#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NADK	65220	hgsc.bcm.edu	37	1	1684346	1684346	+	Silent	SNP	G	G	C			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr1:1684346G>C	ENST00000341426.5	-	12	1559	c.1338C>G	c.(1336-1338)ggC>ggG	p.G446G	NADK_ENST00000378625.1_Silent_p.G591G|NADK_ENST00000342348.5_Silent_p.G414G|NADK_ENST00000344463.4_Silent_p.G591G|NADK_ENST00000341991.3_Silent_p.G446G	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase	446				G -> EG (in Ref. 3; BAH12420). {ECO:0000305}.	ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		GCTTGACCTAGCcctcctcct	0.627																																					p.G591G		Atlas-SNP	.											.	NADK	79	.	0			c.C1773G						.						26.0	23.0	24.0					1																	1684346		2202	4300	6502	SO:0001819	synonymous_variant	65220	exon14			GACCTAGCCCTCC	BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.1338C>G	chr1.hg19:g.1684346G>C		99.0	0.0		65.0	6.0	NM_001198994	A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Silent	SNP	ENST00000341426.5	hg19	CCDS30565.1																																																																																			.	.		0.627	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002769.1	NM_023018	
CLIP4	79745	hgsc.bcm.edu	37	2	29366594	29366594	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr2:29366594C>A	ENST00000320081.5	+	7	923	c.668C>A	c.(667-669)cCt>cAt	p.P223H	CLIP4_ENST00000404424.1_Missense_Mutation_p.P223H|CLIP4_ENST00000401617.2_Missense_Mutation_p.P116H|CLIP4_ENST00000401605.1_Missense_Mutation_p.P223H	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	223										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					GGACAGATCCCTGCTGATGTT	0.418																																					p.P223H		Atlas-SNP	.											.	CLIP4	69	.	0			c.C668A						.						83.0	85.0	84.0					2																	29366594		2203	4300	6503	SO:0001583	missense	79745	exon7			AGATCCCTGCTGA	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.668C>A	chr2.hg19:g.29366594C>A	ENSP00000327009:p.Pro223His	177.0	0.0		129.0	57.0	NM_024692	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Missense_Mutation	SNP	ENST00000320081.5	hg19	CCDS1770.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543573	0.86022	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	T;T;T;T	0.61274	0.12;0.12;0.12;0.12	5.5	5.5	0.81552	Ankyrin repeat-containing domain (3);	0.052984	0.85682	D	0.000000	T	0.75824	0.3902	M	0.75264	2.295	0.80722	D	1	D;D	0.71674	0.998;0.998	P;D	0.63703	0.879;0.917	T	0.78507	-0.2177	10	0.87932	D	0	.	19.3951	0.94604	0.0:1.0:0.0:0.0	.	223;223	A8K6D0;Q8N3C7	.;CLIP4_HUMAN	H	223;116;223;223;223;224;205	ENSP00000384242:P223H;ENSP00000385148:P116H;ENSP00000385594:P223H;ENSP00000327009:P223H	ENSP00000327009:P223H	P	+	2	0	CLIP4	29220098	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.818000	0.86416	2.571000	0.86741	0.655000	0.94253	CCT	.	.		0.418	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
SIX2	10736	hgsc.bcm.edu	37	2	45235916	45235916	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr2:45235916G>A	ENST00000303077.6	-	1	653	c.334C>T	c.(334-336)Cgc>Tgc	p.R112C		NM_016932.4	NP_058628.3	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	112					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|kidney development (GO:0001822)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesenchymal stem cell proliferation (GO:0097168)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|middle ear morphogenesis (GO:0042474)|nephron development (GO:0072006)|nephron morphogenesis (GO:0072028)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus (GO:0006606)|regulation of branching involved in ureteric bud morphogenesis (GO:0090189)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|large_intestine(3)|lung(8)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	22		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AATTTGCGGCGCACGCGGTAT	0.657																																					p.R112C		Atlas-SNP	.											.	SIX2	39	.	0			c.C334T						.						40.0	44.0	42.0					2																	45235916		2203	4300	6503	SO:0001583	missense	10736	exon1			TGCGGCGCACGCG	AF136939	CCDS1822.1	2p21	2011-06-20	2007-07-13		ENSG00000170577	ENSG00000170577		"""Homeoboxes / SINE class"""	10888	protein-coding gene	gene with protein product		604994	"""sine oculis homeobox (Drosophila) homolog 2"", ""sine oculis homeobox homolog 2 (Drosophila)"""				Standard	NM_016932		Approved		uc002ruo.3	Q9NPC8	OTTHUMG00000152421	ENST00000303077.6:c.334C>T	chr2.hg19:g.45235916G>A	ENSP00000304502:p.Arg112Cys	103.0	0.0		102.0	6.0	NM_016932	Q9BXH7	Missense_Mutation	SNP	ENST00000303077.6	hg19	CCDS1822.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980571	0.92982	.	.	ENSG00000170577	ENST00000303077	D	0.91740	-2.9	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.97504	0.9183	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99331	1.0909	10	0.87932	D	0	-31.7345	16.9715	0.86301	0.0:0.0:1.0:0.0	.	112;112	Q8TBA2;Q9NPC8	.;SIX2_HUMAN	C	112	ENSP00000304502:R112C	ENSP00000304502:R112C	R	-	1	0	SIX2	45089420	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.674000	0.74487	2.081000	0.62600	0.462000	0.41574	CGC	.	.		0.657	SIX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326188.2		
MMRN1	22915	hgsc.bcm.edu	37	4	90857798	90857798	+	Silent	SNP	G	G	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr4:90857798G>A	ENST00000394980.1	+	7	3286	c.2967G>A	c.(2965-2967)tcG>tcA	p.S989S	MMRN1_ENST00000508372.1_Silent_p.S731S|MMRN1_ENST00000264790.2_Silent_p.S989S|MMRN1_ENST00000394981.1_Intron			Q13201	MMRN1_HUMAN	multimerin 1	989					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TAGATCGATCGTTGCCTGGTA	0.353																																					p.S989S		Atlas-SNP	.											.	MMRN1	174	.	0			c.G2967A						.						59.0	63.0	62.0					4																	90857798		2203	4298	6501	SO:0001819	synonymous_variant	22915	exon6			TCGATCGTTGCCT	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2967G>A	chr4.hg19:g.90857798G>A		215.0	0.0		173.0	33.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	hg19	CCDS3635.1																																																																																			.	.		0.353	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
GPM6A	2823	hgsc.bcm.edu	37	4	176556161	176556161	+	Silent	SNP	G	G	A	rs141777363	byFrequency	TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr4:176556161G>A	ENST00000280187.7	-	8	777	c.732C>T	c.(730-732)gaC>gaT	p.D244D	GPM6A_ENST00000393658.2_Silent_p.D244D|GPM6A_ENST00000506219.1_5'UTR|GPM6A_ENST00000515090.1_Silent_p.D237D|GPM6A_ENST00000506894.1_Silent_p.D233D	NM_005277.4	NP_005268.1	P51674	GPM6A_HUMAN	glycoprotein M6A	244					neural retina development (GO:0003407)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|positive regulation of filopodium assembly (GO:0051491)|stem cell differentiation (GO:0048863)|synapse assembly (GO:0007416)	axonal growth cone (GO:0044295)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium channel activity (GO:0005262)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		TCCGGCAGGCGTCTTTCACAT	0.428													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17428	0.0		0.0	False		,,,				2504	0.001				p.D244D		Atlas-SNP	.											.	GPM6A	70	.	0			c.C732T						.	G	,,	0,4406		0,0,2203	85.0	78.0	80.0		732,732,699	0.3	1.0	4	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	GPM6A	NM_005277.3,NM_201591.1,NM_201592.1	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	244/279,244/279,233/268	176556161	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2823	exon7			GCAGGCGTCTTTC		CCDS3824.1, CCDS54822.1, CCDS58936.1	4q34	2008-08-29				ENSG00000150625			4460	protein-coding gene	gene with protein product		601275		GPM6		8661015, 18574501	Standard	NM_005277		Approved		uc003iug.4	P51674		ENST00000280187.7:c.732C>T	chr4.hg19:g.176556161G>A		69.0	0.0		48.0	15.0	NM_201591	B7Z642|E9PHI5|Q92602	Silent	SNP	ENST00000280187.7	hg19	CCDS3824.1																																																																																			.	G|1.000;A|0.000		0.428	GPM6A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362163.1		
EIF2AK1	27102	hgsc.bcm.edu	37	7	6064424	6064424	+	Silent	SNP	G	G	T			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr7:6064424G>T	ENST00000199389.6	-	15	1919	c.1773C>A	c.(1771-1773)ctC>ctA	p.L591L	EIF2AK1_ENST00000536084.1_Silent_p.L467L	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	591					negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		TCTGTAGGGTGAGGTTAACCT	0.383																																					p.L591L		Atlas-SNP	.											.	EIF2AK1	76	.	0			c.C1773A						.						121.0	105.0	110.0					7																	6064424		2203	4300	6503	SO:0001819	synonymous_variant	27102	exon15			TAGGGTGAGGTTA	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1773C>A	chr7.hg19:g.6064424G>T		65.0	0.0		76.0	4.0	NM_014413	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Silent	SNP	ENST00000199389.6	hg19	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	G	2.091	-0.408431	0.04832	.	.	ENSG00000086232	ENST00000422786	.	.	.	5.49	1.14	0.20703	.	.	.	.	.	T	0.24812	0.0602	.	.	.	0.27146	N	0.961534	.	.	.	.	.	.	T	0.24693	-1.0153	4	.	.	.	-11.5986	4.6152	0.12422	0.444:0.1642:0.3918:0.0	.	.	.	.	N	43	.	.	H	-	1	0	EIF2AK1	6030950	0.960000	0.32886	0.886000	0.34754	0.459000	0.32528	0.550000	0.23345	0.040000	0.15660	-0.262000	0.10625	CAC	.	.		0.383	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
AHR	196	hgsc.bcm.edu	37	7	17362177	17362177	+	Silent	SNP	A	A	G			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr7:17362177A>G	ENST00000242057.4	+	3	949	c.306A>G	c.(304-306)agA>agG	p.R102R		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	102					apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	ATAACTGTAGAGCAGCAAATT	0.333																																					p.R102R		Atlas-SNP	.											.	AHR	89	.	0			c.A306G						.						67.0	68.0	68.0					7																	17362177		2203	4299	6502	SO:0001819	synonymous_variant	196	exon3			CTGTAGAGCAGCA	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.306A>G	chr7.hg19:g.17362177A>G		567.0	0.0		641.0	30.0	NM_001621	A4D130|Q13728|Q13803|Q13804	Silent	SNP	ENST00000242057.4	hg19	CCDS5366.1																																																																																			.	.		0.333	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
LRRC4	64101	hgsc.bcm.edu	37	7	127669904	127669904	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr7:127669904C>T	ENST00000249363.3	-	2	1047	c.790G>A	c.(790-792)Ggg>Agg	p.G264R	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	264					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.G264W(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		GAAGCCAGCCCGTCAAAAGCA	0.547																																					p.G264R		Atlas-SNP	.											LRRC4,colon,carcinoma,0,1	LRRC4	72	.	1	Substitution - Missense(1)	large_intestine(1)	c.G790A						.						68.0	51.0	57.0					7																	127669904		2203	4299	6502	SO:0001583	missense	64101	exon2			CCAGCCCGTCAAA	AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.790G>A	chr7.hg19:g.127669904C>T	ENSP00000249363:p.Gly264Arg	145.0	0.0		122.0	27.0	NM_022143	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Missense_Mutation	SNP	ENST00000249363.3	hg19	CCDS5799.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466287	0.63625	.	.	ENSG00000128594	ENST00000249363	T	0.62364	0.03	4.7	4.7	0.59300	.	0.331492	0.27340	N	0.019812	T	0.65048	0.2654	M	0.66939	2.045	0.50632	D	0.999886	D	0.55800	0.973	P	0.46389	0.515	T	0.67043	-0.5770	10	0.37606	T	0.19	.	15.1891	0.73028	0.0:1.0:0.0:0.0	.	264	Q9HBW1	LRRC4_HUMAN	R	264	ENSP00000249363:G264R	ENSP00000249363:G264R	G	-	1	0	LRRC4	127457140	0.998000	0.40836	0.998000	0.56505	0.988000	0.76386	3.954000	0.56708	2.408000	0.81797	0.655000	0.94253	GGG	.	.		0.547	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349170.1	NM_022143	
IRF5	3663	hgsc.bcm.edu	37	7	128587359	128587359	+	Missense_Mutation	SNP	A	A	G	rs566635242|rs199508964|rs60344245	byFrequency	TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr7:128587359A>G	ENST00000402030.2	+	6	581	c.509A>G	c.(508-510)cAg>cGg	p.Q170R	IRF5_ENST00000473745.1_Missense_Mutation_p.Q170R|IRF5_ENST00000357234.5_Missense_Mutation_p.Q186R|IRF5_ENST00000477535.1_Intron|IRF5_ENST00000249375.4_Missense_Mutation_p.Q170R	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	170					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						CCCACTCTGCAGCCGCCCACT	0.657													A|||	1	0.000199681	0.0	0.0014	5008	,	,		13852	0.0		0.0	False		,,,				2504	0.0				p.Q186R		Atlas-SNP	.											.	IRF5	40	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.A557G						.						9.0	11.0	10.0					7																	128587359		2119	4233	6352	SO:0001583	missense	3663	exon6			CTCTGCAGCCGCC		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.509A>G	chr7.hg19:g.128587359A>G	ENSP00000385352:p.Gln170Arg	145.0	0.0		131.0	10.0	NM_001098629	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	ENST00000402030.2	hg19	CCDS5808.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.282|1.282	-0.609995|-0.609995	0.03690|0.03690	.|.	.|.	ENSG00000128604|ENSG00000128604	ENST00000357234;ENST00000402030;ENST00000249375;ENST00000473745;ENST00000412326|ENST00000430204	D;D;D;D|.	0.97328|.	-4.34;-4.31;-4.31;-4.31|.	0.128|0.128	0.128|0.128	0.14733|0.14733	.|.	2.402420|.	0.02158|.	N|.	0.058537|.	T|T	0.23451|0.23451	0.0567|0.0567	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;.|.	0.02656|.	0.0;.|.	B;.|.	0.01281|.	0.0;.|.	T|T	0.27020|0.27020	-1.0086|-1.0086	9|5	0.10636|0.30854	T|T	0.68|0.27	.|.	.|.	.|.	.|.	.|.	170;186|159	Q13568;Q13568-2|E9PC81	IRF5_HUMAN;.|.	R|G	186;170;170;170;170|159	ENSP00000349770:Q186R;ENSP00000385352:Q170R;ENSP00000249375:Q170R;ENSP00000419149:Q170R|.	ENSP00000249375:Q170R|ENSP00000409106:S159G	Q|S	+|+	2|1	0|0	IRF5|IRF5	128374595|128374595	0.021000|0.021000	0.18746|0.18746	0.470000|0.470000	0.27216|0.27216	0.091000|0.091000	0.18340|0.18340	0.271000|0.271000	0.18626|0.18626	0.243000|0.243000	0.21327|0.21327	0.240000|0.240000	0.17902|0.17902	CAG|AGC	.	.		0.657	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
IRF5	3663	hgsc.bcm.edu	37	7	128587366	128587366	+	Silent	SNP	C	C	T	rs534043449|rs199508964|rs60344245	byFrequency	TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr7:128587366C>T	ENST00000402030.2	+	6	588	c.516C>T	c.(514-516)ccC>ccT	p.P172P	IRF5_ENST00000473745.1_Silent_p.P172P|IRF5_ENST00000357234.5_Silent_p.P188P|IRF5_ENST00000477535.1_Intron|IRF5_ENST00000249375.4_Silent_p.P172P	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	172					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						TGCAGCCGCCCACTCTGCGGC	0.657													C|||	3	0.000599042	0.0	0.0014	5008	,	,		12915	0.001		0.001	False		,,,				2504	0.0				p.P188P		Atlas-SNP	.											.	IRF5	40	.	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)	c.C564T						.						8.0	9.0	9.0					7																	128587366		2090	4208	6298	SO:0001819	synonymous_variant	3663	exon6			GCCGCCCACTCTG		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.516C>T	chr7.hg19:g.128587366C>T		129.0	0.0		131.0	17.0	NM_001098629	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Silent	SNP	ENST00000402030.2	hg19	CCDS5808.1	.	.	.	.	.	.	.	.	.	.	C	3.008	-0.204506	0.06180	.	.	ENSG00000128604	ENST00000430204	.	.	.	.	.	.	.	0.400804	0.18480	N	0.139975	T	0.13286	0.0322	.	.	.	0.19775	N	0.999958	.	.	.	.	.	.	T	0.29792	-1.0000	4	0.07644	T	0.81	.	.	.	.	.	161	E9PC81	.	L	161	.	ENSP00000409106:P161L	P	+	2	0	IRF5	128374602	0.023000	0.18921	0.251000	0.24312	0.062000	0.15995	0.105000	0.15333	0.119000	0.18210	0.121000	0.15741	CCA	.	.		0.657	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350934.1	NM_001098627	
PODXL	5420	hgsc.bcm.edu	37	7	131241035	131241035	+	Silent	SNP	C	C	G	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr7:131241035C>G	ENST00000378555.3	-	1	331	c.84G>C	c.(82-84)ccG>ccC	p.P28P	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_Silent_p.P28P|PODXL_ENST00000322985.9_Silent_p.P28P|PODXL_ENST00000541194.1_Silent_p.P28P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					GGGAGggcgacggcgacggcg	0.741																																					p.P28P		Atlas-SNP	.											.	PODXL	53	.	2	Deletion - In frame(2)	prostate(2)	c.G84C						.																																			SO:0001819	synonymous_variant	5420	exon1			GGGCGACGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84G>C	chr7.hg19:g.131241035C>G		60.0	0.0		105.0	5.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	hg19	CCDS34755.1																																																																																			.	.		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
XKR4	114786	hgsc.bcm.edu	37	8	56270341	56270341	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr8:56270341A>C	ENST00000327381.6	+	2	1010	c.910A>C	c.(910-912)Atg>Ctg	p.M304L		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	304						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GGATGTGAGTATGCTGCATTT	0.463																																					p.M304L		Atlas-SNP	.											.	XKR4	104	.	0			c.A910C						.						176.0	155.0	162.0					8																	56270341		2203	4300	6503	SO:0001583	missense	114786	exon2			GTGAGTATGCTGC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.910A>C	chr8.hg19:g.56270341A>C	ENSP00000328326:p.Met304Leu	128.0	0.0		109.0	13.0	NM_052898	Q96PZ8	Missense_Mutation	SNP	ENST00000327381.6	hg19	CCDS34893.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.078412	0.55753	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	T	0.66638	-0.22	5.96	5.96	0.96718	.	0.040138	0.85682	D	0.000000	T	0.65801	0.2726	L	0.35723	1.085	0.54753	D	0.99998	P	0.34934	0.476	B	0.43386	0.418	T	0.64356	-0.6427	10	0.38643	T	0.18	-0.4388	16.4447	0.83919	1.0:0.0:0.0:0.0	.	304	Q5GH76	XKR4_HUMAN	L	304	ENSP00000328326:M304L	ENSP00000328326:M304L	M	+	1	0	XKR4	56432895	1.000000	0.71417	0.995000	0.50966	0.697000	0.40408	9.339000	0.96797	2.284000	0.76573	0.528000	0.53228	ATG	.	.		0.463	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378129.2	NM_052898	
CNTNAP3	79937	hgsc.bcm.edu	37	9	39078814	39078814	+	Silent	SNP	C	C	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr9:39078814C>A	ENST00000297668.6	-	22	3619	c.3546G>T	c.(3544-3546)gcG>gcT	p.A1182A	CNTNAP3_ENST00000377656.2_Silent_p.A1101A	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	1182	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		TGGGGCGCAGCGCCGCCTTCA	0.791																																					p.A1182A		Atlas-SNP	.											CNTNAP3,NS,carcinoma,0,1	CNTNAP3	82	.	0			c.G3546T						.						1.0	1.0	1.0					9																	39078814		22	91	113	SO:0001819	synonymous_variant	79937	exon22			GCGCAGCGCCGCC	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.3546G>T	chr9.hg19:g.39078814C>A		12.0	1.0		6.0	2.0	NM_033655	B1AMA0|Q9C0E9	Silent	SNP	ENST00000297668.6	hg19	CCDS6616.1																																																																																			.	.		0.791	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052511.1	NM_033655	
GNA14	9630	hgsc.bcm.edu	37	9	80144156	80144156	+	Silent	SNP	A	A	G			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr9:80144156A>G	ENST00000341700.6	-	2	651	c.138T>C	c.(136-138)agT>agC	p.S46S	RP11-466A17.1_ENST00000439145.1_RNA	NM_004297.3	NP_004288.1	O95837	GNA14_HUMAN	guanine nucleotide binding protein (G protein), alpha 14	46					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	24						TGCTTTTCCCACTTTCACCAG	0.438																																					p.S46S		Atlas-SNP	.											.	GNA14	50	.	0			c.T138C						.						190.0	186.0	187.0					9																	80144156		2203	4300	6503	SO:0001819	synonymous_variant	9630	exon2			TTTCCCACTTTCA	AF105201	CCDS6657.1	9q21	2008-05-23			ENSG00000156049	ENSG00000156049			4382	protein-coding gene	gene with protein product		604397				10191087, 17620339	Standard	NM_004297		Approved		uc004aku.3	O95837	OTTHUMG00000020058	ENST00000341700.6:c.138T>C	chr9.hg19:g.80144156A>G		102.0	0.0		76.0	10.0	NM_004297	B1ALW3	Silent	SNP	ENST00000341700.6	hg19	CCDS6657.1																																																																																			.	.		0.438	GNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052759.1		
SMPD1	6609	hgsc.bcm.edu	37	11	6411972	6411972	+	Silent	SNP	T	T	G	rs281860676		TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr11:6411972T>G	ENST00000342245.4	+	1	312	c.144T>G	c.(142-144)gcT>gcG	p.A48A	SMPD1_ENST00000356761.2_Silent_p.A48A|SMPD1_ENST00000299397.3_Silent_p.A48A|SMPD1_ENST00000527275.1_Silent_p.A48A|SMPD1_ENST00000533196.1_3'UTR	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	47					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	tggcgctggcTCTGTCTGACT	0.697																																					p.A48A		Atlas-SNP	.											.	SMPD1	108	.	0			c.T144G						.						25.0	28.0	27.0					11																	6411972		2201	4296	6497	SO:0001819	synonymous_variant	6609	exon1			GCTGGCTCTGTCT	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.144T>G	chr11.hg19:g.6411972T>G		112.0	0.0		69.0	6.0	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Silent	SNP	ENST00000342245.4	hg19	CCDS44531.1																																																																																			.	.		0.697	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
MUC15	143662	hgsc.bcm.edu	37	11	26582625	26582625	+	Missense_Mutation	SNP	C	C	T	rs560016592		TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr11:26582625C>T	ENST00000455601.2	-	4	1110	c.992G>A	c.(991-993)cGt>cAt	p.R331H	ANO3_ENST00000529242.1_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.R358H|ANO3_ENST00000531568.1_Intron|MUC15_ENST00000527569.1_Missense_Mutation_p.R308H|ANO3_ENST00000256737.3_Intron|ANO3_ENST00000525139.1_Intron|MUC15_ENST00000281268.8_Missense_Mutation_p.R308H|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.R358H	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	331					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R331H(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						TACAGAAGTACGAAGTGGAGG	0.378																																					p.R358H		Atlas-SNP	.											MUC15_ENST00000436318,NS,carcinoma,0,3	MUC15	88	.	2	Substitution - Missense(2)	lung(1)|kidney(1)	c.G1073A						.						178.0	163.0	168.0					11																	26582625		2203	4300	6503	SO:0001583	missense	143662	exon5			GAAGTACGAAGTG	AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.992G>A	chr11.hg19:g.26582625C>T	ENSP00000397339:p.Arg331His	99.0	0.0		88.0	26.0	NM_001135091	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	ENST00000455601.2	hg19	CCDS7859.1	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997644	0.35226	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.39787	1.11;1.06;1.11;1.06;1.11	5.33	2.29	0.28610	.	0.000000	0.49916	D	0.000136	T	0.36663	0.0975	L	0.32530	0.975	0.09310	N	0.999999	D;P;P	0.69078	0.997;0.917;0.917	P;B;B	0.52598	0.703;0.291;0.291	T	0.15435	-1.0437	10	0.87932	D	0	-10.0199	4.5326	0.12013	0.1475:0.539:0.0:0.3135	.	308;331;358	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	H	331;358;308;358;308	ENSP00000397339:R331H;ENSP00000416753:R358H;ENSP00000281268:R308H;ENSP00000431983:R358H;ENSP00000431945:R308H	ENSP00000281268:R308H	R	-	2	0	MUC15	26539201	0.450000	0.25697	0.686000	0.30086	0.099000	0.18886	0.682000	0.25335	0.755000	0.32990	-0.186000	0.12905	CGT	.	.		0.378	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387866.1	NM_145650	
PYGM	5837	hgsc.bcm.edu	37	11	64522206	64522206	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr11:64522206G>T	ENST00000164139.3	-	8	1356	c.958C>A	c.(958-960)Cgt>Agt	p.R320S	PYGM_ENST00000462303.1_5'Flank|PYGM_ENST00000377432.3_Missense_Mutation_p.R232S	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	320					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ACGGGATCACGGCAGCCGAAC	0.592																																					p.R320S		Atlas-SNP	.											.	PYGM	77	.	0			c.C958A						.						81.0	62.0	69.0					11																	64522206		2201	4297	6498	SO:0001583	missense	5837	exon8			GATCACGGCAGCC		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.958C>A	chr11.hg19:g.64522206G>T	ENSP00000164139:p.Arg320Ser	94.0	0.0		71.0	4.0	NM_005609	A0AVK1|A6NDY6	Missense_Mutation	SNP	ENST00000164139.3	hg19	CCDS8079.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159235	0.57368	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.92965	-3.08;-3.14	4.89	4.89	0.63831	.	0.361992	0.24215	N	0.040489	D	0.90566	0.7043	M	0.73962	2.25	0.54753	D	0.999989	B;B	0.12630	0.001;0.006	B;B	0.15484	0.013;0.013	D	0.87674	0.2543	10	0.52906	T	0.07	-6.7916	10.6027	0.45375	0.0:0.0:0.8083:0.1917	.	232;320	A6NDY6;P11217	.;PYGM_HUMAN	S	232;320;301	ENSP00000366650:R232S;ENSP00000164139:R320S	ENSP00000164139:R320S	R	-	1	0	PYGM	64278782	0.784000	0.28713	0.993000	0.49108	0.984000	0.73092	1.059000	0.30517	2.551000	0.86045	0.561000	0.74099	CGT	.	.		0.592	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143254.2	NM_005609	
KLRC1	3821	hgsc.bcm.edu	37	12	10603179	10603179	+	Splice_Site	SNP	C	C	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr12:10603179C>A	ENST00000359151.3	-	3	369		c.e3-1		KLRC1_ENST00000536188.1_Splice_Site|KLRC1_ENST00000408006.3_Splice_Site|KLRC1_ENST00000544822.1_Splice_Site|KLRC1_ENST00000347831.5_Splice_Site	NM_002259.4	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C, member 1						cell surface receptor signaling pathway (GO:0007166)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16						GATGGTAAATCTGCAGGGAGA	0.438																																					.		Atlas-SNP	.											.	KLRC1	33	.	0			c.188-1G>T						.						88.0	85.0	86.0					12																	10603179		2203	4300	6503	SO:0001630	splice_region_variant	3821	exon4			GTAAATCTGCAGG	U54782	CCDS8625.1, CCDS8626.1	12p13	2010-06-30			ENSG00000134545	ENSG00000134545		"""Killer cell lectin-like receptors"", ""CD molecules"""	6374	protein-coding gene	gene with protein product	"""NKG2-1/B activating NK receptor"""	161555		NKG2		9598306	Standard	NM_002259		Approved	NKG2-A, NKG2-B, CD159a	uc001qyl.3	P26715		ENST00000359151.3:c.188-1G>T	chr12.hg19:g.10603179C>A		85.0	0.0		68.0	14.0	NM_002259		Splice_Site	SNP	ENST00000359151.3	hg19	CCDS8625.1	.	.	.	.	.	.	.	.	.	.	c	7.057	0.565618	0.13560	.	.	ENSG00000134545	ENST00000536188;ENST00000359151;ENST00000408006;ENST00000347831;ENST00000544822	.	.	.	3.45	1.27	0.21489	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999975	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0722	0.19895	0.241:0.5726:0.1864:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KLRC1	10494446	0.039000	0.19947	0.001000	0.08648	0.191000	0.23601	0.190000	0.17057	0.178000	0.19917	0.467000	0.42956	.	.	.		0.438	KLRC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400115.1	NM_002259	Intron
WNK4	65266	hgsc.bcm.edu	37	17	40933030	40933030	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr17:40933030C>A	ENST00000246914.5	+	1	335	c.314C>A	c.(313-315)cCc>cAc	p.P105H		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	105					chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		TCCAAAGAACCCCCCGAGGGC	0.726																																					p.P105H	Esophageal Squamous(6;201 374 4964 23855 42828)	Atlas-SNP	.											.	WNK4	182	.	0			c.C314A						.						10.0	13.0	12.0					17																	40933030		2170	4279	6449	SO:0001583	missense	65266	exon1			AAGAACCCCCCGA	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.314C>A	chr17.hg19:g.40933030C>A	ENSP00000246914:p.Pro105His	107.0	0.0		82.0	10.0	NM_032387	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	ENST00000246914.5	hg19	CCDS11439.1	.	.	.	.	.	.	.	.	.	.	C	6.725	0.502455	0.12822	.	.	ENSG00000126562	ENST00000246914	T	0.72394	-0.65	4.85	-1.53	0.08611	.	0.879409	0.09637	N	0.775451	T	0.52964	0.1767	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40365	-0.9567	10	0.42905	T	0.14	-2.29	5.6348	0.17530	0.3006:0.5463:0.0:0.1531	.	105	Q96J92	WNK4_HUMAN	H	105	ENSP00000246914:P105H	ENSP00000246914:P105H	P	+	2	0	WNK4	38186556	0.492000	0.26027	0.025000	0.17156	0.002000	0.02628	0.898000	0.28404	-0.044000	0.13491	0.563000	0.77884	CCC	.	.		0.726	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452389.1		
MBD3L1	85509	hgsc.bcm.edu	37	19	8953859	8953859	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr19:8953859G>A	ENST00000595891.1	+	3	736	c.505G>A	c.(505-507)Gca>Aca	p.A169T	MBD3L1_ENST00000305625.2_Missense_Mutation_p.A169T			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A169T(1)		NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						AGAGAGACTCGCAATAGCACT	0.473																																					p.A169T		Atlas-SNP	.											MBD3L1,colon,carcinoma,0,1	MBD3L1	24	.	1	Substitution - Missense(1)	large_intestine(1)	c.G505A						.						44.0	41.0	42.0					19																	8953859		2203	4297	6500	SO:0001583	missense	85509	exon1			AGACTCGCAATAG	AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.505G>A	chr19.hg19:g.8953859G>A	ENSP00000471575:p.Ala169Thr	65.0	0.0		40.0	12.0	NM_145208	B5BUM6|Q2M291	Missense_Mutation	SNP	ENST00000595891.1	hg19	CCDS12209.1	.	.	.	.	.	.	.	.	.	.	G	8.182	0.793989	0.16327	.	.	ENSG00000170948	ENST00000305625	T	0.49432	0.78	3.92	0.577	0.17385	.	0.646825	0.12885	N	0.431113	T	0.38506	0.1043	M	0.72894	2.215	0.09310	N	1	B	0.33612	0.419	B	0.28385	0.089	T	0.22661	-1.0210	10	0.34782	T	0.22	-14.2204	4.3308	0.11062	0.2079:0.1861:0.606:0.0	.	169	Q8WWY6	MB3L1_HUMAN	T	169	ENSP00000304198:A169T	ENSP00000304198:A169T	A	+	1	0	MBD3L1	8814859	0.329000	0.24696	0.137000	0.22149	0.007000	0.05969	1.118000	0.31246	0.230000	0.21059	-0.165000	0.13383	GCA	.	.		0.473	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459973.1	NM_145208	
MT-ND3	4537	hgsc.bcm.edu	37	M	10392	10392	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chrM:10392G>A	ENST00000361227.2	+	1	334	c.334G>A	c.(334-336)Gac>Aac	p.D112N	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	112					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										AAAAAGGATTAGACTGAGCCG	0.343																																					p.D112N		Atlas-SNP	.											.	.	.	.	0			c.G334A						.																																			SO:0001583	missense	0	exon1			GGATTAGACTGAA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.334G>A	chrM.hg19:g.10392G>A	ENSP00000355206:p.Asp112Asn	27.0	0.0		23.0	21.0	ENST00000361227		Missense_Mutation	SNP	ENST00000361227.2	hg19																																																																																				.	.		0.343	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
SYT7	9066	hgsc.bcm.edu	37	11	61290591	61290591	+	Frame_Shift_Del	DEL	C	C	-			TCGA-XR-A8TE-01A-11D-A35Z-10	TCGA-XR-A8TE-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	52ed1382-9a5b-4ac9-95ff-e59c6d6c48ff	2d84231b-c606-494f-9df7-68b2f88ac114	g.chr11:61290591delC	ENST00000263846.4	-	8	1390	c.1063delG	c.(1063-1065)gtcfs	p.V355fs	SYT7_ENST00000540677.1_Frame_Shift_Del_p.V430fs|SYT7_ENST00000540831.1_5'Flank|SYT7_ENST00000542836.1_Frame_Shift_Del_p.V399fs|SYT7_ENST00000535826.1_Frame_Shift_Del_p.V474fs|SYT7_ENST00000539008.1_Frame_Shift_Del_p.V638fs|SYT7_ENST00000542670.1_Frame_Shift_Del_p.V563fs	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	355	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						TTGTCCATGACAGTGATGATG	0.577																																					p.V430fs		Atlas-INDEL	.											.	SYT7	39	.	0			c.1289delT						.						282.0	220.0	241.0					11																	61290591		2202	4299	6501	SO:0001589	frameshift_variant	9066	exon9			.	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.1063delG	chr11.hg19:g.61290591delC	ENSP00000263846:p.Val355fs	96.0	0.0		72.0	23.0	NM_001252065	F5GZU9|Q08AH6	Frame_Shift_Del	DEL	ENST00000263846.4	hg19	CCDS31577.1																																																																																			.	.		0.577	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	
