#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD2	57540	hgsc.bcm.edu	37	1	11561824	11561824	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:11561824T>A	ENST00000294484.6	+	2	913	c.775T>A	c.(775-777)Tcg>Acg	p.S259T	PTCHD2_ENST00000389575.3_Missense_Mutation_p.S259T	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	259					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CTGGGACTACTCGCGCGCCTA	0.682																																					p.S259T		Atlas-SNP	.											.	PTCHD2	193	.	0			c.T775A						.						9.0	10.0	10.0					1																	11561824		1968	4129	6097	SO:0001583	missense	57540	exon2			GACTACTCGCGCG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.775T>A	chr1.hg19:g.11561824T>A	ENSP00000294484:p.Ser259Thr	125.0	0.0		78.0	5.0	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	hg19	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	T	10.45	1.353496	0.24512	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.24538	1.85;1.85	5.67	4.51	0.55191	.	0.354453	0.28566	N	0.014894	T	0.15825	0.0381	L	0.27053	0.805	0.32304	N	0.564635	B	0.31026	0.304	B	0.29716	0.106	T	0.18935	-1.0321	10	0.25106	T	0.35	-11.2912	7.3622	0.26752	0.1437:0.0:0.1503:0.706	.	259	Q9P2K9	PTHD2_HUMAN	T	259	ENSP00000294484:S259T;ENSP00000374226:S259T	ENSP00000294484:S259T	S	+	1	0	PTCHD2	11484411	0.997000	0.39634	0.949000	0.38748	0.250000	0.25880	1.666000	0.37460	0.936000	0.37367	0.533000	0.62120	TCG	.	.		0.682	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
ZCCHC11	23318	hgsc.bcm.edu	37	1	52897111	52897111	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:52897111G>A	ENST00000371544.3	-	28	4544	c.4282C>T	c.(4282-4284)Cct>Tct	p.P1428S	ZCCHC11_ENST00000257177.4_Missense_Mutation_p.P1429S	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	1428	Gln-rich.|Pro-rich.				cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						TGAGGCTGAGGAGAATAAGAT	0.363																																					p.P1429S		Atlas-SNP	.											.	ZCCHC11	151	.	0			c.C4285T						.						27.0	25.0	26.0					1																	52897111		2202	4297	6499	SO:0001583	missense	23318	exon28			GCTGAGGAGAATA	D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.4282C>T	chr1.hg19:g.52897111G>A	ENSP00000360599:p.Pro1428Ser	142.0	0.0		179.0	85.0	NM_001009881	A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	ENST00000371544.3	hg19	CCDS30716.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.271025|4.271025	0.80469|0.80469	.|.	.|.	ENSG00000134744|ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000531722|ENST00000474453	T;T|.	0.57595|.	0.39;0.4|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.60011|0.60011	0.2236|0.2236	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.85130|.	0.997|.	T|T	0.63229|0.63229	-0.6684|-0.6684	10|6	0.35671|0.59425	T|D	0.21|0.04	.|.	18.8838|18.8838	0.92367|0.92367	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1428|.	Q5TAX3|.	TUT4_HUMAN|.	S|F	1429;1428;266|273	ENSP00000257177:P1429S;ENSP00000360599:P1428S|.	ENSP00000257177:P1429S|ENSP00000433711:S273F	P|S	-|-	1|2	0|0	ZCCHC11|ZCCHC11	52669699|52669699	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	8.849000|8.849000	0.92178|0.92178	2.459000|2.459000	0.83118|0.83118	0.557000|0.557000	0.71058|0.71058	CCT|TCC	.	.		0.363	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022462.1	XM_038288	
DPYD	1806	hgsc.bcm.edu	37	1	98015193	98015193	+	Missense_Mutation	SNP	C	C	T	rs141439344		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:98015193C>T	ENST00000370192.3	-	12	1547	c.1447G>A	c.(1447-1449)Gtt>Att	p.V483I		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	483					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	GCCAAACCAACGACATCACCA	0.433																																					p.V483I		Atlas-SNP	.											.	DPYD	219	.	0			c.G1447A						.	C	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	177.0	146.0	157.0		1447	4.3	1.0	1	dbSNP_134	157	0,8600		0,0,4300	no	missense	DPYD	NM_000110.3	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	483/1026	98015193	2,13004	2203	4300	6503	SO:0001583	missense	1806	exon12			AACCAACGACATC	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.1447G>A	chr1.hg19:g.98015193C>T	ENSP00000359211:p.Val483Ile	132.0	0.0		105.0	30.0	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	hg19	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	C	6.853	0.526762	0.13066	4.54E-4	0.0	ENSG00000188641	ENST00000370192	D	0.82526	-1.62	6.16	4.31	0.51392	.	0.416154	0.26863	N	0.022106	T	0.67887	0.2941	L	0.50919	1.6	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.62310	-0.6881	10	0.45353	T	0.12	-19.0706	13.5794	0.61893	0.0:0.7708:0.0:0.2292	.	483	Q12882	DPYD_HUMAN	I	483	ENSP00000359211:V483I	ENSP00000359211:V483I	V	-	1	0	DPYD	97787781	1.000000	0.71417	0.977000	0.42913	0.007000	0.05969	3.082000	0.50128	0.502000	0.28037	-0.813000	0.03139	GTT	.	C|1.000;T|0.000		0.433	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
CSF1	1435	hgsc.bcm.edu	37	1	110466107	110466107	+	Silent	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:110466107C>T	ENST00000329608.6	+	6	1255	c.864C>T	c.(862-864)aaC>aaT	p.N288N	CSF1_ENST00000369801.1_Silent_p.N288N|CSF1_ENST00000369802.3_Silent_p.N288N|CSF1_ENST00000420111.2_Intron|CSF1_ENST00000344188.5_Silent_p.N288N	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	288					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		GGGCCTTCAACCCCGGGATGG	0.602											OREG0013645	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N288N		Atlas-SNP	.											.	CSF1	40	.	0			c.C864T						.						37.0	41.0	40.0					1																	110466107		2203	4300	6503	SO:0001819	synonymous_variant	1435	exon6			CTTCAACCCCGGG	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.864C>T	chr1.hg19:g.110466107C>T		119.0	0.0	1427	100.0	31.0	NM_172210	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Silent	SNP	ENST00000329608.6	hg19	CCDS816.1																																																																																			.	.		0.602	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757	
SYCP1	6847	hgsc.bcm.edu	37	1	115438077	115438077	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:115438077A>T	ENST00000369522.3	+	16	1507	c.1267A>T	c.(1267-1269)Act>Tct	p.T423S	SYCP1_ENST00000369518.1_Missense_Mutation_p.T423S	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	423					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAAGAGATGACTAAGCTTAC	0.294																																					p.T423S		Atlas-SNP	.											.	SYCP1	149	.	0			c.A1267T						.						25.0	25.0	25.0					1																	115438077		2153	4258	6411	SO:0001583	missense	6847	exon16			GAGATGACTAAGC	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.1267A>T	chr1.hg19:g.115438077A>T	ENSP00000358535:p.Thr423Ser	583.0	1.0		567.0	352.0	NM_003176	O14963|Q5VXJ6	Missense_Mutation	SNP	ENST00000369522.3	hg19	CCDS879.1	.	.	.	.	.	.	.	.	.	.	A	9.033	0.987831	0.18966	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.53857	0.6;0.6;0.6	4.94	1.08	0.20341	.	0.909246	0.09420	N	0.804584	T	0.17959	0.0431	L	0.50333	1.59	0.26261	N	0.978572	B;B	0.19583	0.037;0.037	B;B	0.25614	0.062;0.062	T	0.27400	-1.0075	10	0.11182	T	0.66	1.8418	2.9289	0.05793	0.6139:0.0:0.2027:0.1834	.	423;423	B7ZLS9;Q15431	.;SYCP1_HUMAN	S	423	ENSP00000358535:T423S;ENSP00000410011:T423S;ENSP00000358531:T423S	ENSP00000358531:T423S	T	+	1	0	SYCP1	115239600	0.962000	0.33011	0.585000	0.28666	0.900000	0.52787	0.593000	0.23999	0.336000	0.23639	0.528000	0.53228	ACT	.	.		0.294	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033386.1	NM_003176	
SPAG17	200162	hgsc.bcm.edu	37	1	118640441	118640441	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:118640441G>A	ENST00000336338.5	-	7	928	c.863C>T	c.(862-864)gCc>gTc	p.A288V		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	288						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTCTTTTATGGCATTTTCTTT	0.328																																					p.A288V		Atlas-SNP	.											.	SPAG17	263	.	0			c.C863T						.						120.0	114.0	116.0					1																	118640441		2203	4300	6503	SO:0001583	missense	200162	exon7			TTTATGGCATTTT		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.863C>T	chr1.hg19:g.118640441G>A	ENSP00000337804:p.Ala288Val	133.0	0.0		110.0	28.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	hg19	CCDS899.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.354228	0.24512	.	.	ENSG00000155761	ENST00000336338	T	0.37584	1.19	5.3	-3.69	0.04450	.	1.572630	0.03310	N	0.190387	T	0.09774	0.0240	L	0.38175	1.15	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.31833	-0.9929	10	0.49607	T	0.09	.	3.297	0.06970	0.1524:0.0954:0.2313:0.5208	.	288	Q6Q759	SPG17_HUMAN	V	288	ENSP00000337804:A288V	ENSP00000337804:A288V	A	-	2	0	SPAG17	118441964	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.042000	0.13949	-0.344000	0.08338	0.650000	0.86243	GCC	.	.		0.328	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
NBPF7	343505	hgsc.bcm.edu	37	1	120384152	120384152	+	IGR	SNP	C	C	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:120384152C>G								REG4 (29869 upstream) : ADAM30 (52003 downstream)																							GGAGGCATCTCTCCCTTCCCG	0.498																																					p.R137T		Atlas-SNP	.											NBPF7,right_upper_lobe,carcinoma,0,1	NBPF7	46	.	0			c.G410C						.						136.0	152.0	146.0					1																	120384152		2203	4300	6503	SO:0001628	intergenic_variant	343505	exon3			GCATCTCTCCCTT																													chr1.hg19:g.120384152C>G		168.0	0.0		147.0	40.0	NM_001047980		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.498								
TCHH	7062	hgsc.bcm.edu	37	1	152084224	152084224	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:152084224T>C	ENST00000368804.1	-	2	1468	c.1469A>G	c.(1468-1470)aAg>aGg	p.K490R		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	490	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTCGAGCTTCAGCCAACG	0.672																																					p.K490R		Atlas-SNP	.											.	TCHH	275	.	0			c.A1469G						.						65.0	71.0	69.0					1																	152084224		2109	4224	6333	SO:0001583	missense	7062	exon3			TCGAGCTTCAGCC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1469A>G	chr1.hg19:g.152084224T>C	ENSP00000357794:p.Lys490Arg	37.0	0.0		59.0	5.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	t	8.419	0.845945	0.16963	.	.	ENSG00000159450	ENST00000368804	T	0.04654	3.58	2.98	-5.97	0.02227	.	.	.	.	.	T	0.00524	0.0017	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48547	-0.9026	9	0.09590	T	0.72	.	5.0277	0.14393	0.1398:0.4054:0.0:0.4548	.	490	Q07283	TRHY_HUMAN	R	490	ENSP00000357794:K490R	ENSP00000357794:K490R	K	-	2	0	TCHH	150350848	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.247000	0.00266	-1.053000	0.03218	-1.396000	0.01147	AAG	.	.		0.672	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
KCNN3	3782	hgsc.bcm.edu	37	1	154841900	154841900	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:154841900T>A	ENST00000271915.4	-	1	856	c.541A>T	c.(541-543)Agc>Tgc	p.S181C	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	186					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	ACCCCACCGCTATACTTGCAG	0.677																																					p.S181C		Atlas-SNP	.											.	KCNN3	141	.	0			c.A541T						.						41.0	44.0	43.0					1																	154841900		2203	4300	6503	SO:0001583	missense	3782	exon1			CACCGCTATACTT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.541A>T	chr1.hg19:g.154841900T>A	ENSP00000271915:p.Ser181Cys	98.0	0.0		110.0	48.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	T	19.64	3.864790	0.71949	.	.	ENSG00000143603	ENST00000271915	D	0.95821	-3.82	4.75	4.75	0.60458	.	0.262866	0.27227	N	0.020326	D	0.90293	0.6964	N	0.14661	0.345	0.80722	D	1	D;D	0.64830	0.994;0.983	P;P	0.51355	0.667;0.533	D	0.92589	0.6081	10	0.87932	D	0	-20.1914	12.2631	0.54661	0.0:0.0:0.0:1.0	.	187;186	Q6JXY2;Q9UGI6	.;KCNN3_HUMAN	C	181	ENSP00000271915:S181C	ENSP00000271915:S181C	S	-	1	0	KCNN3	153108524	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.928000	0.70088	1.992000	0.58205	0.460000	0.39030	AGC	.	.		0.677	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
SLC25A44	9673	hgsc.bcm.edu	37	1	156170105	156170105	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:156170105A>G	ENST00000359511.4	+	2	639	c.467A>G	c.(466-468)gAg>gGg	p.E156G	SLC25A44_ENST00000423538.2_Missense_Mutation_p.E133G|SLC25A44_ENST00000469537.1_3'UTR	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	156					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					GGGAACCCAGAGGGACAAGGG	0.562																																					p.E156G		Atlas-SNP	.											.	SLC25A44	30	.	0			c.A467G						.						90.0	80.0	83.0					1																	156170105		2203	4300	6503	SO:0001583	missense	9673	exon2			ACCCAGAGGGACA	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.467A>G	chr1.hg19:g.156170105A>G	ENSP00000352497:p.Glu156Gly	82.0	0.0		123.0	39.0	NM_014655	O75034	Missense_Mutation	SNP	ENST00000359511.4	hg19	CCDS1133.1	.	.	.	.	.	.	.	.	.	.	A	10.02	1.234832	0.22626	.	.	ENSG00000160785	ENST00000359511;ENST00000423538	T;T	0.79247	-1.25;-1.13	5.55	5.55	0.83447	Mitochondrial carrier domain (2);	0.396482	0.27609	N	0.018607	T	0.38188	0.1031	N	0.02916	-0.46	0.44603	D	0.997574	B;B;B	0.10296	0.003;0.002;0.002	B;B;B	0.11329	0.004;0.006;0.004	T	0.40194	-0.9576	10	0.17832	T	0.49	-8.6994	13.7027	0.62620	1.0:0.0:0.0:0.0	.	133;133;156	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	G	156;133	ENSP00000352497:E156G;ENSP00000407560:E133G	ENSP00000352497:E156G	E	+	2	0	SLC25A44	154436729	0.929000	0.31497	0.921000	0.36526	0.675000	0.39556	3.136000	0.50554	2.333000	0.79357	0.482000	0.46254	GAG	.	.		0.562	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040856.1	NM_014655	
CD5L	922	hgsc.bcm.edu	37	1	157805704	157805704	+	Silent	SNP	T	T	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:157805704T>G	ENST00000368174.4	-	3	393	c.297A>C	c.(295-297)acA>acC	p.T99T	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	99	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATGTATCTTCTGTTCCTGTGC	0.493																																					p.T99T		Atlas-SNP	.											CD5L,NS,carcinoma,0,1	CD5L	112	.	0			c.A297C						.						227.0	232.0	230.0					1																	157805704		2203	4300	6503	SO:0001819	synonymous_variant	922	exon3			ATCTTCTGTTCCT	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.297A>C	chr1.hg19:g.157805704T>G		86.0	0.0		96.0	30.0	NM_005894	A8K7M5|Q6UX63	Silent	SNP	ENST00000368174.4	hg19	CCDS1171.1																																																																																			.	.		0.493	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
IL10	3586	hgsc.bcm.edu	37	1	206945657	206945657	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:206945657G>A	ENST00000423557.1	-	1	182	c.124C>T	c.(124-126)Cga>Tga	p.R42*	IL10_ENST00000471071.1_5'Flank	NM_000572.2	NP_000563.1	P22301	IL10_HUMAN	interleukin 10	42					B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|defense response to bacterium (GO:0042742)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|leukocyte chemotaxis (GO:0030595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of chronic inflammatory response to antigenic stimulus (GO:0002875)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interferon-alpha biosynthetic process (GO:0045355)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of myeloid dendritic cell activation (GO:0030886)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor biosynthetic process (GO:0032800)|regulation of gene expression (GO:0010468)|regulation of isotype switching (GO:0045191)|regulation of sensory perception of pain (GO:0051930)|response to activity (GO:0014823)|response to carbon monoxide (GO:0034465)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to inactivity (GO:0014854)|response to insulin (GO:0032868)|response to molecule of bacterial origin (GO:0002237)|type 2 immune response (GO:0042092)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-10 receptor binding (GO:0005141)			endometrium(1)|large_intestine(6)|lung(4)|prostate(1)	12	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			CGGAGATCTCGAAGCATGTTA	0.552																																					p.R42X		Atlas-SNP	.											.	IL10	22	.	0			c.C124T						.						123.0	101.0	108.0					1																	206945657		2203	4300	6503	SO:0001587	stop_gained	3586	exon1			GATCTCGAAGCAT	M57627	CCDS1467.1	1q31-q32	2011-07-14			ENSG00000136634	ENSG00000136634		"""Interleukins and interleukin receptors"""	5962	protein-coding gene	gene with protein product	"""cytokine synthesis inhibitory factor"", ""T-cell growth inhibitory factor"""	124092				9162098	Standard	NM_000572		Approved	CSIF, TGIF, IL10A, IL-10	uc001hen.1	P22301	OTTHUMG00000036386	ENST00000423557.1:c.124C>T	chr1.hg19:g.206945657G>A	ENSP00000412237:p.Arg42*	71.0	0.0		139.0	66.0	NM_000572		Nonsense_Mutation	SNP	ENST00000423557.1	hg19	CCDS1467.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.422291	0.83559	.	.	ENSG00000136634	ENST00000423557	.	.	.	5.86	3.89	0.44902	.	0.305675	0.33161	N	0.005215	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.8814	6.8794	0.24164	0.087:0.0:0.7406:0.1724	.	.	.	.	X	42	.	ENSP00000412237:R42X	R	-	1	2	IL10	205012280	0.482000	0.25948	0.451000	0.26982	0.376000	0.30014	1.684000	0.37649	1.484000	0.48361	0.655000	0.94253	CGA	.	.		0.552	IL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088564.3	NM_000572	
ESRRG	2104	hgsc.bcm.edu	37	1	216850491	216850491	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:216850491G>C	ENST00000408911.3	-	2	552	c.399C>G	c.(397-399)gaC>gaG	p.D133E	ESRRG_ENST00000463665.1_Missense_Mutation_p.D110E|ESRRG_ENST00000361395.2_Missense_Mutation_p.D110E|ESRRG_ENST00000493603.1_Missense_Mutation_p.D110E|ESRRG_ENST00000366937.1_Missense_Mutation_p.D138E|ESRRG_ENST00000366938.2_Missense_Mutation_p.D110E|ESRRG_ENST00000366940.2_Missense_Mutation_p.D110E|ESRRG_ENST00000493748.1_Missense_Mutation_p.D110E|ESRRG_ENST00000361525.3_Missense_Mutation_p.D110E|ESRRG_ENST00000391890.3_Missense_Mutation_p.D110E|ESRRG_ENST00000487276.1_Missense_Mutation_p.D110E|ESRRG_ENST00000360012.3_Missense_Mutation_p.D110E|ESRRG_ENST00000359162.2_Missense_Mutation_p.D110E	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	133					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CAGAAGCGATGTCACCACACA	0.483																																					p.D138E		Atlas-SNP	.											.	ESRRG	111	.	0			c.C414G						.						194.0	170.0	178.0					1																	216850491		2203	4300	6503	SO:0001583	missense	2104	exon3			AGCGATGTCACCA	AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.399C>G	chr1.hg19:g.216850491G>C	ENSP00000386171:p.Asp133Glu	113.0	0.0		224.0	80.0	NM_001243518	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	ENST00000408911.3	hg19	CCDS41468.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457957	0.84317	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98135	-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74;-4.74	6.01	4.92	0.64577	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.98563	0.9520	M	0.82823	2.61	0.58432	D	0.999999	D;D;D	0.71674	0.998;0.99;0.992	D;D;D	0.79108	0.923;0.98;0.992	D	0.98614	1.0664	10	0.87932	D	0	.	13.85	0.63489	0.1234:0.0:0.8766:0.0	.	110;138;133	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	E	110;110;138;133;110;110;110;110;110;110;110;110;110;110;110	ENSP00000355225:D110E;ENSP00000355907:D110E;ENSP00000355904:D138E;ENSP00000386171:D133E;ENSP00000352077:D110E;ENSP00000354584:D110E;ENSP00000355905:D110E;ENSP00000353108:D110E;ENSP00000419594:D110E;ENSP00000375761:D110E;ENSP00000418629:D110E;ENSP00000419155:D110E;ENSP00000417374:D110E;ENSP00000419514:D110E	ENSP00000346386:D110E	D	-	3	2	ESRRG	214917114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.135000	0.57997	2.861000	0.98227	0.650000	0.86243	GAC	.	.		0.483	ESRRG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089882.2	NM_206595	
TRIM67	440730	hgsc.bcm.edu	37	1	231344891	231344891	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:231344891C>T	ENST00000366653.5	+	8	2018	c.2018C>T	c.(2017-2019)gCc>gTc	p.A673V	TRIM67_ENST00000366652.2_Missense_Mutation_p.A673V|TRIM67_ENST00000449018.3_Missense_Mutation_p.A611V|TRIM67_ENST00000444294.3_Missense_Mutation_p.A671V			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	673	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GTGGCCAGGGCCAGCGTGGTC	0.627																																					p.A673V		Atlas-SNP	.											.	TRIM67	160	.	0			c.C2018T						.						85.0	94.0	91.0					1																	231344891		2195	4298	6493	SO:0001583	missense	440730	exon8			CCAGGGCCAGCGT	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.2018C>T	chr1.hg19:g.231344891C>T	ENSP00000355613:p.Ala673Val	160.0	0.0		296.0	112.0	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	ENST00000366653.5	hg19	CCDS44333.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095422	0.36952	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.73	2.33	0.28932	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.213831	0.43416	N	0.000575	T	0.45013	0.1321	N	0.17379	0.485	0.31046	N	0.715771	B	0.12013	0.005	B	0.15870	0.014	T	0.38845	-0.9642	10	0.30854	T	0.27	.	7.4988	0.27505	0.0:0.6079:0.0:0.3921	.	673	Q6ZTA4	TRI67_HUMAN	V	671;673;611;673	ENSP00000412124:A671V;ENSP00000355612:A673V;ENSP00000400163:A611V;ENSP00000355613:A673V	ENSP00000355612:A673V	A	+	2	0	TRIM67	229411514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.353000	0.52247	0.637000	0.30526	0.655000	0.94253	GCC	.	.		0.627	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
FMN2	56776	hgsc.bcm.edu	37	1	240256430	240256430	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:240256430G>A	ENST00000319653.9	+	1	1251	c.1021G>A	c.(1021-1023)Ggg>Agg	p.G341R		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	341					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCCGTGCGAGGGGCTGGGGA	0.731																																					p.G341R		Atlas-SNP	.											.	FMN2	451	.	0			c.G1021A						.						4.0	5.0	5.0					1																	240256430		1568	3405	4973	SO:0001583	missense	56776	exon1			GTGCGAGGGGCTG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1021G>A	chr1.hg19:g.240256430G>A	ENSP00000318884:p.Gly341Arg	29.0	0.0		69.0	24.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	2.889	-0.230026	0.06022	.	.	ENSG00000155816	ENST00000319653	T	0.27557	1.66	2.97	2.05	0.26809	.	0.729752	0.12526	N	0.461216	T	0.24547	0.0595	L	0.54323	1.7	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19679	-1.0298	10	0.31617	T	0.26	.	4.4116	0.11436	0.1324:0.2338:0.6338:0.0	.	341	Q9NZ56	FMN2_HUMAN	R	341	ENSP00000318884:G341R	ENSP00000318884:G341R	G	+	1	0	FMN2	238323053	0.010000	0.17322	0.001000	0.08648	0.485000	0.33311	1.824000	0.39072	0.813000	0.34350	-0.481000	0.04817	GGG	.	.		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
OR2T34	127068	hgsc.bcm.edu	37	1	248737365	248737365	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:248737365T>A	ENST00000328782.2	-	1	715	c.694A>T	c.(694-696)Agg>Tgg	p.R232W		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R232W(1)		breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAATTCATCCTGTGGATGAGA	0.547																																					p.R232W		Atlas-SNP	.											OR2T34,NS,carcinoma,+1,1	OR2T34	72	.	1	Substitution - Missense(1)	lung(1)	c.A694T						.						112.0	128.0	122.0					1																	248737365		2176	4300	6476	SO:0001583	missense	127068	exon1			TCATCCTGTGGAT	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.694A>T	chr1.hg19:g.248737365T>A	ENSP00000330904:p.Arg232Trp	284.0	1.0		536.0	167.0	NM_001001821	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	hg19	CCDS31120.1	.	.	.	.	.	.	.	.	.	.	.	18.33	3.600295	0.66332	.	.	ENSG00000183310	ENST00000328782	T	0.00269	8.37	2.37	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00815	0.0027	H	0.96269	3.795	0.23036	N	0.998395	D	0.76494	0.999	D	0.83275	0.996	T	0.25222	-1.0138	9	0.87932	D	0	.	9.2409	0.37495	0.0:0.0:0.0:1.0	.	232	Q8NGX1	O2T34_HUMAN	W	232	ENSP00000330904:R232W	ENSP00000330904:R232W	R	-	1	2	OR2T34	246803988	0.001000	0.12720	0.140000	0.22221	0.165000	0.22458	0.844000	0.27654	0.964000	0.38108	0.104000	0.15600	AGG	.	.		0.547	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097138.1	NM_001001821	
NTSR2	23620	hgsc.bcm.edu	37	2	11809668	11809668	+	Silent	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:11809668C>A	ENST00000306928.5	-	1	622	c.588G>T	c.(586-588)gtG>gtT	p.V196V		NM_012344.3	NP_036476	O95665	NTR2_HUMAN	neurotensin receptor 2	196					cell surface receptor signaling pathway (GO:0007166)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of membrane potential (GO:0042391)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(7)|lung(7)|prostate(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.129)|OV - Ovarian serous cystadenocarcinoma(76;0.24)	Levocabastine(DB01106)	GGCTCACCAGCACCGTGCACA	0.711																																					p.V196V		Atlas-SNP	.											.	NTSR2	36	.	0			c.G588T						.						11.0	13.0	13.0					2																	11809668		1729	3414	5143	SO:0001819	synonymous_variant	23620	exon1			CACCAGCACCGTG	Y10148	CCDS1681.1	2p25.1	2012-08-08			ENSG00000169006	ENSG00000169006		"""GPCR / Class A : Neurotensin receptors"""	8040	protein-coding gene	gene with protein product		605538				8647296, 9851594	Standard	NM_012344		Approved	NTR2	uc002rbq.4	O95665	OTTHUMG00000119083	ENST00000306928.5:c.588G>T	chr2.hg19:g.11809668C>A		32.0	0.0		31.0	20.0	NM_012344	Q53QQ5|Q57Z87|Q8IY58|Q8TBH6	Silent	SNP	ENST00000306928.5	hg19	CCDS1681.1																																																																																			.	.		0.711	NTSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239297.1		
LPIN1	23175	hgsc.bcm.edu	37	2	11913854	11913854	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:11913854G>T	ENST00000256720.2	+	5	798	c.705G>T	c.(703-705)gaG>gaT	p.E235D	LPIN1_ENST00000449576.2_Missense_Mutation_p.E284D|LPIN1_ENST00000396099.1_Missense_Mutation_p.E241D|LPIN1_ENST00000396098.1_Missense_Mutation_p.E241D|LPIN1_ENST00000425416.2_Missense_Mutation_p.E241D	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	235					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		CGGATAGAGAGTGGTCACCCA	0.463																																					p.E284D		Atlas-SNP	.											.	LPIN1	99	.	0			c.G852T						.						126.0	123.0	124.0					2																	11913854		2203	4300	6503	SO:0001583	missense	23175	exon6			TAGAGAGTGGTCA	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.705G>T	chr2.hg19:g.11913854G>T	ENSP00000256720:p.Glu235Asp	81.0	0.0		60.0	20.0	NM_001261428	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	hg19	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	G	11.54	1.668814	0.29604	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720	T;D;T;T;T	0.88664	-1.41;-2.41;-1.4;-1.44;-1.44	5.33	2.47	0.30058	.	0.260548	0.44483	D	0.000444	T	0.80330	0.4603	L	0.45137	1.4	0.80722	D	1	B;B;B	0.19445	0.004;0.004;0.036	B;B;B	0.22386	0.02;0.012;0.039	T	0.66304	-0.5957	10	0.18276	T	0.48	-29.8864	3.764	0.08615	0.2861:0.192:0.5219:0.0	.	284;235;241	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	D	284;241;241;241;235	ENSP00000397908:E284D;ENSP00000379405:E241D;ENSP00000379406:E241D;ENSP00000401522:E241D;ENSP00000256720:E235D	ENSP00000256720:E235D	E	+	3	2	LPIN1	11831305	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	0.756000	0.26419	0.595000	0.29777	0.467000	0.42956	GAG	.	.		0.463	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
SMEK2	57223	hgsc.bcm.edu	37	2	55825633	55825633	+	Silent	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:55825633T>C	ENST00000345102.5	-	4	1141	c.840A>G	c.(838-840)ccA>ccG	p.P280P	SMEK2_ENST00000407823.3_Silent_p.P280P|SMEK2_ENST00000272313.5_Silent_p.P280P	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	280					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CAAAAACAGATGGTGTGGGCA	0.348																																					p.P280P		Atlas-SNP	.											.	SMEK2	86	.	0			c.A840G						.						83.0	82.0	83.0					2																	55825633		2203	4300	6503	SO:0001819	synonymous_variant	57223	exon4			AACAGATGGTGTG	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.840A>G	chr2.hg19:g.55825633T>C		396.0	0.0		319.0	103.0	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Silent	SNP	ENST00000345102.5	hg19	CCDS46289.1																																																																																			.	.		0.348	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
EGR4	1961	hgsc.bcm.edu	37	2	73519494	73519494	+	Silent	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:73519494G>A	ENST00000545030.1	-	2	935	c.861C>T	c.(859-861)ccC>ccT	p.P287P	EGR4_ENST00000436467.2_Silent_p.P184P	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	287	Pro-rich.				cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CCCGGAGGCCGGGCTTGACGT	0.716																																					p.P287P		Atlas-SNP	.											EGR4_ENST00000545030,NS,adenocarcinoma,0,2	EGR4	52	.	0			c.C861T						.						6.0	9.0	8.0					2																	73519494		2116	4184	6300	SO:0001819	synonymous_variant	1961	exon2			GAGGCCGGGCTTG		CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.861C>T	chr2.hg19:g.73519494G>A		144.0	0.0		111.0	61.0	NM_001965	B2RAE3|G3V1T5|Q2Z1P5	Silent	SNP	ENST00000545030.1	hg19	CCDS1925.2																																																																																			.	.		0.716	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001965	
ATOH8	84913	hgsc.bcm.edu	37	2	85981926	85981926	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:85981926A>G	ENST00000306279.3	+	1	910	c.614A>G	c.(613-615)gAt>gGt	p.D205G	ATOH8_ENST00000463422.1_3'UTR	NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	205					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						AACCACCAGGATTCCTCCGCG	0.647																																					p.D205G		Atlas-SNP	.											.	ATOH8	15	.	0			c.A614G						.						45.0	54.0	51.0					2																	85981926		2189	4271	6460	SO:0001583	missense	84913	exon1			ACCAGGATTCCTC	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.614A>G	chr2.hg19:g.85981926A>G	ENSP00000304676:p.Asp205Gly	161.0	0.0		157.0	88.0	NM_032827	Q504S2|Q659B0	Missense_Mutation	SNP	ENST00000306279.3	hg19	CCDS1985.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.632542	0.46944	.	.	ENSG00000168874	ENST00000306279	D	0.94613	-3.47	3.78	2.6	0.31112	.	0.257225	0.29646	N	0.011563	D	0.83248	0.5213	N	0.08118	0	0.30024	N	0.814115	P;P	0.47409	0.895;0.879	B;B	0.36464	0.191;0.225	T	0.80596	-0.1312	10	0.32370	T	0.25	-10.9615	8.056	0.30606	0.8183:0.0:0.0:0.1817	.	205;205	Q96SQ7;Q96SQ7-2	ATOH8_HUMAN;.	G	205	ENSP00000304676:D205G	ENSP00000304676:D205G	D	+	2	0	ATOH8	85835437	0.986000	0.35501	1.000000	0.80357	0.984000	0.73092	0.869000	0.27996	0.790000	0.33803	0.374000	0.22700	GAT	.	.		0.647	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827	
CERKL	375298	hgsc.bcm.edu	37	2	182468567	182468567	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:182468567C>T	ENST00000339098.5	-	2	477	c.478G>A	c.(478-480)Gca>Aca	p.A160T	CERKL_ENST00000410087.3_Missense_Mutation_p.A160T|CERKL_ENST00000374970.2_Missense_Mutation_p.A160T|CERKL_ENST00000374969.2_Missense_Mutation_p.A160T|CERKL_ENST00000479558.1_5'UTR|CERKL_ENST00000409440.3_Missense_Mutation_p.A160T			Q49MI3	CERKL_HUMAN	ceramide kinase-like	160					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TACTTACCTGCCAATATTTTC	0.308																																					p.A160T		Atlas-SNP	.											.	CERKL	138	.	0			c.G478A						.						70.0	77.0	74.0					2																	182468567		2203	4296	6499	SO:0001583	missense	375298	exon2			TACCTGCCAATAT	BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.478G>A	chr2.hg19:g.182468567C>T	ENSP00000341159:p.Ala160Thr	133.0	0.0		101.0	29.0	NM_001160277	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	ENST00000339098.5	hg19	CCDS42789.1	.	.	.	.	.	.	.	.	.	.	C	4.943	0.175269	0.09391	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.29655	2.26;2.57;2.47;2.57;1.56	4.95	3.82	0.43975	.	0.918265	0.09119	N	0.846016	T	0.26048	0.0635	N	0.08118	0	0.23913	N	0.996485	B;D;B;B;B	0.76494	0.017;0.999;0.063;0.004;0.013	B;D;B;B;B	0.64687	0.002;0.928;0.017;0.004;0.003	T	0.26710	-1.0095	10	0.14252	T	0.57	.	3.8515	0.08957	0.0:0.6468:0.0:0.3532	.	160;160;160;160;160	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	T	160	ENSP00000386725:A160T;ENSP00000387080:A160T;ENSP00000364108:A160T;ENSP00000341159:A160T;ENSP00000364109:A160T	ENSP00000341159:A160T	A	-	1	0	CERKL	182176812	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	3.155000	0.50700	2.455000	0.83008	0.655000	0.94253	GCA	.	.		0.308	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334811.1		
RQCD1	9125	hgsc.bcm.edu	37	2	219447779	219447779	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:219447779T>C	ENST00000273064.6	+	3	665	c.290T>C	c.(289-291)cTg>cCg	p.L97P	RQCD1_ENST00000509807.2_Missense_Mutation_p.L97P|RQCD1_ENST00000295701.5_Missense_Mutation_p.L97P|RQCD1_ENST00000542068.1_Missense_Mutation_p.L97P	NM_005444.2	NP_005435.1	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog (S. pombe)	97					cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|sex differentiation (GO:0007548)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)	15		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGCATTACTGCAATGTGTA	0.393																																					p.L97P		Atlas-SNP	.											.	RQCD1	32	.	0			c.T290C						.						136.0	121.0	126.0					2																	219447779		2203	4300	6503	SO:0001583	missense	9125	exon3			CATTACTGCAATG	D87957	CCDS33379.1, CCDS63123.1	2q35	2010-04-23	2001-11-28		ENSG00000144580	ENSG00000144580			10445	protein-coding gene	gene with protein product	"""cancer/testis antigen 129"""	612054	"""rcd1 (required for cell differentiation, S.pombe) homolog 1"""			9447985	Standard	NM_001271634		Approved	RCD1, RCD1+, CNOT9, CT129	uc010zki.3	Q92600	OTTHUMG00000154750	ENST00000273064.6:c.290T>C	chr2.hg19:g.219447779T>C	ENSP00000273064:p.Leu97Pro	125.0	0.0		133.0	69.0	NM_001271634	B2RPI0|B5MDQ4|B7Z1E5|Q96IX4	Missense_Mutation	SNP	ENST00000273064.6	hg19	CCDS33379.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.794802	0.90453	.	.	ENSG00000144580	ENST00000273064;ENST00000509807;ENST00000542068;ENST00000295701	T;T;T;T	0.72835	-0.69;-0.35;-0.69;-0.69	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90270	0.6957	H	0.97829	4.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.992;1.0;0.999	D	0.93668	0.6987	10	0.72032	D	0.01	-15.1264	16.3979	0.83621	0.0:0.0:0.0:1.0	.	97;97;97	B7Z1E5;Q92600;B5MDQ4	.;RCD1_HUMAN;.	P	97	ENSP00000273064:L97P;ENSP00000441357:L97P;ENSP00000443687:L97P;ENSP00000295701:L97P	ENSP00000273064:L97P	L	+	2	0	RQCD1	219156023	1.000000	0.71417	0.997000	0.53966	0.944000	0.59088	7.997000	0.88414	2.333000	0.79357	0.533000	0.62120	CTG	.	.		0.393	RQCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336920.1	NM_005444	
COL4A4	1286	hgsc.bcm.edu	37	2	228009257	228009257	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:228009257A>C	ENST00000396625.3	-	3	296	c.89T>G	c.(88-90)cTc>cGc	p.L30R	COL4A4_ENST00000329662.7_Missense_Mutation_p.L30R	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	30					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TACAGAAAAGAGAATGAGTAT	0.289																																					p.L30R		Atlas-SNP	.											.	COL4A4	215	.	0			c.T89G						.						90.0	85.0	86.0					2																	228009257		1811	4073	5884	SO:0001583	missense	1286	exon3			GAAAAGAGAATGA		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.89T>G	chr2.hg19:g.228009257A>C	ENSP00000379866:p.Leu30Arg	1177.0	0.0		932.0	550.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	hg19	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	A	12.95	2.090108	0.36855	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.91351	-2.83;-2.78	4.71	4.71	0.59529	.	.	.	.	.	D	0.88930	0.6571	N	0.14661	0.345	0.36174	D	0.84895	D	0.71674	0.998	P	0.62649	0.905	D	0.91211	0.4999	9	0.62326	D	0.03	.	10.5174	0.44898	1.0:0.0:0.0:0.0	.	30	P53420	CO4A4_HUMAN	R	30	ENSP00000379866:L30R;ENSP00000328553:L30R	ENSP00000328553:L30R	L	-	2	0	COL4A4	227717501	0.348000	0.24861	0.632000	0.29296	0.423000	0.31445	3.944000	0.56629	1.970000	0.57323	0.455000	0.32223	CTC	.	.		0.289	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CNTN6	27255	hgsc.bcm.edu	37	3	1414520	1414520	+	Splice_Site	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:1414520A>T	ENST00000446702.2	+	14	2295		c.e14-1		CNTN6_ENST00000350110.2_Splice_Site|CNTN6_ENST00000539053.1_Splice_Site			Q9UQ52	CNTN6_HUMAN	contactin 6						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TTCTGTCTGCAGGAATCTGTT	0.353																																					.		Atlas-SNP	.											CNTN6,NS,malignant_melanoma,0,1	CNTN6	245	.	0			c.1669-2A>T						.						141.0	148.0	146.0					3																	1414520		2203	4300	6503	SO:0001630	splice_region_variant	27255	exon14			GTCTGCAGGAATC	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1669-1A>T	chr3.hg19:g.1414520A>T		67.0	0.0		68.0	16.0	NM_014461	Q2KHM2	Splice_Site	SNP	ENST00000446702.2	hg19	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	A	18.89	3.719325	0.68844	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9209	0.79570	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTN6	1389520	1.000000	0.71417	0.988000	0.46212	0.714000	0.41099	6.797000	0.75150	2.210000	0.71456	0.533000	0.62120	.	.	.		0.353	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	Intron
CMTM7	112616	hgsc.bcm.edu	37	3	32433454	32433454	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:32433454G>A	ENST00000334983.5	+	1	292	c.56G>A	c.(55-57)gGa>gAa	p.G19E	CMTM7_ENST00000349718.4_Missense_Mutation_p.G19E	NM_138410.2	NP_612419.1	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing 7	19					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(1)|lung(2)	4						AGCGCGCTCGGACCCGGGGCC	0.771																																					p.G19E		Atlas-SNP	.											.	CMTM7	14	.	0			c.G56A						.						1.0	1.0	1.0					3																	32433454		820	1756	2576	SO:0001583	missense	112616	exon1			CGCTCGGACCCGG	AF479263	CCDS33730.1, CCDS33731.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000153551	ENSG00000153551			19178	protein-coding gene	gene with protein product		607890	"""chemokine-like factor super family 7"", ""chemokine-like factor superfamily 7"""	CKLFSF7			Standard	NM_138410		Approved	FLJ30992	uc003cey.1	Q96FZ5	OTTHUMG00000155869	ENST00000334983.5:c.56G>A	chr3.hg19:g.32433454G>A	ENSP00000335605:p.Gly19Glu	30.0	0.0		27.0	10.0	NM_138410	Q5VLK1	Missense_Mutation	SNP	ENST00000334983.5	hg19	CCDS33730.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768064	0.49680	.	.	ENSG00000153551	ENST00000334983;ENST00000349718	T	0.30448	1.53	3.91	0.8	0.18672	.	1.336160	0.05327	U	0.527675	T	0.23133	0.0559	N	0.24115	0.695	0.09310	N	1	P;P	0.47677	0.899;0.838	P;B	0.45099	0.469;0.218	T	0.22906	-1.0203	10	0.15952	T	0.53	.	7.9518	0.30019	0.0:0.3141:0.5262:0.1597	.	19;19	Q5VLK1;Q96FZ5	.;CKLF7_HUMAN	E	19	ENSP00000335605:G19E	ENSP00000335605:G19E	G	+	2	0	CMTM7	32408458	0.026000	0.19158	0.008000	0.14137	0.752000	0.42762	1.005000	0.29834	0.824000	0.34613	0.305000	0.20034	GGA	.	.		0.771	CMTM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342084.1		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	T	rs121913416|rs121913400		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:41266101C>T	ENST00000349496.5	+	3	378	c.98C>T	c.(97-99)tCt>tTt	p.S33F	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26F|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33F	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,359	CTNNB1	4904	.	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98T						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>T	chr3.hg19:g.41266101C>T	ENSP00000344456:p.Ser33Phe	220.0	1.0		148.0	50.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498846	0.85069	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	F	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26F;ENSP00000385604:S33F;ENSP00000412219:S33F;ENSP00000379486:S33F;ENSP00000344456:S33F;ENSP00000411226:S26F;ENSP00000379488:S33F;ENSP00000409302:S33F;ENSP00000401599:S33F	ENSP00000344456:S33F	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CCR5	1234	hgsc.bcm.edu	37	3	46415374	46415374	+	Silent	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:46415374C>T	ENST00000292303.4	+	2	1127	c.981C>T	c.(979-981)ttC>ttT	p.F327F	RP11-24F11.2_ENST00000451485.1_RNA|CCR5_ENST00000445772.1_Silent_p.F327F|CCR5_ENST00000343801.4_Silent_p.F327F	NM_001100168.1	NP_001093638.1	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5 (gene/pseudogene)	327					calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|signaling (GO:0023052)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)|phosphatidylinositol phospholipase C activity (GO:0004435)			central_nervous_system(1)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	GTTCTATTTTCCAGCAAGAGG	0.502																																					p.F327F		Atlas-SNP	.											.	CCR5	128	.	0			c.C981T						.						108.0	107.0	108.0					3																	46415374		2203	4296	6499	SO:0001819	synonymous_variant	1234	exon3			TATTTTCCAGCAA		CCDS2739.1	3p21	2012-08-08	2012-01-23		ENSG00000160791	ENSG00000160791		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1606	protein-coding gene	gene with protein product		601373	"""chemokine (C-C motif) receptor 5"""	CMKBR5		8639485	Standard	NM_001100168		Approved	CKR-5, CC-CKR-5, CKR5, CD195, IDDM22	uc003cpo.4	P51681	OTTHUMG00000133481	ENST00000292303.4:c.981C>T	chr3.hg19:g.46415374C>T		96.0	0.0		109.0	71.0	NM_000579	O14692|O14693|O14695|O14696|O14697|O14698|O14699|O14700|O14701|O14702|O14703|O14704|O14705|O14706|O14707|O14708|O15538|Q9UPA4	Silent	SNP	ENST00000292303.4	hg19	CCDS2739.1																																																																																			.	.		0.502	CCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257377.2	NM_000579	
STAB1	23166	hgsc.bcm.edu	37	3	52554832	52554832	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:52554832G>T	ENST00000321725.6	+	55	5795	c.5719G>T	c.(5719-5721)Gcc>Tcc	p.A1907S		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1907					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CAGCCCTGAGGCCTGCTGGCG	0.657																																					p.A1907S		Atlas-SNP	.											.	STAB1	178	.	0			c.G5719T						.						127.0	151.0	143.0					3																	52554832		2203	4300	6503	SO:0001583	missense	23166	exon55			CCTGAGGCCTGCT	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5719G>T	chr3.hg19:g.52554832G>T	ENSP00000312946:p.Ala1907Ser	69.0	0.0		33.0	14.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	ENST00000321725.6	hg19	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	G	4.341	0.062627	0.08388	.	.	ENSG00000010327	ENST00000321725	D	0.84516	-1.86	5.49	-3.57	0.04612	.	1.755180	0.02221	N	0.064051	T	0.70002	0.3174	N	0.24115	0.695	0.09310	N	1	B	0.19583	0.037	B	0.19391	0.025	T	0.58132	-0.7690	10	0.09338	T	0.73	.	2.3425	0.04263	0.3871:0.1188:0.3737:0.1204	.	1907	Q9NY15	STAB1_HUMAN	S	1907	ENSP00000312946:A1907S	ENSP00000312946:A1907S	A	+	1	0	STAB1	52529872	0.001000	0.12720	0.218000	0.23776	0.805000	0.45488	-0.908000	0.04063	-0.701000	0.05063	0.655000	0.94253	GCC	.	.		0.657	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
APPL1	26060	hgsc.bcm.edu	37	3	57282291	57282291	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:57282291G>T	ENST00000288266.3	+	10	922	c.775G>T	c.(775-777)Gat>Tat	p.D259Y		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	259	Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)			breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		AGTAGCCAGTGATCCCTTATA	0.413																																					p.D259Y		Atlas-SNP	.											.	APPL1	59	.	0			c.G775T						.						118.0	111.0	114.0					3																	57282291		2203	4300	6503	SO:0001583	missense	26060	exon10			GCCAGTGATCCCT	AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.775G>T	chr3.hg19:g.57282291G>T	ENSP00000288266:p.Asp259Tyr	263.0	0.0		267.0	168.0	NM_012096	Q9P2B9	Missense_Mutation	SNP	ENST00000288266.3	hg19	CCDS2882.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.633918	0.87660	.	.	ENSG00000157500	ENST00000288266	T	0.11604	2.76	5.94	5.94	0.96194	.	0.044796	0.85682	D	0.000000	T	0.28001	0.0690	M	0.63843	1.955	0.80722	D	1	P;P	0.52316	0.905;0.952	P;P	0.54815	0.678;0.761	T	0.00078	-1.2114	10	0.72032	D	0.01	-15.5856	20.3552	0.98837	0.0:0.0:1.0:0.0	.	242;259	B4DQX8;Q9UKG1	.;DP13A_HUMAN	Y	259	ENSP00000288266:D259Y	ENSP00000288266:D259Y	D	+	1	0	APPL1	57257331	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	9.807000	0.99171	2.812000	0.96745	0.557000	0.71058	GAT	.	.		0.413	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	NM_012096	
TMEM39A	55254	hgsc.bcm.edu	37	3	119155803	119155803	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:119155803C>A	ENST00000319172.5	-	7	1367	c.947G>T	c.(946-948)cGc>cTc	p.R316L	TMEM39A_ENST00000486159.1_5'Flank	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	316						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		ACATGACCAGCGCATGTCATA	0.453																																					p.R316L		Atlas-SNP	.											.	TMEM39A	36	.	0			c.G947T						.						198.0	179.0	186.0					3																	119155803		2203	4300	6503	SO:0001583	missense	55254	exon7			GACCAGCGCATGT	BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.947G>T	chr3.hg19:g.119155803C>A	ENSP00000326063:p.Arg316Leu	124.0	0.0		110.0	23.0	NM_018266	D3DN80|Q53FN4|Q53GI1|Q6PKB5	Missense_Mutation	SNP	ENST00000319172.5	hg19	CCDS2987.1	.	.	.	.	.	.	.	.	.	.	C	14.55	2.570205	0.45798	.	.	ENSG00000176142	ENST00000319172;ENST00000491685	T	0.45668	0.89	5.16	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.46073	0.1374	L	0.40543	1.245	0.80722	D	1	D	0.56521	0.976	P	0.58780	0.845	T	0.27054	-1.0085	10	0.11794	T	0.64	-11.3742	12.867	0.57946	0.0:0.9221:0.0:0.0779	.	316	Q9NV64	TM39A_HUMAN	L	316;162	ENSP00000326063:R316L	ENSP00000326063:R316L	R	-	2	0	TMEM39A	120638493	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.588000	0.67517	1.420000	0.47138	0.650000	0.86243	CGC	.	.		0.453	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354941.3	NM_018266	
STXBP5L	9515	hgsc.bcm.edu	37	3	121126301	121126301	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:121126301A>T	ENST00000273666.6	+	24	3142	c.2871A>T	c.(2869-2871)caA>caT	p.Q957H	STXBP5L_ENST00000492541.1_Missense_Mutation_p.Q957H|STXBP5L_ENST00000471454.1_Missense_Mutation_p.Q933H|STXBP5L_ENST00000472879.1_Missense_Mutation_p.Q933H|STXBP5L_ENST00000497029.1_Missense_Mutation_p.Q931H	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	957					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CAGAAAAACAAGCCAAAGTCT	0.383																																					p.Q957H		Atlas-SNP	.											.	STXBP5L	159	.	0			c.A2871T						.						135.0	131.0	132.0					3																	121126301		1925	4123	6048	SO:0001583	missense	9515	exon24			AAAACAAGCCAAA	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2871A>T	chr3.hg19:g.121126301A>T	ENSP00000273666:p.Gln957His	149.0	0.0		126.0	31.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	hg19	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.203209	0.79127	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53	5.33	5.33	0.75918	Lethal giant larvae (Lgl)-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63534	0.2519	M	0.89904	3.07	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.72507	-0.4272	10	0.87932	D	0	-13.8021	15.5893	0.76512	1.0:0.0:0.0:0.0	.	933;957	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	H	957;933;933;931;957;900	ENSP00000273666:Q957H;ENSP00000420019:Q933H;ENSP00000419627:Q933H;ENSP00000420287:Q931H;ENSP00000420666:Q957H;ENSP00000420167:Q900H	ENSP00000273666:Q957H	Q	+	3	2	STXBP5L	122608991	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.952000	0.70282	2.149000	0.67028	0.528000	0.53228	CAA	.	.		0.383	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
EFCC1	79825	hgsc.bcm.edu	37	3	128720898	128720898	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:128720898C>T	ENST00000480450.1	+	1	427	c.427C>T	c.(427-429)Cgc>Tgc	p.R143C	KIAA1257_ENST00000510149.1_Intron|EFCC1_ENST00000436022.2_5'UTR			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	143							calcium ion binding (GO:0005509)										GCTCACCTTCCGCCAGTTCCA	0.731																																					p.R143C		Atlas-SNP	.											.	.	.	.	0			c.C427T						.						2.0	4.0	4.0					3																	128720898		407	1211	1618	SO:0001583	missense	79825	exon1			ACCTTCCGCCAGT	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.427C>T	chr3.hg19:g.128720898C>T	ENSP00000420075:p.Arg143Cys	113.0	0.0		79.0	29.0	NM_024768	A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	hg19	CCDS3054.2	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898598	0.52227	.	.	ENSG00000114654	ENST00000480450	T	0.58797	0.31	3.43	3.43	0.39272	.	0.000000	0.64402	U	0.000003	T	0.71187	0.3310	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74725	-0.3568	10	0.87932	D	0	-8.647	12.4012	0.55414	0.0:1.0:0.0:0.0	.	143	Q9HA90	CCD48_HUMAN	C	143	ENSP00000420075:R143C	ENSP00000420075:R143C	R	+	1	0	CCDC48	130203588	1.000000	0.71417	1.000000	0.80357	0.305000	0.27757	1.657000	0.37366	1.458000	0.47871	0.306000	0.20318	CGC	.	.		0.731	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1	NM_024768	
PLS1	5357	hgsc.bcm.edu	37	3	142388377	142388377	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:142388377T>G	ENST00000337777.3	+	3	429	c.216T>G	c.(214-216)agT>agG	p.S72R	PLS1_ENST00000457734.2_Missense_Mutation_p.S72R|PLS1_ENST00000497002.1_Missense_Mutation_p.S72R	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	72	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GCAAAATCAGTTTTGAAGAGT	0.403																																					p.S72R		Atlas-SNP	.											.	PLS1	71	.	0			c.T216G						.						178.0	186.0	183.0					3																	142388377		2203	4300	6503	SO:0001583	missense	5357	exon3			AATCAGTTTTGAA	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.216T>G	chr3.hg19:g.142388377T>G	ENSP00000336831:p.Ser72Arg	118.0	0.0		125.0	7.0	NM_001172312	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	ENST00000337777.3	hg19	CCDS3125.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.846534	0.51164	.	.	ENSG00000120756	ENST00000457734;ENST00000475296;ENST00000464320;ENST00000337777;ENST00000497002	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	5.16	0.407	0.16371	EF-hand-like domain (1);	0.204788	0.64402	N	0.000013	T	0.79215	0.4408	M	0.88377	2.95	0.48135	D	0.999593	B	0.02656	0.0	B	0.08055	0.003	T	0.74850	-0.3524	10	0.87932	D	0	-15.057	12.7818	0.57480	0.0:0.8314:0.0:0.1686	.	72	Q14651	PLSI_HUMAN	R	72	ENSP00000387890:S72R;ENSP00000417311:S72R;ENSP00000418880:S72R;ENSP00000336831:S72R;ENSP00000418700:S72R	ENSP00000336831:S72R	S	+	3	2	PLS1	143871067	1.000000	0.71417	0.988000	0.46212	0.991000	0.79684	1.258000	0.32944	-0.160000	0.11002	0.528000	0.53228	AGT	.	.		0.403	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354435.1	NM_002670	
RAP2B	5912	hgsc.bcm.edu	37	3	152880629	152880629	+	Silent	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:152880629G>T	ENST00000323534.2	+	1	601	c.147G>T	c.(145-147)tcG>tcT	p.S49S	RP11-529G21.2_ENST00000487827.1_RNA	NM_002886.2	NP_002877.2	P61225	RAP2B_HUMAN	RAP2B, member of RAS oncogene family	49					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of protein autophosphorylation (GO:0031954)|Rap protein signal transduction (GO:0032486)|regulation of protein tyrosine kinase activity (GO:0061097)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			TGGACTCGTCGCCGTCGGTGC	0.597																																					p.S49S		Atlas-SNP	.											.	RAP2B	20	.	0			c.G147T						.						108.0	106.0	107.0					3																	152880629		2203	4300	6503	SO:0001819	synonymous_variant	5912	exon1			CTCGTCGCCGTCG		CCDS3170.1	3q25.2	2014-05-09			ENSG00000181467	ENSG00000181467			9862	protein-coding gene	gene with protein product	"""Ras-related protein RAP-2B"", ""small GTP binding protein"", ""Ras family small GTP binding protein RAP2B"""	179541				2118648	Standard	NM_002886		Approved		uc003ezr.3	P61225	OTTHUMG00000159655	ENST00000323534.2:c.147G>T	chr3.hg19:g.152880629G>T		138.0	0.0		137.0	40.0	NM_002886	P17964|Q96EG5|Q9CXG0	Silent	SNP	ENST00000323534.2	hg19	CCDS3170.1																																																																																			.	.		0.597	RAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356707.1	NM_002886	
FXR1	8087	hgsc.bcm.edu	37	3	180652981	180652981	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr3:180652981G>T	ENST00000357559.4	+	3	544	c.160G>T	c.(160-162)Gat>Tat	p.D54Y	FXR1_ENST00000468861.1_5'UTR|FXR1_ENST00000445140.2_Missense_Mutation_p.D54Y|FXR1_ENST00000480918.1_Missense_Mutation_p.D41Y|FXR1_ENST00000305586.7_5'UTR|FXR1_ENST00000491062.1_Intron	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	54					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			ACCACCACCTGATATAAAAAA	0.284																																					p.D54Y		Atlas-SNP	.											.	FXR1	75	.	0			c.G160T						.						63.0	65.0	64.0					3																	180652981		2203	4300	6503	SO:0001583	missense	8087	exon3			CCACCTGATATAA	M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.160G>T	chr3.hg19:g.180652981G>T	ENSP00000350170:p.Asp54Tyr	358.0	0.0		256.0	129.0	NM_001013438	A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	ENST00000357559.4	hg19	CCDS3238.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764166	0.89932	.	.	ENSG00000114416	ENST00000357559;ENST00000445140;ENST00000480918;ENST00000484042	T;T;T;T	0.48522	1.81;1.14;1.61;0.81	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.67776	0.2929	M	0.70595	2.14	0.80722	D	1	D;P;D	0.76494	0.999;0.658;0.971	D;P;P	0.63033	0.91;0.476;0.667	T	0.69738	-0.5064	10	0.72032	D	0.01	-8.0643	19.4329	0.94778	0.0:0.0:1.0:0.0	.	41;54;54	B4DXZ6;P51114-2;P51114	.;.;FXR1_HUMAN	Y	54;54;41;58	ENSP00000350170:D54Y;ENSP00000388828:D54Y;ENSP00000418097:D41Y;ENSP00000417513:D58Y	ENSP00000350170:D54Y	D	+	1	0	FXR1	182135675	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.583000	0.90794	2.763000	0.94921	0.557000	0.71058	GAT	.	.		0.284	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350265.5		
LRBA	987	hgsc.bcm.edu	37	4	151773243	151773243	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr4:151773243G>C	ENST00000357115.3	-	23	3862	c.3619C>G	c.(3619-3621)Cag>Gag	p.Q1207E	LRBA_ENST00000510413.1_Missense_Mutation_p.Q1207E|LRBA_ENST00000535741.1_Missense_Mutation_p.Q1207E|LRBA_ENST00000507224.1_Missense_Mutation_p.Q1207E	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1207						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TCCAGCATCTGACCAAGGTCT	0.408																																					p.Q1207E		Atlas-SNP	.											.	LRBA	253	.	0			c.C3619G						.						113.0	109.0	110.0					4																	151773243		2203	4300	6503	SO:0001583	missense	987	exon23			GCATCTGACCAAG	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.3619C>G	chr4.hg19:g.151773243G>C	ENSP00000349629:p.Gln1207Glu	127.0	0.0		67.0	23.0	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.748877	0.00086	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.53640	1.02;1.17;1.02;0.61	5.78	4.02	0.46733	.	1.403590	0.04133	N	0.318263	T	0.25531	0.0621	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32402	-0.9908	10	0.02654	T	1	.	5.8662	0.18777	0.0725:0.3908:0.4035:0.1332	.	1207;1207	P50851;P50851-2	LRBA_HUMAN;.	E	1207	ENSP00000446299:Q1207E;ENSP00000421552:Q1207E;ENSP00000349629:Q1207E;ENSP00000422180:Q1207E	ENSP00000349629:Q1207E	Q	-	1	0	LRBA	151992693	0.166000	0.22962	0.008000	0.14137	0.097000	0.18754	1.589000	0.36644	0.861000	0.35504	0.591000	0.81541	CAG	.	.		0.408	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
SPEF2	79925	hgsc.bcm.edu	37	5	35700832	35700832	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:35700832G>A	ENST00000356031.3	+	16	2530	c.2376G>A	c.(2374-2376)atG>atA	p.M792I	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Missense_Mutation_p.M787I|SPEF2_ENST00000440995.2_Missense_Mutation_p.M787I	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	792					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTTCCTCAATGAGTCGCATGA	0.358																																					p.M792I		Atlas-SNP	.											SPEF2_ENST00000356031,NS,carcinoma,0,1	SPEF2	324	.	0			c.G2376A						.						91.0	82.0	85.0					5																	35700832		1844	4078	5922	SO:0001583	missense	79925	exon16			CTCAATGAGTCGC	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2376G>A	chr5.hg19:g.35700832G>A	ENSP00000348314:p.Met792Ile	115.0	0.0		127.0	24.0	NM_024867	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	hg19	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	6.568	0.473146	0.12461	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995;ENST00000504054	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.79	1.02	0.19986	.	0.583392	0.16116	N	0.228844	T	0.18882	0.0453	N	0.22421	0.69	0.23036	N	0.998399	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.0	T	0.17592	-1.0364	10	0.48119	T	0.1	.	8.6755	0.34176	0.3692:0.0:0.6308:0.0	.	787;787;792	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	I	792;787;787;298	ENSP00000348314:M792I;ENSP00000421593:M787I;ENSP00000412125:M787I;ENSP00000421744:M298I	ENSP00000348314:M792I	M	+	3	0	SPEF2	35736589	0.796000	0.28864	0.004000	0.12327	0.055000	0.15305	1.206000	0.32321	0.098000	0.17522	0.650000	0.86243	ATG	.	.		0.358	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60827372	60827372	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:60827372A>T	ENST00000252744.5	+	9	2065	c.2065A>T	c.(2065-2067)Acg>Tcg	p.T689S		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	689					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						ATCCTATTTAACGCTGGCTGT	0.478																																					p.T689S		Atlas-SNP	.											.	ZSWIM6	51	.	0			c.A2065T						.						70.0	57.0	61.0					5																	60827372		692	1591	2283	SO:0001583	missense	57688	exon9			TATTTAACGCTGG	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.2065A>T	chr5.hg19:g.60827372A>T	ENSP00000252744:p.Thr689Ser	204.0	0.0		254.0	114.0	NM_020928		Missense_Mutation	SNP	ENST00000252744.5	hg19	CCDS47215.1	.	.	.	.	.	.	.	.	.	.	A	8.245	0.807618	0.16467	.	.	ENSG00000130449	ENST00000252744	T	0.42131	0.98	5.83	5.83	0.93111	.	0.231045	0.44285	D	0.000477	T	0.15869	0.0382	N	0.01109	-1.01	0.29647	N	0.844222	B	0.12013	0.005	B	0.15484	0.013	T	0.06285	-1.0835	10	0.05833	T	0.94	-9.6187	16.1968	0.82036	1.0:0.0:0.0:0.0	.	689	Q9HCJ5	ZSWM6_HUMAN	S	689	ENSP00000252744:T689S	ENSP00000252744:T689S	T	+	1	0	ZSWIM6	60863129	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	5.218000	0.65257	2.225000	0.72522	0.533000	0.62120	ACG	.	.		0.478	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	
REEP2	51308	hgsc.bcm.edu	37	5	137780496	137780496	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:137780496G>A	ENST00000254901.5	+	5	479	c.357G>A	c.(355-357)atG>atA	p.M119I	REEP2_ENST00000378339.2_Missense_Mutation_p.M119I|REEP2_ENST00000506158.1_Missense_Mutation_p.M81I	NM_016606.2	NP_057690.2	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	119					cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein transport into membrane raft (GO:0032596)|regulation of intracellular transport (GO:0032386)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AGACCATGATGAGGGTGGGCA	0.612																																					p.M119I		Atlas-SNP	.											.	REEP2	21	.	0			c.G357A						.						72.0	63.0	66.0					5																	137780496		2203	4300	6503	SO:0001583	missense	51308	exon5			CATGATGAGGGTG	AK056193	CCDS4205.1, CCDS64259.1	5q31	2014-03-12	2006-02-07	2006-02-07	ENSG00000132563	ENSG00000132563		"""Receptor accessory proteins"""	17975	protein-coding gene	gene with protein product		609347	"""chromosome 5 open reading frame 19"""	C5orf19		16271481, 15550249, 24388663	Standard	NM_016606		Approved	SGC32445, SPG72	uc003lda.4	Q9BRK0	OTTHUMG00000129205	ENST00000254901.5:c.357G>A	chr5.hg19:g.137780496G>A	ENSP00000254901:p.Met119Ile	136.0	0.0		164.0	29.0	NM_016606	Q53EM8|Q9NYF2	Missense_Mutation	SNP	ENST00000254901.5	hg19	CCDS4205.1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907712	0.72868	.	.	ENSG00000132563	ENST00000378339;ENST00000254901;ENST00000506158	D;D;T	0.87966	-2.31;-2.32;-1.47	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.84442	0.5473	L	0.46157	1.445	0.80722	D	1	B;B	0.19200	0.012;0.034	B;B	0.20955	0.014;0.032	T	0.80466	-0.1370	10	0.45353	T	0.12	-6.4081	17.4692	0.87641	0.0:0.0:1.0:0.0	.	119;119	A8K3D2;Q9BRK0	.;REEP2_HUMAN	I	119;119;81	ENSP00000367590:M119I;ENSP00000254901:M119I;ENSP00000422530:M81I	ENSP00000254901:M119I	M	+	3	0	REEP2	137808395	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.523000	0.98034	2.670000	0.90874	0.650000	0.86243	ATG	.	.		0.612	REEP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251284.1	NM_016606	
NDUFA2	4695	hgsc.bcm.edu	37	5	140027159	140027159	+	Missense_Mutation	SNP	C	C	T	rs370015250		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:140027159C>T	ENST00000252102.4	-	1	211	c.10G>A	c.(10-12)Gcc>Acc	p.A4T	NDUFA2_ENST00000512088.1_Missense_Mutation_p.A4T|MIR3655_ENST00000581765.1_RNA|IK_ENST00000417647.2_5'Flank|NDUFA2_ENST00000510680.1_5'Flank	NM_001185012.1|NM_002488.4	NP_001171941.1|NP_002479.1	O43678	NDUA2_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa	4					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTGCTGCGGCCGCCGCCATC	0.622																																					p.A4T		Atlas-SNP	.											.	NDUFA2	13	.	0			c.G10A						.	C	THR/ALA,THR/ALA	1,4379		0,1,2189	15.0	16.0	16.0		10,10	1.0	0.0	5		16	0,8564		0,0,4282	no	missense,missense	NDUFA2	NM_002488.4,NM_001185012.1	58,58	0,1,6471	TT,TC,CC		0.0,0.0228,0.0077	benign,benign	4/100,4/77	140027159	1,12943	2190	4282	6472	SO:0001583	missense	4695	exon1			CTGCGGCCGCCGC	AF047185	CCDS4234.1, CCDS54911.1	5q31.2	2011-07-04	2002-08-29		ENSG00000131495	ENSG00000131495		"""Mitochondrial respiratory chain complex / Complex I"""	7685	protein-coding gene	gene with protein product	"""complex I B8 subunit"""	602137	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (8kD, B8)"""			9425316, 9763676	Standard	NM_002488		Approved	B8	uc003lgp.3	O43678	OTTHUMG00000129505	ENST00000252102.4:c.10G>A	chr5.hg19:g.140027159C>T	ENSP00000252102:p.Ala4Thr	51.0	0.0		67.0	37.0	NM_001185012	D6RJD6|Q6IAY8	Missense_Mutation	SNP	ENST00000252102.4	hg19	CCDS4234.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.180132	0.78564	2.28E-4	0.0	ENSG00000131495	ENST00000252102;ENST00000512088	.	.	.	5.8	0.998	0.19857	.	0.148745	0.64402	D	0.000012	T	0.42944	0.1225	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.18808	-1.0325	8	0.42905	T	0.14	-0.473	7.5555	0.27822	0.0:0.6431:0.1076:0.2493	.	4	O43678	NDUA2_HUMAN	T	4	.	ENSP00000252102:A4T	A	-	1	0	NDUFA2	140007343	0.979000	0.34478	0.002000	0.10522	0.009000	0.06853	2.463000	0.45058	0.119000	0.18210	-1.002000	0.02502	GCC	.	.		0.622	NDUFA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251679.2	NM_002488	
PCDHGA12	26025	hgsc.bcm.edu	37	5	140810476	140810476	+	Silent	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:140810476G>A	ENST00000252085.3	+	1	292	c.150G>A	c.(148-150)agG>agA	p.R50R	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA7_ENST00000518325.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	50	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACATCTCCAGGGACCTGGGGC	0.642																																					p.R50R		Atlas-SNP	.											.	PCDHGA12	271	.	0			c.G150A						.						65.0	79.0	74.0					5																	140810476		2203	4300	6503	SO:0001819	synonymous_variant	26025	exon1			CTCCAGGGACCTG	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.150G>A	chr5.hg19:g.140810476G>A		254.0	0.0		308.0	145.0	NM_032094	O15100|Q6UW70|Q9Y5D7	Silent	SNP	ENST00000252085.3	hg19	CCDS4260.1																																																																																			.	.		0.642	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
PPP2R2B	5521	hgsc.bcm.edu	37	5	146258290	146258290	+	5'UTR	SNP	A	A	T	rs142461655|rs57408722|rs10591869	byFrequency	TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:146258290A>T	ENST00000453001.1	-	0	167				PPP2R2B_ENST00000394414.1_Intron|PPP2R2B_ENST00000394411.4_5'UTR|PPP2R2B_ENST00000508545.2_Intron|PPP2R2B_ENST00000504198.1_Intron|PPP2R2B_ENST00000394413.3_5'Flank|PPP2R2B_ENST00000394409.3_Intron|PPP2R2B_ENST00000336640.6_Intron|PPP2R2B_ENST00000394410.2_Intron|PPP2R2B_ENST00000356826.3_Intron|PPP2R2B_ENST00000530902.1_5'UTR			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCGCACTCGCAgctgctgctg	0.716																																					p.C20S		Atlas-SNP	.											.	PPP2R2B	271	.	0			c.T58A						.																																			SO:0001623	5_prime_UTR_variant	5521	exon1			ACTCGCAGCTGCT	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000453001.1:c.-151T>A	chr5.hg19:g.146258290A>T		4.0	0.0		12.0	4.0	NM_181675	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	ENST00000453001.1	hg19	CCDS4284.1																																																																																			.	.		0.716	PPP2R2B-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388939.2	NM_181678	
GLRA1	2741	hgsc.bcm.edu	37	5	151271886	151271886	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:151271886C>A	ENST00000455880.2	-	2	456	c.170G>T	c.(169-171)aGg>aTg	p.R57M	GLRA1_ENST00000274576.4_Missense_Mutation_p.R57M|GLRA1_ENST00000471351.2_5'UTR|GLRA1_ENST00000545569.1_Intron			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	57					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAAATTGGGCCTGATCCTGGC	0.498																																					p.R57M		Atlas-SNP	.											.	GLRA1	61	.	0			c.G170T						.						101.0	91.0	94.0					5																	151271886		2203	4300	6503	SO:0001583	missense	2741	exon2			TTGGGCCTGATCC		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.170G>T	chr5.hg19:g.151271886C>A	ENSP00000411593:p.Arg57Met	132.0	0.0		167.0	81.0	NM_000171	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	hg19	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.743030	0.89663	.	.	ENSG00000145888	ENST00000274576;ENST00000455880	D;D	0.83419	-1.72;-1.72	5.48	5.48	0.80851	Neurotransmitter-gated ion-channel ligand-binding (3);	0.105778	0.64402	D	0.000006	D	0.94212	0.8142	H	0.95224	3.64	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.95553	0.8622	10	0.87932	D	0	.	19.3497	0.94378	0.0:1.0:0.0:0.0	.	57;57	P23415;P23415-2	GLRA1_HUMAN;.	M	57	ENSP00000274576:R57M;ENSP00000411593:R57M	ENSP00000274576:R57M	R	-	2	0	GLRA1	151252079	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.311000	0.78958	2.583000	0.87209	0.591000	0.81541	AGG	.	.		0.498	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000373959.1		
HAND1	9421	hgsc.bcm.edu	37	5	153857306	153857306	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:153857306A>T	ENST00000231121.2	-	1	518	c.263T>A	c.(262-264)cTt>cAt	p.L88H		NM_004821.2	NP_004812.1	O96004	HAND1_HUMAN	heart and neural crest derivatives expressed 1	88					angiogenesis (GO:0001525)|blastocyst development (GO:0001824)|cardiac left ventricle formation (GO:0003218)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cartilage morphogenesis (GO:0060536)|embryonic heart tube development (GO:0035050)|embryonic heart tube formation (GO:0003144)|heart development (GO:0007507)|heart looping (GO:0001947)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)|trophoblast giant cell differentiation (GO:0060707)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			ACGGCCGCCAAGCGCCTCCAG	0.716																																					p.L88H		Atlas-SNP	.											.	HAND1	21	.	0			c.T263A						.						14.0	17.0	16.0					5																	153857306		2202	4289	6491	SO:0001583	missense	9421	exon1			CCGCCAAGCGCCT	AF061756	CCDS4327.1	5q33	2013-05-21			ENSG00000113196	ENSG00000113196		"""Basic helix-loop-helix proteins"""	4807	protein-coding gene	gene with protein product		602406				9337404, 9931445	Standard	NM_004821		Approved	eHand, Thing1, Hxt, bHLHa27	uc003lvn.3	O96004	OTTHUMG00000130193	ENST00000231121.2:c.263T>A	chr5.hg19:g.153857306A>T	ENSP00000231121:p.Leu88His	59.0	0.0		65.0	38.0	NM_004821		Missense_Mutation	SNP	ENST00000231121.2	hg19	CCDS4327.1	.	.	.	.	.	.	.	.	.	.	A	13.20	2.165780	0.38217	.	.	ENSG00000113196	ENST00000231121	D	0.95518	-3.73	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000001	D	0.90776	0.7104	L	0.36672	1.1	0.48511	D	0.999664	P	0.46327	0.876	B	0.36289	0.221	D	0.90420	0.4416	10	0.41790	T	0.15	-19.501	12.6267	0.56634	1.0:0.0:0.0:0.0	.	88	O96004	HAND1_HUMAN	H	88	ENSP00000231121:L88H	ENSP00000231121:L88H	L	-	2	0	HAND1	153837499	0.690000	0.27699	0.933000	0.37362	0.677000	0.39632	1.898000	0.39809	1.866000	0.54105	0.260000	0.18958	CTT	.	.		0.716	HAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252511.1	NM_004821	
CANX	821	hgsc.bcm.edu	37	5	179146764	179146764	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:179146764C>G	ENST00000247461.4	+	9	1207	c.1007C>G	c.(1006-1008)gCa>gGa	p.A336G	CANX_ENST00000415618.2_Missense_Mutation_p.A371G|CANX_ENST00000452673.2_Missense_Mutation_p.A336G|CANX_ENST00000512607.2_Missense_Mutation_p.A228G|CANX_ENST00000504734.1_Missense_Mutation_p.A336G	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	336	4 X approximate repeats.|Interaction with PPIB. {ECO:0000250}.|P domain (Extended arm). {ECO:0000250}.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	GATCCAGACGCAGAGAAACCT	0.418																																					p.A336G		Atlas-SNP	.											.	CANX	47	.	0			c.C1007G						.						69.0	70.0	70.0					5																	179146764		2203	4300	6503	SO:0001583	missense	821	exon9			CAGACGCAGAGAA	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1007C>G	chr5.hg19:g.179146764C>G	ENSP00000247461:p.Ala336Gly	237.0	0.0		270.0	113.0	NM_001746	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	ENST00000247461.4	hg19	CCDS4447.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485958	0.63962	.	.	ENSG00000127022	ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000502673;ENST00000512607;ENST00000376953	T;T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39;0.39	5.35	4.48	0.54585	Calreticulin/calnexin, conserved site (1);Calreticulin/calnexin, P (2);	0.000000	0.85682	D	0.000000	T	0.65417	0.2689	H	0.94385	3.53	0.80722	D	1	B;B;B	0.32051	0.1;0.046;0.354	B;B;B	0.32393	0.145;0.043;0.145	T	0.72475	-0.4282	10	0.87932	D	0	-23.0612	14.2121	0.65771	0.0:0.9272:0.0:0.0728	.	371;272;336	B4DGP8;Q6ZP56;P27824	.;.;CALX_HUMAN	G	336;371;336;336;272;228;272	ENSP00000424063:A336G;ENSP00000394817:A371G;ENSP00000391646:A336G;ENSP00000247461:A336G;ENSP00000421107:A272G;ENSP00000423588:A228G	ENSP00000247461:A336G	A	+	2	0	CANX	179079370	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.570000	0.82390	1.256000	0.44068	0.561000	0.74099	GCA	.	.		0.418	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649	
DST	667	hgsc.bcm.edu	37	6	56505183	56505183	+	Silent	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr6:56505183G>A	ENST00000361203.3	-	14	1622	c.1615C>T	c.(1615-1617)Ctg>Ttg	p.L539L	DST_ENST00000370754.5_Silent_p.L717L|DST_ENST00000446842.2_Silent_p.L213L|DST_ENST00000244364.6_Silent_p.L213L|DST_ENST00000312431.6_Silent_p.L539L|DST_ENST00000370769.4_Silent_p.L539L|DST_ENST00000518935.1_Silent_p.L213L|DST_ENST00000370788.2_Silent_p.L539L|DST_ENST00000421834.2_Silent_p.L539L|DST_ENST00000370765.6_Silent_p.L213L			Q03001	DYST_HUMAN	dystonin	539					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCTGATGACAGGCCAGAAGTC	0.473																																					p.L213L		Atlas-SNP	.											.	DST	1427	.	0			c.C637T						.						143.0	146.0	145.0					6																	56505183		2203	4300	6503	SO:0001819	synonymous_variant	667	exon4			ATGACAGGCCAGA	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1615C>T	chr6.hg19:g.56505183G>A		153.0	0.0		213.0	106.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	hg19																																																																																				.	.		0.473	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
GPR63	81491	hgsc.bcm.edu	37	6	97247593	97247593	+	Silent	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr6:97247593T>A	ENST00000229955.3	-	2	360	c.15A>T	c.(13-15)gcA>gcT	p.A5A	GPR63_ENST00000417980.1_Silent_p.A5A	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		CAGTCAACACTGCCGAGAAGA	0.463																																					p.A5A		Atlas-SNP	.											.	GPR63	60	.	0			c.A15T						.						108.0	99.0	102.0					6																	97247593		2203	4300	6503	SO:0001819	synonymous_variant	81491	exon2			CAACACTGCCGAG	AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.15A>T	chr6.hg19:g.97247593T>A		104.0	0.0		87.0	74.0	NM_030784	Q9UJH3	Silent	SNP	ENST00000229955.3	hg19	CCDS5036.1																																																																																			.	.		0.463	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041566.2		
ALDH8A1	64577	hgsc.bcm.edu	37	6	135239910	135239910	+	Silent	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr6:135239910T>C	ENST00000265605.2	-	7	1175	c.1107A>G	c.(1105-1107)gcA>gcG	p.A369A	ALDH8A1_ENST00000367847.2_Silent_p.A319A|ALDH8A1_ENST00000367845.2_Silent_p.A315A	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	369					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		TAAAGTAGCCTGCCTGGTTCC	0.517																																					p.A369A		Atlas-SNP	.											.	ALDH8A1	68	.	0			c.A1107G						.						115.0	112.0	113.0					6																	135239910		2203	4300	6503	SO:0001819	synonymous_variant	64577	exon7			GTAGCCTGCCTGG	AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1107A>G	chr6.hg19:g.135239910T>C		116.0	0.0		72.0	61.0	NM_022568	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Silent	SNP	ENST00000265605.2	hg19	CCDS5171.1																																																																																			.	.		0.517	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042334.2		
CCDC170	80129	hgsc.bcm.edu	37	6	151936741	151936741	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr6:151936741T>C	ENST00000239374.7	+	10	1973	c.1874T>C	c.(1873-1875)aTg>aCg	p.M625T	CCDC170_ENST00000367290.5_Missense_Mutation_p.M632T|RNU6-813P_ENST00000384691.1_RNA	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	625																	GCCAGAAACATGATAGAAGTG	0.403																																					p.M625T		Atlas-SNP	.											.	.	.	.	0			c.T1874C						.						151.0	146.0	147.0					6																	151936741		1848	4093	5941	SO:0001583	missense	80129	exon10			GAAACATGATAGA	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1874T>C	chr6.hg19:g.151936741T>C	ENSP00000239374:p.Met625Thr	347.0	0.0		220.0	192.0	NM_025059	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	ENST00000239374.7	hg19	CCDS43515.1	.	.	.	.	.	.	.	.	.	.	T	9.258	1.042412	0.19748	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.08193	3.13;3.12	6.16	3.82	0.43975	.	0.196579	0.56097	N	0.000040	T	0.02610	0.0079	L	0.45137	1.4	0.36427	D	0.864708	B	0.09022	0.002	B	0.08055	0.003	T	0.33317	-0.9873	10	0.17832	T	0.49	-11.4716	10.1543	0.42814	0.0:0.1329:0.0:0.8671	.	625	Q8IYT3	CF097_HUMAN	T	625;632	ENSP00000239374:M625T;ENSP00000356259:M632T	ENSP00000239374:M625T	M	+	2	0	C6orf97	151978434	0.972000	0.33761	0.284000	0.24805	0.765000	0.43378	2.051000	0.41307	1.152000	0.42452	0.528000	0.53228	ATG	.	.		0.403	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059	
FNDC1	84624	hgsc.bcm.edu	37	6	159642682	159642682	+	Silent	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr6:159642682G>T	ENST00000297267.9	+	6	920	c.720G>T	c.(718-720)cgG>cgT	p.R240R	FNDC1_ENST00000340366.6_Silent_p.R240R|FNDC1_ENST00000480856.1_3'UTR	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	240	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CTCAGGGCCGGAGCCAACCAG	0.498																																					p.R240R		Atlas-SNP	.											.	FNDC1	250	.	0			c.G720T						.						109.0	118.0	115.0					6																	159642682		1984	4158	6142	SO:0001819	synonymous_variant	84624	exon6			GGGCCGGAGCCAA	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.720G>T	chr6.hg19:g.159642682G>T		103.0	0.0		57.0	50.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	ENST00000297267.9	hg19	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.450093	0.26074	.	.	ENSG00000164694	ENST00000329629	.	.	.	6.17	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.963	9.8425	0.41006	0.0698:0.2659:0.6643:0.0	.	.	.	.	X	199	.	.	E	+	1	0	FNDC1	159562670	0.999000	0.42202	0.964000	0.40570	0.976000	0.68499	2.835000	0.48175	1.565000	0.49641	0.655000	0.94253	GAG	.	.		0.498	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
PRR18	285800	hgsc.bcm.edu	37	6	166721359	166721359	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr6:166721359G>A	ENST00000322583.3	-	1	512	c.272C>T	c.(271-273)gCc>gTc	p.A91V		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	91	Pro-rich.									haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		ccggggcggggcgcacgtggc	0.831																																					p.A91V		Atlas-SNP	.											.	PRR18	4	.	0			c.C272T						.						1.0	1.0	1.0					6																	166721359		430	1138	1568	SO:0001583	missense	285800	exon1			GGCGGGGCGCACG	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.272C>T	chr6.hg19:g.166721359G>A	ENSP00000319590:p.Ala91Val	13.0	0.0		35.0	19.0	NM_175922		Missense_Mutation	SNP	ENST00000322583.3	hg19	CCDS5291.1	.	.	.	.	.	.	.	.	.	.	G	11.89	1.772267	0.31411	.	.	ENSG00000176381	ENST00000322583;ENST00000529616	T	0.44482	0.92	3.02	3.02	0.34903	.	0.816969	0.09878	U	0.744100	T	0.18383	0.0441	N	0.19112	0.55	0.09310	N	1	P	0.43938	0.822	P	0.45428	0.48	T	0.09596	-1.0667	10	0.41790	T	0.15	.	11.4293	0.50029	0.0:0.0:1.0:0.0	.	91	Q8N4B5	PRR18_HUMAN	V	91	ENSP00000319590:A91V	ENSP00000319590:A91V	A	-	2	0	PRR18	166641349	0.001000	0.12720	0.413000	0.26509	0.027000	0.11550	0.424000	0.21330	1.202000	0.43218	0.484000	0.47621	GCC	.	.		0.831	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
WDR27	253769	hgsc.bcm.edu	37	6	170043854	170043854	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr6:170043854C>A	ENST00000448612.1	-	17	1795	c.1686G>T	c.(1684-1686)ttG>ttT	p.L562F	WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000423258.1_Missense_Mutation_p.L435F|WDR27_ENST00000333572.6_Missense_Mutation_p.L562F	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	532						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		GATGGTTGGCCAACCCACAGG	0.418																																					p.L562F		Atlas-SNP	.											.	WDR27	129	.	0			c.G1686T						.						49.0	54.0	52.0					6																	170043854		1873	4093	5966	SO:0001583	missense	253769	exon17			GTTGGCCAACCCA	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.1686G>T	chr6.hg19:g.170043854C>A	ENSP00000416289:p.Leu562Phe	115.0	0.0		91.0	39.0	NM_182552	A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	ENST00000448612.1	hg19	CCDS47520.2	.	.	.	.	.	.	.	.	.	.	C	9.881	1.201495	0.22121	.	.	ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258	T;T;T	0.39787	1.07;1.06;4.98	5.19	-1.45	0.08828	.	0.000000	0.47852	D	0.000208	T	0.17704	0.0425	M	0.62723	1.935	0.80722	D	1	B;P;P	0.48407	0.105;0.617;0.91	B;B;P	0.45428	0.042;0.28;0.48	T	0.31052	-0.9957	10	0.12430	T	0.62	-9.8639	4.8836	0.13692	0.1369:0.3538:0.0:0.5092	.	562;435;562	F2Z2U5;A2RRH5-2;C9JGV0	.;.;.	F	562;562;435	ENSP00000416289:L562F;ENSP00000330265:L562F;ENSP00000397869:L435F	ENSP00000330265:L562F	L	-	3	2	WDR27	169785779	0.245000	0.23899	0.144000	0.22314	0.024000	0.10985	-0.609000	0.05635	-0.252000	0.09528	-0.293000	0.09583	TTG	.	.		0.418	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
MTERF1	7978	hgsc.bcm.edu	37	7	91503579	91503579	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr7:91503579C>A	ENST00000351870.3	-	3	622	c.529G>T	c.(529-531)Gag>Tag	p.E177*	MTERF_ENST00000419292.1_Nonsense_Mutation_p.E157*|MTERF_ENST00000481516.1_5'Flank|MTERF_ENST00000406735.2_Nonsense_Mutation_p.E157*	NM_006980.3	NP_008911.1	Q99551	MTEF1_HUMAN		177					DNA geometric change (GO:0032392)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of mitochondrial transcription (GO:0006393)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|skin(1)	14	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			ATATTATTCTCTAAGTTTAGG	0.388																																					p.E177X		Atlas-SNP	.											.	MTERF	32	.	0			c.G529T						.						75.0	77.0	76.0					7																	91503579		2203	4300	6503	SO:0001587	stop_gained	7978	exon3			TATTCTCTAAGTT																												ENST00000351870.3:c.529G>T	chr7.hg19:g.91503579C>A	ENSP00000248643:p.Glu177*	140.0	0.0		204.0	58.0	NM_006980	A4D1E3|Q32NF8|Q53H51|Q9BVR7	Nonsense_Mutation	SNP	ENST00000351870.3	hg19	CCDS5621.1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302166	0.60195	.	.	ENSG00000127989	ENST00000419292;ENST00000351870;ENST00000406735	.	.	.	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7868	12.2646	0.54670	0.0:0.7167:0.2833:0.0	.	.	.	.	X	157;177;157	.	ENSP00000248643:E177X	E	-	1	0	MTERF	91341515	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	1.011000	0.29911	2.503000	0.84419	0.591000	0.81541	GAG	.	.		0.388	MTERF-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000342896.1		
STAG3	10734	hgsc.bcm.edu	37	7	99797925	99797925	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr7:99797925C>T	ENST00000426455.1	+	17	2151	c.1744C>T	c.(1744-1746)Ccc>Tcc	p.P582S	GATS_ENST00000543273.1_RNA|STAG3_ENST00000394018.2_Missense_Mutation_p.P524S|STAG3_ENST00000440830.1_3'UTR|STAG3_ENST00000317296.5_Missense_Mutation_p.P582S	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	582					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCACCTCATCCCCCTGCTGCC	0.597																																					p.P582S		Atlas-SNP	.											.	STAG3	121	.	0			c.C1744T						.						67.0	56.0	60.0					7																	99797925		2203	4300	6503	SO:0001583	missense	10734	exon17			CTCATCCCCCTGC	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.1744C>T	chr7.hg19:g.99797925C>T	ENSP00000400359:p.Pro582Ser	95.0	0.0		132.0	28.0	NM_012447	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	hg19	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	.	19.52	3.843073	0.71488	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000317296	T;T;T	0.22743	1.94;1.94;1.94	5.3	5.3	0.74995	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.52532	D	0.000063	T	0.23094	0.0558	L	0.49455	1.56	0.38969	D	0.958701	P;P	0.41597	0.756;0.58	B;B	0.41466	0.358;0.304	T	0.02352	-1.1172	10	0.59425	D	0.04	-20.0884	12.062	0.53568	0.0:0.827:0.173:0.0	.	524;582	B4DZ10;Q9UJ98	.;STAG3_HUMAN	S	582;524;540;582	ENSP00000400359:P582S;ENSP00000377586:P524S;ENSP00000319318:P582S	ENSP00000319318:P582S	P	+	1	0	STAG3	99635861	0.000000	0.05858	0.999000	0.59377	0.955000	0.61496	0.133000	0.15912	2.757000	0.94681	0.655000	0.94253	CCC	.	.		0.597	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
GPR37	2861	hgsc.bcm.edu	37	7	124404436	124404436	+	Nonsense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr7:124404436T>A	ENST00000303921.2	-	1	1245	c.595A>T	c.(595-597)Aag>Tag	p.K199*		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	199					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TTGGCCGTCTTGGACAGGGGC	0.617																																					p.K199X		Atlas-SNP	.											.	GPR37	89	.	0			c.A595T						.						45.0	52.0	50.0					7																	124404436		2203	4299	6502	SO:0001587	stop_gained	2861	exon1			CCGTCTTGGACAG		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.595A>T	chr7.hg19:g.124404436T>A	ENSP00000306449:p.Lys199*	116.0	0.0		105.0	44.0	NM_005302	A4D0Y6|O00348|O14768|Q8TD39	Nonsense_Mutation	SNP	ENST00000303921.2	hg19	CCDS5792.1	.	.	.	.	.	.	.	.	.	.	T	39	7.525840	0.98339	.	.	ENSG00000170775	ENST00000303921	.	.	.	4.81	2.37	0.29283	.	0.572470	0.19041	N	0.124286	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-24.8929	3.5298	0.07773	0.1957:0.1036:0.0:0.7007	.	.	.	.	X	199	.	ENSP00000306449:K199X	K	-	1	0	GPR37	124191672	0.706000	0.27856	0.387000	0.26183	0.187000	0.23431	2.110000	0.41873	2.033000	0.60031	0.529000	0.55759	AAG	.	.		0.617	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347873.1	NM_005302	
PODXL	5420	hgsc.bcm.edu	37	7	131241035	131241035	+	Silent	SNP	C	C	G	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr7:131241035C>G	ENST00000378555.3	-	1	331	c.84G>C	c.(82-84)ccG>ccC	p.P28P	PODXL_ENST00000322985.9_Silent_p.P28P|PODXL_ENST00000541194.1_Silent_p.P28P|PODXL_ENST00000537928.1_Silent_p.P28P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					GGGAGggcgacggcgacggcg	0.741																																					p.P28P		Atlas-SNP	.											.	PODXL	53	.	2	Deletion - In frame(2)	prostate(2)	c.G84C						.																																			SO:0001819	synonymous_variant	5420	exon1			GGGCGACGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84G>C	chr7.hg19:g.131241035C>G		67.0	0.0		106.0	8.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	hg19	CCDS34755.1																																																																																			.	.		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
CRYGN	155051	hgsc.bcm.edu	37	7	151127230	151127230	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr7:151127230G>C	ENST00000337323.2	-	4	579	c.453C>G	c.(451-453)ttC>ttG	p.F151L	CRYGN_ENST00000476631.1_5'UTR|CRYGN_ENST00000491928.1_3'UTR|RP4-555L14.4_ENST00000465549.1_RNA	NM_144727.1	NP_653328.1	Q8WXF5	CRGN_HUMAN	crystallin, gamma N	151										central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(1)|lung(4)	8			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCTCAGCTGGAAGTCCTCAG	0.562																																					p.F151L		Atlas-SNP	.											.	CRYGN	15	.	0			c.C453G						.						183.0	145.0	158.0					7																	151127230		2203	4300	6503	SO:0001583	missense	155051	exon4			CAGCTGGAAGTCC	AF445455	CCDS5926.1	7q36.1	2003-02-25			ENSG00000127377	ENSG00000127377			20458	protein-coding gene	gene with protein product		609603					Standard	NM_144727		Approved		uc003wke.3	Q8WXF5	OTTHUMG00000157353	ENST00000337323.2:c.453C>G	chr7.hg19:g.151127230G>C	ENSP00000338613:p.Phe151Leu	136.0	0.0		140.0	59.0	NM_144727	Q496G6	Missense_Mutation	SNP	ENST00000337323.2	hg19	CCDS5926.1	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307033	0.40795	.	.	ENSG00000127377	ENST00000337323	T	0.78595	-1.19	1.91	1.91	0.25777	.	0.563161	0.18877	N	0.128688	T	0.68668	0.3026	L	0.49126	1.545	0.09310	N	1	B	0.10296	0.003	B	0.15052	0.012	T	0.63817	-0.6551	10	0.87932	D	0	.	7.3297	0.26575	0.0:0.0:1.0:0.0	.	151	Q8WXF5	CRGN_HUMAN	L	151	ENSP00000338613:F151L	ENSP00000338613:F151L	F	-	3	2	CRYGN	150758163	0.007000	0.16637	0.011000	0.14972	0.015000	0.08874	0.673000	0.25203	1.394000	0.46624	0.561000	0.74099	TTC	.	.		0.562	CRYGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348553.1		
CSMD1	64478	hgsc.bcm.edu	37	8	3046418	3046418	+	Silent	SNP	C	C	A	rs541557117		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:3046418C>A	ENST00000520002.1	-	36	6072	c.5517G>T	c.(5515-5517)tcG>tcT	p.S1839S	CSMD1_ENST00000542608.1_Silent_p.S1838S|CSMD1_ENST00000602557.1_Silent_p.S1839S|CSMD1_ENST00000523387.1_5'UTR|CSMD1_ENST00000537824.1_Silent_p.S1838S|CSMD1_ENST00000602723.1_Silent_p.S1839S|CSMD1_ENST00000400186.3_Silent_p.S1839S|CSMD1_ENST00000539096.1_Silent_p.S1838S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1839	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCTGAATTCCCGAGCCCTCCG	0.468																																					p.S1838S		Atlas-SNP	.											.	CSMD1	1469	.	0			c.G5514T						.						55.0	52.0	53.0					8																	3046418		1879	4098	5977	SO:0001819	synonymous_variant	64478	exon35			AATTCCCGAGCCC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5517G>T	chr8.hg19:g.3046418C>A		141.0	0.0		136.0	85.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	C	0.245	-1.011072	0.02095	.	.	ENSG00000183117	ENST00000335551	.	.	.	5.53	-10.3	0.00346	.	.	.	.	.	T	0.46034	0.1372	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55736	-0.8094	4	.	.	.	.	8.2452	0.31684	0.0:0.3839:0.2804:0.3357	.	.	.	.	W	1319	.	.	G	-	1	0	CSMD1	3033825	0.020000	0.18652	0.046000	0.18839	0.050000	0.14768	-1.027000	0.03592	-1.907000	0.01087	-1.169000	0.01745	GGG	.	.		0.468	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
LZTS1	11178	hgsc.bcm.edu	37	8	20110855	20110855	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:20110855A>T	ENST00000381569.1	-	3	944	c.587T>A	c.(586-588)cTg>cAg	p.L196Q	LZTS1_ENST00000522290.1_Missense_Mutation_p.L196Q|LZTS1_ENST00000265801.6_Missense_Mutation_p.L196Q			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	196					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGGTGTGACCAGCGGGTCCAG	0.642																																					p.L196Q		Atlas-SNP	.											.	LZTS1	72	.	0			c.T587A						.						39.0	47.0	44.0					8																	20110855		2200	4297	6497	SO:0001583	missense	11178	exon2			GTGACCAGCGGGT	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.587T>A	chr8.hg19:g.20110855A>T	ENSP00000370981:p.Leu196Gln	83.0	0.0		58.0	9.0	NM_021020	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	ENST00000381569.1	hg19	CCDS6015.1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.363030	0.41902	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.26223	2.07;2.07;1.75	5.93	5.93	0.95920	.	0.212647	0.39407	N	0.001363	T	0.39200	0.1069	L	0.42245	1.32	0.41912	D	0.990472	D;B	0.89917	1.0;0.278	D;B	0.68943	0.961;0.072	T	0.10753	-1.0616	10	0.10902	T	0.67	-23.1903	15.2069	0.73186	1.0:0.0:0.0:0.0	.	196;196	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	Q	196	ENSP00000370981:L196Q;ENSP00000265801:L196Q;ENSP00000429263:L196Q	ENSP00000265801:L196Q	L	-	2	0	LZTS1	20155135	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	8.962000	0.93254	2.271000	0.75665	0.459000	0.35465	CTG	.	.		0.642	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020	
ELP3	55140	hgsc.bcm.edu	37	8	27957343	27957343	+	Splice_Site	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:27957343A>T	ENST00000256398.8	+	3	496		c.e3-1		ELP3_ENST00000521015.1_Splice_Site|ELP3_ENST00000524103.1_Splice_Site|ELP3_ENST00000523760.1_Splice_Site|ELP3_ENST00000537665.1_Splice_Site|ELP3_ENST00000380353.4_Intron|ELP3_ENST00000542181.1_Intron	NM_001284220.1|NM_001284226.1|NM_018091.5	NP_001271149.1|NP_001271155.1|NP_060561.3	Q9H9T3	ELP3_HUMAN	elongator acetyltransferase complex subunit 3						chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	histone acetyltransferase activity (GO:0004402)|iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|phosphorylase kinase regulator activity (GO:0008607)			kidney(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|KIRC - Kidney renal clear cell carcinoma(542;0.127)|Kidney(114;0.151)|Colorectal(74;0.183)		CTTTACTTTCAGGGTGAAAAC	0.448																																					.		Atlas-SNP	.											.	ELP3	36	.	0			c.120-2A>T						.						96.0	90.0	92.0					8																	27957343		2203	4300	6503	SO:0001630	splice_region_variant	55140	exon3			ACTTTCAGGGTGA		CCDS6065.1, CCDS64860.1, CCDS64861.1, CCDS75717.1, CCDS75718.1	8p21.1	2012-08-14	2012-08-08		ENSG00000134014	ENSG00000134014		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Elongator acetyltransferase complex subunits"""	20696	protein-coding gene	gene with protein product		612722	"""elongation protein 3 homolog (S. cerevisiae)"""			11714725	Standard	NM_018091		Approved	FLJ10422, KAT9	uc003xgo.4	Q9H9T3	OTTHUMG00000102124	ENST00000256398.8:c.120-1A>T	chr8.hg19:g.27957343A>T		71.0	0.0		71.0	44.0	NM_018091	B4DE19|B4DIG1|E2QRI5|Q53G84|Q6AWB0|Q9BVF7|Q9NVZ1	Splice_Site	SNP	ENST00000256398.8	hg19	CCDS6065.1	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994140	0.74703	.	.	ENSG00000134014	ENST00000520270;ENST00000521015;ENST00000521570;ENST00000256398;ENST00000524024;ENST00000520288;ENST00000521099	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5348	0.61641	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ELP3	28013262	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	8.432000	0.90288	2.147000	0.66899	0.482000	0.46254	.	.	.		0.448	ELP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219963.2	NM_018091	Intron
CPA6	57094	hgsc.bcm.edu	37	8	68430279	68430279	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:68430279C>T	ENST00000297770.4	-	3	411	c.196G>A	c.(196-198)Gac>Aac	p.D66N	CPA6_ENST00000518549.1_Missense_Mutation_p.D66N|CPA6_ENST00000297769.4_5'UTR	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	66						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TGCCACAGGTCCACCTGTAGT	0.453																																					p.D66N		Atlas-SNP	.											CPA6,right_upper_lobe,carcinoma,0,1	CPA6	69	.	0			c.G196A						.						92.0	83.0	86.0					8																	68430279		2203	4300	6503	SO:0001583	missense	57094	exon3			ACAGGTCCACCTG	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.196G>A	chr8.hg19:g.68430279C>T	ENSP00000297770:p.Asp66Asn	168.0	0.0		171.0	34.0	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	hg19	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.947866	0.92593	.	.	ENSG00000165078	ENST00000297770;ENST00000518549	T;T	0.21031	2.03;2.03	6.06	6.06	0.98353	Proteinase inhibitor, propeptide (1);Proteinase inhibitor, carboxypeptidase propeptide (2);	0.047994	0.85682	D	0.000000	T	0.48333	0.1494	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.971	T	0.17349	-1.0372	10	0.46703	T	0.11	.	20.2159	0.98296	0.0:1.0:0.0:0.0	.	66;66	Q8N4T0-2;Q8N4T0	.;CBPA6_HUMAN	N	66	ENSP00000297770:D66N;ENSP00000431112:D66N	ENSP00000297770:D66N	D	-	1	0	CPA6	68592833	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.994000	0.70623	2.882000	0.98803	0.655000	0.94253	GAC	.	.		0.453	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
PRDM14	63978	hgsc.bcm.edu	37	8	70970978	70970978	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:70970978C>A	ENST00000276594.2	-	6	1484	c.1283G>T	c.(1282-1284)gGc>gTc	p.G428V		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	428					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			TTTCCTATCGCCCTTGTCCAC	0.483																																					p.G428V	NSCLC(129;99 1813 5906 40656 46114)	Atlas-SNP	.											.	PRDM14	102	.	0			c.G1283T						.						115.0	104.0	108.0					8																	70970978		2203	4300	6503	SO:0001583	missense	63978	exon6			CTATCGCCCTTGT	AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.1283G>T	chr8.hg19:g.70970978C>A	ENSP00000276594:p.Gly428Val	110.0	0.0		123.0	61.0	NM_024504	Q86UX9	Missense_Mutation	SNP	ENST00000276594.2	hg19	CCDS6206.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.855070	0.91355	.	.	ENSG00000147596	ENST00000276594	T	0.14266	2.52	5.73	5.73	0.89815	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.49626	0.1568	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59139	-0.7510	10	0.87932	D	0	-23.4223	19.9036	0.96999	0.0:1.0:0.0:0.0	.	428	Q9GZV8	PRD14_HUMAN	V	428	ENSP00000276594:G428V	ENSP00000276594:G428V	G	-	2	0	PRDM14	71133532	1.000000	0.71417	0.966000	0.40874	0.871000	0.50021	7.343000	0.79319	2.706000	0.92434	0.655000	0.94253	GGC	.	.		0.483	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318505.1		
PTK2	5747	hgsc.bcm.edu	37	8	141678423	141678423	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:141678423T>G	ENST00000522684.1	-	30	3039	c.2810A>C	c.(2809-2811)gAg>gCg	p.E937A	PTK2_ENST00000519465.1_Missense_Mutation_p.E565A|PTK2_ENST00000538769.1_Missense_Mutation_p.E605A|PTK2_ENST00000517712.1_5'UTR|PTK2_ENST00000340930.3_Missense_Mutation_p.E950A|PTK2_ENST00000517887.1_Missense_Mutation_p.E981A|PTK2_ENST00000535192.1_Missense_Mutation_p.E891A|PTK2_ENST00000395218.2_Missense_Mutation_p.E950A|PTK2_ENST00000519419.1_Missense_Mutation_p.E981A|PTK2_ENST00000430260.2_Missense_Mutation_p.E247A|PTK2_ENST00000521059.1_Missense_Mutation_p.E937A	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	937	Interaction with ARHGEF28. {ECO:0000250}.|Interaction with TGFB1I1.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			ACTGGACATCTCGATGACAGC	0.498											OREG0019022	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E959A		Atlas-SNP	.											.	PTK2	311	.	0			c.A2876C						.						114.0	100.0	105.0					8																	141678423		2203	4300	6503	SO:0001583	missense	5747	exon30			GACATCTCGATGA	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.2810A>C	chr8.hg19:g.141678423T>G	ENSP00000429911:p.Glu937Ala	158.0	0.0	1665	142.0	40.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	hg19	CCDS6381.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.402679	0.83230	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000519465;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000395221;ENST00000523539;ENST00000340930;ENST00000538769;ENST00000519419;ENST00000430260;ENST00000521986	T;T;T;T;T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	5.62	5.62	0.85841	Focal adhesion kinase, targeting (FAT) domain (3);	0.000000	0.85682	D	0.000000	T	0.40448	0.1117	N	0.25890	0.77	0.58432	D	0.999996	D;D;B;D;B;D;P;P;B;B	0.76494	0.999;0.999;0.246;0.999;0.374;0.999;0.565;0.537;0.246;0.374	D;D;B;D;B;D;P;B;B;B	0.91635	0.998;0.999;0.268;0.997;0.097;0.996;0.456;0.219;0.194;0.097	T	0.13335	-1.0513	10	0.12430	T	0.62	.	15.8239	0.78683	0.0:0.0:0.0:1.0	.	950;635;860;937;959;891;892;764;605;565	B4E2N6;B4DH13;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6;Q05397-2;Q8N9D7;E9PEI4	.;.;.;FAK1_HUMAN;.;.;.;.;.;.	A	937;891;565;981;937;892;950;861;635;609;950;605;981;247;638	ENSP00000429911:E937A;ENSP00000438009:E891A;ENSP00000429170:E565A;ENSP00000429082:E981A;ENSP00000429474:E937A;ENSP00000378644:E950A;ENSP00000428492:E609A;ENSP00000341189:E950A;ENSP00000445742:E605A;ENSP00000429129:E981A;ENSP00000403416:E247A;ENSP00000430603:E638A	ENSP00000341189:E950A	E	-	2	0	PTK2	141747605	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	7.810000	0.86072	2.135000	0.66039	0.533000	0.62120	GAG	.	.		0.498	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
MAFA	389692	hgsc.bcm.edu	37	8	144512551	144512551	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:144512551G>T	ENST00000333480.2	-	1	25	c.26C>A	c.(25-27)gCc>gAc	p.A9D	MAFA_ENST00000528185.1_5'Flank	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	9					insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			GGGCAGCTCGGCGCCCATCGC	0.741										HNSCC(29;0.082)																											p.A9D		Atlas-SNP	.											.	MAFA	9	.	0			c.C26A						.						12.0	10.0	11.0					8																	144512551		2120	4193	6313	SO:0001583	missense	389692	exon1			AGCTCGGCGCCCA	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.26C>A	chr8.hg19:g.144512551G>T	ENSP00000328364:p.Ala9Asp	43.0	0.0		41.0	11.0	NM_201589		Missense_Mutation	SNP	ENST00000333480.2	hg19	CCDS34955.1	.	.	.	.	.	.	.	.	.	.	g	13.82	2.351261	0.41700	.	.	ENSG00000182759	ENST00000333480	D	0.98362	-4.89	3.06	0.888	0.19206	.	0.085474	0.43110	U	0.000602	D	0.92087	0.7492	N	0.08118	0	0.31181	N	0.702042	B	0.34015	0.435	B	0.33196	0.159	D	0.90874	0.4748	10	0.49607	T	0.09	.	6.3367	0.21300	0.2052:0.1816:0.6132:0.0	.	9	Q8NHW3	MAFA_HUMAN	D	9	ENSP00000328364:A9D	ENSP00000328364:A9D	A	-	2	0	MAFA	144583694	0.957000	0.32711	0.703000	0.30354	0.823000	0.46562	2.781000	0.47750	1.255000	0.44051	0.409000	0.27619	GCC	.	.		0.741	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381511.2	NM_201589	
NRBP2	340371	hgsc.bcm.edu	37	8	144917879	144917879	+	Missense_Mutation	SNP	C	C	T	rs372417243		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr8:144917879C>T	ENST00000442628.2	-	18	1598	c.1459G>A	c.(1459-1461)Gcc>Acc	p.A487T	NRBP2_ENST00000327830.5_Missense_Mutation_p.A244T|RP11-299M14.2_ENST00000534006.1_RNA	NM_178564.3	NP_848659.2			nuclear receptor binding protein 2											central_nervous_system(2)|kidney(1)|large_intestine(2)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			TCCAGGAAGGCGGCCAGCTTC	0.746																																					p.A487T		Atlas-SNP	.											.	NRBP2	20	.	0			c.G1459A						.	C	THR/ALA	0,4402		0,0,2201	35.0	35.0	35.0		1459	-1.2	0.2	8		35	1,8597	1.2+/-3.3	0,1,4298	no	missense	NRBP2	NM_178564.3	58	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	benign	487/502	144917879	1,12999	2201	4299	6500	SO:0001583	missense	340371	exon18			GGAAGGCGGCCAG	BC037396	CCDS34959.1, CCDS34959.2	8q24.3	2005-01-24							19339	protein-coding gene	gene with protein product		615563				14702039	Standard	NM_178564		Approved	DKFZp434P086	uc011lkt.2	Q9NSY0		ENST00000442628.2:c.1459G>A	chr8.hg19:g.144917879C>T	ENSP00000414055:p.Ala487Thr	138.0	0.0		103.0	28.0	NM_178564		Missense_Mutation	SNP	ENST00000442628.2	hg19	CCDS34959.2	.	.	.	.	.	.	.	.	.	.	C	11.36	1.615690	0.28801	0.0	1.16E-4	ENSG00000185189	ENST00000442628;ENST00000327830	T;T	0.30448	4.6;1.53	3.8	-1.24	0.09435	.	1.880630	0.03156	N	0.168547	T	0.15305	0.0369	N	0.11427	0.14	0.09310	N	1	B;B;B	0.24618	0.107;0.014;0.015	B;B;B	0.15484	0.013;0.011;0.005	T	0.19160	-1.0314	10	0.08381	T	0.77	-10.2363	8.9368	0.35704	0.0:0.6002:0.0:0.3998	.	487;155;279	Q9NSY0;B3KSN6;Q9NSY0-2	NRBP2_HUMAN;.;.	T	487;244	ENSP00000414055:A487T;ENSP00000330271:A244T	ENSP00000330271:A244T	A	-	1	0	NRBP2	144989867	0.000000	0.05858	0.218000	0.23776	0.780000	0.44128	-1.022000	0.03611	-0.603000	0.05767	-0.982000	0.02568	GCC	.	.		0.746	NRBP2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382247.1	NM_178564	
UNC13B	10497	hgsc.bcm.edu	37	9	35399446	35399446	+	Splice_Site	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:35399446G>A	ENST00000378495.3	+	34	4230		c.e34+1		UNC13B_ENST00000396787.1_Splice_Site|UNC13B_ENST00000378496.4_Splice_Site	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)						apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			CAAACTCAAGGTACTCTGGGT	0.562																																					.		Atlas-SNP	.											.	UNC13B	153	.	0			c.4008+1G>A						.						94.0	81.0	85.0					9																	35399446		2203	4300	6503	SO:0001630	splice_region_variant	10497	exon34			CTCAAGGTACTCT	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4008+1G>A	chr9.hg19:g.35399446G>A		65.0	0.0		50.0	33.0	NM_006377	Q5VYM8	Splice_Site	SNP	ENST00000378495.3	hg19	CCDS6579.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.342116	0.81911	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1113	0.93317	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC13B	35389446	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.169000	0.94788	2.761000	0.94854	0.655000	0.94253	.	.	.		0.562	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	Intron
TLE1	7088	hgsc.bcm.edu	37	9	84268953	84268953	+	Splice_Site	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:84268953T>A	ENST00000376499.3	-	5	1299		c.e5-2		TLE1_ENST00000376463.1_Splice_Site|TLE1_ENST00000376472.1_Splice_Site	NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)						multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GATTTCAGTCTATAAAGACAA	0.378																																					.	NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	Atlas-SNP	.											.	TLE1	81	.	0			c.235-2A>T						.						112.0	104.0	107.0					9																	84268953		2203	4300	6503	SO:0001630	splice_region_variant	7088	exon6			TCAGTCTATAAAG		CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.235-2A>T	chr9.hg19:g.84268953T>A		87.0	0.0		69.0	38.0	NM_005077	A8K495|Q5T3G4|Q969V9	Splice_Site	SNP	ENST00000376499.3	hg19	CCDS6661.1	.	.	.	.	.	.	.	.	.	.	T	16.46	3.129151	0.56721	.	.	ENSG00000196781	ENST00000376499;ENST00000355002;ENST00000418319;ENST00000376463	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TLE1	83458773	1.000000	0.71417	0.997000	0.53966	0.439000	0.31926	8.040000	0.89188	2.281000	0.76405	0.533000	0.62120	.	.	.		0.378	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055407.1	NM_005077	Intron
CTSL	1514	hgsc.bcm.edu	37	9	90342523	90342523	+	Missense_Mutation	SNP	A	A	G	rs112682750	byFrequency	TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:90342523A>G	ENST00000343150.5	+	2	895	c.5A>G	c.(4-6)aAt>aGt	p.N2S	CTSL_ENST00000342020.5_Missense_Mutation_p.N2S|CTSL_ENST00000340342.6_Missense_Mutation_p.N2S|CTSL_ENST00000495822.1_3'UTR			P07711	CATL1_HUMAN	cathepsin L	2					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										TAAAACATGAATCCTACACTC	0.448																																					p.N2S		Atlas-SNP	.											.	CTSL1	43	.	0			c.A5G						.						120.0	111.0	114.0					9																	90342523		2203	4300	6503	SO:0001583	missense	1514	exon2			ACATGAATCCTAC	X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.5A>G	chr9.hg19:g.90342523A>G	ENSP00000345344:p.Asn2Ser	91.0	0.0		115.0	39.0	NM_145918	Q6IAV1|Q96QJ0	Missense_Mutation	SNP	ENST00000343150.5	hg19	CCDS6675.1	.	.	.	.	.	.	.	.	.	.	A	3.478	-0.106430	0.06924	.	.	ENSG00000135047	ENST00000343150;ENST00000340342;ENST00000342020;ENST00000539280	T;T;T	0.70164	-0.46;-0.46;0.01	3.76	1.2	0.21068	.	0.475967	0.25517	N	0.030136	T	0.49098	0.1537	L	0.29908	0.895	0.09310	N	1	B	0.20887	0.049	B	0.12156	0.007	T	0.34279	-0.9835	10	0.39692	T	0.17	.	8.3874	0.32508	0.589:0.4109:0.0:0.0	.	2	P07711	CATL1_HUMAN	S	2	ENSP00000345344:N2S;ENSP00000365061:N2S;ENSP00000340470:N2S	ENSP00000365061:N2S	N	+	2	0	CTSL1	89532343	0.636000	0.27207	0.413000	0.26509	0.323000	0.28346	0.684000	0.25364	0.040000	0.15660	0.397000	0.26171	AAT	.	A|0.996;C|0.004		0.448	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052936.1	NM_001912	
CCDC180	100499483	hgsc.bcm.edu	37	9	100105753	100105753	+	Silent	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:100105753C>T	ENST00000357054.1	+	33	3890	c.2955C>T	c.(2953-2955)acC>acT	p.T985T	CCDC180_ENST00000411667.2_Silent_p.T843T|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Silent_p.T846T|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000375202.2_Silent_p.T846T|CCDC180_ENST00000395220.1_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	985						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CCCATTCCACCTTCTCAGCCA	0.403																																					p.T846T		Atlas-SNP	.											.	.	.	.	0			c.C2538T						.						115.0	107.0	110.0					9																	100105753		2203	4300	6503	SO:0001819	synonymous_variant	0	exon19			TTCCACCTTCTCA	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2955C>T	chr9.hg19:g.100105753C>T		132.0	0.0		102.0	24.0	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	ENST00000357054.1	hg19																																																																																				.	.		0.403	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
ANKS6	203286	hgsc.bcm.edu	37	9	101539738	101539738	+	Splice_Site	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:101539738T>A	ENST00000353234.4	-	8	1615		c.e8-2		ANKS6_ENST00000375018.1_Splice_Site|ANKS6_ENST00000375019.2_Splice_Site|ANKS6_ENST00000540940.1_Splice_Site			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6							cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TCCCAGGACCTGAGAGACAAA	0.483																																					.		Atlas-SNP	.											.	ANKS6	59	.	0			c.1568-2A>T						.						117.0	110.0	112.0					9																	101539738		1901	4114	6015	SO:0001630	splice_region_variant	203286	exon9			AGGACCTGAGAGA	AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1568-2A>T	chr9.hg19:g.101539738T>A		132.0	0.0		116.0	45.0	NM_173551	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Splice_Site	SNP	ENST00000353234.4	hg19	CCDS43856.1	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846742	0.71603	.	.	ENSG00000165138	ENST00000375019;ENST00000375018;ENST00000353234;ENST00000540940	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2705	0.54704	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKS6	100579559	1.000000	0.71417	0.985000	0.45067	0.986000	0.74619	5.633000	0.67825	2.139000	0.66308	0.533000	0.62120	.	.	.		0.483	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277053.1	NM_173551	Intron
ZNF462	58499	hgsc.bcm.edu	37	9	109687122	109687122	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:109687122G>A	ENST00000277225.5	+	3	1218	c.929G>A	c.(928-930)cGg>cAg	p.R310Q	ZNF462_ENST00000457913.1_Missense_Mutation_p.R310Q|ZNF462_ENST00000441147.2_5'Flank			Q96JM2	ZN462_HUMAN	zinc finger protein 462	310					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GCTGCAAGCCGGGAGATACCC	0.512																																					p.R310Q		Atlas-SNP	.											.	ZNF462	322	.	0			c.G929A						.						67.0	63.0	64.0					9																	109687122		2203	4300	6503	SO:0001583	missense	58499	exon3			CAAGCCGGGAGAT	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.929G>A	chr9.hg19:g.109687122G>A	ENSP00000277225:p.Arg310Gln	177.0	0.0		160.0	36.0	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	hg19	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910093	0.52439	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.05996	3.36;3.81	5.91	4.84	0.62591	.	0.189972	0.52532	D	0.000075	T	0.04543	0.0124	N	0.24115	0.695	0.80722	D	1	P;B	0.35155	0.487;0.355	B;B	0.27608	0.081;0.037	T	0.53711	-0.8400	9	.	.	.	.	14.2337	0.65911	0.0803:0.0:0.9197:0.0	.	310;310	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	Q	310	ENSP00000277225:R310Q;ENSP00000414570:R310Q	.	R	+	2	0	ZNF462	108726943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.882000	0.48546	2.808000	0.96608	0.655000	0.94253	CGG	.	.		0.512	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
COL5A1	1289	hgsc.bcm.edu	37	9	137658880	137658880	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:137658880A>T	ENST00000371817.3	+	23	2582	c.2168A>T	c.(2167-2169)cAg>cTg	p.Q723L		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	723	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCAGGACAGCAGGGTAATCCA	0.652																																					p.Q723L		Atlas-SNP	.											.	COL5A1	323	.	0			c.A2168T						.						35.0	38.0	37.0					9																	137658880		2203	4300	6503	SO:0001583	missense	1289	exon23			GACAGCAGGGTAA	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.2168A>T	chr9.hg19:g.137658880A>T	ENSP00000360882:p.Gln723Leu	159.0	0.0		118.0	35.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	A	17.07	3.294232	0.60086	.	.	ENSG00000130635	ENST00000371817	D	0.95788	-3.81	5.18	5.18	0.71444	.	0.000000	0.64402	U	0.000001	D	0.95701	0.8602	L	0.54908	1.71	0.50467	D	0.99987	P	0.45126	0.851	P	0.55391	0.775	D	0.94991	0.8134	10	0.44086	T	0.13	.	11.3986	0.49858	1.0:0.0:0.0:0.0	.	723	P20908	CO5A1_HUMAN	L	723	ENSP00000360882:Q723L	ENSP00000360882:Q723L	Q	+	2	0	COL5A1	136798701	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.806000	0.62569	1.939000	0.56221	0.533000	0.62120	CAG	.	.		0.652	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
NELFB	25920	hgsc.bcm.edu	37	9	140151494	140151494	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr9:140151494G>T	ENST00000343053.4	+	4	922	c.585G>T	c.(583-585)agG>agT	p.R195S		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	195					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CCAAGACCAGGCGCCAGGGCG	0.622																																					p.R195S		Atlas-SNP	.											.	.	.	.	0			c.G585T						.						55.0	53.0	54.0					9																	140151494		2203	4300	6503	SO:0001583	missense	25920	exon4			GACCAGGCGCCAG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.585G>T	chr9.hg19:g.140151494G>T	ENSP00000339495:p.Arg195Ser	49.0	0.0		37.0	21.0	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Missense_Mutation	SNP	ENST00000343053.4	hg19	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	G	19.09	3.759794	0.69763	.	.	ENSG00000188986	ENST00000343053	.	.	.	5.2	0.0162	0.14107	.	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	M	0.81942	2.565	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.66905	-0.5805	9	0.87932	D	0	-53.3232	5.3017	0.15781	0.44:0.0:0.4288:0.1312	.	195	Q8WX92	NELFB_HUMAN	S	195	.	ENSP00000339495:R195S	R	+	3	2	COBRA1	139271315	0.734000	0.28142	0.920000	0.36463	0.977000	0.68977	-0.073000	0.11468	-0.031000	0.13781	-0.258000	0.10820	AGG	.	.		0.622	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
SFMBT2	57713	hgsc.bcm.edu	37	10	7409744	7409744	+	Silent	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr10:7409744C>A	ENST00000361972.4	-	4	393	c.303G>T	c.(301-303)ggG>ggT	p.G101G	SFMBT2_ENST00000397160.3_Silent_p.G101G|SFMBT2_ENST00000397167.1_Silent_p.G101G|SFMBT2_ENST00000379711.2_Silent_p.G101G|SFMBT2_ENST00000379713.3_Silent_p.G101G	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	101					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GCAGCAGCTGCCCGCACGTGG	0.577																																					p.G101G		Atlas-SNP	.											.	SFMBT2	209	.	0			c.G303T						.						88.0	84.0	85.0					10																	7409744		2203	4300	6503	SO:0001819	synonymous_variant	57713	exon4			CAGCTGCCCGCAC	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.303G>T	chr10.hg19:g.7409744C>A		153.0	0.0		141.0	29.0	NM_001029880	A7MD09|Q9HCF5	Silent	SNP	ENST00000361972.4	hg19	CCDS31138.1																																																																																			.	.		0.577	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
SLC39A12	221074	hgsc.bcm.edu	37	10	18254573	18254573	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr10:18254573A>T	ENST00000377369.2	+	4	978	c.705A>T	c.(703-705)gaA>gaT	p.E235D	SLC39A12_ENST00000377374.4_Missense_Mutation_p.E235D|SLC39A12_ENST00000539911.1_Missense_Mutation_p.E101D|SLC39A12_ENST00000377371.3_Missense_Mutation_p.E235D	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	235					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						ACTTTACAGAATATATTTTCA	0.423																																					p.E235D		Atlas-SNP	.											.	SLC39A12	181	.	0			c.A705T						.						63.0	61.0	62.0					10																	18254573		2203	4300	6503	SO:0001583	missense	221074	exon4			TACAGAATATATT		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.705A>T	chr10.hg19:g.18254573A>T	ENSP00000366586:p.Glu235Asp	113.0	0.0		127.0	64.0	NM_152725	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	hg19	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	A	0.088	-1.171317	0.01660	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.60171	0.36;0.32;0.36;0.21	5.81	-11.0	0.00169	.	0.402119	0.30347	N	0.009838	T	0.28665	0.0710	L	0.43152	1.355	0.21553	N	0.999647	B;B;B	0.13594	0.008;0.003;0.008	B;B;B	0.15052	0.012;0.005;0.012	T	0.51505	-0.8697	10	0.02654	T	1	-2.6034	4.8868	0.13706	0.3389:0.4168:0.1627:0.0817	.	235;235;235	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	D	235;235;235;101;155	ENSP00000366586:E235D;ENSP00000366591:E235D;ENSP00000366588:E235D;ENSP00000440445:E101D	ENSP00000366586:E235D	E	+	3	2	SLC39A12	18294579	0.061000	0.20836	0.014000	0.15608	0.169000	0.22640	-0.890000	0.04140	-1.849000	0.01171	-1.647000	0.00761	GAA	.	.		0.423	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725	
ANKRD30A	91074	hgsc.bcm.edu	37	10	37507926	37507926	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr10:37507926A>T	ENST00000602533.1	+	34	3217	c.3118A>T	c.(3118-3120)Aat>Tat	p.N1040Y	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.N1040Y|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.N1159Y			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1096					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CACTCATGAAAATGAAAATTA	0.318																																					p.N1040Y		Atlas-SNP	.											.	ANKRD30A	448	.	0			c.A3118T						.						29.0	27.0	28.0					10																	37507926		1790	4037	5827	SO:0001583	missense	91074	exon34			CATGAAAATGAAA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3118A>T	chr10.hg19:g.37507926A>T	ENSP00000473551:p.Asn1040Tyr	315.0	0.0		406.0	197.0	NM_052997	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	hg19		.	.	.	.	.	.	.	.	.	.	a	6.191	0.403492	0.11754	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.17691	2.26;2.26	2.07	0.878	0.19150	.	.	.	.	.	T	0.09862	0.0242	N	0.24115	0.695	0.18873	N	0.999988	P	0.44734	0.842	B	0.38378	0.272	T	0.19976	-1.0289	9	0.72032	D	0.01	.	5.1158	0.14833	0.8311:0.0:0.1689:0.0	.	1096	Q9BXX3	AN30A_HUMAN	Y	1040;1159	ENSP00000354432:N1040Y;ENSP00000363792:N1159Y	ENSP00000354432:N1040Y	N	+	1	0	ANKRD30A	37547932	0.998000	0.40836	0.007000	0.13788	0.010000	0.07245	2.586000	0.46119	0.094000	0.17404	0.381000	0.24937	AAT	.	.		0.318	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
RTKN2	219790	hgsc.bcm.edu	37	10	63957897	63957897	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr10:63957897T>A	ENST00000373789.3	-	12	1696	c.1600A>T	c.(1600-1602)Agt>Tgt	p.S534C	RTKN2_ENST00000315289.2_Intron|RTKN2_ENST00000395265.1_Intron	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2	534					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					TGAGATACACTTGTTTTTCCC	0.423																																					p.S534C		Atlas-SNP	.											.	RTKN2	68	.	0			c.A1600T						.						266.0	249.0	255.0					10																	63957897		2203	4300	6503	SO:0001583	missense	219790	exon12			ATACACTTGTTTT	BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.1600A>T	chr10.hg19:g.63957897T>A	ENSP00000362894:p.Ser534Cys	170.0	0.0		204.0	80.0	NM_145307	Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Missense_Mutation	SNP	ENST00000373789.3	hg19	CCDS7263.1	.	.	.	.	.	.	.	.	.	.	T	9.099	1.003623	0.19121	.	.	ENSG00000182010	ENST00000373789	T	0.33654	1.4	5.61	-2.11	0.07187	.	0.716416	0.15065	N	0.282553	T	0.27313	0.0670	L	0.46157	1.445	0.09310	N	1	P	0.40660	0.726	B	0.40101	0.319	T	0.14671	-1.0464	10	0.54805	T	0.06	-0.3926	6.7969	0.23731	0.13:0.4623:0.0:0.4077	.	534	Q8IZC4	RTKN2_HUMAN	C	534	ENSP00000362894:S534C	ENSP00000362894:S534C	S	-	1	0	RTKN2	63627903	0.000000	0.05858	0.009000	0.14445	0.629000	0.37895	-0.113000	0.10774	-0.385000	0.07833	0.533000	0.62120	AGT	.	.		0.423	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091618.1	NM_145307	
CPEB3	22849	hgsc.bcm.edu	37	10	93841114	93841114	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr10:93841114C>T	ENST00000265997.4	-	9	2004	c.1832G>A	c.(1831-1833)cGt>cAt	p.R611H	CPEB3_ENST00000412050.4_Missense_Mutation_p.R597H	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	611	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				CTGCACAAAACGAGCGCTGAT	0.488																																					p.R611H		Atlas-SNP	.											.	CPEB3	43	.	0			c.G1832A						.						155.0	140.0	145.0					10																	93841114		2203	4300	6503	SO:0001583	missense	22849	exon9			ACAAAACGAGCGC	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.1832G>A	chr10.hg19:g.93841114C>T	ENSP00000265997:p.Arg611His	98.0	0.0		118.0	6.0	NM_014912	Q5T389|Q9NQJ7|Q9Y2E9	Missense_Mutation	SNP	ENST00000265997.4	hg19	CCDS31246.1	.	.	.	.	.	.	.	.	.	.	C	36	5.630965	0.96682	.	.	ENSG00000107864	ENST00000394210;ENST00000412050;ENST00000265997	T;T	0.21734	1.99;1.99	5.81	5.81	0.92471	RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.44498	0.1296	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.80764	0.982;0.987;0.994	T	0.18967	-1.0320	10	0.72032	D	0.01	-9.8615	20.0782	0.97758	0.0:1.0:0.0:0.0	.	611;597;597	Q8NE35;Q5QP71;Q8NE35-2	CPEB3_HUMAN;.;.	H	597;597;611	ENSP00000398310:R597H;ENSP00000265997:R611H	ENSP00000265997:R611H	R	-	2	0	CPEB3	93831094	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.746000	0.94184	0.655000	0.94253	CGT	.	.		0.488	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
LZTS2	84445	hgsc.bcm.edu	37	10	102770293	102770293	+	IGR	SNP	T	T	G	rs200896335|rs71013480	byFrequency	TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr10:102770293T>G	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		TGACCCCGgctgctgcggctg	0.697																																					p.S785R	Esophageal Squamous(8;38 437 13604 19902 37640)	Atlas-SNP	.											.	PDZD7	101	.	0			c.A2353C						.																																			SO:0001628	intergenic_variant	79955	exon15			CCCGGCTGCTGCG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		chr10.hg19:g.102770293T>G		428.0	0.0		514.0	21.0	NM_001195263		Missense_Mutation	SNP	ENST00000370220.1	hg19	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	T	2.648	-0.282573	0.05642	.	.	ENSG00000186862	ENST00000393462	.	.	.	3.99	2.83	0.33086	.	.	.	.	.	T	0.29716	0.0742	N	0.24115	0.695	0.28374	N	0.919888	.	.	.	.	.	.	T	0.21793	-1.0235	6	0.20046	T	0.44	.	9.5348	0.39216	0.0:0.0:0.1777:0.8222	.	.	.	.	R	785	.	ENSP00000377106:S785R	S	-	1	0	PDZD7	102760283	0.123000	0.22298	0.736000	0.30914	0.083000	0.17756	0.220000	0.17660	0.649000	0.30751	-0.680000	0.03767	AGC	.	.		0.697	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
CTSD	1509	hgsc.bcm.edu	37	11	1785050	1785050	+	Silent	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr11:1785050G>A	ENST00000236671.2	-	1	172	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	AC068580.1_ENST00000580120.1_RNA|AC068580.5_ENST00000446489.1_RNA|AC068580.6_ENST00000449248.1_RNA	NM_001909.4	NP_001900.1	P07339	CATD_HUMAN	cathepsin D	14					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|autophagic vacuole assembly (GO:0000045)|cell death (GO:0008219)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|large_intestine(4)|lung(8)	13		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGTGCAGCCAGCAGGCAGAGG	0.756																																					p.L14L		Atlas-SNP	.											.	CTSD	26	.	0			c.C40T						.						4.0	6.0	6.0					11																	1785050		1534	2828	4362	SO:0001819	synonymous_variant	1509	exon1			CAGCCAGCAGGCA	M11233	CCDS7725.1	11p15.5	2009-06-26	2006-12-05		ENSG00000117984	ENSG00000117984	3.4.23.5	"""Cathepsins"""	2529	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 10"""	116840	"""cathepsin D (lysosomal aspartyl protease)"""	CPSD		3927292	Standard	NM_001909		Approved	CLN10	uc001luc.2	P07339	OTTHUMG00000044760	ENST00000236671.2:c.40C>T	chr11.hg19:g.1785050G>A		82.0	0.0		60.0	42.0	NM_001909	Q6IB57	Silent	SNP	ENST00000236671.2	hg19	CCDS7725.1																																																																																			.	.		0.756	CTSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104272.5	NM_001909	
OSBPL5	114879	hgsc.bcm.edu	37	11	3113775	3113775	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr11:3113775C>A	ENST00000263650.7	-	19	2305	c.2146G>T	c.(2146-2148)Gac>Tac	p.D716Y	OSBPL5_ENST00000348039.5_Missense_Mutation_p.D648Y|OSBPL5_ENST00000542243.1_Missense_Mutation_p.D347Y|OSBPL5_ENST00000478260.1_Missense_Mutation_p.D170Y|OSBPL5_ENST00000389989.3_Missense_Mutation_p.D648Y|OSBPL5_ENST00000525498.1_Missense_Mutation_p.D627Y	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	716					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TTCAGGGGGTCCCAGGGGCTG	0.677																																					p.D716Y		Atlas-SNP	.											.	OSBPL5	78	.	0			c.G2146T						.						23.0	20.0	21.0					11																	3113775		2194	4289	6483	SO:0001583	missense	114879	exon19			GGGGGTCCCAGGG	AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.2146G>T	chr11.hg19:g.3113775C>A	ENSP00000263650:p.Asp716Tyr	106.0	0.0		79.0	27.0	NM_020896	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Missense_Mutation	SNP	ENST00000263650.7	hg19	CCDS31344.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.922762	0.73213	.	.	ENSG00000021762	ENST00000478260;ENST00000263650;ENST00000389989;ENST00000534454;ENST00000525498;ENST00000542243;ENST00000348039;ENST00000357352	T;T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42;1.42	4.47	2.59	0.31030	.	0.064974	0.64402	D	0.000013	T	0.61413	0.2345	M	0.93283	3.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.65315	-0.6198	10	0.87932	D	0	-13.9727	9.4578	0.38764	0.0:0.8223:0.0:0.1777	.	627;648;716	B4DVB0;Q8N596;Q9H0X9	.;.;OSBL5_HUMAN	Y	170;716;648;269;627;347;648;335	ENSP00000437141:D170Y;ENSP00000263650:D716Y;ENSP00000374639:D648Y;ENSP00000431412:D269Y;ENSP00000433342:D627Y;ENSP00000441551:D347Y;ENSP00000302872:D648Y	ENSP00000263650:D716Y	D	-	1	0	OSBPL5	3070351	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.900000	0.56295	0.361000	0.24292	0.561000	0.74099	GAC	.	.		0.677	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032332.2		
SLC17A6	57084	hgsc.bcm.edu	37	11	22396318	22396318	+	Silent	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr11:22396318T>A	ENST00000263160.3	+	9	1496	c.1059T>A	c.(1057-1059)gcT>gcA	p.A353A		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	353					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TGCTATCTGCTGTGCCACACT	0.373																																					p.A353A		Atlas-SNP	.											.	SLC17A6	135	.	0			c.T1059A						.						233.0	226.0	229.0					11																	22396318		2203	4300	6503	SO:0001819	synonymous_variant	57084	exon9			ATCTGCTGTGCCA	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1059T>A	chr11.hg19:g.22396318T>A		94.0	0.0		79.0	44.0	NM_020346	A6NKS2	Silent	SNP	ENST00000263160.3	hg19	CCDS7856.1																																																																																			.	.		0.373	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
MMP8	4317	hgsc.bcm.edu	37	11	102595576	102595576	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr11:102595576A>T	ENST00000236826.3	-	1	109	c.11T>A	c.(10-12)cTg>cAg	p.L4Q		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	4					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	AAGCGTCTTCAGGGAGAACAT	0.468																																					p.L4Q		Atlas-SNP	.											.	MMP8	68	.	0			c.T11A						.						150.0	157.0	155.0					11																	102595576		2203	4299	6502	SO:0001583	missense	4317	exon1			GTCTTCAGGGAGA	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.11T>A	chr11.hg19:g.102595576A>T	ENSP00000236826:p.Leu4Gln	314.0	1.0		278.0	95.0	NM_002424	Q45F99	Missense_Mutation	SNP	ENST00000236826.3	hg19	CCDS8320.1	.	.	.	.	.	.	.	.	.	.	A	11.61	1.689556	0.29962	.	.	ENSG00000118113	ENST00000236826	T	0.15256	2.44	5.26	2.79	0.32731	.	5.107090	0.00357	N	0.000034	T	0.22781	0.0550	L	0.43152	1.355	0.09310	N	0.999996	D	0.54207	0.965	P	0.47402	0.546	T	0.12116	-1.0560	10	0.87932	D	0	.	5.6196	0.17450	0.7634:0.0:0.0859:0.1507	.	4	P22894	MMP8_HUMAN	Q	4	ENSP00000236826:L4Q	ENSP00000236826:L4Q	L	-	2	0	MMP8	102100786	0.749000	0.28305	0.019000	0.16419	0.003000	0.03518	2.291000	0.43540	0.944000	0.37579	0.533000	0.62120	CTG	.	.		0.468	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424	
ARHGAP20	57569	hgsc.bcm.edu	37	11	110450147	110450147	+	Missense_Mutation	SNP	C	C	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr11:110450147C>G	ENST00000260283.4	-	16	3807	c.3523G>C	c.(3523-3525)Ggg>Cgg	p.G1175R	ARHGAP20_ENST00000533353.1_Missense_Mutation_p.G1149R|ARHGAP20_ENST00000524756.1_Missense_Mutation_p.G1152R|ARHGAP20_ENST00000357139.3_Missense_Mutation_p.G1149R|ARHGAP20_ENST00000529591.1_Missense_Mutation_p.G718R|ARHGAP20_ENST00000527598.1_Missense_Mutation_p.G1139R|ARHGAP20_ENST00000528829.1_Missense_Mutation_p.G1139R	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	1175					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		ACTGTAGGCCCTGAGTCTGGG	0.483																																					p.G1175R		Atlas-SNP	.											.	ARHGAP20	150	.	0			c.G3523C						.						125.0	130.0	128.0					11																	110450147		2201	4298	6499	SO:0001583	missense	57569	exon16			TAGGCCCTGAGTC	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.3523G>C	chr11.hg19:g.110450147C>G	ENSP00000260283:p.Gly1175Arg	94.0	0.0		97.0	49.0	NM_020809	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Missense_Mutation	SNP	ENST00000260283.4	hg19	CCDS31673.1	.	.	.	.	.	.	.	.	.	.	C	6.888	0.533390	0.13188	.	.	ENSG00000137727	ENST00000260283;ENST00000357139;ENST00000529591;ENST00000524756;ENST00000528829;ENST00000533353;ENST00000527598	T;T;T;T;T;T;T	0.09350	2.99;2.99;3.03;2.99;2.99;2.99;2.99	5.62	3.73	0.42828	.	0.544729	0.16797	N	0.199152	T	0.11750	0.0286	L	0.54323	1.7	0.09310	N	1	B;B;B	0.15473	0.013;0.008;0.013	B;B;B	0.17433	0.018;0.007;0.015	T	0.14062	-1.0486	10	0.38643	T	0.18	.	9.4276	0.38590	0.0:0.8322:0.0:0.1677	.	1149;1175;1152	Q9P2F6-2;Q9P2F6;Q9P2F6-3	.;RHG20_HUMAN;.	R	1175;1149;718;1152;1139;1149;1139	ENSP00000260283:G1175R;ENSP00000349660:G1149R;ENSP00000437905:G718R;ENSP00000432076:G1152R;ENSP00000436319:G1139R;ENSP00000436522:G1149R;ENSP00000431399:G1139R	ENSP00000260283:G1175R	G	-	1	0	ARHGAP20	109955357	0.018000	0.18449	0.003000	0.11579	0.067000	0.16453	2.358000	0.44134	1.341000	0.45600	0.655000	0.94253	GGG	.	.		0.483	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390628.1	NM_020809	
STT3A	3703	hgsc.bcm.edu	37	11	125472792	125472792	+	Silent	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr11:125472792C>T	ENST00000529196.1	+	6	572	c.366C>T	c.(364-366)ctC>ctT	p.L122L	STT3A_ENST00000531491.1_Silent_p.L30L|STT3A_ENST00000392708.4_Silent_p.L122L			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	122					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TGGCCCCTCTCTTCTCCTCCT	0.478																																					p.L122L		Atlas-SNP	.											.	STT3A	52	.	0			c.C366T						.						219.0	178.0	192.0					11																	125472792		2201	4299	6500	SO:0001819	synonymous_variant	3703	exon5			CCCTCTCTTCTCC	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.366C>T	chr11.hg19:g.125472792C>T		135.0	0.0		143.0	31.0	NM_152713	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Silent	SNP	ENST00000529196.1	hg19	CCDS8458.1																																																																																			.	.		0.478	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713	
KCNA6	3742	hgsc.bcm.edu	37	12	4920532	4920532	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:4920532G>T	ENST00000280684.3	+	1	2191	c.1325G>T	c.(1324-1326)tGt>tTt	p.C442F	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.C442F			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	442					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	GGCTCGCTGTGTGCCATCGCT	0.597										HNSCC(72;0.22)																											p.C442F		Atlas-SNP	.											.	KCNA6	122	.	0			c.G1325T						.						150.0	129.0	136.0					12																	4920532		2203	4300	6503	SO:0001583	missense	3742	exon1			CGCTGTGTGCCAT	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.1325G>T	chr12.hg19:g.4920532G>T	ENSP00000280684:p.Cys442Phe	121.0	0.0		154.0	40.0	NM_002235		Missense_Mutation	SNP	ENST00000280684.3	hg19	CCDS8534.1	.	.	.	.	.	.	.	.	.	.	G	19.91	3.915152	0.73098	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.98264	-4.83;-4.83	5.18	5.18	0.71444	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99089	0.9687	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99581	1.0973	10	0.87932	D	0	.	17.8587	0.88775	0.0:0.0:1.0:0.0	.	442	P17658	KCNA6_HUMAN	F	442	ENSP00000408321:C442F;ENSP00000280684:C442F	ENSP00000280684:C442F	C	+	2	0	KCNA6	4790793	1.000000	0.71417	0.967000	0.41034	0.950000	0.60333	9.565000	0.98154	2.688000	0.91661	0.655000	0.94253	TGT	.	.		0.597	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235	
NCAPD2	9918	hgsc.bcm.edu	37	12	6635520	6635520	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:6635520G>A	ENST00000315579.5	+	20	3348	c.2549G>A	c.(2548-2550)cGg>cAg	p.R850Q	NCAPD2_ENST00000542492.1_3'UTR|NCAPD2_ENST00000545962.1_Missense_Mutation_p.R805Q	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	850					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						GAGCGACTGCGGGAGACAGTC	0.562																																					p.R850Q		Atlas-SNP	.											.	NCAPD2	99	.	0			c.G2549A						.						78.0	77.0	77.0					12																	6635520		2203	4300	6503	SO:0001583	missense	9918	exon20			GACTGCGGGAGAC	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.2549G>A	chr12.hg19:g.6635520G>A	ENSP00000325017:p.Arg850Gln	120.0	0.0		119.0	20.0	NM_014865	D3DUR4|Q8N6U3	Missense_Mutation	SNP	ENST00000315579.5	hg19	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	G	5.659	0.306235	0.10733	.	.	ENSG00000010292	ENST00000315579;ENST00000382457;ENST00000545962;ENST00000535602	T;T;T	0.43688	0.94;0.94;0.94	5.39	-10.8	0.00216	Armadillo-type fold (1);	0.982473	0.08360	N	0.957858	T	0.18087	0.0434	N	0.11560	0.145	0.09310	N	1	B;B;B	0.15141	0.012;0.0;0.001	B;B;B	0.09377	0.004;0.002;0.002	T	0.36866	-0.9730	10	0.11485	T	0.65	-0.5211	14.6822	0.69026	0.7242:0.0834:0.1924:0.0	.	805;811;850	F5GZJ1;B3KY03;Q15021	.;.;CND1_HUMAN	Q	850;722;805;722	ENSP00000325017:R850Q;ENSP00000371895:R722Q;ENSP00000444417:R805Q	ENSP00000325017:R850Q	R	+	2	0	NCAPD2	6505781	0.000000	0.05858	0.000000	0.03702	0.341000	0.28922	-1.492000	0.02300	-2.524000	0.00495	-0.982000	0.02568	CGG	.	.		0.562	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
A2ML1	144568	hgsc.bcm.edu	37	12	9027081	9027081	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:9027081T>A	ENST00000299698.7	+	34	4462	c.4282T>A	c.(4282-4284)Ttg>Atg	p.L1428M	A2ML1_ENST00000539547.1_Missense_Mutation_p.L937M	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						GGTCACCAACTTGAAACCAGC	0.448																																					p.L1428M		Atlas-SNP	.											.	A2ML1	199	.	0			c.T4282A						.						138.0	134.0	135.0					12																	9027081		2015	4167	6182	SO:0001583	missense	144568	exon34			ACCAACTTGAAAC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.4282T>A	chr12.hg19:g.9027081T>A	ENSP00000299698:p.Leu1428Met	85.0	0.0		85.0	34.0	NM_144670		Missense_Mutation	SNP	ENST00000299698.7	hg19	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	t	16.25	3.069744	0.55539	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547	T;T;T	0.25749	1.78;1.78;1.78	3.32	-2.08	0.07254	Alpha-macroglobulin, receptor-binding (3);	0.000000	0.35708	N	0.003021	T	0.44623	0.1302	M	0.78049	2.395	0.26427	N	0.976002	D	0.89917	1.0	D	0.87578	0.998	T	0.33854	-0.9852	10	0.72032	D	0.01	.	9.3268	0.37997	0.0:0.5694:0.0:0.4306	.	1428	A8K2U0	A2ML1_HUMAN	M	1428;1428;978;937	ENSP00000299698:L1428M;ENSP00000443174:L978M;ENSP00000438292:L937M	ENSP00000299698:L1428M	L	+	1	2	A2ML1	8918348	0.214000	0.23563	0.976000	0.42696	0.973000	0.67179	0.120000	0.15647	-0.482000	0.06782	-1.008000	0.02478	TTG	.	.		0.448	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
CCER1	196477	hgsc.bcm.edu	37	12	91348095	91348095	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:91348095C>T	ENST00000358859.2	-	1	858	c.425G>A	c.(424-426)cGc>cAc	p.R142H	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	142																	GCGGCCCCAGCGCTTCTTCCT	0.701																																					p.R142H		Atlas-SNP	.											C12orf12,NS,carcinoma,0,1	.	.	.	0			c.G425A						.						14.0	17.0	16.0					12																	91348095		2198	4287	6485	SO:0001583	missense	196477	exon1			CCCCAGCGCTTCT	BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.425G>A	chr12.hg19:g.91348095C>T	ENSP00000351727:p.Arg142His	34.0	0.0		30.0	13.0	NM_152638	Q8TC47	Missense_Mutation	SNP	ENST00000358859.2	hg19	CCDS9036.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173783	0.78452	.	.	ENSG00000197651	ENST00000358859	T	0.39997	1.05	4.62	3.73	0.42828	.	0.000000	0.33023	N	0.005378	T	0.29288	0.0729	L	0.29908	0.895	0.31812	N	0.627021	P	0.44877	0.845	B	0.39027	0.288	T	0.38802	-0.9644	10	0.52906	T	0.07	-13.9974	10.0901	0.42443	0.0:0.9055:0.0:0.0945	.	142	Q8TC90	CL012_HUMAN	H	142	ENSP00000351727:R142H	ENSP00000351727:R142H	R	-	2	0	C12orf12	89872226	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.434000	0.44802	1.152000	0.42452	0.462000	0.41574	CGC	.	.		0.701	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
NR1H4	9971	hgsc.bcm.edu	37	12	100926383	100926383	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:100926383A>C	ENST00000551379.1	+	3	651	c.623A>C	c.(622-624)tAt>tCt	p.Y208S	NR1H4_ENST00000392986.3_Missense_Mutation_p.Y198S|NR1H4_ENST00000188403.7_Intron|NR1H4_ENST00000549996.1_Intron|NR1H4_ENST00000548884.1_Intron			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	208					bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	GAATGTATGTATACAGGTATT	0.398																																					p.Y208S		Atlas-SNP	.											.	NR1H4	145	.	0			c.A623C						.						184.0	164.0	171.0					12																	100926383		2203	4300	6503	SO:0001583	missense	9971	exon3			GTATGTATACAGG	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.623A>C	chr12.hg19:g.100926383A>C	ENSP00000447149:p.Tyr208Ser	135.0	0.0		168.0	93.0	NM_001206993	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Missense_Mutation	SNP	ENST00000551379.1	hg19	CCDS55876.1	.	.	.	.	.	.	.	.	.	.	A	12.19	1.862160	0.32884	.	.	ENSG00000012504	ENST00000392986;ENST00000551379	D;D	0.96200	-3.94;-3.94	5.67	5.67	0.87782	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (1);	0.000000	0.56097	D	0.000023	D	0.89315	0.6680	N	0.08118	0	0.80722	D	1	P;P	0.49090	0.919;0.816	P;B	0.45343	0.477;0.382	D	0.88091	0.2813	9	.	.	.	.	10.2824	0.43548	0.9263:0.0:0.0737:0.0	.	208;198	Q96RI1;F1DAL1	NR1H4_HUMAN;.	S	198;208	ENSP00000376712:Y198S;ENSP00000447149:Y208S	.	Y	+	2	0	NR1H4	99450514	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.973000	0.56845	2.165000	0.68154	0.459000	0.35465	TAT	.	.		0.398	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123	
NUP37	79023	hgsc.bcm.edu	37	12	102512142	102512142	+	Splice_Site	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:102512142T>A	ENST00000552283.1	-	2	294	c.155A>T	c.(154-156)cAg>cTg	p.Q52L	PARPBP_ENST00000541394.1_5'Flank|NUP37_ENST00000251074.1_Splice_Site_p.Q52L|PARPBP_ENST00000358383.5_5'Flank|PARPBP_ENST00000392911.2_5'Flank|PARPBP_ENST00000543784.1_5'Flank|PARPBP_ENST00000378128.3_5'Flank|PARPBP_ENST00000327680.2_5'Flank|PARPBP_ENST00000537257.1_5'Flank|NUP37_ENST00000543021.1_5'UTR			Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	52					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(10)|ovary(1)	17						TAGACTAACCTGAAACGTACA	0.368																																					p.Q52L		Atlas-SNP	.											.	NUP37	26	.	0			c.A155T						.						205.0	185.0	192.0					12																	102512142		2203	4300	6503	SO:0001630	splice_region_variant	79023	exon1			CTAACCTGAAACG	AF514994	CCDS9089.1	12q23.2	2014-08-12			ENSG00000075188	ENSG00000075188		"""WD repeat domain containing"""	29929	protein-coding gene	gene with protein product		609264				12196509	Standard	NM_024057		Approved	MGC5585, FLJ22618	uc001tjc.3	Q8NFH4	OTTHUMG00000170478	ENST00000552283.1:c.156+1A>T	chr12.hg19:g.102512142T>A		117.0	0.0		153.0	53.0	NM_024057	Q9H644	Missense_Mutation	SNP	ENST00000552283.1	hg19	CCDS9089.1	.	.	.	.	.	.	.	.	.	.	T	19.00	3.742024	0.69418	.	.	ENSG00000075188	ENST00000552283;ENST00000251074;ENST00000551744	T;T;T	0.69685	-0.42;-0.42;2.85	5.55	5.55	0.83447	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.050915	0.85682	D	0.000000	T	0.66228	0.2768	M	0.73598	2.24	0.80722	D	1	P;P	0.40144	0.704;0.651	B;B	0.36922	0.236;0.198	T	0.66818	-0.5827	10	0.27785	T	0.31	-8.1022	15.6948	0.77488	0.0:0.0:0.0:1.0	.	52;52	B4DKV8;Q8NFH4	.;NUP37_HUMAN	L	52	ENSP00000448054:Q52L;ENSP00000251074:Q52L;ENSP00000448086:Q52L	ENSP00000251074:Q52L	Q	-	2	0	NUP37	101036272	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.185000	0.77714	2.109000	0.64355	0.528000	0.53228	CAG	.	.		0.368	NUP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409330.1	NM_024057	Missense_Mutation
ANKRD13A	88455	hgsc.bcm.edu	37	12	110456257	110456257	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:110456257A>G	ENST00000261739.4	+	5	674	c.508A>G	c.(508-510)Ata>Gta	p.I170V	ANKRD13A_ENST00000550404.1_3'UTR	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	170						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						CATGAGCTGGATAAGAGGGAG	0.418																																					p.I170V		Atlas-SNP	.											.	ANKRD13A	39	.	0			c.A508G						.						138.0	138.0	138.0					12																	110456257		2203	4300	6503	SO:0001583	missense	88455	exon5			AGCTGGATAAGAG	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.508A>G	chr12.hg19:g.110456257A>G	ENSP00000261739:p.Ile170Val	222.0	0.0		251.0	105.0	NM_033121	O60736	Missense_Mutation	SNP	ENST00000261739.4	hg19	CCDS9140.1	.	.	.	.	.	.	.	.	.	.	A	12.08	1.830347	0.32329	.	.	ENSG00000076513	ENST00000261739	T	0.41758	0.99	5.63	4.49	0.54785	.	0.135399	0.64402	N	0.000004	T	0.33990	0.0882	N	0.21448	0.665	0.80722	D	1	P;B;P	0.41643	0.758;0.003;0.758	B;B;P	0.46208	0.426;0.007;0.507	T	0.10730	-1.0617	10	0.49607	T	0.09	-8.0922	8.0558	0.30604	0.8295:0.0:0.1705:0.0	.	170;170;170	B4DYP5;Q3ZTS7;Q8IZ07	.;.;AN13A_HUMAN	V	170	ENSP00000261739:I170V	ENSP00000261739:I170V	I	+	1	0	ANKRD13A	108940640	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.405000	0.52630	0.981000	0.38548	0.533000	0.62120	ATA	.	.		0.418	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403430.1	NM_033121	
PTPN11	5781	hgsc.bcm.edu	37	12	112942513	112942513	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr12:112942513G>T	ENST00000351677.2	+	15	1925	c.1727G>T	c.(1726-1728)aGt>aTt	p.S576I		NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	580					abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						AGAGAAGACAGTGCTAGAGTC	0.363			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.S576I		Atlas-SNP	.		Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	PTPN11	623	.	0			c.G1727T						.						46.0	43.0	44.0					12																	112942513		2203	4300	6503	SO:0001583	missense	5781	exon15	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	AAGACAGTGCTAG	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1727G>T	chr12.hg19:g.112942513G>T	ENSP00000340944:p.Ser576Ile	406.0	0.0		497.0	210.0	NM_002834	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	hg19	CCDS9163.1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830161	0.50845	.	.	ENSG00000179295	ENST00000351677	T	0.10860	2.83	5.8	-0.274	0.12910	.	0.314416	0.37348	N	0.002131	T	0.06645	0.0170	N	0.24115	0.695	0.44024	D	0.996749	B	0.13145	0.007	B	0.10450	0.005	T	0.24048	-1.0171	10	0.72032	D	0.01	.	7.6148	0.28152	0.3303:0.1351:0.5347:0.0	.	576	Q06124-2	.	I	576	ENSP00000340944:S576I	ENSP00000340944:S576I	S	+	2	0	PTPN11	111426896	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	1.446000	0.35090	0.035000	0.15519	-0.300000	0.09419	AGT	.	.		0.363	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
CCDC169	728591	hgsc.bcm.edu	37	13	36871783	36871783	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr13:36871783A>T	ENST00000239859.7	-	1	105	c.74T>A	c.(73-75)gTc>gAc	p.V25D	CCDC169-SOHLH2_ENST00000511166.1_5'UTR|CCDC169_ENST00000379864.2_5'UTR|CCDC169_ENST00000239860.6_5'UTR|CCDC169_ENST00000503173.1_Missense_Mutation_p.V25D|CCDC169_ENST00000491049.2_5'UTR|CCDC169_ENST00000510088.1_5'UTR|SOHLH2_ENST00000554962.1_5'UTR|CCDC169_ENST00000379862.2_5'UTR|CCDC169_ENST00000477250.1_5'UTR			A6NNP5	CC169_HUMAN	coiled-coil domain containing 169	25										breast(1)|endometrium(1)	2						CTTCTTGCGGACTTCTTCCAG	0.617																																					p.V25D		Atlas-SNP	.											.	CCDC169	20	.	0			c.T74A						.						53.0	53.0	53.0					13																	36871783		692	1591	2283	SO:0001583	missense	728591	exon1			TTGCGGACTTCTT		CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000239859.7:c.74T>A	chr13.hg19:g.36871783A>T	ENSP00000239859:p.Val25Asp	34.0	0.0		26.0	15.0	NM_001144981	A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	Missense_Mutation	SNP	ENST00000239859.7	hg19	CCDS45028.1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.433531	0.25813	.	.	ENSG00000242715	ENST00000503173;ENST00000239859	T;T	0.46063	0.88;0.95	4.96	-0.107	0.13592	.	.	.	.	.	T	0.19967	0.0480	N	0.08118	0	0.30017	N	0.814655	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.17433	0.015;0.009;0.018	T	0.17715	-1.0360	9	0.54805	T	0.06	.	4.0704	0.09879	0.5467:0.1761:0.2772:0.0	.	25;25;25	A6NNP5-4;A6NNP5;A6NNP5-2	.;CC169_HUMAN;.	D	25	ENSP00000426174:V25D;ENSP00000239859:V25D	ENSP00000239859:V25D	V	-	2	0	CCDC169	35769783	0.876000	0.30132	0.963000	0.40424	0.031000	0.12232	0.189000	0.17037	0.120000	0.18254	-0.250000	0.11733	GTC	.	.		0.617	CCDC169-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368255.1	NM_001144981	
CCNA1	8900	hgsc.bcm.edu	37	13	37012886	37012886	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr13:37012886A>G	ENST00000255465.4	+	5	1039	c.775A>G	c.(775-777)Aaa>Gaa	p.K259E	CCNA1_ENST00000449823.1_Missense_Mutation_p.K215E|CCNA1_ENST00000418263.1_Missense_Mutation_p.K258E|CCNA1_ENST00000440264.1_Missense_Mutation_p.K215E			P78396	CCNA1_HUMAN	cyclin A1	259					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|male meiosis I (GO:0007141)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)				breast(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	35		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.91e-07)|Epithelial(112;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0119)|GBM - Glioblastoma multiforme(144;0.0242)		GGAAGAATATAAACTTCGAGC	0.517																																					p.K259E		Atlas-SNP	.											.	CCNA1	91	.	0			c.A775G						.						145.0	126.0	132.0					13																	37012886		2203	4300	6503	SO:0001583	missense	8900	exon5			GAATATAAACTTC	U66838	CCDS9357.1, CCDS45031.1	13q12.3-q13	2014-01-21			ENSG00000133101	ENSG00000133101			1577	protein-coding gene	gene with protein product		604036				9041194	Standard	NM_003914		Approved	CT146	uc001uvr.4	P78396	OTTHUMG00000016733	ENST00000255465.4:c.775A>G	chr13.hg19:g.37012886A>G	ENSP00000255465:p.Lys259Glu	231.0	0.0		125.0	53.0	NM_003914	B7Z7E3|Q5T3V0|Q5U0G2|Q8IY91	Missense_Mutation	SNP	ENST00000255465.4	hg19	CCDS9357.1	.	.	.	.	.	.	.	.	.	.	A	16.81	3.226606	0.58668	.	.	ENSG00000133101	ENST00000440264;ENST00000449823;ENST00000418263;ENST00000255465	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	5.33	4.15	0.48705	Cyclin, N-terminal (2);Cyclin-like (3);	0.187288	0.56097	D	0.000026	T	0.24661	0.0598	L	0.39566	1.225	0.54753	D	0.999984	P;B	0.38048	0.616;0.277	B;P	0.49528	0.423;0.614	T	0.01652	-1.1303	10	0.54805	T	0.06	.	12.55	0.56222	0.8521:0.1479:0.0:0.0	.	258;259	P78396-2;P78396	.;CCNA1_HUMAN	E	215;215;258;259	ENSP00000400666:K215E;ENSP00000409873:K215E;ENSP00000396479:K258E;ENSP00000255465:K259E	ENSP00000255465:K259E	K	+	1	0	CCNA1	35910886	1.000000	0.71417	0.002000	0.10522	0.439000	0.31926	5.892000	0.69790	0.955000	0.37878	0.528000	0.53228	AAA	.	.		0.517	CCNA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044514.2	NM_003914	
POSTN	10631	hgsc.bcm.edu	37	13	38159034	38159034	+	Silent	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr13:38159034G>T	ENST00000379747.4	-	8	1044	c.927C>A	c.(925-927)ctC>ctA	p.L309L	POSTN_ENST00000541179.1_Silent_p.L309L|POSTN_ENST00000379742.4_Silent_p.L309L|POSTN_ENST00000541481.1_Silent_p.L309L|POSTN_ENST00000379743.4_Silent_p.L309L|POSTN_ENST00000379749.4_Silent_p.L309L	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	309	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CAGAACACTGGAGAGTATTTA	0.393																																					p.L309L		Atlas-SNP	.											.	POSTN	161	.	0			c.C927A						.						110.0	103.0	106.0					13																	38159034		2203	4300	6503	SO:0001819	synonymous_variant	10631	exon8			ACACTGGAGAGTA	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.927C>A	chr13.hg19:g.38159034G>T		91.0	0.0		40.0	21.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Silent	SNP	ENST00000379747.4	hg19	CCDS9364.1																																																																																			.	.		0.393	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
AJUBA	84962	hgsc.bcm.edu	37	14	23444239	23444239	+	Silent	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr14:23444239G>A	ENST00000262713.2	-	5	1689	c.1314C>T	c.(1312-1314)ggC>ggT	p.G438G	RP11-298I3.5_ENST00000555074.1_Intron|AJUBA_ENST00000361265.4_Silent_p.G438G|AJUBA_ENST00000397388.3_Silent_p.G21G	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	438	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										TGAAGGGGATGCCATCCAGGC	0.522																																					p.G438G		Atlas-SNP	.											.	.	.	.	0			c.C1314T						.						159.0	145.0	150.0					14																	23444239		2203	4300	6503	SO:0001819	synonymous_variant	84962	exon5			GGGGATGCCATCC	AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.1314C>T	chr14.hg19:g.23444239G>A		75.0	0.0		82.0	26.0	NM_032876	A8MX18|D3DS37	Silent	SNP	ENST00000262713.2	hg19	CCDS9581.1																																																																																			.	.		0.522	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071685.2		
HEATR5A	25938	hgsc.bcm.edu	37	14	31814462	31814462	+	Silent	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr14:31814462T>C	ENST00000389961.3	-	19	2870	c.2871A>G	c.(2869-2871)ctA>ctG	p.L957L	HEATR5A_ENST00000439348.1_Silent_p.L957L|HEATR5A_ENST00000439727.1_Silent_p.L670L|HEATR5A_ENST00000404677.3_Silent_p.L963L|HEATR5A_ENST00000543095.2_Silent_p.L963L			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	957										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TGATCAATGATAGAGAATGTA	0.333																																					p.L963L		Atlas-SNP	.											.	HEATR5A	181	.	0			c.A2889G						.						89.0	84.0	86.0					14																	31814462		1879	4095	5974	SO:0001819	synonymous_variant	25938	exon20			CAATGATAGAGAA	AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.2871A>G	chr14.hg19:g.31814462T>C		107.0	0.0		125.0	44.0	NM_015473	Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Silent	SNP	ENST00000389961.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.257|8.257	0.810209|0.810209	0.16537|0.16537	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000550366|ENST00000538864	.|.	.|.	.|.	5.41|5.41	-10.8|-10.8	0.00216|0.00216	.|.	.|.	.|.	.|.	.|.	T|T	0.47967|0.47967	0.1474|0.1474	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.60880|0.60880	-0.7175|-0.7175	4|4	.|.	.|.	.|.	.|.	10.5804|10.5804	0.45252|0.45252	0.0757:0.5897:0.2397:0.0949|0.0757:0.5897:0.2397:0.0949	.|.	.|.	.|.	.|.	V|C	606|591	.|.	.|.	I|Y	-|-	1|2	0|0	HEATR5A|HEATR5A	30884213|30884213	0.003000|0.003000	0.15002|0.15002	0.103000|0.103000	0.21229|0.21229	0.865000|0.865000	0.49528|0.49528	-1.191000|-1.191000	0.03055|0.03055	-1.913000|-1.913000	0.01079|0.01079	-0.250000|-0.250000	0.11733|0.11733	ATC|TAT	.	.		0.333	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015473	
CTAGE5	4253	hgsc.bcm.edu	37	14	39819413	39819413	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr14:39819413T>G	ENST00000280083.3	+	24	2674	c.2360T>G	c.(2359-2361)aTt>aGt	p.I787S	CTAGE5_ENST00000553383.1_3'UTR|CTAGE5_ENST00000341502.5_Intron|CTAGE5_ENST00000553352.1_Missense_Mutation_p.I758S|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.I758S|CTAGE5_ENST00000557038.1_Missense_Mutation_p.I707S|CTAGE5_ENST00000348007.3_Missense_Mutation_p.I744S|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.I1322S|CTAGE5_ENST00000341749.3_Missense_Mutation_p.I775S|CTAGE5_ENST00000396165.4_Missense_Mutation_p.I758S|CTAGE5_ENST00000396158.2_Missense_Mutation_p.I792S|CTAGE5_ENST00000556148.1_Missense_Mutation_p.I712S			O15320	CTGE5_HUMAN	CTAGE family, member 5	787	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TCAGGTTTGATTCCACCTTCA	0.453																																					p.I792S		Atlas-SNP	.											.	CTAGE5	75	.	0			c.T2375G						.						90.0	91.0	91.0					14																	39819413		2203	4300	6503	SO:0001583	missense	4253	exon24			GTTTGATTCCACC	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.2360T>G	chr14.hg19:g.39819413T>G	ENSP00000280083:p.Ile787Ser	187.0	0.0		157.0	88.0	NM_001247989	B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	ENST00000280083.3	hg19	CCDS9674.1	.	.	.	.	.	.	.	.	.	.	T	10.10	1.258866	0.23051	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	T;T;T;T;T;T;T;T;T	0.08458	3.27;3.1;3.09;3.1;3.39;3.39;3.1;3.44;3.1	5.61	-8.4	0.00965	.	0.492488	0.15133	N	0.278742	T	0.04318	0.0119	N	0.25890	0.77	0.09310	N	1	B;B;B;B;B	0.10296	0.003;0.002;0.003;0.002;0.003	B;B;B;B;B	0.12156	0.007;0.005;0.007;0.005;0.007	T	0.33343	-0.9872	9	.	.	.	.	10.8927	0.47004	0.0:0.5518:0.2266:0.2216	.	792;744;787;715;775	O15320-5;O15320-2;O15320;O15320-7;G3XAC5	.;.;CTGE5_HUMAN;.;.	S	1322;775;707;655;758;792;787;712;744;758	ENSP00000452252:I1322S;ENSP00000343897:I775S;ENSP00000450869:I707S;ENSP00000379468:I758S;ENSP00000379462:I792S;ENSP00000280083:I787S;ENSP00000452562:I712S;ENSP00000343912:I744S;ENSP00000450449:I758S	.	I	+	2	0	CTAGE5;RP11-407N17.3	38889164	0.000000	0.05858	0.000000	0.03702	0.729000	0.41735	-0.743000	0.04845	-1.762000	0.01308	0.460000	0.39030	ATT	.	.		0.453	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276771.2	NM_005930	
UNC79	57578	hgsc.bcm.edu	37	14	94088968	94088968	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr14:94088968C>A	ENST00000393151.2	+	30	5389	c.5389C>A	c.(5389-5391)Ccc>Acc	p.P1797T	UNC79_ENST00000256339.4_Missense_Mutation_p.P1620T|UNC79_ENST00000553484.1_Missense_Mutation_p.P1819T|UNC79_ENST00000555664.1_Missense_Mutation_p.P1797T			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1797					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TGCAGAGAACCCCACAGAAAG	0.522																																					p.P1620T		Atlas-SNP	.											.	UNC79	366	.	0			c.C4858A						.						66.0	60.0	62.0					14																	94088968		2203	4300	6503	SO:0001583	missense	57578	exon30			GAGAACCCCACAG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.5389C>A	chr14.hg19:g.94088968C>A	ENSP00000376858:p.Pro1797Thr	218.0	0.0		200.0	60.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	C	3.270	-0.149306	0.06585	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.57	4.67	0.58626	.	0.238613	0.42964	D	0.000629	T	0.12347	0.0300	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.18561	0.022	T	0.19418	-1.0306	10	0.15499	T	0.54	-2.5733	16.5969	0.84799	0.0:0.8698:0.1302:0.0	.	1819	C9JQL1	.	T	1620;1797;1819;1797;1819	ENSP00000256339:P1620T;ENSP00000450868:P1797T;ENSP00000451360:P1819T;ENSP00000376858:P1797T	ENSP00000256339:P1620T	P	+	1	0	KIAA1409	93158721	0.827000	0.29292	0.013000	0.15412	0.454000	0.32378	3.109000	0.50345	1.329000	0.45376	0.484000	0.47621	CCC	.	.		0.522	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
TRPM1	4308	hgsc.bcm.edu	37	15	31323191	31323191	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr15:31323191A>G	ENST00000256552.6	-	23	3269	c.3122T>C	c.(3121-3123)aTa>aCa	p.I1041T	TRPM1_ENST00000542188.1_Missense_Mutation_p.I1058T|RP11-348B17.1_ENST00000561299.1_RNA|TRPM1_ENST00000397795.2_Missense_Mutation_p.I1019T|RP11-348B17.1_ENST00000558755.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTTACGGTCTATCTGGTCTGC	0.428																																					p.I1058T		Atlas-SNP	.											.	TRPM1	183	.	0			c.T3173C						.						126.0	129.0	128.0					15																	31323191		2159	4287	6446	SO:0001583	missense	4308	exon22			CGGTCTATCTGGT	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3122T>C	chr15.hg19:g.31323191A>G	ENSP00000256552:p.Ile1041Thr	123.0	0.0		133.0	81.0	NM_001252020		Missense_Mutation	SNP	ENST00000256552.6	hg19	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.078174	0.55753	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	D;D;D	0.98512	-4.97;-4.97;-4.97	6.05	4.93	0.64822	Ion transport (1);	0.087042	0.85682	N	0.000000	D	0.98416	0.9473	M	0.72576	2.205	0.50813	D	0.999897	D;P	0.71674	0.998;0.931	D;P	0.62955	0.909;0.817	D	0.98628	1.0670	10	0.87932	D	0	-22.2619	12.1212	0.53893	0.9334:0.0:0.0666:0.0	.	1013;1019	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	T	1019;1058;1041;1019	ENSP00000380897:I1019T;ENSP00000437849:I1058T;ENSP00000256552:I1041T	ENSP00000256552:I1041T	I	-	2	0	TRPM1	29110483	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.472000	0.80996	1.113000	0.41760	0.528000	0.53228	ATA	.	.		0.428	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
FBN1	2200	hgsc.bcm.edu	37	15	48829987	48829987	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr15:48829987C>T	ENST00000316623.5	-	7	1012	c.557G>A	c.(556-558)tGt>tAt	p.C186Y		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	186	TB 1.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CACAGTAAAACATGGGCCTGT	0.493																																					p.C186Y		Atlas-SNP	.											.	FBN1	310	.	0			c.G557A						.						62.0	64.0	63.0					15																	48829987		2197	4296	6493	SO:0001583	missense	2200	exon7			GTAAAACATGGGC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.557G>A	chr15.hg19:g.48829987C>T	ENSP00000325527:p.Cys186Tyr	116.0	0.0		114.0	7.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262391	0.80358	.	.	ENSG00000166147	ENST00000316623;ENST00000544030;ENST00000537463	D;D	0.98060	-4.69;-4.69	5.14	5.14	0.70334	Matrix fibril-associated (2);TGF-beta binding (1);	0.000000	0.85682	D	0.000000	D	0.98811	0.9599	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.99517	1.0957	10	0.72032	D	0.01	.	19.143	0.93452	0.0:1.0:0.0:0.0	.	186	P35555	FBN1_HUMAN	Y	186	ENSP00000325527:C186Y;ENSP00000440294:C186Y	ENSP00000325527:C186Y	C	-	2	0	FBN1	46617279	1.000000	0.71417	0.973000	0.42090	0.965000	0.64279	7.606000	0.82863	2.814000	0.96858	0.655000	0.94253	TGT	.	.		0.493	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
LARP6	55323	hgsc.bcm.edu	37	15	71124522	71124522	+	Missense_Mutation	SNP	C	C	T	rs146941351		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr15:71124522C>T	ENST00000299213.8	-	3	1415	c.1345G>A	c.(1345-1347)Ggt>Agt	p.G449S	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	449					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						GGACTCGTACCGGGGCTTTTC	0.617																																					p.G449S		Atlas-SNP	.											.	LARP6	43	.	0			c.G1345A						.						69.0	73.0	72.0					15																	71124522		2199	4297	6496	SO:0001583	missense	55323	exon3			TCGTACCGGGGCT	BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.1345G>A	chr15.hg19:g.71124522C>T	ENSP00000299213:p.Gly449Ser	129.0	0.0		102.0	35.0	NM_018357	Q5XKE4|Q8N3N2|Q9NUR0	Missense_Mutation	SNP	ENST00000299213.8	hg19	CCDS32281.1	.	.	.	.	.	.	.	.	.	.	C	5.204	0.223079	0.09863	.	.	ENSG00000166173	ENST00000299213	T	0.39997	1.05	5.3	2.19	0.27852	.	0.242826	0.40908	D	0.000983	T	0.18257	0.0438	N	0.08118	0	0.25583	N	0.986774	B	0.18863	0.031	B	0.14023	0.01	T	0.20739	-1.0266	10	0.17369	T	0.5	-11.2105	6.5295	0.22320	0.0:0.6889:0.1436:0.1675	.	449	Q9BRS8	LARP6_HUMAN	S	449	ENSP00000299213:G449S	ENSP00000299213:G449S	G	-	1	0	LARP6	68911576	0.022000	0.18835	0.001000	0.08648	0.311000	0.27955	1.794000	0.38774	0.159000	0.19401	0.555000	0.69702	GGT	.	C|1.000;A|0.000		0.617	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417197.2	NM_018357	
NEO1	4756	hgsc.bcm.edu	37	15	73541947	73541947	+	Silent	SNP	T	T	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr15:73541947T>G	ENST00000339362.5	+	12	2226	c.1779T>G	c.(1777-1779)tcT>tcG	p.S593S	NEO1_ENST00000560262.1_Silent_p.S593S|NEO1_ENST00000261908.6_Silent_p.S593S|NEO1_ENST00000560352.1_3'UTR|NEO1_ENST00000558964.1_Silent_p.S593S			Q92859	NEO1_HUMAN	neogenin 1	593	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						CAAGTCACTCTTACACCATTA	0.348																																					p.S593S		Atlas-SNP	.											.	NEO1	102	.	0			c.T1779G						.						103.0	98.0	100.0					15																	73541947		2198	4297	6495	SO:0001819	synonymous_variant	4756	exon11			TCACTCTTACACC	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.1779T>G	chr15.hg19:g.73541947T>G		134.0	0.0		121.0	34.0	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Silent	SNP	ENST00000339362.5	hg19	CCDS10247.1																																																																																			.	.		0.348	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
AXIN1	8312	hgsc.bcm.edu	37	16	396840	396840	+	Missense_Mutation	SNP	C	C	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr16:396840C>A	ENST00000262320.3	-	2	557	c.186G>T	c.(184-186)agG>agT	p.R62S	AXIN1_ENST00000481769.1_Intron|AXIN1_ENST00000354866.3_Missense_Mutation_p.R62S	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	62					activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GATCCGAGCGCCTCGGAGTGG	0.607											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.R62S		Atlas-SNP	.											.	AXIN1	290	.	0			c.G186T						.						37.0	36.0	36.0					16																	396840		2203	4300	6503	SO:0001583	missense	8312	exon2			CGAGCGCCTCGGA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.186G>T	chr16.hg19:g.396840C>A	ENSP00000262320:p.Arg62Ser	86.0	0.0	588	35.0	17.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.179822	0.57800	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.64991	-0.13;-0.12	5.34	3.37	0.38596	.	0.000000	0.85682	D	0.000000	T	0.77611	0.4156	M	0.81341	2.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.78250	-0.2277	10	0.72032	D	0.01	-19.0395	10.6745	0.45778	0.0:0.8434:0.0:0.1566	.	62;62	O15169-2;O15169	.;AXIN1_HUMAN	S	62	ENSP00000262320:R62S;ENSP00000346935:R62S	ENSP00000262320:R62S	R	-	3	2	AXIN1	336841	0.999000	0.42202	0.979000	0.43373	0.885000	0.51271	0.798000	0.27014	0.625000	0.30304	0.655000	0.94253	AGG	.	.		0.607	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
SSTR5	6755	hgsc.bcm.edu	37	16	1129724	1129724	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr16:1129724T>C	ENST00000293897.4	+	1	944	c.856T>C	c.(856-858)Tac>Cac	p.Y286H	SSTR5-AS1_ENST00000569832.1_RNA|SSTR5_ENST00000562758.1_Intron|SSTR5_ENST00000397547.2_Missense_Mutation_p.Y286H	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	286					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	CGCCGGCCTCTACTTCTTCGT	0.617																																					p.Y286H		Atlas-SNP	.											.	SSTR5	36	.	0			c.T856C						.						74.0	84.0	80.0					16																	1129724		2193	4296	6489	SO:0001583	missense	6755	exon2			GGCCTCTACTTCT	D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.856T>C	chr16.hg19:g.1129724T>C	ENSP00000293897:p.Tyr286His	63.0	0.0		48.0	22.0	NM_001172560	P34988|Q541E0|Q9UJI5	Missense_Mutation	SNP	ENST00000293897.4	hg19	CCDS10429.1	.	.	.	.	.	.	.	.	.	.	T	10.04	1.242590	0.22796	.	.	ENSG00000162009	ENST00000397547;ENST00000293897	T;T	0.73047	-0.71;-0.71	4.76	4.76	0.60689	GPCR, rhodopsin-like superfamily (1);	0.136393	0.51477	D	0.000097	T	0.72811	0.3507	L	0.61218	1.895	0.36314	D	0.857852	P	0.37636	0.603	B	0.44278	0.445	T	0.78866	-0.2035	10	0.44086	T	0.13	.	13.4447	0.61134	0.0:0.0:0.0:1.0	.	286	P35346	SSR5_HUMAN	H	286	ENSP00000380680:Y286H;ENSP00000293897:Y286H	ENSP00000293897:Y286H	Y	+	1	0	SSTR5	1069725	1.000000	0.71417	0.997000	0.53966	0.030000	0.12068	7.813000	0.86123	1.786000	0.52430	0.459000	0.35465	TAC	.	.		0.617	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420836.1		
IL21R	50615	hgsc.bcm.edu	37	16	27448987	27448987	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr16:27448987A>T	ENST00000337929.3	+	4	804	c.331A>T	c.(331-333)Agc>Tgc	p.S111C	IL21R_ENST00000395755.1_Missense_Mutation_p.S111C|IL21R_ENST00000564089.1_Missense_Mutation_p.S111C|IL21R_ENST00000395754.4_Missense_Mutation_p.S111C	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	111	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						GGAGTGTGGCAGCTTTCTCCT	0.557			T	BCL6	NHL																																p.S133C		Atlas-SNP	.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	95	.	0			c.A397T						.						116.0	88.0	98.0					16																	27448987		2197	4300	6497	SO:0001583	missense	50615	exon5			TGTGGCAGCTTTC	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.331A>T	chr16.hg19:g.27448987A>T	ENSP00000338010:p.Ser111Cys	78.0	0.0		52.0	27.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	hg19	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	A	13.44	2.236641	0.39498	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.57752	0.38;0.38;0.38	4.79	0.789	0.18607	Fibronectin, type III (1);	0.778148	0.12653	N	0.450337	T	0.59810	0.2221	M	0.69823	2.125	0.32605	N	0.525403	D	0.67145	0.996	P	0.56216	0.794	T	0.64584	-0.6373	10	0.59425	D	0.04	-9.8773	5.7655	0.18224	0.5212:0.3223:0.0:0.1565	.	111	Q9HBE5	IL21R_HUMAN	C	111	ENSP00000338010:S111C;ENSP00000379104:S111C;ENSP00000379103:S111C	ENSP00000338010:S111C	S	+	1	0	IL21R	27356488	0.964000	0.33143	0.990000	0.47175	0.073000	0.16967	0.210000	0.17455	0.227000	0.20999	-0.478000	0.04885	AGC	.	.		0.557	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
LONP2	83752	hgsc.bcm.edu	37	16	48295405	48295405	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr16:48295405A>T	ENST00000285737.4	+	5	887	c.794A>T	c.(793-795)gAa>gTa	p.E265V	LONP2_ENST00000535754.1_Missense_Mutation_p.E221V	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						GATGAAGATGAAGATAATGAT	0.353																																					p.E265V		Atlas-SNP	.											.	LONP2	63	.	0			c.A794T						.						151.0	150.0	150.0					16																	48295405		2200	4300	6500	SO:0001583	missense	83752	exon5			AAGATGAAGATAA	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.794A>T	chr16.hg19:g.48295405A>T	ENSP00000285737:p.Glu265Val	296.0	0.0		174.0	67.0	NM_031490		Missense_Mutation	SNP	ENST00000285737.4	hg19	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.905543	0.92107	.	.	ENSG00000102910	ENST00000285737;ENST00000535754;ENST00000416006	T;T	0.34275	1.37;1.39	5.88	5.88	0.94601	.	0.159786	0.56097	D	0.000024	T	0.48314	0.1493	M	0.81112	2.525	0.80722	D	1	P;P	0.49961	0.93;0.93	P;P	0.44860	0.462;0.462	T	0.56860	-0.7909	10	0.62326	D	0.03	-30.4383	16.2898	0.82742	1.0:0.0:0.0:0.0	.	221;265	B7ZKL7;Q86WA8	.;LONP2_HUMAN	V	265;221;221	ENSP00000285737:E265V;ENSP00000445426:E221V	ENSP00000285737:E265V	E	+	2	0	LONP2	46852906	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.984000	0.88150	2.250000	0.74265	0.482000	0.46254	GAA	.	.		0.353	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
NLRC5	84166	hgsc.bcm.edu	37	16	57062007	57062007	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr16:57062007A>G	ENST00000262510.6	+	7	2324	c.2099A>G	c.(2098-2100)gAt>gGt	p.D700G	NLRC5_ENST00000436936.1_Missense_Mutation_p.D700G|NLRC5_ENST00000308149.7_Missense_Mutation_p.D700G|NLRC5_ENST00000539144.1_Missense_Mutation_p.D700G	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	700					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				AAGTGTGGGGATGCCTTTGCA	0.577																																					p.D700G		Atlas-SNP	.											.	NLRC5	186	.	0			c.A2099G						.						48.0	44.0	45.0					16																	57062007		2198	4300	6498	SO:0001583	missense	84166	exon6			GTGGGGATGCCTT	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2099A>G	chr16.hg19:g.57062007A>G	ENSP00000262510:p.Asp700Gly	70.0	0.0		38.0	21.0	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	hg19	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.749607	0.49257	.	.	ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030	T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41	5.31	5.31	0.75309	.	0.000000	0.33401	N	0.004947	T	0.69314	0.3097	M	0.65975	2.015	0.40836	D	0.98363	D;D;D;B	0.89917	1.0;1.0;0.994;0.161	D;D;D;B	0.97110	1.0;1.0;0.941;0.174	T	0.72896	-0.4153	10	0.59425	D	0.04	.	12.6503	0.56757	1.0:0.0:0.0:0.0	.	700;700;700;700	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.;.;.;NLRC5_HUMAN	G	700;700;700;174;700;207;55	ENSP00000262510:D700G;ENSP00000308886:D700G;ENSP00000389739:D700G;ENSP00000441727:D700G;ENSP00000441597:D207G;ENSP00000440153:D55G	ENSP00000262510:D700G	D	+	2	0	NLRC5	55619508	1.000000	0.71417	0.910000	0.35882	0.046000	0.14306	5.874000	0.69652	2.028000	0.59812	0.533000	0.62120	GAT	.	.		0.577	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
ENO3	2027	hgsc.bcm.edu	37	17	4857083	4857083	+	Silent	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:4857083C>T	ENST00000323997.6	+	6	519	c.387C>T	c.(385-387)ccC>ccT	p.P129P	ENO3_ENST00000519584.1_Silent_p.P86P|ENO3_ENST00000518175.1_Silent_p.P129P	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	129					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						AGGGGGTCCCCCTGTACCGCC	0.622																																					p.P129P		Atlas-SNP	.											.	ENO3	36	.	0			c.C387T						.						110.0	97.0	102.0					17																	4857083		2203	4300	6503	SO:0001819	synonymous_variant	2027	exon6			GGTCCCCCTGTAC	X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.387C>T	chr17.hg19:g.4857083C>T		118.0	0.0		68.0	15.0	NM_001976	B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Silent	SNP	ENST00000323997.6	hg19	CCDS11062.1																																																																																			.	.		0.622	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216851.2		
SLC35G6	643664	hgsc.bcm.edu	37	17	7385340	7385340	+	Missense_Mutation	SNP	T	T	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:7385340T>G	ENST00000412468.2	+	2	152	c.37T>G	c.(37-39)Tcc>Gcc	p.S13A	ZBTB4_ENST00000380599.4_5'Flank|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	13						integral component of membrane (GO:0016021)											CCCGCCTGACTCCACACACCC	0.672																																					p.S13A		Atlas-SNP	.											.	.	.	.	0			c.T37G						.						51.0	54.0	53.0					17																	7385340		2203	4300	6503	SO:0001583	missense	643664	exon2			CCTGACTCCACAC		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.37T>G	chr17.hg19:g.7385340T>G	ENSP00000396523:p.Ser13Ala	81.0	0.0		88.0	52.0	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	hg19	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.028742	0.00410	.	.	ENSG00000181222	ENST00000412468	T	0.27104	1.69	4.21	3.12	0.35913	.	.	.	.	.	T	0.10380	0.0254	N	0.08118	0	0.09310	N	0.999994	B	0.09022	0.002	B	0.09377	0.004	T	0.32877	-0.9890	9	0.06625	T	0.88	-5.403	7.0163	0.24890	0.0:0.1102:0.0:0.8898	.	13	P0C7Q6	S35G6_HUMAN	A	13	ENSP00000396523:S13A	ENSP00000396523:S13A	S	+	1	0	SLC35G6	7326064	1.000000	0.71417	1.000000	0.80357	0.008000	0.06430	1.164000	0.31810	1.681000	0.50988	0.379000	0.24179	TCC	.	.		0.672	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
SLC35G6	643664	hgsc.bcm.edu	37	17	7385382	7385382	+	Missense_Mutation	SNP	T	T	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:7385382T>C	ENST00000412468.2	+	2	194	c.79T>C	c.(79-81)Tgg>Cgg	p.W27R	ZBTB4_ENST00000380599.4_5'Flank|POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	27						integral component of membrane (GO:0016021)											CAGCCTCCGCTGGCACCAGTG	0.662																																					p.W27R		Atlas-SNP	.											.	.	.	.	0			c.T79C						.						45.0	51.0	49.0					17																	7385382		2202	4298	6500	SO:0001583	missense	643664	exon2			CTCCGCTGGCACC		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.79T>C	chr17.hg19:g.7385382T>C	ENSP00000396523:p.Trp27Arg	71.0	0.0		81.0	48.0	NM_001102614		Missense_Mutation	SNP	ENST00000412468.2	hg19	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	T	3.764	-0.049064	0.07407	.	.	ENSG00000181222	ENST00000412468	T	0.26373	1.74	4.21	1.96	0.26148	.	.	.	.	.	T	0.10680	0.0261	N	0.08118	0	0.19575	N	0.999967	B	0.29085	0.232	B	0.23574	0.047	T	0.28933	-1.0028	9	0.25106	T	0.35	6.0E-4	5.2846	0.15694	0.0:0.2418:0.0:0.7582	.	27	P0C7Q6	S35G6_HUMAN	R	27	ENSP00000396523:W27R	ENSP00000396523:W27R	W	+	1	0	SLC35G6	7326106	0.006000	0.16342	0.093000	0.20910	0.519000	0.34347	0.409000	0.21082	0.608000	0.30000	0.379000	0.24179	TGG	.	.		0.662	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
DNAH9	1770	hgsc.bcm.edu	37	17	11593507	11593507	+	Silent	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:11593507G>A	ENST00000262442.4	+	20	4436	c.4368G>A	c.(4366-4368)cgG>cgA	p.R1456R	DNAH9_ENST00000454412.2_Silent_p.R1456R	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1456	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.R1456R(1)		NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CCCACCCACGGACCAATGTCC	0.493																																					p.R1456R		Atlas-SNP	.											DNAH9,NS,carcinoma,0,1	DNAH9	695	.	1	Substitution - coding silent(1)	lung(1)	c.G4368A						.						81.0	79.0	80.0					17																	11593507		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon20			CCCACGGACCAAT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4368G>A	chr17.hg19:g.11593507G>A		116.0	0.0		119.0	47.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	hg19	CCDS11160.1																																																																																			.	.		0.493	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DNAH9	1770	hgsc.bcm.edu	37	17	11833232	11833232	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:11833232A>T	ENST00000262442.4	+	63	11995	c.11927A>T	c.(11926-11928)gAg>gTg	p.E3976V	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Intron|DNAH9_ENST00000608377.1_Missense_Mutation_p.E288V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3976	AAA 6. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AAGAAGCTGGAGGAGCACAGT	0.592																																					p.E3976V		Atlas-SNP	.											.	DNAH9	695	.	0			c.A11927T						.						74.0	57.0	63.0					17																	11833232		2203	4300	6503	SO:0001583	missense	1770	exon63			AGCTGGAGGAGCA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11927A>T	chr17.hg19:g.11833232A>T	ENSP00000262442:p.Glu3976Val	144.0	0.0		154.0	44.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.005631	0.74932	.	.	ENSG00000007174	ENST00000262442;ENST00000396001	T;T	0.10099	2.91;2.91	5.19	4.1	0.47936	Dynein heavy chain (1);	0.053068	0.64402	D	0.000001	T	0.41811	0.1175	M	0.94142	3.5	0.58432	D	0.999999	D	0.60575	0.988	D	0.73708	0.981	T	0.52866	-0.8518	10	0.87932	D	0	.	11.2692	0.49129	0.7083:0.2917:0.0:0.0	.	3976	Q9NYC9	DYH9_HUMAN	V	3976;288	ENSP00000262442:E3976V;ENSP00000379323:E288V	ENSP00000262442:E3976V	E	+	2	0	DNAH9	11773957	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.227000	0.78070	0.973000	0.38340	0.460000	0.39030	GAG	.	.		0.592	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
PPP1R1B	84152	hgsc.bcm.edu	37	17	37791873	37791873	+	Silent	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:37791873A>T	ENST00000254079.4	+	6	928	c.459A>T	c.(457-459)acA>acT	p.T153T	PPP1R1B_ENST00000394267.2_Silent_p.T117T|PPP1R1B_ENST00000394265.1_Silent_p.T117T|STARD3_ENST00000580611.1_5'Flank|PPP1R1B_ENST00000579000.1_Silent_p.T120T|STARD3_ENST00000394250.4_5'Flank|STARD3_ENST00000336308.5_5'Flank|PPP1R1B_ENST00000580825.1_Silent_p.T153T|STARD3_ENST00000544210.2_5'Flank	NM_032192.3	NP_115568.2	Q9UD71	PPR1B_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1B	153					intracellular signal transduction (GO:0035556)|negative regulation of catalytic activity (GO:0043086)|negative regulation of female receptivity (GO:0007621)|negative regulation of protein kinase activity (GO:0006469)|regulation of catalytic activity (GO:0050790)|response to amphetamine (GO:0001975)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	protein kinase inhibitor activity (GO:0004860)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 1 regulator activity (GO:0008599)			kidney(1)|large_intestine(1)|liver(1)|lung(2)	5	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GGCAAAAGACAACCTGTGGCC	0.587																																					p.T153T		Atlas-SNP	.											.	PPP1R1B	9	.	0			c.A459T						.						84.0	96.0	92.0					17																	37791873		2203	4300	6503	SO:0001819	synonymous_variant	84152	exon6			AAAGACAACCTGT	AI124650	CCDS11339.1, CCDS11340.1	17q12	2012-04-17	2008-07-31		ENSG00000131771	ENSG00000131771	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9287	protein-coding gene	gene with protein product	"""dopamine and cAMP regulated phosphoprotein"""	604399				8120638	Standard	NM_032192		Approved	DARPP-32, FLJ20940	uc002hrz.3	Q9UD71	OTTHUMG00000133210	ENST00000254079.4:c.459A>T	chr17.hg19:g.37791873A>T		107.0	0.0		106.0	45.0	NM_032192	Q547V9|Q547W0|Q9H7G1	Silent	SNP	ENST00000254079.4	hg19	CCDS11339.1																																																																																			.	.		0.587	PPP1R1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256925.2	NM_032192	
KRT9	3857	hgsc.bcm.edu	37	17	39726458	39726458	+	Silent	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:39726458T>A	ENST00000246662.4	-	2	722	c.657A>T	c.(655-657)acA>acT	p.T219T	KRT9_ENST00000588431.1_5'UTR	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	219	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				TGTTGCCCACTGTCAGGTCCA	0.502																																					p.T219T		Atlas-SNP	.											.	KRT9	78	.	0			c.A657T						.						272.0	230.0	244.0					17																	39726458		2203	4300	6503	SO:0001819	synonymous_variant	3857	exon2			GCCCACTGTCAGG		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.657A>T	chr17.hg19:g.39726458T>A		145.0	0.0		116.0	36.0	NM_000226	O00109|Q0IJ47|Q14665	Silent	SNP	ENST00000246662.4	hg19	CCDS32654.1																																																																																			.	.		0.502	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
KCNH4	23415	hgsc.bcm.edu	37	17	40330239	40330239	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:40330239G>T	ENST00000264661.3	-	4	796	c.464C>A	c.(463-465)tCc>tAc	p.S155Y	KCNH4_ENST00000607371.1_Missense_Mutation_p.S155Y	NM_012285.2	NP_036417.1	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 4	155					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|urinary_tract(1)	32		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TCTACCAAGGGAGTTTTCTGT	0.592																																					p.S155Y	NSCLC(117;707 1703 2300 21308 31858)	Atlas-SNP	.											.	KCNH4	105	.	0			c.C464A						.						73.0	72.0	73.0					17																	40330239		2203	4300	6503	SO:0001583	missense	23415	exon4			CCAAGGGAGTTTT	AB022698	CCDS11420.1	17q21	2012-07-05				ENSG00000089558		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6253	protein-coding gene	gene with protein product		604528				10455180, 16382104	Standard	NM_012285		Approved	Kv12.3, elk1	uc002hzb.2	Q9UQ05		ENST00000264661.3:c.464C>A	chr17.hg19:g.40330239G>T	ENSP00000264661:p.Ser155Tyr	91.0	0.0		85.0	50.0	NM_012285		Missense_Mutation	SNP	ENST00000264661.3	hg19	CCDS11420.1	.	.	.	.	.	.	.	.	.	.	G	7.853	0.724445	0.15439	.	.	ENSG00000089558	ENST00000264661	D	0.98792	-5.14	4.99	4.02	0.46733	.	0.195495	0.25517	N	0.030123	D	0.95683	0.8596	L	0.43152	1.355	0.21604	N	0.999623	B	0.12630	0.006	B	0.14578	0.011	D	0.88790	0.3277	10	0.30078	T	0.28	.	4.541	0.12058	0.179:0.0:0.6311:0.1899	.	155	Q9UQ05	KCNH4_HUMAN	Y	155	ENSP00000264661:S155Y	ENSP00000264661:S155Y	S	-	2	0	KCNH4	37583765	1.000000	0.71417	0.996000	0.52242	0.183000	0.23260	2.203000	0.42752	1.326000	0.45319	0.563000	0.77884	TCC	.	.		0.592	KCNH4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449791.2	NM_012285	
ZNF556	80032	hgsc.bcm.edu	37	19	2877959	2877959	+	Nonsense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:2877959A>T	ENST00000307635.2	+	4	1090	c.1003A>T	c.(1003-1005)Aga>Tga	p.R335*	ZNF556_ENST00000586426.1_Nonsense_Mutation_p.R334*	NM_024967.1	NP_079243.1	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(3)|skin(7)	31				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAACACGCGAGAACGCATGC	0.507																																					p.R335X		Atlas-SNP	.											.	ZNF556	73	.	0			c.A1003T						.						43.0	41.0	41.0					19																	2877959		2203	4300	6503	SO:0001587	stop_gained	80032	exon4			CACGCGAGAACGC	BC009374	CCDS12097.1, CCDS74254.1	19p13.3	2013-09-20			ENSG00000172000	ENSG00000172000		"""Zinc fingers, C2H2-type"", ""-"""	25669	protein-coding gene	gene with protein product						12477932	Standard	XM_005259647		Approved	FLJ11637	uc002lwp.1	Q9HAH1	OTTHUMG00000180501	ENST00000307635.2:c.1003A>T	chr19.hg19:g.2877959A>T	ENSP00000302603:p.Arg335*	154.0	0.0		127.0	69.0	NM_024967	Q96GM3	Nonsense_Mutation	SNP	ENST00000307635.2	hg19	CCDS12097.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107895	0.77096	.	.	ENSG00000172000	ENST00000307635	.	.	.	2.13	2.13	0.27403	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5549	0.27819	1.0:0.0:0.0:0.0	.	.	.	.	X	335	.	ENSP00000302603:R335X	R	+	1	2	ZNF556	2828959	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.875000	0.01634	0.826000	0.34661	0.334000	0.21626	AGA	.	.		0.507	ZNF556-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451638.2	NM_024967	
NMRK2	27231	hgsc.bcm.edu	37	19	3942230	3942230	+	Missense_Mutation	SNP	A	A	G	rs143940174	byFrequency	TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:3942230A>G	ENST00000168977.2	+	8	942	c.652A>G	c.(652-654)Aga>Gga	p.R218G	NMRK2_ENST00000593949.1_Missense_Mutation_p.R223G|NMRK2_ENST00000599576.1_3'UTR	NM_170678.2	NP_733778.1	Q9NPI5	NRK2_HUMAN	nicotinamide riboside kinase 2	218					NAD biosynthetic process (GO:0009435)|negative regulation of myoblast differentiation (GO:0045662)	intracellular (GO:0005622)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|ribosylnicotinamide kinase activity (GO:0050262)										ATGCGGCCACAGAACGGCCAG	0.657																																					p.R218G		Atlas-SNP	.											.	.	.	.	0			c.A652G						.						21.0	21.0	21.0					19																	3942230		2201	4297	6498	SO:0001583	missense	27231	exon8			GGCCACAGAACGG	AF190819	CCDS12115.1, CCDS74259.1	19p13.3	2013-10-28	2012-05-31	2012-05-31	ENSG00000077009	ENSG00000077009			17871	protein-coding gene	gene with protein product	"""muscle-specific beta 1 integrin binding protein"", ""nicotinamide riboside kinase 2"""	608705	"""integrin beta 1 binding protein 3"""	ITGB1BP3		10613898, 15137942	Standard	NM_170678		Approved	MIBP, NRK2	uc002lyz.4	Q9NPI5	OTTHUMG00000181758	ENST00000168977.2:c.652A>G	chr19.hg19:g.3942230A>G	ENSP00000168977:p.Arg218Gly	89.0	0.0		93.0	30.0	NM_170678	B7ZKR3|Q52M81|Q9NZK3	Missense_Mutation	SNP	ENST00000168977.2	hg19	CCDS12115.1	.	.	.	.	.	.	.	.	.	.	A	4.796	0.148092	0.09134	.	.	ENSG00000077009	ENST00000168977;ENST00000395034	T	0.44881	0.91	2.42	-0.334	0.12666	.	.	.	.	.	T	0.18087	0.0434	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17531	-1.0366	9	0.46703	T	0.11	2.9665	1.4237	0.02318	0.4205:0.0:0.2593:0.3202	.	223;218	B7ZKR3;Q9NPI5	.;NRK2_HUMAN	G	218;174	ENSP00000168977:R218G	ENSP00000168977:R218G	R	+	1	2	ITGB1BP3	3893230	0.000000	0.05858	0.018000	0.16275	0.153000	0.21895	0.013000	0.13310	0.188000	0.20168	0.397000	0.26171	AGA	.	A|0.999;C|0.001		0.657	NMRK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457492.1	NM_014446, NM_170678	
SH2D3A	10045	hgsc.bcm.edu	37	19	6755305	6755305	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:6755305G>C	ENST00000245908.6	-	5	787	c.518C>G	c.(517-519)tCt>tGt	p.S173C	SH2D3A_ENST00000599563.1_5'UTR|SH2D3A_ENST00000437152.3_Missense_Mutation_p.S51C	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	173					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						GGGCAAGGCAGATATGGGCAT	0.587																																					p.S173C		Atlas-SNP	.											.	SH2D3A	53	.	0			c.C518G						.						89.0	93.0	91.0					19																	6755305		2203	4300	6503	SO:0001583	missense	10045	exon5			AAGGCAGATATGG	AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.518C>G	chr19.hg19:g.6755305G>C	ENSP00000245908:p.Ser173Cys	155.0	0.0		143.0	50.0	NM_005490	A8K9R6|B4DRS7|Q9Y2X4	Missense_Mutation	SNP	ENST00000245908.6	hg19	CCDS12173.1	.	.	.	.	.	.	.	.	.	.	G	8.921	0.961100	0.18583	.	.	ENSG00000125731	ENST00000245908;ENST00000437152	T;T	0.42131	2.58;0.98	4.1	-1.33	0.09172	.	0.774326	0.10546	N	0.662111	T	0.29850	0.0746	L	0.42245	1.32	0.09310	N	1	B;B	0.14438	0.01;0.001	B;B	0.11329	0.006;0.001	T	0.31364	-0.9946	10	0.59425	D	0.04	-0.0312	4.0897	0.09963	0.2536:0.3715:0.3748:0.0	.	51;173	B4DRS7;Q9BRG2	.;SH23A_HUMAN	C	173;51	ENSP00000245908:S173C;ENSP00000393303:S51C	ENSP00000245908:S173C	S	-	2	0	SH2D3A	6706305	0.033000	0.19621	0.043000	0.18650	0.080000	0.17528	1.826000	0.39092	-0.089000	0.12484	0.313000	0.20887	TCT	.	.		0.587	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458016.1	NM_005490	
MUC16	94025	hgsc.bcm.edu	37	19	9066432	9066432	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:9066432A>C	ENST00000397910.4	-	3	21217	c.21014T>G	c.(21013-21015)tTg>tGg	p.L7005W		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7007	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TATTTCTGGCAAAACTGTGGA	0.512																																					p.L7005W		Atlas-SNP	.											.	MUC16	4315	.	0			c.T21014G						.						291.0	268.0	276.0					19																	9066432		1988	4173	6161	SO:0001583	missense	94025	exon3			TCTGGCAAAACTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21014T>G	chr19.hg19:g.9066432A>C	ENSP00000381008:p.Leu7005Trp	106.0	0.0		117.0	36.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	3.961	-0.010309	0.07727	.	.	ENSG00000181143	ENST00000397910	T	0.03301	3.98	3.05	-0.419	0.12340	.	.	.	.	.	T	0.04182	0.0116	L	0.29908	0.895	.	.	.	P	0.47106	0.89	P	0.46362	0.514	T	0.37174	-0.9717	8	0.87932	D	0	.	7.597	0.28054	0.2532:0.0:0.7468:0.0	.	7005	B5ME49	.	W	7005	ENSP00000381008:L7005W	ENSP00000381008:L7005W	L	-	2	0	MUC16	8927432	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.470000	0.22084	0.012000	0.14892	-1.615000	0.00797	TTG	.	.		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
INSL3	3640	hgsc.bcm.edu	37	19	17932271	17932271	+	Silent	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:17932271A>T	ENST00000317306.7	-	1	61	c.45T>A	c.(43-45)ccT>ccA	p.P15P	INSL3_ENST00000379695.5_Silent_p.P15P	NM_005543.3	NP_005534.2	P51460	INSL3_HUMAN	insulin-like 3 (Leydig cell)	15					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)	insulin receptor binding (GO:0005158)|protease binding (GO:0002020)|receptor binding (GO:0005102)			breast(1)|lung(1)	2						ACACCAGGGCAGGGCCCAGCA	0.731																																					p.P15P		Atlas-SNP	.											.	INSL3	8	.	0			c.T45A						.						4.0	7.0	6.0					19																	17932271		1709	3178	4887	SO:0001819	synonymous_variant	3640	exon1			CAGGGCAGGGCCC		CCDS12365.1, CCDS58655.1	19p13.2-p12	2013-02-26	2003-05-13			ENSG00000248099		"""Endogenous ligands"""	6086	protein-coding gene	gene with protein product	"""prepro-INSL3"""	146738	"""relaxin-like factor"""	RLNL		8020942	Standard	NM_001265587		Approved	RLF, MGC119818, MGC119819	uc010ebf.2	P51460		ENST00000317306.7:c.45T>A	chr19.hg19:g.17932271A>T		166.0	0.0		153.0	79.0	NM_005543	B4DZ72|G3XAG0|Q3KPI5|Q3KPI6|Q6YNB5|Q9UEA2|Q9UPH6	Silent	SNP	ENST00000317306.7	hg19	CCDS12365.1																																																																																			.	.		0.731	INSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466836.1	NM_005543	
KCNN1	3780	hgsc.bcm.edu	37	19	18092673	18092673	+	Silent	SNP	G	G	T	rs371311512		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:18092673G>T	ENST00000222249.9	+	5	973	c.654G>T	c.(652-654)gcG>gcT	p.A218A		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	218					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	TCACGTACGCGCCCTCGGTGG	0.657																																					p.A218A		Atlas-SNP	.											.	KCNN1	74	.	0			c.G654T						.						27.0	29.0	28.0					19																	18092673		2200	4290	6490	SO:0001819	synonymous_variant	3780	exon5			GTACGCGCCCTCG	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.654G>T	chr19.hg19:g.18092673G>T		71.0	0.0		71.0	20.0	NM_002248	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	hg19																																																																																				.	.		0.657	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
ZNF90	7643	hgsc.bcm.edu	37	19	20228890	20228890	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:20228890T>A	ENST00000418063.2	+	4	639	c.527T>A	c.(526-528)aTa>aAa	p.I176K	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	176					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						TTCAAATGTATAGAATGTGGC	0.338																																					p.I176K		Atlas-SNP	.											.	ZNF90	93	.	0			c.T527A						.						33.0	30.0	31.0					19																	20228890		692	1591	2283	SO:0001583	missense	7643	exon4			AATGTATAGAATG	M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.527T>A	chr19.hg19:g.20228890T>A	ENSP00000410466:p.Ile176Lys	151.0	0.0		162.0	7.0	NM_007138	B9EH87	Missense_Mutation	SNP	ENST00000418063.2	hg19	CCDS46028.1	.	.	.	.	.	.	.	.	.	.	T	0.061	-1.223539	0.01530	.	.	ENSG00000213988	ENST00000418063	T	0.15834	2.39	1.18	-1.08	0.09936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04952	0.0133	N	0.00201	-1.865	0.09310	N	1	D	0.53151	0.958	P	0.54590	0.756	T	0.09400	-1.0676	8	.	.	.	.	1.5824	0.02637	0.3582:0.2957:0.0:0.3462	.	176	Q03938	ZNF90_HUMAN	K	176	ENSP00000410466:I176K	.	I	+	2	0	ZNF90	20089890	0.000000	0.05858	0.023000	0.16930	0.023000	0.10783	-3.899000	0.00339	0.251000	0.21505	0.248000	0.18094	ATA	.	.		0.338	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350101.1	NM_007138	
UPK1A	11045	hgsc.bcm.edu	37	19	36166776	36166776	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:36166776G>T	ENST00000222275.2	+	5	503	c.503G>T	c.(502-504)tGg>tTg	p.W168L	UPK1A-AS1_ENST00000443196.1_RNA|UPK1A_ENST00000379013.2_Missense_Mutation_p.W168L	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A	168					epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCCATGGACTGGGTGAACTTC	0.617																																					p.W168L		Atlas-SNP	.											.	UPK1A	23	.	0			c.G503T						.						76.0	66.0	69.0					19																	36166776		2203	4300	6503	SO:0001583	missense	11045	exon5			TGGACTGGGTGAA	AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.503G>T	chr19.hg19:g.36166776G>T	ENSP00000222275:p.Trp168Leu	54.0	0.0		43.0	12.0	NM_007000	Q3KNU5|Q3KNU6	Missense_Mutation	SNP	ENST00000222275.2	hg19	CCDS12470.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625855	0.87560	.	.	ENSG00000105668	ENST00000222275;ENST00000379013	T;T	0.81330	-1.48;-1.48	5.22	5.22	0.72569	Tetraspanin, EC2 domain (1);	0.000000	0.64402	D	0.000001	D	0.88503	0.6454	M	0.66939	2.045	0.54753	D	0.999985	D;D	0.69078	0.993;0.997	P;D	0.79108	0.857;0.992	D	0.89641	0.3862	10	0.87932	D	0	0.8394	16.2551	0.82510	0.0:0.0:1.0:0.0	.	168;168	O00322-2;O00322	.;UPK1A_HUMAN	L	168	ENSP00000222275:W168L;ENSP00000368298:W168L	ENSP00000222275:W168L	W	+	2	0	UPK1A	40858616	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.340000	0.72973	2.433000	0.82419	0.549000	0.68633	TGG	.	.		0.617	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109486.3		
ZNF382	84911	hgsc.bcm.edu	37	19	37117233	37117233	+	Missense_Mutation	SNP	A	A	G			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:37117233A>G	ENST00000292928.2	+	5	547	c.434A>G	c.(433-435)aAt>aGt	p.N145S	ZNF382_ENST00000435416.1_Missense_Mutation_p.N144S|ZNF382_ENST00000423582.1_Missense_Mutation_p.N96S|CTD-3234P18.2_ENST00000585467.1_lincRNA|ZNF382_ENST00000439428.1_Missense_Mutation_p.N144S	NM_001256838.1|NM_032825.4	NP_001243767.1|NP_116214.2	Q96SR6	ZN382_HUMAN	zinc finger protein 382	145	Represses transcription. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	34	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GTTTTGAAAAATATTTCAGAA	0.323																																					p.N145S		Atlas-SNP	.											.	ZNF382	87	.	0			c.A434G						.						63.0	71.0	69.0					19																	37117233		2190	4292	6482	SO:0001583	missense	84911	exon5			TGAAAAATATTTC	AF513816	CCDS33004.1, CCDS58659.1	19q13.13	2013-01-08			ENSG00000161298	ENSG00000161298		"""Zinc fingers, C2H2-type"", ""-"""	17409	protein-coding gene	gene with protein product		609516					Standard	NM_032825		Approved	FLJ14686, KS1	uc010efb.4	Q96SR6	OTTHUMG00000048153	ENST00000292928.2:c.434A>G	chr19.hg19:g.37117233A>G	ENSP00000292928:p.Asn145Ser	406.0	0.0		326.0	194.0	NM_032825	A3KMP6|A8MT55|C9K0V5|Q53ZY8|Q5JPJ2	Missense_Mutation	SNP	ENST00000292928.2	hg19	CCDS33004.1	.	.	.	.	.	.	.	.	.	.	A	5.998	0.368011	0.11352	.	.	ENSG00000161298	ENST00000423582;ENST00000292928;ENST00000439428;ENST00000435416	T;T;T;T	0.06068	3.35;3.55;3.56;3.56	4.83	4.83	0.62350	.	0.000000	0.45867	D	0.000337	T	0.04679	0.0127	N	0.16098	0.37	0.27857	N	0.940528	P;P;P	0.50528	0.936;0.936;0.895	P;P;B	0.47645	0.553;0.553;0.351	T	0.14671	-1.0464	10	0.05436	T	0.98	.	10.9744	0.47456	1.0:0.0:0.0:0.0	.	144;144;145	Q96SR6-2;Q96SR6-3;Q96SR6	.;.;ZN382_HUMAN	S	96;145;144;144	ENSP00000389722:N96S;ENSP00000292928:N145S;ENSP00000407593:N144S;ENSP00000410113:N144S	ENSP00000292928:N145S	N	+	2	0	ZNF382	41809073	0.388000	0.25197	1.000000	0.80357	0.908000	0.53690	1.778000	0.38614	2.163000	0.67991	0.460000	0.39030	AAT	.	.		0.323	ZNF382-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109562.2	NM_032825	
GRIK5	2901	hgsc.bcm.edu	37	19	42507596	42507596	+	Missense_Mutation	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:42507596A>T	ENST00000262895.3	-	18	2401	c.2402T>A	c.(2401-2403)aTg>aAg	p.M801K	GRIK5_ENST00000301218.4_Missense_Mutation_p.M801K|GRIK5_ENST00000593562.1_Missense_Mutation_p.M801K	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	801					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				AATGTTCTCCATGCCCAAACC	0.577																																					p.M801K		Atlas-SNP	.											.	GRIK5	220	.	0			c.T2402A						.						96.0	80.0	85.0					19																	42507596		2203	4300	6503	SO:0001583	missense	2901	exon18			TTCTCCATGCCCA		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.2402T>A	chr19.hg19:g.42507596A>T	ENSP00000262895:p.Met801Lys	108.0	0.0		103.0	63.0	NM_002088	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	hg19	CCDS12595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.76|19.76	3.887112|3.887112	0.72410|0.72410	.|.	.|.	ENSG00000105737|ENSG00000105737	ENST00000454993|ENST00000262895;ENST00000301218	.|T;T	.|0.54479	.|0.57;0.57	4.06|4.06	4.06|4.06	0.47325|0.47325	.|Ionotropic glutamate receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.54663|0.54663	0.1872|0.1872	L|L	0.49571|0.49571	1.57|1.57	0.53688|0.53688	D|D	0.999974|0.999974	.|B	.|0.31859	.|0.343	.|B	.|0.42361	.|0.385	T|T	0.60850|0.60850	-0.7181|-0.7181	5|10	.|0.87932	.|D	.|0	.|.	12.1313|12.1313	0.53944|0.53944	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|801	.|Q16478	.|GRIK5_HUMAN	Q|K	177|801	.|ENSP00000262895:M801K;ENSP00000301218:M801K	.|ENSP00000262895:M801K	H|M	-|-	3|2	2|0	GRIK5|GRIK5	47199436|47199436	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	8.842000|8.842000	0.92136|0.92136	1.697000|1.697000	0.51169|0.51169	0.454000|0.454000	0.30748|0.30748	CAT|ATG	.	.		0.577	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463453.1		
PRKCG	5582	hgsc.bcm.edu	37	19	54393251	54393251	+	Missense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:54393251C>T	ENST00000263431.3	+	5	791	c.509C>T	c.(508-510)gCa>gTa	p.A170V	PRKCG_ENST00000542049.1_Missense_Mutation_p.A57V|PRKCG_ENST00000536044.1_Missense_Mutation_p.A170V|PRKCG_ENST00000540413.1_Missense_Mutation_p.A170V	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	170	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	GCTCCCACAGCAGATGAGATC	0.711																																					p.A170V		Atlas-SNP	.											.	PRKCG	246	.	0			c.C509T						.						11.0	13.0	12.0					19																	54393251		2172	4244	6416	SO:0001583	missense	5582	exon5			CCACAGCAGATGA	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.509C>T	chr19.hg19:g.54393251C>T	ENSP00000263431:p.Ala170Val	93.0	0.0		76.0	18.0	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	hg19	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	c	9.550	1.115735	0.20795	.	.	ENSG00000126583	ENST00000536044;ENST00000540413;ENST00000263431;ENST00000542049	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	4.75	2.23	0.28157	C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.30510	0.0767	L	0.45352	1.415	0.09310	N	1	B;B;B;B;B	0.21688	0.059;0.009;0.002;0.004;0.0	B;B;B;B;B	0.08055	0.003;0.002;0.001;0.001;0.0	T	0.15292	-1.0442	8	.	.	.	.	6.6773	0.23102	0.1816:0.5574:0.261:0.0	.	57;170;170;170;170	B7Z8Q0;F5H5C4;B7Z870;B7Z3W6;P05129	.;.;.;.;KPCG_HUMAN	V	170;170;170;57	ENSP00000440541:A170V;ENSP00000443493:A170V;ENSP00000263431:A170V;ENSP00000438090:A57V	.	A	+	2	0	PRKCG	59085063	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	0.820000	0.27323	1.090000	0.41315	0.651000	0.88453	GCA	.	.		0.711	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
ATRN	8455	hgsc.bcm.edu	37	20	3619493	3619493	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr20:3619493C>T	ENST00000262919.5	+	27	4029	c.3961C>T	c.(3961-3963)Caa>Taa	p.Q1321*		NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	1321					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						TCGAGAGATGCAACAGATGGC	0.423																																					p.Q1321X		Atlas-SNP	.											.	ATRN	118	.	0			c.C3961T						.						86.0	79.0	82.0					20																	3619493		2203	4300	6503	SO:0001587	stop_gained	8455	exon27			GAGATGCAACAGA	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.3961C>T	chr20.hg19:g.3619493C>T	ENSP00000262919:p.Gln1321*	82.0	0.0		96.0	43.0	NM_139321	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Nonsense_Mutation	SNP	ENST00000262919.5	hg19	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	C	43	10.275521	0.99373	.	.	ENSG00000088812	ENST00000262919	.	.	.	5.09	5.09	0.68999	.	0.202236	0.43747	D	0.000531	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-10.1928	16.0325	0.80588	0.0:1.0:0.0:0.0	.	.	.	.	X	1321	.	ENSP00000262919:Q1321X	Q	+	1	0	ATRN	3567493	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.242000	0.78210	2.638000	0.89438	0.650000	0.86243	CAA	.	.		0.423	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077740.2	NM_139321	
DHX35	60625	hgsc.bcm.edu	37	20	37647529	37647529	+	Missense_Mutation	SNP	G	G	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr20:37647529G>C	ENST00000252011.3	+	15	1518	c.1485G>C	c.(1483-1485)atG>atC	p.M495I	DHX35_ENST00000373325.2_Missense_Mutation_p.M495I|DHX35_ENST00000373323.4_Missense_Mutation_p.M464I	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	495					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				TTGCCAAAATGCTGCTTGAAT	0.453																																					p.M495I		Atlas-SNP	.											.	DHX35	82	.	0			c.G1485C						.						167.0	156.0	160.0					20																	37647529		2203	4300	6503	SO:0001583	missense	60625	exon15			CAAAATGCTGCTT	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.1485G>C	chr20.hg19:g.37647529G>C	ENSP00000252011:p.Met495Ile	110.0	0.0		126.0	64.0	NM_021931	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Missense_Mutation	SNP	ENST00000252011.3	hg19	CCDS13310.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514404	0.85389	.	.	ENSG00000101452	ENST00000373325;ENST00000252011;ENST00000373323;ENST00000373321	T;T;T	0.34275	1.37;1.37;1.37	5.94	5.94	0.96194	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.46776	0.1410	L	0.45137	1.4	0.80722	D	1	B;P	0.50528	0.415;0.936	B;P	0.50970	0.198;0.655	T	0.36504	-0.9745	10	0.72032	D	0.01	.	20.3594	0.98849	0.0:0.0:1.0:0.0	.	464;495	F5GXM6;Q9H5Z1	.;DHX35_HUMAN	I	495;495;464;1	ENSP00000362422:M495I;ENSP00000252011:M495I;ENSP00000362420:M464I	ENSP00000252011:M495I	M	+	3	0	DHX35	37080943	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.816000	0.99350	2.816000	0.96949	0.563000	0.77884	ATG	.	.		0.453	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
OSBPL2	9885	hgsc.bcm.edu	37	20	60854388	60854388	+	Silent	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr20:60854388C>T	ENST00000313733.3	+	7	869	c.667C>T	c.(667-669)Ctg>Ttg	p.L223L	OSBPL2_ENST00000439951.2_Silent_p.L131L|OSBPL2_ENST00000358053.2_Silent_p.L211L	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	223					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			CACCCTGGAGCTGCTCAAGTG	0.567																																					p.L223L		Atlas-SNP	.											.	OSBPL2	51	.	0			c.C667T						.						76.0	64.0	68.0					20																	60854388		2203	4300	6503	SO:0001819	synonymous_variant	9885	exon7			CTGGAGCTGCTCA	AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.667C>T	chr20.hg19:g.60854388C>T		103.0	0.0		114.0	48.0	NM_144498	A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Silent	SNP	ENST00000313733.3	hg19	CCDS13495.1																																																																																			.	.		0.567	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080021.1	NM_014835	
DEPDC5	9681	hgsc.bcm.edu	37	22	32266715	32266715	+	Missense_Mutation	SNP	A	A	C			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr22:32266715A>C	ENST00000382112.3	+	33	3513	c.3443A>C	c.(3442-3444)aAc>aCc	p.N1148T	DEPDC5_ENST00000400246.1_Missense_Mutation_p.N1157T|DEPDC5_ENST00000539165.1_5'UTR|DEPDC5_ENST00000382111.2_Missense_Mutation_p.N1157T|DEPDC5_ENST00000382105.2_Missense_Mutation_p.N1079T|DEPDC5_ENST00000400248.2_Missense_Mutation_p.N1126T|DEPDC5_ENST00000494060.1_3'UTR|DEPDC5_ENST00000266091.3_Missense_Mutation_p.N1135T|DEPDC5_ENST00000535622.1_Missense_Mutation_p.N1057T|DEPDC5_ENST00000400249.2_Missense_Mutation_p.N1126T	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1157					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TCCTCCACAAACTCCAGTGAC	0.532																																					p.N1157T		Atlas-SNP	.											.	DEPDC5	266	.	0			c.A3470C						.						88.0	90.0	90.0					22																	32266715		1997	4172	6169	SO:0001583	missense	9681	exon34			CCACAAACTCCAG	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.3443A>C	chr22.hg19:g.32266715A>C	ENSP00000371546:p.Asn1148Thr	138.0	0.0		139.0	8.0	NM_001242896	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	hg19	CCDS46692.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.73|12.73	2.026962|2.026962	0.35797|0.35797	.|.	.|.	ENSG00000100150|ENSG00000100150	ENST00000433147|ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	.|T;T;T;T;T;T;T;T	.|0.32272	.|1.46;1.88;1.88;1.85;1.47;1.88;1.85;1.88	5.95|5.95	3.81|3.81	0.43845|0.43845	.|.	.|0.488018	.|0.22083	.|N	.|0.064865	T|T	0.20577|0.20577	0.0495|0.0495	L|L	0.27053|0.27053	0.805|0.805	0.22468|0.22468	N|N	0.999079|0.999079	.|P;B;B;P;B;B;B	.|0.35923	.|0.528;0.049;0.102;0.515;0.066;0.049;0.09	.|B;B;B;B;B;B;B	.|0.41332	.|0.167;0.042;0.034;0.354;0.05;0.042;0.028	T|T	0.14699|0.14699	-1.0463|-1.0463	5|10	.|0.12103	.|T	.|0.63	.|.	6.6623|6.6623	0.23020|0.23020	0.7651:0.0:0.2349:0.0|0.7651:0.0:0.2349:0.0	.|.	.|478;1157;1057;543;1135;1148;1126	.|B4DSS1;B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.|.;.;.;.;.;.;DEPD5_HUMAN	N|T	532|1057;1135;1126;1057;1157;1079;1148;1157;1126	.|ENSP00000440210:N1057T;ENSP00000266091:N1135T;ENSP00000383108:N1126T;ENSP00000383105:N1157T;ENSP00000371539:N1079T;ENSP00000371546:N1148T;ENSP00000371545:N1157T;ENSP00000383107:N1126T	.|ENSP00000266091:N1135T	K|N	+|+	3|2	2|0	DEPDC5|DEPDC5	30596715|30596715	0.910000|0.910000	0.30920|0.30920	0.847000|0.847000	0.33407|0.33407	0.985000|0.985000	0.73830|0.73830	1.825000|1.825000	0.39081|0.39081	1.034000|1.034000	0.39945|0.39945	0.533000|0.533000	0.62120|0.62120	AAA|AAC	.	.		0.532	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
TRIOBP	11078	hgsc.bcm.edu	37	22	38121212	38121212	+	Silent	SNP	C	C	T	rs374255684		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr22:38121212C>T	ENST00000406386.3	+	7	2904	c.2649C>T	c.(2647-2649)ccC>ccT	p.P883P		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	883					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CATCATCTCCCCACCGCTCCA	0.537																																					p.P883P		Atlas-SNP	.											.	TRIOBP	262	.	0			c.C2649T						.						139.0	152.0	147.0					22																	38121212		2036	4165	6201	SO:0001819	synonymous_variant	11078	exon7			ATCTCCCCACCGC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2649C>T	chr22.hg19:g.38121212C>T		160.0	0.0		149.0	42.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	ENST00000406386.3	hg19	CCDS43015.1																																																																																			.	.		0.537	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
DDX17	10521	hgsc.bcm.edu	37	22	38888102	38888102	+	Missense_Mutation	SNP	G	G	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr22:38888102G>T	ENST00000396821.3	-	11	1505	c.1406C>A	c.(1405-1407)gCa>gAa	p.A469E	DDX17_ENST00000432525.1_5'UTR|DDX17_ENST00000381633.3_Missense_Mutation_p.A390E	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	469	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					AAGGATGGGTGCCTTTCCAGA	0.363																																					p.A469E	Ovarian(55;1085 1454 6392 21425)	Atlas-SNP	.											.	DDX17	73	.	0			c.C1406A						.						93.0	74.0	81.0					22																	38888102		2203	4300	6503	SO:0001583	missense	10521	exon11			ATGGGTGCCTTTC	U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.1406C>A	chr22.hg19:g.38888102G>T	ENSP00000380033:p.Ala469Glu	113.0	0.0		94.0	4.0	NM_006386	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	ENST00000396821.3	hg19	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	G	31	5.076927	0.94000	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.05025	3.51;3.51;3.51	6.17	6.17	0.99709	Helicase, C-terminal (3);	0.088322	0.85682	D	0.000000	T	0.22166	0.0534	L	0.49513	1.565	0.80722	D	1	D;P;P	0.63880	0.993;0.916;0.897	D;P;P	0.66497	0.944;0.642;0.51	T	0.00002	-1.2636	10	0.72032	D	0.01	-14.5753	20.8794	0.99867	0.0:0.0:1.0:0.0	.	390;471;469	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	E	469;390;469;471	ENSP00000380033:A469E;ENSP00000371046:A390E;ENSP00000385536:A469E	ENSP00000371046:A390E	A	-	2	0	DDX17	37218048	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.429000	0.97481	2.941000	0.99782	0.655000	0.94253	GCA	.	.		0.363	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881	
ASMTL	8623	hgsc.bcm.edu	37	X	1571669	1571669	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrX:1571669G>A	ENST00000381317.3	-	1	97	c.65C>T	c.(64-66)cCa>cTa	p.P22L	ASMTL_ENST00000534940.1_Intron|ASMTL_ENST00000416733.2_5'UTR|ASMTL_ENST00000381333.4_Missense_Mutation_p.P22L	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	22	MAF-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CTGACGGCGTGGGGAGGCGCT	0.726																																					p.P22L		Atlas-SNP	.											.	ASMTL	56	.	0			c.C65T						.						16.0	22.0	21.0					X																	1571669		1943	4117	6060	SO:0001583	missense	8623	exon1			CGGCGTGGGGAGG	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.65C>T	chrX.hg19:g.1571669G>A	ENSP00000370718:p.Pro22Leu	58.0	0.0		65.0	17.0	NM_001173474	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Missense_Mutation	SNP	ENST00000381317.3	hg19	CCDS43917.1	.	.	.	.	.	.	.	.	.	.	N	12.06	1.823775	0.32237	.	.	ENSG00000169093	ENST00000381333;ENST00000381317	T;T	0.04360	3.64;3.82	2.12	2.12	0.27331	.	0.000000	0.64402	U	0.000001	T	0.24890	0.0604	H	0.96301	3.8	0.42202	D	0.991772	D;D	0.60575	0.97;0.988	P;D	0.66084	0.467;0.941	T	0.01824	-1.1266	10	0.87932	D	0	.	6.0088	0.19562	0.1731:0.0:0.8269:0.0	.	22;22	O95671-2;O95671	.;ASML_HUMAN	L	22	ENSP00000370734:P22L;ENSP00000370718:P22L	ENSP00000370718:P22L	P	-	2	0	ASMTL	1531669	0.977000	0.34250	0.990000	0.47175	0.777000	0.43975	2.237000	0.43061	0.649000	0.30751	0.272000	0.19324	CCA	.	.		0.726	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192	
ZBED1	9189	hgsc.bcm.edu	37	X	2408474	2408474	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrX:2408474T>A	ENST00000381223.4	-	2	490	c.287A>T	c.(286-288)aAg>aTg	p.K96M	ZBED1_ENST00000381218.3_Missense_Mutation_p.K96M|ZBED1_ENST00000381222.2_Missense_Mutation_p.K96M|ZBED1_ENST00000515319.1_5'Flank|DHRSX_ENST00000334651.5_Intron	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	96					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGGCTTCAGCTTGGAGAAGGC	0.647																																					p.K96M		Atlas-SNP	.											.	ZBED1	64	.	0			c.A287T						.						116.0	109.0	112.0					X																	2408474		2203	4296	6499	SO:0001583	missense	9189	exon2			TTCAGCTTGGAGA	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.287A>T	chrX.hg19:g.2408474T>A	ENSP00000370621:p.Lys96Met	231.0	0.0		185.0	56.0	NM_001171135	Q96BY4	Missense_Mutation	SNP	ENST00000381223.4	hg19	CCDS14118.1	.	.	.	.	.	.	.	.	.	.	T	14.00	2.403463	0.42613	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218;ENST00000461691	.	.	.	2.62	2.62	0.31277	.	0.087637	0.42294	U	0.000731	T	0.34337	0.0894	.	.	.	0.09310	N	1	P	0.51791	0.948	P	0.46543	0.52	T	0.13602	-1.0503	8	0.45353	T	0.12	-19.7652	10.2814	0.43541	0.0:0.0:0.0:1.0	.	96	O96006	ZBED1_HUMAN	M	96	.	ENSP00000370616:K96M	K	-	2	0	ZBED1	2418474	1.000000	0.71417	0.997000	0.53966	0.720000	0.41350	2.499000	0.45372	0.888000	0.36160	0.347000	0.21830	AAG	.	.		0.647	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144310.3	NM_004729	
TLR7	51284	hgsc.bcm.edu	37	X	12903873	12903873	+	Silent	SNP	A	A	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrX:12903873A>T	ENST00000380659.3	+	3	385	c.246A>T	c.(244-246)ccA>ccT	p.P82P		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	82					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	ACATCTCCCCAGCGTCCTTTC	0.483																																					p.P82P		Atlas-SNP	.											.	TLR7	125	.	0			c.A246T						.						145.0	135.0	138.0					X																	12903873		2203	4300	6503	SO:0001819	synonymous_variant	51284	exon3			CTCCCCAGCGTCC	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.246A>T	chrX.hg19:g.12903873A>T		178.0	0.0		215.0	201.0	NM_016562	D1CS69|Q9NR98	Silent	SNP	ENST00000380659.3	hg19	CCDS14151.1																																																																																			.	.		0.483	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
DDX53	168400	hgsc.bcm.edu	37	X	23019572	23019572	+	Silent	SNP	C	C	T			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrX:23019572C>T	ENST00000327968.5	+	1	1486	c.1398C>T	c.(1396-1398)ccC>ccT	p.P466P	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	466	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						ACATGTCACCCAACGACAAAG	0.383																																					p.P466P		Atlas-SNP	.											.	DDX53	76	.	0			c.C1398T						.						108.0	96.0	100.0					X																	23019572		2203	4300	6503	SO:0001819	synonymous_variant	168400	exon1			GTCACCCAACGAC	AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.1398C>T	chrX.hg19:g.23019572C>T		169.0	0.0		202.0	10.0	NM_182699	Q0D2N2|Q6NVV4	Silent	SNP	ENST00000327968.5	hg19	CCDS35214.1																																																																																			.	.		0.383	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
LANCL3	347404	hgsc.bcm.edu	37	X	37431397	37431397	+	Missense_Mutation	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrX:37431397T>A	ENST00000378619.3	+	1	493	c.274T>A	c.(274-276)Tac>Aac	p.Y92N	LANCL3_ENST00000378621.3_Missense_Mutation_p.Y92N|TM4SF2_ENST00000465127.1_Intron	NM_001170331.1	NP_001163802.1	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3 (bacterial)	92							catalytic activity (GO:0003824)			lung(4)|pancreas(1)	5						CCGGGAACGCTACCTGCGCTC	0.716																																					p.Y92N		Atlas-SNP	.											.	LANCL3	42	.	0			c.T274A						.						9.0	8.0	9.0					X																	37431397		2054	4009	6063	SO:0001583	missense	347404	exon1			GAACGCTACCTGC	AK124915	CCDS14240.1, CCDS55398.1	Xp21.1	2008-02-05			ENSG00000147036	ENSG00000147036			24767	protein-coding gene	gene with protein product							Standard	NM_198511		Approved	FLJ42925	uc011mkd.2	Q6ZV70	OTTHUMG00000033177	ENST00000378619.3:c.274T>A	chrX.hg19:g.37431397T>A	ENSP00000367882:p.Tyr92Asn	36.0	0.0		36.0	33.0	NM_001170331	A6NHE3	Missense_Mutation	SNP	ENST00000378619.3	hg19	CCDS55398.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.511046	0.64522	.	.	ENSG00000147036	ENST00000378621;ENST00000378619	T;T	0.51817	0.69;0.69	4.62	4.62	0.57501	.	0.000000	0.64402	D	0.000001	T	0.63177	0.2489	M	0.79805	2.47	0.58432	D	0.999999	D;D	0.67145	0.996;0.981	P;P	0.57846	0.828;0.74	T	0.64402	-0.6416	10	0.30078	T	0.28	-13.7322	12.9836	0.58579	0.0:0.0:0.0:1.0	.	92;92	Q6ZV70;Q6ZV70-2	LANC3_HUMAN;.	N	92	ENSP00000367885:Y92N;ENSP00000367882:Y92N	ENSP00000367882:Y92N	Y	+	1	0	LANCL3	37316316	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	6.742000	0.74843	1.513000	0.48852	0.388000	0.25769	TAC	.	.		0.716	LANCL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080885.1	NM_198511	
TSPYL2	64061	hgsc.bcm.edu	37	X	53112112	53112112	+	Silent	SNP	G	G	A	rs376774006		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrX:53112112G>A	ENST00000375442.4	+	1	564	c.432G>A	c.(430-432)ggG>ggA	p.G144G		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	144					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						GTGGAGAGGGGGCCCTAGAAA	0.592																																					p.G144G		Atlas-SNP	.											.	TSPYL2	53	.	0			c.G432A						.			0,3831		0,0,1630,571	26.0	29.0	28.0		432	2.6	0.9	X		28	1,6726		0,1,2427,1871	no	coding-synonymous	TSPYL2	NM_022117.3		0,1,4057,2442	AA,AG,GG,G		0.0149,0.0,0.0095		144/694	53112112	1,10557	2201	4299	6500	SO:0001819	synonymous_variant	64061	exon1			AGAGGGGGCCCTA	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.432G>A	chrX.hg19:g.53112112G>A		145.0	0.0		191.0	11.0	NM_022117	O94799|Q96DG7|Q9BZW6	Silent	SNP	ENST00000375442.4	hg19	CCDS14350.1																																																																																			.	.		0.592	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
LRCH2	57631	hgsc.bcm.edu	37	X	114414316	114414316	+	Splice_Site	SNP	T	T	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrX:114414316T>A	ENST00000317135.8	-	4	652		c.e4-2		LRCH2_ENST00000538422.1_Splice_Site	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2											breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						GCTAATATCCTAAGGAGAACA	0.269																																					.		Atlas-SNP	.											.	LRCH2	138	.	0			c.622-2A>T						.						40.0	32.0	35.0					X																	114414316		1785	4045	5830	SO:0001630	splice_region_variant	57631	exon5			ATATCCTAAGGAG	AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.622-2A>T	chrX.hg19:g.114414316T>A		207.0	0.0		253.0	235.0	NM_001243963	F5H2T1|Q08AD5|Q9HA88|Q9P233	Splice_Site	SNP	ENST00000317135.8	hg19	CCDS48155.1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.388682	0.61956	.	.	ENSG00000130224	ENST00000317135;ENST00000538422	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1402	0.59430	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRCH2	114320572	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.452000	0.80683	1.850000	0.53721	0.437000	0.28790	.	.	.		0.269	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057971.2	NM_020871	Intron
MT-ATP6	4508	hgsc.bcm.edu	37	M	9178	9178	+	Missense_Mutation	SNP	G	G	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chrM:9178G>A	ENST00000361899.2	+	1	652	c.652G>A	c.(652-654)Gta>Ata	p.V218I	MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TK_ENST00000387421.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	218					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						TCACACTTCTAGTAAGCCTCT	0.448																																					p.V218M		Atlas-SNP	.											.	.	.	.	0			c.G652A						.																																			SO:0001583	missense	0	exon1			CTTCTAGTAAGCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.652G>A	chrM.hg19:g.9178G>A	ENSP00000354632:p.Val218Ile	59.0	0.0		63.0	10.0	ENST00000361899	Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	ENST00000361899.2	hg19																																																																																				.	.		0.448	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024031	
CDH19	28513	hgsc.bcm.edu	37	18	64239248	64239248	+	Splice_Site	DEL	T	T	-			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr18:64239248delT	ENST00000540086.1	-	2	440	c.194delA	c.(193-195)cag>cg	p.Q65fs	CDH19_ENST00000262150.2_Splice_Site_p.Q65fs	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	165	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				AATAAGTACCTGGCCGATGTG	0.378																																					p.Q65fs		Atlas-INDEL	.											.	CDH19	141	.	0			c.195delG						.						67.0	64.0	65.0					18																	64239248		2202	4300	6502	SO:0001630	splice_region_variant	28513	exon2			.	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.195+1A>-	chr18.hg19:g.64239248delT		84.0	0.0		80.0	27.0	NM_021153	O15098	Frame_Shift_Del	DEL	ENST00000540086.1	hg19	CCDS59325.1																																																																																			.	.		0.378	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153	Frame_Shift_Del
PGS1	9489	hgsc.bcm.edu	37	17	76374876	76374894	+	Splice_Site	DEL	CGCCAGCGCAGGAGGTGAG	CGCCAGCGCAGGAGGTGAG	-	rs368468919		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	CGCCAGCGCAGGAGGTGAG	CGCCAGCGCAGGAGGTGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr17:76374876_76374894delCGCCAGCGCAGGAGGTGAG	ENST00000262764.6	+	1	156_169	c.130_143delCGCCAGCGCAGGAGGTGAG	c.(130-144)cgccagcgcaggagg>g	p.RQRRR44fs	PGS1_ENST00000329897.7_5'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	44					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GAACCGGGACCGCCAGCGCAGGAGGTGAGAGGGGCGGCC	0.758																																					p.43_48del	Esophageal Squamous(45;182 1126 10685 43198)	Atlas-INDEL	.											.	PGS1	30	.	0			c.129_143del						.																																			SO:0001630	splice_region_variant	9489	exon1			.		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.143+1CGCCAGCGCAGGAGGTGAG>-	chr17.hg19:g.76374876_76374894delCGCCAGCGCAGGAGGTGAG		68.0	0.0		55.0	33.0	NM_024419	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	In_Frame_Del	DEL	ENST00000262764.6	hg19	CCDS42391.1																																																																																			.	.		0.758	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	Frame_Shift_Del
NAIP	4671	hgsc.bcm.edu	37	5	70280580	70280583	+	Frame_Shift_Del	DEL	CCTG	CCTG	-			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	CCTG	CCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr5:70280580_70280583delCCTG	ENST00000517649.1	-	12	2583_2586	c.2293_2296delCAGG	c.(2293-2298)caggaafs	p.QE765fs	NAIP_ENST00000523981.1_Frame_Shift_Del_p.QE603fs|NAIP_ENST00000503719.2_Frame_Shift_Del_p.QE603fs|NAIP_ENST00000194097.4_Frame_Shift_Del_p.QE765fs|NAIP_ENST00000508426.2_Frame_Shift_Del_p.QE765fs	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein	765					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)			central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		TCTTGATGTTCCTGCCTATCTGAA	0.441																																					p.765_766del		Atlas-INDEL	.											.	NAIP	38	.	0			c.2294_2297del						.																																			SO:0001589	frameshift_variant	4671	exon12			.	U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.2293_2296delCAGG	chr5.hg19:g.70280580_70280583delCCTG	ENSP00000428657:p.Gln765fs	189.0	0.0		84.0	17.0	NM_004536	B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Frame_Shift_Del	DEL	ENST00000517649.1	hg19	CCDS4009.1																																																																																			.	.		0.441	NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536	
ARID1A	8289	hgsc.bcm.edu	37	1	27107072	27107075	+	Frame_Shift_Del	DEL	TGGA	TGGA	-	rs573998153		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	TGGA	TGGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:27107072_27107075delTGGA	ENST00000324856.7	+	20	7054_7057	c.6683_6686delTGGA	c.(6682-6687)gtggacfs	p.VD2228fs	ARID1A_ENST00000540690.1_Frame_Shift_Del_p.VD556fs|ARID1A_ENST00000457599.2_Frame_Shift_Del_p.VD2011fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.VD1845fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2228					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CCAACTAGTGTGGACATGATGCGG	0.603			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.2228_2229del		Atlas-INDEL	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.6682_6685del						.																																			SO:0001589	frameshift_variant	8289	exon20			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6683_6686delTGGA	chr1.hg19:g.27107072_27107075delTGGA	ENSP00000320485:p.Val2228fs	92.0	0.0		28.0	18.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.		0.603	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
OR4A47	403253	hgsc.bcm.edu	37	11	48510756	48510757	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr11:48510756_48510757delGT	ENST00000446524.1	+	1	488_489	c.412_413delGT	c.(412-414)gtgfs	p.V138fs		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						GAGACAATGGGTGTGTGTTGTG	0.475																																					p.137_138del		Atlas-INDEL	.											.	OR4A47	72	.	0			c.411_412del						.																																			SO:0001589	frameshift_variant	403253	exon1			.	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.412_413delGT	chr11.hg19:g.48510762_48510763delGT	ENSP00000412752:p.Val138fs	74.0	0.0		88.0	23.0	NM_001005512		Frame_Shift_Del	DEL	ENST00000446524.1	hg19	CCDS31490.1																																																																																			.	.		0.475	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390559.1	NM_001005512	
MAP1S	55201	hgsc.bcm.edu	37	19	17838628	17838629	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr19:17838628_17838629delAC	ENST00000324096.4	+	5	2586_2587	c.2435_2436delAC	c.(2434-2436)gacfs	p.D812fs	MAP1S_ENST00000544059.2_Frame_Shift_Del_p.D786fs|CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000597681.1_3'UTR	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	812	Necessary for association with microtubules.|Necessary for interaction with RASSF1 isoform A and isoform C.|Pro-rich.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						TCAGACGAAGACACAGAGGGCT	0.673																																					p.812_812del		Atlas-INDEL	.											.	MAP1S	74	.	0			c.2434_2435del						.																																			SO:0001589	frameshift_variant	55201	exon5			.	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.2435_2436delAC	chr19.hg19:g.17838630_17838631delAC	ENSP00000325313:p.Asp812fs	119.0	0.0		119.0	34.0	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Frame_Shift_Del	DEL	ENST00000324096.4	hg19	CCDS32954.1																																																																																			.	.		0.673	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
ARID1A	8289	hgsc.bcm.edu	37	1	27107078	27107095	+	In_Frame_Del	DEL	TGATGCGGCGGGCTGCCC	TGATGCGGCGGGCTGCCC	-	rs142878055		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	TGATGCGGCGGGCTGCCC	TGATGCGGCGGGCTGCCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr1:27107078_27107095delTGATGCGGCGGGCTGCCC	ENST00000324856.7	+	20	7060_7077	c.6689_6706delTGATGCGGCGGGCTGCCC	c.(6688-6708)atgatgcggcgggctgcccgc>agc	p.2230_2236MMRRAAR>S	ARID1A_ENST00000540690.1_In_Frame_Del_p.558_564MMRRAAR>S|ARID1A_ENST00000457599.2_In_Frame_Del_p.2013_2019MMRRAAR>S|ARID1A_ENST00000374152.2_In_Frame_Del_p.1847_1853MMRRAAR>S	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2230					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.A2235fs*32(1)|p.M2231fs*32(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGTGTGGACATGATGCGGCGGGCTGCCCGCGCGCTGCT	0.587			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.2230_2235del		Atlas-INDEL	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	2	Deletion - Frameshift(2)	ovary(1)|liver(1)	c.6688_6705del						.																																			SO:0001651	inframe_deletion	8289	exon20			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6689_6706delTGATGCGGCGGGCTGCCC	chr1.hg19:g.27107078_27107095delTGATGCGGCGGGCTGCCC	ENSP00000320485:p.Met2230_Arg2236delinsSer	89.0	0.0		26.0	18.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	In_Frame_Del	DEL	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.		0.587	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
EPG5	57724	hgsc.bcm.edu	37	18	43462411	43462412	+	Frame_Shift_Ins	INS	-	-	A			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr18:43462411_43462412insA	ENST00000282041.5	-	31	5379_5380	c.5345_5346insT	c.(5344-5346)ctgfs	p.L1782fs	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1782					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TACGATCAGACAGAGGAGGTTT	0.391																																					p.L1782fs		Atlas-INDEL	.											.	EPG5	199	.	0			c.5346_5347insT						.																																			SO:0001589	frameshift_variant	57724	exon31			.	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.5346dupT	chr18.hg19:g.43462412_43462412dupA	ENSP00000282041:p.Leu1782fs	192.0	0.0		168.0	49.0	NM_020964	A2BDF3|Q9H8C8	Frame_Shift_Ins	INS	ENST00000282041.5	hg19	CCDS11926.2																																																																																			.	.		0.391	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
TTN	7273	hgsc.bcm.edu	37	2	179399523	179399542	+	Frame_Shift_Del	DEL	ATGTCAAAGTGTCCAATATT	ATGTCAAAGTGTCCAATATT	-	rs184789288|rs56376197|rs76106451	byFrequency	TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	ATGTCAAAGTGTCCAATATT	ATGTCAAAGTGTCCAATATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr2:179399523_179399542delATGTCAAAGTGTCCAATATT	ENST00000591111.1	-	308	97101_97120	c.96877_96896delAATATTGGACACTTTGACAT	c.(96877-96897)aatattggacactttgacattfs	p.NIGHFDI32293fs	TTN_ENST00000460472.2_Frame_Shift_Del_p.NIGHFDI24869fs|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Frame_Shift_Del_p.NIGHFDI25061fs|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Frame_Shift_Del_p.NIGHFDI31366fs|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN_ENST00000589042.1_Frame_Shift_Del_p.NIGHFDI33934fs|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN_ENST00000359218.5_Frame_Shift_Del_p.NIGHFDI24994fs|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000588257.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32293	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTGGTCTAATGTCAAAGTGTCCAATATTATGACTGTGT	0.373																																					p.33934_33940del		Atlas-INDEL	.											.	TTN	18412	.	0			c.101801_101820del						.																																			SO:0001589	frameshift_variant	7273	exon358			.	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96877_96896delAATATTGGACACTTTGACAT	chr2.hg19:g.179399523_179399542delATGTCAAAGTGTCCAATATT	ENSP00000465570:p.Asn32293fs	49.0	0.0		46.0	10.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	hg19																																																																																				.	.		0.373	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CCDC71L	168455	hgsc.bcm.edu	37	7	106301219	106301220	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr7:106301219_106301220delAC	ENST00000523505.1	-	1	222_223	c.123_124delGT	c.(121-126)gtgtacfs	p.Y42fs		NM_175884.4	NP_787080.2	Q8N9Z2	CC71L_HUMAN	coiled-coil domain containing 71-like	42										endometrium(1)	1						GACCGCGAGTACACCACCTTCT	0.718																																					p.42_42del		Atlas-INDEL	.											.	CCDC71L	2	.	0			c.124_125del						.																																			SO:0001589	frameshift_variant	168455	exon1			.		CCDS55151.1	7q22.3	2011-12-12	2011-12-12	2011-12-12	ENSG00000253276	ENSG00000253276			26685	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 74"""	C7orf74		12477932	Standard	NM_175884		Approved	FLJ36031	uc003vdt.3	Q8N9Z2	OTTHUMG00000164150	ENST00000523505.1:c.123_124delGT	chr7.hg19:g.106301221_106301222delAC	ENSP00000430897:p.Tyr42fs	90.0	0.0		111.0	36.0	NM_175884	Q7Z756	Frame_Shift_Del	DEL	ENST00000523505.1	hg19	CCDS55151.1																																																																																			.	.		0.718	CCDC71L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377493.1	NM_175884	
FLRT2	23768	hgsc.bcm.edu	37	14	86089243	86089243	+	Frame_Shift_Del	DEL	T	T	-	rs139260862		TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr14:86089243delT	ENST00000330753.4	+	2	2152	c.1385delT	c.(1384-1386)gtafs	p.V462fs	FLRT2_ENST00000554746.1_Frame_Shift_Del_p.V462fs	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	462	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CACAGTTTAGTAGGGGGCATC	0.488																																					p.V462X		Atlas-INDEL	.											.	FLRT2	168	.	0			c.1384delG						.						105.0	95.0	98.0					14																	86089243		2203	4300	6503	SO:0001589	frameshift_variant	23768	exon2			.	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1385delT	chr14.hg19:g.86089243delT	ENSP00000332879:p.Val462fs	141.0	0.0		127.0	71.0	NM_013231	A0AV84|B7ZLP3	Frame_Shift_Del	DEL	ENST00000330753.4	hg19	CCDS9877.1																																																																																			.	.		0.488	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
PI4K2A	55361	hgsc.bcm.edu	37	10	99433469	99433492	+	In_Frame_Del	DEL	GAGCCGGAAGCCCTTCTTTTCATG	GAGCCGGAAGCCCTTCTTTTCATG	-			TCGA-XR-A8TF-01A-11D-A35Z-10	TCGA-XR-A8TF-10A-01D-A35Z-10	GAGCCGGAAGCCCTTCTTTTCATG	GAGCCGGAAGCCCTTCTTTTCATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ff0de221-788c-40f3-ba51-eb71a52ccfa5	bf67ce8b-0bd6-4d14-9747-17eb2471d622	g.chr10:99433469_99433492delGAGCCGGAAGCCCTTCTTTTCATG	ENST00000370631.3	+	9	1467_1490	c.1410_1433delGAGCCGGAAGCCCTTCTTTTCATG	c.(1408-1434)cagagccggaagcccttcttttcatgg>cag	p.SRKPFFSW471del	PI4K2A_ENST00000370649.3_In_Frame_Del_p.SRKPFFSW441del|PI4K2A_ENST00000555577.1_In_Frame_Del_p.SRKPFFSW441del	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	471					basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		AGAGCTTTCAGAGCCGGAAGCCCTTCTTTTCATGGTGGTAGCTC	0.58																																					p.470_478del		Atlas-INDEL	.											.	PI4K2A	57	.	0			c.1409_1432del						.																																			SO:0001651	inframe_deletion	55361	exon9			.	AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.1410_1433delGAGCCGGAAGCCCTTCTTTTCATG	chr10.hg19:g.99433469_99433492delGAGCCGGAAGCCCTTCTTTTCATG	ENSP00000359665:p.Ser471_Trp478del	66.0	0.0		83.0	16.0	NM_018425	D3DR59|Q9NSG8	In_Frame_Del	DEL	ENST00000370631.3	hg19	CCDS7469.1																																																																																			.	.		0.580	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049735.1	NM_018425	
