.4	-	9	1486	c.1275C>T	c.(1273-1275)ccC>ccT	p.P425P	ABCA9_ENST00000370732.2_Splice_Site_p.P425P|ABCA9_ENST00000453985.2_Splice_Site_p.P425P	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	425					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					AGTACTTACCGGGCAAAATTT	0.299																																					p.P425P		Atlas-SNP	.											.	ABCA9	192	.	0			c.C1275T						.	G		2,4404	4.2+/-10.8	0,2,2201	90.0	100.0	96.0		1275	-0.1	1.0	17	dbSNP_134	96	0,8596		0,0,4298	yes	coding-synonymous-near-splice	ABCA9	NM_080283.3		0,2,6499	AA,AG,GG		0.0,0.0454,0.0154		425/1625	67029868	2,13000	2203	4298	6501	SO:0001630	splice_region_variant	10350	exon9			CTTACCGGGCAAA	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.1276+1C>T	chr17.hg19:g.67029868G>A		297.0	0.0		268.0	41.0	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Silent	SNP	ENST00000340001.4	hg19	CCDS11681.1																																																																																			.	G|1.000;A|0.000		0.299	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	Silent
GRIN2C	2905	hgsc.bcm.edu	37	17	72845978	72845978	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:72845978G>A	ENST00000293190.5	-	7	1732	c.1586C>T	c.(1585-1587)aCg>aTg	p.T529M	GRIN2C_ENST00000347612.4_Missense_Mutation_p.T529M|GRIN2C_ENST00000578159.1_5'Flank	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	529					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACTGATGCCCGTCTCCACAAA	0.627																																					p.T529M		Atlas-SNP	.											.	GRIN2C	144	.	0			c.C1586T						.						106.0	96.0	99.0					17																	72845978		2203	4300	6503	SO:0001583	missense	2905	exon7			ATGCCCGTCTCCA		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1586C>T	chr17.hg19:g.72845978G>A	ENSP00000293190:p.Thr529Met	81.0	0.0		88.0	9.0	NM_000835	B2RTT1	Missense_Mutation	SNP	ENST00000293190.5	hg19	CCDS32724.1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754016	0.49362	.	.	ENSG00000161509	ENST00000293190;ENST00000347612	T	0.30981	1.51	4.19	4.19	0.49359	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.62502	0.2433	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.72337	-0.4324	10	0.72032	D	0.01	.	17.0587	0.86541	0.0:0.0:1.0:0.0	.	563;529	Q8IW23;Q14957	.;NMDE3_HUMAN	M	529;563	ENSP00000293190:T529M	ENSP00000293190:T529M	T	-	2	0	GRIN2C	70357573	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.468000	0.97676	2.313000	0.78055	0.491000	0.48974	ACG	.	.		0.627	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1		
EVPL	2125	hgsc.bcm.edu	37	17	74005326	74005326	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:74005326G>A	ENST00000301607.3	-	22	4213	c.3960C>T	c.(3958-3960)caC>caT	p.H1320H	EVPL_ENST00000586740.1_Silent_p.H1342H	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1320	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						GGTCCTTCTCGTGGCGCACCA	0.701																																					p.H1320H		Atlas-SNP	.											EVPL,NS,carcinoma,0,1	EVPL	155	.	0			c.C3960T						.						102.0	113.0	109.0					17																	74005326		2202	4300	6502	SO:0001819	synonymous_variant	2125	exon22			CTTCTCGTGGCGC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3960C>T	chr17.hg19:g.74005326G>A		25.0	0.0		19.0	4.0	NM_001988	A0AUV5	Silent	SNP	ENST00000301607.3	hg19	CCDS11737.1																																																																																			.	.		0.701	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
DNAH17	8632	hgsc.bcm.edu	37	17	76535911	76535911	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:76535911A>G	ENST00000585328.1	-	18	2708	c.2584T>C	c.(2584-2586)Tat>Cat	p.Y862H	DNAH17_ENST00000389840.5_Missense_Mutation_p.Y862H	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	862	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TAGATGACATAATCCTTCCAG	0.453																																					p.Y862H		Atlas-SNP	.											.	DNAH17	347	.	0			c.T2584C						.						68.0	68.0	68.0					17																	76535911		2010	4172	6182	SO:0001583	missense	8632	exon18			TGACATAATCCTT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.2584T>C	chr17.hg19:g.76535911A>G	ENSP00000465516:p.Tyr862His	309.0	0.0		310.0	118.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.98	3.520295	0.64747	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.36157	1.27	4.97	4.97	0.65823	.	.	.	.	.	T	0.59473	0.2196	M	0.83774	2.66	0.42318	D	0.992241	.	.	.	.	.	.	T	0.67620	-0.5624	7	0.87932	D	0	.	14.6508	0.68794	1.0:0.0:0.0:0.0	.	.	.	.	H	862	ENSP00000374490:Y862H	ENSP00000300671:Y862H	Y	-	1	0	DNAH17	74047506	1.000000	0.71417	0.218000	0.23776	0.396000	0.30629	8.121000	0.89582	1.861000	0.53984	0.533000	0.62120	TAT	.	.		0.453	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
CBX8	57332	hgsc.bcm.edu	37	17	77769341	77769341	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:77769341T>C	ENST00000269385.4	-	5	380	c.263A>G	c.(262-264)aAg>aGg	p.K88R	CBX8_ENST00000485449.1_5'UTR	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	88					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			AGTTTTGGCCTTTGCCTTGGC	0.642																																					p.K88R		Atlas-SNP	.											.	CBX8	42	.	0			c.A263G						.						14.0	17.0	16.0					17																	77769341		2170	4263	6433	SO:0001583	missense	57332	exon5			TTGGCCTTTGCCT	AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.263A>G	chr17.hg19:g.77769341T>C	ENSP00000269385:p.Lys88Arg	37.0	0.0		38.0	5.0	NM_020649	Q96H39|Q9NR07	Missense_Mutation	SNP	ENST00000269385.4	hg19	CCDS11765.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.499783	0.26861	.	.	ENSG00000141570	ENST00000269385;ENST00000427800;ENST00000413392	T;T;T	0.48836	0.8;1.49;1.49	4.72	3.64	0.41730	.	0.221289	0.34460	N	0.003948	T	0.34513	0.0900	L	0.38838	1.175	0.46678	D	0.999154	B	0.21753	0.06	B	0.20577	0.03	T	0.07404	-1.0774	10	0.19590	T	0.45	-21.3299	10.0454	0.42184	0.0:0.0805:0.0:0.9195	.	88	Q9HC52	CBX8_HUMAN	R	88;63;78	ENSP00000269385:K88R;ENSP00000408753:K63R;ENSP00000405058:K78R	ENSP00000269385:K88R	K	-	2	0	CBX8	75383936	1.000000	0.71417	0.994000	0.49952	0.912000	0.54170	5.794000	0.69067	0.642000	0.30620	0.459000	0.35465	AAG	.	.		0.642	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318011.1	NM_020649	
AATK	9625	hgsc.bcm.edu	37	17	79096552	79096552	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:79096552A>G	ENST00000326724.4	-	11	1208	c.1184T>C	c.(1183-1185)cTg>cCg	p.L395P	MIR657_ENST00000385003.1_RNA|AATK_ENST00000572339.1_5'Flank|AATK_ENST00000417379.1_Missense_Mutation_p.L292P	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	395	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CAGGTAGGACAGCAGCAGGTG	0.726																																					p.L395P		Atlas-SNP	.											.	AATK	102	.	0			c.T1184C						.						8.0	10.0	10.0					17																	79096552		2036	4151	6187	SO:0001583	missense	9625	exon11			TAGGACAGCAGCA	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1184T>C	chr17.hg19:g.79096552A>G	ENSP00000324196:p.Leu395Pro	84.0	0.0		83.0	36.0	NM_001080395	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	hg19	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	22.8|22.8	4.334837|4.334837	0.81801|0.81801	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000417379|ENST00000326724;ENST00000374792	.|D;D	.|0.84442	.|-1.85;-1.68	4.61|4.61	3.53|3.53	0.40419|0.40419	.|Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.257134	.|0.31450	.|N	.|0.007630	D|D	0.92107|0.92107	0.7498|0.7498	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.92424|0.92424	0.5948|0.5948	5|10	.|0.87932	.|D	.|0	.|.	9.2376|9.2376	0.37475|0.37475	0.912:0.0:0.088:0.0|0.912:0.0:0.088:0.0	.|.	.|395	.|Q6ZMQ8	.|LMTK1_HUMAN	R|P	348|395	.|ENSP00000324196:L395P;ENSP00000363924:L395P	.|ENSP00000324196:L395P	C|L	-|-	1|2	0|0	AATK|AATK	76711147|76711147	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.983000|0.983000	0.72400|0.72400	5.766000|5.766000	0.68843|0.68843	1.701000|1.701000	0.51217|0.51217	0.375000|0.375000	0.23000|0.23000	TGT|CTG	.	.		0.726	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
GAREM	64762	hgsc.bcm.edu	37	18	29850320	29850320	+	Silent	SNP	G	G	A	rs368693154		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr18:29850320G>A	ENST00000269209.6	-	5	1596	c.1593C>T	c.(1591-1593)aaC>aaT	p.N531N	GAREM_ENST00000399218.4_Silent_p.N531N			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	531	Necessary for interaction with GRB2.|Pro-rich.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CAGGTGGGGCGTTCAGGAGCC	0.597													g|||	1	0.000199681	0.0008	0.0	5008	,	,		16312	0.0		0.0	False		,,,				2504	0.0				p.N531N		Atlas-SNP	.											.	.	.	.	0			c.C1593T						.	G	,	1,4405	2.1+/-5.4	0,1,2202	90.0	77.0	81.0		1593,1593	2.0	1.0	18		81	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	FAM59A	NM_001242409.1,NM_022751.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	531/877,531/876	29850320	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64762	exon5			TGGGGCGTTCAGG	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1593C>T	chr18.hg19:g.29850320G>A		131.0	0.0		112.0	22.0	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Silent	SNP	ENST00000269209.6	hg19	CCDS56057.1																																																																																			.	.		0.597	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
ZBTB7C	201501	hgsc.bcm.edu	37	18	45566490	45566490	+	Missense_Mutation	SNP	T	T	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr18:45566490T>G	ENST00000588982.1	-	3	1490	c.989A>C	c.(988-990)gAc>gCc	p.D330A	ZBTB7C_ENST00000586438.1_Missense_Mutation_p.D330A|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.D330A|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.D330A|ZBTB7C_ENST00000535628.2_Missense_Mutation_p.D330A			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	330							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						GGCACCGTAGTCGTTCTCCGC	0.632																																					p.D330A		Atlas-SNP	.											.	ZBTB7C	73	.	0			c.A989C						.						73.0	73.0	73.0					18																	45566490		2203	4300	6503	SO:0001583	missense	201501	exon2			CCGTAGTCGTTCT	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.989A>C	chr18.hg19:g.45566490T>G	ENSP00000468782:p.Asp330Ala	48.0	0.0		62.0	8.0	NM_001039360	O73453	Missense_Mutation	SNP	ENST00000588982.1	hg19	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901489	0.72754	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.11495	2.77;2.77	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	L	0.27053	0.805	0.58432	D	0.999999	D;D	0.69078	0.997;0.997	D;D	0.67103	0.949;0.949	T	0.11767	-1.0574	10	0.12103	T	0.63	.	15.2867	0.73833	0.0:0.0:0.0:1.0	.	330;330	B2RG49;A1YPR0	.;ZBT7C_HUMAN	A	330	ENSP00000439781:D330A;ENSP00000328732:D330A	ENSP00000328732:D330A	D	-	2	0	ZBTB7C	43820488	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.259000	0.72494	2.013000	0.59113	0.459000	0.35465	GAC	.	.		0.632	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
MEX3C	51320	hgsc.bcm.edu	37	18	48723154	48723154	+	Intron	SNP	G	G	C	rs78074704|rs62092914|rs147438518		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr18:48723154G>C	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		ccgccgccgcggccgccgccT	0.771																																					p.A179A		Atlas-SNP	.											MEX3C_ENST00000406189,NS,carcinoma,0,1	MEX3C	77	.	0			c.C537G						.						3.0	3.0	3.0					18																	48723154		1139	2266	3405	SO:0001627	intron_variant	51320	exon1			CGCCGCGGCCGCC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19208C>G	chr18.hg19:g.48723154G>C		37.0	0.0		56.0	11.0	NM_016626	A1L022|Q9NZE3	Silent	SNP	ENST00000591040.1	hg19																																																																																				.	.		0.771	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
RTTN	25914	hgsc.bcm.edu	37	18	67753861	67753861	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr18:67753861A>G	ENST00000255674.6	-	32	4648	c.4362T>C	c.(4360-4362)gaT>gaC	p.D1454D	RTTN_ENST00000437017.1_Silent_p.D1454D|RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1454					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				GCCAAGTATAATCCTTTATAA	0.249																																					p.D1454D		Atlas-SNP	.											.	RTTN	184	.	0			c.T4362C						.						85.0	93.0	90.0					18																	67753861		1787	4055	5842	SO:0001819	synonymous_variant	25914	exon32			AGTATAATCCTTT	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4362T>C	chr18.hg19:g.67753861A>G		294.0	0.0		307.0	47.0	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	hg19	CCDS42443.1																																																																																			.	.		0.249	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
PPAP2C	8612	hgsc.bcm.edu	37	19	282794	282794	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:282794C>T	ENST00000269812.3	-	4	547	c.498G>A	c.(496-498)tcG>tcA	p.S166S	PPAP2C_ENST00000327790.3_Silent_p.S187S|PPAP2C_ENST00000434325.2_Silent_p.S110S	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	166					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGAGTGTCCCGAGTAGAAAG	0.587																																					p.S187S		Atlas-SNP	.											.	PPAP2C	38	.	0			c.G561A						.						109.0	92.0	98.0					19																	282794		2203	4300	6503	SO:0001819	synonymous_variant	8612	exon4			GTGTCCCGAGTAG	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.498G>A	chr19.hg19:g.282794C>T		90.0	0.0		115.0	25.0	NM_177543	A6NLV0|E9PAY8	Silent	SNP	ENST00000269812.3	hg19	CCDS12023.1																																																																																			.	.		0.587	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2		
ODF3L2	284451	hgsc.bcm.edu	37	19	464152	464152	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:464152G>A	ENST00000315489.4	-	4	797	c.562C>T	c.(562-564)Cgc>Tgc	p.R188C	ODF3L2_ENST00000382696.3_Missense_Mutation_p.R152C	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	188	Pro-rich.					cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						gggggggtgcggcccACCACC	0.697																																					p.R188C		Atlas-SNP	.											.	ODF3L2	18	.	0			c.C562T						.						3.0	3.0	3.0					19																	464152		1557	3170	4727	SO:0001583	missense	284451	exon4			GGGTGCGGCCCAC	AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.562C>T	chr19.hg19:g.464152G>A	ENSP00000318029:p.Arg188Cys	69.0	0.0		64.0	19.0	NM_182577	Q3SX65|Q8N1L2	Missense_Mutation	SNP	ENST00000315489.4	hg19	CCDS12027.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326900	0.24080	.	.	ENSG00000181781	ENST00000315489;ENST00000382696	T;T	0.55930	1.01;0.49	3.8	0.197	0.15164	.	0.283333	0.34555	N	0.003873	T	0.63534	0.2519	M	0.86502	2.82	0.34587	D	0.715127	P;D	0.64830	0.941;0.994	B;P	0.58873	0.244;0.847	T	0.66492	-0.5910	10	0.87932	D	0	-20.4769	2.293	0.04143	0.1011:0.1663:0.3923:0.3403	.	152;188	Q3SX64-2;Q3SX64	.;OD3L2_HUMAN	C	188;152	ENSP00000318029:R188C;ENSP00000372143:R152C	ENSP00000318029:R188C	R	-	1	0	ODF3L2	415152	0.917000	0.31117	0.025000	0.17156	0.002000	0.02628	1.872000	0.39549	-0.069000	0.12931	-0.325000	0.08501	CGC	.	.		0.697	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451849.2	NM_182577	
REEP6	92840	hgsc.bcm.edu	37	19	1495386	1495386	+	Splice_Site	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:1495386C>T	ENST00000233596.3	+	2	313	c.209C>T	c.(208-210)tCa>tTa	p.S70L		NM_138393.1	NP_612402.1	Q96HR9	REEP6_HUMAN	receptor accessory protein 6	70					regulation of intracellular transport (GO:0032386)	apical part of cell (GO:0045177)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				lung(1)|ovary(1)	2		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCATATGCCTCGTGAGTGCAC	0.627																																					p.S70L		Atlas-SNP	.											.	REEP6	21	.	0			c.C209T						.						100.0	88.0	92.0					19																	1495386		2201	4300	6501	SO:0001630	splice_region_variant	92840	exon2			ATGCCTCGTGAGT	BC008201	CCDS12070.1	19p13.3	2012-12-20	2006-02-08	2006-02-07	ENSG00000115255	ENSG00000115255		"""Receptor accessory proteins"""	30078	protein-coding gene	gene with protein product	"""polyposis locus protein 1-like 1"", ""deleted in polyposis 1-like 1"""	609346	"""chromosome 19 open reading frame 32"""	C19orf32		16271481, 15550249	Standard	NM_138393		Approved	DP1L1, FLJ25383	uc002ltc.3	Q96HR9	OTTHUMG00000180072	ENST00000233596.3:c.209+1C>T	chr19.hg19:g.1495386C>T		42.0	0.0		51.0	8.0	NM_138393	B2RE01|D6W5Z0|Q96LM0	Missense_Mutation	SNP	ENST00000233596.3	hg19	CCDS12070.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711835	0.68730	.	.	ENSG00000115255	ENST00000233596;ENST00000395479	D	0.95447	-3.71	4.48	4.48	0.54585	.	.	.	.	.	D	0.98789	0.9592	H	0.99347	4.525	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.954	D	0.99395	1.0926	9	0.72032	D	0.01	-0.8094	15.7471	0.77955	0.0:1.0:0.0:0.0	.	70;70	B4DF39;Q96HR9	.;REEP6_HUMAN	L	70	ENSP00000233596:S70L	ENSP00000233596:S70L	S	+	2	0	REEP6	1446386	1.000000	0.71417	0.994000	0.49952	0.064000	0.16182	7.476000	0.81055	2.046000	0.60703	0.556000	0.70494	TCA	.	.		0.627	REEP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449623.1	NM_138393	Missense_Mutation
TLE2	7089	hgsc.bcm.edu	37	19	3006585	3006585	+	Missense_Mutation	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:3006585G>T	ENST00000262953.6	-	15	1595	c.1333C>A	c.(1333-1335)Ccg>Acg	p.P445T	TLE2_ENST00000586422.1_Intron|TLE2_ENST00000447365.2_Missense_Mutation_p.P112T|TLE2_ENST00000443826.3_Missense_Mutation_p.P323T|TLE2_ENST00000455444.2_Missense_Mutation_p.P323T|TLE2_ENST00000591529.1_Missense_Mutation_p.P459T|TLE2_ENST00000590536.1_Missense_Mutation_p.P446T|TLE2_ENST00000426948.2_Missense_Mutation_p.P459T	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	445					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGTGCCGCGGGATGCCCGCG	0.692																																					p.P459T		Atlas-SNP	.											.	TLE2	35	.	0			c.C1375A						.						13.0	17.0	16.0					19																	3006585		2088	4208	6296	SO:0001583	missense	7089	exon16			GCCGCGGGATGCC	M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.1333C>A	chr19.hg19:g.3006585G>T	ENSP00000262953:p.Pro445Thr	227.0	0.0		222.0	84.0	NM_001144761	B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Missense_Mutation	SNP	ENST00000262953.6	hg19	CCDS45911.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784479	0.90282	.	.	ENSG00000065717	ENST00000262953;ENST00000455444;ENST00000450017;ENST00000447365;ENST00000443826;ENST00000426948;ENST00000439015	T;T;T;T;T	0.12039	2.72;2.72;2.72;2.72;2.72	3.87	3.87	0.44632	WD40 repeat-like-containing domain (1);	0.111765	0.64402	D	0.000008	T	0.40448	0.1117	M	0.83603	2.65	0.58432	D	0.999995	D;D;D;D;D;D	0.89917	1.0;1.0;0.983;0.999;1.0;1.0	D;D;P;D;D;D	0.85130	0.997;0.996;0.609;0.961;0.997;0.997	T	0.48007	-0.9072	10	0.87932	D	0	-19.3704	15.0009	0.71469	0.0:0.0:1.0:0.0	.	353;323;112;459;323;445	B4DZU9;E9PEV7;B4DE62;F8WCH2;B4DE03;Q04725	.;.;.;.;.;TLE2_HUMAN	T	445;323;439;112;323;459;353	ENSP00000262953:P445T;ENSP00000413107:P323T;ENSP00000406523:P112T;ENSP00000392427:P323T;ENSP00000392869:P459T	ENSP00000262953:P445T	P	-	1	0	TLE2	2957585	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	7.716000	0.84723	2.183000	0.69458	0.456000	0.33151	CCG	.	.		0.692	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452194.2	NM_003260	
CATSPERD	257062	hgsc.bcm.edu	37	19	5778650	5778650	+	Missense_Mutation	SNP	G	G	A	rs556362293		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:5778650G>A	ENST00000381624.3	+	22	2421	c.2360G>A	c.(2359-2361)cGc>cAc	p.R787H	CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	787					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											CCCCCGGGACGCCACCGCACT	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		17120	0.0		0.0	False		,,,				2504	0.001				p.R787H		Atlas-SNP	.											TMEM146,NS,lymphoid_neoplasm,0,2	.	.	.	0			c.G2360A						.						42.0	49.0	47.0					19																	5778650		2118	4226	6344	SO:0001583	missense	257062	exon22			CGGGACGCCACCG	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.2360G>A	chr19.hg19:g.5778650G>A	ENSP00000371037:p.Arg787His	161.0	0.0		174.0	31.0	NM_152784	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	hg19	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	G	1.069	-0.670465	0.03403	.	.	ENSG00000174898	ENST00000381624;ENST00000381613	T	0.26067	1.76	1.09	-2.19	0.07015	.	.	.	.	.	T	0.12092	0.0294	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22347	-1.0219	9	0.72032	D	0.01	.	4.6743	0.12705	0.5611:0.0:0.4389:0.0	.	787	Q86XM0	TM146_HUMAN	H	787;456	ENSP00000371037:R787H	ENSP00000371026:R456H	R	+	2	0	TMEM146	5729650	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.309000	0.02728	-0.927000	0.03766	-1.056000	0.02311	CGC	.	.		0.582	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
PSPN	5623	hgsc.bcm.edu	37	19	6375770	6375770	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:6375770C>T	ENST00000245810.1	-	1	90	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	PSPN_ENST00000597721.1_Missense_Mutation_p.V31M	NM_004158.2	NP_004149.1	O60542	PSPN_HUMAN	persephin	31					axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|central nervous system development (GO:0007417)|nervous system development (GO:0007399)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			lung(1)|ovary(1)|skin(1)	3						CCATCGGCCACGGGAACCCCA	0.647																																					p.V31M		Atlas-SNP	.											.	PSPN	5	.	0			c.G91A						.						48.0	43.0	45.0					19																	6375770		2203	4300	6503	SO:0001583	missense	5623	exon1			CGGCCACGGGAAC	AF040962	CCDS12164.1	19p13.3	2014-01-30				ENSG00000125650		"""Endogenous ligands"""	9579	protein-coding gene	gene with protein product		602921				10072588	Standard	NM_004158		Approved	PSP	uc010xja.2	O60542		ENST00000245810.1:c.91G>A	chr19.hg19:g.6375770C>T	ENSP00000245810:p.Val31Met	220.0	0.0		222.0	45.0	NM_004158		Missense_Mutation	SNP	ENST00000245810.1	hg19	CCDS12164.1	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548062	0.27652	.	.	ENSG00000125650	ENST00000545374;ENST00000245810	D	0.89939	-2.59	3.45	0.948	0.19561	.	.	.	.	.	T	0.78509	0.4294	L	0.27053	0.805	0.09310	N	1	D	0.54772	0.968	B	0.39876	0.312	T	0.70212	-0.4934	9	0.62326	D	0.03	-9.747	5.3807	0.16189	0.2344:0.5371:0.2285:0.0	.	31	O60542	PSPN_HUMAN	M	31	ENSP00000245810:V31M	ENSP00000245810:V31M	V	-	1	0	PSPN	6326770	0.000000	0.05858	0.050000	0.19076	0.031000	0.12232	-0.596000	0.05720	0.732000	0.32470	0.313000	0.20887	GTG	.	.		0.647	PSPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398032.1	NM_004158	
XAB2	56949	hgsc.bcm.edu	37	19	7687478	7687478	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:7687478A>G	ENST00000358368.4	-	11	1478	c.1441T>C	c.(1441-1443)Tac>Cac	p.Y481H	XAB2_ENST00000534844.1_Missense_Mutation_p.Y478H	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	481					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						AGTGACTTGTACACGCGGTTC	0.687								Direct reversal of damage;Nucleotide excision repair (NER)																													p.Y481H		Atlas-SNP	.											.	XAB2	69	.	0			c.T1441C						.						47.0	45.0	46.0					19																	7687478		2203	4300	6503	SO:0001583	missense	56949	exon11			ACTTGTACACGCG	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.1441T>C	chr19.hg19:g.7687478A>G	ENSP00000351137:p.Tyr481His	35.0	0.0		39.0	5.0	NM_020196	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	ENST00000358368.4	hg19	CCDS32892.1	.	.	.	.	.	.	.	.	.	.	A	3.964	-0.009680	0.07727	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.12255	2.7;2.7	3.95	3.95	0.45737	.	0.073373	0.56097	D	0.000027	T	0.06917	0.0176	N	0.13327	0.33	0.58432	D	0.999994	B	0.11235	0.004	B	0.10450	0.005	T	0.12091	-1.0561	10	0.02654	T	1	-27.8417	11.9474	0.52936	1.0:0.0:0.0:0.0	.	481	Q9HCS7	SYF1_HUMAN	H	481;478	ENSP00000351137:Y481H;ENSP00000438225:Y478H	ENSP00000351137:Y481H	Y	-	1	0	XAB2	7593478	1.000000	0.71417	0.998000	0.56505	0.630000	0.37929	6.901000	0.75693	1.659000	0.50751	0.379000	0.24179	TAC	.	.		0.687	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196	
FBN3	84467	hgsc.bcm.edu	37	19	8145942	8145942	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:8145942G>A	ENST00000600128.1	-	59	7812	c.7398C>T	c.(7396-7398)ggC>ggT	p.G2466G	FBN3_ENST00000270509.2_Silent_p.G2466G|FBN3_ENST00000601739.1_Silent_p.G2466G			Q75N90	FBN3_HUMAN	fibrillin 3	2466	EGF-like 40; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGGTGAAGGCGCCCACAGTGT	0.662																																					p.G2466G		Atlas-SNP	.											.	FBN3	300	.	0			c.C7398T						.						72.0	63.0	66.0					19																	8145942		2203	4300	6503	SO:0001819	synonymous_variant	84467	exon58			GAAGGCGCCCACA		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7398C>T	chr19.hg19:g.8145942G>A		24.0	0.0		35.0	6.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	hg19	CCDS12196.1																																																																																			.	.		0.662	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
OR7D4	125958	hgsc.bcm.edu	37	19	9324680	9324680	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:9324680G>A	ENST00000308682.2	-	1	862	c.834C>T	c.(832-834)taC>taT	p.Y278Y		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						TGACCATGGCGTACATCACTG	0.557																																					p.Y278Y		Atlas-SNP	.											OR7D4,NS,carcinoma,0,1	OR7D4	66	.	0			c.C834T						.						70.0	63.0	65.0					19																	9324680		2203	4300	6503	SO:0001819	synonymous_variant	125958	exon1			CATGGCGTACATC		CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.834C>T	chr19.hg19:g.9324680G>A		66.0	0.0		68.0	27.0	NM_001005191	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Silent	SNP	ENST00000308682.2	hg19	CCDS32901.1																																																																																			.	.		0.557	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1		
DOCK6	57572	hgsc.bcm.edu	37	19	11322519	11322519	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:11322519G>A	ENST00000294618.7	-	37	4695	c.4684C>T	c.(4684-4686)Ctg>Ttg	p.L1562L	DOCK6_ENST00000319867.7_Silent_p.L901L|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1562					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GTGTCCGTCAGGATCATGTGC	0.592																																					p.L1562L		Atlas-SNP	.											.	DOCK6	104	.	0			c.C4684T						.						55.0	55.0	55.0					19																	11322519		2048	4183	6231	SO:0001819	synonymous_variant	57572	exon37			CCGTCAGGATCAT		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4684C>T	chr19.hg19:g.11322519G>A		88.0	0.0		69.0	11.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	hg19	CCDS45975.1																																																																																			.	.		0.592	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
RFX1	5989	hgsc.bcm.edu	37	19	14090352	14090352	+	Missense_Mutation	SNP	T	T	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:14090352T>A	ENST00000254325.4	-	7	975	c.741A>T	c.(739-741)agA>agT	p.R247S		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	247					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			GGACCACAGATCTCTGGGAGG	0.612																																					p.R247S		Atlas-SNP	.											.	RFX1	63	.	0			c.A741T						.						47.0	51.0	50.0					19																	14090352		2203	4300	6503	SO:0001583	missense	5989	exon7			CACAGATCTCTGG		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.741A>T	chr19.hg19:g.14090352T>A	ENSP00000254325:p.Arg247Ser	76.0	0.0		89.0	11.0	NM_002918		Missense_Mutation	SNP	ENST00000254325.4	hg19	CCDS12301.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.024166	0.75390	.	.	ENSG00000132005	ENST00000254325	T	0.47528	0.84	4.7	2.37	0.29283	RFX1 transcription activation region (1);	0.089033	0.43579	D	0.000554	T	0.49098	0.1537	L	0.33485	1.01	0.41127	D	0.985851	D	0.62365	0.991	D	0.78314	0.991	T	0.46062	-0.9218	10	0.40728	T	0.16	-23.4529	4.2842	0.10846	0.0:0.5895:0.0:0.4105	.	247	P22670	RFX1_HUMAN	S	247	ENSP00000254325:R247S	ENSP00000254325:R247S	R	-	3	2	RFX1	13951352	1.000000	0.71417	0.998000	0.56505	0.751000	0.42716	1.458000	0.35223	0.974000	0.38366	-0.232000	0.12228	AGA	.	.		0.612	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
JAK3	3718	hgsc.bcm.edu	37	19	17942173	17942173	+	Missense_Mutation	SNP	G	G	A	rs200202992		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:17942173G>A	ENST00000527670.1	-	20	2871	c.2842C>T	c.(2842-2844)Cgc>Tgc	p.R948C	JAK3_ENST00000534444.1_Missense_Mutation_p.R948C|JAK3_ENST00000458235.1_Missense_Mutation_p.R948C			P52333	JAK3_HUMAN	Janus kinase 3	948	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)	p.R948C(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GCCAGGTCGCGGTGCACGCAG	0.642		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.R948C		Atlas-SNP	.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	JAK3_ENST00000458235,head_neck,carcinoma,0,3	JAK3	341	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C2842T						.						100.0	90.0	93.0					19																	17942173		2203	4300	6503	SO:0001583	missense	3718	exon21			GGTCGCGGTGCAC	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2842C>T	chr19.hg19:g.17942173G>A	ENSP00000432511:p.Arg948Cys	66.0	1.0		55.0	4.0	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	hg19	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271589	0.80469	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	T;T;D	0.88818	-0.88;-0.88;-2.43	3.43	2.25	0.28309	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.146397	0.44688	D	0.000439	D	0.93284	0.7860	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92590	0.6082	10	0.87932	D	0	-22.2012	7.5508	0.27796	0.0:0.0:0.6005:0.3995	.	948;948	P52333-2;P52333	.;JAK3_HUMAN	C	948	ENSP00000391676:R948C;ENSP00000432511:R948C;ENSP00000436421:R948C	ENSP00000391676:R948C	R	-	1	0	JAK3	17803173	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.581000	0.23819	1.883000	0.54544	0.462000	0.41574	CGC	.	.		0.642	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
MAST3	23031	hgsc.bcm.edu	37	19	18218416	18218416	+	Missense_Mutation	SNP	G	G	A	rs368179436		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:18218416G>A	ENST00000262811.6	+	2	59	c.59G>A	c.(58-60)cGc>cAc	p.R20H		NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	20							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						AGCCTGCCACGCCGAGGACGT	0.567																																					p.R20H		Atlas-SNP	.											.	MAST3	83	.	0			c.G59A						.	G	HIS/ARG	0,3916		0,0,1958	105.0	113.0	111.0		59	4.3	1.0	19		111	1,8277		0,1,4138	no	missense	MAST3	NM_015016.1	29	0,1,6096	AA,AG,GG		0.0121,0.0,0.0082	possibly-damaging	20/1310	18218416	1,12193	1958	4139	6097	SO:0001583	missense	23031	exon2			TGCCACGCCGAGG	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.59G>A	chr19.hg19:g.18218416G>A	ENSP00000262811:p.Arg20His	68.0	0.0		52.0	7.0	NM_015016	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	ENST00000262811.6	hg19	CCDS46014.1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.343020	0.61073	0.0	1.21E-4	ENSG00000099308	ENST00000262811	T	0.72051	-0.62	4.29	4.29	0.51040	.	.	.	.	.	T	0.66557	0.2801	L	0.51422	1.61	0.30329	N	0.786876	P	0.34562	0.457	B	0.34590	0.186	T	0.69807	-0.5045	9	0.59425	D	0.04	-0.0014	13.8648	0.63581	0.0:0.0:1.0:0.0	.	20	O60307	MAST3_HUMAN	H	20	ENSP00000262811:R20H	ENSP00000262811:R20H	R	+	2	0	MAST3	18079416	1.000000	0.71417	0.992000	0.48379	0.965000	0.64279	5.024000	0.64090	2.103000	0.63969	0.561000	0.74099	CGC	.	.		0.567	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466526.2	XM_038150	
ZNF91	7644	hgsc.bcm.edu	37	19	23543832	23543832	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:23543832C>T	ENST00000300619.7	-	4	2154	c.1949G>A	c.(1948-1950)aGa>aAa	p.R650K	ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.R618K|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	650					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R650I(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				AGTATGAATTCTCTTATGTTT	0.383																																					p.R650K		Atlas-SNP	.											ZNF91_ENST00000300619,NS,carcinoma,0,3	ZNF91	349	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1949A						.						57.0	60.0	59.0					19																	23543832		2098	4239	6337	SO:0001583	missense	7644	exon4			TGAATTCTCTTAT	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1949G>A	chr19.hg19:g.23543832C>T	ENSP00000300619:p.Arg650Lys	162.0	0.0		179.0	27.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	hg19	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	8.797	0.931978	0.18131	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.18338	2.22;2.22	1.71	0.586	0.17434	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13415	0.0325	L	0.48877	1.53	0.26529	N	0.974284	B;P	0.42409	0.41;0.779	B;B	0.36666	0.147;0.23	T	0.12811	-1.0533	9	0.44086	T	0.13	.	8.1214	0.30974	0.2433:0.7567:0.0:0.0	.	618;650	Q05481-2;Q05481	.;ZNF91_HUMAN	K	650;618	ENSP00000300619:R650K;ENSP00000380272:R618K	ENSP00000300619:R650K	R	-	2	0	ZNF91	23335672	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-2.082000	0.01365	0.055000	0.16094	-1.048000	0.02349	AGA	.	.		0.383	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ZNF536	9745	hgsc.bcm.edu	37	19	30935510	30935510	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:30935510C>T	ENST00000355537.3	+	2	1188	c.1041C>T	c.(1039-1041)tgC>tgT	p.C347C		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	347					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AGTTCCGCTGCGAGGTGTGCG	0.652																																					p.C347C		Atlas-SNP	.											.	ZNF536	424	.	0			c.C1041T						.						95.0	105.0	102.0					19																	30935510		2203	4300	6503	SO:0001819	synonymous_variant	9745	exon2			CCGCTGCGAGGTG		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1041C>T	chr19.hg19:g.30935510C>T		54.0	0.0		66.0	14.0	NM_014717	A2RU18	Silent	SNP	ENST00000355537.3	hg19	CCDS32984.1																																																																																			.	.		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
PEPD	5184	hgsc.bcm.edu	37	19	34003533	34003533	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:34003533C>T	ENST00000244137.7	-	2	200	c.167G>A	c.(166-168)cGc>cAc	p.R56H	PEPD_ENST00000397032.4_Missense_Mutation_p.R56H|PEPD_ENST00000436370.3_Missense_Mutation_p.R56H	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	56					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					GGTGCAGTAGCGCTGAGTCTC	0.652																																					p.R56H		Atlas-SNP	.											.	PEPD	48	.	0			c.G167A						.						32.0	39.0	37.0					19																	34003533		2106	4223	6329	SO:0001583	missense	5184	exon2			CAGTAGCGCTGAG	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.167G>A	chr19.hg19:g.34003533C>T	ENSP00000244137:p.Arg56His	59.0	0.0		76.0	12.0	NM_000285	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	ENST00000244137.7	hg19	CCDS42544.1	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654629	0.67472	.	.	ENSG00000124299	ENST00000244137;ENST00000397032;ENST00000436370	T;T;T	0.79554	-1.28;-1.28;-1.28	4.83	4.83	0.62350	Peptidase M24B, X-Pro dipeptidase/aminopeptidase P N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81221	0.4777	M	0.80982	2.52	0.80722	D	1	B;P;P	0.45474	0.169;0.632;0.859	B;B;B	0.39027	0.037;0.288;0.21	D	0.83948	0.0315	10	0.44086	T	0.13	-34.6234	16.8537	0.86000	0.0:1.0:0.0:0.0	.	56;56;56	E9PCE8;A8MX47;P12955	.;.;PEPD_HUMAN	H	56	ENSP00000244137:R56H;ENSP00000380226:R56H;ENSP00000391890:R56H	ENSP00000244137:R56H	R	-	2	0	PEPD	38695373	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	5.253000	0.65452	2.403000	0.81681	0.305000	0.20034	CGC	.	.		0.652	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285	
LSM14A	26065	hgsc.bcm.edu	37	19	34685491	34685491	+	Missense_Mutation	SNP	T	T	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:34685491T>A	ENST00000433627.5	+	2	305	c.230T>A	c.(229-231)gTt>gAt	p.V77D	LSM14A_ENST00000540746.2_Missense_Mutation_p.V77D|LSM14A_ENST00000544216.3_Missense_Mutation_p.V77D	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	77					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					GACCTTACTGTTTGTGAGCCA	0.433																																					p.V77D		Atlas-SNP	.											.	LSM14A	44	.	0			c.T230A						.						219.0	187.0	198.0					19																	34685491		2203	4300	6503	SO:0001583	missense	26065	exon2			TTACTGTTTGTGA	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.230T>A	chr19.hg19:g.34685491T>A	ENSP00000413964:p.Val77Asp	126.0	0.0		127.0	40.0	NM_001114093	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Missense_Mutation	SNP	ENST00000433627.5	hg19	CCDS46040.1	.	.	.	.	.	.	.	.	.	.	T	32	5.162407	0.94727	.	.	ENSG00000257103	ENST00000544216;ENST00000433627;ENST00000540746	T;T;T	0.56611	0.45;0.46;0.52	5.42	5.42	0.78866	Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.000000	0.85682	D	0.000000	T	0.78916	0.4359	M	0.93106	3.38	0.80722	D	1	D;D;D	0.89917	1.0;0.984;0.997	D;P;D	0.81914	0.995;0.825;0.973	D	0.84620	0.0683	10	0.87932	D	0	-16.3008	15.7539	0.78009	0.0:0.0:0.0:1.0	.	77;77;77	B4DTG6;Q8ND56;Q8ND56-2	.;LS14A_HUMAN;.	D	77	ENSP00000446271:V77D;ENSP00000413964:V77D;ENSP00000446451:V77D	ENSP00000314768:V77D	V	+	2	0	LSM14A	39377331	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.985000	0.88162	2.189000	0.69895	0.533000	0.62120	GTT	.	.		0.433	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
ZNF568	374900	hgsc.bcm.edu	37	19	37440932	37440932	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:37440932C>T	ENST00000333987.7	+	7	1383	c.877C>T	c.(877-879)Ctt>Ttt	p.L293F	ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.L229F|ZNF568_ENST00000455427.2_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATGTCAAACCTTATTAGACA	0.368																																					p.L293F		Atlas-SNP	.											.	ZNF568	106	.	0			c.C877T						.						38.0	41.0	40.0					19																	37440932		2150	4267	6417	SO:0001583	missense	374900	exon7			TCAAACCTTATTA	BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.877C>T	chr19.hg19:g.37440932C>T	ENSP00000334685:p.Leu293Phe	99.0	0.0		94.0	29.0	NM_198539	B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	ENST00000333987.7	hg19	CCDS42558.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205184	0.39003	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.52057	0.68;0.68	3.95	1.74	0.24563	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33382	N	0.004973	T	0.62950	0.2470	M	0.78344	2.41	0.21256	N	0.999741	D	0.89917	1.0	D	0.91635	0.999	T	0.51498	-0.8698	10	0.56958	D	0.05	.	6.7282	0.23369	0.1751:0.7258:0.0:0.099	.	293	Q3ZCX4	ZN568_HUMAN	F	293;229	ENSP00000334685:L293F;ENSP00000394514:L229F	ENSP00000334685:L293F	L	+	1	0	ZNF568	42132772	0.000000	0.05858	0.154000	0.22540	0.996000	0.88848	-0.187000	0.09656	0.414000	0.25790	0.655000	0.94253	CTT	.	.		0.368	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109572.2	NM_198539	
ZNF585A	199704	hgsc.bcm.edu	37	19	37643170	37643170	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:37643170T>C	ENST00000356958.4	-	5	1889	c.1631A>G	c.(1630-1632)cAc>cGc	p.H544R	ZNF585A_ENST00000355533.2_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.H489R|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000292841.5_Missense_Mutation_p.H489R			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	544					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTCTCCAGTGTGAATTTTCTG	0.408																																					p.H489R		Atlas-SNP	.											.	ZNF585A	117	.	0			c.A1466G						.						91.0	90.0	90.0					19																	37643170		2203	4300	6503	SO:0001583	missense	199704	exon6			CCAGTGTGAATTT	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1631A>G	chr19.hg19:g.37643170T>C	ENSP00000349440:p.His544Arg	261.0	0.0		283.0	37.0	NM_199126	Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	hg19		.	.	.	.	.	.	.	.	.	.	T	17.78	3.474327	0.63737	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157	T;T;T	0.67523	-0.27;-0.27;-0.27	3.03	3.03	0.35002	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38548	N	0.001655	T	0.79522	0.4460	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81495	-0.0907	9	0.87932	D	0	.	10.64	0.45588	0.0:0.0:0.0:1.0	.	544	Q6P3V2	Z585A_HUMAN	R	544;489;489	ENSP00000349440:H544R;ENSP00000292841:H489R;ENSP00000375998:H489R	ENSP00000292841:H489R	H	-	2	0	ZNF585A	42335010	1.000000	0.71417	0.982000	0.44146	0.991000	0.79684	7.315000	0.78998	1.395000	0.46643	0.529000	0.55759	CAC	.	.		0.408	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000457980.2	NM_152655	
ZNF793	390927	hgsc.bcm.edu	37	19	38028487	38028487	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:38028487A>G	ENST00000587143.1	+	6	1162	c.927A>G	c.(925-927)agA>agG	p.R309R	ZNF793_ENST00000589319.1_Intron|ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000445217.1_Silent_p.R309R|ZNF793_ENST00000542455.1_Silent_p.R309R			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	309					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CAGGAGAGAGACCCTTTGTCT	0.458																																					p.R309R	Melanoma(44;400 1431 1499 19093)	Atlas-SNP	.											.	ZNF793	50	.	0			c.A927G						.						80.0	90.0	87.0					19																	38028487		2178	4287	6465	SO:0001819	synonymous_variant	390927	exon8			AGAGAGACCCTTT	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.927A>G	chr19.hg19:g.38028487A>G		114.0	0.0		93.0	18.0	NM_001013659	E9PGN4|Q7Z3Q9	Silent	SNP	ENST00000587143.1	hg19	CCDS46062.1																																																																																			.	.		0.458	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
ECH1	1891	hgsc.bcm.edu	37	19	39307754	39307754	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:39307754G>A	ENST00000221418.4	-	6	771	c.539C>T	c.(538-540)aCc>aTc	p.T180I		NM_001398.2	NP_001389.2	Q13011	ECH1_HUMAN	enoyl CoA hydratase 1, peroxisomal	180					fatty acid beta-oxidation (GO:0006635)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	isomerase activity (GO:0016853)|receptor binding (GO:0005102)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	6	all_cancers(60;9.36e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GTCACAGGCGGTGACAAGGTC	0.602																																					p.T180I		Atlas-SNP	.											.	ECH1	14	.	0			c.C539T						.						51.0	43.0	45.0					19																	39307754		2199	4292	6491	SO:0001583	missense	1891	exon6			CAGGCGGTGACAA	U16660	CCDS33014.1	19q13.1	2010-04-30	2010-04-30			ENSG00000104823			3149	protein-coding gene	gene with protein product		600696	"""enoyl Coenzyme A hydratase 1, peroxisomal"""			7558027	Standard	XM_005258610		Approved	HPXEL		Q13011		ENST00000221418.4:c.539C>T	chr19.hg19:g.39307754G>A	ENSP00000221418:p.Thr180Ile	86.0	0.0		107.0	37.0	NM_001398	A8K745|Q8WVX0|Q96EZ9	Missense_Mutation	SNP	ENST00000221418.4	hg19	CCDS33014.1	.	.	.	.	.	.	.	.	.	.	g	16.98	3.270985	0.59540	.	.	ENSG00000104823	ENST00000221418	T	0.63417	-0.04	5.45	3.28	0.37604	Enoyl-CoA hydratase/isomerase, conserved site (1);Crotonase, core (1);	0.354167	0.27700	N	0.018212	T	0.73102	0.3544	M	0.62723	1.935	0.47341	D	0.99939	D	0.76494	0.999	D	0.85130	0.997	T	0.74328	-0.3701	10	0.72032	D	0.01	.	9.2486	0.37541	0.076:0.2707:0.6533:0.0	.	180	Q13011	ECH1_HUMAN	I	180	ENSP00000221418:T180I	ENSP00000221418:T180I	T	-	2	0	ECH1	43999594	1.000000	0.71417	0.756000	0.31282	0.525000	0.34531	4.654000	0.61469	1.301000	0.44836	0.579000	0.79373	ACC	.	.		0.602	ECH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462650.1		
FCGBP	8857	hgsc.bcm.edu	37	19	40392050	40392050	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:40392050G>A	ENST00000221347.6	-	17	8343	c.8336C>T	c.(8335-8337)gCc>gTc	p.A2779V		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2779	Cys-rich.|TIL 6.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GGGCACGCAGGCTTGGCCGTT	0.607																																					p.A2779V		Atlas-SNP	.											.	FCGBP	416	.	0			c.C8336T						.						40.0	39.0	40.0					19																	40392050		2185	4297	6482	SO:0001583	missense	8857	exon17			ACGCAGGCTTGGC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.8336C>T	chr19.hg19:g.40392050G>A	ENSP00000221347:p.Ala2779Val	212.0	0.0		207.0	40.0	NM_003890	O95784	Missense_Mutation	SNP	ENST00000221347.6	hg19	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	G	0.693	-0.793780	0.02862	.	.	ENSG00000090920	ENST00000221347	D	0.90844	-2.74	2.66	1.55	0.23275	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	1.572440	0.04474	U	0.376608	D	0.90147	0.6921	N	0.16903	0.455	0.09310	N	1	D	0.60160	0.987	D	0.65140	0.932	T	0.80946	-0.1155	10	0.27785	T	0.31	.	10.0626	0.42284	0.0:0.3955:0.6045:0.0	.	2779	Q9Y6R7	FCGBP_HUMAN	V	2779	ENSP00000221347:A2779V	ENSP00000221347:A2779V	A	-	2	0	FCGBP	45083890	0.000000	0.05858	0.246000	0.24233	0.021000	0.10359	-1.739000	0.01840	0.421000	0.25980	0.298000	0.19748	GCC	.	.		0.607	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
ZNF227	7770	hgsc.bcm.edu	37	19	44740750	44740750	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:44740750A>G	ENST00000313040.7	+	6	2372	c.2167A>G	c.(2167-2169)Aag>Gag	p.K723E	ZNF227_ENST00000391961.2_Missense_Mutation_p.K672E|ZNF227_ENST00000589005.1_Missense_Mutation_p.K672E|ZNF235_ENST00000589799.1_3'UTR	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	723					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				GGAGTGTGGTAAGGCCTTCAG	0.488																																					p.K723E		Atlas-SNP	.											.	ZNF227	62	.	0			c.A2167G						.						101.0	103.0	103.0					19																	44740750		2203	4300	6503	SO:0001583	missense	7770	exon6			TGTGGTAAGGCCT	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.2167A>G	chr19.hg19:g.44740750A>G	ENSP00000321049:p.Lys723Glu	104.0	0.0		88.0	34.0	NM_182490	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	hg19	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.303774	0.60305	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.27104	1.69;1.69	3.92	2.9	0.33743	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50171	0.1600	M	0.86097	2.795	0.80722	D	1	P;D;D;P	0.76494	0.942;0.999;0.999;0.942	P;D;D;P	0.80764	0.542;0.991;0.994;0.542	T	0.55179	-0.8181	9	0.87932	D	0	.	8.6523	0.34042	0.9004:0.0:0.0996:0.0	.	644;702;675;723	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	E	723;680;672;702;362	ENSP00000321049:K723E;ENSP00000375823:K672E	ENSP00000321049:K723E	K	+	1	0	ZNF227	49432590	0.999000	0.42202	0.969000	0.41365	0.987000	0.75469	4.331000	0.59273	1.780000	0.52325	0.460000	0.39030	AAG	.	.		0.488	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
SYMPK	8189	hgsc.bcm.edu	37	19	46318890	46318890	+	Silent	SNP	T	T	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:46318890T>A	ENST00000245934.7	-	27	3997	c.3753A>T	c.(3751-3753)ggA>ggT	p.G1251G	RSPH6A_ENST00000597055.1_5'Flank|SYMPK_ENST00000598155.1_5'UTR|RSPH6A_ENST00000221538.3_5'Flank	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	1251					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TAGCATCTTCTCCAACAGGTG	0.682																																					p.G1251G		Atlas-SNP	.											.	SYMPK	104	.	0			c.A3753T						.						19.0	20.0	20.0					19																	46318890		2202	4300	6502	SO:0001819	synonymous_variant	8189	exon27			ATCTTCTCCAACA	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.3753A>T	chr19.hg19:g.46318890T>A		112.0	0.0		102.0	19.0	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	hg19	CCDS12676.2																																																																																			.	.		0.682	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
KDELR1	10945	hgsc.bcm.edu	37	19	48887541	48887541	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:48887541C>T	ENST00000330720.2	-	4	744	c.550G>A	c.(550-552)Ggc>Agc	p.G184S	KDELR1_ENST00000597017.1_Missense_Mutation_p.G122S	NM_006801.2	NP_006792.1	P24390	ERD21_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1	184					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	KDEL sequence binding (GO:0005046)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|pancreas(1)|urinary_tract(1)	11		all_epithelial(76;2.48e-06)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Prostate(7;0.122)|Breast(70;0.203)		all cancers(93;0.000114)|OV - Ovarian serous cystadenocarcinoma(262;0.000136)|Epithelial(262;0.01)|GBM - Glioblastoma multiforme(486;0.0145)		TGGACCAGGCCTGCCACAATG	0.522																																					p.G184S		Atlas-SNP	.											.	KDELR1	26	.	0			c.G550A						.						70.0	60.0	64.0					19																	48887541		2203	4300	6503	SO:0001583	missense	10945	exon4			CCAGGCCTGCCAC	X55885	CCDS12718.1	19q13.3	2008-05-02				ENSG00000105438			6304	protein-coding gene	gene with protein product		131235				2172835	Standard	NM_006801		Approved	ERD2.1, ERD2, HDEL	uc002pjb.1	P24390		ENST00000330720.2:c.550G>A	chr19.hg19:g.48887541C>T	ENSP00000329471:p.Gly184Ser	143.0	0.0		117.0	19.0	NM_006801	B2R6N4|Q54A39|Q8NBW7	Missense_Mutation	SNP	ENST00000330720.2	hg19	CCDS12718.1	.	.	.	.	.	.	.	.	.	.	C	36	5.718211	0.96839	.	.	ENSG00000105438	ENST00000330720	T	0.79141	-1.24	4.68	4.68	0.58851	.	0.000000	0.64402	D	0.000009	D	0.91543	0.7329	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.93894	0.7182	10	0.87932	D	0	.	16.8929	0.86092	0.0:1.0:0.0:0.0	.	184	P24390	ERD21_HUMAN	S	184	ENSP00000329471:G184S	ENSP00000329471:G184S	G	-	1	0	KDELR1	53579353	1.000000	0.71417	0.966000	0.40874	0.993000	0.82548	7.549000	0.82163	2.607000	0.88179	0.655000	0.94253	GGC	.	.		0.522	KDELR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465708.1		
PNKP	11284	hgsc.bcm.edu	37	19	50370458	50370458	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:50370458C>A	ENST00000322344.3	-	2	113	c.4G>T	c.(4-6)Ggc>Tgc	p.G2C	PNKP_ENST00000596014.1_Missense_Mutation_p.G2C|PNKP_ENST00000595792.1_5'UTR|PNKP_ENST00000600910.1_Missense_Mutation_p.G2C|PNKP_ENST00000600573.1_Missense_Mutation_p.G2C	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	2					dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TCCACCTCGCCCATCCTGGGT	0.697								Other BER factors																													p.G2C		Atlas-SNP	.											.	PNKP	71	.	0			c.G4T						.						8.0	10.0	9.0					19																	50370458		2066	4089	6155	SO:0001583	missense	11284	exon2			CCTCGCCCATCCT	AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.4G>T	chr19.hg19:g.50370458C>A	ENSP00000323511:p.Gly2Cys	93.0	0.0		113.0	20.0	NM_007254	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Missense_Mutation	SNP	ENST00000322344.3	hg19	CCDS12783.1	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122739	0.37436	.	.	ENSG00000039650	ENST00000322344	T	0.44482	0.92	5.17	2.99	0.34606	.	0.646359	0.12800	N	0.438122	T	0.21718	0.0523	N	0.08118	0	0.24408	N	0.994671	B	0.33379	0.41	B	0.31751	0.135	T	0.13656	-1.0501	10	0.66056	D	0.02	-7.3769	6.2095	0.20621	0.1903:0.713:0.0:0.0966	.	2	Q96T60	PNKP_HUMAN	C	2	ENSP00000323511:G2C	ENSP00000323511:G2C	G	-	1	0	PNKP	55062270	0.643000	0.27269	0.865000	0.33974	0.157000	0.22087	0.125000	0.15749	0.530000	0.28619	0.655000	0.94253	GGC	.	.		0.697	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465830.1	NM_007254	
ZNF528	84436	hgsc.bcm.edu	37	19	52919436	52919436	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:52919436C>T	ENST00000360465.3	+	7	1757	c.1331C>T	c.(1330-1332)aCa>aTa	p.T444I	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		AAATGTGGCACAGCGTTTAGA	0.388																																					p.T444I		Atlas-SNP	.											.	ZNF528	95	.	0			c.C1331T						.						77.0	79.0	78.0					19																	52919436		2203	4300	6503	SO:0001583	missense	84436	exon7			GTGGCACAGCGTT	AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1331C>T	chr19.hg19:g.52919436C>T	ENSP00000353652:p.Thr444Ile	128.0	0.0		126.0	15.0	NM_032423	B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	ENST00000360465.3	hg19	CCDS33091.1	.	.	.	.	.	.	.	.	.	.	C	8.089	0.774151	0.16051	.	.	ENSG00000167555	ENST00000360465	T	0.35789	1.29	1.71	-0.766	0.11020	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20414	0.0491	N	0.25890	0.77	0.09310	N	0.999999	P	0.45474	0.859	B	0.38880	0.284	T	0.14282	-1.0478	9	0.87932	D	0	.	4.0916	0.09972	0.6205:0.2247:0.1548:0.0	.	444	Q3MIS6	ZN528_HUMAN	I	444	ENSP00000353652:T444I	ENSP00000353652:T444I	T	+	2	0	ZNF528	57611248	0.001000	0.12720	0.040000	0.18447	0.060000	0.15804	0.609000	0.24238	-0.054000	0.13266	-0.535000	0.04281	ACA	.	.		0.388	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344336.1	NM_032423	
ZNF534	147658	hgsc.bcm.edu	37	19	52941014	52941014	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:52941014G>A	ENST00000332323.6	+	4	401	c.340G>A	c.(340-342)Gga>Aga	p.G114R	ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000433050.1_Missense_Mutation_p.G101R	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	114					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						AAGCAGTGCAGGAAACAAGTC	0.353																																					p.G114R		Atlas-SNP	.											.	ZNF534	105	.	0			c.G340A						.						54.0	46.0	49.0					19																	52941014		1568	3582	5150	SO:0001583	missense	147658	exon4			AGTGCAGGAAACA	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.340G>A	chr19.hg19:g.52941014G>A	ENSP00000327538:p.Gly114Arg	306.0	0.0		274.0	88.0	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	hg19	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	G	9.084	1.000152	0.19121	.	.	ENSG00000198633	ENST00000332323;ENST00000433050;ENST00000391790	T;T	0.06768	3.26;3.32	1.69	1.69	0.24217	.	.	.	.	.	T	0.09423	0.0232	L	0.58302	1.8	0.09310	N	0.999997	P;B	0.44734	0.842;0.128	B;B	0.43809	0.432;0.045	T	0.22068	-1.0227	9	0.26408	T	0.33	.	4.1353	0.10167	0.2258:0.0:0.7742:0.0	.	101;114	Q76KX8-2;Q76KX8	.;ZN534_HUMAN	R	114;101;113	ENSP00000327538:G114R;ENSP00000391358:G101R	ENSP00000327538:G114R	G	+	1	0	ZNF534	57632826	0.430000	0.25538	0.115000	0.21578	0.028000	0.11728	3.246000	0.51414	0.903000	0.36546	0.205000	0.17691	GGA	.	.		0.353	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
MYADM	91663	hgsc.bcm.edu	37	19	54377623	54377623	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:54377623C>T	ENST00000391769.2	+	3	1120	c.840C>T	c.(838-840)agC>agT	p.S280S	MYADM_ENST00000336967.3_Silent_p.S280S|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391768.2_Silent_p.S280S|MYADM_ENST00000391771.1_Silent_p.S280S|MYADM_ENST00000391770.4_Silent_p.S280S	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	280	MARVEL 2. {ECO:0000255|PROSITE- ProRule:PRU00581}.				establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		TAAGCTGCAGCCGCAGCCATG	0.617																																					p.S280S		Atlas-SNP	.											.	MYADM	39	.	0			c.C840T						.						53.0	47.0	49.0					19																	54377623		2203	4300	6503	SO:0001819	synonymous_variant	91663	exon3			CTGCAGCCGCAGC	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.840C>T	chr19.hg19:g.54377623C>T		73.0	0.0		86.0	13.0	NM_138373	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Silent	SNP	ENST00000391769.2	hg19	CCDS12866.1																																																																																			.	.		0.617	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134337.1	NM_138373	
PRKCG	5582	hgsc.bcm.edu	37	19	54406355	54406355	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:54406355C>T	ENST00000263431.3	+	15	1886	c.1604C>T	c.(1603-1605)tCt>tTt	p.S535F	PRKCG_ENST00000542049.1_Missense_Mutation_p.S422F|PRKCG_ENST00000540413.1_Missense_Mutation_p.S535F	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	535	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TATGGGAAGTCTGTCGATTGG	0.547																																					p.S535F		Atlas-SNP	.											.	PRKCG	246	.	0			c.C1604T						.						358.0	323.0	335.0					19																	54406355		2203	4300	6503	SO:0001583	missense	5582	exon15			GGAAGTCTGTCGA	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1604C>T	chr19.hg19:g.54406355C>T	ENSP00000263431:p.Ser535Phe	113.0	0.0		144.0	44.0	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	hg19	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667345	0.88348	.	.	ENSG00000126583	ENST00000540413;ENST00000263431;ENST00000542049	T;T;T	0.66995	-0.24;-0.24;-0.24	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.83686	0.5308	M	0.85099	2.735	0.80722	D	1	D;D;D	0.89917	0.995;0.999;1.0	D;D;D	0.79108	0.925;0.986;0.992	D	0.85973	0.1478	9	0.87932	D	0	.	17.1095	0.86672	0.0:1.0:0.0:0.0	.	422;535;535	B7Z8Q0;F5H5C4;P05129	.;.;KPCG_HUMAN	F	535;535;422	ENSP00000443493:S535F;ENSP00000263431:S535F;ENSP00000438090:S422F	ENSP00000263431:S535F	S	+	2	0	PRKCG	59098167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.586000	0.82596	2.719000	0.93026	0.655000	0.94253	TCT	.	.		0.547	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
LENG8	114823	hgsc.bcm.edu	37	19	54965734	54965734	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:54965734G>A	ENST00000326764.5	+	6	1031	c.552G>A	c.(550-552)caG>caA	p.Q184Q	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	147										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GTGGCCCTCAGCCTGGGACAG	0.677																																					p.Q184Q		Atlas-SNP	.											LENG8,NS,carcinoma,0,1	LENG8	73	.	0			c.G552A						.						19.0	20.0	20.0					19																	54965734		2200	4298	6498	SO:0001819	synonymous_variant	114823	exon6			CCCTCAGCCTGGG	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.552G>A	chr19.hg19:g.54965734G>A		136.0	0.0		123.0	26.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	ENST00000326764.5	hg19	CCDS12894.1																																																																																			.	.		0.677	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
DNAAF3	352909	hgsc.bcm.edu	37	19	55676758	55676758	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:55676758G>A	ENST00000524407.2	-	4	335	c.302C>T	c.(301-303)cCg>cTg	p.P101L	DNAAF3_ENST00000455045.1_Missense_Mutation_p.P47L|snoU13_ENST00000459370.1_RNA|DNAAF3_ENST00000527223.2_Missense_Mutation_p.P169L|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000391720.4_Missense_Mutation_p.P148L			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	101					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											CATCTTCTCCGGTTCCTCCAG	0.532																																					p.P169L		Atlas-SNP	.											.	.	.	.	0			c.C506T						.						66.0	71.0	69.0					19																	55676758		1960	4158	6118	SO:0001583	missense	352909	exon4			TTCTCCGGTTCCT	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.302C>T	chr19.hg19:g.55676758G>A	ENSP00000432046:p.Pro101Leu	73.0	0.0		95.0	11.0	NM_001256714	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	hg19	CCDS59422.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334702	0.24253	.	.	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720	T;T	0.18657	2.2;2.2	4.64	3.6	0.41247	.	0.196427	0.42294	D	0.000736	T	0.37237	0.0996	L	0.49455	1.56	0.28535	N	0.912415	D;D;B;D	0.89917	1.0;1.0;0.163;1.0	D;D;B;D	0.87578	0.998;0.976;0.042;0.99	T	0.11941	-1.0567	10	0.37606	T	0.19	-8.062	11.8649	0.52488	0.0881:0.0:0.9119:0.0	.	169;47;122;101	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	L	169;47;148	ENSP00000394343:P47L;ENSP00000375600:P148L	ENSP00000301249:P169L	P	-	2	0	C19orf51	60368570	0.954000	0.32549	0.101000	0.21167	0.169000	0.22640	2.857000	0.48349	1.094000	0.41399	0.650000	0.86243	CCG	.	.		0.532	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837	
C20orf96	140680	hgsc.bcm.edu	37	20	256674	256674	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:256674C>T	ENST00000360321.2	-	10	1104	c.966G>A	c.(964-966)gaG>gaA	p.E322E	C20orf96_ENST00000382369.5_Silent_p.E287E	NM_080571.1|NM_153269.2	NP_542138.1|NP_695001.2	Q9NUD7	CT096_HUMAN	chromosome 20 open reading frame 96	322										endometrium(3)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	12		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GGGCTTGGAGCTCTTCCACCT	0.527																																					p.E322E		Atlas-SNP	.											.	C20orf96	28	.	0			c.G966A						.						89.0	89.0	89.0					20																	256674		2203	4300	6503	SO:0001819	synonymous_variant	140680	exon10			TTGGAGCTCTTCC	AL034548	CCDS12994.1, CCDS74685.1	20p13	2012-10-30			ENSG00000196476	ENSG00000196476			16227	protein-coding gene	gene with protein product							Standard	NM_153269		Approved	dJ1103G7.2	uc002wde.2	Q9NUD7	OTTHUMG00000031626	ENST00000360321.2:c.966G>A	chr20.hg19:g.256674C>T		126.0	0.0		86.0	38.0	NM_153269	A3KPE0|B2RPH9|Q8N840|Q8NAX5	Silent	SNP	ENST00000360321.2	hg19	CCDS12994.1																																																																																			.	.		0.527	C20orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077439.2	NM_153269	
CENPB	1059	hgsc.bcm.edu	37	20	3766272	3766272	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:3766272C>T	ENST00000379751.4	-	1	1065	c.859G>A	c.(859-861)Gca>Aca	p.A287T	CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa	287					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						CGAGACTCTGCAGCCATTCGG	0.672																																					p.A287T		Atlas-SNP	.											.	CENPB	24	.	0			c.G859A						.						20.0	21.0	20.0					20																	3766272		2195	4299	6494	SO:0001583	missense	1059	exon1			ACTCTGCAGCCAT	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761	ENST00000379751.4:c.859G>A	chr20.hg19:g.3766272C>T	ENSP00000369075:p.Ala287Thr	198.0	0.0		233.0	16.0	NM_001810	Q96EI4	Missense_Mutation	SNP	ENST00000379751.4	hg19	CCDS13064.1	.	.	.	.	.	.	.	.	.	.	c	12.66	2.005136	0.35415	.	.	ENSG00000125817	ENST00000379751	T	0.44482	0.92	4.24	-2.27	0.06846	.	0.574921	0.12892	U	0.430469	T	0.32734	0.0839	L	0.36672	1.1	0.23386	N	0.997789	D	0.54397	0.966	P	0.49953	0.627	T	0.33752	-0.9856	10	0.15066	T	0.55	-1.3942	7.0224	0.24922	0.5645:0.3466:0.0:0.0889	.	287	P07199	CENPB_HUMAN	T	287	ENSP00000369075:A287T	ENSP00000369075:A287T	A	-	1	0	CENPB	3714272	0.000000	0.05858	0.937000	0.37676	0.834000	0.47266	-0.928000	0.03980	-0.379000	0.07906	0.457000	0.33378	GCA	.	.		0.672	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077772.2	NM_001810	
PROKR2	128674	hgsc.bcm.edu	37	20	5294612	5294612	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:5294612C>T	ENST00000217270.3	-	1	403	c.404G>A	c.(403-405)cGc>cAc	p.R135H	PROKR2_ENST00000546004.1_Missense_Mutation_p.R135H	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	135					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						GGAGACGGTGCGCAGGTAGTT	0.622										HNSCC(71;0.22)																											p.R135H		Atlas-SNP	.											PROKR2,NS,carcinoma,0,1	PROKR2	90	.	0			c.G404A						.						104.0	79.0	87.0					20																	5294612		2203	4300	6503	SO:0001583	missense	128674	exon1			ACGGTGCGCAGGT	AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.404G>A	chr20.hg19:g.5294612C>T	ENSP00000217270:p.Arg135His	121.0	1.0		173.0	23.0	NM_144773	A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	ENST00000217270.3	hg19	CCDS13089.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278795	0.80692	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.37235	1.21;1.21	5.12	5.12	0.69794	GPCR, rhodopsin-like superfamily (1);	0.112601	0.64402	D	0.000011	T	0.54727	0.1876	L	0.50919	1.6	0.54753	D	0.999985	D	0.89917	1.0	D	0.78314	0.991	T	0.54589	-0.8271	10	0.56958	D	0.05	.	16.398	0.83630	0.0:1.0:0.0:0.0	.	135	Q8NFJ6	PKR2_HUMAN	H	135	ENSP00000440790:R135H;ENSP00000217270:R135H	ENSP00000217270:R135H	R	-	2	0	PROKR2	5242612	0.994000	0.37717	0.993000	0.49108	0.989000	0.77384	3.910000	0.56371	2.525000	0.85131	0.643000	0.83706	CGC	.	.		0.622	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077854.1	NM_144773	
SSTR4	6754	hgsc.bcm.edu	37	20	23017003	23017003	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:23017003G>A	ENST00000255008.3	+	1	947	c.883G>A	c.(883-885)Gtg>Atg	p.V295M	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	295					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.V295L(2)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CGTCAACCACGTGTCCCTTAT	0.562																																					p.V295M	Esophageal Squamous(15;850 1104 16640)	Atlas-SNP	.											SSTR4,NS,carcinoma,0,2	SSTR4	83	.	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|lung(1)	c.G883A						.						205.0	205.0	205.0					20																	23017003		2203	4300	6503	SO:0001583	missense	6754	exon1			AACCACGTGTCCC		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.883G>A	chr20.hg19:g.23017003G>A	ENSP00000255008:p.Val295Met	80.0	0.0		86.0	17.0	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	hg19	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863182	0.51482	.	.	ENSG00000132671	ENST00000255008	T	0.40756	1.02	3.36	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.228496	0.21195	U	0.078570	T	0.32704	0.0838	L	0.45422	1.42	0.27023	N	0.964426	B	0.30686	0.29	B	0.32805	0.153	T	0.28808	-1.0032	10	0.72032	D	0.01	.	6.3952	0.21609	0.2355:0.0:0.7645:0.0	.	295	P31391	SSR4_HUMAN	M	295	ENSP00000255008:V295M	ENSP00000255008:V295M	V	+	1	0	SSTR4	22965003	0.212000	0.23540	0.991000	0.47740	0.975000	0.68041	1.530000	0.36007	0.608000	0.30000	0.655000	0.94253	GTG	.	.		0.562	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
CD93	22918	hgsc.bcm.edu	37	20	23065156	23065156	+	Silent	SNP	G	G	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:23065156G>T	ENST00000246006.4	-	1	1821	c.1674C>A	c.(1672-1674)ccC>ccA	p.P558P		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	558					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CAGGCTCCTGGGGGCCAGAGG	0.627																																					p.P558P		Atlas-SNP	.											.	CD93	84	.	0			c.C1674A						.						62.0	66.0	64.0					20																	23065156		2203	4300	6503	SO:0001819	synonymous_variant	22918	exon1			CTCCTGGGGGCCA	U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1674C>A	chr20.hg19:g.23065156G>T		48.0	0.0		52.0	9.0	NM_012072	O00274	Silent	SNP	ENST00000246006.4	hg19	CCDS13149.1																																																																																			.	.		0.627	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078312.2	NM_012072	
GSS	2937	hgsc.bcm.edu	37	20	33519901	33519901	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:33519901A>G	ENST00000216951.2	-	10	968	c.870T>C	c.(868-870)caT>caC	p.H290H	GSS_ENST00000451957.2_Silent_p.H179H|GSS_ENST00000541098.1_Silent_p.H162H	NM_000178.2	NP_000169.1	P48637	GSHB_HUMAN	glutathione synthetase	290					aging (GO:0007568)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|nervous system development (GO:0007399)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to nutrient levels (GO:0031667)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|glutathione binding (GO:0043295)|glutathione synthase activity (GO:0004363)|glycine binding (GO:0016594)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(18;0.035)		Acetylcysteine(DB06151)|Glutathione(DB00143)|Glycine(DB00145)|L-Cysteine(DB00151)	ACTTGGCAGCATGTGACCTCT	0.527																																					p.H290H		Atlas-SNP	.											.	GSS	33	.	0			c.T870C						.						98.0	90.0	93.0					20																	33519901		2203	4300	6503	SO:0001819	synonymous_variant	2937	exon10			GGCAGCATGTGAC		CCDS13245.1	20q11.2	1996-06-18			ENSG00000100983	ENSG00000100983	6.3.2.3		4624	protein-coding gene	gene with protein product		601002				8825653	Standard	NM_000178		Approved		uc002xbg.3	P48637	OTTHUMG00000032315	ENST00000216951.2:c.870T>C	chr20.hg19:g.33519901A>G		248.0	0.0		271.0	37.0	NM_000178	B2R697|B6F210|E1P5P9|Q4TTD9	Silent	SNP	ENST00000216951.2	hg19	CCDS13245.1																																																																																			.	.		0.527	GSS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078821.2		
FAM65C	140876	hgsc.bcm.edu	37	20	49225478	49225478	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:49225478C>T	ENST00000327979.2	-	9	1054	c.643G>A	c.(643-645)Gca>Aca	p.A215T	FAM65C_ENST00000045083.2_Missense_Mutation_p.A215T|FAM65C_ENST00000535356.1_Missense_Mutation_p.A219T			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	215										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAGAGGCGTGCGTAGCCCACC	0.652																																					p.A215T		Atlas-SNP	.											.	FAM65C	87	.	0			c.G643A						.						44.0	34.0	38.0					20																	49225478		2198	4299	6497	SO:0001583	missense	140876	exon9			GGCGTGCGTAGCC	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.643G>A	chr20.hg19:g.49225478C>T	ENSP00000332663:p.Ala215Thr	98.0	0.0		91.0	18.0	NM_080829	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	hg19	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	C	34	5.398429	0.96030	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02737	4.18;4.18;4.18	4.75	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.16685	0.0401	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.00563	-1.1669	10	0.87932	D	0	-13.9061	16.5474	0.84450	0.0:1.0:0.0:0.0	.	219;215	F5H0X2;Q96MK2	.;FA65C_HUMAN	T	215;215;219	ENSP00000332663:A215T;ENSP00000045083:A215T;ENSP00000439802:A219T	ENSP00000045083:A215T	A	-	1	0	FAM65C	48658885	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.824000	0.69279	2.182000	0.69389	0.561000	0.74099	GCA	.	.		0.652	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
ZNF217	7764	hgsc.bcm.edu	37	20	52193651	52193651	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:52193651C>T	ENST00000371471.2	-	4	2077	c.1652G>A	c.(1651-1653)aGt>aAt	p.S551N	ZNF217_ENST00000302342.3_Missense_Mutation_p.S551N|RP4-724E16.2_ENST00000424252.1_RNA			O75362	ZN217_HUMAN	zinc finger protein 217	551					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			GGTTTGCGCACTGTCAGCGGT	0.418																																					p.S551N		Atlas-SNP	.											.	ZNF217	227	.	0			c.G1652A						.						138.0	133.0	135.0					20																	52193651		2203	4300	6503	SO:0001583	missense	7764	exon3			TGCGCACTGTCAG	AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.1652G>A	chr20.hg19:g.52193651C>T	ENSP00000360526:p.Ser551Asn	74.0	0.0		89.0	28.0	NM_006526	E1P5Y6|Q14DB8	Missense_Mutation	SNP	ENST00000371471.2	hg19	CCDS13443.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.668981	0.47677	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.09350	2.99;2.99	5.69	5.69	0.88448	.	0.682298	0.15015	N	0.285313	T	0.13200	0.0320	L	0.57536	1.79	0.27702	N	0.94576	P	0.34462	0.454	B	0.32677	0.15	T	0.10154	-1.0642	10	0.31617	T	0.26	-7.7665	12.7297	0.57191	0.0:0.9246:0.0:0.0754	.	551	O75362	ZN217_HUMAN	N	551	ENSP00000360526:S551N;ENSP00000304308:S551N	ENSP00000304308:S551N	S	-	2	0	ZNF217	51627058	0.001000	0.12720	0.407000	0.26434	0.852000	0.48524	1.005000	0.29834	2.679000	0.91253	0.650000	0.86243	AGT	.	.		0.418	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079757.2	NM_006526	
LAMA5	3911	hgsc.bcm.edu	37	20	60888755	60888755	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:60888755G>A	ENST00000252999.3	-	63	8674	c.8608C>T	c.(8608-8610)Cgg>Tgg	p.R2870W		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2870	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TCGTCTGGCCGCAGGTTGAGC	0.662																																					p.R2870W		Atlas-SNP	.											.	LAMA5	268	.	0			c.C8608T						.						94.0	76.0	82.0					20																	60888755		2203	4296	6499	SO:0001583	missense	3911	exon63			CTGGCCGCAGGTT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.8608C>T	chr20.hg19:g.60888755G>A	ENSP00000252999:p.Arg2870Trp	41.0	0.0		70.0	7.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	hg19	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	g	15.02	2.710200	0.48517	.	.	ENSG00000130702	ENST00000252999	T	0.78246	-1.16	4.2	0.14	0.14804	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.215770	0.05785	U	0.609342	T	0.69593	0.3128	L	0.29908	0.895	0.19575	N	0.999967	D	0.52996	0.957	P	0.44394	0.448	T	0.61451	-0.7060	10	0.72032	D	0.01	.	8.7331	0.34512	0.0:0.1069:0.3587:0.5344	.	2870	O15230	LAMA5_HUMAN	W	2870	ENSP00000252999:R2870W	ENSP00000252999:R2870W	R	-	1	2	LAMA5	60322150	0.000000	0.05858	0.008000	0.14137	0.662000	0.39071	0.183000	0.16919	0.186000	0.20125	0.457000	0.33378	CGG	.	.		0.662	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
SRMS	6725	hgsc.bcm.edu	37	20	62172859	62172859	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:62172859C>T	ENST00000217188.1	-	6	1101	c.1061G>A	c.(1060-1062)cGg>cAg	p.R354Q		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	354	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			GAGCACGTTCCGGGCGGCCAA	0.701																																					p.R354Q		Atlas-SNP	.											.	SRMS	48	.	0			c.G1061A						.						19.0	19.0	19.0					20																	62172859		2187	4291	6478	SO:0001583	missense	6725	exon6			ACGTTCCGGGCGG		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.1061G>A	chr20.hg19:g.62172859C>T	ENSP00000217188:p.Arg354Gln	123.0	0.0		124.0	26.0	NM_080823		Missense_Mutation	SNP	ENST00000217188.1	hg19	CCDS13525.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947896	0.73787	.	.	ENSG00000125508	ENST00000217188	D	0.87334	-2.24	4.16	4.16	0.48862	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000014	D	0.92980	0.7766	M	0.79343	2.45	0.47308	D	0.99938	D	0.76494	0.999	D	0.75020	0.985	D	0.93926	0.7210	10	0.62326	D	0.03	.	16.4298	0.83837	0.0:1.0:0.0:0.0	.	354	Q9H3Y6	SRMS_HUMAN	Q	354	ENSP00000217188:R354Q	ENSP00000217188:R354Q	R	-	2	0	SRMS	61643303	1.000000	0.71417	0.959000	0.39883	0.022000	0.10575	4.160000	0.58164	2.039000	0.60335	0.561000	0.74099	CGG	.	.		0.701	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823	
TNFRSF6B	8771	hgsc.bcm.edu	37	20	62328389	62328389	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:62328389A>G	ENST00000369996.1	+	1	369	c.269A>G	c.(268-270)tAc>tGc	p.Y90C	RTEL1_ENST00000318100.4_Silent_p.L1392L|ARFRP1_ENST00000485858.1_5'Flank|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.L1392L	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	90					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			CGCTGCCGCTACTGCAACGTC	0.687																																					p.Y90C		Atlas-SNP	.											.	TNFRSF6B	22	.	0			c.A269G						.						21.0	23.0	22.0					20																	62328389		2186	4280	6466	SO:0001583	missense	8771	exon1			GCCGCTACTGCAA	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.269A>G	chr20.hg19:g.62328389A>G	ENSP00000359013:p.Tyr90Cys	102.0	0.0		115.0	16.0	NM_003823		Missense_Mutation	SNP	ENST00000369996.1	hg19	CCDS13532.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.683001	0.88542	.	.	ENSG00000243509	ENST00000370006;ENST00000369996;ENST00000342852	D	0.91068	-2.78	4.0	4.0	0.46444	TNFR/CD27/30/40/95 cysteine-rich region (3);	.	.	.	.	D	0.94807	0.8323	M	0.81341	2.54	0.36702	D	0.880189	D	0.89917	1.0	D	0.91635	0.999	D	0.96489	0.9362	9	0.59425	D	0.04	-51.921	12.9181	0.58216	1.0:0.0:0.0:0.0	.	90	O95407	TNF6B_HUMAN	C	90	ENSP00000359013:Y90C	ENSP00000342328:Y90C	Y	+	2	0	TNFRSF6B	61798833	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	6.743000	0.74848	1.457000	0.47850	0.459000	0.35465	TAC	.	.		0.687	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080182.1		
ABHD16B	140701	hgsc.bcm.edu	37	20	62493729	62493729	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:62493729C>T	ENST00000369916.3	+	1	1164	c.836C>T	c.(835-837)gCg>gTg	p.A279V	TPD52L2_ENST00000351424.4_5'Flank|TPD52L2_ENST00000346249.4_5'Flank|C20ORF135_ENST00000601296.1_5'Flank|TPD52L2_ENST00000217121.5_5'Flank|TPD52L2_ENST00000352482.4_5'Flank|TPD52L2_ENST00000348257.5_5'Flank|TPD52L2_ENST00000369927.4_5'Flank|TPD52L2_ENST00000358548.4_5'Flank	NM_080622.3	NP_542189.1	Q9H3Z7	ABHGB_HUMAN	abhydrolase domain containing 16B	279							hydrolase activity (GO:0016787)			endometrium(2)|kidney(1)|lung(3)	6						GTGCCGCTGGCGCTGAAGGTC	0.667																																					p.A279V		Atlas-SNP	.											.	ABHD16B	22	.	0			c.C836T						.						30.0	22.0	25.0					20																	62493729		2201	4295	6496	SO:0001583	missense	140701	exon1			CGCTGGCGCTGAA		CCDS13539.1	20q13.33	2013-01-17	2010-12-09	2010-12-09	ENSG00000183260	ENSG00000183260		"""Abhydrolase domain containing"""	16128	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 135"""	C20orf135			Standard	NM_080622		Approved	dJ591C20.1	uc002ygx.1	Q9H3Z7	OTTHUMG00000033010	ENST00000369916.3:c.836C>T	chr20.hg19:g.62493729C>T	ENSP00000358932:p.Ala279Val	51.0	0.0		57.0	9.0	NM_080622		Missense_Mutation	SNP	ENST00000369916.3	hg19	CCDS13539.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093455	0.76756	.	.	ENSG00000183260	ENST00000369916	T	0.38240	1.15	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.61874	0.2382	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64786	-0.6325	10	0.45353	T	0.12	0.2397	15.4277	0.75065	0.0:1.0:0.0:0.0	.	279	Q9H3Z7	ABHGB_HUMAN	V	279	ENSP00000358932:A279V	ENSP00000358932:A279V	A	+	2	0	ABHD16B	61964173	1.000000	0.71417	0.969000	0.41365	0.848000	0.48234	5.025000	0.64097	2.235000	0.73313	0.491000	0.48974	GCG	.	.		0.667	ABHD16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080254.1		
KRTAP13-2	337959	hgsc.bcm.edu	37	21	31744329	31744329	+	Missense_Mutation	SNP	G	G	A	rs202124632		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr21:31744329G>A	ENST00000399889.2	-	1	228	c.203C>T	c.(202-204)aCg>aTg	p.T68M		NM_181621.3	NP_853652.1	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	68	5 X 10 AA approximate repeats.					intermediate filament (GO:0005882)				endometrium(1)|kidney(1)|lung(14)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	21						CACATAGGACGTCTGGCAGCT	0.607																																					p.T68M		Atlas-SNP	.											.	KRTAP13-2	29	.	0			c.C203T						.	G	MET/THR	0,4406		0,0,2203	56.0	56.0	56.0		203	-2.7	0.0	21		56	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRTAP13-2	NM_181621.3	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	68/176	31744329	1,13005	2203	4300	6503	SO:0001583	missense	337959	exon1			TAGGACGTCTGGC	AP001708	CCDS13589.1	21q22.1	2011-02-10			ENSG00000182816	ENSG00000182816		"""Keratin associated proteins"""	18923	protein-coding gene	gene with protein product						12359730	Standard	NM_181621		Approved	KAP13-2	uc002ynz.4	Q52LG2	OTTHUMG00000057793	ENST00000399889.2:c.203C>T	chr21.hg19:g.31744329G>A	ENSP00000382777:p.Thr68Met	145.0	0.0		116.0	23.0	NM_181621		Missense_Mutation	SNP	ENST00000399889.2	hg19	CCDS13589.1	.	.	.	.	.	.	.	.	.	.	G	7.820	0.717638	0.15372	0.0	1.16E-4	ENSG00000182816	ENST00000399889	T	0.03242	4.0	4.39	-2.74	0.05932	.	0.658638	0.12375	N	0.474447	T	0.06735	0.0172	M	0.80508	2.5	0.09310	N	1	D	0.54207	0.965	P	0.47891	0.56	T	0.08597	-1.0714	10	0.45353	T	0.12	.	2.8407	0.05528	0.168:0.3592:0.3445:0.1283	.	68	Q52LG2	KR132_HUMAN	M	68	ENSP00000382777:T68M	ENSP00000382777:T68M	T	-	2	0	KRTAP13-2	30666200	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.125000	0.10579	-0.716000	0.04962	-0.140000	0.14226	ACG	.	G|0.999;A|0.001		0.607	KRTAP13-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128245.1		
C21orf2	755	hgsc.bcm.edu	37	21	45750586	45750586	+	Intron	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr21:45750586T>C	ENST00000339818.4	-	6	850				C21orf2_ENST00000496321.1_Intron|C21orf2_ENST00000325223.7_Intron|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000397956.3_Silent_p.S253S|AP001062.8_ENST00000422357.1_RNA	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2						cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		CAAGGCCCTGTGAGGCTCCAT	0.692																																					p.S253S		Atlas-SNP	.											.	C21orf2	10	.	0			c.A759G						.																																			SO:0001627	intron_variant	755	exon6			GCCCTGTGAGGCT	Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.642+119A>G	chr21.hg19:g.45750586T>C		108.0	0.0		101.0	21.0	NM_001271441	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	Silent	SNP	ENST00000339818.4	hg19	CCDS13709.1																																																																																			.	.		0.692	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195799.1	NM_004928	
SLC19A1	6573	hgsc.bcm.edu	37	21	46951806	46951806	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr21:46951806T>C	ENST00000311124.4	-	3	598	c.446A>G	c.(445-447)tAc>tGc	p.Y149C	SLC19A1_ENST00000380010.4_Missense_Mutation_p.Y149C|SLC19A1_ENST00000567670.1_Missense_Mutation_p.Y149C|SLC19A1_ENST00000485649.2_Missense_Mutation_p.Y109C	NM_194255.2	NP_919231.1	P41440	S19A1_HUMAN	solute carrier family 19 (folate transporter), member 1	149					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	10				Colorectal(79;0.0569)|READ - Rectum adenocarcinoma(84;0.172)	Methotrexate(DB00563)|Pralatrexate(DB06813)	CACACGCTGGTAGCGCGCGGG	0.662																																					p.Y149C		Atlas-SNP	.											.	SLC19A1	53	.	0			c.A446G						.						26.0	23.0	24.0					21																	46951806		2179	4281	6460	SO:0001583	missense	6573	exon3			CGCTGGTAGCGCG	U15939	CCDS13725.1, CCDS56217.1, CCDS56218.1	21q22.3	2013-05-22			ENSG00000173638	ENSG00000173638		"""Solute carriers"""	10937	protein-coding gene	gene with protein product		600424				9570943	Standard	NM_194255		Approved	FOLT	uc002zhl.2	P41440	OTTHUMG00000090397	ENST00000311124.4:c.446A>G	chr21.hg19:g.46951806T>C	ENSP00000308895:p.Tyr149Cys	67.0	0.0		48.0	5.0	NM_001205206	B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	ENST00000311124.4	hg19	CCDS13725.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.688652	0.48097	.	.	ENSG00000173638	ENST00000311124;ENST00000380010;ENST00000485649;ENST00000427839;ENST00000443742	D;D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23;-3.23	4.95	3.78	0.43462	Major facilitator superfamily domain, general substrate transporter (1);	0.061993	0.64402	D	0.000002	D	0.97182	0.9079	H	0.94964	3.605	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77557	0.99;0.99;0.989;0.99	D	0.96828	0.9609	10	0.87932	D	0	-27.4956	10.3217	0.43769	0.1475:0.0:0.0:0.8525	.	109;171;149;149	B7Z8C3;D3DSM6;E9PFY4;P41440	.;.;.;S19A1_HUMAN	C	149;149;109;149;149	ENSP00000308895:Y149C;ENSP00000369347:Y149C;ENSP00000441772:Y109C;ENSP00000401850:Y149C;ENSP00000411345:Y149C	ENSP00000308895:Y149C	Y	-	2	0	SLC19A1	45776234	1.000000	0.71417	0.985000	0.45067	0.011000	0.07611	4.627000	0.61276	0.821000	0.34540	0.379000	0.24179	TAC	.	.		0.662	SLC19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206796.1		
DIP2A	23181	hgsc.bcm.edu	37	21	47959885	47959885	+	Missense_Mutation	SNP	C	C	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr21:47959885C>G	ENST00000417564.2	+	17	2038	c.2017C>G	c.(2017-2019)Ctg>Gtg	p.L673V	DIP2A_ENST00000400274.1_Missense_Mutation_p.L669V|DIP2A_ENST00000435722.3_Missense_Mutation_p.L673V|DIP2A_ENST00000457905.3_Missense_Mutation_p.L673V|DIP2A_ENST00000427143.2_Missense_Mutation_p.L609V|DIP2A_ENST00000466639.1_Missense_Mutation_p.L630V|DIP2A_ENST00000318711.7_Missense_Mutation_p.L674V			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	673					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TCCTGAGGCGCTGACTGTCGC	0.532																																					p.L673V		Atlas-SNP	.											.	DIP2A	332	.	0			c.C2017G						.						133.0	139.0	137.0					21																	47959885		2131	4242	6373	SO:0001583	missense	23181	exon17			GAGGCGCTGACTG	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.2017C>G	chr21.hg19:g.47959885C>G	ENSP00000392066:p.Leu673Val	49.0	0.0		58.0	4.0	NM_206891	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	ENST00000417564.2	hg19	CCDS46655.1	.	.	.	.	.	.	.	.	.	.	C	11.16	1.558272	0.27827	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	4.7	3.81	0.43845	AMP-dependent synthetase/ligase (1);	0.077515	0.52532	D	0.000078	T	0.54127	0.1839	M	0.73372	2.23	0.46241	D	0.998941	B;P;D;P;P;P;B	0.58268	0.287;0.594;0.982;0.897;0.499;0.843;0.031	B;P;P;P;P;P;B	0.57244	0.314;0.493;0.768;0.816;0.648;0.628;0.05	T	0.53085	-0.8488	10	0.33940	T	0.23	-13.2254	11.3259	0.49448	0.0:0.9116:0.0:0.0884	.	674;609;630;609;673;673;673	E9PER1;E7EMA5;Q14689-3;B4E0F0;Q14689;Q14689-4;Q14689-2	.;.;.;.;DIP2A_HUMAN;.;.	V	669;609;674;630;673;630;673;673	ENSP00000383133:L669V;ENSP00000400528:L609V;ENSP00000323633:L674V;ENSP00000393434:L673V;ENSP00000430249:L630V;ENSP00000415089:L673V;ENSP00000392066:L673V	ENSP00000323633:L674V	L	+	1	2	DIP2A	46784313	0.018000	0.18449	0.023000	0.16930	0.536000	0.34869	0.307000	0.19296	2.158000	0.67659	0.655000	0.94253	CTG	.	.		0.532	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
PEX26	55670	hgsc.bcm.edu	37	22	18561184	18561184	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:18561184G>A	ENST00000329627.7	+	2	248	c.42G>A	c.(40-42)ggG>ggA	p.G14G	XXbac-B476C20.9_ENST00000426483.1_RNA|XXbac-B476C20.9_ENST00000607927.1_RNA|PEX26_ENST00000428061.2_Silent_p.G14G|PEX26_ENST00000399744.3_Silent_p.G14G	NM_017929.5	NP_060399.1	Q7Z412	PEX26_HUMAN	peroxisomal biogenesis factor 26	14					protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome membrane (GO:0045046)	integral component of peroxisomal membrane (GO:0005779)|peroxisome (GO:0005777)	ATPase binding (GO:0051117)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|kidney(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CCCTCAGGGGGCTCGGGGGAC	0.726																																					p.G14G		Atlas-SNP	.											.	PEX26	27	.	0			c.G42A						.						4.0	5.0	5.0					22																	18561184		1910	3798	5708	SO:0001819	synonymous_variant	55670	exon1			CAGGGGGCTCGGG	AB089678	CCDS13750.1, CCDS56221.1	22q11.21	2008-08-26	2008-08-26		ENSG00000215193	ENSG00000215193			22965	protein-coding gene	gene with protein product		608666	"""peroxisome biogenesis factor 26"""			12717447, 12851857	Standard	NM_017929		Approved	FLJ20695	uc002znp.4	Q7Z412	OTTHUMG00000149970	ENST00000329627.7:c.42G>A	chr22.hg19:g.18561184G>A		57.0	0.0		83.0	32.0	NM_001127649	F6UBB5|Q7Z413|Q7Z414|Q7Z415|Q7Z416|Q96B12|Q9NWQ0|Q9NXU0	Silent	SNP	ENST00000329627.7	hg19	CCDS13750.1																																																																																			.	.		0.726	PEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314644.3	NM_017929	
HIRA	7290	hgsc.bcm.edu	37	22	19344473	19344473	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:19344473G>A	ENST00000263208.5	-	19	2592	c.2336C>T	c.(2335-2337)aCt>aTt	p.T779I	HIRA_ENST00000340170.4_Intron|HIRA_ENST00000546308.1_Missense_Mutation_p.T735I|HIRA_ENST00000541063.1_Missense_Mutation_p.T735I	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	779	Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.|Interaction with histone H4.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GCAATGCAAAGTAGAGATCGG	0.602																																					p.T779I		Atlas-SNP	.											.	HIRA	100	.	0			c.C2336T						.						253.0	194.0	214.0					22																	19344473		2203	4300	6503	SO:0001583	missense	7290	exon19			TGCAAAGTAGAGA	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.2336C>T	chr22.hg19:g.19344473G>A	ENSP00000263208:p.Thr779Ile	78.0	0.0		110.0	9.0	NM_003325	Q05BU9|Q8IXN2	Missense_Mutation	SNP	ENST00000263208.5	hg19	CCDS13759.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980184	0.53827	.	.	ENSG00000100084	ENST00000263208;ENST00000541063;ENST00000539600;ENST00000546308	T;T;T	0.68624	-0.34;-0.19;-0.22	5.55	4.52	0.55395	TUP1-like enhancer of split (1);	0.115737	0.64402	D	0.000014	T	0.54532	0.1864	N	0.25647	0.755	0.80722	D	1	P;B	0.38078	0.617;0.379	B;B	0.39738	0.308;0.129	T	0.51419	-0.8708	10	0.21540	T	0.41	-14.6448	14.6662	0.68910	0.0711:0.0:0.9289:0.0	.	735;779	F5H4M2;P54198	.;HIRA_HUMAN	I	779;735;288;735	ENSP00000263208:T779I;ENSP00000446073:T735I;ENSP00000441870:T735I	ENSP00000263208:T779I	T	-	2	0	HIRA	17724473	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.378000	0.79679	2.592000	0.87571	0.655000	0.94253	ACT	.	.		0.602	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316488.2	NM_003325	
RSPH14	27156	hgsc.bcm.edu	37	22	23406095	23406095	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:23406095G>A	ENST00000216036.4	-	5	834	c.638C>T	c.(637-639)gCg>gTg	p.A213V		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		213										breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		ATTAAGGAGCGCACGGGCGGC	0.632																																					p.A213V		Atlas-SNP	.											.	RTDR1	39	.	0			c.C638T						.						68.0	61.0	64.0					22																	23406095		2203	4300	6503	SO:0001583	missense	27156	exon5			AGGAGCGCACGGG																												ENST00000216036.4:c.638C>T	chr22.hg19:g.23406095G>A	ENSP00000216036:p.Ala213Val	77.0	0.0		88.0	31.0	NM_014433		Missense_Mutation	SNP	ENST00000216036.4	hg19	CCDS13803.1	.	.	.	.	.	.	.	.	.	.	G	5.511	0.279316	0.10458	.	.	ENSG00000100218	ENST00000216036	T	0.54279	0.58	4.71	1.43	0.22495	Armadillo-like helical (1);Armadillo-type fold (1);	1.325690	0.04962	N	0.462276	T	0.46521	0.1397	L	0.56769	1.78	0.09310	N	0.999997	B	0.29115	0.233	B	0.20384	0.029	T	0.22765	-1.0207	10	0.28530	T	0.3	-5.5588	6.8903	0.24226	0.3029:0.0:0.6971:0.0	.	213	Q9UHP6	RTDR1_HUMAN	V	213	ENSP00000216036:A213V	ENSP00000216036:A213V	A	-	2	0	RTDR1	21736095	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.081000	0.30791	0.169000	0.19679	0.555000	0.69702	GCG	.	.		0.632	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1		
MYO18B	84700	hgsc.bcm.edu	37	22	26159258	26159258	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:26159258C>A	ENST00000407587.2	+	3	269	c.100C>A	c.(100-102)Cca>Aca	p.P34T	MYO18B_ENST00000335473.7_Missense_Mutation_p.P34T|MYO18B_ENST00000536101.1_Missense_Mutation_p.P34T			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	34						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTCTGTCATCCCAGGGGGCTT	0.547																																					p.P34T		Atlas-SNP	.											MYO18B,NS,carcinoma,0,1	MYO18B	322	.	0			c.C100A						.						33.0	35.0	35.0					22																	26159258		1876	4109	5985	SO:0001583	missense	84700	exon3			GTCATCCCAGGGG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.100C>A	chr22.hg19:g.26159258C>A	ENSP00000386096:p.Pro34Thr	118.0	0.0		118.0	21.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	20.7	4.026083	0.75390	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.97575	-4.41;-4.41;-4.44	5.09	5.09	0.68999	.	0.000000	0.39615	N	0.001313	D	0.98090	0.9370	M	0.69823	2.125	0.36602	D	0.87471	D	0.89917	1.0	D	0.87578	0.998	D	0.99962	1.1748	10	0.87932	D	0	.	15.5718	0.76345	0.0:1.0:0.0:0.0	.	34	F5GYU7	.	T	34	ENSP00000441229:P34T;ENSP00000334563:P34T;ENSP00000386096:P34T	ENSP00000334563:P34T	P	+	1	0	MYO18B	24489258	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.291000	0.59025	2.531000	0.85337	0.467000	0.42956	CCA	.	.		0.547	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
NF2	4771	hgsc.bcm.edu	37	22	30069387	30069387	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:30069387C>T	ENST00000338641.4	+	12	1693	c.1252C>T	c.(1252-1254)Cgc>Tgc	p.R418C	NF2_ENST00000413209.2_Intron|NF2_ENST00000403435.1_Missense_Mutation_p.R389C|NF2_ENST00000353887.4_Missense_Mutation_p.R335C|NF2_ENST00000334961.7_Missense_Mutation_p.R335C|NF2_ENST00000403999.3_Missense_Mutation_p.R418C|NF2_ENST00000347330.5_Intron|NF2_ENST00000361676.4_Missense_Mutation_p.R376C|NF2_ENST00000361452.4_Missense_Mutation_p.R377C|NF2_ENST00000361166.4_Missense_Mutation_p.R418C|NF2_ENST00000397789.3_Missense_Mutation_p.R418C	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	418	Glu-rich.		R -> C (in vestibular schwannoma). {ECO:0000269|PubMed:8012353}.		actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.M375fs*20(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						CACAGCGATTCGCACGGAGGA	0.612			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.R418C		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	NF2_ENST00000403999,NS,carcinoma,0,4	NF2	1312	.	4	Unknown(3)|Deletion - Frameshift(1)	large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	c.C1252T	GRCh37	CM942127	NF2	M		.						58.0	50.0	52.0					22																	30069387		2203	4300	6503	SO:0001583	missense	4771	exon12	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	GCGATTCGCACGG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	ENST00000338641.4:c.1252C>T	chr22.hg19:g.30069387C>T	ENSP00000344666:p.Arg418Cys	136.0	0.0		155.0	20.0	NM_000268	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Missense_Mutation	SNP	ENST00000338641.4	hg19	CCDS13861.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097507	0.76870	.	.	ENSG00000186575	ENST00000338641;ENST00000403435;ENST00000361452;ENST00000397822;ENST00000403999;ENST00000334961;ENST00000353887;ENST00000397789;ENST00000361676;ENST00000361166	D;D;D;D;D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7;-1.7	6.06	2.59	0.31030	Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88074	0.6339	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.998;0.999;0.998;0.999;1.0;0.999	D;P;D;D;D;P;P;P	0.67725	0.953;0.886;0.921;0.953;0.921;0.899;0.899;0.854	D	0.87468	0.2412	9	.	.	.	.	16.1807	0.81895	0.3826:0.6174:0.0:0.0	.	393;389;377;418;418;376;335;418	B7Z4B6;P35240-8;P35240-5;P35240;P35240-2;P35240-6;P35240-4;P35240-3	.;.;.;MERL_HUMAN;.;.;.;.	C	418;389;377;393;418;335;335;418;376;418	ENSP00000344666:R418C;ENSP00000384029:R389C;ENSP00000354897:R377C;ENSP00000384797:R418C;ENSP00000335652:R335C;ENSP00000340626:R335C;ENSP00000380891:R418C;ENSP00000355183:R376C;ENSP00000354529:R418C	.	R	+	1	0	NF2	28399387	0.220000	0.23631	0.990000	0.47175	0.915000	0.54546	0.907000	0.28531	0.838000	0.34948	0.655000	0.94253	CGC	.	.		0.612	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
SEC14L3	266629	hgsc.bcm.edu	37	22	30857443	30857443	+	Missense_Mutation	SNP	G	G	A	rs144684185		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:30857443G>A	ENST00000215812.4	-	11	1025	c.935C>T	c.(934-936)gCg>gTg	p.A312V	SEC14L3_ENST00000402286.1_Missense_Mutation_p.A235V|SEC14L3_ENST00000403066.1_Missense_Mutation_p.A253V|SEC14L3_ENST00000539629.1_Missense_Mutation_p.A253V|SEC14L3_ENST00000401751.1_Missense_Mutation_p.A253V|SEC14L3_ENST00000540910.1_Missense_Mutation_p.A235V|SEC14L3_ENST00000415957.2_Missense_Mutation_p.A253V	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	312	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GCCGATGTCCGCACCATCAGA	0.607																																					p.A312V	Esophageal Squamous(108;290 1516 3584 23771 37333)	Atlas-SNP	.											.	SEC14L3	46	.	0			c.C935T						.	G	VAL/ALA	0,4406		0,0,2203	56.0	51.0	53.0		935	-2.5	0.0	22	dbSNP_134	53	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEC14L3	NM_174975.4	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	312/401	30857443	1,13005	2203	4300	6503	SO:0001583	missense	266629	exon11			ATGTCCGCACCAT	AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.935C>T	chr22.hg19:g.30857443G>A	ENSP00000215812:p.Ala312Val	65.0	0.0		78.0	16.0	NM_174975	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000215812.4	hg19	CCDS13877.1	.	.	.	.	.	.	.	.	.	.	G	11.05	1.526214	0.27299	0.0	1.16E-4	ENSG00000100012	ENST00000403066;ENST00000415957;ENST00000215812;ENST00000402286;ENST00000401751;ENST00000539629;ENST00000540910	T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.52	-2.46	0.06461	GOLD (2);	0.286036	0.38663	N	0.001608	T	0.34337	0.0894	M	0.75447	2.3	0.23331	N	0.997895	P;P	0.42584	0.784;0.635	B;B	0.25987	0.065;0.049	T	0.41610	-0.9499	10	0.51188	T	0.08	0.0087	15.6975	0.77512	0.0:0.5808:0.3161:0.1031	.	235;312	E9PE57;Q9UDX4	.;S14L3_HUMAN	V	253;253;312;235;253;253;235	ENSP00000385941:A253V;ENSP00000401864:A253V;ENSP00000215812:A312V;ENSP00000385004:A235V;ENSP00000383896:A253V;ENSP00000444691:A253V;ENSP00000439752:A235V	ENSP00000215812:A312V	A	-	2	0	SEC14L3	29187443	0.100000	0.21855	0.000000	0.03702	0.178000	0.23041	0.888000	0.28268	-0.553000	0.06158	-0.211000	0.12701	GCG	.	G|1.000;A|0.000		0.607	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321950.4	NM_174975	
TIMP3	7078	hgsc.bcm.edu	37	22	33255323	33255323	+	Missense_Mutation	SNP	G	G	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:33255323G>C	ENST00000266085.6	+	5	896	c.595G>C	c.(595-597)Gcc>Ccc	p.A199P	SYN3_ENST00000332840.5_Intron|SYN3_ENST00000358763.2_Intron	NM_000362.4	NP_000353.1	P35625	TIMP3_HUMAN	TIMP metallopeptidase inhibitor 3	199					cellular response to organic substance (GO:0071310)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(2)|large_intestine(3)|lung(1)|urinary_tract(1)	7						CCGAGGATGGGCCCCCCCGGA	0.607																																					p.A199P		Atlas-SNP	.											TIMP3,NS,adenoma,0,1	TIMP3	31	.	0			c.G595C						.						58.0	49.0	52.0					22																	33255323		2203	4300	6503	SO:0001583	missense	7078	exon5			GGATGGGCCCCCC		CCDS13911.1	22q12.3	2013-01-08	2008-07-31		ENSG00000100234	ENSG00000100234			11822	protein-coding gene	gene with protein product		188826	"""tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory)"""	SFD		8188246, 12652295	Standard	NM_000362		Approved		uc003anb.3	P35625	OTTHUMG00000030784	ENST00000266085.6:c.595G>C	chr22.hg19:g.33255323G>C	ENSP00000266085:p.Ala199Pro	27.0	0.0		49.0	18.0	NM_000362	B2RBY9|Q5THV4|Q9UC74|Q9UGS2	Missense_Mutation	SNP	ENST00000266085.6	hg19	CCDS13911.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.10|12.10	1.835667|1.835667	0.32421|0.32421	.|.	.|.	ENSG00000100234|ENSG00000100234	ENST00000266085;ENST00000538671|ENST00000382049	D|.	0.95137|.	-3.62|.	3.91|3.91	3.91|3.91	0.45181|0.45181	Tissue inhibitor of metalloproteinases-like, OB-fold (1);|.	0.316966|.	0.33670|.	N|.	0.004663|.	T|T	0.47930|0.47930	0.1472|0.1472	L|L	0.31120|0.31120	0.905|0.905	0.27786|0.27786	N|N	0.94299|0.94299	B|.	0.22800|.	0.075|.	B|.	0.14578|.	0.011|.	T|T	0.51474|0.51474	-0.8701|-0.8701	10|6	0.42905|0.87932	T|D	0.14|0	-14.9435|-14.9435	16.1096|16.1096	0.81250|0.81250	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	199|.	P35625|.	TIMP3_HUMAN|.	P|A	199;133|201	ENSP00000266085:A199P|.	ENSP00000266085:A199P|ENSP00000371481:G201A	A|G	+|+	1|2	0|0	TIMP3|TIMP3	31585323|31585323	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.715000|2.715000	0.47210|0.47210	2.019000|2.019000	0.59389|0.59389	0.561000|0.561000	0.74099|0.74099	GCC|GGC	.	.		0.607	TIMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075672.2	NM_000362	
CACNG2	10369	hgsc.bcm.edu	37	22	36960548	36960548	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:36960548G>A	ENST00000300105.6	-	4	1803	c.822C>T	c.(820-822)agC>agT	p.S274S	RP5-1119A7.17_ENST00000562756.1_RNA	NM_006078.3	NP_006069.1	Q9Y698	CCG2_HUMAN	calcium channel, voltage-dependent, gamma subunit 2	274					membrane depolarization (GO:0051899)|membrane hyperpolarization (GO:0060081)|neuromuscular junction development (GO:0007528)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	18						GGGGGTCCCTGCTGAGCGTGT	0.627																																					p.S274S		Atlas-SNP	.											.	CACNG2	43	.	0			c.C822T						.						68.0	69.0	68.0					22																	36960548		2203	4300	6503	SO:0001819	synonymous_variant	10369	exon4			GTCCCTGCTGAGC	AF096322	CCDS13931.1	22q13.1	2006-08-01			ENSG00000166862	ENSG00000166862		"""Calcium channel subunits"""	1406	protein-coding gene	gene with protein product		602911					Standard	NM_006078		Approved	stargazin, MGC138502, MGC138504	uc003aps.2	Q9Y698	OTTHUMG00000030612	ENST00000300105.6:c.822C>T	chr22.hg19:g.36960548G>A		119.0	0.0		143.0	22.0	NM_006078	Q2M1M1|Q5TGT3|Q9UGZ7	Silent	SNP	ENST00000300105.6	hg19	CCDS13931.1																																																																																			.	.		0.627	CACNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075500.2		
CARD10	29775	hgsc.bcm.edu	37	22	37904630	37904630	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:37904630A>G	ENST00000403299.1	-	6	1185	c.969T>C	c.(967-969)caT>caC	p.H323H	CARD10_ENST00000406271.3_Silent_p.H37H|CARD10_ENST00000251973.5_Silent_p.H323H|CARD10_ENST00000494166.1_5'UTR			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	323					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CCCGCCAGTCATGCTCTAGGA	0.711																																					p.H323H		Atlas-SNP	.											.	CARD10	55	.	0			c.T969C						.						11.0	12.0	12.0					22																	37904630		2193	4289	6482	SO:0001819	synonymous_variant	29775	exon5			CCAGTCATGCTCT	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.969T>C	chr22.hg19:g.37904630A>G		46.0	0.0		61.0	21.0	NM_014550	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	Silent	SNP	ENST00000403299.1	hg19	CCDS13948.1																																																																																			.	.		0.711	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318997.1	NM_014550	
CDC42EP1	11135	hgsc.bcm.edu	37	22	37964226	37964226	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:37964226C>T	ENST00000249014.4	+	3	995	c.575C>T	c.(574-576)tCt>tTt	p.S192F		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	192					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					CGCTCTGACTCTCTCTTGTCC	0.652																																					p.S192F		Atlas-SNP	.											.	CDC42EP1	53	.	0			c.C575T						.						69.0	75.0	73.0					22																	37964226		2203	4300	6503	SO:0001583	missense	11135	exon3			CTGACTCTCTCTT	M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.575C>T	chr22.hg19:g.37964226C>T	ENSP00000249014:p.Ser192Phe	67.0	0.0		70.0	19.0	NM_152243	A8K825|Q96GN1	Missense_Mutation	SNP	ENST00000249014.4	hg19	CCDS13949.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.887172	0.52014	.	.	ENSG00000128283	ENST00000249014	T	0.61627	0.09	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000001	T	0.76601	0.4010	M	0.79123	2.44	0.53005	D	0.999963	D	0.89917	1.0	D	0.76071	0.987	T	0.80072	-0.1535	10	0.87932	D	0	-22.987	16.4323	0.83853	0.0:1.0:0.0:0.0	.	192	Q00587	BORG5_HUMAN	F	192	ENSP00000249014:S192F	ENSP00000249014:S192F	S	+	2	0	CDC42EP1	36294172	1.000000	0.71417	1.000000	0.80357	0.437000	0.31866	6.374000	0.73132	2.397000	0.81536	0.491000	0.48974	TCT	.	.		0.652	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318993.1	NM_152243	
APOBEC3G	60489	hgsc.bcm.edu	37	22	39482298	39482298	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:39482298C>T	ENST00000407997.3	+	6	1107	c.750C>T	c.(748-750)caC>caT	p.H250H	APOBEC3G_ENST00000452957.2_Silent_p.H250H	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	250	Necessary for homooligomerization.				base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					CACATAAACACGGTTTCCTTG	0.483																																					p.H250H		Atlas-SNP	.											.	APOBEC3G	69	.	0			c.C750T						.						69.0	72.0	71.0					22																	39482298		2203	4300	6503	SO:0001819	synonymous_variant	60489	exon6			TAAACACGGTTTC	AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.750C>T	chr22.hg19:g.39482298C>T		126.0	0.0		131.0	22.0	NM_021822	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Silent	SNP	ENST00000407997.3	hg19	CCDS13984.1																																																																																			.	.		0.483	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321219.1	NM_021822	
EFCAB6	64800	hgsc.bcm.edu	37	22	44168976	44168976	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:44168976A>G	ENST00000262726.7	-	4	400	c.147T>C	c.(145-147)gcT>gcC	p.A49A	EFCAB6_ENST00000396231.2_Intron|EFCAB6_ENST00000358439.4_Intron|EFCAB6_ENST00000356087.4_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	49					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				GATTTGCAACAGCTGTGGCTA	0.373																																					p.A49A		Atlas-SNP	.											.	EFCAB6	177	.	0			c.T147C						.						53.0	54.0	53.0					22																	44168976		2203	4300	6503	SO:0001819	synonymous_variant	64800	exon4			TGCAACAGCTGTG	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.147T>C	chr22.hg19:g.44168976A>G		99.0	0.0		113.0	14.0	NM_022785	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Silent	SNP	ENST00000262726.7	hg19	CCDS14049.1																																																																																			.	.		0.373	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
IL3RA	3563	hgsc.bcm.edu	37	X	1484120	1484120	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:1484120C>T	ENST00000331035.4	+	9	1198	c.849C>T	c.(847-849)agC>agT	p.S283S	IL3RA_ENST00000381469.2_Silent_p.S205S	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	283					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	AATTCTTGAGCGCCTGGAGCA	0.627																																					p.S283S		Atlas-SNP	.											.	IL3RA	49	.	0			c.C849T						.						62.0	72.0	68.0					X																	1484120		2199	4288	6487	SO:0001819	synonymous_variant	3563	exon9			CTTGAGCGCCTGG	M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.849C>T	chrX.hg19:g.1484120C>T		260.0	0.0		292.0	16.0	NM_002183	A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Silent	SNP	ENST00000331035.4	hg19	CCDS14113.1																																																																																			.	.		0.627	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055600.3		
FAM9A	171482	hgsc.bcm.edu	37	X	8763403	8763403	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:8763403C>T	ENST00000543214.1	-	7	682	c.547G>A	c.(547-549)Gca>Aca	p.A183T	FAM9A_ENST00000381003.3_Missense_Mutation_p.A183T	NM_001171186.1	NP_001164657.1	Q8IZU1	FAM9A_HUMAN	family with sequence similarity 9, member A	183	Glu-rich.					nucleus (GO:0005634)				endometrium(11)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	18		Hepatocellular(5;0.219)				TGCTTCTCTGCGATGTATTCT	0.468																																					p.A183T		Atlas-SNP	.											.	FAM9A	57	.	0			c.G547A						.						132.0	110.0	118.0					X																	8763403		2203	4300	6503	SO:0001583	missense	171482	exon7			TCTCTGCGATGTA		CCDS14131.1	Xp22.32	2012-11-29			ENSG00000183304	ENSG00000183304			18403	protein-coding gene	gene with protein product	"""testis expressed 39A"""	300477					Standard	NM_174951		Approved	TEX39A	uc004csg.3	Q8IZU1	OTTHUMG00000021110	ENST00000543214.1:c.547G>A	chrX.hg19:g.8763403C>T	ENSP00000440163:p.Ala183Thr	91.0	0.0		84.0	28.0	NM_174951	B7ZLH5|Q2M2D1	Missense_Mutation	SNP	ENST00000543214.1	hg19	CCDS14131.1	.	.	.	.	.	.	.	.	.	.	c	1.178	-0.638873	0.03557	.	.	ENSG00000183304	ENST00000381003;ENST00000543214	.	.	.	0.611	-1.19	0.09585	.	.	.	.	.	T	0.06325	0.0163	N	0.02247	-0.625	0.09310	N	1	P	0.50943	0.94	B	0.35240	0.198	T	0.24835	-1.0149	7	0.20519	T	0.43	.	.	.	.	.	183	Q8IZU1	FAM9A_HUMAN	T	183	.	ENSP00000370391:A183T	A	-	1	0	FAM9A	8723403	0.048000	0.20356	0.000000	0.03702	0.000000	0.00434	0.947000	0.29082	-0.480000	0.06803	-0.497000	0.04613	GCA	.	.		0.468	FAM9A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055697.1	NM_174951	
DCAF8L2	347442	hgsc.bcm.edu	37	X	27765399	27765399	+	Silent	SNP	A	A	G	rs371896121		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:27765399A>G	ENST00000451261.2	+	5	786	c.387A>G	c.(385-387)gaA>gaG	p.E129E		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	129	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						aggaggaggaagaggaggagg	0.572																																					p.E129E		Atlas-SNP	.											.	DCAF8L2	79	.	0			c.A387G						.						24.0	21.0	22.0					X																	27765399		692	1589	2281	SO:0001819	synonymous_variant	347442	exon1			GGAGGAAGAGGAG		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.387A>G	chrX.hg19:g.27765399A>G		33.0	0.0		34.0	5.0	NM_001136533	B2RXH9|J3KT06	Silent	SNP	ENST00000451261.2	hg19	CCDS59162.1																																																																																			.	.		0.572	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
FAM47A	158724	hgsc.bcm.edu	37	X	34149344	34149344	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:34149344C>T	ENST00000346193.3	-	1	1103	c.1052G>A	c.(1051-1053)cGc>cAc	p.R351H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	351										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGGCTCCGAGCGGAGACTGGA	0.657																																					p.R351H		Atlas-SNP	.											.	FAM47A	249	.	0			c.G1052A						.						23.0	25.0	24.0					X																	34149344		2190	4294	6484	SO:0001583	missense	158724	exon1			TCCGAGCGGAGAC	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1052G>A	chrX.hg19:g.34149344C>T	ENSP00000345029:p.Arg351His	130.0	0.0		157.0	26.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	N	1.759	-0.487340	0.04352	.	.	ENSG00000185448	ENST00000346193	T	0.09538	2.97	0.226	-0.452	0.12205	.	.	.	.	.	T	0.04048	0.0113	N	0.04508	-0.205	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.40021	-0.9585	8	0.39692	T	0.17	.	.	.	.	.	351	Q5JRC9	FA47A_HUMAN	H	351	ENSP00000345029:R351H	ENSP00000345029:R351H	R	-	2	0	FAM47A	34059265	0.772000	0.28567	0.001000	0.08648	0.001000	0.01503	-1.078000	0.03413	-0.826000	0.04284	-0.832000	0.03076	CGC	.	.		0.657	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
RP2	6102	hgsc.bcm.edu	37	X	46713333	46713333	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:46713333T>C	ENST00000218340.3	+	2	686	c.525T>C	c.(523-525)caT>caC	p.H175H		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	175	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						GTAACATTCATGACTTTACAC	0.403																																					p.H175H		Atlas-SNP	.											.	RP2	37	.	0			c.T525C						.						102.0	87.0	92.0					X																	46713333		2203	4300	6503	SO:0001819	synonymous_variant	6102	exon2			CATTCATGACTTT	AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.525T>C	chrX.hg19:g.46713333T>C		201.0	0.0		225.0	9.0	NM_006915	Q86XJ7|Q9NU67	Silent	SNP	ENST00000218340.3	hg19	CCDS14270.1																																																																																			.	.		0.403	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056375.1	NM_006915	
TIMP1	7076	hgsc.bcm.edu	37	X	47444965	47444965	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:47444965C>T	ENST00000218388.4	+	5	522	c.352C>T	c.(352-354)Cac>Tac	p.H118Y	TIMP1_ENST00000377017.1_Missense_Mutation_p.H54Y|SYN1_ENST00000340666.4_Intron|MIR4769_ENST00000584126.1_RNA|SYN1_ENST00000295987.7_Intron|TIMP1_ENST00000456754.2_3'UTR|TIMP1_ENST00000377018.2_Missense_Mutation_p.H112Y	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1	118	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|large_intestine(2)	3						TGGACTCTTGCACATCACTAC	0.582																																					p.H118Y		Atlas-SNP	.											.	TIMP1	12	.	0			c.C352T						.						46.0	38.0	41.0					X																	47444965		2203	4300	6503	SO:0001583	missense	7076	exon5			CTCTTGCACATCA		CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.352C>T	chrX.hg19:g.47444965C>T	ENSP00000218388:p.His118Tyr	233.0	0.0		240.0	48.0	NM_003254	Q14252|Q9UCU1	Missense_Mutation	SNP	ENST00000218388.4	hg19	CCDS14281.1	.	.	.	.	.	.	.	.	.	.	c	0.033	-1.323223	0.01309	.	.	ENSG00000102265	ENST00000218388;ENST00000377018;ENST00000377017	D;D;D	0.94330	-3.4;-3.4;-3.4	5.29	-0.22	0.13130	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);	0.412581	0.23197	N	0.050824	D	0.85771	0.5774	N	0.25647	0.755	0.22266	N	0.99925	B;B	0.21071	0.051;0.01	B;B	0.31337	0.128;0.004	T	0.70270	-0.4918	10	0.10377	T	0.69	.	8.7409	0.34556	0.0:0.4903:0.0:0.5097	.	112;118	B4DJK3;P01033	.;TIMP1_HUMAN	Y	118;112;54	ENSP00000218388:H118Y;ENSP00000366217:H112Y;ENSP00000366216:H54Y	ENSP00000218388:H118Y	H	+	1	0	TIMP1	47329909	0.998000	0.40836	0.620000	0.29132	0.539000	0.34962	0.333000	0.19768	-0.099000	0.12263	0.519000	0.50382	CAC	.	.		0.582	TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056423.1	NM_003254	
GRIPAP1	56850	hgsc.bcm.edu	37	X	48847397	48847397	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:48847397T>C	ENST00000376441.1	-	7	617	c.583A>G	c.(583-585)Aaa>Gaa	p.K195E	GRIPAP1_ENST00000376425.3_Missense_Mutation_p.K195E|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.K150E|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.K142E|GRIPAP1_ENST00000473581.1_5'UTR	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	195						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						ATTTCCCATTTCAGCTCCACC	0.607																																					p.K195E		Atlas-SNP	.											.	GRIPAP1	128	.	0			c.A583G						.						95.0	85.0	88.0					X																	48847397		2203	4300	6503	SO:0001583	missense	56850	exon7			CCCATTTCAGCTC	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.583A>G	chrX.hg19:g.48847397T>C	ENSP00000365624:p.Lys195Glu	169.0	0.0		176.0	47.0	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	hg19	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678208	0.68042	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.05	5.05	0.67936	.	0.280477	0.33401	N	0.004950	T	0.38480	0.1042	L	0.34521	1.04	0.32150	N	0.584303	D;D;D	0.71674	0.986;0.982;0.998	P;P;D	0.80764	0.795;0.831;0.994	T	0.28650	-1.0037	10	0.10111	T	0.7	-16.9781	11.4077	0.49908	0.0:0.0:0.0:1.0	.	142;85;195	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	E	195;150;195;195;142	ENSP00000365608:K195E;ENSP00000365627:K150E;ENSP00000365624:K195E;ENSP00000365606:K142E	ENSP00000365606:K142E	K	-	1	0	GRIPAP1	48732341	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.253000	0.51469	1.675000	0.50919	0.451000	0.29950	AAA	.	.		0.607	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
PRICKLE3	4007	hgsc.bcm.edu	37	X	49032590	49032590	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:49032590C>T	ENST00000376317.3	-	9	1374	c.1280G>A	c.(1279-1281)cGc>cAc	p.R427H	PRICKLE3_ENST00000540849.1_Missense_Mutation_p.R359H|PRICKLE3_ENST00000538114.1_Missense_Mutation_p.R263H|PRICKLE3_ENST00000536904.1_Missense_Mutation_p.R346H	NM_006150.3	NP_006141.2	O43900	PRIC3_HUMAN	prickle homolog 3 (Drosophila)	427				Missing (in Ref. 7; AAB92357). {ECO:0000305}.			zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|skin(2)	22						TCTCAGAAAGCGGGAGGGCTC	0.677																																					p.R427H		Atlas-SNP	.											.	PRICKLE3	59	.	0			c.G1280A						.						5.0	6.0	6.0					X																	49032590		1836	3777	5613	SO:0001583	missense	4007	exon9			AGAAAGCGGGAGG	BC016856	CCDS14320.1	Xp11.23	2008-02-05	2007-09-18	2007-09-18	ENSG00000012211	ENSG00000012211			6645	protein-coding gene	gene with protein product		300111	"""LIM domain only 6"""	LMO6		9344658	Standard	XM_005272605		Approved		uc004dmy.1	O43900	OTTHUMG00000024134	ENST00000376317.3:c.1280G>A	chrX.hg19:g.49032590C>T	ENSP00000365494:p.Arg427His	98.0	0.0		92.0	19.0	NM_006150	B7Z8F2|O76007|Q53XR5	Missense_Mutation	SNP	ENST00000376317.3	hg19	CCDS14320.1	.	.	.	.	.	.	.	.	.	.	-	2.314	-0.357254	0.05138	.	.	ENSG00000012211	ENST00000376317;ENST00000536904;ENST00000540849;ENST00000538114	T;T;T;T	0.69435	-0.39;-0.4;-0.39;-0.39	4.09	-3.27	0.05048	.	0.906261	0.09107	N	0.847581	T	0.35189	0.0923	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.001	T	0.21348	-1.0248	10	0.13108	T	0.6	-3.0129	6.1358	0.20233	0.0:0.2317:0.1532:0.615	.	389;346;427	B7Z6S4;B7Z8F2;O43900	.;.;PRIC3_HUMAN	H	427;346;359;263	ENSP00000365494:R427H;ENSP00000441385:R346H;ENSP00000446051:R359H;ENSP00000441743:R263H	ENSP00000365494:R427H	R	-	2	0	PRICKLE3	48919534	0.000000	0.05858	0.059000	0.19551	0.725000	0.41563	-1.870000	0.01641	-0.788000	0.04504	-0.322000	0.08575	CGC	.	.		0.677	PRICKLE3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060811.1	NM_006150	
CACNA1F	778	hgsc.bcm.edu	37	X	49082873	49082873	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:49082873G>A	ENST00000376265.2	-	11	1555	c.1494C>T	c.(1492-1494)tgC>tgT	p.C498C	CACNA1F_ENST00000376251.1_Silent_p.C433C|CACNA1F_ENST00000323022.5_Silent_p.C487C	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	498					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCCTCACAGGCAGCGTGTAC	0.612																																					p.C498C		Atlas-SNP	.											.	CACNA1F	218	.	0			c.C1494T						.						38.0	34.0	36.0					X																	49082873		2200	4280	6480	SO:0001819	synonymous_variant	778	exon11			TCACAGGCAGCGT	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.1494C>T	chrX.hg19:g.49082873G>A		74.0	0.0		85.0	5.0	NM_005183	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	ENST00000376265.2	hg19	CCDS35253.1																																																																																			.	.		0.612	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358157.1	NM_005183	
HEPH	9843	hgsc.bcm.edu	37	X	65483530	65483530	+	Splice_Site	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:65483530G>A	ENST00000343002.2	+	19	3908	c.3244G>A	c.(3244-3246)Gca>Aca	p.A1082T	HEPH_ENST00000419594.1_Splice_Site_p.A893T|HEPH_ENST00000374727.3_Splice_Site_p.A1085T|HEPH_ENST00000441993.2_Splice_Site_p.V1085M|HEPH_ENST00000519389.1_Splice_Site_p.A1136T|HEPH_ENST00000336279.5_Splice_Site_p.A815T			Q9BQS7	HEPH_HUMAN	hephaestin	1082	Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						GACTGAAAAAGGTACGTAAAA	0.438																																					p.A1136T		Atlas-SNP	.											.	HEPH	224	.	0			c.G3406A						.						221.0	153.0	176.0					X																	65483530		2203	4300	6503	SO:0001630	splice_region_variant	9843	exon20			GAAAAAGGTACGT	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.3244+1G>A	chrX.hg19:g.65483530G>A		238.0	0.0		286.0	81.0	NM_138737	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.81|12.81	2.048543|2.048543	0.36181|0.36181	.|.	.|.	ENSG00000089472|ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000419594;ENST00000343002|ENST00000441993	D;D;D;D;D|D	0.99287|0.99264	-5.69;-5.67;-5.68;-5.69;-5.67|-5.65	3.95|3.95	3.95|3.95	0.45737|0.45737	.|.	0.257731|.	0.26967|.	N|.	0.021584|.	D|D	0.97704|0.97704	0.9247|0.9247	L|L	0.51422|0.51422	1.61|1.61	0.33550|0.33550	D|D	0.59603|0.59603	B;P|B	0.35551|0.23490	0.094;0.509|0.086	B;B|B	0.30495|0.25884	0.026;0.116|0.064	D|D	0.99979|0.99979	1.2422|1.2422	10|9	0.22706|0.44086	T|T	0.39|0.13	.|.	10.4386|10.4386	0.44450|0.44450	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1136;893|1083	E9PHN8;E7ES21|Q9BQS7	.;.|HEPH_HUMAN	T|M	1136;1085;815;893;1082|1085	ENSP00000430620:A1136T;ENSP00000363859:A1085T;ENSP00000337418:A815T;ENSP00000413211:A893T;ENSP00000343939:A1082T|ENSP00000411687:V1085M	ENSP00000337418:A815T|ENSP00000411687:V1085M	A|V	+|+	1|1	0|0	HEPH|HEPH	65400255|65400255	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.331000|0.331000	0.28603|0.28603	3.394000|3.394000	0.52551|0.52551	2.221000|2.221000	0.72209|0.72209	0.600000|0.600000	0.82982|0.82982	GCA|GTG	.	.		0.438	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	Missense_Mutation
HDX	139324	hgsc.bcm.edu	37	X	83723918	83723918	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:83723918G>A	ENST00000297977.5	-	3	924	c.813C>T	c.(811-813)agC>agT	p.S271S	HDX_ENST00000373177.2_Silent_p.S271S|HDX_ENST00000506585.2_Silent_p.S213S	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	271						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GGGGGTAATCGCTAACTGCCA	0.448																																					p.S271S	Pancreas(53;231 1169 36156 43751 51139)	Atlas-SNP	.											.	HDX	124	.	0			c.C813T						.						91.0	87.0	89.0					X																	83723918		2203	4300	6503	SO:0001819	synonymous_variant	139324	exon3			GTAATCGCTAACT	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.813C>T	chrX.hg19:g.83723918G>A		166.0	0.0		159.0	35.0	NM_144657	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Silent	SNP	ENST00000297977.5	hg19	CCDS35342.1																																																																																			.	.		0.448	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657	
ESX1	80712	hgsc.bcm.edu	37	X	103498837	103498837	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:103498837C>T	ENST00000372588.4	-	2	587	c.504G>A	c.(502-504)gcG>gcA	p.A168A		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	168					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CCACTTACCGCGCCACAACGT	0.627																																					p.A168A	Pancreas(200;1705 2227 25194 28471 45274)	Atlas-SNP	.											.	ESX1	57	.	0			c.G504A						.						48.0	50.0	50.0					X																	103498837		2202	4298	6500	SO:0001819	synonymous_variant	80712	exon2			TTACCGCGCCACA	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.504G>A	chrX.hg19:g.103498837C>T		152.0	0.0		165.0	50.0	NM_153448	B0QYU3|Q7Z6K7	Silent	SNP	ENST00000372588.4	hg19	CCDS14516.1																																																																																			.	.		0.627	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448	
TEX13A	56157	hgsc.bcm.edu	37	X	104464092	104464092	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:104464092G>A	ENST00000413579.1	-	5	895	c.784C>T	c.(784-786)Cag>Tag	p.Q262*	IL1RAPL2_ENST00000344799.4_Intron|IL1RAPL2_ENST00000372582.1_Intron|TEX13A_ENST00000372578.3_Silent_p.G262G|TEX13A_ENST00000372575.1_Silent_p.G262G			Q9BXU3	TX13A_HUMAN	testis expressed 13A	262							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						CCCTCCTTCTGCCCCCAATAG	0.557																																					p.Q262X		Atlas-SNP	.											.	TEX13A	55	.	0			c.C784T						.						67.0	66.0	66.0					X																	104464092		2007	4165	6172	SO:0001587	stop_gained	56157	exon5			CCTTCTGCCCCCA	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.784C>T	chrX.hg19:g.104464092G>A	ENSP00000399753:p.Gln262*	160.0	0.0		169.0	45.0	NM_031274	B1B1G8|Q32NB6	Nonsense_Mutation	SNP	ENST00000413579.1	hg19		.	.	.	.	.	.	.	.	.	.	G	14.65	2.600065	0.46318	.	.	ENSG00000133149	ENST00000413579	.	.	.	3.45	0.451	0.16629	.	0.485125	0.15503	N	0.258925	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	8.4708	0.32984	0.0:0.0:0.4039:0.5961	.	.	.	.	X	262	.	ENSP00000399753:Q262X	Q	-	1	0	TEX13A	104350748	0.077000	0.21312	0.004000	0.12327	0.002000	0.02628	0.749000	0.26320	-0.027000	0.13873	-1.496000	0.00964	CAG	.	.		0.557	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274	
CAPN6	827	hgsc.bcm.edu	37	X	110491972	110491972	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:110491972G>A	ENST00000324068.1	-	10	1476	c.1309C>T	c.(1309-1311)Cac>Tac	p.H437Y	CAPN6_ENST00000541758.1_Missense_Mutation_p.H182Y	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	437	Domain III.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						TAGAGGTGGTGGAGGCGGAAT	0.448																																					p.H437Y		Atlas-SNP	.											.	CAPN6	120	.	0			c.C1309T						.						102.0	91.0	94.0					X																	110491972		2203	4300	6503	SO:0001583	missense	827	exon10			GGTGGTGGAGGCG	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1309C>T	chrX.hg19:g.110491972G>A	ENSP00000317214:p.His437Tyr	140.0	0.0		157.0	55.0	NM_014289	D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	hg19	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480561	0.84747	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	D;D	0.88431	-2.38;-2.38	4.94	4.94	0.65067	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.317386	0.38778	N	0.001576	D	0.92348	0.7572	L	0.55990	1.75	0.80722	D	1	D	0.65815	0.995	D	0.67382	0.951	D	0.92229	0.5791	10	0.46703	T	0.11	.	16.0038	0.80344	0.0:0.0:1.0:0.0	.	437	Q9Y6Q1	CAN6_HUMAN	Y	437;182	ENSP00000317214:H437Y;ENSP00000441736:H182Y	ENSP00000317214:H437Y	H	-	1	0	CAPN6	110378628	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.980000	0.93460	2.294000	0.77228	0.529000	0.55759	CAC	.	.		0.448	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
MCTS1	28985	hgsc.bcm.edu	37	X	119739358	119739358	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:119739358T>C	ENST00000371317.5	+	2	365	c.108T>C	c.(106-108)atT>atC	p.I36I	MCTS1_ENST00000487133.1_3'UTR|MCTS1_ENST00000371315.3_Silent_p.I37I	NM_014060.2	NP_054779.1	Q9ULC4	MCTS1_HUMAN	malignant T cell amplified sequence 1	36					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|formation of translation preinitiation complex (GO:0001731)|IRES-dependent translational initiation (GO:0002192)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|ribosome disassembly (GO:0032790)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|stomach(1)|urinary_tract(1)	10						TTCCAGGTATTGAACCATGGC	0.353																																					p.I37I		Atlas-SNP	.											.	MCTS1	40	.	0			c.T111C						.						96.0	96.0	96.0					X																	119739358		2203	4295	6498	SO:0001819	synonymous_variant	28985	exon2			AGGTATTGAACCA	AB034206	CCDS14601.1, CCDS48160.1	Xq24	2008-05-14			ENSG00000232119	ENSG00000232119			23357	protein-coding gene	gene with protein product		300587				9766643	Standard	NM_014060		Approved	MCT-1	uc011mub.2	Q9ULC4	OTTHUMG00000022303	ENST00000371317.5:c.108T>C	chrX.hg19:g.119739358T>C		399.0	1.0		479.0	121.0	NM_001137554	B4DGY2|Q502X6	Silent	SNP	ENST00000371317.5	hg19	CCDS14601.1																																																																																			.	.		0.353	MCTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058110.1	NM_014060	
C1GALT1C1	29071	hgsc.bcm.edu	37	X	119760167	119760167	+	Missense_Mutation	SNP	C	C	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:119760167C>G	ENST00000304661.5	-	2	1093	c.855G>C	c.(853-855)caG>caC	p.Q285H	C1GALT1C1_ENST00000371313.2_Missense_Mutation_p.Q285H	NM_001011551.2	NP_001011551.1	Q96EU7	C1GLC_HUMAN	C1GALT1-specific chaperone 1	285					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	11						TCACATGCATCTGATTTGGAG	0.413																																					p.Q285H		Atlas-SNP	.											.	C1GALT1C1	22	.	0			c.G855C						.						170.0	141.0	151.0					X																	119760167		2203	4300	6503	SO:0001583	missense	29071	exon3			ATGCATCTGATTT	AJ238398	CCDS14602.1	Xq24	2008-02-05			ENSG00000171155	ENSG00000171155			24338	protein-coding gene	gene with protein product		300611				11042152, 12361956	Standard	NM_152692		Approved	COSMC, C1GALT2	uc004esz.3	Q96EU7	OTTHUMG00000022305	ENST00000304661.5:c.855G>C	chrX.hg19:g.119760167C>G	ENSP00000304364:p.Gln285His	271.0	0.0		344.0	111.0	NM_152692	A8K246|Q8WWS3|Q9NZX1	Missense_Mutation	SNP	ENST00000304661.5	hg19	CCDS14602.1	.	.	.	.	.	.	.	.	.	.	C	8.110	0.778585	0.16120	.	.	ENSG00000171155	ENST00000304661;ENST00000371313	T;T	0.46819	0.86;0.86	5.46	0.37	0.16160	.	0.315127	0.35320	N	0.003300	T	0.33147	0.0853	L	0.46157	1.445	0.46376	D	0.999012	B	0.16166	0.016	B	0.18561	0.022	T	0.05971	-1.0853	9	.	.	.	-12.5479	5.6306	0.17508	0.0:0.3883:0.2535:0.3581	.	285	Q96EU7	C1GLC_HUMAN	H	285	ENSP00000304364:Q285H;ENSP00000360363:Q285H	.	Q	-	3	2	C1GALT1C1	119644195	0.961000	0.32948	0.998000	0.56505	0.957000	0.61999	0.086000	0.14935	-0.015000	0.14150	-0.498000	0.04607	CAG	.	.		0.413	C1GALT1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058117.1	NM_152692	
GLUD2	2747	hgsc.bcm.edu	37	X	120181885	120181885	+	Missense_Mutation	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:120181885T>C	ENST00000328078.1	+	1	424	c.347T>C	c.(346-348)cTg>cCg	p.L116P		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	116					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AACCATGTGCTGAGTCTCTCC	0.647																																					p.L116P		Atlas-SNP	.											.	GLUD2	89	.	0			c.T347C						.						77.0	56.0	63.0					X																	120181885		2203	4296	6499	SO:0001583	missense	2747	exon1			ATGTGCTGAGTCT	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.347T>C	chrX.hg19:g.120181885T>C	ENSP00000327589:p.Leu116Pro	484.0	0.0		533.0	92.0	NM_012084	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	hg19	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.919106	0.73098	.	.	ENSG00000182890	ENST00000328078	D	0.97352	-4.35	1.61	1.61	0.23674	Glutamate/phenylalanine/leucine/valine dehydrogenase, dimerisation domain (1);	0.000000	0.64402	D	0.000005	D	0.98585	0.9527	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.97569	1.0103	10	0.87932	D	0	-3.1044	6.8732	0.24133	0.0:0.0:0.0:1.0	.	116	P49448	DHE4_HUMAN	P	116	ENSP00000327589:L116P	ENSP00000327589:L116P	L	+	2	0	GLUD2	120009566	1.000000	0.71417	0.099000	0.21106	0.459000	0.32528	5.137000	0.64789	0.925000	0.37094	0.384000	0.25694	CTG	.	.		0.647	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
STAG2	10735	hgsc.bcm.edu	37	X	123191803	123191803	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:123191803G>A	ENST00000371160.1	+	15	1682	c.1392G>A	c.(1390-1392)ttG>ttA	p.L464L	STAG2_ENST00000371157.3_Silent_p.L464L|STAG2_ENST00000371144.3_Silent_p.L464L|STAG2_ENST00000371145.3_Silent_p.L464L|STAG2_ENST00000354548.5_Silent_p.L395L|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Silent_p.L464L	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	464					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TTAAGACATTGGTTTTTTTCT	0.348																																					p.L464L		Atlas-SNP	.											.	STAG2	309	.	0			c.G1392A						.						133.0	120.0	125.0					X																	123191803		2203	4300	6503	SO:0001819	synonymous_variant	10735	exon15			GACATTGGTTTTT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1392G>A	chrX.hg19:g.123191803G>A		126.0	0.0		132.0	14.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Silent	SNP	ENST00000371160.1	hg19	CCDS14607.1																																																																																			.	.		0.348	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
TENM1	10178	hgsc.bcm.edu	37	X	123517731	123517731	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:123517731G>A	ENST00000371130.3	-	29	7092	c.7029C>T	c.(7027-7029)ggC>ggT	p.G2343G	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Silent_p.G2350G	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2343					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GATAGATATCGCCATAAGGTG	0.428																																					p.G2350G		Atlas-SNP	.											.	.	.	.	0			c.C7050T						.						110.0	100.0	103.0					X																	123517731		2203	4300	6503	SO:0001819	synonymous_variant	10178	exon30			GATATCGCCATAA	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7029C>T	chrX.hg19:g.123517731G>A		179.0	0.0		210.0	25.0	NM_001163278	B2RTR5|Q5JZ17	Silent	SNP	ENST00000371130.3	hg19	CCDS14609.1																																																																																			.	.		0.428	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
OCRL	4952	hgsc.bcm.edu	37	X	128701327	128701327	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:128701327C>T	ENST00000371113.4	+	14	1618	c.1453C>T	c.(1453-1455)Cgg>Tgg	p.R485W	OCRL_ENST00000357121.5_Missense_Mutation_p.R485W	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	485	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						TAAAACAGACCGGTGGGATTC	0.393																																					p.R485W		Atlas-SNP	.											.	OCRL	117	.	0			c.C1453T						.						70.0	58.0	62.0					X																	128701327		2203	4300	6503	SO:0001583	missense	4952	exon14			ACAGACCGGTGGG	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.1453C>T	chrX.hg19:g.128701327C>T	ENSP00000360154:p.Arg485Trp	469.0	0.0		518.0	161.0	NM_000276	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	hg19	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623662	0.66901	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	T;T	0.80738	-1.41;-1.41	5.86	3.86	0.44501	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.193093	0.46145	D	0.000312	D	0.89887	0.6845	M	0.89414	3.03	0.58432	D	0.999996	D;D	0.89917	1.0;0.998	D;P	0.63703	0.917;0.849	D	0.91769	0.5426	10	0.72032	D	0.01	.	14.5239	0.67873	0.2837:0.7162:0.0:0.0	.	485;485	Q01968-2;Q01968	.;OCRL_HUMAN	W	485	ENSP00000360154:R485W;ENSP00000349635:R485W	ENSP00000349635:R485W	R	+	1	2	OCRL	128529008	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.301000	0.43628	1.179000	0.42884	0.600000	0.82982	CGG	.	.		0.393	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
BCORL1	63035	hgsc.bcm.edu	37	X	129185869	129185869	+	Silent	SNP	T	T	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:129185869T>C	ENST00000218147.7	+	12	4928	c.4731T>C	c.(4729-4731)caT>caC	p.H1577H	BCORL1_ENST00000303743.5_Silent_p.H1651H|BCORL1_ENST00000359304.2_Silent_p.H1447H|BCORL1_ENST00000540052.1_Silent_p.H1577H			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1577					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						ACCTCCTACATAATCCTCCTG	0.468																																					p.H1577H		Atlas-SNP	.											.	BCORL1	213	.	0			c.T4731C						.						195.0	171.0	179.0					X																	129185869		2203	4300	6503	SO:0001819	synonymous_variant	63035	exon11			CCTACATAATCCT	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4731T>C	chrX.hg19:g.129185869T>C		195.0	0.0		207.0	9.0	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Silent	SNP	ENST00000218147.7	hg19	CCDS14616.1																																																																																			.	.		0.468	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
ENOX2	10495	hgsc.bcm.edu	37	X	129759306	129759306	+	Missense_Mutation	SNP	C	C	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:129759306C>A	ENST00000370927.1	-	13	1836	c.1815G>T	c.(1813-1815)gaG>gaT	p.E605D	ENOX2_ENST00000370935.1_Missense_Mutation_p.E576D|ENOX2_ENST00000394363.1_Missense_Mutation_p.E576D|ENOX2_ENST00000338144.3_Missense_Mutation_p.E605D			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	605					cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						GCTTCAAGCCCTCGAAGCCAC	0.423																																					p.E605D	Ovarian(101;828 1506 2951 9500 35258)	Atlas-SNP	.											.	ENOX2	70	.	0			c.G1815T						.						118.0	95.0	103.0					X																	129759306		2203	4300	6503	SO:0001583	missense	10495	exon16			CAAGCCCTCGAAG	AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1815G>T	chrX.hg19:g.129759306C>A	ENSP00000359965:p.Glu605Asp	308.0	0.0		314.0	13.0	NM_182314	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	ENST00000370927.1	hg19	CCDS14626.1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.404322	0.25378	.	.	ENSG00000165675	ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927	.	.	.	4.98	2.04	0.26737	.	0.199430	0.44902	D	0.000419	T	0.22898	0.0553	N	0.11427	0.14	0.34614	D	0.717876	B;B	0.10296	0.003;0.003	B;B	0.11329	0.006;0.006	T	0.08066	-1.0740	9	0.40728	T	0.16	-13.2107	3.6445	0.08180	0.1933:0.596:0.0:0.2107	.	605;633	Q16206;A4QPE1	ENOX2_HUMAN;.	D	576;605;576;633;605	.	ENSP00000337146:E605D	E	-	3	2	ENOX2	129586987	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.472000	0.35376	0.594000	0.29761	0.538000	0.68166	GAG	.	.		0.423	ENOX2-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058277.1	NM_182314	
TFDP3	51270	hgsc.bcm.edu	37	X	132352255	132352255	+	Silent	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:132352255G>A	ENST00000310125.4	-	1	121	c.33C>T	c.(31-33)aaC>aaT	p.N11N		NM_016521.2	NP_057605.3	Q5H9I0	TFDP3_HUMAN	transcription factor Dp family, member 3	11					cellular response to DNA damage stimulus (GO:0006974)|G1/S transition of mitotic cell cycle (GO:0000082)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(1)|lung(8)|ovary(1)|prostate(2)	19	Acute lymphoblastic leukemia(192;0.000127)					TGAGTTCTTCGTTAGCTTCAG	0.468																																					p.N11N		Atlas-SNP	.											.	TFDP3	92	.	0			c.C33T						.						58.0	43.0	47.0					X																	132352255		692	1591	2283	SO:0001819	synonymous_variant	51270	exon1			TTCTTCGTTAGCT	AF219119	CCDS14636.2	Xq26.2	2009-03-25			ENSG00000183434	ENSG00000183434			24603	protein-coding gene	gene with protein product	"""E2F-like protein"", ""cancer/testis antigen 30"""	300772				12097419	Standard	NM_016521		Approved	HCA661, E2F-like, CT30	uc004exb.1	Q5H9I0	OTTHUMG00000022433	ENST00000310125.4:c.33C>T	chrX.hg19:g.132352255G>A		259.0	0.0		268.0	85.0	NM_016521	Q6DK49|Q9NZ54	Silent	SNP	ENST00000310125.4	hg19	CCDS14636.2																																																																																			.	.		0.468	TFDP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058337.1	NM_016521	
SAGE1	55511	hgsc.bcm.edu	37	X	134987456	134987456	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:134987456G>A	ENST00000370709.3	+	4	359	c.359G>A	c.(358-360)gGc>gAc	p.G120D	SAGE1_ENST00000535938.1_Missense_Mutation_p.G120D|SAGE1_ENST00000537770.1_Missense_Mutation_p.G120D|SAGE1_ENST00000324447.3_Missense_Mutation_p.G120D			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	120						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					ATGGAAAATGGCCAATCTCGA	0.463																																					p.G120D		Atlas-SNP	.											.	SAGE1	160	.	0			c.G359A						.						207.0	133.0	158.0					X																	134987456		2203	4300	6503	SO:0001583	missense	55511	exon5			AAAATGGCCAATC	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.359G>A	chrX.hg19:g.134987456G>A	ENSP00000359743:p.Gly120Asp	108.0	0.0		107.0	13.0	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	hg19	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	G	6.879	0.531693	0.13127	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.52295	0.67;0.67;1.5;0.67	1.32	1.32	0.21799	.	0.219686	0.28927	U	0.013700	T	0.44159	0.1280	N	0.19112	0.55	0.18873	N	0.999987	B;D	0.76494	0.002;0.999	B;D	0.74023	0.017;0.982	T	0.15838	-1.0423	10	0.31617	T	0.26	.	5.5445	0.17055	0.0:0.0:1.0:0.0	.	120;120	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	D	120	ENSP00000323191:G120D;ENSP00000445959:G120D;ENSP00000438276:G120D;ENSP00000359743:G120D	ENSP00000323191:G120D	G	+	2	0	SAGE1	134815122	0.648000	0.27313	0.522000	0.27862	0.066000	0.16364	0.286000	0.18902	0.932000	0.37266	0.284000	0.19432	GGC	.	.		0.463	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
GPR112	139378	hgsc.bcm.edu	37	X	135431189	135431189	+	Missense_Mutation	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:135431189A>G	ENST00000394143.1	+	6	5615	c.5324A>G	c.(5323-5325)aAg>aGg	p.K1775R	GPR112_ENST00000412101.1_Missense_Mutation_p.K1570R|GPR112_ENST00000370652.1_Missense_Mutation_p.K1775R|GPR112_ENST00000394141.1_Missense_Mutation_p.K1570R|GPR112_ENST00000287534.4_Missense_Mutation_p.K1712R	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1775					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACTAGCTTTAAGAGTGCTTCT	0.373																																					p.K1775R		Atlas-SNP	.											.	GPR112	459	.	0			c.A5324G						.						156.0	148.0	151.0					X																	135431189		2203	4300	6503	SO:0001583	missense	139378	exon6			GCTTTAAGAGTGC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5324A>G	chrX.hg19:g.135431189A>G	ENSP00000377699:p.Lys1775Arg	293.0	0.0		339.0	94.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	hg19	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	16.58	3.163536	0.57476	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.32272	1.5;1.5;1.46;1.59;1.46	3.57	-2.58	0.06228	.	.	.	.	.	T	0.18173	0.0436	L	0.34521	1.04	0.09310	N	1	P;P;P	0.50819	0.939;0.879;0.849	P;B;B	0.48063	0.565;0.308;0.239	T	0.17501	-1.0367	9	0.07175	T	0.84	.	1.1328	0.01749	0.2965:0.385:0.1281:0.1904	.	1712;1570;1775	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	R	1775;1775;1570;1712;1570	ENSP00000377699:K1775R;ENSP00000359686:K1775R;ENSP00000416526:K1570R;ENSP00000287534:K1712R;ENSP00000377697:K1570R	ENSP00000287534:K1712R	K	+	2	0	GPR112	135258855	0.000000	0.05858	0.001000	0.08648	0.375000	0.29983	0.064000	0.14437	-0.112000	0.11979	0.372000	0.22366	AAG	.	.		0.373	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
ZIC3	7547	hgsc.bcm.edu	37	X	136648912	136648912	+	Missense_Mutation	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:136648912C>T	ENST00000287538.5	+	1	612	c.62C>T	c.(61-63)gCg>gTg	p.A21V	RP1-137H15.2_ENST00000442841.1_RNA|RP1-137H15.2_ENST00000456631.1_RNA|ZIC3_ENST00000370606.3_Missense_Mutation_p.A21V	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	21					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					AGCTTCGGCGCGCCGCGCCAC	0.726																																					p.A21V		Atlas-SNP	.											.	ZIC3	93	.	0			c.C62T						.						11.0	10.0	10.0					X																	136648912		2175	4270	6445	SO:0001583	missense	7547	exon1			TCGGCGCGCCGCG	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.62C>T	chrX.hg19:g.136648912C>T	ENSP00000287538:p.Ala21Val	126.0	0.0		151.0	16.0	NM_003413	B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	ENST00000287538.5	hg19	CCDS14663.1	.	.	.	.	.	.	.	.	.	.	c	14.71	2.616537	0.46736	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	T;T	0.11930	2.73;2.78	3.97	3.97	0.46021	.	0.060777	0.64402	D	0.000004	T	0.06735	0.0172	N	0.14661	0.345	0.32859	D	0.507747	P	0.35226	0.491	B	0.25405	0.06	T	0.23547	-1.0185	10	0.18710	T	0.47	.	12.7167	0.57119	0.0:1.0:0.0:0.0	.	21	O60481	ZIC3_HUMAN	V	21	ENSP00000287538:A21V;ENSP00000359638:A21V	ENSP00000287538:A21V	A	+	2	0	ZIC3	136476578	0.871000	0.30034	1.000000	0.80357	0.981000	0.71138	5.664000	0.68045	1.847000	0.53656	0.525000	0.51046	GCG	.	.		0.726	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
SOX3	6658	hgsc.bcm.edu	37	X	139586440	139586440	+	Silent	SNP	C	C	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:139586440C>T	ENST00000370536.2	-	1	785	c.786G>A	c.(784-786)acG>acA	p.T262T		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	262					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					CGTTCACGTGCGTGTACGTGT	0.786																																					p.T262T		Atlas-SNP	.											.	SOX3	44	.	0			c.G786A						.						4.0	4.0	4.0					X																	139586440		1398	2852	4250	SO:0001819	synonymous_variant	6658	exon1			CACGTGCGTGTAC		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.786G>A	chrX.hg19:g.139586440C>T		160.0	0.0		168.0	21.0	NM_005634	P35714|Q5JWI3|Q9NP49	Silent	SNP	ENST00000370536.2	hg19	CCDS14669.1																																																																																			.	.		0.786	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1		
SLITRK4	139065	hgsc.bcm.edu	37	X	142717165	142717165	+	Missense_Mutation	SNP	G	G	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:142717165G>A	ENST00000381779.4	-	2	1985	c.1760C>T	c.(1759-1761)cCg>cTg	p.P587L	SLITRK4_ENST00000338017.4_Missense_Mutation_p.P587L|SLITRK4_ENST00000356928.1_Missense_Mutation_p.P587L	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	587						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGCAGACGGCTTATTTAA	0.453																																					p.P587L		Atlas-SNP	.											.	SLITRK4	162	.	0			c.C1760T						.						109.0	110.0	109.0					X																	142717165		2203	4300	6503	SO:0001583	missense	139065	exon2			GCAGACGGCTTAT	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1760C>T	chrX.hg19:g.142717165G>A	ENSP00000371198:p.Pro587Leu	145.0	0.0		180.0	20.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	G	10.44	1.350036	0.24426	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.56611	0.45;0.45;0.45	5.71	4.85	0.62838	.	0.060395	0.64402	U	0.000002	T	0.42359	0.1199	L	0.36672	1.1	0.80722	D	1	B	0.17852	0.024	B	0.14578	0.011	T	0.20075	-1.0286	10	0.28530	T	0.3	-5.1881	12.7043	0.57051	0.0818:0.0:0.9182:0.0	.	587	Q8IW52	SLIK4_HUMAN	L	587	ENSP00000371198:P587L;ENSP00000349400:P587L;ENSP00000336627:P587L	ENSP00000336627:P587L	P	-	2	0	SLITRK4	142544831	1.000000	0.71417	0.996000	0.52242	0.889000	0.51656	5.513000	0.67037	1.179000	0.42884	-0.190000	0.12839	CCG	.	.		0.453	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
MTMR1	8776	hgsc.bcm.edu	37	X	149931129	149931129	+	Missense_Mutation	SNP	G	G	A	rs200100741		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:149931129G>A	ENST00000370390.3	+	15	2082	c.1925G>A	c.(1924-1926)cGc>cAc	p.R642H	MTMR1_ENST00000544228.1_Missense_Mutation_p.R642H|MTMR1_ENST00000445323.2_Missense_Mutation_p.R650H|MTMR1_ENST00000541925.1_Missense_Mutation_p.R548H|MTMR1_ENST00000538506.1_Intron	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1	642					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GTGGCCACGCGCGCCGTCTCA	0.667																																					p.R642H		Atlas-SNP	.											.	MTMR1	82	.	0			c.G1925A						.						62.0	56.0	58.0					X																	149931129		2203	4300	6503	SO:0001583	missense	8776	exon15			CCACGCGCGCCGT	U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.1925G>A	chrX.hg19:g.149931129G>A	ENSP00000359417:p.Arg642His	151.0	0.0		175.0	53.0	NM_003828	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Missense_Mutation	SNP	ENST00000370390.3	hg19	CCDS14695.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.364218	0.41902	.	.	ENSG00000063601	ENST00000541925;ENST00000370390;ENST00000445323;ENST00000544228	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.14	5.14	0.70334	.	0.186575	0.44902	D	0.000420	T	0.44074	0.1276	L	0.60455	1.87	0.80722	D	1	B;B	0.32543	0.109;0.375	B;B	0.32583	0.041;0.148	T	0.46289	-0.9202	10	0.56958	D	0.05	.	17.8016	0.88589	0.0:0.0:1.0:0.0	.	642;650	Q13613;F8WA39	MTMR1_HUMAN;.	H	548;642;650;642	ENSP00000441879:R548H;ENSP00000359417:R642H;ENSP00000414178:R650H;ENSP00000440534:R642H	ENSP00000359417:R642H	R	+	2	0	MTMR1	149681787	1.000000	0.71417	0.110000	0.21437	0.015000	0.08874	4.791000	0.62460	2.134000	0.65973	0.529000	0.55759	CGC	.	.		0.667	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060863.2	NM_003828, NM_176789	
MT-ATP6	4508	hgsc.bcm.edu	37	M	8673	8673	+	Silent	SNP	A	A	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrM:8673A>G	ENST00000361899.2	+	1	147	c.147A>G	c.(145-147)ctA>ctG	p.L49L	MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TS1_ENST00000387416.2_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	49					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						CAACAATGACTAATCAAACTA	0.408																																					p.L49L		Atlas-SNP	.											.	.	.	.	0			c.A147G						.																																			SO:0001819	synonymous_variant	0	exon1			ATGACTAATCAAA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.147A>G	chrM.hg19:g.8673A>G		24.0	0.0		51.0	5.0	ENST00000361899	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Silent	SNP	ENST00000361899.2	hg19																																																																																				.	.		0.408	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024031	
HEXDC	284004	hgsc.bcm.edu	37	17	80400207	80400208	+	Frame_Shift_Ins	INS	-	-	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:80400207_80400208insC	ENST00000327949.9	+	12	1419_1420	c.1408_1409insC	c.(1408-1410)gccfs	p.A470fs	HEXDC_ENST00000337014.6_Frame_Shift_Ins_p.P500fs|HEXDC_ENST00000577944.1_Frame_Shift_Ins_p.CP472fs			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	470					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CGAGGTGTCTGCCCCCCCGCTG	0.688																																					p.L499fs		Atlas-INDEL	.											.,1	HEXDC	43	.	0			c.1497_1498insC						.																																			SO:0001589	frameshift_variant	284004	exon12			.	AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.1415dupC	chr17.hg19:g.80400214_80400214dupC	ENSP00000332634:p.Ala470fs	96.0	0.0		96.0	17.0	NM_173620	B7UUP6|Q8IYN4|Q8TE81	Frame_Shift_Ins	INS	ENST00000327949.9	hg19																																																																																				.	.		0.688	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000443513.1	NM_173620	
SPAG17	200162	hgsc.bcm.edu	37	1	118539117	118539117	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:118539117delA	ENST00000336338.5	-	34	4994	c.4929delT	c.(4927-4929)tttfs	p.F1643fs		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1643						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CATACATAACAAAAAACCTAT	0.284																																					p.V1644fs		Atlas-INDEL	.											.	SPAG17	263	.	0			c.4930delG						.						55.0	60.0	59.0					1																	118539117		2203	4299	6502	SO:0001589	frameshift_variant	200162	exon34			.		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4929delT	chr1.hg19:g.118539117delA	ENSP00000337804:p.Phe1643fs	175.0	0.0		299.0	42.0	NM_206996	Q8NAZ1|Q9NT21	Frame_Shift_Del	DEL	ENST00000336338.5	hg19	CCDS899.1																																																																																			.	.		0.284	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
PPP6R2	9701	hgsc.bcm.edu	37	22	50879410	50879410	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:50879410delC	ENST00000216061.5	+	23	2925	c.2555delC	c.(2554-2556)gccfs	p.A852fs	PPP6R2_ENST00000359139.3_Frame_Shift_Del_p.A819fs|PPP6R2_ENST00000395741.3_Frame_Shift_Del_p.A819fs|PPP6R2_ENST00000395744.3_Frame_Shift_Del_p.A818fs			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	852						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						GGCCGGGAGGCCCCCCCGCTG	0.721																																					p.A845fs		Atlas-INDEL	.											.	PPP6R2	71	.	0			c.2533delG						.						16.0	19.0	18.0					22																	50879410		2198	4294	6492	SO:0001589	frameshift_variant	9701	exon22			.	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.2555delC	chr22.hg19:g.50879410delC	ENSP00000216061:p.Ala852fs	84.0	0.0		87.0	18.0	NM_001242898	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Frame_Shift_Del	DEL	ENST00000216061.5	hg19																																																																																				.	.		0.721	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
PHF21A	51317	hgsc.bcm.edu	37	11	45955607	45955607	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:45955607delG	ENST00000418153.2	-	18	2154	c.1955delC	c.(1954-1956)cctfs	p.P652fs	PHF21A_ENST00000257821.4_Frame_Shift_Del_p.P653fs|PHF21A_ENST00000323180.6_Frame_Shift_Del_p.P606fs			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	652	Required for transcriptional repression.				blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						GGCATTGGCAGGGGGGGTGCA	0.617																																					p.P652fs		Atlas-INDEL	.											.	PHF21A	107	.	0			c.1956delT						.						31.0	38.0	36.0					11																	45955607		2202	4299	6501	SO:0001589	frameshift_variant	51317	exon18			.	AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.1955delC	chr11.hg19:g.45955607delG	ENSP00000398824:p.Pro652fs	72.0	0.0		83.0	25.0	NM_001101802	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Frame_Shift_Del	DEL	ENST00000418153.2	hg19	CCDS44578.1																																																																																			.	.		0.617	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392583.1	NM_016621	
DMRTC2	63946	hgsc.bcm.edu	37	19	42352585	42352585	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:42352585delC	ENST00000269945.3	+	4	487	c.436delC	c.(436-438)cccfs	p.P147fs	DMRTC2_ENST00000602098.1_3'UTR|DMRTC2_ENST00000596827.1_Frame_Shift_Del_p.P147fs	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	147	Pro-rich.				male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						GGCACCGACACCCCCCGGGAA	0.602																																					p.T145fs		Atlas-INDEL	.											.	DMRTC2	31	.	0			c.435delA						.																																			SO:0001589	frameshift_variant	63946	exon4			.	AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.436delC	chr19.hg19:g.42352585delC	ENSP00000269945:p.Pro147fs	254.0	0.0		257.0	45.0	NM_001040283	Q8N6Q2|Q96M39|Q96SD4	Frame_Shift_Del	DEL	ENST00000269945.3	hg19	CCDS33034.1																																																																																			.	.		0.602	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463045.1	NM_001040283	
MPP5	64398	hgsc.bcm.edu	37	14	67768752	67768755	+	Frame_Shift_Del	DEL	GAGA	GAGA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	GAGA	GAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:67768752_67768755delGAGA	ENST00000261681.4	+	6	1379_1382	c.718_721delGAGA	c.(718-723)gagagafs	p.ER240fs	MPP5_ENST00000555925.1_Frame_Shift_Del_p.ER206fs	NM_022474.3	NP_071919.2	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5)	240	Interaction with LIN7C. {ECO:0000250}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|establishment of protein localization to plasma membrane (GO:0090002)|morphogenesis of an epithelial sheet (GO:0002011)|myelin assembly (GO:0032288)|peripheral nervous system myelin maintenance (GO:0032287)|protein localization to myelin sheath abaxonal region (GO:0035750)|tight junction assembly (GO:0070830)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lateral loop (GO:0043219)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	18				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		CATTACAGATGAGAGAGTTTATGA	0.417																																					p.239_240del		Atlas-INDEL	.											.	MPP5	46	.	0			c.717_720del						.																																			SO:0001589	frameshift_variant	64398	exon6			.	AK022677	CCDS9779.1, CCDS58325.1	14q23.3	2008-08-11				ENSG00000072415			18669	protein-coding gene	gene with protein product	"""stardust"""	606958				11927608	Standard	NM_022474		Approved	PALS1, FLJ12615	uc001xjc.4	Q8N3R9		ENST00000261681.4:c.718_721delGAGA	chr14.hg19:g.67768752_67768755delGAGA	ENSP00000261681:p.Glu240fs	195.0	0.0		123.0	50.0	NM_022474	A1L380|Q7Z631|Q86T98|Q8N7I5|Q9H9Q0	Frame_Shift_Del	DEL	ENST00000261681.4	hg19	CCDS9779.1																																																																																			.	.		0.417	MPP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412498.1	NM_022474	
FAM217A	222826	hgsc.bcm.edu	37	6	4069257	4069259	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:4069257_4069259delATC	ENST00000274673.3	-	7	1601_1603	c.1198_1200delGAT	c.(1198-1200)gatdel	p.D400del	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	400																	TGGGATTCTTATCATAAGTTTCA	0.35																																					p.400_401del		Atlas-INDEL	.											.	.	.	.	0			c.1199_1201del						.																																			SO:0001651	inframe_deletion	222826	exon7			.	BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.1198_1200delGAT	chr6.hg19:g.4069257_4069259delATC	ENSP00000274673:p.Asp400del	135.0	0.0		177.0	32.0	NM_173563	Q5JYK1	In_Frame_Del	DEL	ENST00000274673.3	hg19	CCDS4489.1																																																																																			.	.		0.350	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352577.2	NM_173563	
BAP1	8314	hgsc.bcm.edu	37	3	52437802	52437803	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:52437802_52437803delTT	ENST00000460680.1	-	13	1829_1830	c.1358_1359delAA	c.(1357-1359)aaafs	p.K453fs	BAP1_ENST00000296288.5_Frame_Shift_Del_p.K435fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K453fs*15(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TCTGGGACTCTTTGAGCTTCTC	0.594			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.453_454del	GBM(101;493 1458 7992 21037 25532)	Atlas-INDEL	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	1	Deletion - Frameshift(1)	kidney(1)	c.1359_1360del						.																																			SO:0001589	frameshift_variant	8314	exon13			.	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1358_1359delAA	chr3.hg19:g.52437802_52437803delTT	ENSP00000417132:p.Lys453fs	52.0	0.0		52.0	25.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	hg19	CCDS2853.1																																																																																			.	.		0.594	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
RXRB	6257	hgsc.bcm.edu	37	6	33164232	33164233	+	Frame_Shift_Ins	INS	-	-	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:33164232_33164233insC	ENST00000374680.3	-	5	1182_1183	c.971_972insG	c.(970-972)ggafs	p.G324fs	RXRB_ENST00000374685.4_Frame_Shift_Ins_p.G324fs|RXRB_ENST00000413614.2_Frame_Shift_Ins_p.G228fs|RXRB_ENST00000544186.1_Frame_Shift_Ins_p.G134fs	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	324	Hinge.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TACCCCCGGTTCCCCCAGGACC	0.639																																					p.G324fs		Atlas-INDEL	.											.	RXRB	34	.	0			c.972_973insG						.																																			SO:0001589	frameshift_variant	6257	exon5			.	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.972dupG	chr6.hg19:g.33164237_33164237dupC	ENSP00000363812:p.Gly324fs	85.0	0.0		113.0	10.0	NM_021976	P28703|Q59G65|Q5JP92|Q5STQ1	Frame_Shift_Ins	INS	ENST00000374680.3	hg19	CCDS4768.1																																																																																			.	.		0.639	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976	
SAMD7	344658	hgsc.bcm.edu	37	3	169656232	169656233	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:169656232_169656233insT	ENST00000428432.2	+	9	1668_1669	c.1279_1280insT	c.(1279-1281)attfs	p.I427fs	RP11-379K17.4_ENST00000487580.1_RNA|SAMD7_ENST00000335556.3_Frame_Shift_Ins_p.I427fs	NM_182610.2	NP_872416.1	Q7Z3H4	SAMD7_HUMAN	sterile alpha motif domain containing 7	427								p.C429fs*6(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(22;1.55e-22)|all_epithelial(15;2.41e-27)|all_lung(20;3.52e-17)|Lung NSC(18;1.44e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0106)			TACAATGAACATTTTTTGTCCC	0.391																																					p.I427fs		Atlas-INDEL	.											.	SAMD7	69	.	1	Deletion - Frameshift(1)	lung(1)	c.1279_1280insT						.																																			SO:0001589	frameshift_variant	344658	exon9			.	BX537903	CCDS3209.1	3q26.31	2013-01-10			ENSG00000187033	ENSG00000187033		"""Sterile alpha motif (SAM) domain containing"""	25394	protein-coding gene	gene with protein product							Standard	NM_182610		Approved	DKFZp686E1583	uc003fgd.3	Q7Z3H4	OTTHUMG00000158730	ENST00000428432.2:c.1285dupT	chr3.hg19:g.169656238_169656238dupT	ENSP00000391299:p.Ile427fs	157.0	0.0		139.0	38.0	NM_182610		Frame_Shift_Ins	INS	ENST00000428432.2	hg19	CCDS3209.1																																																																																			.	.		0.391	SAMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351959.1	NM_182610	
DENND4B	9909	hgsc.bcm.edu	37	1	153916546	153916547	+	Frame_Shift_Ins	INS	-	-	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:153916546_153916547insG	ENST00000361217.4	-	2	722_723	c.304_305insC	c.(304-306)ctcfs	p.L102fs		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	102	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAGCTCAACGAGGGGGGGCTTG	0.634																																					p.L102fs		Atlas-INDEL	.											.	DENND4B	210	.	0			c.305_306insC						.																																			SO:0001589	frameshift_variant	9909	exon2			.	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.305dupC	chr1.hg19:g.153916553_153916553dupG	ENSP00000354597:p.Leu102fs	132.0	0.0		167.0	24.0	NM_014856	Q5T4K0	Frame_Shift_Ins	INS	ENST00000361217.4	hg19	CCDS44228.1																																																																																			.	.		0.634	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
THSD4	79875	hgsc.bcm.edu	37	15	72057470	72057470	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr15:72057470delC	ENST00000355327.3	+	16	2835	c.2701delC	c.(2701-2703)cccfs	p.P902fs	THSD4_ENST00000357769.4_Frame_Shift_Del_p.P542fs|THSD4_ENST00000567838.1_3'UTR|THSD4_ENST00000261862.6_Frame_Shift_Del_p.P902fs			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	902	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CCTGGAGAAACCCCCCAGCCA	0.522																																					p.K900fs		Atlas-INDEL	.											.	THSD4	75	.	0			c.2700delA						.						101.0	103.0	102.0					15																	72057470		1909	4133	6042	SO:0001589	frameshift_variant	79875	exon15			.	AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2701delC	chr15.hg19:g.72057470delC	ENSP00000347484:p.Pro902fs	136.0	0.0		113.0	20.0	NM_024817	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Frame_Shift_Del	DEL	ENST00000355327.3	hg19	CCDS10238.2																																																																																			.	.		0.522	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257253.2	NM_024817	
LRRC8D	55144	hgsc.bcm.edu	37	1	90400489	90400498	+	Frame_Shift_Del	DEL	ACGGCACTAA	ACGGCACTAA	-	rs372637181		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	ACGGCACTAA	ACGGCACTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:90400489_90400498delACGGCACTAA	ENST00000337338.5	+	3	2269_2278	c.1862_1871delACGGCACTAA	c.(1861-1872)gacggcactaaafs	p.DGTK621fs	LRRC8D_ENST00000394593.3_Frame_Shift_Del_p.DGTK621fs	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	621					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		ATTCATAATGACGGCACTAAACTCTTGGTA	0.438																																					p.621_624del		Atlas-INDEL	.											.	LRRC8D	78	.	0			c.1861_1870del						.																																			SO:0001589	frameshift_variant	55144	exon3			.	AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1862_1871delACGGCACTAA	chr1.hg19:g.90400489_90400498delACGGCACTAA	ENSP00000338887:p.Asp621fs	107.0	0.0		152.0	16.0	NM_018103	D3DT29|Q6UWB2|Q9NVW3	Frame_Shift_Del	DEL	ENST00000337338.5	hg19	CCDS726.1																																																																																			.	.		0.438	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029203.2	NM_018103	
PABPC1L2A	340529	hgsc.bcm.edu	37	X	72298895	72298897	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:72298895_72298897delAGA	ENST00000373519.1	-	1	454_456	c.329_331delTCT	c.(328-333)ttctcg>tcg	p.F110del	RP11-493K23.4_ENST00000454388.1_RNA|PABPC1L2A_ENST00000453389.1_In_Frame_Del_p.F110del	NM_001012977.2	NP_001012995.1	Q5JQF8	PAP1M_HUMAN	poly(A) binding protein, cytoplasmic 1-like 2A	110	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)					Renal(35;0.156)					CCGAACGCCGAGAAGATGTTGTA	0.591																																					p.110_111del		Atlas-INDEL	.											.	.	.	.	0			c.330_332del						.																																			SO:0001651	inframe_deletion	340529	exon1			.	BC041956	CCDS35334.1	Xq13.2	2013-02-12	2007-11-21	2007-11-21		ENSG00000186288		"""RNA binding motif (RRM) containing"""	27989	protein-coding gene	gene with protein product			"""RNA binding motif protein 32A"""	RBM32A		12477932	Standard	NM_001012977		Approved		uc004ebg.2	Q5JQF8		ENST00000373519.1:c.329_331delTCT	chrX.hg19:g.72298898_72298900delAGA	ENSP00000362618:p.Phe110del	1524.0	0.0		1725.0	152.0	NM_001012977	B2RMV9|Q8IVU8	In_Frame_Del	DEL	ENST00000373519.1	hg19	CCDS35334.1																																																																																			.	.		0.591	PABPC1L2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057222.1	NM_001012977	
SPAG9	9043	hgsc.bcm.edu	37	17	49071264	49071266	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr17:49071264_49071266delTTC	ENST00000262013.7	-	19	2465_2467	c.2257_2259delGAA	c.(2257-2259)gaadel	p.E753del	SPAG9_ENST00000505279.1_In_Frame_Del_p.E743del|SPAG9_ENST00000510283.1_In_Frame_Del_p.E596del|SPAG9_ENST00000357122.4_In_Frame_Del_p.E739del	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	753					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			GACTGGATAATTCTTCTTGATTT	0.365																																					p.753_754del		Atlas-INDEL	.											.	SPAG9	151	.	0			c.2258_2260del						.																																			SO:0001651	inframe_deletion	9043	exon19			.	AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.2257_2259delGAA	chr17.hg19:g.49071267_49071269delTTC	ENSP00000262013:p.Glu753del	117.0	0.0		105.0	12.0	NM_001130528	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	In_Frame_Del	DEL	ENST00000262013.7	hg19	CCDS45740.1																																																																																			.	.		0.365	SPAG9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000368543.2	NM_003971	
IRF2BP1	26145	hgsc.bcm.edu	37	19	46387532	46387532	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:46387532delG	ENST00000302165.3	-	1	1844	c.1501delC	c.(1501-1503)ctgfs	p.L501fs		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		GTACAGCACAGGGGGGCCCCA	0.682																																					p.L501fs		Atlas-INDEL	.											.	IRF2BP1	23	.	0			c.1502delT						.						12.0	14.0	13.0					19																	46387532		2174	4257	6431	SO:0001589	frameshift_variant	26145	exon1			.	AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.1501delC	chr19.hg19:g.46387532delG	ENSP00000307265:p.Leu501fs	81.0	0.0		87.0	16.0	NM_015649	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Frame_Shift_Del	DEL	ENST00000302165.3	hg19	CCDS12678.1																																																																																			.	.		0.682	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461683.1	NM_015649	
TENM3	55714	hgsc.bcm.edu	37	4	183609359	183609359	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr4:183609359delG	ENST00000511685.1	+	12	2199	c.2076delG	c.(2074-2076)atgfs	p.M692fs	TENM3_ENST00000406950.2_Frame_Shift_Del_p.M692fs|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	692	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GCGTTTGCATGGGGGGGACGT	0.592																																					p.M692fs		Atlas-INDEL	.											.	.	.	.	0			c.2075delT						.						109.0	116.0	113.0					4																	183609359		1969	4158	6127	SO:0001589	frameshift_variant	55714	exon11			.	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.2076delG	chr4.hg19:g.183609359delG	ENSP00000424226:p.Met692fs	62.0	0.0		49.0	16.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Frame_Shift_Del	DEL	ENST00000511685.1	hg19	CCDS47165.1																																																																																			.	.		0.592	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
MICALL2	79778	hgsc.bcm.edu	37	7	1487299	1487299	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr7:1487299delG	ENST00000297508.7	-	4	612	c.437delC	c.(436-438)ccafs	p.P146fs	MICALL2_ENST00000405088.4_Intron	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	146	Forms an intramolecular interaction with the C-terminal coiled coil domain keeping the protein in a closed conformation. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		CTTCCGGGCTGGGGCGGGCGA	0.677																																					p.P146fs		Atlas-INDEL	.											.	MICALL2	63	.	0			c.438delA						.						22.0	23.0	22.0					7																	1487299		2151	4264	6415	SO:0001589	frameshift_variant	79778	exon4			.	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.437delC	chr7.hg19:g.1487299delG	ENSP00000297508:p.Pro146fs	109.0	0.0		157.0	47.0	NM_182924	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Frame_Shift_Del	DEL	ENST00000297508.7	hg19	CCDS5324.1																																																																																			.	.		0.677	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
SPACA4	171169	hgsc.bcm.edu	37	19	49110275	49110275	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:49110275delC	ENST00000321762.1	+	1	276	c.40delC	c.(40-42)cccfs	p.P15fs	FAM83E_ENST00000263266.3_Intron	NM_133498.2	NP_598005.1	Q8TDM5	SACA4_HUMAN	sperm acrosome associated 4	15					cell adhesion (GO:0007155)	anchored component of membrane (GO:0031225)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		GATGGCTCTGCCCCCAGGCAC	0.652																																					p.L13fs		Atlas-INDEL	.											.	SPACA4	9	.	0			c.39delG						.						59.0	53.0	55.0					19																	49110275		2203	4300	6503	SO:0001589	frameshift_variant	171169	exon1			.		CCDS12725.1	19q13.33	2013-10-24			ENSG00000177202	ENSG00000177202			16441	protein-coding gene	gene with protein product		609932					Standard	NM_133498		Approved	SAMP14	uc002pjo.3	Q8TDM5	OTTHUMG00000183316	ENST00000321762.1:c.40delC	chr19.hg19:g.49110275delC	ENSP00000312774:p.Pro15fs	38.0	0.0		41.0	15.0	NM_133498		Frame_Shift_Del	DEL	ENST00000321762.1	hg19	CCDS12725.1																																																																																			.	.		0.652	SPACA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466149.1	NM_133498	
AKAP17A	8227	hgsc.bcm.edu	37	X	1712781	1712781	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:1712781delG	ENST00000313871.3	+	2	622	c.426delG	c.(424-426)ccgfs	p.P142fs	AKAP17A_ENST00000381261.3_Frame_Shift_Del_p.P142fs	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	142					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						AGACCCTGCCGGGGGAGCGGC	0.667																																					p.P142fs		Atlas-INDEL	.											.	AKAP17A	46	.	0			c.425delC						.						113.0	128.0	123.0					X																	1712781		2203	4296	6499	SO:0001589	frameshift_variant	8227	exon2			.	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.426delG	chrX.hg19:g.1712781delG	ENSP00000324827:p.Pro142fs	161.0	0.0		167.0	26.0	NM_005088	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Frame_Shift_Del	DEL	ENST00000313871.3	hg19	CCDS14116.1																																																																																			.	.		0.667	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
DEPDC1	55635	hgsc.bcm.edu	37	1	68948426	68948427	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:68948426_68948427insT	ENST00000456315.2	-	8	1178_1179	c.1064_1065insA	c.(1063-1065)aacfs	p.N355fs	RP4-694A7.2_ENST00000425820.1_RNA|DEPDC1_ENST00000370966.5_Intron	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	355					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		ATTCTTCTTTGTTTTTTTCTCT	0.342																																					p.N355fs		Atlas-INDEL	.											.	DEPDC1	102	.	0			c.1065_1066insA						.																																			SO:0001589	frameshift_variant	55635	exon8			.	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.1065dupA	chr1.hg19:g.68948433_68948433dupT	ENSP00000412292:p.Asn355fs	148.0	0.0		77.0	21.0	NM_001114120	A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Frame_Shift_Ins	INS	ENST00000456315.2	hg19	CCDS44159.1																																																																																			.	.		0.342	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	NM_017779	
C11orf54	28970	hgsc.bcm.edu	37	11	93486913	93486914	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:93486913_93486914insA	ENST00000331239.4	+	4	399_400	c.220_221insA	c.(220-222)caafs	p.Q74fs	C11orf54_ENST00000540113.1_Frame_Shift_Ins_p.Q55fs|C11orf54_ENST00000528099.1_Frame_Shift_Ins_p.Q74fs|C11orf54_ENST00000354421.3_Frame_Shift_Ins_p.Q74fs|C11orf54_ENST00000528288.1_Frame_Shift_Ins_p.Q74fs			Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	74					metabolic process (GO:0008152)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TCTTGTAAACCAAAAAAAAGTA	0.356																																					p.Q74fs		Atlas-INDEL	.											.	C11orf54	23	.	0			c.220_221insA						.																																			SO:0001589	frameshift_variant	28970	exon4			.	AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919			30204	protein-coding gene	gene with protein product		615810				16522806	Standard	NM_014039		Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.228dupA	chr11.hg19:g.93486921_93486921dupA	ENSP00000331209:p.Gln74fs	100.0	0.0		103.0	30.0	NM_014039	A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	Frame_Shift_Ins	INS	ENST00000331239.4	hg19																																																																																				.	.		0.356	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394671.1	NM_014039	
USP44	84101	hgsc.bcm.edu	37	12	95927482	95927483	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:95927482_95927483insT	ENST00000258499.3	-	2	838_839	c.550_551insA	c.(550-552)atafs	p.I184fs	USP44_ENST00000537435.2_Frame_Shift_Ins_p.I184fs|USP44_ENST00000552440.1_Frame_Shift_Ins_p.I184fs|USP44_ENST00000393091.2_Frame_Shift_Ins_p.I184fs	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	184					mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						TTTTACTACTATTTTTTCCTGA	0.356																																					p.I184fs		Atlas-INDEL	.											.	USP44	83	.	0			c.551_552insA						.																																			SO:0001589	frameshift_variant	84101	exon2			.	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.551dupA	chr12.hg19:g.95927488_95927488dupT	ENSP00000258499:p.Ile184fs	89.0	0.0		92.0	41.0	NM_032147	B2RDW3	Frame_Shift_Ins	INS	ENST00000258499.3	hg19	CCDS9053.1																																																																																			.	.		0.356	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	
PABPC1L2B	645974	hgsc.bcm.edu	37	X	72223807	72223809	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	TCT	TCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:72223807_72223809delTCT	ENST00000373521.2	+	1	456_458	c.326_328delTCT	c.(325-330)atcttc>atc	p.F110del	PABPC1L2B_ENST00000538388.1_In_Frame_Del_p.F110del|RP11-493K23.1_ENST00000416989.2_RNA	NM_001042506.1	NP_001035971.1	Q5JQF8	PAP1M_HUMAN	poly(A) binding protein, cytoplasmic 1-like 2B	110	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)					Renal(35;0.156)					CTGTACAACATCTTCTCGGCGTT	0.581																																					p.109_109del		Atlas-INDEL	.											.	.	.	.	0			c.325_327del						.																																			SO:0001651	inframe_deletion	645974	exon1			.		CCDS43972.1	Xq13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000184388	ENSG00000184388		"""RNA binding motif (RRM) containing"""	31852	protein-coding gene	gene with protein product			"""RNA binding motif protein 32B"""	RBM32B			Standard	NM_001042506		Approved		uc004ebf.3	Q5JQF8	OTTHUMG00000021823	ENST00000373521.2:c.326_328delTCT	chrX.hg19:g.72223810_72223812delTCT	ENSP00000362621:p.Phe110del	1522.0	0.0		1742.0	173.0	NM_001042506	B2RMV9|Q8IVU8	In_Frame_Del	DEL	ENST00000373521.2	hg19	CCDS43972.1																																																																																			.	.		0.581	PABPC1L2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057221.1	NM_001042506	
KLK6	5653	hgsc.bcm.edu	37	19	51462437	51462437	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:51462437delT	ENST00000376851.3	-	6	1157	c.718delA	c.(718-720)accfs	p.T240fs	KLK6_ENST00000376853.4_Frame_Shift_Del_p.K111fs|KLK6_ENST00000310157.2_Frame_Shift_Del_p.T240fs|KLK6_ENST00000456750.2_Frame_Shift_Del_p.T133fs|CTB-147C22.8_ENST00000601506.1_RNA|CTB-147C22.8_ENST00000594939.1_RNA|KLK6_ENST00000391808.1_Frame_Shift_Del_p.T133fs|KLK6_ENST00000594641.1_Frame_Shift_Del_p.T240fs	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	240	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		GCCTGAATGGTTTTTTGGATC	0.547																																					p.T240fs		Atlas-INDEL	.											.	KLK6	35	.	0			c.719delC						.						485.0	454.0	465.0					19																	51462437		2203	4300	6503	SO:0001589	frameshift_variant	5653	exon6			.	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.718delA	chr19.hg19:g.51462437delT	ENSP00000366047:p.Thr240fs	155.0	0.0		145.0	30.0	NM_001012964	A6NJA1|A8MW09|Q6H301	Frame_Shift_Del	DEL	ENST00000376851.3	hg19	CCDS12811.1																																																																																			.	.		0.547	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
TRIOBP	11078	hgsc.bcm.edu	37	22	38130772	38130773	+	Frame_Shift_Ins	INS	-	-	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:38130772_38130773insG	ENST00000406386.3	+	9	4684_4685	c.4429_4430insG	c.(4429-4431)tggfs	p.W1477fs		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1477					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGAGGGAGCATGGGGGGGCACT	0.663																																					p.W1477fs		Atlas-INDEL	.											.	TRIOBP	262	.	0			c.4429_4430insG						.			14,3234		0,14,1610						-2.3	0.0			11	12,7306		2,8,3649	no	frameshift	TRIOBP	NM_001039141.2		2,22,5259	A1A1,A1R,RR		0.164,0.431,0.2461				26,10540				SO:0001589	frameshift_variant	11078	exon9			.	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4436dupG	chr22.hg19:g.38130779_38130779dupG	ENSP00000384312:p.Trp1477fs	99.0	0.0		89.0	13.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Ins	INS	ENST00000406386.3	hg19	CCDS43015.1																																																																																			.	.		0.663	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
NDC80	10403	hgsc.bcm.edu	37	18	2599168	2599169	+	Splice_Site	DEL	TA	TA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr18:2599168_2599169delTA	ENST00000261597.4	+	12	1554_1555	c.1372_1373delTA	c.(1372-1374)tat>t	p.Y458fs		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	458	Interaction with NEK2 and ZWINT.|Interaction with PSMC2 and SMC1A.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						GGCTCAAGTTTATGTAAGTAAT	0.351																																					p.457_458del		Atlas-INDEL	.											.	NDC80	62	.	0			c.1371_1372del						.																																			SO:0001630	splice_region_variant	10403	exon12			.	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1374+1TA>-	chr18.hg19:g.2599168_2599169delTA		59.0	0.0		63.0	13.0	NM_006101	Q6PJX2	Frame_Shift_Del	DEL	ENST00000261597.4	hg19	CCDS11827.1																																																																																			.	.		0.351	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	Frame_Shift_Del
PKN3	29941	hgsc.bcm.edu	37	9	131480648	131480650	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:131480648_131480650delAGA	ENST00000291906.4	+	17	2423_2425	c.2030_2032delAGA	c.(2029-2034)gagaag>gag	p.K679del	ZDHHC12_ENST00000467312.1_5'Flank|PKN3_ENST00000485301.1_3'UTR	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	679	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TTCTTACACGAGAAGAAGATCAT	0.591																																					p.677_677del		Atlas-INDEL	.											.	PKN3	62	.	0			c.2029_2031del						.																																			SO:0001651	inframe_deletion	29941	exon17			.	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.2030_2032delAGA	chr9.hg19:g.131480654_131480656delAGA	ENSP00000291906:p.Lys679del	100.0	0.0		71.0	11.0	NM_013355	Q9UM03	In_Frame_Del	DEL	ENST00000291906.4	hg19	CCDS6908.1																																																																																			.	.		0.591	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
CDC14A	8556	hgsc.bcm.edu	37	1	100889837	100889837	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:100889837delC	ENST00000336454.3	+	5	724	c.369delC	c.(367-369)aacfs	p.N123fs	CDC14A_ENST00000370125.2_Frame_Shift_Del_p.N123fs|CDC14A_ENST00000542213.1_Frame_Shift_Del_p.N65fs|CDC14A_ENST00000544534.1_Frame_Shift_Del_p.N123fs|CDC14A_ENST00000370124.3_Frame_Shift_Del_p.N123fs|CDC14A_ENST00000469387.1_3'UTR|CDC14A_ENST00000361544.6_Frame_Shift_Del_p.N123fs	NM_003672.3	NP_003663.2	Q9UNH5	CC14A_HUMAN	cell division cycle 14A	123	A.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(6)|large_intestine(6)|lung(10)|skin(2)|urinary_tract(1)	31		all_epithelial(167;3.71e-06)|all_lung(203;0.00097)|Lung NSC(277;0.001)		Epithelial(280;0.0676)|all cancers(265;0.127)|COAD - Colon adenocarcinoma(174;0.201)|Lung(183;0.227)|Colorectal(144;0.241)		CTGGCTCAAACCCCCCCTATC	0.403																																					p.N123fs		Atlas-INDEL	.											.,1	CDC14A	65	.	0			c.368delA						.						95.0	99.0	98.0					1																	100889837		2203	4300	6503	SO:0001589	frameshift_variant	8556	exon5			.	AF000367	CCDS769.1, CCDS770.1, CCDS771.1	1p21	2013-01-17	2013-01-17		ENSG00000079335	ENSG00000079335		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1718	protein-coding gene	gene with protein product		603504	"""CDC10 (cell division cycle 10, S. cerevisiae, homolog)"", ""CDC14 cell division cycle 14 homolog A (S. cerevisiae)"""			9367992, 10409437	Standard	NM_033312		Approved	Cdc14A1, Cdc14A2, cdc14	uc001dtf.2	Q9UNH5	OTTHUMG00000010987	ENST00000336454.3:c.369delC	chr1.hg19:g.100889837delC	ENSP00000336739:p.Asn123fs	119.0	0.0		105.0	40.0	NM_033313	A6MA65|B1AQ14|B1AQ15|O43171|O60727|O60728|Q52LH9|Q8IXX0	Frame_Shift_Del	DEL	ENST00000336454.3	hg19	CCDS769.1																																																																																			.	.		0.403	CDC14A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000030220.1	NM_033312	
AIM2	9447	hgsc.bcm.edu	37	1	159033322	159033322	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:159033322delT	ENST00000368130.4	-	5	1247	c.959delA	c.(958-960)aatfs	p.N320fs	AIM2_ENST00000411768.1_5'Flank	NM_004833.1	NP_004824.1	O14862	AIM2_HUMAN	absent in melanoma 2	320	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to drug (GO:0035690)|cellular response to interferon-beta (GO:0035458)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein oligomerization (GO:0032461)|pyroptosis (GO:0070269)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)			breast(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(1)	16	all_hematologic(112;0.0429)					TTTTTCTCCATTTTTTGACAG	0.408																																					p.N320fs		Atlas-INDEL	.											.	AIM2	70	.	0			c.960delT						.						242.0	228.0	233.0					1																	159033322		2203	4300	6503	SO:0001589	frameshift_variant	9447	exon5			.	AF024714	CCDS1181.1	1q22	2008-07-18			ENSG00000163568	ENSG00000163568			357	protein-coding gene	gene with protein product		604578				9242382	Standard	NM_004833		Approved	PYHIN4	uc001ftj.1	O14862	OTTHUMG00000037183	ENST00000368130.4:c.959delA	chr1.hg19:g.159033322delT	ENSP00000357112:p.Asn320fs	92.0	0.0		115.0	37.0	NM_004833	A8K7M7|Q5T3V9|Q96FG9	Frame_Shift_Del	DEL	ENST00000368130.4	hg19	CCDS1181.1																																																																																			.	.		0.408	AIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090341.1	NM_004833	
USH2A	7399	hgsc.bcm.edu	37	1	216062118	216062118	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:216062118delC	ENST00000307340.3	-	41	8259	c.7873delG	c.(7873-7875)gaafs	p.E2625fs	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Frame_Shift_Del_p.E2625fs	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2625	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGGATCCCTTCCGGTGCCCCT	0.507										HNSCC(13;0.011)																											p.E2625fs		Atlas-INDEL	.											.	USH2A	1168	.	0			c.7874delA						.						76.0	79.0	78.0					1																	216062118		2203	4300	6503	SO:0001589	frameshift_variant	7399	exon41			.	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7873delG	chr1.hg19:g.216062118delC	ENSP00000305941:p.Glu2625fs	114.0	0.0		170.0	27.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Frame_Shift_Del	DEL	ENST00000307340.3	hg19	CCDS31025.1																																																																																			.	.		0.507	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
CDC42EP1	11135	hgsc.bcm.edu	37	22	37962638	37962639	+	Frame_Shift_Ins	INS	-	-	C	rs150186371		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:37962638_37962639insC	ENST00000249014.4	+	2	702_703	c.282_283insC	c.(283-285)cccfs	p.P95fs		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	95					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					GGGTGGGGGCGCCCCCCCGGAG	0.693																																					p.A94fs		Atlas-INDEL	.											.,1	CDC42EP1	53	.	0			c.282_283insC						.			16,4230		0,16,2107						-9.9	0.0			29	14,8214		0,14,4100	no	frameshift	CDC42EP1	NM_152243.2		0,30,6207	A1A1,A1R,RR		0.1702,0.3768,0.2405				30,12444				SO:0001589	frameshift_variant	11135	exon2			.	M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.289dupC	chr22.hg19:g.37962645_37962645dupC	ENSP00000249014:p.Pro95fs	194.0	0.0		166.0	42.0	NM_152243	A8K825|Q96GN1	Frame_Shift_Ins	INS	ENST00000249014.4	hg19	CCDS13949.1																																																																																			.	.		0.693	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318993.1	NM_152243	
BEX4	56271	hgsc.bcm.edu	37	X	102471235	102471236	+	Frame_Shift_Ins	INS	-	-	G	rs62623366		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chrX:102471235_102471236insG	ENST00000372695.5	+	3	389_390	c.154_155insG	c.(154-156)cggfs	p.R52fs	BEX4_ENST00000372691.3_Frame_Shift_Ins_p.R52fs	NM_001080425.3	NP_001073894.1	Q9NWD9	BEX4_HUMAN	brain expressed, X-linked 4	52						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	9						AAATATCAGGCGGGGGCGAGTT	0.52																																					p.R52fs		Atlas-INDEL	.											.	BEX4	15	.	0			c.154_155insG						.																																			SO:0001589	frameshift_variant	56271	exon3			.	AL035494	CCDS35355.1	Xq22.1-q22.3	2014-03-21	2008-11-04	2007-08-24	ENSG00000102409	ENSG00000102409			25475	protein-coding gene	gene with protein product		300692	"""brain expressed X-linked-like 1"", ""BEX family member 4"""	BEXL1		15958283, 16221301	Standard	NM_001080425		Approved	FLJ10097	uc004ejw.4	Q9NWD9	OTTHUMG00000022091	ENST00000372695.5:c.159dupG	chrX.hg19:g.102471240_102471240dupG	ENSP00000361780:p.Arg52fs	349.0	0.0		396.0	52.0	NM_001080425		Frame_Shift_Ins	INS	ENST00000372695.5	hg19	CCDS35355.1																																																																																			.	.		0.520	BEX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057694.1	XM_043653	
ADAMTSL1	92949	hgsc.bcm.edu	37	9	18777687	18777687	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:18777687delG	ENST00000380548.4	+	19	3799	c.3460delG	c.(3460-3462)gggfs	p.G1156fs		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1156						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CGGGGACGCCGGGGGAGGCTC	0.667																																					p.A1153fs		Atlas-INDEL	.											.	ADAMTSL1	306	.	0			c.3459delC						.						23.0	28.0	27.0					9																	18777687		2103	4205	6308	SO:0001589	frameshift_variant	92949	exon19			.	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3460delG	chr9.hg19:g.18777687delG	ENSP00000369921:p.Gly1156fs	89.0	0.0		69.0	18.0	NM_001040272	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Frame_Shift_Del	DEL	ENST00000380548.4	hg19	CCDS47954.1																																																																																			.	.		0.667	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
C11orf57	55216	hgsc.bcm.edu	37	11	111953315	111953316	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:111953315_111953316insA	ENST00000280352.9	+	6	1134_1135	c.498_499insA	c.(499-501)aaafs	p.K167fs	C11orf57_ENST00000420986.2_Frame_Shift_Ins_p.K167fs|TIMM8B_ENST00000507614.1_5'Flank|C11orf57_ENST00000532163.1_Frame_Shift_Ins_p.K139fs|C11orf57_ENST00000393047.3_Frame_Shift_Ins_p.K168fs	NM_001082970.1|NM_018195.3	NP_001076439.1|NP_060665.3	Q6ZUT1	CK057_HUMAN	chromosome 11 open reading frame 57	167	Lys-rich.									autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12		all_cancers(61;9.8e-15)|all_epithelial(67;6.57e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;3.6e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;7.01e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0521)		AAAGGTCACACAAAAAACAGAA	0.411																																					p.H167fs		Atlas-INDEL	.											.,1	C11orf57	41	.	0			c.501_502insA						.																																			SO:0001589	frameshift_variant	55216	exon6			.	BX538107	CCDS8356.2, CCDS41715.1, CCDS73383.1	11q23.1	2006-03-09			ENSG00000150776	ENSG00000150776			25569	protein-coding gene	gene with protein product						12477932	Standard	NM_001082970		Approved	FLJ10726	uc001pmw.4	Q6ZUT1	OTTHUMG00000150213	ENST00000280352.9:c.504dupA	chr11.hg19:g.111953321_111953321dupA	ENSP00000339076:p.Lys167fs	309.0	0.0		361.0	86.0	NM_001082969	Q5RL41|Q6IN53|Q7Z357|Q8N2T3	Frame_Shift_Ins	INS	ENST00000280352.9	hg19	CCDS41715.1																																																																																			.	.		0.411	C11orf57-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316852.1	NM_018195	
FGFR2	2263	hgsc.bcm.edu	37	10	123310909	123310929	+	In_Frame_Del	DEL	GTTGGCCGCAGGCACAGCATG	GTTGGCCGCAGGCACAGCATG	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	GTTGGCCGCAGGCACAGCATG	GTTGGCCGCAGGCACAGCATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:123310909_123310929delGTTGGCCGCAGGCACAGCATG	ENST00000358487.5	-	5	771_791	c.499_519delCATGCTGTGCCTGCGGCCAAC	c.(499-519)catgctgtgcctgcggccaacdel	p.HAVPAAN167del	FGFR2_ENST00000369056.1_In_Frame_Del_p.HAVPAAN167del|FGFR2_ENST00000457416.2_In_Frame_Del_p.HAVPAAN167del|FGFR2_ENST00000359354.2_In_Frame_Del_p.HAVPAAN167del|FGFR2_ENST00000357555.5_In_Frame_Del_p.HAVPAAN78del|FGFR2_ENST00000369059.1_In_Frame_Del_p.HAVPAAN52del|FGFR2_ENST00000346997.2_In_Frame_Del_p.HAVPAAN167del|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000356226.4_In_Frame_Del_p.HAVPAAN52del|FGFR2_ENST00000351936.6_In_Frame_Del_p.HAVPAAN167del|FGFR2_ENST00000369060.4_In_Frame_Del_p.HAVPAAN167del|FGFR2_ENST00000360144.3_In_Frame_Del_p.HAVPAAN78del|FGFR2_ENST00000369061.4_In_Frame_Del_p.HAVPAAN167del	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	167	Heparin-binding.|Ig-like C2-type 2.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.A172A(1)|p.A83A(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	ACTTGACAGTGTTGGCCGCAGGCACAGCATGGAGCCGCTTT	0.525		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.167_174del		Atlas-INDEL	.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	FGFR2	758	.	2	Substitution - coding silent(2)	large_intestine(2)	c.500_520del	GRCh37	CP025146	FGFR2	X		.																																			SO:0001651	inframe_deletion	2263	exon5	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.499_519delCATGCTGTGCCTGCGGCCAAC	chr10.hg19:g.123310909_123310929delGTTGGCCGCAGGCACAGCATG	ENSP00000351276:p.His167_Asn173del	98.0	0.0		57.0	12.0	NM_000141	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	In_Frame_Del	DEL	ENST00000358487.5	hg19	CCDS31298.1																																																																																			.	.		0.525	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
AHCTF1	25909	hgsc.bcm.edu	37	1	247024553	247024553	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:247024553delT	ENST00000391829.2	-	29	3903	c.3780delA	c.(3778-3780)aaafs	p.K1260fs	AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Frame_Shift_Del_p.K1269fs|AHCTF1_ENST00000366508.1_Frame_Shift_Del_p.K1295fs			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1260	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GAACTGCACATTTTTTAGGTG	0.358																																					p.C1270fs	Colon(145;197 1800 4745 15099 26333)	Atlas-INDEL	.											.	AHCTF1	187	.	0			c.3808delT						.						30.0	29.0	29.0					1																	247024553		2203	4293	6496	SO:0001589	frameshift_variant	25909	exon29			.		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3780delA	chr1.hg19:g.247024553delT	ENSP00000375705:p.Lys1260fs	211.0	0.0		287.0	30.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Frame_Shift_Del	DEL	ENST00000391829.2	hg19																																																																																				.	.		0.358	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
HSF1	3297	hgsc.bcm.edu	37	8	145512978	145512979	+	5'Flank	INS	-	-	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:145512978_145512979insG	ENST00000528838.1	+	0	0				BOP1_ENST00000307404.5_Frame_Shift_Ins_p.L36fs|BOP1_ENST00000529231.1_5'UTR	NM_005526.2	NP_005517.1	Q00613	HSF1_HUMAN	heat shock transcription factor 1						cellular response to heat (GO:0034605)|defense response (GO:0006952)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|female meiotic division (GO:0007143)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)|response to lipopolysaccharide (GO:0032496)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pronucleus (GO:0045120)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)|urinary_tract(2)	11	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.12e-39)|all cancers(56;9.11e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0547)|Colorectal(110;0.055)			GGTGCAGAGGAGGGGGGGCTGC	0.639																																					p.L36fs		Atlas-INDEL	.											.	BOP1	7	.	0			c.107_108insC						.																																			SO:0001631	upstream_gene_variant	23246	exon2			.	M64673	CCDS6419.1	8q24.3	2014-04-10			ENSG00000185122	ENSG00000185122			5224	protein-coding gene	gene with protein product		140580				1871105	Standard	NM_005526		Approved	HSTF1	uc003zbt.4	Q00613	OTTHUMG00000174604		chr8.hg19:g.145512985_145512985dupG	Exception_encountered	56.0	0.0		107.0	18.0	NM_015201	A8K4L0|A8MW26|Q53XT4	Frame_Shift_Ins	INS	ENST00000528838.1	hg19	CCDS6419.1																																																																																			.	.		0.639	HSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382053.1	NM_005526	
NES	10763	hgsc.bcm.edu	37	1	156642804	156642804	+	Frame_Shift_Del	DEL	G	G	-	rs372020167		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:156642804delG	ENST00000368223.3	-	4	1308	c.1176delC	c.(1174-1176)cccfs	p.P392fs		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	392	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTGAGGTGTGGGGGGGATGG	0.597																																					p.T393fs		Atlas-INDEL	.											.	NES	196	.	0			c.1177delA						.						74.0	93.0	86.0					1																	156642804		2203	4299	6502	SO:0001589	frameshift_variant	10763	exon4			.	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1176delC	chr1.hg19:g.156642804delG	ENSP00000357206:p.Pro392fs	76.0	0.0		122.0	37.0	NM_006617	O00552|Q3LIF5|Q5SYZ6	Frame_Shift_Del	DEL	ENST00000368223.3	hg19	CCDS1151.1																																																																																			.	.		0.597	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
MPHOSPH10	10199	hgsc.bcm.edu	37	2	71377061	71377061	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:71377061delA	ENST00000244230.2	+	11	2314	c.1962delA	c.(1960-1962)gtafs	p.V654fs		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	654					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						AAGATCAAGTAAAAATGCAAA	0.289																																					p.V654fs		Atlas-INDEL	.											.	MPHOSPH10	81	.	0			c.1961delT						.						85.0	87.0	87.0					2																	71377061		2203	4298	6501	SO:0001589	frameshift_variant	10199	exon11			.	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1962delA	chr2.hg19:g.71377061delA	ENSP00000244230:p.Val654fs	458.0	0.0		381.0	119.0	NM_005791	A0AVJ8	Frame_Shift_Del	DEL	ENST00000244230.2	hg19	CCDS1916.1																																																																																			.	.		0.289	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
ZNF292	23036	hgsc.bcm.edu	37	6	87966812	87966812	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:87966812delT	ENST00000369577.3	+	8	3508	c.3465delT	c.(3463-3465)tatfs	p.Y1155fs	ZNF292_ENST00000339907.4_Frame_Shift_Del_p.Y1150fs	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1155						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AGTTTGTTTATTTTTTGCCAT	0.408																																					p.Y1155fs		Atlas-INDEL	.											.	ZNF292	479	.	0			c.3464delA						.						54.0	51.0	52.0					6																	87966812		1912	4110	6022	SO:0001589	frameshift_variant	23036	exon8			.	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.3465delT	chr6.hg19:g.87966812delT	ENSP00000358590:p.Tyr1155fs	59.0	0.0		68.0	34.0	NM_015021	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Frame_Shift_Del	DEL	ENST00000369577.3	hg19	CCDS47457.1																																																																																			.	.		0.408	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
STAG1	10274	hgsc.bcm.edu	37	3	136240141	136240143	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	TCA	TCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:136240141_136240143delTCA	ENST00000383202.2	-	7	844_846	c.588_590delTGA	c.(586-591)gatgag>gag	p.D196del	STAG1_ENST00000236698.5_In_Frame_Del_p.D196del|STAG1_ENST00000480733.1_In_Frame_Del_p.D196del|STAG1_ENST00000434713.2_De_novo_Start_InFrame	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	196					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CATCATATACTCATCATAAATTA	0.404																																					p.197_197del		Atlas-INDEL	.											.	STAG1	135	.	0			c.589_591del						.																																			SO:0001651	inframe_deletion	10274	exon7			.	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.588_590delTGA	chr3.hg19:g.136240144_136240146delTCA	ENSP00000372689:p.Asp196del	272.0	0.0		247.0	30.0	NM_005862	O00539|Q6P275	In_Frame_Del	DEL	ENST00000383202.2	hg19	CCDS3090.1																																																																																			.	.		0.404	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
OBSL1	23363	hgsc.bcm.edu	37	2	220435528	220435528	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:220435528delC	ENST00000404537.1	-	1	483	c.427delG	c.(427-429)gcgfs	p.A143fs	INHA_ENST00000489456.1_Intron|OBSL1_ENST00000373873.4_Frame_Shift_Del_p.A143fs|OBSL1_ENST00000373876.1_Frame_Shift_Del_p.A143fs|OBSL1_ENST00000265318.4_Frame_Shift_Del_p.A143fs|OBSL1_ENST00000491370.1_Intron|OBSL1_ENST00000289656.3_Intron|INHA_ENST00000243786.2_5'Flank|OBSL1_ENST00000603926.1_Frame_Shift_Del_p.A143fs	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	143	Ig-like 2.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		ACCACCTCCGCCCCCCGCAGC	0.746																																					p.A143fs		Atlas-INDEL	.											.	OBSL1	120	.	0			c.428delC						.						3.0	4.0	4.0					2																	220435528		1598	3556	5154	SO:0001589	frameshift_variant	23363	exon1			.	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.427delG	chr2.hg19:g.220435528delC	ENSP00000385636:p.Ala143fs	354.0	0.0		402.0	61.0	NM_001173431	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Frame_Shift_Del	DEL	ENST00000404537.1	hg19	CCDS46520.1																																																																																			.	.		0.746	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
IARS2	55699	hgsc.bcm.edu	37	1	220273982	220273985	+	Frame_Shift_Del	DEL	AGAA	AGAA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	AGAA	AGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:220273982_220273985delAGAA	ENST00000302637.5	+	3	645_648	c.541_544delAGAA	c.(541-546)agaaagfs	p.RK181fs	IARS2_ENST00000366922.1_Frame_Shift_Del_p.RK109fs	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	181					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	TATGGAAATTAGAAAGAAAGGTAA	0.353																																					p.180_181del		Atlas-INDEL	.											.	IARS2	106	.	0			c.540_543del						.																																			SO:0001589	frameshift_variant	55699	exon3			.	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.541_544delAGAA	chr1.hg19:g.220273986_220273989delAGAA	ENSP00000303279:p.Arg181fs	224.0	0.0		329.0	24.0	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Frame_Shift_Del	DEL	ENST00000302637.5	hg19	CCDS1523.1																																																																																			.	.		0.353	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
OOSP2	219990	hgsc.bcm.edu	37	11	59814440	59814440	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:59814440delT	ENST00000278855.2	+	4	556	c.371delT	c.(370-372)gttfs	p.V124fs		NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		124						extracellular region (GO:0005576)				breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						CTTACACCAGTTTCTACTGAG	0.368																																					p.V124fs		Atlas-INDEL	.											.	PLAC1L	36	.	0			c.370delG						.						166.0	160.0	162.0					11																	59814440		2201	4295	6496	SO:0001589	frameshift_variant	219990	exon4			.																												ENST00000278855.2:c.371delT	chr11.hg19:g.59814440delT	ENSP00000278855:p.Val124fs	110.0	0.0		138.0	37.0	NM_173801	E9PJA4|Q8N9U6	Frame_Shift_Del	DEL	ENST00000278855.2	hg19	CCDS7979.1																																																																																			.	.		0.368	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394411.1		
ZNF480	147657	hgsc.bcm.edu	37	19	52825303	52825303	+	Frame_Shift_Del	DEL	T	T	-	rs375581081		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr19:52825303delT	ENST00000595962.1	+	5	866	c.800delT	c.(799-801)gttfs	p.V267fs	ZNF480_ENST00000335090.6_Frame_Shift_Del_p.V190fs|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000334564.7_Frame_Shift_Del_p.V224fs|ZNF480_ENST00000490272.1_3'UTR	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	267					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		TGTGGCAAGGTTTTTAGTTAC	0.363																																					p.V267fs		Atlas-INDEL	.											.	ZNF480	123	.	0			c.799delG						.						34.0	36.0	35.0					19																	52825303		2200	4299	6499	SO:0001589	frameshift_variant	147657	exon5			.	AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.800delT	chr19.hg19:g.52825303delT	ENSP00000471754:p.Val267fs	114.0	0.0		114.0	11.0	NM_144684	Q5JPG9|Q6P0Q4|Q8N1M5	Frame_Shift_Del	DEL	ENST00000595962.1	hg19	CCDS12850.2																																																																																			.	.		0.363	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349001.3	NM_144684	
LRP1	4035	hgsc.bcm.edu	37	12	57605934	57605934	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:57605934delG	ENST00000243077.3	+	88	13850	c.13384delG	c.(13384-13386)gggfs	p.G4462fs		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	4462	Interaction with MAFB. {ECO:0000250}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GATGACCAACGGGGCCATGAA	0.547																																					p.N4461fs		Atlas-INDEL	.											.	LRP1	428	.	0			c.13383delC						.						87.0	86.0	86.0					12																	57605934		2203	4300	6503	SO:0001589	frameshift_variant	4035	exon88			.	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.13384delG	chr12.hg19:g.57605934delG	ENSP00000243077:p.Gly4462fs	181.0	0.0		152.0	17.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Frame_Shift_Del	DEL	ENST00000243077.3	hg19	CCDS8932.1																																																																																			.	.		0.547	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
C9orf129	445577	hgsc.bcm.edu	37	9	96080811	96080812	+	Frame_Shift_Ins	INS	-	-	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr9:96080811_96080812insC	ENST00000375419.1	-	5	822_823	c.459_460insG	c.(457-462)gggcatfs	p.H154fs	WNK2_ENST00000471076.1_Intron|WNK2_ENST00000356055.3_Intron|WNK2_ENST00000349097.3_Intron|WNK2_ENST00000395477.2_Intron|WNK2_ENST00000395475.2_Intron	NM_001098808.1	NP_001092278.1	Q5T035	CI129_HUMAN	chromosome 9 open reading frame 129	154										endometrium(2)|large_intestine(1)|lung(1)|ovary(2)	6						GAGCAGACATGCCCCCCATGCC	0.599																																					p.H154fs		Atlas-INDEL	.											.	C9orf129	18	.	0			c.460_461insG						.																																			SO:0001589	frameshift_variant	445577	exon5			.		CCDS43850.1	9q22.31	2012-04-02			ENSG00000204352	ENSG00000204352			31116	protein-coding gene	gene with protein product							Standard	NM_001098808		Approved	bA165J3.3	uc010mre.3	Q5T035	OTTHUMG00000020248	ENST00000375419.1:c.460dupG	chr9.hg19:g.96080817_96080817dupC	ENSP00000364568:p.His154fs	88.0	0.0		124.0	20.0	NM_001098808		Frame_Shift_Ins	INS	ENST00000375419.1	hg19	CCDS43850.1																																																																																			.	.		0.599	C9orf129-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053147.1	NM_001098808	
GAB2	9846	hgsc.bcm.edu	37	11	77934490	77934490	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr11:77934490delG	ENST00000361507.4	-	6	1620	c.1535delC	c.(1534-1536)cctfs	p.P512fs	GAB2_ENST00000340149.2_Frame_Shift_Del_p.P474fs	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	512					cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GCGGTTGACAGGGGGTGGCTG	0.552																																					p.P512fs		Atlas-INDEL	.											.	GAB2	63	.	0			c.1536delT						.						155.0	144.0	148.0					11																	77934490		2200	4292	6492	SO:0001589	frameshift_variant	9846	exon6			.	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.1535delC	chr11.hg19:g.77934490delG	ENSP00000354952:p.Pro512fs	154.0	0.0		169.0	22.0	NM_080491	A2RRM2|A6NEW9|A7MD36|O60317	Frame_Shift_Del	DEL	ENST00000361507.4	hg19	CCDS8259.1																																																																																			.	.		0.552	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491	
CLK1	1195	hgsc.bcm.edu	37	2	201722550	201722550	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:201722550delA	ENST00000321356.4	-	7	858	c.723delT	c.(721-723)tttfs	p.F241fs	CLK1_ENST00000409769.2_Frame_Shift_Del_p.F64fs|CLK1_ENST00000434813.2_Frame_Shift_Del_p.F283fs	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	241	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CCAATAGTTCAAAAACAATGC	0.363																																					p.E284fs		Atlas-INDEL	.											.	CLK1	103	.	0			c.850delG						.						105.0	100.0	102.0					2																	201722550		2203	4300	6503	SO:0001589	frameshift_variant	1195	exon7			.	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.723delT	chr2.hg19:g.201722550delA	ENSP00000326830:p.Phe241fs	146.0	0.0		119.0	24.0	NM_001162407	B4DFW7|Q0P694|Q8N5V8	Frame_Shift_Del	DEL	ENST00000321356.4	hg19	CCDS2331.1																																																																																			.	.		0.363	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		
CAPN7	23473	hgsc.bcm.edu	37	3	15282001	15282001	+	Frame_Shift_Del	DEL	A	A	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr3:15282001delA	ENST00000253693.2	+	13	1682	c.1429delA	c.(1429-1431)aaafs	p.K477fs		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	477	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						TATCCAGTTGAAAAATCCTTG	0.333																																					p.L476fs		Atlas-INDEL	.											.	CAPN7	63	.	0			c.1428delG						.						59.0	63.0	62.0					3																	15282001		2201	4299	6500	SO:0001589	frameshift_variant	23473	exon13			.	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.1429delA	chr3.hg19:g.15282001delA	ENSP00000253693:p.Lys477fs	93.0	0.0		139.0	10.0	NM_014296		Frame_Shift_Del	DEL	ENST00000253693.2	hg19	CCDS2624.1																																																																																			.	.		0.333	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252105.2	NM_014296	
LAMA1	284217	hgsc.bcm.edu	37	18	6942222	6942222	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr18:6942222delT	ENST00000389658.3	-	63	9177	c.9084delA	c.(9082-9084)aaafs	p.K3028fs		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	3028	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TGCGCAGGCATTTTTGCTTCA	0.468																																					p.C3029fs		Atlas-INDEL	.											.	LAMA1	458	.	0			c.9085delT						.						46.0	48.0	48.0					18																	6942222		2203	4300	6503	SO:0001589	frameshift_variant	284217	exon63			.	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.9084delA	chr18.hg19:g.6942222delT	ENSP00000374309:p.Lys3028fs	42.0	0.0		55.0	10.0	NM_005559		Frame_Shift_Del	DEL	ENST00000389658.3	hg19	CCDS32787.1																																																																																			.	.		0.468	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ELMSAN1	91748	hgsc.bcm.edu	37	14	74205773	74205773	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr14:74205773delG	ENST00000286523.5	-	2	1721	c.939delC	c.(937-939)cccfs	p.P313fs	ELMSAN1_ENST00000486739.1_5'Flank|ELMSAN1_ENST00000394071.2_Frame_Shift_Del_p.P313fs	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	313	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TATCTGGGTTGGGGGGGAAGG	0.662																																					p.N314fs		Atlas-INDEL	.											.	.	.	.	0			c.940delA						.						21.0	22.0	22.0					14																	74205773		2203	4299	6502	SO:0001589	frameshift_variant	91748	exon2			.	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.939delC	chr14.hg19:g.74205773delG	ENSP00000286523:p.Pro313fs	47.0	0.0		45.0	18.0	NM_194278	Q6PK13|Q6PK59|Q6ZS23	Frame_Shift_Del	DEL	ENST00000286523.5	hg19	CCDS9819.1																																																																																			.	.		0.662	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317793.1	NM_194278	
HLCS	3141	hgsc.bcm.edu	37	21	38128905	38128906	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr21:38128905_38128906delTT	ENST00000399120.1	-	11	3176_3177	c.1946_1947delAA	c.(1945-1947)aaafs	p.K649fs	HLCS_ENST00000336648.4_Frame_Shift_Del_p.K649fs	NM_001242784.1	NP_001229713.1	P50747	BPL1_HUMAN	holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase)	649	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				biotin metabolic process (GO:0006768)|cell proliferation (GO:0008283)|histone biotinylation (GO:0071110)|histone modification (GO:0016570)|protein biotinylation (GO:0009305)|response to biotin (GO:0070781)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin-[acetyl-CoA-carboxylase] ligase activity (GO:0004077)|biotin-[methylcrotonoyl-CoA-carboxylase] ligase activity (GO:0004078)|biotin-[methylmalonyl-CoA-carboxytransferase] ligase activity (GO:0004079)|biotin-[propionyl-CoA-carboxylase (ATP-hydrolyzing)] ligase activity (GO:0004080)|biotin-protein ligase activity (GO:0018271)|enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(46;0.0422)			Biotin(DB00121)	CCTGAAACTCTTTGATCAGTTT	0.465																																					p.649_650del		Atlas-INDEL	.											.	HLCS	64	.	0			c.1947_1948del						.																																			SO:0001589	frameshift_variant	3141	exon11			.		CCDS13647.1	21q22.1	2012-07-13	2010-04-30		ENSG00000159267	ENSG00000159267	6.3.4.9, 6.3.4.10, 6.3.4.11, 6.3.4.15		4976	protein-coding gene	gene with protein product		609018	"""holocarboxylase synthetase (biotin-[proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)"", ""holocarboxylase synthetase (biotin-(proprionyl-Coenzyme A-carboxylase (ATP-hydrolysing)) ligase)"""			7842009	Standard	NM_000411		Approved	HCS	uc021wjb.1	P50747	OTTHUMG00000086636	ENST00000399120.1:c.1946_1947delAA	chr21.hg19:g.38128905_38128906delTT	ENSP00000382071:p.Lys649fs	196.0	0.0		173.0	59.0	NM_000411	B2RAH1|D3DSG6|Q99451	Frame_Shift_Del	DEL	ENST00000399120.1	hg19	CCDS13647.1																																																																																			.	.		0.465	HLCS-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194687.2		
TRIOBP	11078	hgsc.bcm.edu	37	22	38121789	38121789	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr22:38121789delC	ENST00000406386.3	+	7	3481	c.3226delC	c.(3226-3228)cccfs	p.P1077fs		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1077					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCGTCCTCGCCCCCCCGCCA	0.652																																					p.S1075fs		Atlas-INDEL	.											TRIOBP_ENST00000344404,NS,carcinoma,0,3	TRIOBP	262	.	0			c.3225delG						.						43.0	47.0	46.0					22																	38121789		1882	4079	5961	SO:0001589	frameshift_variant	11078	exon7			.	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3226delC	chr22.hg19:g.38121789delC	ENSP00000384312:p.Pro1077fs	95.0	0.0		87.0	14.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Frame_Shift_Del	DEL	ENST00000406386.3	hg19	CCDS43015.1																																																																																			.	.		0.652	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
SLC27A3	11000	hgsc.bcm.edu	37	1	153747867	153747869	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:153747867_153747869delAGG	ENST00000368661.3	+	1	100_102	c.35_37delAGG	c.(34-39)aaggag>aag	p.E13del	SLC27A3_ENST00000271857.2_In_Frame_Del_p.E94del|SLC27A3_ENST00000484014.1_3'UTR	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	13					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GCTCCCTGGAAGGAGAAGTCTCA	0.655																																					p.12_12del		Atlas-INDEL	.											.	SLC27A3	42	.	0			c.34_36del						.																																			SO:0001651	inframe_deletion	11000	exon1			.	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.35_37delAGG	chr1.hg19:g.153747867_153747869delAGG	ENSP00000357650:p.Glu13del	60.0	0.0		75.0	11.0	NM_024330	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	In_Frame_Del	DEL	ENST00000368661.3	hg19	CCDS1053.1																																																																																			.	.		0.655	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
ACADL	33	hgsc.bcm.edu	37	2	211081128	211081129	+	Frame_Shift_Ins	INS	-	-	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:211081128_211081129insG	ENST00000233710.3	-	4	705_706	c.478_479insC	c.(478-480)cagfs	p.Q160fs	AC006994.2_ENST00000412065.1_RNA	NM_001608.3	NP_001599.1	P28330	ACADL_HUMAN	acyl-CoA dehydrogenase, long chain	160					carnitine catabolic process (GO:0042413)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid catabolic process (GO:0044242)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|long-chain fatty acid catabolic process (GO:0042758)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|oxidation-reduction process (GO:0055114)|protein homotetramerization (GO:0051289)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|palmitoyl-CoA oxidase activity (GO:0016401)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14		Renal(323;0.202)		Epithelial(149;0.00631)|Lung(261;0.0438)|LUSC - Lung squamous cell carcinoma(261;0.0466)|all cancers(144;0.0621)		TGCAGTCATCTGGGGAATAAAG	0.406																																					p.Q160fs		Atlas-INDEL	.											.	ACADL	38	.	0			c.479_480insC						.																																			SO:0001589	frameshift_variant	33	exon4			.	M74096	CCDS2389.1	2q34	2012-07-13	2010-04-30		ENSG00000115361	ENSG00000115361	1.3.99.13		88	protein-coding gene	gene with protein product		609576	"""acyl-Coenzyme A dehydrogenase, long chain"""			1774065	Standard	NM_001608		Approved	LCAD, ACAD4	uc002vdz.4	P28330	OTTHUMG00000132989	ENST00000233710.3:c.479dupC	chr2.hg19:g.211081132_211081132dupG	ENSP00000233710:p.Gln160fs	95.0	0.0		93.0	12.0	NM_001608	B2R8T3|Q8IUN8	Frame_Shift_Ins	INS	ENST00000233710.3	hg19	CCDS2389.1																																																																																			.	.		0.406	ACADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256561.2	NM_001608	
ARFGAP1	55738	hgsc.bcm.edu	37	20	61917759	61917760	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr20:61917759_61917760insT	ENST00000370283.4	+	12	1016_1017	c.876_877insT	c.(877-879)tttfs	p.F293fs	ARFGAP1_ENST00000519273.2_Frame_Shift_Ins_p.F180fs|ARFGAP1_ENST00000547204.1_Frame_Shift_Ins_p.F227fs|ARFGAP1_ENST00000519604.1_Frame_Shift_Ins_p.F248fs|ARFGAP1_ENST00000370275.4_Frame_Shift_Ins_p.PF372fs|ARFGAP1_ENST00000518794.2_3'UTR|MIR4326_ENST00000582203.1_RNA|ARFGAP1_ENST00000353546.3_Frame_Shift_Ins_p.F301fs	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	293					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					ACGTCACCACCTTTTTTTCGGG	0.624																																					p.T300fs		Atlas-INDEL	.											.,1	ARFGAP1	38	.	0			c.900_901insT						.																																			SO:0001589	frameshift_variant	55738	exon13			.	AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.883dupT	chr20.hg19:g.61917766_61917766dupT	ENSP00000359306:p.Phe293fs	105.0	0.0		113.0	24.0	NM_175609	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Frame_Shift_Ins	INS	ENST00000370283.4	hg19	CCDS13515.1																																																																																			.	.		0.624	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080134.3	NM_018209	
NFASC	23114	hgsc.bcm.edu	37	1	204924033	204924033	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:204924033delC	ENST00000401399.1	+	6	688	c.489delC	c.(487-489)aacfs	p.N163fs	NFASC_ENST00000338515.6_Frame_Shift_Del_p.N163fs|NFASC_ENST00000367171.4_Frame_Shift_Del_p.N163fs|NFASC_ENST00000367169.4_Frame_Shift_Del_p.N163fs|NFASC_ENST00000338586.6_Frame_Shift_Del_p.N163fs|NFASC_ENST00000339876.6_Frame_Shift_Del_p.N163fs|NFASC_ENST00000367172.4_Frame_Shift_Del_p.N163fs|NFASC_ENST00000513543.1_Frame_Shift_Del_p.N157fs|NFASC_ENST00000404907.1_Frame_Shift_Del_p.N157fs|NFASC_ENST00000404076.1_Frame_Shift_Del_p.N157fs|NFASC_ENST00000403080.1_Frame_Shift_Del_p.N163fs|NFASC_ENST00000360049.4_Frame_Shift_Del_p.N157fs|NFASC_ENST00000539706.1_Frame_Shift_Del_p.N157fs|NFASC_ENST00000367170.4_Frame_Shift_Del_p.N163fs			O94856	NFASC_HUMAN	neurofascin	163	Ig-like C2-type 2.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)		p.P159fs*12(1)|p.P165fs*12(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCCAGTGCAACCCCCCGCCTG	0.562																																					p.N163fs		Atlas-INDEL	.											.	NFASC	396	.	2	Deletion - Frameshift(2)	large_intestine(2)	c.488delA						.						144.0	145.0	145.0					1																	204924033		2203	4300	6503	SO:0001589	frameshift_variant	23114	exon7			.	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.489delC	chr1.hg19:g.204924033delC	ENSP00000385637:p.Asn163fs	110.0	0.0		134.0	30.0	NM_001005388	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Frame_Shift_Del	DEL	ENST00000401399.1	hg19	CCDS53460.1																																																																																			.	.		0.562	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
RICTOR	253260	hgsc.bcm.edu	37	5	38958624	38958624	+	Intron	DEL	A	A	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr5:38958624delA	ENST00000357387.3	-	24	2374				RICTOR_ENST00000296782.5_Intron|RICTOR_ENST00000503698.1_Intron	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					AGATTGGCCTAAAAGAGATTA	0.308																																					.		Atlas-INDEL	.											.	RICTOR	182	.	0			c.2344-2T>-						.						77.0	83.0	81.0					5																	38958624		2203	4300	6503	SO:0001627	intron_variant	253260	exon25			.		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2344-3T>-	chr5.hg19:g.38958624delA		317.0	0.0		340.0	102.0	NM_152756		Splice_Site	DEL	ENST00000357387.3	hg19	CCDS34148.1																																																																																			.	.		0.308	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
ZEB1	6935	hgsc.bcm.edu	37	10	31809832	31809833	+	Frame_Shift_Ins	INS	-	-	G			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:31809832_31809833insG	ENST00000320985.10	+	7	1679_1680	c.1569_1570insG	c.(1570-1572)gggfs	p.G524fs	ZEB1_ENST00000542815.3_Frame_Shift_Ins_p.G457fs|ZEB1_ENST00000446923.2_Frame_Shift_Ins_p.G508fs|ZEB1_ENST00000361642.5_Frame_Shift_Ins_p.G525fs|ZEB1_ENST00000560721.2_Frame_Shift_Ins_p.G504fs|ZEB1_ENST00000559858.1_3'UTR			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	524					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				AAAGCTTTGAAGGGGGGGTGAA	0.371																																					p.E524fs	Ovarian(40;423 959 14296 36701 49589)	Atlas-INDEL	.											.	ZEB1	173	.	0			c.1572_1573insG	GRCh37	CD075582	ZEB1	D	rs35708848	.																																			SO:0001589	frameshift_variant	6935	exon7			.	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.1576dupG	chr10.hg19:g.31809839_31809839dupG	ENSP00000319248:p.Gly524fs	100.0	0.0		108.0	11.0	NM_001174096	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Frame_Shift_Ins	INS	ENST00000320985.10	hg19	CCDS7169.1																																																																																			.	.		0.371	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
SDC2	6383	hgsc.bcm.edu	37	8	97621775	97621775	+	Stop_Codon_Del	DEL	A	A	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:97621775delA	ENST00000302190.4	+	0	1526				SDC2_ENST00000518385.1_Stop_Codon_Del|SDC2_ENST00000519914.1_Stop_Codon_Del|SDC2_ENST00000522911.1_Stop_Codon_Del	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2						carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	TTTTATGCGTAAAACTCCAAC	0.353																																					p.X202K		Atlas-INDEL	.											.	SDC2	33	.	0			c.604delT						.						76.0	69.0	71.0					8																	97621775		2203	4300	6503	SO:0001567	stop_retained_variant	6383	exon5			.	BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	Exception_encountered	chr8.hg19:g.97621775delA		69.0	0.0		86.0	14.0	NM_002998	B3KQA3|Q6PIS6|Q9H6V1	Frame_Shift_Del	DEL	ENST00000302190.4	hg19	CCDS6272.1																																																																																			.	.		0.353	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379750.1	NM_002998	
ANKRD12	23253	hgsc.bcm.edu	37	18	9255558	9255559	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr18:9255558_9255559insA	ENST00000262126.4	+	9	2533_2534	c.2293_2294insA	c.(2293-2295)gaafs	p.E765fs	ANKRD12_ENST00000383440.2_Frame_Shift_Ins_p.E742fs|ANKRD12_ENST00000400020.3_Frame_Shift_Ins_p.E742fs	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	765						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TTTTAGGGAGGAAAAAATAAAA	0.351																																					p.E765fs		Atlas-INDEL	.											.	ANKRD12	167	.	0			c.2293_2294insA						.																																			SO:0001589	frameshift_variant	23253	exon9			.	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2299dupA	chr18.hg19:g.9255564_9255564dupA	ENSP00000262126:p.Glu765fs	103.0	0.0		123.0	49.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Frame_Shift_Ins	INS	ENST00000262126.4	hg19	CCDS11843.1																																																																																			.	.		0.351	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ELF3	1999	hgsc.bcm.edu	37	1	201982384	201982385	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	AA	AA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:201982384_201982385delAA	ENST00000359651.3	+	6	3955_3956	c.763_764delAA	c.(763-765)aaafs	p.K255fs	RP11-465N4.4_ENST00000419190.1_RNA|RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367283.3_Frame_Shift_Del_p.K255fs|ELF3_ENST00000367284.5_Frame_Shift_Del_p.K255fs					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						AAAGCTGAGCAAAGAGTACTGG	0.639																																					p.254_255del		Atlas-INDEL	.											.	ELF3	92	.	0			c.762_763del						.																																			SO:0001589	frameshift_variant	1999	exon7			.	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.763_764delAA	chr1.hg19:g.201982384_201982385delAA	ENSP00000352673:p.Lys255fs	231.0	0.0		302.0	30.0	NM_001114309		Frame_Shift_Del	DEL	ENST00000359651.3	hg19	CCDS1419.1																																																																																			.	.		0.639	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
ZNF142	7701	hgsc.bcm.edu	37	2	219508083	219508084	+	Frame_Shift_Ins	INS	-	-	C			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:219508083_219508084insC	ENST00000449707.1	-	8	3576_3577	c.3155_3156insG	c.(3154-3156)ggafs	p.G1052fs	ZNF142_ENST00000411696.2_Frame_Shift_Ins_p.G1052fs	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1052					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G1052fs*20(1)|p.G889fs*20(1)		breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CCCCGCCACGTCCCCCCCTGCA	0.604																																					p.G1052fs	Colon(170;867 1942 8995 15834 18053)	Atlas-INDEL	.											.,2	ZNF142	190	.	2	Deletion - Frameshift(2)	lung(2)	c.3156_3157insG						.																																			SO:0001589	frameshift_variant	7701	exon8			.	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.3156dupG	chr2.hg19:g.219508090_219508090dupC	ENSP00000408643:p.Gly1052fs	143.0	0.0		140.0	26.0	NM_001105537	Q92510	Frame_Shift_Ins	INS	ENST00000449707.1	hg19	CCDS42817.1																																																																																			.	.		0.604	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
GBP3	2635	hgsc.bcm.edu	37	1	89476691	89476693	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr1:89476691_89476693delCTT	ENST00000370481.4	-	8	1476_1478	c.1256_1258delAAG	c.(1255-1260)gaagtg>gtg	p.E419del		NM_018284.2	NP_060754.2	Q8WXF7	ATLA1_HUMAN	guanylate binding protein 3	0					axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(277;0.123)		all cancers(265;0.0103)|Epithelial(280;0.0293)		CCCGCCTTCACTTCTTCTTCTAG	0.419																																					p.419_420del		Atlas-INDEL	.											.	GBP3	53	.	0			c.1257_1259del						.																																			SO:0001651	inframe_deletion	2635	exon8			.	BC063819	CCDS717.2	1p22.2	2008-02-05			ENSG00000117226	ENSG00000117226			4184	protein-coding gene	gene with protein product		600413				7518790	Standard	NM_018284		Approved	FLJ10961	uc001dmt.3	Q9H0R5	OTTHUMG00000010616	ENST00000370481.4:c.1256_1258delAAG	chr1.hg19:g.89476697_89476699delCTT	ENSP00000359512:p.Glu419del	89.0	0.0		145.0	69.0	NM_018284	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	In_Frame_Del	DEL	ENST00000370481.4	hg19	CCDS717.2																																																																																			.	.		0.419	GBP3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313541.3	NM_018284	
SPATC1	375686	hgsc.bcm.edu	37	8	145095783	145095784	+	Frame_Shift_Ins	INS	-	-	C	rs576544596	byFrequency	TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr8:145095783_145095784insC	ENST00000377470.3	+	3	1183_1184	c.1081_1082insC	c.(1081-1083)gccfs	p.A361fs	SPATC1_ENST00000447830.2_Frame_Shift_Ins_p.A361fs	NM_198572.2	NP_940974.2	Q76KD6	SPERI_HUMAN	spermatogenesis and centriole associated 1	361						centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;3.67e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCAGGGTGCCCCCCATCCC	0.658																																					p.A361fs		Atlas-INDEL	.											SPATC1_ENST00000377470,NS,carcinoma,0,2	SPATC1	77	.	0			c.1081_1082insC						.																																			SO:0001589	frameshift_variant	375686	exon3			.	BC053547	CCDS6413.2, CCDS47937.1	8q24.3	2005-01-11			ENSG00000186583	ENSG00000186583			30510	protein-coding gene	gene with protein product		610874				15280373	Standard	NM_198572		Approved	MGC61633, SPATA15, SPERIOLIN	uc011lkw.2	Q76KD6	OTTHUMG00000156976	ENST00000377470.3:c.1087dupC	chr8.hg19:g.145095789_145095789dupC	ENSP00000366690:p.Ala361fs	81.0	0.0		114.0	24.0	NM_001134374	B4DWW9|Q5U5I8|Q7Z6L7	Frame_Shift_Ins	INS	ENST00000377470.3	hg19	CCDS6413.2																																																																																			.	.		0.658	SPATC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346926.1	NM_198572	
SLC8A1	6546	hgsc.bcm.edu	37	2	40656189	40656191	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:40656189_40656191delAAG	ENST00000403092.1	-	2	1263_1265	c.1230_1232delCTT	c.(1228-1233)ttcttt>ttt	p.410_411FF>F	SLC8A1_ENST00000406785.2_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000542756.1_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000402441.1_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000542024.1_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000408028.2_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000405901.3_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000405269.1_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000332839.4_In_Frame_Del_p.410_411FF>F|SLC8A1_ENST00000406391.2_In_Frame_Del_p.410_411FF>F			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	410	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	CCCTTGTTCAAAGAAGATCTTAC	0.453																																					p.411_411del		Atlas-INDEL	.											.	SLC8A1	221	.	0			c.1231_1233del						.																																			SO:0001651	inframe_deletion	6546	exon2			.		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1230_1232delCTT	chr2.hg19:g.40656192_40656194delAAG	ENSP00000384763:p.Phe411del	95.0	0.0		101.0	12.0	NM_001112802	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	In_Frame_Del	DEL	ENST00000403092.1	hg19	CCDS1806.1																																																																																			.	.		0.453	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
HIVEP1	3096	hgsc.bcm.edu	37	6	12124209	12124209	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr6:12124209delC	ENST00000379388.2	+	4	4513	c.4181delC	c.(4180-4182)accfs	p.T1394fs	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1394					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				GGAAGCATCACCCCACCCCAG	0.498																																					p.T1394fs		Atlas-INDEL	.											.	HIVEP1	242	.	0			c.4180delA						.						133.0	136.0	135.0					6																	12124209		2074	4205	6279	SO:0001589	frameshift_variant	3096	exon4			.	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.4181delC	chr6.hg19:g.12124209delC	ENSP00000368698:p.Thr1394fs	119.0	0.0		141.0	25.0	NM_002114	B2RTU3|Q14122|Q5MPB1|Q5VW60	Frame_Shift_Del	DEL	ENST00000379388.2	hg19	CCDS43426.1																																																																																			.	.		0.498	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039870.2	NM_002114	
DNAH6	1768	hgsc.bcm.edu	37	2	84806683	84806684	+	Frame_Shift_Ins	INS	-	-	A			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr2:84806683_84806684insA	ENST00000237449.6	+	13	2117_2118	c.2109_2110insA	c.(2110-2112)aaafs	p.K704fs	DNAH6_ENST00000389394.3_Frame_Shift_Ins_p.K704fs|DNAH6_ENST00000398278.2_Frame_Shift_Ins_p.K704fs			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	704	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GTCAAAGCAAGAAAAAAGTGGA	0.322																																					p.K703fs		Atlas-INDEL	.											.	DNAH6	194	.	0			c.2109_2110insA						.																																			SO:0001589	frameshift_variant	1768	exon14			.	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2115dupA	chr2.hg19:g.84806689_84806689dupA	ENSP00000237449:p.Lys704fs	75.0	0.0		82.0	20.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Frame_Shift_Ins	INS	ENST00000237449.6	hg19	CCDS46348.1																																																																																			.	.		0.322	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
NHLRC2	374354	hgsc.bcm.edu	37	10	115663496	115663499	+	Splice_Site	DEL	GTAA	GTAA	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	GTAA	GTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:115663496_115663499delGTAA	ENST00000369301.3	+	9	1916		c.e9+1			NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2											breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		GGTATCTGTGGTAAGTAATTTTAA	0.328																																					p.568_568del		Atlas-INDEL	.											.	NHLRC2	56	.	0			c.1704_1704del						.																																			SO:0001630	splice_region_variant	374354	exon9			.	AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.1704+1GTAA>-	chr10.hg19:g.115663500_115663503delGTAA		334.0	0.0		288.0	34.0	NM_198514	Q8N1H1|Q8N5A6	Frame_Shift_Del	DEL	ENST00000369301.3	hg19	CCDS7585.1																																																																																			.	.		0.328	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050446.1	NM_198514	Intron
ULK1	8408	hgsc.bcm.edu	37	12	132402065	132402066	+	Frame_Shift_Ins	INS	-	-	C	rs376230231		TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr12:132402065_132402066insC	ENST00000321867.4	+	22	2643_2644	c.2292_2293insC	c.(2293-2295)cccfs	p.P765fs	ULK1_ENST00000540647.1_5'Flank	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	765					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GCGGGAGCACGCCCCCCCAGGG	0.718																																					p.T764fs		Atlas-INDEL	.											.	ULK1	92	.	0			c.2292_2293insC						.																																			SO:0001589	frameshift_variant	8408	exon22			.	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2299dupC	chr12.hg19:g.132402072_132402072dupC	ENSP00000324560:p.Pro765fs	215.0	0.0		222.0	40.0	NM_003565	Q9UQ28	Frame_Shift_Ins	INS	ENST00000321867.4	hg19	CCDS9274.1																																																																																			.	.		0.718	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
ANK3	288	hgsc.bcm.edu	37	10	61828444	61828444	+	Frame_Shift_Del	DEL	T	T	-			TCGA-WQ-A9G7-01A-11D-A36X-10	TCGA-WQ-A9G7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9b21e6c1-c220-41e9-b999-323e7bd7079a	60cdfad5-5cd4-4b7e-964b-b6e042e046da	g.chr10:61828444delT	ENST00000280772.2	-	37	12386	c.12195delA	c.(12193-12195)aaafs	p.K4065fs	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4065					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CACTCTTTGATTTTAAAGGTG	0.512																																					p.S4066fs		Atlas-INDEL	.											.	ANK3	703	.	0			c.12196delT						.						117.0	121.0	119.0					10																	61828444		2203	4300	6503	SO:0001589	frameshift_variant	288	exon37			.	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12195delA	chr10.hg19:g.61828444delT	ENSP00000280772:p.Lys4065fs	70.0	0.0		76.0	17.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Frame_Shift_Del	DEL	ENST00000280772.2	hg19	CCDS7258.1																																																																																			.	.		0.512	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
