#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CSMD2	114784	hgsc.bcm.edu	37	1	34209061	34209061	+	Missense_Mutation	SNP	C	C	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr1:34209061C>G	ENST00000373381.4	-	14	2169	c.1993G>C	c.(1993-1995)Gtg>Ctg	p.V665L		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	625	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V625M(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGAGGCTCCACGTCAATGTCG	0.602																																					p.V625L		Atlas-SNP	.											CSMD2,caecum,carcinoma,0,1	CSMD2	946	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1873C						.						84.0	84.0	84.0					1																	34209061		2203	4300	6503	SO:0001583	missense	114784	exon14			GCTCCACGTCAAT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.1993G>C	chr1.hg19:g.34209061C>G	ENSP00000362479:p.Val665Leu	60.0	0.0		71.0	23.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	hg19		.	.	.	.	.	.	.	.	.	.	C	13.80	2.345427	0.41498	.	.	ENSG00000121904	ENST00000373381	T	0.15256	2.44	5.58	5.58	0.84498	CUB (5);	0.055186	0.64402	D	0.000001	T	0.08492	0.0211	N	0.02120	-0.675	0.80722	D	1	B;B	0.23990	0.095;0.01	B;B	0.33846	0.171;0.079	T	0.16100	-1.0414	10	0.02654	T	1	.	18.9334	0.92576	0.0:1.0:0.0:0.0	.	625;665	Q7Z408;E7EUA6	CSMD2_HUMAN;.	L	665	ENSP00000362479:V665L	ENSP00000241312:V625L	V	-	1	0	CSMD2	33981648	1.000000	0.71417	0.968000	0.41197	0.989000	0.77384	4.839000	0.62810	2.782000	0.95742	0.655000	0.94253	GTG	.	.		0.602	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
COL24A1	255631	hgsc.bcm.edu	37	1	86200503	86200503	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr1:86200503T>A	ENST00000370571.2	-	59	5293	c.4927A>T	c.(4927-4929)Aag>Tag	p.K1643*	COL24A1_ENST00000436319.1_Nonsense_Mutation_p.K1622*	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1643	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TTCCATCCCTTGAAACCAATA	0.433																																					p.K1643X		Atlas-SNP	.											.	COL24A1	202	.	0			c.A4927T						.						177.0	170.0	172.0					1																	86200503		1891	4117	6008	SO:0001587	stop_gained	255631	exon59			ATCCCTTGAAACC	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.4927A>T	chr1.hg19:g.86200503T>A	ENSP00000359603:p.Lys1643*	187.0	0.0		200.0	77.0	NM_152890	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Nonsense_Mutation	SNP	ENST00000370571.2	hg19	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	T	42	9.714598	0.99245	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	.	.	.	5.23	5.23	0.72850	.	0.000000	0.38720	N	0.001589	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.2771	0.73750	0.0:0.0:0.0:1.0	.	.	.	.	X	1643;1622	.	ENSP00000359603:K1643X	K	-	1	0	COL24A1	85973091	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	2.664000	0.46783	2.191000	0.70037	0.528000	0.53228	AAG	.	.		0.433	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029335.4	NM_152890	
ANKRD35	148741	hgsc.bcm.edu	37	1	145562472	145562472	+	Silent	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr1:145562472C>T	ENST00000355594.4	+	10	2247	c.2160C>T	c.(2158-2160)agC>agT	p.S720S		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	720										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTGCACAAAGCAAAGCAGCGG	0.662																																					p.S720S	Melanoma(9;127 754 22988 51047)	Atlas-SNP	.											.	ANKRD35	96	.	0			c.C2160T						.						22.0	26.0	25.0					1																	145562472		2203	4300	6503	SO:0001819	synonymous_variant	148741	exon10			ACAAAGCAAAGCA	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.2160C>T	chr1.hg19:g.145562472C>T		163.0	0.0		185.0	52.0	NM_144698	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	ENST00000355594.4	hg19	CCDS919.1																																																																																			.	.		0.662	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
YY1AP1	55249	hgsc.bcm.edu	37	1	155640243	155640243	+	Missense_Mutation	SNP	G	G	C			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr1:155640243G>C	ENST00000295566.4	-	8	817	c.794C>G	c.(793-795)cCc>cGc	p.P265R	YY1AP1_ENST00000368330.2_Missense_Mutation_p.P199R|YY1AP1_ENST00000368339.5_Missense_Mutation_p.P337R|YY1AP1_ENST00000311573.5_Missense_Mutation_p.P188R|YY1AP1_ENST00000476093.1_5'UTR|YY1AP1_ENST00000438245.2_Intron|YY1AP1_ENST00000407221.1_Missense_Mutation_p.P188R|YY1AP1_ENST00000361831.5_Missense_Mutation_p.P188R|YY1AP1_ENST00000368340.5_Missense_Mutation_p.P337R|YY1AP1_ENST00000347088.5_Missense_Mutation_p.P199R|YY1AP1_ENST00000359205.5_Missense_Mutation_p.P188R|YY1AP1_ENST00000404643.1_Missense_Mutation_p.P199R|MSTO1_ENST00000538143.1_Intron|YY1AP1_ENST00000355499.4_Missense_Mutation_p.P199R|YY1AP1_ENST00000535662.1_Missense_Mutation_p.P65R|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000405763.3_Missense_Mutation_p.P337R	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	265					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TGGCAAACAGGGAAATTCATT	0.408																																					p.P337R		Atlas-SNP	.											.	YY1AP1	104	.	0			c.C1010G						.						85.0	83.0	84.0					1																	155640243		2203	4300	6503	SO:0001583	missense	55249	exon7			AAACAGGGAAATT	BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.794C>G	chr1.hg19:g.155640243G>C	ENSP00000295566:p.Pro265Arg	124.0	0.0		148.0	41.0	NM_001198904	B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	ENST00000295566.4	hg19	CCDS1115.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703830	0.48412	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662;ENST00000405763;ENST00000443231	T;T;T;T;T;T;T;T;T;T;T;T	0.27256	1.71;1.71;1.79;1.71;1.71;1.78;1.79;1.71;1.79;1.81;1.68;1.81	3.17	3.17	0.36434	.	0.071494	0.56097	D	0.000029	T	0.31949	0.0813	M	0.73962	2.25	0.80722	D	1	P;P;P;P;D;P;D	0.64830	0.551;0.944;0.919;0.929;0.978;0.933;0.994	P;P;P;P;P;P;P	0.60682	0.516;0.714;0.587;0.586;0.716;0.668;0.878	T	0.13629	-1.0502	10	0.72032	D	0.01	.	7.8062	0.29204	0.123:0.0:0.877:0.0	.	265;337;199;337;265;199;337	B4DQQ0;B4DMP2;Q9H869-4;B0QZ55;Q9H869;Q9H869-2;Q5VYZ1	.;.;.;.;YYAP1_HUMAN;.;.	R	188;199;188;199;188;337;265;199;188;199;337;65;337;188	ENSP00000352134:P188R;ENSP00000347686:P199R;ENSP00000311138:P188R;ENSP00000316079:P199R;ENSP00000355298:P188R;ENSP00000357324:P337R;ENSP00000295566:P265R;ENSP00000357314:P199R;ENSP00000385791:P188R;ENSP00000385390:P199R;ENSP00000357323:P337R;ENSP00000437926:P65R	ENSP00000295566:P265R	P	-	2	0	YY1AP1	153906867	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.786000	0.47790	1.756000	0.51951	0.557000	0.71058	CCC	.	.		0.408	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000086027.1	NM_139118	
KIAA1804	84451	hgsc.bcm.edu	37	1	233489695	233489695	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr1:233489695A>G	ENST00000366624.3	+	3	1390	c.1129A>G	c.(1129-1131)Atg>Gtg	p.M377V	MLK4_ENST00000366623.3_Missense_Mutation_p.M377V	NM_032435.2	NP_115811.2																					TGCCAAGCTCATGAAAGGTAT	0.448																																					p.M377V		Atlas-SNP	.											.	KIAA1804	129	.	0			c.A1129G						.						121.0	106.0	111.0					1																	233489695		2203	4300	6503	SO:0001583	missense	0	exon3			AAGCTCATGAAAG																												ENST00000366624.3:c.1129A>G	chr1.hg19:g.233489695A>G	ENSP00000355583:p.Met377Val	90.0	0.0		127.0	75.0	NM_032435		Missense_Mutation	SNP	ENST00000366624.3	hg19	CCDS1598.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.195953	0.58126	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	D;D	0.86366	-2.11;-2.11	4.91	4.91	0.64330	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86033	0.5836	N	0.16098	0.37	0.80722	D	1	P;P	0.45474	0.859;0.575	P;B	0.58620	0.842;0.343	D	0.87394	0.2365	10	0.48119	T	0.1	.	14.7177	0.69284	1.0:0.0:0.0:0.0	.	377;377	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	V	377	ENSP00000355582:M377V;ENSP00000355583:M377V	ENSP00000355582:M377V	M	+	1	0	RP5-862P8.2	231556318	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.263000	0.78421	2.053000	0.61076	0.460000	0.39030	ATG	.	.		0.448	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
CCDC121	79635	hgsc.bcm.edu	37	2	27849931	27849931	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr2:27849931T>A	ENST00000324364.3	-	2	916	c.736A>T	c.(736-738)Aga>Tga	p.R246*	GPN1_ENST00000407583.3_5'Flank|ZNF512_ENST00000556601.1_Intron|GPN1_ENST00000515877.1_5'Flank|GPN1_ENST00000503738.1_5'Flank|GPN1_ENST00000424214.1_5'Flank|GPN1_ENST00000610189.1_5'Flank|CCDC121_ENST00000394775.3_Nonsense_Mutation_p.R408*|GPN1_ENST00000458167.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000264718.3_5'Flank	NM_024584.4	NP_078860.2	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121	246										breast(1)|endometrium(3)|large_intestine(2)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(172;0.155)					CCTTGCAGTCTCTGCCTCGCC	0.478																																					p.R408X		Atlas-SNP	.											.	CCDC121	43	.	0			c.A1222T						.						121.0	114.0	116.0					2																	27849931		2203	4300	6503	SO:0001587	stop_gained	79635	exon2			GCAGTCTCTGCCT	AK125354	CCDS1759.1, CCDS46247.1	2p23.2	2008-02-05			ENSG00000176714	ENSG00000176714			25833	protein-coding gene	gene with protein product							Standard	NM_024584		Approved	FLJ43364, FLJ13646	uc002rld.3	Q6ZUS5	OTTHUMG00000128427	ENST00000324364.3:c.736A>T	chr2.hg19:g.27849931T>A	ENSP00000339087:p.Arg246*	87.0	0.0		75.0	34.0	NM_001142683	B3KW66|J3KQZ8|Q9H8G6	Nonsense_Mutation	SNP	ENST00000324364.3	hg19	CCDS1759.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.172399	0.57584	.	.	ENSG00000176714	ENST00000324364;ENST00000394775	.	.	.	5.24	2.22	0.28083	.	1.730580	0.03530	N	0.222357	.	.	.	.	.	.	0.49213	D	0.999765	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.8964	11.4413	0.50099	0.0:0.0:0.4601:0.5399	.	.	.	.	X	246;408	.	ENSP00000339087:R246X	R	-	1	2	CCDC121	27703435	0.001000	0.12720	0.002000	0.10522	0.001000	0.01503	0.493000	0.22451	0.117000	0.18138	-0.435000	0.05868	AGA	.	.		0.478	CCDC121-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250215.1	NM_024584	
CLK1	1195	hgsc.bcm.edu	37	2	201726515	201726515	+	Missense_Mutation	SNP	C	C	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr2:201726515C>G	ENST00000321356.4	-	2	206	c.71G>C	c.(70-72)aGc>aCc	p.S24T	CLK1_ENST00000492793.1_Intron|Y_RNA_ENST00000516950.1_RNA|CLK1_ENST00000434813.2_Missense_Mutation_p.S66T	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	24					cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						ACTGCTGCTGCTCCTCCATTT	0.413																																					p.S66T		Atlas-SNP	.											.	CLK1	103	.	0			c.G197C						.						191.0	179.0	183.0					2																	201726515		2203	4300	6503	SO:0001583	missense	1195	exon2			CTGCTGCTCCTCC	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.71G>C	chr2.hg19:g.201726515C>G	ENSP00000326830:p.Ser24Thr	107.0	0.0		86.0	38.0	NM_001162407	B4DFW7|Q0P694|Q8N5V8	Missense_Mutation	SNP	ENST00000321356.4	hg19	CCDS2331.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.266578	0.40095	.	.	ENSG00000013441	ENST00000321356;ENST00000357369;ENST00000434813	T;T	0.67523	-0.2;-0.27	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000003	T	0.65026	0.2652	M	0.63428	1.95	0.32787	N	0.501672	B;B	0.27823	0.19;0.094	B;B	0.29077	0.098;0.046	T	0.68326	-0.5438	10	0.23302	T	0.38	.	17.0516	0.86520	0.0:1.0:0.0:0.0	.	66;24	B4DFW7;P49759	.;CLK1_HUMAN	T	24;24;66	ENSP00000326830:S24T;ENSP00000394734:S66T	ENSP00000326830:S24T	S	-	2	0	CLK1	201434760	0.414000	0.25408	1.000000	0.80357	0.753000	0.42808	1.376000	0.34306	2.613000	0.88420	0.637000	0.83480	AGC	.	.		0.413	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		
ATG9A	79065	hgsc.bcm.edu	37	2	220087067	220087067	+	Missense_Mutation	SNP	G	G	C			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr2:220087067G>C	ENST00000409618.1	-	12	2393	c.1954C>G	c.(1954-1956)Ctg>Gtg	p.L652V	ATG9A_ENST00000361242.4_Missense_Mutation_p.L652V|AC068946.1_ENST00000408417.1_RNA|ATG9A_ENST00000396761.2_Missense_Mutation_p.L652V|ATG9A_ENST00000409422.1_Missense_Mutation_p.L591V			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	652					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGGAGCGCAGGGCAGAGGCG	0.662																																					p.L652V		Atlas-SNP	.											.	ATG9A	50	.	0			c.C1954G						.						49.0	58.0	55.0					2																	220087067		1979	4151	6130	SO:0001583	missense	79065	exon12			AGCGCAGGGCAGA	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.1954C>G	chr2.hg19:g.220087067G>C	ENSP00000386710:p.Leu652Val	143.0	0.0		107.0	31.0	NM_001077198	Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Missense_Mutation	SNP	ENST00000409618.1	hg19	CCDS42820.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133382	0.56828	.	.	ENSG00000198925	ENST00000396761;ENST00000409618;ENST00000361242;ENST00000409422;ENST00000429920	T;T;T;T;T	0.38722	1.8;1.8;1.8;1.38;1.12	5.35	4.48	0.54585	.	0.145153	0.47455	D	0.000237	T	0.56247	0.1972	M	0.71581	2.175	0.46586	D	0.999112	D	0.63880	0.993	D	0.67548	0.952	T	0.54944	-0.8217	10	0.15499	T	0.54	-7.6341	10.2144	0.43160	0.1499:0.0:0.8501:0.0	.	652	Q7Z3C6	ATG9A_HUMAN	V	652;652;652;591;211	ENSP00000379983:L652V;ENSP00000386710:L652V;ENSP00000355173:L652V;ENSP00000386535:L591V;ENSP00000400234:L211V	ENSP00000355173:L652V	L	-	1	2	ATG9A	219795311	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.352000	0.44080	1.503000	0.48686	0.591000	0.81541	CTG	.	.		0.662	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085	
SCN10A	6336	hgsc.bcm.edu	37	3	38797307	38797307	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr3:38797307C>A	ENST00000449082.2	-	10	1432	c.1433G>T	c.(1432-1434)cGc>cTc	p.R478L		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	478					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	AGGATCAGAGCGGGGTGATTT	0.488																																					p.R478L		Atlas-SNP	.											SCN10A,colon,carcinoma,0,2	SCN10A	359	.	0			c.G1433T						.						276.0	231.0	246.0					3																	38797307		2203	4300	6503	SO:0001583	missense	6336	exon10			TCAGAGCGGGGTG	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.1433G>T	chr3.hg19:g.38797307C>A	ENSP00000390600:p.Arg478Leu	107.0	1.0		102.0	41.0	NM_006514	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	hg19	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	3.042	-0.197227	0.06259	.	.	ENSG00000185313	ENST00000449082	D	0.95756	-3.8	5.34	-0.209	0.13180	.	.	.	.	.	D	0.87669	0.6235	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.77365	-0.2615	9	0.66056	D	0.02	.	1.8994	0.03264	0.1318:0.1499:0.1374:0.581	.	478	Q9Y5Y9	SCNAA_HUMAN	L	478	ENSP00000390600:R478L	ENSP00000390600:R478L	R	-	2	0	SCN10A	38772311	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.031000	0.12287	-0.056000	0.13221	-1.099000	0.02127	CGC	.	.		0.488	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109745.3	NM_006514	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	119.0	0.0		146.0	68.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
TTC14	151613	hgsc.bcm.edu	37	3	180328329	180328329	+	Silent	SNP	A	A	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr3:180328329A>G	ENST00000296015.4	+	12	2444	c.2312A>G	c.(2311-2313)tAa>tGa	p.*771*	TTC14_ENST00000382584.4_Intron|TTC14_ENST00000412756.2_3'UTR	NM_133462.3	NP_597719.1	Q96N46	TTC14_HUMAN	tetratricopeptide repeat domain 14	0							RNA binding (GO:0003723)			endometrium(3)|kidney(5)|large_intestine(9)|lung(24)|ovary(2)|pancreas(1)|skin(1)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TCAAAAAATTAATACACCAAG	0.299																																					p.X771X		Atlas-SNP	.											.	TTC14	112	.	0			c.A2312G						.						31.0	37.0	35.0					3																	180328329		2079	4231	6310	SO:0001819	synonymous_variant	151613	exon12			AAAATTAATACAC	AB075860	CCDS3237.1, CCDS46963.1, CCDS75055.1	3q27.2	2013-01-10			ENSG00000163728	ENSG00000163728		"""Tetratricopeptide (TTC) repeat domain containing"""	24697	protein-coding gene	gene with protein product						11853319	Standard	NM_001042601		Approved	FLJ00166, KIAA1980	uc003fkk.3	Q96N46	OTTHUMG00000157859	ENST00000296015.4:c.2312A>G	chr3.hg19:g.180328329A>G		139.0	0.0		129.0	64.0	NM_133462	G5E9X0|Q6UWJ7|Q8TF22	Silent	SNP	ENST00000296015.4	hg19	CCDS3237.1																																																																																			.	.		0.299	TTC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349786.1	NM_133462	
NRROS	375387	hgsc.bcm.edu	37	3	196387632	196387632	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr3:196387632A>G	ENST00000328557.4	+	3	1321	c.1118A>G	c.(1117-1119)gAg>gGg	p.E373G		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	373					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CGGGAGCACGAGCCCCCCGGA	0.642																																					p.E373G		Atlas-SNP	.											.	LRRC33	91	.	0			c.A1118G						.						64.0	68.0	66.0					3																	196387632		2203	4300	6503	SO:0001583	missense	375387	exon3			AGCACGAGCCCCC	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.1118A>G	chr3.hg19:g.196387632A>G	ENSP00000328625:p.Glu373Gly	77.0	0.0		69.0	32.0	NM_198565		Missense_Mutation	SNP	ENST00000328557.4	hg19	CCDS3319.1	.	.	.	.	.	.	.	.	.	.	A	10.41	1.341592	0.24339	.	.	ENSG00000174004	ENST00000328557	T	0.58940	0.3	6.17	5.03	0.67393	.	0.586814	0.18714	N	0.133219	T	0.30665	0.0772	N	0.02334	-0.595	0.26626	N	0.972567	P	0.43231	0.801	B	0.38106	0.265	T	0.11542	-1.0583	10	0.34782	T	0.22	.	11.8368	0.52330	0.9327:0.0:0.0673:0.0	.	373	Q86YC3	LRC33_HUMAN	G	373	ENSP00000328625:E373G	ENSP00000328625:E373G	E	+	2	0	LRRC33	197872029	0.999000	0.42202	0.993000	0.49108	0.267000	0.26476	4.157000	0.58144	2.371000	0.80710	0.533000	0.62120	GAG	.	.		0.642	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
SENP5	205564	hgsc.bcm.edu	37	3	196612404	196612404	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr3:196612404A>G	ENST00000323460.5	+	2	601	c.352A>G	c.(352-354)Aag>Gag	p.K118E	SENP5_ENST00000419026.1_Intron|SENP5_ENST00000445299.2_Missense_Mutation_p.K118E	NM_152699.4	NP_689912.2	Q96HI0	SENP5_HUMAN	SUMO1/sentrin specific peptidase 5	118					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(14)|skin(1)	32	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.14e-24)|all cancers(36;2.1e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.004)		CCAAGCAGAGAAGCTGTTGTC	0.403																																					p.K118E	Ovarian(47;891 1095 11174 13858 51271)	Atlas-SNP	.											.	SENP5	68	.	0			c.A352G						.						61.0	62.0	62.0					3																	196612404		2203	4300	6503	SO:0001583	missense	205564	exon2			GCAGAGAAGCTGT	BC030705	CCDS3322.1	3q29	2005-08-17	2005-08-17		ENSG00000119231	ENSG00000119231			28407	protein-coding gene	gene with protein product		612845	"""SUMO1/sentrin specific protease 5"""			12477932	Standard	NM_152699		Approved	MGC27076	uc003fwz.4	Q96HI0	OTTHUMG00000155527	ENST00000323460.5:c.352A>G	chr3.hg19:g.196612404A>G	ENSP00000327197:p.Lys118Glu	108.0	0.0		86.0	31.0	NM_152699	B4DY82|Q96SA5	Missense_Mutation	SNP	ENST00000323460.5	hg19	CCDS3322.1	.	.	.	.	.	.	.	.	.	.	A	10.54	1.379178	0.24944	.	.	ENSG00000119231	ENST00000323460;ENST00000445299	T;T	0.25085	2.16;1.82	5.18	4.0	0.46444	.	1.206240	0.05724	N	0.598271	T	0.21718	0.0523	N	0.24115	0.695	0.80722	D	1	B;B	0.20052	0.041;0.041	B;B	0.16722	0.016;0.016	T	0.02553	-1.1142	10	0.62326	D	0.03	-2.1309	10.0949	0.42469	0.8493:0.0:0.0:0.1506	.	118;118	B4DY82;Q96HI0	.;SENP5_HUMAN	E	118	ENSP00000327197:K118E;ENSP00000390231:K118E	ENSP00000327197:K118E	K	+	1	0	SENP5	198096801	1.000000	0.71417	0.626000	0.29213	0.450000	0.32258	5.992000	0.70609	1.031000	0.39867	0.533000	0.62120	AAG	.	.		0.403	SENP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340524.1	NM_152699	
CWH43	80157	hgsc.bcm.edu	37	4	49005762	49005762	+	Silent	SNP	A	A	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr4:49005762A>G	ENST00000226432.4	+	7	996	c.813A>G	c.(811-813)tcA>tcG	p.S271S	CWH43_ENST00000513409.1_Silent_p.S244S	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	271					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GAACAGCTTCAGCTGCGGGGC	0.502																																					p.S271S		Atlas-SNP	.											.	CWH43	101	.	0			c.A813G						.						78.0	79.0	78.0					4																	49005762		2203	4300	6503	SO:0001819	synonymous_variant	80157	exon7			AGCTTCAGCTGCG		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.813A>G	chr4.hg19:g.49005762A>G		80.0	0.0		70.0	32.0	NM_025087	B2RPD7	Silent	SNP	ENST00000226432.4	hg19	CCDS3486.1																																																																																			.	.		0.502	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
CENPE	1062	hgsc.bcm.edu	37	4	104065618	104065618	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr4:104065618T>C	ENST00000265148.3	-	33	5104	c.5015A>G	c.(5014-5016)cAg>cGg	p.Q1672R	CENPE_ENST00000380026.3_Missense_Mutation_p.Q1647R	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1672					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		ATGTAGTATCTGAGTCAACCT	0.393																																					p.Q1672R		Atlas-SNP	.											.	CENPE	253	.	0			c.A5015G						.						184.0	176.0	179.0					4																	104065618		2203	4300	6503	SO:0001583	missense	1062	exon33			AGTATCTGAGTCA	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5015A>G	chr4.hg19:g.104065618T>C	ENSP00000265148:p.Gln1672Arg	77.0	0.0		109.0	44.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	hg19	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	15.65	2.897007	0.52121	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.71698	-0.59;-0.59	5.13	5.13	0.70059	.	.	.	.	.	D	0.83358	0.5237	M	0.77313	2.365	0.27375	N	0.955571	D;D	0.69078	0.997;0.995	D;D	0.79784	0.993;0.965	T	0.76429	-0.2962	9	0.49607	T	0.09	.	13.2046	0.59788	0.0:0.0:0.0:1.0	.	1647;1672	Q02224-3;Q02224	.;CENPE_HUMAN	R	1672;1672;1647	ENSP00000265148:Q1672R;ENSP00000369365:Q1647R	ENSP00000265148:Q1672R	Q	-	2	0	CENPE	104285067	0.995000	0.38212	0.345000	0.25642	0.503000	0.33858	4.162000	0.58177	1.948000	0.56530	0.445000	0.29226	CAG	.	.		0.393	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
SGTB	54557	hgsc.bcm.edu	37	5	64976566	64976566	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr5:64976566C>T	ENST00000381007.4	-	7	770	c.535G>A	c.(535-537)Gca>Aca	p.A179T		NM_019072.2	NP_061945.1	Q96EQ0	SGTB_HUMAN	small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta	179										large_intestine(3)|lung(3)|skin(3)	9		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Ovarian(174;0.0545)|Breast(144;0.174)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0657)|Lung(70;0.00487)		AGATCTAATGCCTTTTGATAA	0.348																																					p.A179T		Atlas-SNP	.											.	SGTB	22	.	0			c.G535A						.						140.0	140.0	140.0					5																	64976566		2203	4300	6503	SO:0001583	missense	54557	exon7			CTAATGCCTTTTG	AK096321	CCDS3988.1	5q12.3	2013-01-10			ENSG00000197860	ENSG00000197860		"""Tetratricopeptide (TTC) repeat domain containing"""	23567	protein-coding gene	gene with protein product						12477932	Standard	XM_005248548		Approved	Sgt2, FLJ39002	uc003jud.3	Q96EQ0	OTTHUMG00000097801	ENST00000381007.4:c.535G>A	chr5.hg19:g.64976566C>T	ENSP00000370395:p.Ala179Thr	98.0	0.0		121.0	9.0	NM_019072		Missense_Mutation	SNP	ENST00000381007.4	hg19	CCDS3988.1	.	.	.	.	.	.	.	.	.	.	C	35	5.449249	0.96205	.	.	ENSG00000197860	ENST00000381007;ENST00000506816	D;D	0.83837	-1.77;-1.77	5.31	5.31	0.75309	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.93481	0.7920	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94799	0.7969	10	0.87932	D	0	-18.9877	18.9824	0.92760	0.0:1.0:0.0:0.0	.	179	Q96EQ0	SGTB_HUMAN	T	179	ENSP00000370395:A179T;ENSP00000421447:A179T	ENSP00000370395:A179T	A	-	1	0	SGTB	65012322	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.463000	0.80869	2.496000	0.84212	0.557000	0.71058	GCA	.	.		0.348	SGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215057.2	NM_019072	
ARL10	285598	hgsc.bcm.edu	37	5	175798739	175798739	+	Silent	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr5:175798739C>T	ENST00000310389.5	+	4	672	c.576C>T	c.(574-576)gcC>gcT	p.A192A		NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	192					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGAGCGAGGCCATGAGTATGG	0.562																																					p.A192A		Atlas-SNP	.											.	ARL10	19	.	0			c.C576T						.						92.0	99.0	96.0					5																	175798739		2203	4300	6503	SO:0001819	synonymous_variant	285598	exon4			CGAGGCCATGAGT	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.576C>T	chr5.hg19:g.175798739C>T		115.0	0.0		157.0	8.0	NM_173664		Silent	SNP	ENST00000310389.5	hg19	CCDS4400.1																																																																																			.	.		0.562	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
RXRB	6257	hgsc.bcm.edu	37	6	33162491	33162491	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr6:33162491C>A	ENST00000374680.3	-	10	1781	c.1570G>T	c.(1570-1572)Gag>Tag	p.E524*	RXRB_ENST00000374685.4_Nonsense_Mutation_p.E528*|COL11A2_ENST00000374714.1_5'Flank|COL11A2_ENST00000374712.1_5'Flank|COL11A2_ENST00000374713.1_5'Flank|COL11A2_ENST00000361917.1_5'Flank|COL11A2_ENST00000374708.4_5'Flank|COL11A2_ENST00000341947.2_5'Flank|COL11A2_ENST00000395194.1_5'Flank|COL11A2_ENST00000357486.1_5'Flank|COL11A2_ENST00000395197.1_5'Flank|RXRB_ENST00000544186.1_Nonsense_Mutation_p.E338*	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	524	Ligand-binding. {ECO:0000250}.				cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	TCAAGCATCTCCATGAGGAAG	0.557																																					p.E528X		Atlas-SNP	.											.	RXRB	34	.	0			c.G1582T						.						86.0	80.0	82.0					6																	33162491		1511	2709	4220	SO:0001587	stop_gained	6257	exon10			GCATCTCCATGAG	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.1570G>T	chr6.hg19:g.33162491C>A	ENSP00000363812:p.Glu524*	87.0	0.0		66.0	34.0	NM_001270401	P28703|Q59G65|Q5JP92|Q5STQ1	Nonsense_Mutation	SNP	ENST00000374680.3	hg19	CCDS4768.1	.	.	.	.	.	.	.	.	.	.	C	39	7.389040	0.98252	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	16.1569	0.81675	0.0:1.0:0.0:0.0	.	.	.	.	X	528;524;338	.	ENSP00000363812:E524X	E	-	1	0	RXRB	33270469	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.644000	0.83416	2.674000	0.91012	0.551000	0.68910	GAG	.	.		0.557	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976	
ANKRD66	100287718	hgsc.bcm.edu	37	6	46721610	46721610	+	Silent	SNP	C	C	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr6:46721610C>A	ENST00000565422.1	+	4	485	c.480C>A	c.(478-480)gcC>gcA	p.A160A	ANKRD66_ENST00000536046.1_Silent_p.A131A	NM_001162435.2	NP_001155907.2	B4E2M5	ANR66_HUMAN	ankyrin repeat domain 66	160																	CCATCGACGCCCCTGACTTCT	0.473																																					p.A160A		Atlas-SNP	.											.	.	.	.	0			c.C480A						.						64.0	56.0	59.0					6																	46721610		692	1591	2283	SO:0001819	synonymous_variant	100287718	exon4			CGACGCCCCTGAC	AK304342	CCDS59024.1	6p12.3	2013-01-11			ENSG00000230062	ENSG00000230062		"""Ankyrin repeat domain containing"""	44669	protein-coding gene	gene with protein product							Standard	NM_001162435		Approved		uc011dwf.2	B4E2M5	OTTHUMG00000014791	ENST00000565422.1:c.480C>A	chr6.hg19:g.46721610C>A		123.0	0.0		119.0	39.0	NM_001162435		Silent	SNP	ENST00000565422.1	hg19	CCDS59024.1																																																																																			.	.		0.473	ANKRD66-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432045.1	NM_001162435	
FZD1	8321	hgsc.bcm.edu	37	7	90895843	90895843	+	Missense_Mutation	SNP	A	A	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr7:90895843A>G	ENST00000287934.2	+	1	2061	c.1648A>G	c.(1648-1650)Atc>Gtc	p.I550V		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	550					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			GCCAGCCACCATCGTCATCGC	0.607																																					p.I550V		Atlas-SNP	.											.	FZD1	64	.	0			c.A1648G						.						93.0	72.0	79.0					7																	90895843		2203	4300	6503	SO:0001583	missense	8321	exon1			GCCACCATCGTCA	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.1648A>G	chr7.hg19:g.90895843A>G	ENSP00000287934:p.Ile550Val	58.0	0.0		48.0	23.0	NM_003505	A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	ENST00000287934.2	hg19	CCDS5620.1	.	.	.	.	.	.	.	.	.	.	A	16.43	3.122341	0.56613	.	.	ENSG00000157240	ENST00000287934	T	0.81247	-1.47	5.03	5.03	0.67393	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000003	T	0.77644	0.4161	L	0.41824	1.3	0.54753	D	0.999986	P	0.36683	0.565	B	0.42882	0.401	T	0.75889	-0.3158	10	0.31617	T	0.26	.	14.9189	0.70818	1.0:0.0:0.0:0.0	.	550	Q9UP38	FZD1_HUMAN	V	550	ENSP00000287934:I550V	ENSP00000287934:I550V	I	+	1	0	FZD1	90733779	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.270000	0.78493	2.107000	0.64212	0.533000	0.62120	ATC	.	.		0.607	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
MYC	4609	hgsc.bcm.edu	37	8	128750607	128750607	+	Missense_Mutation	SNP	G	G	C	rs61752959	byFrequency	TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr8:128750607G>C	ENST00000259523.6	+	2	1304	c.99G>C	c.(97-99)caG>caC	p.Q33H	MYC_ENST00000524013.1_Missense_Mutation_p.Q47H|MYC_ENST00000377970.2_Missense_Mutation_p.Q48H			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	33	Poly-Gln.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.Q33H(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	ACTTCTACCAGCAGCAGCAGC	0.612		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q48H		Atlas-SNP	.		Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	MYC,trunk,malignant_melanoma,0,1	MYC	168	.	1	Substitution - Missense(1)	skin(1)	c.G144C						.						44.0	46.0	45.0					8																	128750607		2203	4300	6503	SO:0001583	missense	4609	exon2			CTACCAGCAGCAG		CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.99G>C	chr8.hg19:g.128750607G>C	ENSP00000259523:p.Gln33His	88.0	1.0	1567	87.0	4.0	NM_002467	A8WFE7|P01107|Q14026	Missense_Mutation	SNP	ENST00000259523.6	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.18|10.18	1.279178|1.279178	0.23307|0.23307	.|.	.|.	ENSG00000136997|ENSG00000136997	ENST00000259523;ENST00000517291;ENST00000377970;ENST00000524013|ENST00000520751	T;T;T;T|.	0.16073|.	2.37;2.37;2.37;2.37|.	5.08|5.08	0.863|0.863	0.19062|0.19062	Transcription regulator Myc, N-terminal (1);|.	0.789352|.	0.11848|.	N|.	0.523582|.	T|T	0.36276|0.36276	0.0961|0.0961	N|N	0.11927|0.11927	0.2|0.2	0.23266|0.23266	N|N	0.998011|0.998011	B|.	0.02656|.	0.0|.	B|.	0.08055|.	0.003|.	T|T	0.47509|0.47509	-0.9112|-0.9112	10|6	0.11485|0.87932	T|D	0.65|0	-6.8285|-6.8285	19.6165|19.6165	0.95636|0.95636	0.0:0.7294:0.2705:0.0|0.0:0.7294:0.2705:0.0	.|.	33|.	P01106|.	MYC_HUMAN|.	H|T	33;47;48;47|22	ENSP00000259523:Q33H;ENSP00000429441:Q47H;ENSP00000367207:Q48H;ENSP00000430235:Q47H|.	ENSP00000259523:Q33H|ENSP00000430226:S22T	Q|S	+|+	3|2	2|0	MYC|MYC	128819789|128819789	0.000000|0.000000	0.05858|0.05858	0.997000|0.997000	0.53966|0.53966	0.870000|0.870000	0.49936|0.49936	-0.054000|-0.054000	0.11826|0.11826	-0.043000|-0.043000	0.13513|0.13513	0.561000|0.561000	0.74099|0.74099	CAG|AGC	.	G|0.985;A|0.015		0.612	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000250278.1		
KANK1	23189	hgsc.bcm.edu	37	9	713335	713335	+	Missense_Mutation	SNP	T	T	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr9:713335T>G	ENST00000382303.1	+	7	3221	c.2569T>G	c.(2569-2571)Tca>Gca	p.S857A	KANK1_ENST00000382293.3_Missense_Mutation_p.S699A|KANK1_ENST00000382297.2_Missense_Mutation_p.S857A|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	857					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GGAACCTCACTCACAGATGGG	0.517																																					p.S857A		Atlas-SNP	.											.	KANK1	231	.	0			c.T2569G						.						130.0	123.0	126.0					9																	713335		2203	4300	6503	SO:0001583	missense	23189	exon7			CCTCACTCACAGA	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2569T>G	chr9.hg19:g.713335T>G	ENSP00000371740:p.Ser857Ala	111.0	0.0		106.0	39.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	hg19	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945167	0.53079	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.75704	-0.96;-0.96;-0.96	5.79	4.59	0.56863	.	0.151922	0.31071	N	0.008313	T	0.68686	0.3028	L	0.46157	1.445	0.80722	D	1	B;B	0.23591	0.088;0.034	B;B	0.27380	0.079;0.022	T	0.68922	-0.5281	10	0.56958	D	0.05	-11.0127	12.661	0.56813	0.0:0.0:0.1377:0.8623	.	857;857	Q5W0W1;Q14678	.;KANK1_HUMAN	A	857;857;857;699	ENSP00000371740:S857A;ENSP00000371734:S857A;ENSP00000371730:S699A	ENSP00000346479:S857A	S	+	1	0	KANK1	703335	1.000000	0.71417	0.918000	0.36340	0.991000	0.79684	3.931000	0.56529	2.208000	0.71279	0.533000	0.62120	TCA	.	.		0.517	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
FRMPD1	22844	hgsc.bcm.edu	37	9	37746177	37746177	+	Missense_Mutation	SNP	C	C	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr9:37746177C>A	ENST00000539465.1	+	16	4741	c.4148C>A	c.(4147-4149)gCc>gAc	p.A1383D	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.A1383D			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1383						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TGGAGGCCTGCCCGAGCCCAC	0.652																																					p.A1383D		Atlas-SNP	.											.	FRMPD1	237	.	0			c.C4148A						.						43.0	51.0	48.0					9																	37746177		2203	4300	6503	SO:0001583	missense	22844	exon16			GGCCTGCCCGAGC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.4148C>A	chr9.hg19:g.37746177C>A	ENSP00000444411:p.Ala1383Asp	80.0	0.0		54.0	25.0	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	hg19	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.739027	0.30774	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.08102	3.13;3.13	5.52	3.65	0.41850	.	0.740008	0.13361	N	0.393680	T	0.06600	0.0169	N	0.24115	0.695	0.80722	D	1	P	0.42409	0.779	B	0.39299	0.296	T	0.38090	-0.9677	10	0.52906	T	0.07	-1.1614	8.8199	0.35018	0.0:0.7631:0.1534:0.0834	.	1383	Q5SYB0	FRPD1_HUMAN	D	1383	ENSP00000366995:A1383D;ENSP00000444411:A1383D	ENSP00000366995:A1383D	A	+	2	0	FRMPD1	37736177	0.001000	0.12720	0.977000	0.42913	0.300000	0.27592	0.557000	0.23454	1.307000	0.44944	0.655000	0.94253	GCC	.	.		0.652	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
CDK9	1025	hgsc.bcm.edu	37	9	130550509	130550509	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr9:130550509T>C	ENST00000373264.4	+	5	549	c.449T>C	c.(448-450)aTg>aCg	p.M150T	CDK9_ENST00000480353.1_3'UTR|MIR3960_ENST00000583311.1_RNA|CDK9_ENST00000373265.2_Missense_Mutation_p.M267T	NM_001261.3	NP_001252.1	P50750	CDK9_HUMAN	cyclin-dependent kinase 9	150	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|DNA repair (GO:0006281)|gene expression (GO:0010467)|negative regulation of cell cycle arrest (GO:0071157)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of DNA repair (GO:0006282)|regulation of histone modification (GO:0031056)|replication fork arrest (GO:0043111)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|positive transcription elongation factor complex b (GO:0008024)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA binding (GO:0003677)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			lung(1)	1						CATAGGGACATGAAGGCTGCT	0.602																																					p.M150T		Atlas-SNP	.											.	CDK9	22	.	0			c.T449C						.						59.0	50.0	53.0					9																	130550509		2203	4300	6503	SO:0001583	missense	1025	exon5			GGGACATGAAGGC	L25676	CCDS6879.1	9q34.1	2011-11-08	2007-11-21		ENSG00000136807	ENSG00000136807		"""Cyclin-dependent kinases"""	1780	protein-coding gene	gene with protein product		603251	"""cyclin-dependent kinase 9 (CDC2-related kinase)"""	CDC2L4		8170997, 9356449	Standard	NM_001261		Approved	PITALRE, C-2k, TAK	uc004bse.2	P50750	OTTHUMG00000020715	ENST00000373264.4:c.449T>C	chr9.hg19:g.130550509T>C	ENSP00000362361:p.Met150Thr	83.0	0.0		64.0	23.0	NM_001261	Q5JU24|Q5JU25|Q5U006|Q96TF1	Missense_Mutation	SNP	ENST00000373264.4	hg19	CCDS6879.1	.	.	.	.	.	.	.	.	.	.	T	18.49	3.634584	0.67130	.	.	ENSG00000136807	ENST00000373265;ENST00000373264	T;T	0.44482	0.92;0.92	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64670	0.2619	L	0.46157	1.445	0.80722	D	1	B	0.31318	0.319	D	0.71656	0.974	T	0.67197	-0.5731	10	0.87932	D	0	-12.7817	14.5075	0.67762	0.0:0.0:0.0:1.0	.	150	P50750	CDK9_HUMAN	T	267;150	ENSP00000362362:M267T;ENSP00000362361:M150T	ENSP00000362361:M150T	M	+	2	0	CDK9	129590330	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.636000	0.83301	2.019000	0.59389	0.443000	0.29094	ATG	.	.		0.602	CDK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054235.1		
RPS13	6207	hgsc.bcm.edu	37	11	17099170	17099170	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr11:17099170G>A	ENST00000525634.1	-	1	164	c.19C>T	c.(19-21)Ccc>Tcc	p.P7S	SNORD14B_ENST00000364533.1_RNA|PIK3C2A_ENST00000531428.1_5'Flank|SNORD14A_ENST00000606526.1_RNA|RPS13_ENST00000228140.2_Missense_Mutation_p.P7S|RPS13_ENST00000526895.1_5'UTR			P62277	RS13_HUMAN	ribosomal protein S13	7					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)	5						GCTCACCCGGGAGCATGCATG	0.647																																					p.P7S		Atlas-SNP	.											RPS13,NS,carcinoma,+2,1	RPS13	14	.	0			c.C19T						.						36.0	44.0	42.0					11																	17099170		2200	4294	6494	SO:0001583	missense	6207	exon1			ACCCGGGAGCATG	X79239	CCDS7823.1	11p	2011-04-05			ENSG00000110700	ENSG00000110700		"""S ribosomal proteins"""	10386	protein-coding gene	gene with protein product	"""40S ribosomal protein S13"""	180476				8332508, 9582194	Standard	NM_001017		Approved	S13	uc001mmp.3	P62277	OTTHUMG00000165988	ENST00000525634.1:c.19C>T	chr11.hg19:g.17099170G>A	ENSP00000435777:p.Pro7Ser	258.0	0.0		235.0	110.0	NM_001017	B2R549|P19116|Q02546|Q29200|Q498Y0	Missense_Mutation	SNP	ENST00000525634.1	hg19	CCDS7823.1	.	.	.	.	.	.	.	.	.	.	G	32	5.141462	0.94560	.	.	ENSG00000110700	ENST00000228140;ENST00000525634;ENST00000533969	T	0.22134	1.97	6.07	6.07	0.98685	Ribosomal protein S13/S15, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.20210	0.0486	L	0.35644	1.08	0.80722	D	1	B	0.02656	0.0	B	0.11329	0.006	T	0.03818	-1.1001	10	0.22706	T	0.39	.	18.417	0.90574	0.0:0.0:1.0:0.0	.	7	P62277	RS13_HUMAN	S	7	ENSP00000432096:P7S	ENSP00000228140:P7S	P	-	1	0	RPS13	17055746	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.305000	0.96197	2.884000	0.98904	0.655000	0.94253	CCC	.	.		0.647	RPS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387320.2	NM_001017	
ZNF202	7753	hgsc.bcm.edu	37	11	123598282	123598282	+	Missense_Mutation	SNP	T	T	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr11:123598282T>A	ENST00000529691.1	-	6	1073	c.854A>T	c.(853-855)gAt>gTt	p.D285V	ZNF202_ENST00000336139.4_Missense_Mutation_p.D285V|ZNF202_ENST00000530393.1_Missense_Mutation_p.D285V			O95125	ZN202_HUMAN	zinc finger protein 202	285	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		GGAGATCTCATCAGGTCTGGG	0.473																																					p.D285V		Atlas-SNP	.											.	ZNF202	72	.	0			c.A854T						.						96.0	93.0	94.0					11																	123598282		2202	4299	6501	SO:0001583	missense	7753	exon8			ATCTCATCAGGTC	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.854A>T	chr11.hg19:g.123598282T>A	ENSP00000433881:p.Asp285Val	57.0	0.0		57.0	26.0	NM_003455	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	ENST00000529691.1	hg19	CCDS8443.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.438843	0.62955	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.00976	5.48;5.48;5.48	4.73	4.73	0.59995	Krueppel-associated box (3);	0.266360	0.26816	N	0.022344	T	0.01387	0.0045	L	0.55213	1.73	0.58432	D	0.999993	B	0.29085	0.232	B	0.32533	0.147	T	0.58399	-0.7643	10	0.51188	T	0.08	-4.1193	6.9389	0.24483	0.0:0.1009:0.0:0.8991	.	285	O95125	ZN202_HUMAN	V	285	ENSP00000337724:D285V;ENSP00000432504:D285V;ENSP00000433881:D285V	ENSP00000337724:D285V	D	-	2	0	ZNF202	123103492	0.002000	0.14202	1.000000	0.80357	0.997000	0.91878	0.227000	0.17795	1.987000	0.57996	0.454000	0.30748	GAT	.	.		0.473	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387419.1	NM_003455	
SMG1	23049	hgsc.bcm.edu	37	16	18937327	18937327	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr16:18937327C>T	ENST00000446231.2	-	1	449	c.37G>A	c.(37-39)Ggc>Agc	p.G13S	SMG1_ENST00000567737.1_5'UTR|CTD-2288F12.1_ENST00000565782.1_RNA|SMG1_ENST00000389467.3_Missense_Mutation_p.G13S			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	13	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ccgccgccgccgctgcTCAGC	0.736																																					p.G13S		Atlas-SNP	.											.	SMG1	401	.	0			c.G37A						.						2.0	3.0	3.0					16																	18937327		1046	2801	3847	SO:0001583	missense	23049	exon1			CGCCGCCGCTGCT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.37G>A	chr16.hg19:g.18937327C>T	ENSP00000402515:p.Gly13Ser	78.0	0.0		92.0	5.0	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	hg19	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	c	16.19	3.051895	0.55218	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01240	5.12;5.12	4.27	3.31	0.37934	.	0.832224	0.10596	N	0.656220	T	0.00998	0.0033	N	0.14661	0.345	0.31512	N	0.663496	B	0.22346	0.068	B	0.08055	0.003	T	0.29912	-0.9996	10	0.12766	T	0.61	.	6.0417	0.19738	0.0:0.7231:0.0:0.2769	.	13	Q96Q15	SMG1_HUMAN	S	13	ENSP00000402515:G13S;ENSP00000374118:G13S	ENSP00000374118:G13S	G	-	1	0	SMG1	18844828	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.149000	0.42244	0.999000	0.39023	0.455000	0.32223	GGC	.	.		0.736	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	
ZNF267	10308	hgsc.bcm.edu	37	16	31896500	31896500	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr16:31896500C>T	ENST00000300870.10	+	3	358	c.149C>T	c.(148-150)cCg>cTg	p.P50L	ZNF267_ENST00000394846.3_Missense_Mutation_p.P50L	NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	50	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						GTCTCTAAGCCGGACCTGATC	0.408																																					p.P50L		Atlas-SNP	.											.	ZNF267	94	.	0			c.C149T						.						57.0	56.0	56.0					16																	31896500		2197	4300	6497	SO:0001583	missense	10308	exon3			CTAAGCCGGACCT	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.149C>T	chr16.hg19:g.31896500C>T	ENSP00000300870:p.Pro50Leu	127.0	0.0		105.0	7.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	hg19	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	c	0.003	-2.488876	0.00161	.	.	ENSG00000185947	ENST00000300870;ENST00000394846	T;T	0.01025	5.43;5.43	0.675	-0.981	0.10269	Krueppel-associated box (3);	.	.	.	.	T	0.03915	0.0110	M	0.86651	2.83	0.09310	N	1	D	0.76494	0.999	D	0.63283	0.913	T	0.21759	-1.0236	8	0.38643	T	0.18	.	.	.	.	.	50	Q14586	ZN267_HUMAN	L	50	ENSP00000300870:P50L;ENSP00000461286:P50L	ENSP00000300870:P50L	P	+	2	0	ZNF267	31804001	0.004000	0.15560	0.001000	0.08648	0.007000	0.05969	0.442000	0.21628	-0.418000	0.07450	-0.339000	0.08088	CCG	.	.		0.408	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
ZFP90	146198	hgsc.bcm.edu	37	16	68598406	68598406	+	Missense_Mutation	SNP	G	G	C			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr16:68598406G>C	ENST00000570495.1	+	5	2008	c.1716G>C	c.(1714-1716)gaG>gaC	p.E572D	ZFP90_ENST00000563169.2_Missense_Mutation_p.E572D|ZFP90_ENST00000398253.2_Missense_Mutation_p.E572D			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	572					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		TTCAGCATGAGAGAACTCATA	0.428																																					p.E572D		Atlas-SNP	.											.	ZFP90	67	.	0			c.G1716C						.						100.0	114.0	110.0					16																	68598406		2189	4297	6486	SO:0001583	missense	146198	exon4			GCATGAGAGAACT	AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.1716G>C	chr16.hg19:g.68598406G>C	ENSP00000460547:p.Glu572Asp	151.0	0.0		124.0	48.0	NM_133458	B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	ENST00000570495.1	hg19	CCDS42183.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556705	0.65425	.	.	ENSG00000184939	ENST00000398253	T	0.18502	2.21	5.97	5.01	0.66863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23846	0.0577	L	0.55990	1.75	0.29328	N	0.866888	P	0.52692	0.955	P	0.49085	0.6	T	0.14062	-1.0486	9	0.87932	D	0	-12.1166	8.4866	0.33076	0.1754:0.0:0.8246:0.0	.	572	Q8TF47	ZFP90_HUMAN	D	572	ENSP00000381304:E572D	ENSP00000381304:E572D	E	+	3	2	ZFP90	67155907	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	2.078000	0.41567	1.509000	0.48786	0.561000	0.74099	GAG	.	.		0.428	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436217.3	XM_085375	
GSG2	83903	hgsc.bcm.edu	37	17	3629472	3629472	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr17:3629472T>C	ENST00000325418.4	+	1	2262	c.2243T>C	c.(2242-2244)cTg>cCg	p.L748P	ITGAE_ENST00000571185.1_Intron|ITGAE_ENST00000263087.4_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	748	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										TTACATTACCTGACAGACAAG	0.418																																					p.L748P		Atlas-SNP	.											.	GSG2	48	.	0			c.T2243C						.						87.0	84.0	85.0					17																	3629472		2203	4300	6503	SO:0001583	missense	83903	exon1			ATTACCTGACAGA	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.2243T>C	chr17.hg19:g.3629472T>C	ENSP00000325290:p.Leu748Pro	122.0	0.0		100.0	4.0	NM_031965	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	ENST00000325418.4	hg19	CCDS11036.1	.	.	.	.	.	.	.	.	.	.	T	16.77	3.213988	0.58452	.	.	ENSG00000177602	ENST00000325418	T	0.13778	2.56	5.41	5.41	0.78517	Protein kinase-like domain (1);Domain of unknown function DUF3635 (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000029	T	0.43722	0.1260	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.51576	-0.8688	10	0.87932	D	0	-24.1108	13.4721	0.61287	0.0:0.0:0.0:1.0	.	748	Q8TF76	HASP_HUMAN	P	748	ENSP00000325290:L748P	ENSP00000325290:L748P	L	+	2	0	GSG2	3576221	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	5.780000	0.68956	2.184000	0.69523	0.533000	0.62120	CTG	.	.		0.418	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207391.1	NM_031965	
CCDC144NL	339184	hgsc.bcm.edu	37	17	20768818	20768818	+	Silent	SNP	A	A	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr17:20768818A>G	ENST00000327925.5	-	4	695	c.576T>C	c.(574-576)taT>taC	p.Y192Y	CCDC144NL_ENST00000539484.1_5'UTR|RP11-344E13.3_ENST00000439794.2_RNA|RP11-344E13.3_ENST00000577537.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	192										large_intestine(3)|lung(3)|skin(1)	7						GCAGATGACAATACTCTTGAA	0.358																																					p.Y192Y		Atlas-SNP	.											.	CCDC144NL	34	.	0			c.T576C						.						73.0	67.0	69.0					17																	20768818		2203	4300	6503	SO:0001819	synonymous_variant	339184	exon4			ATGACAATACTCT		CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.576T>C	chr17.hg19:g.20768818A>G		19.0	0.0		25.0	5.0	NM_001004306		Silent	SNP	ENST00000327925.5	hg19	CCDS32591.1																																																																																			.	.		0.358	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255361.2	NM_001004306	
OR1M1	125963	hgsc.bcm.edu	37	19	9204711	9204711	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr19:9204711C>T	ENST00000429566.3	+	1	857	c.791C>T	c.(790-792)tCg>tTg	p.S264L		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TGTCCCTCCTCGGTCCTCACC	0.557																																					p.S264L		Atlas-SNP	.											.	OR1M1	52	.	0			c.C791T						.						149.0	134.0	139.0					19																	9204711		2203	4300	6503	SO:0001583	missense	125963	exon1			CCTCCTCGGTCCT		CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.791C>T	chr19.hg19:g.9204711C>T	ENSP00000401966:p.Ser264Leu	76.0	0.0		68.0	7.0	NM_001004456	B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	hg19	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	c	17.14	3.312329	0.60414	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.00216	8.53	3.71	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.118256	0.38837	N	0.001550	T	0.00356	0.0011	M	0.84585	2.705	0.09310	N	1	D	0.57571	0.98	P	0.51999	0.687	T	0.41106	-0.9527	10	0.54805	T	0.06	.	8.6371	0.33955	0.0:0.8057:0.0:0.1943	.	264	Q8NGA1	OR1M1_HUMAN	L	267;264	ENSP00000401966:S264L	ENSP00000303195:S267L	S	+	2	0	OR1M1	9065711	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.376000	0.07465	0.376000	0.24707	0.580000	0.79431	TCG	.	.		0.557	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1		
SIX5	147912	hgsc.bcm.edu	37	19	46270086	46270086	+	Silent	SNP	G	G	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr19:46270086G>A	ENST00000317578.6	-	2	1512	c.1131C>T	c.(1129-1131)gcC>gcT	p.A377A	SIX5_ENST00000560168.1_3'UTR|AC074212.5_ENST00000592217.2_RNA|AC074212.5_ENST00000559756.1_RNA|AC074212.6_ENST00000590076.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	377					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		TGGTCTCGCTGGCCCCCTGAG	0.721																																					p.A377A		Atlas-SNP	.											.	SIX5	35	.	0			c.C1131T						.						4.0	4.0	4.0					19																	46270086		2064	3995	6059	SO:0001819	synonymous_variant	147912	exon2			CTCGCTGGCCCCC	L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.1131C>T	chr19.hg19:g.46270086G>A		81.0	0.0		55.0	20.0	NM_175875		Silent	SNP	ENST00000317578.6	hg19	CCDS12673.1																																																																																			.	.		0.721	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417341.3	NM_175875	
ZSCAN4	201516	hgsc.bcm.edu	37	19	58189641	58189641	+	Missense_Mutation	SNP	G	G	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr19:58189641G>A	ENST00000318203.5	+	5	1367	c.670G>A	c.(670-672)Gaa>Aaa	p.E224K		NM_152677.2	NP_689890.1	Q8NAM6	ZSCA4_HUMAN	zinc finger and SCAN domain containing 4	224					telomere maintenance via telomere lengthening (GO:0010833)|transcription, DNA-templated (GO:0006351)	nuclear chromosome, telomeric region (GO:0000784)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|liver(2)|lung(17)|ovary(1)|skin(1)|stomach(1)	30		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CATCATCCAGGAAGAGAACGG	0.423																																					p.E224K		Atlas-SNP	.											.	ZSCAN4	72	.	0			c.G670A						.						74.0	70.0	72.0					19																	58189641		2203	4300	6503	SO:0001583	missense	201516	exon5			ATCCAGGAAGAGA	AK092424	CCDS12958.1	19q13.43	2013-01-08	2004-11-01	2004-11-02		ENSG00000180532		"""-"", ""Zinc fingers, C2H2-type"""	23709	protein-coding gene	gene with protein product		613419	"""zinc finger protein 494"""	ZNF494			Standard	NM_152677		Approved	FLJ35105	uc002qpu.3	Q8NAM6		ENST00000318203.5:c.670G>A	chr19.hg19:g.58189641G>A	ENSP00000321963:p.Glu224Lys	99.0	0.0		115.0	51.0	NM_152677	Q3MIQ2	Missense_Mutation	SNP	ENST00000318203.5	hg19	CCDS12958.1	.	.	.	.	.	.	.	.	.	.	G	7.554	0.663292	0.14710	.	.	ENSG00000180532	ENST00000318203	T	0.06849	3.25	4.13	-0.41	0.12374	.	0.950149	0.08717	N	0.904015	T	0.04407	0.0121	N	0.22421	0.69	0.09310	N	1	B	0.21452	0.056	B	0.15870	0.014	T	0.47114	-0.9142	10	0.10902	T	0.67	-2.7827	3.8628	0.09004	0.3062:0.1809:0.5129:0.0	.	224	Q8NAM6	ZSCA4_HUMAN	K	224	ENSP00000321963:E224K	ENSP00000321963:E224K	E	+	1	0	ZSCAN4	62881453	0.404000	0.25328	0.000000	0.03702	0.010000	0.07245	0.479000	0.22228	0.039000	0.15632	-0.150000	0.13652	GAA	.	.		0.423	ZSCAN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466812.1	NM_152677	
EDN3	1908	hgsc.bcm.edu	37	20	57899428	57899428	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr20:57899428C>T	ENST00000337938.2	+	5	1017	c.631C>T	c.(631-633)Cac>Tac	p.H211Y	EDN3_ENST00000311585.7_3'UTR|EDN3_ENST00000395654.3_Missense_Mutation_p.H197Y|EDN3_ENST00000371028.2_Missense_Mutation_p.H211Y|EDN3_ENST00000371025.3_3'UTR	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	211					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					TTTAGACCTCCACCATCCAAA	0.532																																					p.H211Y		Atlas-SNP	.											.	EDN3	83	.	0			c.C631T						.						108.0	111.0	110.0					20																	57899428		2203	4300	6503	SO:0001583	missense	1908	exon5			GACCTCCACCATC	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.631C>T	chr20.hg19:g.57899428C>T	ENSP00000337128:p.His211Tyr	143.0	0.0		127.0	60.0	NM_207034	E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	ENST00000337938.2	hg19	CCDS13477.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528713	0.27387	.	.	ENSG00000124205	ENST00000337938;ENST00000371028;ENST00000395654	D;D;D	0.95949	-2.13;-2.13;-3.86	4.78	2.84	0.33178	.	315.406000	0.00166	N	0.000000	D	0.92740	0.7692	L	0.34521	1.04	0.09310	N	1	P;P	0.42518	0.782;0.675	B;B	0.40444	0.329;0.176	D	0.84887	0.0834	10	0.52906	T	0.07	.	7.5959	0.28048	0.0:0.8062:0.0:0.1938	.	197;211	P14138-2;P14138	.;EDN3_HUMAN	Y	211;211;197	ENSP00000337128:H211Y;ENSP00000360067:H211Y;ENSP00000379015:H197Y	ENSP00000337128:H211Y	H	+	1	0	EDN3	57332823	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.215000	0.17562	0.733000	0.32492	-0.140000	0.14226	CAC	.	.		0.532	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2	NM_000114	
FBLN1	2192	hgsc.bcm.edu	37	22	45937218	45937218	+	Silent	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr22:45937218C>T	ENST00000327858.6	+	9	1127	c.1032C>T	c.(1030-1032)ggC>ggT	p.G344G	FBLN1_ENST00000442170.2_Silent_p.G344G|FBLN1_ENST00000348697.2_Silent_p.G344G|FBLN1_ENST00000402984.3_Silent_p.G382G|FBLN1_ENST00000476366.1_3'UTR|FBLN1_ENST00000262722.7_Silent_p.G344G|FBLN1_ENST00000340923.5_Silent_p.G344G	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1	344	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		GTGGCCGTGGCTACCATCTCA	0.527																																					p.G344G		Atlas-SNP	.											.	FBLN1	143	.	0			c.C1032T						.						119.0	97.0	105.0					22																	45937218		2203	4300	6503	SO:0001819	synonymous_variant	2192	exon9			CCGTGGCTACCAT		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1032C>T	chr22.hg19:g.45937218C>T		108.0	0.0		108.0	40.0	NM_006487	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Silent	SNP	ENST00000327858.6	hg19	CCDS14067.1																																																																																			.	.		0.527	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322287.1	NM_006486	
CELSR1	9620	hgsc.bcm.edu	37	22	46930896	46930896	+	Silent	SNP	G	G	A			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr22:46930896G>A	ENST00000262738.3	-	1	2171	c.2172C>T	c.(2170-2172)ctC>ctT	p.L724L	CELSR1_ENST00000497509.1_5'Flank|CELSR1_ENST00000395964.1_Silent_p.L724L	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	724	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGCCGCCTGTGAGCTGGTAGG	0.637																																					p.L724L		Atlas-SNP	.											.	CELSR1	242	.	0			c.C2172T						.						57.0	39.0	45.0					22																	46930896		2201	4299	6500	SO:0001819	synonymous_variant	9620	exon1			GCCTGTGAGCTGG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.2172C>T	chr22.hg19:g.46930896G>A		54.0	0.0		33.0	14.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Silent	SNP	ENST00000262738.3	hg19	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	0.128	-1.117159	0.01799	.	.	ENSG00000075275	ENST00000454637	.	.	.	4.51	0.798	0.18660	.	.	.	.	.	T	0.58836	0.2150	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54576	-0.8273	4	.	.	.	.	11.0373	0.47808	0.0846:0.4365:0.4788:0.0	.	.	.	.	L	99	.	.	S	-	2	0	CELSR1	45309560	0.999000	0.42202	0.993000	0.49108	0.070000	0.16714	0.393000	0.20817	0.315000	0.23110	0.305000	0.20034	TCA	.	.		0.637	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
PLXNB2	23654	hgsc.bcm.edu	37	22	50718956	50718956	+	Missense_Mutation	SNP	C	C	G			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr22:50718956C>G	ENST00000449103.1	-	25	4277	c.4137G>C	c.(4135-4137)caG>caC	p.Q1379H	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_Missense_Mutation_p.Q1379H			O15031	PLXB2_HUMAN	plexin B2	1379					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCACCACGTACTGCTCCAGGA	0.672																																					p.Q1379H		Atlas-SNP	.											.	PLXNB2	172	.	0			c.G4137C						.						82.0	88.0	86.0					22																	50718956		2191	4295	6486	SO:0001583	missense	23654	exon25			CACGTACTGCTCC		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4137G>C	chr22.hg19:g.50718956C>G	ENSP00000409171:p.Gln1379His	59.0	0.0		54.0	17.0	NM_012401	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	ENST00000449103.1	hg19	CCDS43035.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.562678	0.45694	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399964	T;T	0.12255	2.7;2.7	4.28	4.28	0.50868	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000003	T	0.23410	0.0566	L	0.51422	1.61	0.44234	D	0.997079	P	0.45428	0.858	P	0.57960	0.83	T	0.00380	-1.1776	10	0.37606	T	0.19	.	8.4285	0.32744	0.0:0.8239:0.0:0.1761	.	1379	O15031	PLXB2_HUMAN	H	1379;1379;11	ENSP00000409171:Q1379H;ENSP00000352288:Q1379H	ENSP00000352288:Q1379H	Q	-	3	2	PLXNB2	49061083	0.989000	0.36119	1.000000	0.80357	0.988000	0.76386	0.289000	0.18957	2.366000	0.80165	0.561000	0.74099	CAG	.	.		0.672	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316874.3	NM_012401	
KAL1	3730	hgsc.bcm.edu	37	X	8504916	8504916	+	Missense_Mutation	SNP	C	C	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chrX:8504916C>T	ENST00000262648.3	-	11	1666	c.1517G>A	c.(1516-1518)cGg>cAg	p.R506Q	KAL1_ENST00000481896.1_5'UTR	NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	506	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						ACTTTTTGGCCGTATTGGTTG	0.443																																					p.R506Q		Atlas-SNP	.											.	KAL1	78	.	0			c.G1517A						.						132.0	109.0	117.0					X																	8504916		2203	4300	6503	SO:0001583	missense	3730	exon11			TTTGGCCGTATTG		CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.1517G>A	chrX.hg19:g.8504916C>T	ENSP00000262648:p.Arg506Gln	217.0	0.0		211.0	83.0	NM_000216	B2RPF8	Missense_Mutation	SNP	ENST00000262648.3	hg19	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	C	4.781	0.145252	0.09134	.	.	ENSG00000011201	ENST00000262648	T	0.53857	0.6	3.99	2.14	0.27477	Fibronectin, type III (2);	0.434585	0.26079	N	0.026467	T	0.38639	0.1048	M	0.62723	1.935	0.22926	N	0.998559	P	0.37233	0.588	B	0.29942	0.109	T	0.20371	-1.0277	10	0.22706	T	0.39	-6.8111	4.9608	0.14065	0.0:0.6052:0.1733:0.2215	.	506	P23352	KALM_HUMAN	Q	506	ENSP00000262648:R506Q	ENSP00000262648:R506Q	R	-	2	0	KAL1	8464916	0.851000	0.29673	0.010000	0.14722	0.136000	0.21042	0.573000	0.23699	0.087000	0.17167	-0.198000	0.12761	CGG	.	.		0.443	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	
CFP	5199	hgsc.bcm.edu	37	X	47483694	47483694	+	Missense_Mutation	SNP	G	G	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chrX:47483694G>T	ENST00000396992.3	-	9	1510	c.1390C>A	c.(1390-1392)Cct>Act	p.P464T	CFP_ENST00000247153.3_Missense_Mutation_p.P464T	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	464					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						TCTTCCTCAGGGTCTTTGCAA	0.542																																					p.P464T		Atlas-SNP	.											.	CFP	43	.	0			c.C1390A						.						259.0	177.0	204.0					X																	47483694		2203	4300	6503	SO:0001583	missense	5199	exon9			CCTCAGGGTCTTT	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.1390C>A	chrX.hg19:g.47483694G>T	ENSP00000380189:p.Pro464Thr	151.0	0.0		147.0	63.0	NM_001145252	O15134|O15135|O15136|O75826	Missense_Mutation	SNP	ENST00000396992.3	hg19	CCDS14282.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495704	0.64186	.	.	ENSG00000126759	ENST00000396992;ENST00000247153	T;T	0.43294	0.95;0.95	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000001	T	0.60327	0.2260	M	0.64997	1.995	0.35791	D	0.822416	D	0.76494	0.999	D	0.85130	0.997	T	0.70249	-0.4924	10	0.72032	D	0.01	.	12.5877	0.56426	0.0:0.0:1.0:0.0	.	464	P27918	PROP_HUMAN	T	464	ENSP00000380189:P464T;ENSP00000247153:P464T	ENSP00000247153:P464T	P	-	1	0	CFP	47368638	1.000000	0.71417	0.972000	0.41901	0.699000	0.40488	2.579000	0.46059	2.465000	0.83290	0.529000	0.55759	CCT	.	.		0.542	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2	NM_002621	
MT-ND4	4538	hgsc.bcm.edu	37	M	11301	11301	+	Missense_Mutation	SNP	T	T	C			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chrM:11301T>C	ENST00000361381.2	+	1	542	c.542T>C	c.(541-543)cTc>cCc	p.L181P	MT-ND5_ENST00000361567.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	181					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						ACTACTCACTCTCACTGCCCA	0.413																																					p.L181P		Atlas-SNP	.											.	.	.	.	0			c.T542C						.																																			SO:0001583	missense	0	exon1			TCACTCTCACTGC			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.542T>C	chrM.hg19:g.11301T>C	ENSP00000354961:p.Leu181Pro	10.0	0.0		65.0	5.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.413	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
BMP2K	55589	hgsc.bcm.edu	37	4	79792095	79792115	+	In_Frame_Del	DEL	CAGCAGCAGCAGCAACAGCAA	CAGCAGCAGCAGCAACAGCAA	-	rs375179282|rs534035187|rs553571896	byFrequency	TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	CAGCAGCAGCAGCAACAGCAA	CAGCAGCAGCAGCAACAGCAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr4:79792095_79792115delCAGCAGCAGCAGCAACAGCAA	ENST00000335016.5	+	11	1556_1576	c.1390_1410delCAGCAGCAGCAGCAACAGCAA	c.(1390-1410)cagcagcagcagcaacagcaadel	p.QQQQQQQ478del	BMP2K_ENST00000502871.1_In_Frame_Del_p.QQQQQQQ478del	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	478	Gln/His-rich.			Missing (in Ref. 2; CAB70863). {ECO:0000305}.|Q -> R (in Ref. 4; AAH36021). {ECO:0000305}.	regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						gcagcagcagcagcagcagcagcaacagcaacagcagcagc	0.557																																					p.463_470del		Atlas-INDEL	.											.	BMP2K	169	.	0			c.1389_1409del						.																																			SO:0001651	inframe_deletion	55589	exon11			.	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1390_1410delCAGCAGCAGCAGCAACAGCAA	chr4.hg19:g.79792095_79792115delCAGCAGCAGCAGCAACAGCAA	ENSP00000334836:p.Gln478_Gln484del	27.0	0.0		34.0	10.0	NM_017593	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	In_Frame_Del	DEL	ENST00000335016.5	hg19	CCDS47083.1																																																																																			.	.		0.557	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_017593	
IL6ST	3572	hgsc.bcm.edu	37	5	55260054	55260065	+	In_Frame_Del	DEL	TTGACAAAATAC	TTGACAAAATAC	-			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	TTGACAAAATAC	TTGACAAAATAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr5:55260054_55260065delTTGACAAAATAC	ENST00000381298.2	-	6	879_890	c.567_578delGTATTTTGTCAA	c.(565-579)gtgtattttgtcaac>gtc	p.YFVN190del	IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000522633.2_In_Frame_Del_p.YFVN190del|IL6ST_ENST00000381294.3_In_Frame_Del_p.YFVN190del|IL6ST_ENST00000577363.1_5'UTR|IL6ST_ENST00000536319.1_In_Frame_Del_p.YFVN190del|IL6ST_ENST00000336909.5_In_Frame_Del_p.YFVN190del|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000381287.4_In_Frame_Del_p.YFVN190del|IL6ST_ENST00000502326.3_In_Frame_Del_p.YFVN190del|IL6ST_ENST00000396816.1_In_Frame_Del_p.47_51CILST>S	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	190	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)	p.N193delN(1)|p.Y186_Y190delYSTVY(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				GACTTCAATGTTGACAAAATACACAGTAGAAT	0.368			O		hepatocellular ca																																p.190_193del		Atlas-INDEL	.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.,1	IL6ST	75	.	2	Deletion - In frame(2)	liver(2)	c.568_579del						.																																			SO:0001651	inframe_deletion	3572	exon6			.	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.567_578delGTATTTTGTCAA	chr5.hg19:g.55260054_55260065delTTGACAAAATAC	ENSP00000370698:p.Tyr190_Asn193del	165.0	0.0		193.0	73.0	NM_002184	A0N0L4|Q5FC04|Q9UQ41	In_Frame_Del	DEL	ENST00000381298.2	hg19	CCDS3971.1																																																																																			.	.		0.368	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
STARD8	9754	hgsc.bcm.edu	37	X	67938119	67938126	+	Frame_Shift_Del	DEL	TGGGCCCA	TGGGCCCA	-			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	TGGGCCCA	TGGGCCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chrX:67938119_67938126delTGGGCCCA	ENST00000252336.6	+	5	1495_1502	c.1123_1130delTGGGCCCA	c.(1123-1131)tgggcccagfs	p.WAQ375fs	STARD8_ENST00000374599.3_Frame_Shift_Del_p.WAQ455fs|STARD8_ENST00000374597.3_Frame_Shift_Del_p.WAQ375fs	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	375					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						GTCCCCAGCCTGGGCCCAGGCTGAAGTC	0.644																																					p.454_457del		Atlas-INDEL	.											.	STARD8	282	.	0			c.1362_1369del						.																																			SO:0001589	frameshift_variant	9754	exon6			.	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1123_1130delTGGGCCCA	chrX.hg19:g.67938119_67938126delTGGGCCCA	ENSP00000252336:p.Trp375fs	190.0	0.0		175.0	60.0	NM_001142503	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Frame_Shift_Del	DEL	ENST00000252336.6	hg19	CCDS14390.1																																																																																			.	.		0.644	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057026.2	NM_014725	
TAF10	6881	hgsc.bcm.edu	37	11	6636106	6636107	+	5'Flank	INS	-	-	C	rs1128396	byFrequency	TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr11:6636106_6636107insC	ENST00000299424.4	-	0	0				TPP1_ENST00000534644.1_5'Flank|TAF10_ENST00000531760.1_5'Flank|TPP1_ENST00000533371.1_Frame_Shift_Ins_p.G271fs|TPP1_ENST00000299427.6_Frame_Shift_Ins_p.G514fs	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa						chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)						Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CATCAAAGAGTCCTGCCCCATG	0.535																																					p.G514fs		Atlas-INDEL	.											.	TPP1	71	.	0			c.1542_1543insG						.																																			SO:0001631	upstream_gene_variant	1200	exon12			.	U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402		chr11.hg19:g.6636108_6636108dupC	Exception_encountered	97.0	0.0		72.0	27.0	NM_000391	O00703|Q13175|Q6FH13	Frame_Shift_Ins	INS	ENST00000299424.4	hg19	CCDS7769.1																																																																																			.	.		0.535	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257259.2	NM_006284	
FARP1	10160	hgsc.bcm.edu	37	13	98896955	98896956	+	Intron	INS	-	-	T			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr13:98896955_98896956insT	ENST00000319562.6	+	2	436				FARP1_ENST00000376586.2_Intron|FARP1_ENST00000595437.1_Intron|FARP1_ENST00000376581.5_Frame_Shift_Ins_p.L128fs	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)						dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			GCTTCTTAATCTTTTTTGAGTC	0.381																																					p.L128fs		Atlas-INDEL	.											.	FARP1	207	.	0			c.382_383insT						.																																			SO:0001627	intron_variant	10160	exon3			.	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.171+31288->T	chr13.hg19:g.98896961_98896961dupT		84.0	0.0		75.0	23.0	NM_001001715	Q5JVI9|Q6IQ29	Frame_Shift_Ins	INS	ENST00000319562.6	hg19	CCDS9487.1																																																																																			.	.		0.381	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
BASP1	10409	hgsc.bcm.edu	37	5	17275402	17275403	+	Frame_Shift_Ins	INS	-	-	CGAGGGCG			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr5:17275402_17275403insCGAGGGCG	ENST00000322611.3	+	2	337_338	c.77_78insCGAGGGCG	c.(76-81)gccgagfs	p.-29fs		NM_001271606.1|NM_006317.3	NP_001258535.1|NP_006308.3	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein 1						diaphragm development (GO:0060539)|glomerular visceral epithelial cell differentiation (GO:0072112)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchyme development (GO:0072075)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of heart growth (GO:0060421)|positive regulation of metanephric ureteric bud development (GO:2001076)|substantia nigra development (GO:0021762)|thorax and anterior abdomen determination (GO:0007356)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(8)	9						GACAAGAAGGCCGAGGGCGCGG	0.614																																					p.A26fs		Atlas-INDEL	.											.	BASP1	29	.	0			c.77_78insCGAGGGCG						.																																			SO:0001589	frameshift_variant	10409	exon2			.	AF039656	CCDS3888.1	5p15.1	2010-12-03			ENSG00000176788	ENSG00000176788			957	protein-coding gene	gene with protein product		605940				9310187, 9749536	Standard	NM_001271606		Approved	NAP-22, NAP22, CAP23, CAP-23	uc031siz.1	P80723	OTTHUMG00000131061	ENST00000322611.3:c.78_85dupCGAGGGCG	chr5.hg19:g.17275403_17275410dupCGAGGGCG	ENSP00000319281:p.Ala29fs	327.0	0.0		393.0	52.0	NM_006317	B4DJA8|D3DTD5|O43596|Q5U0S0|Q9BWA5	Frame_Shift_Ins	INS	ENST00000322611.3	hg19	CCDS3888.1																																																																																			.	.		0.614	BASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253716.2		
CDKL4	344387	hgsc.bcm.edu	37	2	39452979	39452979	+	Splice_Site	DEL	C	C	-			TCGA-WX-AA47-01A-11D-A38X-10	TCGA-WX-AA47-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dab9728a-5871-4bb0-9ae4-8c6b4885000f	e0c88f8e-49d8-413f-be0d-85b5e3e27b15	g.chr2:39452979delC	ENST00000395035.3	-	2	290		c.e2+1		CDKL4_ENST00000378803.1_Splice_Site			Q5MAI5	CDKL4_HUMAN	cyclin-dependent kinase-like 4							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|large_intestine(2)|liver(1)|lung(7)|ovary(1)	12		all_hematologic(82;0.248)				AGATTACTTACCCATTTGGGT	0.373																																					.		Atlas-INDEL	.											.	CDKL4	30	.	0			c.290+2G>-						.						66.0	65.0	65.0					2																	39452979		2202	4299	6501	SO:0001630	splice_region_variant	344387	exon3			.		CCDS33184.1	2p22.3	2011-11-04			ENSG00000205111	ENSG00000205111		"""Cyclin-dependent kinases"""	19287	protein-coding gene	gene with protein product							Standard	NM_001009565		Approved		uc002rrm.3	Q5MAI5	OTTHUMG00000133574	ENST00000395035.3:c.290+1G>-	chr2.hg19:g.39452979delC		59.0	0.0		73.0	26.0	NM_001009565	Q2NME9	Splice_Site	DEL	ENST00000395035.3	hg19																																																																																				.	.		0.373	CDKL4-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000331655.1	XM_293029	Intron
