#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PRAMEF4	400735	hgsc.bcm.edu	37	1	12942173	12942173	+	Missense_Mutation	SNP	C	C	G	rs201789683		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:12942173C>G	ENST00000235349.5	-	3	447	c.377G>C	c.(376-378)tGc>tCc	p.C126S		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	126					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGAGGAAGCACCCATGGGC	0.493																																					p.C126S		Atlas-SNP	.											PRAMEF4,NS,carcinoma,0,1	PRAMEF4	62	.	0			c.G377C						.						44.0	56.0	52.0					1																	12942173		1381	2629	4010	SO:0001583	missense	400735	exon3			AGGAAGCACCCAT		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.377G>C	chr1.hg19:g.12942173C>G	ENSP00000235349:p.Cys126Ser	25.0	1.0		32.0	3.0	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	hg19	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	c	8.575	0.881031	0.17467	.	.	ENSG00000243073	ENST00000235349	T	0.18016	2.24	1.35	0.315	0.15852	.	1.371720	0.04624	N	0.402516	T	0.19406	0.0466	L	0.53671	1.685	0.09310	N	1	P	0.50272	0.933	P	0.44811	0.461	T	0.23190	-1.0195	10	0.33940	T	0.23	.	5.2546	0.15540	0.0:0.6297:0.3703:0.0	.	126	O60810	PRAM4_HUMAN	S	126	ENSP00000235349:C126S	ENSP00000235349:C126S	C	-	2	0	PRAMEF4	12864760	0.002000	0.14202	0.003000	0.11579	0.008000	0.06430	0.188000	0.17018	0.112000	0.17975	0.194000	0.17425	TGC	.	C|0.500;G|0.500		0.493	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
PLEKHM2	23207	hgsc.bcm.edu	37	1	16055169	16055169	+	Missense_Mutation	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:16055169A>G	ENST00000375799.3	+	12	2154	c.1927A>G	c.(1927-1929)Aca>Gca	p.T643A	PLEKHM2_ENST00000375793.2_Missense_Mutation_p.T623A|RP11-288I21.1_ENST00000453804.1_RNA	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	643					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		CTCAGGGGCCACAGAGAAGCC	0.562																																					p.T643A		Atlas-SNP	.											.	PLEKHM2	94	.	0			c.A1927G						.						39.0	46.0	44.0					1																	16055169		1939	4128	6067	SO:0001583	missense	23207	exon12			GGGGCCACAGAGA	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.1927A>G	chr1.hg19:g.16055169A>G	ENSP00000364956:p.Thr643Ala	130.0	0.0		151.0	36.0	NM_015164	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Missense_Mutation	SNP	ENST00000375799.3	hg19	CCDS44063.1	.	.	.	.	.	.	.	.	.	.	A	7.659	0.684463	0.14973	.	.	ENSG00000116786	ENST00000375799;ENST00000375793	T;T	0.42513	0.98;0.97	5.51	3.15	0.36227	.	0.235147	0.45867	N	0.000327	T	0.14141	0.0342	N	0.02916	-0.46	0.30768	N	0.743383	B	0.02656	0.0	B	0.04013	0.001	T	0.32903	-0.9889	10	0.02654	T	1	-0.9871	6.8392	0.23953	0.6555:0.0:0.3445:0.0	.	643	Q8IWE5	PKHM2_HUMAN	A	643;623	ENSP00000364956:T643A;ENSP00000364950:T623A	ENSP00000364950:T623A	T	+	1	0	PLEKHM2	15927756	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.530000	0.67141	0.376000	0.24707	-0.290000	0.09829	ACA	.	.		0.562	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164	
USP24	23358	hgsc.bcm.edu	37	1	55604390	55604390	+	Splice_Site	SNP	T	T	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:55604390T>A	ENST00000294383.6	-	26	2818	c.2819A>T	c.(2818-2820)gAt>gTt	p.D940V	USP24_ENST00000407756.1_Splice_Site_p.D780V	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	940					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AGAGTAAAAATCCTTAAAAAA	0.338																																					p.D940V		Atlas-SNP	.											.	USP24	323	.	0			c.A2819T						.						57.0	55.0	56.0					1																	55604390		1899	4123	6022	SO:0001630	splice_region_variant	23358	exon26			TAAAAATCCTTAA	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.2818-1A>T	chr1.hg19:g.55604390T>A		79.0	0.0		100.0	31.0	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	hg19	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	T	23.8	4.454380	0.84209	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02446	4.29;4.29	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.11153	0.0272	L	0.53249	1.67	0.80722	D	1	D	0.76494	0.999	D	0.69307	0.963	T	0.18999	-1.0319	10	0.27785	T	0.31	.	16.3197	0.82945	0.0:0.0:0.0:1.0	rs34039649	780	B7WPF4	.	V	940;780	ENSP00000294383:D940V;ENSP00000385700:D780V	ENSP00000294383:D940V	D	-	2	0	USP24	55376978	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.655000	0.83696	2.302000	0.77476	0.533000	0.62120	GAT	.	.		0.338	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		Missense_Mutation
LRRIQ3	127255	hgsc.bcm.edu	37	1	74540431	74540431	+	Missense_Mutation	SNP	C	C	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:74540431C>A	ENST00000395089.1	-	5	910	c.911G>T	c.(910-912)aGa>aTa	p.R304I	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.R304I			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	304										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						CACATGTTTTCTGTGTTCACT	0.264																																					p.R304I		Atlas-SNP	.											.	LRRIQ3	146	.	0			c.G911T						.						50.0	43.0	45.0					1																	74540431		1768	4022	5790	SO:0001583	missense	127255	exon6			TGTTTTCTGTGTT	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.911G>T	chr1.hg19:g.74540431C>A	ENSP00000378524:p.Arg304Ile	321.0	0.0		320.0	75.0	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	hg19	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	C	5.722	0.317619	0.10845	.	.	ENSG00000162620	ENST00000417067;ENST00000395089;ENST00000354431	T;T	0.11821	2.74;2.74	4.62	0.617	0.17619	.	0.413516	0.17863	N	0.159453	T	0.03263	0.0095	L	0.44542	1.39	0.09310	N	1	B	0.15930	0.015	B	0.12837	0.008	T	0.37126	-0.9719	10	0.62326	D	0.03	.	3.1262	0.06408	0.1894:0.5081:0.0:0.3025	.	304	A6PVS8	LRIQ3_HUMAN	I	15;304;304	ENSP00000378524:R304I;ENSP00000346414:R304I	ENSP00000346414:R304I	R	-	2	0	LRRIQ3	74313019	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.942000	0.03921	0.234000	0.21139	-0.899000	0.02877	AGA	.	.		0.264	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
PALMD	54873	hgsc.bcm.edu	37	1	100152711	100152711	+	Silent	SNP	T	T	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:100152711T>C	ENST00000263174.4	+	6	855	c.480T>C	c.(478-480)aaT>aaC	p.N160N	PALMD_ENST00000605497.1_Silent_p.N160N	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	160					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		AGGAGATAAATGAAGAAAAAG	0.328																																					p.N160N		Atlas-SNP	.											.	PALMD	64	.	0			c.T480C						.						76.0	83.0	81.0					1																	100152711		2201	4297	6498	SO:0001819	synonymous_variant	54873	exon6			GATAAATGAAGAA	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.480T>C	chr1.hg19:g.100152711T>C		336.0	0.0		362.0	81.0	NM_017734	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Silent	SNP	ENST00000263174.4	hg19	CCDS758.1																																																																																			.	.		0.328	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734	
TSPAN2	10100	hgsc.bcm.edu	37	1	115615540	115615540	+	Missense_Mutation	SNP	T	T	C	rs570453338		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:115615540T>C	ENST00000369516.2	-	2	189	c.158A>G	c.(157-159)gAg>gGg	p.E53G	TSPAN2_ENST00000369514.2_Missense_Mutation_p.E53G|TSPAN2_ENST00000369515.2_Missense_Mutation_p.E53G	NM_005725.4	NP_005716.2	O60636	TSN2_HUMAN	tetraspanin 2	53					astrocyte development (GO:0014002)|axon development (GO:0061564)|brain development (GO:0007420)|inflammatory response (GO:0006954)|microglia development (GO:0014005)|myelination (GO:0042552)|oligodendrocyte differentiation (GO:0048709)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)				central_nervous_system(1)|large_intestine(4)|lung(3)|pancreas(1)|prostate(1)	10	Lung SC(450;0.211)	all_cancers(81;2.9e-07)|all_epithelial(167;1.42e-06)|all_lung(203;6.72e-06)|Lung NSC(69;1.13e-05)|Acute lymphoblastic leukemia(138;0.191)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|all cancers(265;0.159)|Epithelial(280;0.179)		ATAGAAATACTCTGGGGACTT	0.502													T|||	1	0.000199681	0.0	0.0	5008	,	,		19445	0.0		0.0	False		,,,				2504	0.001				p.E53G		Atlas-SNP	.											.	TSPAN2	37	.	0			c.A158G						.						113.0	104.0	107.0					1																	115615540		2203	4300	6503	SO:0001583	missense	10100	exon2			AAATACTCTGGGG	AF054839	CCDS881.1	1p13.1	2013-02-14			ENSG00000134198	ENSG00000134198		"""Tetraspanins"""	20659	protein-coding gene	gene with protein product		613133				9714763, 11739647	Standard	NM_005725		Approved	TSPAN-2, TSN2, FLJ12082	uc001eft.3	O60636	OTTHUMG00000011878	ENST00000369516.2:c.158A>G	chr1.hg19:g.115615540T>C	ENSP00000358529:p.Glu53Gly	68.0	0.0		76.0	13.0	NM_005725	D6PTH4|Q5TET2|Q8WU05	Missense_Mutation	SNP	ENST00000369516.2	hg19	CCDS881.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.612481	0.66672	.	.	ENSG00000134198	ENST00000369516;ENST00000369515;ENST00000433172;ENST00000369514	T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3	5.35	5.35	0.76521	.	0.871613	0.10262	N	0.695783	T	0.73560	0.3602	L	0.27053	0.805	0.53688	D	0.999977	D	0.63880	0.993	D	0.63192	0.912	T	0.66826	-0.5825	10	0.13108	T	0.6	.	12.8614	0.57915	0.0:0.0:0.0:1.0	.	53	O60636	TSN2_HUMAN	G	53;53;47;53	ENSP00000358529:E53G;ENSP00000358528:E53G;ENSP00000415256:E47G;ENSP00000358527:E53G	ENSP00000358527:E53G	E	-	2	0	TSPAN2	115417063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.529000	0.60588	2.021000	0.59480	0.533000	0.62120	GAG	.	.		0.502	TSPAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032828.1	NM_005725	
PRUNE	58497	hgsc.bcm.edu	37	1	151006653	151006653	+	Missense_Mutation	SNP	G	G	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:151006653G>T	ENST00000271620.3	+	8	1461	c.1305G>T	c.(1303-1305)gaG>gaT	p.E435D	PRUNE_ENST00000368934.1_Missense_Mutation_p.E200D|BNIPL_ENST00000295294.7_5'Flank|PRUNE_ENST00000368936.1_Missense_Mutation_p.E253D|BNIPL_ENST00000368931.3_5'Flank|PRUNE_ENST00000368935.1_Missense_Mutation_p.E150D|PRUNE_ENST00000368937.1_Missense_Mutation_p.E200D|PRUNE_ENST00000271619.8_Missense_Mutation_p.E223D	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	435						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCGTCTTCGAGAAGTGCAGTC	0.582																																					p.E435D		Atlas-SNP	.											.	PRUNE	40	.	0			c.G1305T						.						148.0	130.0	136.0					1																	151006653		2203	4300	6503	SO:0001583	missense	58497	exon8			CTTCGAGAAGTGC	U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.1305G>T	chr1.hg19:g.151006653G>T	ENSP00000271620:p.Glu435Asp	65.0	0.0		83.0	4.0	NM_021222	B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	ENST00000271620.3	hg19	CCDS977.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.157966	0.57368	.	.	ENSG00000143363	ENST00000271620;ENST00000302413;ENST00000271619;ENST00000368937;ENST00000368936;ENST00000368935;ENST00000368934	T;T;T;T;T;T	0.38077	1.38;1.17;1.16;1.29;1.21;1.16	5.58	3.62	0.41486	.	0.063063	0.64402	D	0.000008	T	0.16557	0.0398	N	0.17082	0.46	0.35444	D	0.795098	P;P	0.48089	0.905;0.603	P;B	0.52793	0.709;0.184	T	0.03534	-1.1027	9	.	.	.	.	7.0318	0.24970	0.2854:0.0:0.7145:0.0	.	223;435	E9PCU1;Q86TP1	.;PRUNE_HUMAN	D	435;368;223;200;253;150;200	ENSP00000271620:E435D;ENSP00000271619:E223D;ENSP00000357933:E200D;ENSP00000357932:E253D;ENSP00000357931:E150D;ENSP00000357930:E200D	.	E	+	3	2	PRUNE	149273277	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	1.561000	0.36342	1.513000	0.48852	0.655000	0.94253	GAG	.	.		0.582	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1	NM_021222	
LCE1D	353134	hgsc.bcm.edu	37	1	152770563	152770563	+	Missense_Mutation	SNP	G	G	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:152770563G>T	ENST00000326233.6	+	2	336	c.293G>T	c.(292-294)gGc>gTc	p.G98V		NM_178352.2	NP_848129.1	Q5T752	LCE1D_HUMAN	late cornified envelope 1D	98	Cys-rich.				cellular response to calcium ion (GO:0071277)|cognition (GO:0050890)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(1)	1	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCTCGGGGGGCTCCAGCTGC	0.652																																					p.G98V		Atlas-SNP	.											.	LCE1D	19	.	0			c.G293T						.						39.0	35.0	37.0					1																	152770563		2015	3734	5749	SO:0001583	missense	353134	exon2			CGGGGGGCTCCAG		CCDS1025.1	1q21.3	2008-02-05			ENSG00000172155	ENSG00000172155		"""Late cornified envelopes"""	29465	protein-coding gene	gene with protein product		612606				11698679	Standard	NM_178352		Approved	LEP4	uc009wnp.3	Q5T752	OTTHUMG00000012444	ENST00000326233.6:c.293G>T	chr1.hg19:g.152770563G>T	ENSP00000316737:p.Gly98Val	374.0	0.0		590.0	161.0	NM_178352		Missense_Mutation	SNP	ENST00000326233.6	hg19	CCDS1025.1	.	.	.	.	.	.	.	.	.	.	G	7.299	0.612726	0.14066	.	.	ENSG00000172155	ENST00000326233	T	0.04454	3.62	4.26	4.26	0.50523	.	0.000000	0.36268	N	0.002697	T	0.07683	0.0193	M	0.82823	2.61	0.45704	D	0.998613	P	0.51351	0.944	P	0.47645	0.553	T	0.01537	-1.1330	10	0.87932	D	0	.	12.8829	0.58028	0.0:0.0:1.0:0.0	.	98	Q5T752	LCE1D_HUMAN	V	98	ENSP00000316737:G98V	ENSP00000316737:G98V	G	+	2	0	LCE1D	151037187	1.000000	0.71417	0.995000	0.50966	0.330000	0.28571	1.936000	0.40183	2.307000	0.77673	0.555000	0.69702	GGC	.	.		0.652	LCE1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034657.2	NM_178352	
BCAN	63827	hgsc.bcm.edu	37	1	156618414	156618414	+	Missense_Mutation	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:156618414C>T	ENST00000329117.5	+	6	1160	c.824C>T	c.(823-825)gCg>gTg	p.A275V	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.A275V	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	275	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAAGCACGGGCGTACTGCCAG	0.612																																					p.A275V		Atlas-SNP	.											.	BCAN	174	.	0			c.C824T						.						84.0	80.0	82.0					1																	156618414		2203	4300	6503	SO:0001583	missense	63827	exon6			CACGGGCGTACTG	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.824C>T	chr1.hg19:g.156618414C>T	ENSP00000331210:p.Ala275Val	121.0	0.0		181.0	82.0	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	hg19	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	C	10.42	1.345214	0.24426	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000424639;ENST00000361588	T;T;T	0.32272	2.82;1.46;2.82	4.66	1.52	0.23074	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.671285	0.12836	N	0.435203	T	0.16685	0.0401	M	0.62154	1.92	0.09310	N	1	P;P	0.41345	0.746;0.489	B;B	0.39840	0.311;0.132	T	0.05022	-1.0911	10	0.54805	T	0.06	2.0E-4	12.3362	0.55069	0.5933:0.4067:0.0:0.0	.	275;275	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	V	216;275;173;275	ENSP00000331210:A275V;ENSP00000401709:A173V;ENSP00000354925:A275V	ENSP00000255029:A216V	A	+	2	0	BCAN	154885038	0.000000	0.05858	0.022000	0.16811	0.829000	0.46940	-0.397000	0.07269	0.127000	0.18452	0.561000	0.74099	GCG	.	.		0.612	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
SUSD4	55061	hgsc.bcm.edu	37	1	223396698	223396698	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:223396698G>A	ENST00000343846.3	-	7	1970	c.1337C>T	c.(1336-1338)cCt>cTt	p.P446L	SUSD4_ENST00000484758.2_Missense_Mutation_p.P377L|SUSD4_ENST00000454695.2_Missense_Mutation_p.P286L|SUSD4_ENST00000494793.2_Missense_Mutation_p.P446L|SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000366878.4_Missense_Mutation_p.P446L			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	446						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GCACCTGGGAGGTGAATACAG	0.597																																					p.P446L		Atlas-SNP	.											.	SUSD4	82	.	0			c.C1337T						.						60.0	67.0	65.0					1																	223396698		2065	4204	6269	SO:0001583	missense	55061	exon8			CTGGGAGGTGAAT	AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.1337C>T	chr1.hg19:g.223396698G>A	ENSP00000344219:p.Pro446Leu	45.0	0.0		48.0	10.0	NM_017982	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	ENST00000343846.3	hg19	CCDS41471.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.71|10.71	1.427792|1.427792	0.25726|0.25726	.|.	.|.	ENSG00000143502|ENSG00000143502	ENST00000271787|ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695	.|T;T;T	.|0.30182	.|1.54;1.54;1.63	5.16|5.16	4.25|4.25	0.50352|0.50352	.|.	.|0.424789	.|0.20246	.|N	.|0.096182	T|T	0.28863|0.28863	0.0716|0.0716	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	.|B	.|0.17038	.|0.02	.|B	.|0.16722	.|0.016	T|T	0.07597|0.07597	-1.0764|-1.0764	6|10	0.34782|0.72032	T|D	0.22|0.01	0.173|0.173	13.3163|13.3163	0.60409|0.60409	0.0773:0.0:0.9227:0.0|0.0773:0.0:0.9227:0.0	.|.	.|446	.|Q5VX71	.|SUSD4_HUMAN	F|L	221|446;446;377;286	.|ENSP00000344219:P446L;ENSP00000355843:P446L;ENSP00000399288:P286L	ENSP00000271787:L221F|ENSP00000344219:P446L	L|P	-|-	1|2	0|0	SUSD4|SUSD4	221463321|221463321	1.000000|1.000000	0.71417|0.71417	0.292000|0.292000	0.24919|0.24919	0.067000|0.067000	0.16453|0.16453	5.921000|5.921000	0.70028|0.70028	1.178000|1.178000	0.42870|0.42870	0.655000|0.655000	0.94253|0.94253	CTC|CCT	.	.		0.597	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092592.2	NM_017982	
DNAH14	127602	hgsc.bcm.edu	37	1	225305624	225305624	+	Intron	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:225305624G>A	ENST00000445597.2	+	17	3051				DNAH14_ENST00000430092.1_Silent_p.L1338L|DNAH14_ENST00000439375.2_Silent_p.L1338L			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AACAATTATTGATATGGAAAC	0.348																																					p.L1338L		Atlas-SNP	.											.	DNAH14	300	.	0			c.G4014A						.						151.0	138.0	142.0					1																	225305624		692	1591	2283	SO:0001627	intron_variant	127602	exon25			ATTATTGATATGG	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3052-22846G>A	chr1.hg19:g.225305624G>A		169.0	0.0		202.0	40.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	hg19																																																																																				.	.		0.348	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
RYR2	6262	hgsc.bcm.edu	37	1	237729909	237729909	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:237729909G>A	ENST00000366574.2	+	28	3574	c.3257G>A	c.(3256-3258)cGa>cAa	p.R1086Q	RYR2_ENST00000542537.1_Missense_Mutation_p.R1070Q|RYR2_ENST00000360064.6_Missense_Mutation_p.R1084Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1086	4 X approximate repeats.|B30.2/SPRY 2. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAAGGTTCCGAATCTTCCGT	0.542																																					p.R1086Q		Atlas-SNP	.											.	RYR2	1273	.	0			c.G3257A						.						80.0	80.0	80.0					1																	237729909		1917	4133	6050	SO:0001583	missense	6262	exon28			GGTTCCGAATCTT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.3257G>A	chr1.hg19:g.237729909G>A	ENSP00000355533:p.Arg1086Gln	117.0	0.0		125.0	11.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	G	35	5.518913	0.96416	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97186	-4.28;-4.25;-4.27	5.29	5.29	0.74685	B30.2/SPRY domain (1);	0.000000	0.56097	D	0.000037	D	0.97870	0.9300	M	0.87682	2.9	0.80722	D	1	D	0.67145	0.996	P	0.50570	0.644	D	0.98703	1.0701	10	0.72032	D	0.01	.	18.9442	0.92615	0.0:0.0:1.0:0.0	.	1086	Q92736	RYR2_HUMAN	Q	1086;1084;1070	ENSP00000355533:R1086Q;ENSP00000353174:R1084Q;ENSP00000443798:R1070Q	ENSP00000353174:R1084Q	R	+	2	0	RYR2	235796532	1.000000	0.71417	0.992000	0.48379	0.881000	0.50899	9.807000	0.99171	2.465000	0.83290	0.655000	0.94253	CGA	.	.		0.542	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
OR2G3	81469	hgsc.bcm.edu	37	1	247768926	247768926	+	Silent	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:247768926C>T	ENST00000320002.2	+	1	71	c.39C>T	c.(37-39)atC>atT	p.I13I	RP11-978I15.10_ENST00000446347.1_RNA|RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	13						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TGGATTTCATCCTTCTAGGCT	0.468																																					p.I13I		Atlas-SNP	.											.	OR2G3	108	.	0			c.C39T						.						162.0	166.0	165.0					1																	247768926		2203	4300	6503	SO:0001819	synonymous_variant	81469	exon1			TTTCATCCTTCTA	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.39C>T	chr1.hg19:g.247768926C>T		93.0	0.0		94.0	4.0	NM_001001914	B2RN64|Q5JQT1|Q6IF45	Silent	SNP	ENST00000320002.2	hg19	CCDS31093.1																																																																																			.	.		0.468	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1		
MAP3K19	80122	hgsc.bcm.edu	37	2	135763003	135763003	+	Splice_Site	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr2:135763003A>G	ENST00000375845.3	-	3	266		c.e3+1		MAP3K19_ENST00000392917.3_Splice_Site|MAP3K19_ENST00000358371.4_Splice_Site|MAP3K19_ENST00000375844.3_Splice_Site|MAP3K19_ENST00000315513.3_Splice_Site|MAP3K19_ENST00000392918.3_Splice_Site|MAP3K19_ENST00000392915.1_Splice_Site	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19								ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										AAAGCCCAGTACCTTCTGTCC	0.433																																					.		Atlas-SNP	.											.	.	.	.	0			c.235+2T>C						.						151.0	136.0	141.0					2																	135763003		2203	4300	6503	SO:0001630	splice_region_variant	80122	exon4			CCCAGTACCTTCT	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.235+1T>C	chr2.hg19:g.135763003A>G		63.0	0.0		75.0	4.0	NM_001018046	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Splice_Site	SNP	ENST00000375845.3	hg19	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	A	12.01	1.808973	0.31961	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915;ENST00000425952	.	.	.	5.08	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1577	0.31178	0.8215:0.0:0.0:0.1785	.	.	.	.	.	-1	.	.	.	-	.	.	YSK4	135479473	1.000000	0.71417	0.951000	0.38953	0.448000	0.32197	3.873000	0.56093	1.029000	0.39812	0.379000	0.24179	.	.	.		0.433	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	Intron
DNAH7	56171	hgsc.bcm.edu	37	2	196788420	196788420	+	Silent	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr2:196788420G>A	ENST00000312428.6	-	23	3824	c.3724C>T	c.(3724-3726)Ctg>Ttg	p.L1242L		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1242	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TGGACATCCAGTACCACAAGT	0.403																																					p.L1242L		Atlas-SNP	.											.	DNAH7	512	.	0			c.C3724T						.						124.0	115.0	118.0					2																	196788420		1981	4162	6143	SO:0001819	synonymous_variant	56171	exon23			CATCCAGTACCAC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.3724C>T	chr2.hg19:g.196788420G>A		263.0	0.0		308.0	88.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	hg19	CCDS42794.1																																																																																			.	.		0.403	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
SLC6A11	6538	hgsc.bcm.edu	37	3	10976791	10976791	+	Missense_Mutation	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr3:10976791A>G	ENST00000254488.2	+	13	1718	c.1652A>G	c.(1651-1653)tAt>tGt	p.Y551C		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	551					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	GCCTGGGGCTATGGCATTGGC	0.562																																					p.Y551C		Atlas-SNP	.											.	SLC6A11	87	.	0			c.A1652G						.						194.0	172.0	179.0					3																	10976791		2203	4300	6503	SO:0001583	missense	6538	exon13			GGGGCTATGGCAT	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1652A>G	chr3.hg19:g.10976791A>G	ENSP00000254488:p.Tyr551Cys	137.0	0.0		127.0	24.0	NM_014229	B2R6U6|Q8IYC9	Missense_Mutation	SNP	ENST00000254488.2	hg19	CCDS2602.1	.	.	.	.	.	.	.	.	.	.	A	18.04	3.535097	0.64972	.	.	ENSG00000132164	ENST00000254488	T	0.74842	-0.88	4.19	4.19	0.49359	.	0.000000	0.64402	D	0.000001	D	0.87629	0.6225	M	0.93550	3.43	0.80722	D	1	P	0.49961	0.93	P	0.61275	0.886	D	0.89080	0.3475	10	0.39692	T	0.17	.	13.7375	0.62827	1.0:0.0:0.0:0.0	.	551	P48066	S6A11_HUMAN	C	551	ENSP00000254488:Y551C	ENSP00000254488:Y551C	Y	+	2	0	SLC6A11	10951791	1.000000	0.71417	0.883000	0.34634	0.837000	0.47467	8.941000	0.92964	1.904000	0.55121	0.533000	0.62120	TAT	.	.		0.562	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
SETD2	29072	hgsc.bcm.edu	37	3	47165806	47165806	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr3:47165806G>A	ENST00000409792.3	-	3	362	c.320C>T	c.(319-321)cCt>cTt	p.P107L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	107					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TACCTGAAGAGGTACAGCTGG	0.428			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.P107L		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.C320T						.						212.0	180.0	190.0					3																	47165806		692	1591	2283	SO:0001583	missense	29072	exon3			TGAAGAGGTACAG	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.320C>T	chr3.hg19:g.47165806G>A	ENSP00000386759:p.Pro107Leu	110.0	0.0		107.0	21.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	6.095	0.385853	0.11524	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	D;T	0.90844	-2.74;1.15	5.42	4.53	0.55603	.	.	.	.	.	D	0.82733	0.5101	N	0.19112	0.55	0.38060	D	0.936058	B;B	0.28128	0.201;0.09	B;B	0.22386	0.039;0.024	T	0.82010	-0.0669	9	0.87932	D	0	.	11.1243	0.48308	0.0:0.1392:0.716:0.1447	.	107;107	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	107;107;107;63	ENSP00000386759:P107L;ENSP00000416401:P63L	ENSP00000386759:P107L	P	-	2	0	SETD2	47140810	1.000000	0.71417	0.997000	0.53966	0.095000	0.18619	3.367000	0.52350	1.262000	0.44165	-0.302000	0.09304	CCT	.	.		0.428	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
ARGFX	503582	hgsc.bcm.edu	37	3	121303907	121303907	+	Missense_Mutation	SNP	G	G	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr3:121303907G>C	ENST00000334384.3	+	3	374	c.364G>C	c.(364-366)Gta>Cta	p.V122L		NM_001012659.1	NP_001012677.1	A6NJG6	ARGFX_HUMAN	arginine-fifty homeobox	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15				GBM - Glioblastoma multiforme(114;0.152)		GGAGTCAACAGTAAAGGTCTG	0.507																																					p.V122L		Atlas-SNP	.											ARGFX,NS,carcinoma,0,1	ARGFX	36	.	0			c.G364C						.						79.0	80.0	80.0					3																	121303907		2203	4300	6503	SO:0001583	missense	503582	exon4			TCAACAGTAAAGG		CCDS33834.1	3q13.33	2011-06-20			ENSG00000186103	ENSG00000186103		"""Homeoboxes / PRD class"""	30146	protein-coding gene	gene with protein product		611164					Standard	XM_005247505		Approved		uc003eef.3	A6NJG6	OTTHUMG00000159395	ENST00000334384.3:c.364G>C	chr3.hg19:g.121303907G>C	ENSP00000335578:p.Val122Leu	62.0	0.0		77.0	16.0	NM_001012659		Missense_Mutation	SNP	ENST00000334384.3	hg19	CCDS33834.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430688	0.62844	.	.	ENSG00000186103	ENST00000334384	D	0.98958	-5.27	2.92	0.0615	0.14341	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.411364	0.17853	N	0.159762	D	0.97192	0.9082	L	0.58101	1.795	0.09310	N	1	P	0.46395	0.877	P	0.48488	0.579	D	0.93681	0.6998	10	0.87932	D	0	-0.818	5.3905	0.16242	0.4102:0.0:0.5898:0.0	.	122	A6NJG6	ARGFX_HUMAN	L	122	ENSP00000335578:V122L	ENSP00000335578:V122L	V	+	1	0	ARGFX	122786597	0.636000	0.27207	0.092000	0.20876	0.639000	0.38242	0.227000	0.17795	-0.001000	0.14495	0.555000	0.69702	GTA	.	.		0.507	ARGFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355096.2	NM_001012659	
DNAJC13	23317	hgsc.bcm.edu	37	3	132172975	132172975	+	Silent	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr3:132172975A>G	ENST00000260818.6	+	9	1154	c.906A>G	c.(904-906)caA>caG	p.Q302Q	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	302					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)		p.Q302Q(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TAAAAGGGCAAGTACGGAAAT	0.313																																					p.Q302Q		Atlas-SNP	.											DNAJC13_ENST00000260818,NS,carcinoma,0,1	DNAJC13	253	.	1	Substitution - coding silent(1)	prostate(1)	c.A906G						.						77.0	91.0	86.0					3																	132172975		2201	4285	6486	SO:0001819	synonymous_variant	23317	exon9			AGGGCAAGTACGG	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.906A>G	chr3.hg19:g.132172975A>G		410.0	1.0		391.0	79.0	NM_015268	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	ENST00000260818.6	hg19	CCDS33857.1																																																																																			.	.		0.313	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356807.2	NM_015268	
SLC2A2	6514	hgsc.bcm.edu	37	3	170725003	170725003	+	Silent	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr3:170725003G>A	ENST00000314251.3	-	5	625	c.546C>T	c.(544-546)acC>acT	p.T182T	SLC2A2_ENST00000382808.4_Silent_p.T63T	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	182					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	CCCTGAGAGCGGTTGGAGCAA	0.458																																					p.T182T		Atlas-SNP	.											.	SLC2A2	71	.	0			c.C546T						.						88.0	80.0	83.0					3																	170725003		2203	4300	6503	SO:0001819	synonymous_variant	6514	exon5			GAGAGCGGTTGGA	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.546C>T	chr3.hg19:g.170725003G>A		112.0	0.0		131.0	23.0	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Silent	SNP	ENST00000314251.3	hg19	CCDS3215.1																																																																																			.	.		0.458	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
ECT2	1894	hgsc.bcm.edu	37	3	172473092	172473092	+	Missense_Mutation	SNP	G	G	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr3:172473092G>C	ENST00000392692.3	+	3	314	c.138G>C	c.(136-138)atG>atC	p.M46I	ECT2_ENST00000441497.2_Missense_Mutation_p.M46I|ECT2_ENST00000540509.1_Missense_Mutation_p.M46I|ECT2_ENST00000232458.5_Missense_Mutation_p.M46I|ECT2_ENST00000427830.1_Missense_Mutation_p.M46I|ECT2_ENST00000417960.1_Missense_Mutation_p.M45I	NM_001258315.1	NP_001245244.1	Q9H8V3	ECT2_HUMAN	epithelial cell transforming 2	46					activation of protein kinase activity (GO:0032147)|activation of Rac GTPase activity (GO:0032863)|activation of Rho GTPase activity (GO:0032862)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of Rho GTPase activity (GO:0032321)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|centralspindlin complex (GO:0097149)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|tight junction (GO:0005923)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Ovarian(172;0.00197)|Breast(254;0.158)		Lung(28;1.33e-14)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)			CAGAAGAGATGCCTCAGATTG	0.313																																					p.M46I		Atlas-SNP	.											.	ECT2	79	.	0			c.G138C						.						89.0	93.0	92.0					3																	172473092		2203	4296	6499	SO:0001583	missense	1894	exon3			AGAGATGCCTCAG	AA206473	CCDS3220.1, CCDS58860.1	3q26.1-q26.2	2014-03-11	2014-03-11		ENSG00000114346	ENSG00000114346		"""Rho guanine nucleotide exchange factors"""	3155	protein-coding gene	gene with protein product		600586	"""epithelial cell transforming sequence 2 oncogene"""			8464478, 10579713	Standard	NM_018098		Approved	ARHGEF31	uc003fil.2	Q9H8V3	OTTHUMG00000156762	ENST00000392692.3:c.138G>C	chr3.hg19:g.172473092G>C	ENSP00000376457:p.Met46Ile	369.0	0.0		311.0	76.0	NM_001258315	Q0MT80|Q2M269|Q6U836|Q9NSV8|Q9NVW9	Missense_Mutation	SNP	ENST00000392692.3	hg19	CCDS58860.1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482213	0.44147	.	.	ENSG00000114346	ENST00000232458;ENST00000392692;ENST00000427830;ENST00000417960;ENST00000428567;ENST00000426894;ENST00000366090;ENST00000415665;ENST00000438041;ENST00000441497;ENST00000540509	T;T;T;T;T;T;T;T;T;T;T	0.68903	-0.3;-0.19;-0.36;-0.26;0.8;0.8;0.83;0.81;0.85;-0.3;-0.19	5.58	5.58	0.84498	.	0.045058	0.85682	D	0.000000	T	0.62171	0.2406	L	0.50333	1.59	0.58432	D	0.999991	B;B;B;B	0.23990	0.036;0.095;0.011;0.007	B;B;B;B	0.23574	0.012;0.047;0.013;0.008	T	0.58171	-0.7683	10	0.12430	T	0.62	-19.3201	19.5631	0.95380	0.0:0.0:1.0:0.0	.	46;46;46;45	Q9H8V3;Q9H8V3-3;G5E9L8;Q9H8V3-2	ECT2_HUMAN;.;.;.	I	46;46;46;45;45;46;46;46;46;46;46	ENSP00000232458:M46I;ENSP00000376457:M46I;ENSP00000401910:M46I;ENSP00000415876:M45I;ENSP00000403501:M45I;ENSP00000412331:M46I;ENSP00000403446:M46I;ENSP00000412028:M46I;ENSP00000389108:M46I;ENSP00000412259:M46I;ENSP00000443160:M46I	ENSP00000232458:M46I	M	+	3	0	ECT2	173955786	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.049000	0.71053	2.628000	0.89032	0.491000	0.48974	ATG	.	.		0.313	ECT2-003	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000345994.2	NM_018098	
EVC2	132884	hgsc.bcm.edu	37	4	5691040	5691040	+	Missense_Mutation	SNP	G	G	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr4:5691040G>C	ENST00000344408.5	-	5	603	c.550C>G	c.(550-552)Cgc>Ggc	p.R184G	EVC2_ENST00000310917.2_Missense_Mutation_p.R104G|EVC2_ENST00000344938.1_Missense_Mutation_p.R184G	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	184					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						AGCCATATGCGGGCTGTCTGT	0.542																																					p.R184G		Atlas-SNP	.											.	EVC2	202	.	0			c.C550G						.						88.0	73.0	78.0					4																	5691040		2203	4300	6503	SO:0001583	missense	132884	exon5			ATATGCGGGCTGT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.550C>G	chr4.hg19:g.5691040G>C	ENSP00000342144:p.Arg184Gly	90.0	0.0		56.0	8.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	hg19	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	G	0.873	-0.731442	0.03135	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.74002	-0.8;-0.79;-0.8	4.54	2.65	0.31530	.	0.777031	0.11710	N	0.537047	T	0.49081	0.1536	N	0.08118	0	0.09310	N	1	B	0.18166	0.026	B	0.14023	0.01	T	0.24512	-1.0158	10	0.27082	T	0.32	-0.8185	4.4327	0.11535	0.1144:0.0:0.6611:0.2245	.	184	Q86UK5	LBN_HUMAN	G	184;104;184	ENSP00000339954:R184G;ENSP00000311683:R104G;ENSP00000342144:R184G	ENSP00000311683:R104G	R	-	1	0	EVC2	5741941	0.003000	0.15002	0.004000	0.12327	0.011000	0.07611	1.368000	0.34216	2.250000	0.74265	0.561000	0.74099	CGC	.	.		0.542	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
ZNF827	152485	hgsc.bcm.edu	37	4	146806895	146806895	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr4:146806895G>A	ENST00000508784.1	-	4	1909	c.1682C>T	c.(1681-1683)gCg>gTg	p.A561V	ZNF827_ENST00000379448.4_Missense_Mutation_p.A561V|ZNF827_ENST00000513320.1_Missense_Mutation_p.A211V			Q17R98	ZN827_HUMAN	zinc finger protein 827	561					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					CAATGCTGACGCACTGTTGGC	0.502																																					p.A561V		Atlas-SNP	.											.	ZNF827	102	.	0			c.C1682T						.						100.0	99.0	100.0					4																	146806895		2203	4300	6503	SO:0001583	missense	152485	exon4			GCTGACGCACTGT	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.1682C>T	chr4.hg19:g.146806895G>A	ENSP00000421863:p.Ala561Val	134.0	0.0		128.0	7.0	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	hg19		.	.	.	.	.	.	.	.	.	.	G	22.3	4.269972	0.80469	.	.	ENSG00000151612	ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	T;T;T	0.09911	3.0;2.93;3.04	5.29	5.29	0.74685	.	0.094424	0.64402	D	0.000001	T	0.14270	0.0345	L	0.40543	1.245	0.58432	D	0.999994	D;P;D	0.54772	0.968;0.947;0.968	P;B;P	0.44772	0.46;0.271;0.46	T	0.01305	-1.1390	10	0.44086	T	0.13	-1.7467	18.9492	0.92635	0.0:0.0:1.0:0.0	.	211;561;561	G5E9Z1;Q17R98;Q17R98-2	.;ZN827_HUMAN;.	V	561;211;561;560;211	ENSP00000421863:A561V;ENSP00000423130:A211V;ENSP00000368761:A561V	ENSP00000281318:A560V	A	-	2	0	ZNF827	147026345	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	6.778000	0.75043	2.472000	0.83506	0.555000	0.69702	GCG	.	.		0.502	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
ETFDH	2110	hgsc.bcm.edu	37	4	159627390	159627390	+	Nonsense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr4:159627390G>A	ENST00000511912.1	+	11	1667	c.1335G>A	c.(1333-1335)tgG>tgA	p.W445*	ETFDH_ENST00000307738.5_Nonsense_Mutation_p.W398*	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	445					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		CATGGGTATGGAAAGAGCTAT	0.373																																					p.W445X		Atlas-SNP	.											.	ETFDH	57	.	0			c.G1335A						.						99.0	102.0	101.0					4																	159627390		2203	4300	6503	SO:0001587	stop_gained	2110	exon11			GGTATGGAAAGAG	S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.1335G>A	chr4.hg19:g.159627390G>A	ENSP00000426638:p.Trp445*	88.0	0.0		78.0	29.0	NM_004453	B4E3R9|J3KND9|Q7Z347	Nonsense_Mutation	SNP	ENST00000511912.1	hg19	CCDS3800.1	.	.	.	.	.	.	.	.	.	.	G	37	6.456944	0.97581	.	.	ENSG00000171503	ENST00000511912;ENST00000307738	.	.	.	5.89	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5324	16.9456	0.86229	0.0:0.128:0.872:0.0	.	.	.	.	X	445;398	.	ENSP00000303552:W398X	W	+	3	0	ETFDH	159846840	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.869000	0.99810	1.463000	0.47967	0.591000	0.81541	TGG	.	.		0.373	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365718.2		
SLCO6A1	133482	hgsc.bcm.edu	37	5	101815950	101815950	+	Missense_Mutation	SNP	G	G	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr5:101815950G>C	ENST00000506729.1	-	2	718	c.547C>G	c.(547-549)Ctt>Gtt	p.L183V	SLCO6A1_ENST00000514551.1_Intron|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.L183V|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.L183V|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.L183V|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.L183V			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AGTGATCCAAGTCCTATTAAA	0.318																																					p.L183V		Atlas-SNP	.											.	SLCO6A1	153	.	0			c.C547G						.						101.0	104.0	103.0					5																	101815950		2203	4298	6501	SO:0001583	missense	133482	exon2			ATCCAAGTCCTAT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.547C>G	chr5.hg19:g.101815950G>C	ENSP00000421339:p.Leu183Val	81.0	0.0		83.0	22.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	hg19	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	G	9.816	1.184358	0.21870	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52	4.46	-6.11	0.02131	Major facilitator superfamily domain, general substrate transporter (1);	1.056360	0.07386	N	0.888314	T	0.79482	0.4453	M	0.72118	2.19	0.19575	N	0.999969	P;B;P	0.45531	0.532;0.261;0.86	B;B;P	0.52957	0.376;0.07;0.714	T	0.69064	-0.5244	10	0.30078	T	0.28	.	2.1464	0.03788	0.2352:0.2695:0.3632:0.1321	.	183;183;183	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	V	183	ENSP00000421339:L183V;ENSP00000369135:L183V;ENSP00000373671:L183V;ENSP00000421990:L183V;ENSP00000369138:L183V	ENSP00000369135:L183V	L	-	1	0	SLCO6A1	101843849	0.000000	0.05858	0.062000	0.19696	0.012000	0.07955	-1.737000	0.01843	-1.370000	0.02144	-0.469000	0.05056	CTT	.	.		0.318	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
EEF1A1	1915	hgsc.bcm.edu	37	6	74229620	74229620	+	Missense_Mutation	SNP	T	T	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr6:74229620T>C	ENST00000316292.9	-	1	1121	c.130A>G	c.(130-132)Aag>Gag	p.K44E	EEF1A1_ENST00000331523.2_Missense_Mutation_p.K44E|EEF1A1_ENST00000309268.6_Missense_Mutation_p.K44E|EEF1A1_ENST00000491404.1_5'Flank	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	44	tr-type G.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						GCAGCCTCCTTCTCAAATTTT	0.423																																					p.K44E		Atlas-SNP	.											.	EEF1A1	56	.	0			c.A130G						.						127.0	129.0	128.0					6																	74229620		2203	4300	6503	SO:0001583	missense	1915	exon2			CCTCCTTCTCAAA	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.130A>G	chr6.hg19:g.74229620T>C	ENSP00000339063:p.Lys44Glu	35.0	0.0		33.0	6.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.380554	0.42207	.	.	ENSG00000156508	ENST00000316292;ENST00000358190;ENST00000309268;ENST00000331523;ENST00000391977;ENST00000456206;ENST00000356303;ENST00000455918	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	4.15	4.15	0.48705	Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	U	0.000000	T	0.23965	0.0580	L	0.39326	1.205	0.80722	D	1	B;B;B;B;B	0.14012	0.002;0.009;0.009;0.009;0.009	B;B;B;B;B	0.26416	0.013;0.069;0.069;0.069;0.069	T	0.21999	-1.0229	10	0.87932	D	0	.	13.6597	0.62359	0.0:0.0:0.0:1.0	.	44;44;44;44;44	A6PW80;P68104;Q53HR5;Q6IPS9;Q5VTE0	.;EF1A1_HUMAN;.;.;EF1A3_HUMAN	E	44	ENSP00000339063:K44E;ENSP00000339053:K44E;ENSP00000330054:K44E;ENSP00000348651:K44E;ENSP00000392366:K44E	ENSP00000339053:K44E	K	-	1	0	EEF1A1	74286341	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.669000	0.83911	1.874000	0.54306	0.454000	0.30748	AAG	.	.		0.423	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
COL12A1	1303	hgsc.bcm.edu	37	6	75904617	75904617	+	Silent	SNP	A	A	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr6:75904617A>T	ENST00000322507.8	-	3	429	c.120T>A	c.(118-120)acT>acA	p.T40T	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Silent_p.T40T|COL12A1_ENST00000483888.2_Silent_p.T40T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	40	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACATATGAACAGTATTTTCAT	0.363																																					p.T40T		Atlas-SNP	.											.	COL12A1	385	.	0			c.T120A						.						93.0	89.0	91.0					6																	75904617		1814	4075	5889	SO:0001819	synonymous_variant	1303	exon3			ATGAACAGTATTT	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.120T>A	chr6.hg19:g.75904617A>T		74.0	0.0		92.0	38.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	.		0.363	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
DOPEY1	23033	hgsc.bcm.edu	37	6	83847837	83847837	+	Missense_Mutation	SNP	A	A	G	rs145538359		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr6:83847837A>G	ENST00000349129.2	+	21	4336	c.4076A>G	c.(4075-4077)aAt>aGt	p.N1359S	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Missense_Mutation_p.N1350S|DOPEY1_ENST00000237163.5_Missense_Mutation_p.N1340S	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	1359					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		AAATCTCCCAATTTCAACATT	0.428																																					p.N1359S		Atlas-SNP	.											.	DOPEY1	190	.	0			c.A4076G						.	G	SER/ASN,SER/ASN	1,4405	825.1+/-416.5	0,1,2202	113.0	117.0	115.0		4049,4076	-9.9	0.1	6	dbSNP_134	115	0,8598		0,0,4299	no	missense,missense	DOPEY1	NM_001199942.1,NM_015018.3	46,46	0,1,6501	GG,GA,AA		0.0,0.0227,0.0077	benign,benign	1350/2477,1359/2466	83847837	1,13003	2203	4299	6502	SO:0001583	missense	23033	exon21			CTCCCAATTTCAA	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.4076A>G	chr6.hg19:g.83847837A>G	ENSP00000195654:p.Asn1359Ser	98.0	0.0		122.0	11.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	hg19	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	G	0.546	-0.851409	0.02651	2.27E-4	0.0	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T	0.20881	2.04;2.05	5.96	-9.85	0.00476	.	0.538426	0.23081	N	0.052147	T	0.01870	0.0059	N	0.08118	0	0.32598	N	0.526339	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.32322	-0.9911	10	0.07990	T	0.79	.	14.1367	0.65291	0.4447:0.0:0.4839:0.0714	.	1250;1350;1359	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	S	1359;1340;1340	ENSP00000195654:N1359S;ENSP00000237163:N1340S	ENSP00000237163:N1340S	N	+	2	0	DOPEY1	83904556	0.001000	0.12720	0.050000	0.19076	0.778000	0.44026	-0.214000	0.09292	-2.382000	0.00593	-2.352000	0.00242	AAT	.	A|1.000;G|0.000		0.428	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
FUT9	10690	hgsc.bcm.edu	37	6	96651692	96651692	+	Missense_Mutation	SNP	G	G	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr6:96651692G>C	ENST00000302103.5	+	3	987	c.661G>C	c.(661-663)Gca>Cca	p.A221P		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	221					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		CTACGGGCAAGCATTTGGAGA	0.368																																					p.A221P	Melanoma(98;1369 1476 6592 22940 26587)	Atlas-SNP	.											.	FUT9	79	.	0			c.G661C						.						54.0	53.0	53.0					6																	96651692		2203	4300	6503	SO:0001583	missense	10690	exon3			GGGCAAGCATTTG	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.661G>C	chr6.hg19:g.96651692G>C	ENSP00000302599:p.Ala221Pro	83.0	0.0		86.0	12.0	NM_006581	Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	hg19	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683913	0.68157	.	.	ENSG00000172461	ENST00000302103	T	0.26223	1.75	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.36690	0.0976	M	0.75884	2.315	0.80722	D	1	B	0.33477	0.413	P	0.46479	0.518	T	0.14811	-1.0459	10	0.66056	D	0.02	-12.7125	18.9407	0.92604	0.0:0.0:1.0:0.0	.	221	Q9Y231	FUT9_HUMAN	P	221	ENSP00000302599:A221P	ENSP00000302599:A221P	A	+	1	0	FUT9	96758413	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.719000	0.93026	0.655000	0.94253	GCA	.	.		0.368	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581	
MAN1A1	4121	hgsc.bcm.edu	37	6	119510970	119510970	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr6:119510970G>A	ENST00000368468.3	-	10	1846	c.1405C>T	c.(1405-1407)Cac>Tac	p.H469Y		NM_005907.3	NP_005898.2	P33908	MA1A1_HUMAN	mannosidase, alpha, class 1A, member 1	469					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|mannosidase activity (GO:0015923)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|skin(3)	24		all_epithelial(87;0.173)		OV - Ovarian serous cystadenocarcinoma(136;0.0612)|GBM - Glioblastoma multiforme(226;0.0702)|all cancers(137;0.115)		CCCATCTTGTGCTCCAGGAGG	0.552																																					p.H469Y	Ovarian(136;8 1825 12608 33541 47587)	Atlas-SNP	.											.	MAN1A1	77	.	0			c.C1405T						.						82.0	77.0	79.0					6																	119510970		2203	4300	6503	SO:0001583	missense	4121	exon10			TCTTGTGCTCCAG	AK025599	CCDS5122.1	6q22	2008-08-29			ENSG00000111885	ENSG00000111885	3.2.1.113		6821	protein-coding gene	gene with protein product		604344				8223597	Standard	NM_005907		Approved		uc003pym.2	P33908	OTTHUMG00000015472	ENST00000368468.3:c.1405C>T	chr6.hg19:g.119510970G>A	ENSP00000357453:p.His469Tyr	134.0	0.0		131.0	57.0	NM_005907	E7EU32|Q6P052|Q9NU44|Q9UJI3	Missense_Mutation	SNP	ENST00000368468.3	hg19	CCDS5122.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937048	0.92458	.	.	ENSG00000111885	ENST00000368468	T	0.71461	-0.57	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.76579	0.4007	L	0.56769	1.78	0.80722	D	1	D	0.69078	0.997	P	0.60012	0.867	T	0.76242	-0.3031	10	0.49607	T	0.09	-36.6344	19.4267	0.94743	0.0:0.0:1.0:0.0	.	469	P33908	MA1A1_HUMAN	Y	469	ENSP00000357453:H469Y	ENSP00000357453:H469Y	H	-	1	0	MAN1A1	119552669	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.863000	0.87023	2.596000	0.87737	0.655000	0.94253	CAC	.	.		0.552	MAN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042015.1	NM_005907	
ZNF479	90827	hgsc.bcm.edu	37	7	57188114	57188114	+	Missense_Mutation	SNP	C	C	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr7:57188114C>G	ENST00000331162.4	-	5	1278	c.1008G>C	c.(1006-1008)tgG>tgC	p.W336C		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	336					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			GGTTTGAGGACCAGCTAAAGG	0.453																																					p.W336C		Atlas-SNP	.											.	ZNF479	193	.	0			c.G1008C						.						17.0	18.0	18.0					7																	57188114		2037	4221	6258	SO:0001583	missense	90827	exon5			TGAGGACCAGCTA	AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1008G>C	chr7.hg19:g.57188114C>G	ENSP00000333776:p.Trp336Cys	203.0	0.0		262.0	83.0	NM_033273		Missense_Mutation	SNP	ENST00000331162.4	hg19	CCDS43590.1	.	.	.	.	.	.	.	.	.	.	t	0	-2.749784	0.00086	.	.	ENSG00000185177	ENST00000331162	T	0.07567	3.18	1.01	-2.03	0.07365	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03651	0.0104	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36407	-0.9749	9	0.37606	T	0.19	.	6.028	0.19665	0.0:0.6308:0.2019:0.1673	.	336	Q96JC4	ZN479_HUMAN	C	336	ENSP00000333776:W336C	ENSP00000333776:W336C	W	-	3	0	ZNF479	57192056	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.972000	0.00087	-3.137000	0.00234	-3.214000	0.00053	TGG	.	.		0.453	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345302.1	XM_291202	
ANKRD7	56311	hgsc.bcm.edu	37	7	117876954	117876954	+	Missense_Mutation	SNP	A	A	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr7:117876954A>C	ENST00000265224.4	+	5	841	c.686A>C	c.(685-687)aAt>aCt	p.N229T	ANKRD7_ENST00000357099.4_Missense_Mutation_p.N249T|ANKRD7_ENST00000433239.1_Missense_Mutation_p.N176T|ANKRD7_ENST00000417525.1_Missense_Mutation_p.N176T|ANKRD7_ENST00000477532.1_3'UTR	NM_019644.3	NP_062618.2	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	229					male gonad development (GO:0008584)	nucleus (GO:0005634)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)	29						CAGCTGAGGAATATGTTTATT	0.388																																					p.N229T		Atlas-SNP	.											.	ANKRD7	44	.	0			c.A686C						.						298.0	276.0	283.0					7																	117876954		1900	4120	6020	SO:0001583	missense	56311	exon5			TGAGGAATATGTT	D78334	CCDS43638.1	7q31	2013-01-10			ENSG00000106013	ENSG00000106013		"""Ankyrin repeat domain containing"""	18588	protein-coding gene	gene with protein product	"""testis-specific ankyrin motif containing protein"""	610731				8812458	Standard	NM_019644		Approved	TSA806	uc003vji.3	Q92527	OTTHUMG00000156960	ENST00000265224.4:c.686A>C	chr7.hg19:g.117876954A>C	ENSP00000265224:p.Asn229Thr	132.0	0.0		133.0	17.0	NM_019644	B4DYF5|Q96QN1|Q9UDM3	Missense_Mutation	SNP	ENST00000265224.4	hg19	CCDS43638.1	.	.	.	.	.	.	.	.	.	.	A	8.617	0.890390	0.17613	.	.	ENSG00000106013	ENST00000357099;ENST00000265224;ENST00000417525;ENST00000433239	T;T;T;T	0.39592	1.08;1.18;1.12;1.07	4.35	0.115	0.14643	.	1.317880	0.05170	N	0.499413	T	0.27063	0.0663	L	0.36672	1.1	0.20563	N	0.999889	B	0.26081	0.141	B	0.19666	0.026	T	0.13845	-1.0494	10	0.16420	T	0.52	0.6552	1.696	0.02862	0.4111:0.3301:0.0984:0.1604	.	229	Q92527	ANKR7_HUMAN	T	249;229;176;176	ENSP00000349612:N249T;ENSP00000265224:N229T;ENSP00000395595:N176T;ENSP00000388473:N176T	ENSP00000265224:N229T	N	+	2	0	ANKRD7	117664190	0.994000	0.37717	1.000000	0.80357	0.083000	0.17756	0.068000	0.14531	0.167000	0.19631	0.254000	0.18369	AAT	.	.		0.388	ANKRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346826.1	NM_001077708	
CPED1	79974	hgsc.bcm.edu	37	7	120782177	120782177	+	Silent	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr7:120782177A>G	ENST00000310396.5	+	16	2504	c.2037A>G	c.(2035-2037)acA>acG	p.T679T	CPED1_ENST00000450913.2_Silent_p.T679T|CPED1_ENST00000423795.1_Silent_p.T459T	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	679						endoplasmic reticulum (GO:0005783)											AGGCCTTCACAGCATGTGGTT	0.443																																					p.T679T		Atlas-SNP	.											.	.	.	.	0			c.A2037G						.						183.0	161.0	169.0					7																	120782177		2203	4299	6502	SO:0001819	synonymous_variant	79974	exon15			CTTCACAGCATGT		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2037A>G	chr7.hg19:g.120782177A>G		111.0	0.0		144.0	51.0	NM_001105533	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Silent	SNP	ENST00000310396.5	hg19	CCDS34739.1																																																																																			.	.		0.443	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346959.1	NM_024913	
ADAM2	2515	hgsc.bcm.edu	37	8	39695697	39695697	+	Missense_Mutation	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr8:39695697C>T	ENST00000265708.4	-	1	111	c.8G>A	c.(7-9)cGc>cAc	p.R3H	ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000347580.4_Missense_Mutation_p.R3H|ADAM2_ENST00000521880.1_Missense_Mutation_p.R3H|ADAM2_ENST00000379853.2_Missense_Mutation_p.R3H	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	3				Missing (in Ref. 2; AAD04206). {ECO:0000305}.	adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R3H(1)		haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AAACAAGACGCGCCACATGGC	0.617																																					p.R3H		Atlas-SNP	.											ADAM2,face,carcinoma,0,1	ADAM2	124	.	1	Substitution - Missense(1)	skin(1)	c.G8A						.						74.0	75.0	75.0					8																	39695697		2203	4300	6503	SO:0001583	missense	2515	exon1			AAGACGCGCCACA	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.8G>A	chr8.hg19:g.39695697C>T	ENSP00000265708:p.Arg3His	160.0	0.0		130.0	13.0	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	hg19	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	C	11.64	1.699800	0.30142	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.02177	5.03;4.41;5.27;5.23	3.27	2.39	0.29439	.	.	.	.	.	T	0.01976	0.0062	L	0.39898	1.24	0.09310	N	1	B;P;B;P	0.50819	0.002;0.928;0.032;0.939	B;B;B;B	0.36719	0.001;0.211;0.008;0.231	T	0.50972	-0.8764	8	.	.	.	.	6.4652	0.21977	0.0:0.8654:0.0:0.1346	.	3;3;3;3	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	H	3	ENSP00000343854:R3H;ENSP00000369182:R3H;ENSP00000265708:R3H;ENSP00000429352:R3H	.	R	-	2	0	ADAM2	39814854	0.000000	0.05858	0.002000	0.10522	0.045000	0.14185	0.552000	0.23376	0.942000	0.37525	0.467000	0.42956	CGC	.	.		0.617	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
CYP7A1	1581	hgsc.bcm.edu	37	8	59404951	59404951	+	Silent	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr8:59404951C>T	ENST00000301645.3	-	5	1313	c.1176G>A	c.(1174-1176)caG>caA	p.Q392Q		NM_000780.3	NP_000771.2	P22680	CP7A1_HUMAN	cytochrome P450, family 7, subfamily A, polypeptide 1	392					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cholesterol catabolic process (GO:0006707)|cholesterol homeostasis (GO:0042632)|regulation of bile acid biosynthetic process (GO:0070857)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	cholesterol 7-alpha-monooxygenase activity (GO:0008123)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(1)|urinary_tract(1)	34		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				AGTGCATTAACTGTGGGTAAA	0.438									Neonatal Giant Cell Hepatitis																												p.Q392Q		Atlas-SNP	.											.	CYP7A1	76	.	0			c.G1176A						.						184.0	161.0	169.0					8																	59404951		2203	4300	6503	SO:0001819	synonymous_variant	1581	exon5	Familial Cancer Database	Neonatal Hemochromatosis	CATTAACTGTGGG	M89803	CCDS6171.1	8q11-q12	2010-05-04	2003-01-14		ENSG00000167910	ENSG00000167910	1.14.13.17	"""Cytochrome P450s"""	2651	protein-coding gene	gene with protein product	"""cholesterol 7 alpha-monooxygenase"""	118455	"""cytochrome P450, subfamily VIIA (cholesterol 7 alpha-monooxygenase), polypeptide 1"""	CYP7		1358792	Standard	NM_000780		Approved		uc003xtm.4	P22680	OTTHUMG00000164301	ENST00000301645.3:c.1176G>A	chr8.hg19:g.59404951C>T		186.0	0.0		278.0	26.0	NM_000780	P78454|Q3MIL8|Q7KZ19	Silent	SNP	ENST00000301645.3	hg19	CCDS6171.1																																																																																			.	.		0.438	CYP7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378190.1	NM_000780	
RBM12B	389677	hgsc.bcm.edu	37	8	94747750	94747750	+	Missense_Mutation	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr8:94747750C>T	ENST00000399300.2	-	3	1102	c.889G>A	c.(889-891)Gaa>Aaa	p.E297K	RBM12B_ENST00000517700.1_Missense_Mutation_p.E297K|RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	297	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			AAATCTCTTTCGTCAATACTG	0.338																																					p.E297K		Atlas-SNP	.											.	RBM12B	78	.	0			c.G889A						.						64.0	61.0	62.0					8																	94747750		1806	4071	5877	SO:0001583	missense	389677	exon3			CTCTTTCGTCAAT		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.889G>A	chr8.hg19:g.94747750C>T	ENSP00000382239:p.Glu297Lys	82.0	0.0		126.0	20.0	NM_203390	A8MYB5	Missense_Mutation	SNP	ENST00000399300.2	hg19	CCDS43755.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.501601	0.01001	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	T;T	0.36520	1.25;1.25	5.26	2.9	0.33743	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.078542	0.53938	N	0.000050	T	0.10380	0.0254	N	0.01352	-0.895	0.28387	N	0.919275	B	0.06786	0.001	B	0.04013	0.001	T	0.35748	-0.9776	10	0.02654	T	1	-18.9042	9.0783	0.36536	0.0:0.1534:0.0:0.8466	.	297	Q8IXT5	RB12B_HUMAN	K	297	ENSP00000382239:E297K;ENSP00000427729:E297K	ENSP00000382239:E297K	E	-	1	0	RBM12B	94816926	1.000000	0.71417	0.945000	0.38365	0.460000	0.32559	5.932000	0.70121	0.411000	0.25702	-0.469000	0.05056	GAA	.	.		0.338	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
SLC25A32	81034	hgsc.bcm.edu	37	8	104427710	104427710	+	5'Flank	SNP	T	T	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr8:104427710T>C	ENST00000297578.4	-	0	0				DCAF13_ENST00000521999.1_3'UTR|DCAF13_ENST00000519682.1_Silent_p.N8N|DCAF13_ENST00000297579.5_Silent_p.N164N|DCAF13_ENST00000521716.1_Silent_p.N8N|DCAF13_ENST00000521971.1_Silent_p.N8N|SLC25A32_ENST00000543107.1_5'Flank	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32						folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	ATCCGGACAATTATGTCCGCG	0.567																																					p.N164N		Atlas-SNP	.											.	DCAF13	66	.	0			c.T492C						.						30.0	34.0	32.0					8																	104427710		2203	4300	6503	SO:0001631	upstream_gene_variant	25879	exon1			GGACAATTATGTC	AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790		chr8.hg19:g.104427710T>C	Exception_encountered	116.0	0.0		153.0	15.0	NM_015420	Q96JZ6|Q96SU7	Silent	SNP	ENST00000297578.4	hg19	CCDS6300.1																																																																																			.	.		0.567	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380290.2	NM_030780	
KANK1	23189	hgsc.bcm.edu	37	9	711084	711084	+	Missense_Mutation	SNP	C	C	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr9:711084C>A	ENST00000382303.1	+	7	970	c.318C>A	c.(316-318)ttC>ttA	p.F106L	KANK1_ENST00000382293.3_5'UTR|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Missense_Mutation_p.F106L	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	106					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GCCCCAACTTCCTCATAGCCA	0.507																																					p.F106L		Atlas-SNP	.											.	KANK1	231	.	0			c.C318A						.						150.0	117.0	128.0					9																	711084		2203	4300	6503	SO:0001583	missense	23189	exon7			CAACTTCCTCATA	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.318C>A	chr9.hg19:g.711084C>A	ENSP00000371740:p.Phe106Leu	115.0	0.0		93.0	30.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	hg19	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	C	7.285	0.609960	0.14066	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297	T;T	0.38240	1.15;1.15	5.99	3.19	0.36642	.	0.000000	0.53938	D	0.000057	T	0.25606	0.0623	L	0.38838	1.175	0.80722	D	1	B;B	0.24317	0.101;0.075	B;B	0.29663	0.105;0.042	T	0.03840	-1.0999	10	0.09843	T	0.71	-0.065	9.536	0.39222	0.0:0.7352:0.0:0.2648	.	106;106	Q5W0W1;Q14678	.;KANK1_HUMAN	L	106	ENSP00000371740:F106L;ENSP00000371734:F106L	ENSP00000346479:F106L	F	+	3	2	KANK1	701084	0.997000	0.39634	0.998000	0.56505	0.398000	0.30690	0.839000	0.27586	0.435000	0.26365	0.655000	0.94253	TTC	.	.		0.507	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
VPS13A	23230	hgsc.bcm.edu	37	9	79971726	79971726	+	Silent	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr9:79971726A>G	ENST00000360280.3	+	55	8009	c.7749A>G	c.(7747-7749)gaA>gaG	p.E2583E	VPS13A_ENST00000376636.3_Silent_p.E2544E|VPS13A_ENST00000376634.4_Silent_p.E2583E|VPS13A_ENST00000357409.5_Silent_p.E2583E	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2583					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						AATTTAAGGAATATACTGAAT	0.358																																					p.E2583E		Atlas-SNP	.											.	VPS13A	735	.	0			c.A7749G						.						81.0	83.0	83.0					9																	79971726		2203	4299	6502	SO:0001819	synonymous_variant	23230	exon55			TAAGGAATATACT	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.7749A>G	chr9.hg19:g.79971726A>G		79.0	0.0		75.0	9.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	ENST00000360280.3	hg19	CCDS6655.1																																																																																			.	.		0.358	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
NODAL	4838	hgsc.bcm.edu	37	10	72195099	72195099	+	Silent	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr10:72195099G>A	ENST00000287139.3	-	2	833	c.834C>T	c.(832-834)ggC>ggT	p.G278G	AC022532.1_ENST00000420338.2_Missense_Mutation_p.A16T	NM_018055.4	NP_060525.3	Q96S42	NODAL_HUMAN	nodal growth differentiation factor	278					axial mesodermal cell fate specification (GO:0048327)|brain development (GO:0007420)|cell migration involved in gastrulation (GO:0042074)|digestive tract morphogenesis (GO:0048546)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic pattern specification (GO:0009880)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|endodermal cell differentiation (GO:0035987)|epiblast cell-extraembryonic ectoderm cell signaling involved in anterior/posterior axis specification (GO:0060802)|floor plate morphogenesis (GO:0033505)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|heart looping (GO:0001947)|inhibition of neuroepithelial cell differentiation (GO:0002085)|left lung morphogenesis (GO:0060460)|liver development (GO:0001889)|maternal placenta development (GO:0001893)|maternal process involved in parturition (GO:0060137)|mesendoderm development (GO:0048382)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of chorionic trophoblast cell proliferation (GO:1901383)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of trophoblast cell migration (GO:1901164)|neural fold formation (GO:0001842)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|placenta development (GO:0001890)|polarity specification of proximal/distal axis (GO:0010085)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gastrulation (GO:0010470)|regulation of stem cell maintenance (GO:2000036)|SMAD protein signal transduction (GO:0060395)|stem cell maintenance (GO:0019827)|transforming growth factor beta receptor signaling pathway involved in primitive streak formation (GO:0090010)|trophectodermal cellular morphogenesis (GO:0001831)|vasculature development (GO:0001944)	extracellular space (GO:0005615)	morphogen activity (GO:0016015)|type I activin receptor binding (GO:0070698)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	15						TAGGACACTCGCCCTCACAGC	0.572																																					p.G278G		Atlas-SNP	.											.	NODAL	32	.	0			c.C834T						.						87.0	67.0	74.0					10																	72195099		2203	4300	6503	SO:0001819	synonymous_variant	4838	exon2			ACACTCGCCCTCA	BC033585	CCDS7304.1	10q22.1	2012-12-07	2012-12-07		ENSG00000156574	ENSG00000156574			7865	protein-coding gene	gene with protein product		601265	"""nodal, mouse, homolog"", ""nodal homolog (mouse)"""			9354794	Standard	NM_018055		Approved		uc001jrc.2	Q96S42	OTTHUMG00000018408	ENST00000287139.3:c.834C>T	chr10.hg19:g.72195099G>A		103.0	0.0		92.0	41.0	NM_018055	Q2M3A5|Q8N4V3	Silent	SNP	ENST00000287139.3	hg19	CCDS7304.1	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053779	0.55218	.	.	ENSG00000197604	ENST00000420338	.	.	.	5.88	1.37	0.22104	.	.	.	.	.	T	0.60560	0.2278	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59674	-0.7410	5	0.87932	D	0	.	6.412	0.21696	0.149:0.0:0.4186:0.4324	.	.	.	.	T	16	.	ENSP00000411125:A16T	A	+	1	0	AC022532.1	71865105	0.000000	0.05858	1.000000	0.80357	0.948000	0.59901	-0.860000	0.04272	0.354000	0.24105	0.655000	0.94253	GCC	.	.		0.572	NODAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048511.1	NM_018055	
LHPP	64077	hgsc.bcm.edu	37	10	126150467	126150467	+	Silent	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr10:126150467C>T	ENST00000368842.5	+	1	64	c.36C>T	c.(34-36)cgC>cgT	p.R12R	LHPP_ENST00000368839.1_Silent_p.R12R|LHPP_ENST00000392757.4_Silent_p.R12R	NM_022126.3	NP_071409.3	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic pyrophosphate phosphatase	12					phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|phosphohistidine phosphatase activity (GO:0008969)|protein homodimerization activity (GO:0042803)			large_intestine(2)|lung(2)	4		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		CTGGCGTGCGCGGGGTGCTGC	0.786																																					p.R12R	GBM(165;1980 2715 15999 18454)	Atlas-SNP	.											.	LHPP	18	.	0			c.C36T						.						7.0	6.0	7.0					10																	126150467		1921	3823	5744	SO:0001819	synonymous_variant	64077	exon1			CGTGCGCGGGGTG	AB049629	CCDS7640.1, CCDS53587.1	10q26.2	2010-02-17			ENSG00000107902	ENSG00000107902	3.6.1.1		30042	protein-coding gene	gene with protein product						12801912, 16430861	Standard	NM_022126		Approved	HDHD2B	uc001lhs.2	Q9H008	OTTHUMG00000019214	ENST00000368842.5:c.36C>T	chr10.hg19:g.126150467C>T		55.0	0.0		59.0	34.0	NM_022126	B3KP20|Q2TBE9|Q5VUV9|Q5VUW0	Silent	SNP	ENST00000368842.5	hg19	CCDS7640.1																																																																																			.	.		0.786	LHPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050870.1	NM_022126	
OR5M10	390167	hgsc.bcm.edu	37	11	56344592	56344592	+	Silent	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr11:56344592A>G	ENST00000526812.2	-	1	671	c.606T>C	c.(604-606)gtT>gtC	p.V202V		NM_001004741.1	NP_001004741.1	Q6IEU7	OR5MA_HUMAN	olfactory receptor, family 5, subfamily M, member 10	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(15)|upper_aerodigestive_tract(2)|urinary_tract(2)	25						TAAAGCCTGCAACTACAAACA	0.463																																					p.V202V		Atlas-SNP	.											.	OR5M10	56	.	0			c.T606C						.						83.0	80.0	81.0					11																	56344592		1929	4122	6051	SO:0001819	synonymous_variant	390167	exon1			GCCTGCAACTACA	BK004515	CCDS53630.1	11q11	2012-08-09				ENSG00000254834		"""GPCR / Class A : Olfactory receptors"""	15290	protein-coding gene	gene with protein product							Standard	NM_001004741		Approved		uc001niz.1	Q6IEU7		ENST00000526812.2:c.606T>C	chr11.hg19:g.56344592A>G		322.0	0.0		254.0	36.0	NM_001004741	B9EIL9	Silent	SNP	ENST00000526812.2	hg19	CCDS53630.1																																																																																			.	.		0.463	OR5M10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391609.1	NM_001004741	
AHNAK	79026	hgsc.bcm.edu	37	11	62298786	62298786	+	Missense_Mutation	SNP	C	C	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr11:62298786C>A	ENST00000378024.4	-	5	3377	c.3103G>T	c.(3103-3105)Gat>Tat	p.D1035Y	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1035					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GCATTAGTATCTACTTTTGGT	0.463																																					p.D1035Y		Atlas-SNP	.											.	AHNAK	532	.	0			c.G3103T						.						91.0	89.0	90.0					11																	62298786		2202	4299	6501	SO:0001583	missense	79026	exon5			TAGTATCTACTTT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.3103G>T	chr11.hg19:g.62298786C>A	ENSP00000367263:p.Asp1035Tyr	135.0	0.0		99.0	35.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	12.39	1.923144	0.33908	.	.	ENSG00000124942	ENST00000378024	T	0.03035	4.07	4.63	3.7	0.42460	.	0.182863	0.46442	D	0.000300	T	0.26521	0.0648	H	0.96269	3.795	0.36492	D	0.868466	D	0.89917	1.0	D	0.91635	0.999	T	0.50533	-0.8817	10	0.66056	D	0.02	-13.8139	12.5834	0.56403	0.0:0.9113:0.0:0.0887	.	1035	Q09666	AHNK_HUMAN	Y	1035	ENSP00000367263:D1035Y	ENSP00000367263:D1035Y	D	-	1	0	AHNAK	62055362	0.929000	0.31497	0.995000	0.50966	0.362000	0.29581	1.692000	0.37731	2.285000	0.76669	0.555000	0.69702	GAT	.	.		0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
PPP1CA	5499	hgsc.bcm.edu	37	11	67166283	67166283	+	Silent	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr11:67166283C>T	ENST00000376745.4	-	6	940	c.792G>A	c.(790-792)gtG>gtA	p.V264V	PPP1CA_ENST00000532446.1_5'UTR|PPP1CA_ENST00000358239.4_Silent_p.V220V|PPP1CA_ENST00000312989.7_Silent_p.V275V	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	264					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			AGAAAAGTGTCACCAGCTGCC	0.597																																					p.V275V		Atlas-SNP	.											.	PPP1CA	83	.	0			c.G825A						.						93.0	92.0	93.0					11																	67166283		2200	4295	6495	SO:0001819	synonymous_variant	5499	exon6			AAGTGTCACCAGC		CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.792G>A	chr11.hg19:g.67166283C>T		52.0	0.0		47.0	19.0	NM_001008709	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Silent	SNP	ENST00000376745.4	hg19	CCDS8160.1																																																																																			.	.		0.597	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395487.1	NM_002708	
PITPNM1	9600	hgsc.bcm.edu	37	11	67265462	67265462	+	Missense_Mutation	SNP	G	G	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr11:67265462G>C	ENST00000534749.1	-	11	1896	c.1708C>G	c.(1708-1710)Ctg>Gtg	p.L570V	PITPNM1_ENST00000436757.2_Missense_Mutation_p.L570V|PITPNM1_ENST00000356404.3_Missense_Mutation_p.L570V			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	570					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TCAAAGCCCAGGATGCCACCA	0.642																																					p.L570V	GBM(28;144 709 4607 5525)	Atlas-SNP	.											.	PITPNM1	84	.	0			c.C1708G						.						56.0	51.0	53.0					11																	67265462		2200	4295	6495	SO:0001583	missense	9600	exon12			AGCCCAGGATGCC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.1708C>G	chr11.hg19:g.67265462G>C	ENSP00000437286:p.Leu570Val	44.0	0.0		36.0	10.0	NM_001130848	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	hg19	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	g	16.56	3.157199	0.57259	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.64260	-0.07;-0.09;-0.07	3.98	3.98	0.46160	.	0.000000	0.33938	N	0.004413	T	0.79736	0.4497	M	0.84326	2.69	0.39340	D	0.965565	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	D	0.83408	0.0026	10	0.52906	T	0.07	-25.3043	15.1894	0.73032	0.0:0.0:1.0:0.0	.	570;570	O00562-2;O00562	.;PITM1_HUMAN	V	570	ENSP00000437286:L570V;ENSP00000398787:L570V;ENSP00000348772:L570V	ENSP00000348772:L570V	L	-	1	2	PITPNM1	67022038	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	5.217000	0.65252	2.235000	0.73313	0.556000	0.70494	CTG	.	.		0.642	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
FAT3	120114	hgsc.bcm.edu	37	11	92564913	92564913	+	Missense_Mutation	SNP	A	A	T	rs139337740	byFrequency	TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr11:92564913A>T	ENST00000298047.6	+	13	9624	c.9607A>T	c.(9607-9609)Atc>Ttc	p.I3203F	FAT3_ENST00000409404.2_Missense_Mutation_p.I3203F|FAT3_ENST00000525166.1_Missense_Mutation_p.I3053F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3203	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TTCGTACAACATCAGCGTGCG	0.562										TCGA Ovarian(4;0.039)																											p.I3203F		Atlas-SNP	.											.	FAT3	1822	.	0			c.A9607T						.						69.0	76.0	74.0					11																	92564913		2166	4270	6436	SO:0001583	missense	120114	exon13			TACAACATCAGCG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9607A>T	chr11.hg19:g.92564913A>T	ENSP00000298047:p.Ile3203Phe	66.0	0.0		61.0	12.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	A	14.56	2.571711	0.45798	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.61859	0.07;0.07;0.07	5.19	4.04	0.47022	.	.	.	.	.	T	0.35248	0.0925	N	0.10972	0.075	0.80722	D	1	P	0.34639	0.461	B	0.32805	0.153	T	0.27157	-1.0082	9	0.87932	D	0	.	7.7134	0.28690	0.7862:0.1413:0.0726:0.0	.	3203	Q8TDW7-3	.	F	3203;3203;3053	ENSP00000298047:I3203F;ENSP00000387040:I3203F;ENSP00000432586:I3053F	ENSP00000298047:I3203F	I	+	1	0	FAT3	92204561	1.000000	0.71417	0.998000	0.56505	0.762000	0.43233	1.833000	0.39161	0.894000	0.36317	0.533000	0.62120	ATC	.	A|0.999;G|0.001		0.562	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
OR6X1	390260	hgsc.bcm.edu	37	11	123625085	123625085	+	Missense_Mutation	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr11:123625085A>G	ENST00000327930.2	-	1	168	c.142T>C	c.(142-144)Tgg>Cgg	p.W48R		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GGCTCAGCCCACACAGTGGCA	0.438																																					p.W48R		Atlas-SNP	.											.	OR6X1	54	.	0			c.T142C						.						94.0	91.0	92.0					11																	123625085		2202	4299	6501	SO:0001583	missense	390260	exon1			CAGCCCACACAGT	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.142T>C	chr11.hg19:g.123625085A>G	ENSP00000333724:p.Trp48Arg	119.0	0.0		129.0	38.0	NM_001005188	B9EGW9|Q6IFA0	Missense_Mutation	SNP	ENST00000327930.2	hg19	CCDS31695.1	.	.	.	.	.	.	.	.	.	.	A	12.12	1.841155	0.32513	.	.	ENSG00000221931	ENST00000327930	T	0.03801	3.8	4.08	2.95	0.34219	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02610	0.0079	N	0.05124	-0.11	0.28141	N	0.92981	B	0.26081	0.141	B	0.20767	0.031	T	0.41305	-0.9516	9	0.41790	T	0.15	-3.6195	7.5173	0.27608	0.8938:0.0:0.1062:0.0	.	48	Q8NH79	OR6X1_HUMAN	R	48	ENSP00000333724:W48R	ENSP00000333724:W48R	W	-	1	0	OR6X1	123130295	0.000000	0.05858	0.887000	0.34795	0.844000	0.47949	-0.004000	0.12878	0.628000	0.30357	0.528000	0.53228	TGG	.	.		0.438	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387436.1	NM_001005188	
DCP1B	196513	hgsc.bcm.edu	37	12	2062188	2062188	+	Silent	SNP	T	T	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr12:2062188T>C	ENST00000280665.6	-	7	997	c.918A>G	c.(916-918)ccA>ccG	p.P306P	DCP1B_ENST00000397173.4_Silent_p.P204P|DCP1B_ENST00000540622.1_Silent_p.P180P|DCP1B_ENST00000541700.1_5'UTR	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	306					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			GCTCTGACAATGGGTGGAGGT	0.537																																					p.P306P		Atlas-SNP	.											.	DCP1B	63	.	0			c.A918G						.						83.0	89.0	87.0					12																	2062188		2203	4300	6503	SO:0001819	synonymous_variant	196513	exon7			TGACAATGGGTGG	AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.918A>G	chr12.hg19:g.2062188T>C		55.0	0.0		48.0	12.0	NM_152640	B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Silent	SNP	ENST00000280665.6	hg19	CCDS31727.1																																																																																			.	.		0.537	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398244.1	NM_152640	
OTOGL	283310	hgsc.bcm.edu	37	12	80752454	80752454	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr12:80752454G>A	ENST00000547103.1	+	50	6068	c.6062G>A	c.(6061-6063)tGt>tAt	p.C2021Y	OTOGL_ENST00000458043.2_Missense_Mutation_p.C2033Y|OTOGL_ENST00000546620.1_Missense_Mutation_p.C52Y			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2021	Cys-rich.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTTTTAGTATGTGAACCAAAC	0.353																																					p.C2033Y		Atlas-SNP	.											.	OTOGL	235	.	0			c.G6098A						.						95.0	94.0	95.0					12																	80752454		2203	4300	6503	SO:0001583	missense	283310	exon50			TAGTATGTGAACC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6062G>A	chr12.hg19:g.80752454G>A	ENSP00000447211:p.Cys2021Tyr	42.0	0.0		48.0	13.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.13|17.13	3.309777|3.309777	0.60414|0.60414	.|.	.|.	ENSG00000165899|ENSG00000165899	ENST00000547103;ENST00000458043;ENST00000546620;ENST00000550182|ENST00000298820	T;T;T;T|.	0.31247|.	1.5;1.5;1.5;1.5|.	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82664|0.82664	0.5086|0.5086	M|M	0.84846|0.84846	2.72|2.72	0.44611|0.44611	D|D	0.997583|0.997583	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	D|D	0.84493|0.84493	0.0612|0.0612	10|5	0.62326|.	D|.	0.03|.	.|.	18.8344|18.8344	0.92155|0.92155	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	398|.	Q3ZCN5|.	OTOGL_HUMAN|.	Y|M	2021;2033;52;50|476	ENSP00000447211:C2021Y;ENSP00000400895:C2033Y;ENSP00000449094:C52Y;ENSP00000449641:C50Y|.	ENSP00000400895:C2033Y|.	C|V	+|+	2|1	0|0	OTOGL|OTOGL	79276585|79276585	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.524000|0.524000	0.34500|0.34500	8.327000|8.327000	0.90012|0.90012	2.526000|2.526000	0.85167|0.85167	0.591000|0.591000	0.81541|0.81541	TGT|GTG	.	.		0.353	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
FGD6	55785	hgsc.bcm.edu	37	12	95500747	95500747	+	Missense_Mutation	SNP	A	A	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr12:95500747A>C	ENST00000343958.4	-	13	3623	c.3400T>G	c.(3400-3402)Tca>Gca	p.S1134A	FGD6_ENST00000549499.1_Missense_Mutation_p.S1134A|FGD6_ENST00000546711.1_Missense_Mutation_p.S1134A	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1134	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						CCAGCCAGTGAGAGCATGTTG	0.388																																					p.S1134A		Atlas-SNP	.											.	FGD6	127	.	0			c.T3400G						.						190.0	176.0	181.0					12																	95500747		2203	4300	6503	SO:0001583	missense	55785	exon13			CCAGTGAGAGCAT	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.3400T>G	chr12.hg19:g.95500747A>C	ENSP00000344446:p.Ser1134Ala	183.0	0.0		173.0	24.0	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	hg19	CCDS31878.1	.	.	.	.	.	.	.	.	.	.	A	8.501	0.864219	0.17250	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000551521;ENST00000549499	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	6.02	6.02	0.97574	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.38326	N	0.001739	T	0.79896	0.4525	N	0.20574	0.59	0.58432	D	0.999996	P;D	0.71674	0.537;0.998	B;D	0.71870	0.316;0.975	T	0.79242	-0.1884	10	0.32370	T	0.25	-16.3161	16.5494	0.84464	1.0:0.0:0.0:0.0	.	1134;1134	Q6ZV73-2;Q6ZV73	.;FGD6_HUMAN	A	1134;1134;130;1134	ENSP00000344446:S1134A;ENSP00000450342:S1134A;ENSP00000450240:S130A;ENSP00000449005:S1134A	ENSP00000344446:S1134A	S	-	1	0	FGD6	94024878	1.000000	0.71417	0.802000	0.32245	0.848000	0.48234	7.133000	0.77259	2.299000	0.77371	0.528000	0.53228	TCA	.	.		0.388	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
CCDC60	160777	hgsc.bcm.edu	37	12	119909929	119909929	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr12:119909929G>A	ENST00000327554.2	+	3	766	c.301G>A	c.(301-303)Gaa>Aaa	p.E101K	CCDC60_ENST00000546345.1_3'UTR|RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	101								p.E101K(2)		endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CCAGCCAGCCGAAAAGATCTC	0.423																																					p.E101K		Atlas-SNP	.											CCDC60,NS,malignant_melanoma,0,4	CCDC60	84	.	2	Substitution - Missense(2)	lung(1)|skin(1)	c.G301A						.						160.0	166.0	164.0					12																	119909929		2203	4300	6503	SO:0001583	missense	160777	exon3			CCAGCCGAAAAGA	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.301G>A	chr12.hg19:g.119909929G>A	ENSP00000333374:p.Glu101Lys	119.0	0.0		138.0	17.0	NM_178499		Missense_Mutation	SNP	ENST00000327554.2	hg19	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	G	1.545	-0.540681	0.04053	.	.	ENSG00000183273	ENST00000327554	T	0.21361	2.01	5.22	2.8	0.32819	.	0.477213	0.19451	N	0.113928	T	0.06325	0.0163	N	0.01705	-0.755	0.33283	D	0.562555	B	0.09022	0.002	B	0.04013	0.001	T	0.26780	-1.0093	9	.	.	.	-6.4841	4.9568	0.14046	0.715:0.1871:0.0978:0.0	.	101	Q8IWA6	CCD60_HUMAN	K	101	ENSP00000333374:E101K	.	E	+	1	0	CCDC60	118394312	0.704000	0.27836	0.569000	0.28460	0.315000	0.28087	1.025000	0.30090	0.289000	0.22422	-0.481000	0.04817	GAA	.	.		0.423	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
HCAR3	8843	hgsc.bcm.edu	37	12	123201235	123201235	+	Missense_Mutation	SNP	T	T	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr12:123201235T>A	ENST00000528880.2	-	1	204	c.50A>T	c.(49-51)aAc>aTc	p.N17I	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	17					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	CACACAGCAGTTCTTCTTGTC	0.542																																					p.N17I		Atlas-SNP	.											.	HCAR3	49	.	0			c.A50T						.						88.0	81.0	83.0					12																	123201235		2203	4300	6503	SO:0001583	missense	8843	exon1			CAGCAGTTCTTCT	D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.50A>T	chr12.hg19:g.123201235T>A	ENSP00000436714:p.Asn17Ile	91.0	0.0		93.0	8.0	NM_006018	A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	ENST00000528880.2	hg19	CCDS53842.1	.	.	.	.	.	.	.	.	.	.	T	9.314	1.056359	0.19907	.	.	ENSG00000255398	ENST00000528880	T	0.63580	-0.05	3.27	0.255	0.15561	.	.	.	.	.	T	0.48732	0.1516	L	0.46157	1.445	0.23533	N	0.997476	P	0.36683	0.565	B	0.35550	0.205	T	0.41305	-0.9516	9	0.52906	T	0.07	.	4.0878	0.09955	0.0:0.1302:0.4373:0.4325	.	17	E9PI97	.	I	17	ENSP00000436714:N17I	ENSP00000436714:N17I	N	-	2	0	HCAR3	121767188	1.000000	0.71417	0.174000	0.22961	0.513000	0.34164	0.374000	0.20501	0.238000	0.21222	0.155000	0.16302	AAC	.	.		0.542	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387549.2	NM_006018	
PARP4	143	hgsc.bcm.edu	37	13	25021314	25021314	+	Missense_Mutation	SNP	T	T	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr13:25021314T>C	ENST00000381989.3	-	26	3230	c.3125A>G	c.(3124-3126)cAa>cGa	p.Q1042R		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1042	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CCTGGTCATTTGGTCTTCTAT	0.428																																					p.Q1042R		Atlas-SNP	.											.	PARP4	142	.	0			c.A3125G						.						49.0	49.0	49.0					13																	25021314		2203	4300	6503	SO:0001583	missense	143	exon26			GTCATTTGGTCTT	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3125A>G	chr13.hg19:g.25021314T>C	ENSP00000371419:p.Gln1042Arg	188.0	0.0		133.0	38.0	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	hg19	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459965	0.63401	.	.	ENSG00000102699	ENST00000381989	T	0.21543	2.0	4.71	4.71	0.59529	von Willebrand factor, type A (2);	0.057132	0.64402	D	0.000001	T	0.48241	0.1489	M	0.85542	2.76	0.45822	D	0.998692	D	0.65815	0.995	D	0.69307	0.963	T	0.54728	-0.8250	10	0.66056	D	0.02	-18.7938	12.4962	0.55929	0.0:0.0:0.0:1.0	.	1042	Q9UKK3	PARP4_HUMAN	R	1042	ENSP00000371419:Q1042R	ENSP00000371419:Q1042R	Q	-	2	0	PARP4	23919314	1.000000	0.71417	0.877000	0.34402	0.713000	0.41058	5.285000	0.65633	2.113000	0.64589	0.524000	0.50904	CAA	.	.		0.428	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
FRY	10129	hgsc.bcm.edu	37	13	32759191	32759191	+	Silent	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr13:32759191C>T	ENST00000380250.3	+	26	3721	c.3225C>T	c.(3223-3225)ctC>ctT	p.L1075L		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1075						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CCCGCATGCTCCTAGAAGCTG	0.438																																					p.L1075L		Atlas-SNP	.											.	FRY	312	.	0			c.C3225T						.						129.0	125.0	126.0					13																	32759191		1861	4090	5951	SO:0001819	synonymous_variant	10129	exon26			CATGCTCCTAGAA	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.3225C>T	chr13.hg19:g.32759191C>T		144.0	0.0		97.0	29.0	NM_023037	Q9Y3N6	Silent	SNP	ENST00000380250.3	hg19	CCDS41875.1																																																																																			.	.		0.438	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
GRK1	6011	hgsc.bcm.edu	37	13	114324085	114324085	+	Silent	SNP	C	C	A	rs370686602		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr13:114324085C>A	ENST00000335678.6	+	2	1015	c.783C>A	c.(781-783)gcC>gcA	p.A261A		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			AAACCAAAGCCGACCTCTGTC	0.552																																					p.A261A		Atlas-SNP	.											.	GRK1	41	.	0			c.C783A						.						150.0	153.0	152.0					13																	114324085		2042	4193	6235	SO:0001819	synonymous_variant	6011	exon2			CAAAGCCGACCTC			13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.783C>A	chr13.hg19:g.114324085C>A		49.0	0.0		64.0	15.0	NM_002929	Q53X14	Silent	SNP	ENST00000335678.6	hg19																																																																																				.	.		0.552	GRK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470655.1	NM_002929	
IPO4	79711	hgsc.bcm.edu	37	14	24649686	24649686	+	Missense_Mutation	SNP	T	T	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr14:24649686T>G	ENST00000354464.6	-	30	3384	c.3208A>C	c.(3208-3210)Aag>Cag	p.K1070Q	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	1070					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		TCCTGAGCCTTGTCAACAGGC	0.597																																					p.K1070Q		Atlas-SNP	.											.	IPO4	74	.	0			c.A3208C						.						44.0	47.0	46.0					14																	24649686		2040	4183	6223	SO:0001583	missense	79711	exon30			GAGCCTTGTCAAC	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.3208A>C	chr14.hg19:g.24649686T>G	ENSP00000346453:p.Lys1070Gln	51.0	0.0		58.0	12.0	NM_024658	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	hg19	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	T	11.05	1.524698	0.27299	.	.	ENSG00000196497	ENST00000354464;ENST00000399536	T	0.08984	3.03	5.84	5.84	0.93424	Armadillo-like helical (1);	0.187146	0.47093	D	0.000257	T	0.05410	0.0143	N	0.16368	0.405	0.35392	D	0.790833	B;B	0.13145	0.004;0.007	B;B	0.11329	0.003;0.006	T	0.27365	-1.0076	10	0.08381	T	0.77	-31.4907	12.5963	0.56472	0.0:0.0:0.0:1.0	.	1070;1072	Q8TEX9;Q8TEX9-2	IPO4_HUMAN;.	Q	1070;746	ENSP00000346453:K1070Q	ENSP00000346453:K1070Q	K	-	1	0	IPO4	23719526	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.120000	0.41968	2.234000	0.73211	0.459000	0.35465	AAG	.	.		0.597	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
NKX2-1	7080	hgsc.bcm.edu	37	14	36988348	36988348	+	Missense_Mutation	SNP	G	G	T	rs546402304		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr14:36988348G>T	ENST00000518149.1	-	2	820	c.215C>A	c.(214-216)gCg>gAg	p.A72E	NKX2-1_ENST00000498187.2_Missense_Mutation_p.A72E|NKX2-1_ENST00000522719.2_Missense_Mutation_p.A72E|NKX2-1-AS1_ENST00000521292.2_RNA|RP11-896J10.3_ENST00000521945.1_RNA|NKX2-1_ENST00000354822.5_Missense_Mutation_p.A102E			P43699	NKX21_HUMAN	NK2 homeobox 1	72					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		CACCCCCGCCGCCGTCATGTG	0.726			A		NSCLC																																p.A102E		Atlas-SNP	.		Dom	yes		14	14q13	7080	NK2 homeobox 1		E	.	NKX2-1	21	.	0			c.C305A						.						8.0	10.0	9.0					14																	36988348		1801	3920	5721	SO:0001583	missense	7080	exon2			CCCGCCGCCGTCA		CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000518149.1:c.215C>A	chr14.hg19:g.36988348G>T	ENSP00000428341:p.Ala72Glu	46.0	0.0		55.0	15.0	NM_001079668	D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	Missense_Mutation	SNP	ENST00000518149.1	hg19	CCDS9659.1	.	.	.	.	.	.	.	.	.	.	G	19.85	3.903642	0.72754	.	.	ENSG00000136352	ENST00000354822;ENST00000498187;ENST00000518149;ENST00000522719	T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59	4.59	4.59	0.56863	.	0.058788	0.64402	D	0.000002	T	0.80984	0.4729	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.992	T	0.76383	-0.2979	10	0.10902	T	0.67	.	17.5585	0.87900	0.0:0.0:1.0:0.0	.	102;72	P43699-3;P43699	.;NKX21_HUMAN	E	102;72;72;72	ENSP00000346879:A102E;ENSP00000429607:A72E;ENSP00000428341:A72E;ENSP00000429519:A72E	ENSP00000346879:A102E	A	-	2	0	NKX2-1	36058099	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.946000	0.92992	2.381000	0.81170	0.462000	0.41574	GCG	.	.		0.726	NKX2-1-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376225.2	NM_003317	
PSEN1	5663	hgsc.bcm.edu	37	14	73637640	73637640	+	Silent	SNP	T	T	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr14:73637640T>C	ENST00000324501.5	+	4	495	c.223T>C	c.(223-225)Ttg>Ctg	p.L75L	PSEN1_ENST00000557511.1_Silent_p.L75L|PSEN1_ENST00000344094.3_Silent_p.L75L|PSEN1_ENST00000357710.4_Silent_p.L71L|PSEN1_ENST00000406768.1_5'UTR|PSEN1_ENST00000394157.3_Silent_p.L75L|PSEN1_ENST00000261970.3_Silent_p.L75L|PSEN1_ENST00000394164.1_Silent_p.L71L	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	75					activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		GGAGCTGACATTGAAATATGG	0.527																																					p.L75L		Atlas-SNP	.											.	PSEN1	38	.	0			c.T223C						.						156.0	132.0	140.0					14																	73637640		2203	4300	6503	SO:0001819	synonymous_variant	5663	exon4			CTGACATTGAAAT	AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.223T>C	chr14.hg19:g.73637640T>C		138.0	0.0		173.0	59.0	NM_000021	B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Silent	SNP	ENST00000324501.5	hg19	CCDS9812.1																																																																																			.	.		0.527	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280500.2		
GPR65	8477	hgsc.bcm.edu	37	14	88477913	88477913	+	Missense_Mutation	SNP	C	C	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr14:88477913C>A	ENST00000267549.3	+	2	1280	c.722C>A	c.(721-723)cCc>cAc	p.P241H	RP11-300J18.2_ENST00000554433.1_RNA	NM_003608.3	NP_003599.2	Q8IYL9	PSYR_HUMAN	G protein-coupled receptor 65	241					actin cytoskeleton reorganization (GO:0031532)|activation of Rho GTPase activity (GO:0032862)|apoptotic process (GO:0006915)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of stress fiber assembly (GO:0051496)|response to acidic pH (GO:0010447)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)	16						TGCTTTACTCCCTTTCATGTG	0.408																																					p.P241H		Atlas-SNP	.											.	GPR65	48	.	0			c.C722A						.						82.0	78.0	79.0					14																	88477913		2203	4300	6503	SO:0001583	missense	8477	exon2			TTACTCCCTTTCA	U95218	CCDS9879.1	14q31-q32.1	2012-08-21			ENSG00000140030	ENSG00000140030		"""GPCR / Class A : Orphans"""	4517	protein-coding gene	gene with protein product		604620				9655242	Standard	NM_003608		Approved	hTDAG8, TDAG8	uc001xvv.3	Q8IYL9	OTTHUMG00000028648	ENST00000267549.3:c.722C>A	chr14.hg19:g.88477913C>A	ENSP00000267549:p.Pro241His	120.0	0.0		160.0	42.0	NM_003608	O75819	Missense_Mutation	SNP	ENST00000267549.3	hg19	CCDS9879.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638001	0.87760	.	.	ENSG00000140030	ENST00000267549	T	0.80393	-1.37	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000032	D	0.93294	0.7863	H	0.94183	3.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93870	0.7161	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	241	Q8IYL9	PSYR_HUMAN	H	241	ENSP00000267549:P241H	ENSP00000267549:P241H	P	+	2	0	GPR65	87547666	1.000000	0.71417	0.996000	0.52242	0.899000	0.52679	7.587000	0.82613	2.937000	0.99478	0.650000	0.86243	CCC	.	.		0.408	GPR65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071564.4		
GABRA5	2558	hgsc.bcm.edu	37	15	27159962	27159962	+	Silent	SNP	T	T	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr15:27159962T>G	ENST00000335625.5	+	7	1398	c.510T>G	c.(508-510)tcT>tcG	p.S170S	GABRA5_ENST00000355395.5_Silent_p.S170S|GABRB3_ENST00000541819.2_Intron|GABRA5_ENST00000400081.3_Silent_p.S170S|GABRA5_ENST00000557449.1_3'UTR	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	170					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	TGACCATCTCTGCAGAGTGCC	0.473																																					p.S170S		Atlas-SNP	.											.	GABRA5	127	.	0			c.T510G						.						77.0	77.0	77.0					15																	27159962		1966	4168	6134	SO:0001819	synonymous_variant	2558	exon7			CATCTCTGCAGAG		CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.510T>G	chr15.hg19:g.27159962T>G		67.0	0.0		49.0	21.0	NM_001165037	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Silent	SNP	ENST00000335625.5	hg19	CCDS45194.1																																																																																			.	.		0.473	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415234.1		
PATL2	197135	hgsc.bcm.edu	37	15	44961589	44961589	+	Missense_Mutation	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr15:44961589A>G	ENST00000560775.1	-	10	1012	c.953T>C	c.(952-954)aTa>aCa	p.I318T	PATL2_ENST00000560780.1_Missense_Mutation_p.I129T|PATL2_ENST00000434130.1_Missense_Mutation_p.I318T			C9JE40	PATL2_HUMAN	protein associated with topoisomerase II homolog 2 (yeast)	318					negative regulation of cytoplasmic mRNA processing body assembly (GO:0010607)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	RNA binding (GO:0003723)			kidney(2)|stomach(1)	3						GCCTTCCTCTATTTCTAGTAA	0.463																																					p.I318T		Atlas-SNP	.											.	PATL2	19	.	0			c.T953C						.						54.0	50.0	51.0					15																	44961589		687	1589	2276	SO:0001583	missense	197135	exon11			TCCTCTATTTCTA	BC036924	CCDS45253.1	15q21.1	2010-06-04			ENSG00000229474	ENSG00000229474			33630	protein-coding gene	gene with protein product		614661				17936923	Standard	NM_001145112		Approved		uc010uej.2	C9JE40		ENST00000560775.1:c.953T>C	chr15.hg19:g.44961589A>G	ENSP00000453915:p.Ile318Thr	94.0	0.0		61.0	20.0	NM_001145112		Missense_Mutation	SNP	ENST00000560775.1	hg19	CCDS45253.1	.	.	.	.	.	.	.	.	.	.	A	19.28	3.797471	0.70567	.	.	ENSG00000229474	ENST00000434130	T	0.48522	0.81	5.53	5.53	0.82687	.	.	.	.	.	T	0.58032	0.2094	M	0.65975	2.015	0.30457	N	0.774696	D	0.54601	0.967	P	0.52554	0.702	T	0.64597	-0.6370	9	0.87932	D	0	-11.8752	12.0431	0.53464	1.0:0.0:0.0:0.0	.	318	C9JE40	PATL2_HUMAN	T	318	ENSP00000416673:I318T	ENSP00000416673:I318T	I	-	2	0	PATL2	42748881	1.000000	0.71417	0.999000	0.59377	0.832000	0.47134	6.435000	0.73412	2.099000	0.63709	0.459000	0.35465	ATA	.	.		0.463	PATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415947.1	NM_001145112	
ADCY9	115	hgsc.bcm.edu	37	16	4015980	4015980	+	Missense_Mutation	SNP	C	C	A	rs370863551		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr16:4015980C>A	ENST00000294016.3	-	11	4396	c.3858G>T	c.(3856-3858)caG>caT	p.Q1286H		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	1286					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						TGTCCACATACTGGACAGAAG	0.602																																					p.Q1286H		Atlas-SNP	.											.	ADCY9	151	.	0			c.G3858T						.						100.0	88.0	93.0					16																	4015980		2197	4300	6497	SO:0001583	missense	115	exon11			CACATACTGGACA	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.3858G>T	chr16.hg19:g.4015980C>A	ENSP00000294016:p.Gln1286His	74.0	0.0		62.0	7.0	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	ENST00000294016.3	hg19	CCDS32382.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.721068	0.30503	.	.	ENSG00000162104	ENST00000294016	D	0.83250	-1.7	5.67	3.62	0.41486	.	0.206543	0.43110	D	0.000614	T	0.68879	0.3049	N	0.17082	0.46	0.32166	N	0.582351	B	0.02656	0.0	B	0.04013	0.001	T	0.69034	-0.5252	10	0.37606	T	0.19	.	10.4262	0.44380	0.0:0.7935:0.1335:0.073	.	1286	O60503	ADCY9_HUMAN	H	1286	ENSP00000294016:Q1286H	ENSP00000294016:Q1286H	Q	-	3	2	ADCY9	3955981	0.986000	0.35501	0.573000	0.28510	0.926000	0.56050	2.141000	0.42168	1.541000	0.49316	0.655000	0.94253	CAG	.	.		0.602	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
AKTIP	64400	hgsc.bcm.edu	37	16	53529086	53529086	+	Splice_Site	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr16:53529086C>T	ENST00000394657.7	-	5	488		c.e5-1		AKTIP_ENST00000570004.1_Splice_Site|AKTIP_ENST00000300245.4_Splice_Site	NM_001012398.1|NM_022476.2	NP_001012398.1|NP_071921.1	Q9H8T0	AKTIP_HUMAN	AKT interacting protein						apoptotic process (GO:0006915)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|protein transport (GO:0015031)	FHF complex (GO:0070695)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)			large_intestine(1)|lung(2)|prostate(2)	5		all_cancers(37;0.14)				CCAAACCACACTGTAGGAAAA	0.383																																					.		Atlas-SNP	.											.	AKTIP	16	.	0			c.314-1G>A						.						116.0	118.0	118.0					16																	53529086		2198	4300	6498	SO:0001630	splice_region_variant	64400	exon6			ACCACACTGTAGG	AK023320	CCDS10749.1	16q12.2	2010-01-14	2007-01-16	2007-01-16	ENSG00000166971	ENSG00000166971		"""Ubiquitin-conjugating enzymes E2"""	16710	protein-coding gene	gene with protein product		608483	"""fused toes (mouse) homolog"", ""fused toes homolog (mouse)"""	FTS		7818539, 8626685	Standard	XM_005256094		Approved	FLJ13258	uc002ehl.3	Q9H8T0	OTTHUMG00000133199	ENST00000394657.7:c.314-1G>A	chr16.hg19:g.53529086C>T		171.0	0.0		251.0	31.0	NM_001012398	Q503B1|Q53H38	Splice_Site	SNP	ENST00000394657.7	hg19	CCDS10749.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.301396	0.81136	.	.	ENSG00000166971	ENST00000394657;ENST00000300245	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2279	0.98344	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AKTIP	52086587	1.000000	0.71417	0.999000	0.59377	0.770000	0.43624	7.721000	0.84768	2.778000	0.95560	0.655000	0.94253	.	.	.		0.383	AKTIP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256909.4	NM_022476	Intron
ZC3H18	124245	hgsc.bcm.edu	37	16	88677881	88677881	+	Missense_Mutation	SNP	A	A	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr16:88677881A>T	ENST00000301011.5	+	8	1612	c.1412A>T	c.(1411-1413)gAc>gTc	p.D471V	ZC3H18_ENST00000452588.2_Missense_Mutation_p.D495V	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	471						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CGTGACCGCGACCGggagaag	0.701																																					p.D471V	Ovarian(121;375 2276 20373 38669)	Atlas-SNP	.											.	ZC3H18	90	.	0			c.A1412T						.						49.0	39.0	42.0					16																	88677881		1780	3422	5202	SO:0001583	missense	124245	exon8			ACCGCGACCGGGA	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.1412A>T	chr16.hg19:g.88677881A>T	ENSP00000301011:p.Asp471Val	269.0	1.0		320.0	158.0	NM_144604	Q96DG4|Q96MP7	Missense_Mutation	SNP	ENST00000301011.5	hg19	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	a	12.93	2.086639	0.36855	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588	T;T	0.54279	0.58;0.58	3.61	3.61	0.41365	.	1.035860	0.07564	N	0.917518	T	0.52158	0.1717	L	0.50333	1.59	0.51482	D	0.999928	P;B;P	0.44429	0.835;0.403;0.835	B;B;B	0.43018	0.405;0.405;0.405	T	0.50215	-0.8854	10	0.66056	D	0.02	-2.2907	10.0554	0.42241	1.0:0.0:0.0:0.0	.	495;495;471	E7ERS3;B4DTK7;Q86VM9	.;.;ZCH18_HUMAN	V	471;439;495	ENSP00000301011:D471V;ENSP00000416951:D495V	ENSP00000289509:D439V	D	+	2	0	ZC3H18	87205382	0.998000	0.40836	0.219000	0.23793	0.703000	0.40648	4.178000	0.58284	1.411000	0.46957	0.370000	0.22315	GAC	.	.		0.701	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
TP53	7157	hgsc.bcm.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr17:7578235T>G	ENST00000269305.4	-	6	803	c.614A>C	c.(613-615)tAt>tCt	p.Y205S	TP53_ENST00000359597.4_Missense_Mutation_p.Y205S|TP53_ENST00000420246.2_Missense_Mutation_p.Y205S|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.Y205S|TP53_ENST00000455263.2_Missense_Mutation_p.Y205S|TP53_ENST00000445888.2_Missense_Mutation_p.Y205S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y205S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,temporoparietal,glioma,0,24	TP53	33396	.	117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)	c.A614C						.						136.0	121.0	126.0					17																	7578235		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TCCAAATACTCCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>C	chr17.hg19:g.7578235T>G	ENSP00000269305:p.Tyr205Ser	175.0	0.0		152.0	54.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	19.82	3.897640	0.72639	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92738	3.34	0.58432	D	0.999999	P;D;P;P;D;P;P	0.58268	0.766;0.982;0.89;0.954;0.974;0.853;0.943	P;P;P;P;P;P;P	0.61940	0.714;0.829;0.681;0.781;0.896;0.781;0.623	D	0.97292	0.9925	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205S;ENSP00000352610:Y205S;ENSP00000269305:Y205S;ENSP00000398846:Y205S;ENSP00000391127:Y205S;ENSP00000391478:Y205S;ENSP00000425104:Y73S;ENSP00000423862:Y112S	ENSP00000269305:Y205S	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT	.	.		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP16-1	100505753	hgsc.bcm.edu	37	17	39465082	39465082	+	Missense_Mutation	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr17:39465082A>G	ENST00000391352.1	-	1	423	c.424T>C	c.(424-426)Tct>Cct	p.S142P		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	142	11 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						ACGGAACAAGAAGGCTCACAA	0.562																																					p.S142P		Atlas-SNP	.											.	KRTAP16-1	12	.	0			c.T424C						.																																			SO:0001583	missense	100505753	exon1			AACAAGAAGGCTC	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.424T>C	chr17.hg19:g.39465082A>G	ENSP00000375147:p.Ser142Pro	192.0	0.0		146.0	24.0	NM_001146182		Missense_Mutation	SNP	ENST00000391352.1	hg19	CCDS56032.1	.	.	.	.	.	.	.	.	.	.	A	6.988	0.552358	0.13374	.	.	ENSG00000212657	ENST00000391352	T	0.01981	4.52	3.73	-2.03	0.07365	.	.	.	.	.	T	0.04182	0.0116	M	0.72624	2.21	0.09310	N	1	.	.	.	.	.	.	T	0.31613	-0.9937	7	0.36615	T	0.2	.	4.373	0.11256	0.3173:0.324:0.0:0.3586	.	.	.	.	P	142	ENSP00000375147:S142P	ENSP00000375147:S142P	S	-	1	0	KRTAP16-1	36718608	0.000000	0.05858	0.002000	0.10522	0.053000	0.15095	-1.816000	0.01720	-0.576000	0.05974	-0.527000	0.04329	TCT	.	.		0.562	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257785.1	NM_001146182	
MRC2	9902	hgsc.bcm.edu	37	17	60758227	60758227	+	Missense_Mutation	SNP	C	C	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr17:60758227C>T	ENST00000303375.5	+	17	2942	c.2540C>T	c.(2539-2541)gCg>gTg	p.A847V	MRC2_ENST00000446119.2_5'Flank	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	847	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TCCACGTGGGCGCAGGCGCAG	0.672																																					p.A847V		Atlas-SNP	.											.	MRC2	126	.	0			c.C2540T						.						26.0	25.0	25.0					17																	60758227		2201	4299	6500	SO:0001583	missense	9902	exon17			CGTGGGCGCAGGC	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2540C>T	chr17.hg19:g.60758227C>T	ENSP00000307513:p.Ala847Val	82.0	0.0		72.0	25.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	hg19	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882540	0.51908	.	.	ENSG00000011028	ENST00000303375	T	0.19806	2.12	4.9	-1.13	0.09775	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.756743	0.12961	N	0.425011	T	0.10594	0.0259	N	0.17674	0.51	0.80722	D	1	B	0.09022	0.002	B	0.04013	0.001	T	0.16188	-1.0411	10	0.32370	T	0.25	-4.3242	5.3093	0.15821	0.0:0.2466:0.1806:0.5728	.	847	Q9UBG0	MRC2_HUMAN	V	847	ENSP00000307513:A847V	ENSP00000307513:A847V	A	+	2	0	MRC2	58111959	0.031000	0.19500	0.904000	0.35570	0.985000	0.73830	0.288000	0.18939	0.131000	0.18576	-0.291000	0.09656	GCG	.	.		0.672	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
SF3A2	8175	hgsc.bcm.edu	37	19	2245549	2245549	+	Missense_Mutation	SNP	A	A	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr19:2245549A>G	ENST00000221494.5	+	5	768	c.350A>G	c.(349-351)tAc>tGc	p.Y117C		NM_007165.4	NP_009096.2	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2, 66kDa	117					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(2)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCCGGGCTACAAAGGTGAG	0.647																																					p.Y117C		Atlas-SNP	.											.	SF3A2	22	.	0			c.A350G						.						28.0	35.0	32.0					19																	2245549		1641	3000	4641	SO:0001583	missense	8175	exon5			CGGGCTACAAAGG	L21990	CCDS12084.1	19p13.3	2012-10-02	2002-08-29		ENSG00000104897	ENSG00000104897			10766	protein-coding gene	gene with protein product		600796	"""splicing factor 3a, subunit 2, 66kD"""			8211113, 8541848	Standard	NM_007165		Approved	SF3a66, SAP62, PRPF11, Prp11	uc002lvg.3	Q15428	OTTHUMG00000180414	ENST00000221494.5:c.350A>G	chr19.hg19:g.2245549A>G	ENSP00000221494:p.Tyr117Cys	174.0	0.0		160.0	40.0	NM_007165	B2RBU1|D6W605|O75245	Missense_Mutation	SNP	ENST00000221494.5	hg19	CCDS12084.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.173739	0.78452	.	.	ENSG00000104897	ENST00000221494	T	0.56444	0.46	4.48	4.48	0.54585	.	0.000000	0.85682	D	0.000000	T	0.73713	0.3622	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77667	-0.2502	10	0.54805	T	0.06	-47.2792	12.9781	0.58547	1.0:0.0:0.0:0.0	.	117	Q15428	SF3A2_HUMAN	C	117	ENSP00000221494:Y117C	ENSP00000221494:Y117C	Y	+	2	0	SF3A2	2196549	1.000000	0.71417	0.997000	0.53966	0.895000	0.52256	8.421000	0.90259	1.658000	0.50742	0.459000	0.35465	TAC	.	.		0.647	SF3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451268.3		
LPHN1	22859	hgsc.bcm.edu	37	19	14274022	14274022	+	Silent	SNP	G	G	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr19:14274022G>T	ENST00000340736.6	-	6	903	c.606C>A	c.(604-606)acC>acA	p.T202T	CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Silent_p.T197T|LPHN1_ENST00000591528.1_5'UTR|CTB-55O6.12_ENST00000592086.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	202	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGTAGGTGGTGGTGTGGCGGG	0.622																																					p.T202T		Atlas-SNP	.											.	LPHN1	107	.	0			c.C606A						.						99.0	77.0	84.0					19																	14274022		2203	4300	6503	SO:0001819	synonymous_variant	22859	exon6			GGTGGTGGTGTGG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.606C>A	chr19.hg19:g.14274022G>T		74.0	0.0		52.0	18.0	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Silent	SNP	ENST00000340736.6	hg19	CCDS32928.1																																																																																			.	.		0.622	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
CLASRP	11129	hgsc.bcm.edu	37	19	45567465	45567465	+	Silent	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr19:45567465G>A	ENST00000221455.3	+	12	1199	c.1101G>A	c.(1099-1101)ccG>ccA	p.P367P	CLASRP_ENST00000544944.2_Silent_p.P367P|CLASRP_ENST00000391953.4_Silent_p.P305P	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	367					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GCCCCGCCCCGGGACGTAATG	0.756																																					p.P367P		Atlas-SNP	.											.	CLASRP	44	.	0			c.G1101A						.						5.0	7.0	6.0					19																	45567465		2027	3961	5988	SO:0001819	synonymous_variant	11129	exon12			CGCCCCGGGACGT	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1101G>A	chr19.hg19:g.45567465G>A		117.0	0.0		129.0	8.0	NM_007056	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Silent	SNP	ENST00000221455.3	hg19	CCDS12652.2																																																																																			.	.		0.756	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
CCDC9	26093	hgsc.bcm.edu	37	19	47763963	47763963	+	Missense_Mutation	SNP	G	G	T	rs368381443		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr19:47763963G>T	ENST00000221922.6	+	5	551	c.329G>T	c.(328-330)cGc>cTc	p.R110L		NM_015603.2	NP_056418.1	Q9Y3X0	CCDC9_HUMAN	coiled-coil domain containing 9	110	Gly-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|urinary_tract(1)	12		all_cancers(25;0.0432)|all_epithelial(76;0.00812)|Medulloblastoma(540;0.0208)|all_neural(266;0.0416)|Hepatocellular(1079;0.114)		OV - Ovarian serous cystadenocarcinoma(262;8.51e-95)|Epithelial(262;1.15e-92)|all cancers(93;7.67e-84)|GBM - Glioblastoma multiforme(486;0.024)|STAD - Stomach adenocarcinoma(1328;0.183)		CGAGCATCGCGCAGCTGGGAG	0.761																																					p.R110L		Atlas-SNP	.											.	CCDC9	37	.	0			c.G329T						.						11.0	14.0	13.0					19																	47763963		2055	4135	6190	SO:0001583	missense	26093	exon5			CATCGCGCAGCTG	AL050284	CCDS12698.1	19q13.33	2008-02-05				ENSG00000105321			24560	protein-coding gene	gene with protein product						11230166	Standard	NM_015603		Approved	DKFZP586M1019	uc010xym.2	Q9Y3X0		ENST00000221922.6:c.329G>T	chr19.hg19:g.47763963G>T	ENSP00000221922:p.Arg110Leu	52.0	0.0		66.0	11.0	NM_015603		Missense_Mutation	SNP	ENST00000221922.6	hg19	CCDS12698.1	.	.	.	.	.	.	.	.	.	.	-	10.46	1.356895	0.24598	.	.	ENSG00000105321	ENST00000221922;ENST00000504556	T	0.25579	1.79	3.32	0.336	0.15958	.	1.182760	0.06421	N	0.722298	T	0.20373	0.0490	L	0.47716	1.5	0.09310	N	1	P	0.35226	0.491	B	0.32805	0.153	T	0.25152	-1.0140	10	0.31617	T	0.26	-3.3954	5.3138	0.15845	0.374:0.0:0.626:0.0	.	110	Q9Y3X0	CCDC9_HUMAN	L	110	ENSP00000221922:R110L	ENSP00000221922:R110L	R	+	2	0	CCDC9	52455803	0.046000	0.20272	0.001000	0.08648	0.464000	0.32679	0.758000	0.26447	0.036000	0.15547	0.431000	0.28591	CGC	.	.		0.761	CCDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466917.1	NM_015603	
PPFIA3	8541	hgsc.bcm.edu	37	19	49652850	49652850	+	Missense_Mutation	SNP	T	T	C			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr19:49652850T>C	ENST00000334186.4	+	28	3750	c.3401T>C	c.(3400-3402)tTc>tCc	p.F1134S	PPFIA3_ENST00000602351.1_Missense_Mutation_p.F1125S	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	1134					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CGGAAGATGTTCCGGGAGAAG	0.642																																					p.F1134S		Atlas-SNP	.											.	PPFIA3	71	.	0			c.T3401C						.						40.0	41.0	41.0					19																	49652850		2203	4300	6503	SO:0001583	missense	8541	exon28			AGATGTTCCGGGA	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.3401T>C	chr19.hg19:g.49652850T>C	ENSP00000335614:p.Phe1134Ser	171.0	0.0		182.0	44.0	NM_003660	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	ENST00000334186.4	hg19	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.701402	0.88924	.	.	ENSG00000177380	ENST00000334186	T	0.22539	1.95	4.12	4.12	0.48240	.	0.000000	0.48286	U	0.000185	T	0.41282	0.1152	M	0.69358	2.11	0.80722	D	1	P;D	0.76494	0.919;0.999	P;D	0.66351	0.615;0.943	T	0.36841	-0.9731	10	0.72032	D	0.01	-17.3063	12.5337	0.56131	0.0:0.0:0.0:1.0	.	1125;1134	O75145-2;O75145	.;LIPA3_HUMAN	S	1134	ENSP00000335614:F1134S	ENSP00000335614:F1134S	F	+	2	0	PPFIA3	54344662	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.678000	0.84035	1.863000	0.54032	0.379000	0.24179	TTC	.	.		0.642	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
ZNF831	128611	hgsc.bcm.edu	37	20	57767596	57767596	+	Missense_Mutation	SNP	C	C	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr20:57767596C>G	ENST00000371030.2	+	1	1522	c.1522C>G	c.(1522-1524)Ccc>Gcc	p.P508A		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	508							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CAACTCGCTGCCCTTCGTCGA	0.697																																					p.P508A		Atlas-SNP	.											.	ZNF831	287	.	0			c.C1522G						.						14.0	17.0	16.0					20																	57767596		1926	4093	6019	SO:0001583	missense	128611	exon1			TCGCTGCCCTTCG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.1522C>G	chr20.hg19:g.57767596C>G	ENSP00000360069:p.Pro508Ala	112.0	0.0		132.0	19.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244634	0.59103	.	.	ENSG00000124203	ENST00000371030	T	0.23754	1.89	5.21	5.21	0.72293	.	.	.	.	.	T	0.52980	0.1768	M	0.75615	2.305	0.32959	D	0.520812	D	0.89917	1.0	D	0.74674	0.984	T	0.65676	-0.6110	9	0.87932	D	0	-16.3529	17.7439	0.88414	0.0:1.0:0.0:0.0	.	508	Q5JPB2	ZN831_HUMAN	A	508	ENSP00000360069:P508A	ENSP00000360069:P508A	P	+	1	0	ZNF831	57200991	1.000000	0.71417	0.997000	0.53966	0.816000	0.46133	4.615000	0.61190	2.423000	0.82170	0.655000	0.94253	CCC	.	.		0.697	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
AR	367	hgsc.bcm.edu	37	X	66765173	66765173	+	Missense_Mutation	SNP	A	A	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chrX:66765173A>T	ENST00000374690.3	+	1	709	c.185A>T	c.(184-186)cAg>cTg	p.Q62L	AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Missense_Mutation_p.Q62L|AR_ENST00000396044.3_Missense_Mutation_p.Q62L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	62	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	cagcagcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q62L		Atlas-SNP	.											.	AR	249	.	0			c.A185T						.						5.0	9.0	7.0					X																	66765173		1734	3384	5118	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.185A>T	chrX.hg19:g.66765173A>T	ENSP00000363822:p.Gln62Leu	124.0	0.0		132.0	6.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	13.85	2.358892	0.41801	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.69306	-0.39;-0.39;-0.39	.	.	.	.	1.296110	0.05656	N	0.585987	T	0.58850	0.2151	N	0.19112	0.55	0.09310	N	0.999999	P;P;.	0.43431	0.807;0.458;.	P;B;.	0.53518	0.728;0.245;.	T	0.51180	-0.8738	8	0.11485	T	0.65	.	.	.	.	.	62;62;60	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	62	ENSP00000363822:Q62L;ENSP00000421155:Q62L;ENSP00000379359:Q62L	ENSP00000363822:Q62L	Q	+	2	0	AR	66681898	0.984000	0.35163	0.863000	0.33907	0.539000	0.34962	1.220000	0.32491	0.000000	0.14550	0.000000	0.15137	CAG	.	.		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
AR	367	hgsc.bcm.edu	37	X	66765176	66765176	+	Missense_Mutation	SNP	A	A	T	rs62636527		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chrX:66765176A>T	ENST00000374690.3	+	1	712	c.188A>T	c.(187-189)cAg>cTg	p.Q63L	AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Missense_Mutation_p.Q63L|AR_ENST00000396044.3_Missense_Mutation_p.Q63L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	63	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	cagcagcagcagcagcagcag	0.672									Androgen Insensitivity Syndrome																												p.Q63L		Atlas-SNP	.											.	AR	249	.	0			c.A188T						.						5.0	8.0	7.0					X																	66765176		1640	3236	4876	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.188A>T	chrX.hg19:g.66765176A>T	ENSP00000363822:p.Gln63Leu	122.0	0.0		131.0	9.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.08	1.532203	0.27387	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.78246	-1.16;-1.16;-1.16	.	.	.	.	0.479323	0.15343	U	0.267412	T	0.62624	0.2443	N	0.19112	0.55	0.09310	N	0.999992	P;D;.	0.58268	0.755;0.982;.	B;P;.	0.48627	0.089;0.584;.	T	0.56408	-0.7984	8	0.17832	T	0.49	.	.	.	.	rs62636527	63;63;61	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	63	ENSP00000363822:Q63L;ENSP00000421155:Q63L;ENSP00000379359:Q63L	ENSP00000363822:Q63L	Q	+	2	0	AR	66681901	0.810000	0.29049	0.871000	0.34182	0.555000	0.35460	1.078000	0.30754	0.000000	0.14550	0.000000	0.15137	CAG	.	A|0.982;T|0.018		0.672	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
AR	367	hgsc.bcm.edu	37	X	66765179	66765179	+	Missense_Mutation	SNP	A	A	T			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chrX:66765179A>T	ENST00000374690.3	+	1	715	c.191A>T	c.(190-192)cAg>cTg	p.Q64L	AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Missense_Mutation_p.Q64L|AR_ENST00000396044.3_Missense_Mutation_p.Q64L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	64	Gln-rich.|Modulating.|Poly-Gln.		Q -> R (in prostate cancer).		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	cagcagcagcagcagcagcag	0.677									Androgen Insensitivity Syndrome																												p.Q64L		Atlas-SNP	.											.	AR	249	.	0			c.A191T						.						4.0	8.0	7.0					X																	66765179		1590	3143	4733	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.191A>T	chrX.hg19:g.66765179A>T	ENSP00000363822:p.Gln64Leu	116.0	0.0		131.0	12.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.28	1.591655	0.28357	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.67865	-0.29;-0.29;-0.29	.	.	.	.	1.847110	0.03494	N	0.217131	T	0.56124	0.1964	N	0.19112	0.55	0.09310	N	0.999991	P;D;.	0.58268	0.755;0.982;.	B;P;.	0.48627	0.089;0.584;.	T	0.50381	-0.8835	8	0.38643	T	0.18	.	.	.	.	.	64;64;62	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	64	ENSP00000363822:Q64L;ENSP00000421155:Q64L;ENSP00000379359:Q64L	ENSP00000363822:Q64L	Q	+	2	0	AR	66681904	0.024000	0.19004	0.883000	0.34634	0.574000	0.36063	-0.145000	0.10265	0.000000	0.14550	0.000000	0.15137	CAG	.	.		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
AR	367	hgsc.bcm.edu	37	X	66765207	66765207	+	Silent	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chrX:66765207G>A	ENST00000374690.3	+	1	743	c.219G>A	c.(217-219)caG>caA	p.Q73Q	AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Silent_p.Q73Q|AR_ENST00000396044.3_Silent_p.Q73Q	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	73	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcagcagcagcagc	0.672									Androgen Insensitivity Syndrome																												p.Q73Q		Atlas-SNP	.											.	AR	249	.	0			c.G219A						.						5.0	6.0	6.0					X																	66765207		1961	3776	5737	SO:0001819	synonymous_variant	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GCAGCAGCAGCAG	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.219G>A	chrX.hg19:g.66765207G>A		107.0	0.0		103.0	8.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.		0.672	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
DLG3	1741	hgsc.bcm.edu	37	X	69712085	69712085	+	Missense_Mutation	SNP	C	C	G			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chrX:69712085C>G	ENST00000374360.3	+	11	1882	c.1649C>G	c.(1648-1650)aCc>aGc	p.T550S	DLG3_ENST00000194900.4_Missense_Mutation_p.T568S|DLG3_ENST00000374355.3_Missense_Mutation_p.T213S|DLG3_ENST00000542398.1_Missense_Mutation_p.T67S	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	550	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)			endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					AGGCTGGTGACCCCACACGGA	0.532																																					p.T550S		Atlas-SNP	.											.	DLG3	100	.	0			c.C1649G						.						85.0	71.0	75.0					X																	69712085		2203	4300	6503	SO:0001583	missense	1741	exon11			TGGTGACCCCACA	U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.1649C>G	chrX.hg19:g.69712085C>G	ENSP00000363480:p.Thr550Ser	112.0	0.0		153.0	11.0	NM_021120	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Missense_Mutation	SNP	ENST00000374360.3	hg19	CCDS14403.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995471	0.35226	.	.	ENSG00000082458	ENST00000194900;ENST00000374360;ENST00000374355;ENST00000542398	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	5.15	5.15	0.70609	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.68348	0.2991	N	0.16602	0.42	0.80722	D	1	B;B;B	0.24186	0.08;0.099;0.002	B;B;B	0.25405	0.05;0.06;0.007	T	0.63761	-0.6564	9	.	.	.	.	16.6272	0.84974	0.0:1.0:0.0:0.0	.	67;213;550	B4E0H1;Q5JUW6;Q92796	.;.;DLG3_HUMAN	S	568;550;213;67	ENSP00000194900:T568S;ENSP00000363480:T550S;ENSP00000363475:T213S;ENSP00000441393:T67S	.	T	+	2	0	DLG3	69628810	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.651000	0.83577	2.389000	0.81357	0.600000	0.82982	ACC	.	.		0.532	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057074.2	NM_021120	
MT-CO1	4512	hgsc.bcm.edu	37	M	6069	6069	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chrM:6069G>A	ENST00000361624.2	+	1	166	c.166G>A	c.(166-168)Gtt>Att	p.V56I	MT-TC_ENST00000387405.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	56					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACATCTACAACGTTATCGTCA	0.493																																					p.V56I		Atlas-SNP	.											.	.	.	.	0			c.G166A						.																																			SO:0001583	missense	5742	exon1			TACAACGTTATCG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.166G>A	chrM.hg19:g.6069G>A	ENSP00000354499:p.Val56Ile	28.0	0.0		39.0	18.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.493	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
MT-ND5	4540	hgsc.bcm.edu	37	M	13042	13042	+	Missense_Mutation	SNP	G	G	A			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chrM:13042G>A	ENST00000361567.2	+	1	706	c.706G>A	c.(706-708)Gcc>Acc	p.A236T	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	236			A -> T (in MELAS/LS; due to mitochondrial complex I deficiency). {ECO:0000269|PubMed:15767514, ECO:0000269|PubMed:17400793}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GACTCCCCTCAGCCATAGAAG	0.547																																					p.A236T		Atlas-SNP	.											.	.	.	.	0			c.G706A						.																																			SO:0001583	missense	0	exon1			CCCTCAGCCATAG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.706G>A	chrM.hg19:g.13042G>A	ENSP00000354813:p.Ala236Thr	24.0	0.0		26.0	13.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.547	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
NFATC2	4773	hgsc.bcm.edu	37	20	50048660	50048675	+	Frame_Shift_Del	DEL	GGTAATACTTCCTTTT	GGTAATACTTCCTTTT	-	rs6067777	byFrequency	TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	GGTAATACTTCCTTTT	GGTAATACTTCCTTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr20:50048660_50048675delGGTAATACTTCCTTTT	ENST00000396009.3	-	9	2870_2885	c.2651_2666delAAAAGGAAGTATTACC	c.(2650-2667)caaaaggaagtattacctfs	p.QKEVLP884fs	NFATC2_ENST00000609943.1_Frame_Shift_Del_p.QKEVLP864fs|NFATC2_ENST00000371564.3_Frame_Shift_Del_p.QKEVLP884fs|NFATC2_ENST00000609507.1_Frame_Shift_Del_p.QKEVLP665fs|NFATC2_ENST00000414705.1_Frame_Shift_Del_p.QKEVLP864fs|NFATC2_ENST00000610033.1_Frame_Shift_Del_p.QKEVLP665fs	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	884					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V887A(1)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CACCCCCGCAGGTAATACTTCCTTTTGGTCACTGAC	0.542																																					p.884_889del		Atlas-INDEL	.											.	NFATC2	112	.	1	Substitution - Missense(1)	lung(1)	c.2652_2667del						.																																			SO:0001589	frameshift_variant	4773	exon9			.	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2651_2666delAAAAGGAAGTATTACC	chr20.hg19:g.50048660_50048675delGGTAATACTTCCTTTT	ENSP00000379330:p.Gln884fs	131.0	0.0		115.0	14.0	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Frame_Shift_Del	DEL	ENST00000396009.3	hg19	CCDS13437.1																																																																																			.	.		0.542	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
IP6K1	9807	hgsc.bcm.edu	37	3	49785257	49785257	+	Frame_Shift_Del	DEL	A	A	-			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr3:49785257delA	ENST00000321599.4	-	2	518	c.217delT	c.(217-219)tacfs	p.Y73fs	IP6K1_ENST00000468463.1_Frame_Shift_Del_p.Y73fs|IP6K1_ENST00000395238.1_Intron|IP6K1_ENST00000498149.1_5'Flank|IP6K1_ENST00000460540.1_Intron	NM_001242829.1|NM_153273.3	NP_001229758.1|NP_695005.1	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1	73					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	15						TGACCTTTGTATTCAGGGGTG	0.493																																					p.Y73fs		Atlas-INDEL	.											.	IP6K1	41	.	0			c.218delA						.						52.0	50.0	51.0					3																	49785257		2203	4300	6503	SO:0001589	frameshift_variant	9807	exon2			.	D87452	CCDS33760.1, CCDS43092.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000176095	ENSG00000176095			18360	protein-coding gene	gene with protein product		606991	"""inositol hexaphosphate kinase 1"""	IHPK1			Standard	NM_001242829		Approved	KIAA0263	uc003cxm.1	Q92551	OTTHUMG00000158197	ENST00000321599.4:c.217delT	chr3.hg19:g.49785257delA	ENSP00000323780:p.Tyr73fs	127.0	0.0		132.0	26.0	NM_153273	A8K157|A8MUX4|Q7L3I7|Q96E38	Frame_Shift_Del	DEL	ENST00000321599.4	hg19	CCDS33760.1																																																																																			.	.		0.493	IP6K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350380.1	NM_153273	
GUCY2D	3000	hgsc.bcm.edu	37	17	7909969	7909969	+	Frame_Shift_Del	DEL	G	G	-	rs140638938		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr17:7909969delG	ENST00000254854.4	+	4	1465	c.1315delG	c.(1315-1317)gggfs	p.G440fs		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	440					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				CTTCCCGCGTGGGGGATCAGC	0.647																																					p.R438fs		Atlas-INDEL	.											.	GUCY2D	82	.	0			c.1314delT						.						23.0	22.0	23.0					17																	7909969		2203	4300	6503	SO:0001589	frameshift_variant	3000	exon4			.	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1315delG	chr17.hg19:g.7909969delG	ENSP00000254854:p.Gly440fs	57.0	0.0		33.0	12.0	NM_000180	Q6LEA7	Frame_Shift_Del	DEL	ENST00000254854.4	hg19	CCDS11127.1																																																																																			.	.		0.647	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
NEFH	4744	hgsc.bcm.edu	37	22	29885572	29885573	+	In_Frame_Ins	INS	-	-	CCCTGAGAAGGCCAAGTC			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr22:29885572_29885573insCCCTGAGAAGGCCAAGTC	ENST00000310624.6	+	4	1976_1977	c.1943_1944insCCCTGAGAAGGCCAAGTC	c.(1942-1947)tcccct>tcCCCTGAGAAGGCCAAGTCccct	p.648_649SP>SPEKAKSP		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	654	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GAAGCAAAGTCCCCTGAGAAGG	0.569																																					p.S648delinsSPEKAKS		Atlas-INDEL	.											.	NEFH	178	.	0			c.1943_1944insCCCTGAGAAGGCCAAGTC						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1944_1961dupCCCTGAGAAGGCCAAGTC	chr22.hg19:g.29885572_29885573insCCCTGAGAAGGCCAAGTC	ENSP00000311997:p.Pro643_Ser648dup	234.0	0.0		280.0	45.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305781	39305782	+	In_Frame_Ins	INS	-	-	AGCTGGGGCGGCAGC			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr17:39305781_39305782insAGCTGGGGCGGCAGC	ENST00000343246.4	-	1	272_273	c.238_239insGCTGCCGCCCCAGCT	c.(238-240)tgc>tGCTGCCGCCCCAGCTgc	p.80_80C>CCRPSC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	80	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].		C -> CCCRPS.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ggtctggcagcagcaggggcgg	0.653																																					p.C80delinsCCRPSC		Atlas-INDEL	.											.	KRTAP4-5	34	.	0			c.239_240insGCTGCCGCCCCAGCT						.																																			SO:0001652	inframe_insertion	85289	exon1			.	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.238_239insGCTGCCGCCCCAGCT	chr17.hg19:g.39305781_39305782insAGCTGGGGCGGCAGC	Exception_encountered	65.0	0.0		48.0	22.0	NM_033188		In_Frame_Ins	INS	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
APOB	338	hgsc.bcm.edu	37	2	21236200	21236201	+	Frame_Shift_Ins	INS	-	-	T	rs371083133		TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr2:21236200_21236201insT	ENST00000233242.1	-	25	4174_4175	c.4047_4048insA	c.(4045-4050)caagtgfs	p.V1350fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1350					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGAGAGGCACTTGCAGTTGAT	0.505																																					p.V1350fs		Atlas-INDEL	.											.	APOB	761	.	0			c.4048_4049insA						.																																			SO:0001589	frameshift_variant	338	exon25			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4048dupA	chr2.hg19:g.21236202_21236202dupT	ENSP00000233242:p.Val1350fs	119.0	0.0		113.0	25.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.505	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
DSPP	1834	hgsc.bcm.edu	37	4	88537208	88537216	+	In_Frame_Del	DEL	AGCAGTGAT	AGCAGTGAT	-	rs546380675|rs151217478|rs200679221|rs551655835	byFrequency	TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	AGCAGTGAT	AGCAGTGAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr4:88537208_88537216delAGCAGTGAT	ENST00000282478.7	+	4	3427_3435	c.3394_3402delAGCAGTGAT	c.(3394-3402)agcagtgatdel	p.SSD1135del	DSPP_ENST00000399271.1_In_Frame_Del_p.SSD1135del|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1135	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		cagcagcgacagcagtgatagcagtgaca	0.565																																					p.1131_1134del		Atlas-INDEL	.											.	DSPP	174	.	0			c.3393_3401del						.																																			SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3394_3402delAGCAGTGAT	chr4.hg19:g.88537208_88537216delAGCAGTGAT	ENSP00000282478:p.Ser1135_Asp1137del	127.0	0.0		98.0	58.0	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.565	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SNX27	81609	hgsc.bcm.edu	37	1	151641091	151641091	+	Frame_Shift_Del	DEL	G	G	-			TCGA-YA-A8S7-01A-11D-A36X-10	TCGA-YA-A8S7-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0669d47b-cc46-4b77-ad30-b3f1adbbfd9f	71d7d669-128a-455a-b4c9-898b7e7a4a61	g.chr1:151641091delG	ENST00000458013.2	+	7	1249	c.1129delG	c.(1129-1131)gttfs	p.V377fs	SNX27_ENST00000482791.1_3'UTR|SNX27_ENST00000368838.1_Frame_Shift_Del_p.V284fs|SNX27_ENST00000368843.3_Frame_Shift_Del_p.V377fs			Q96L92	SNX27_HUMAN	sorting nexin family member 27	377	FERM-like region F2.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGACCTTGCTGTTACCTACTT	0.368																																					p.A376fs	Colon(46;291 966 40145 41237 41888)	Atlas-INDEL	.											.	SNX27	44	.	0			c.1128delT						.						72.0	71.0	71.0					1																	151641091		2203	4300	6503	SO:0001589	frameshift_variant	81609	exon7			.	AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1129delG	chr1.hg19:g.151641091delG	ENSP00000400333:p.Val377fs	102.0	0.0		170.0	83.0	NM_030918	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Frame_Shift_Del	DEL	ENST00000458013.2	hg19																																																																																				.	.		0.368	SNX27-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000036624.3	NM_030918	
