#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MAP3K6	9064	hgsc.bcm.edu	37	1	27686481	27686481	+	Silent	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:27686481G>A	ENST00000493901.1	-	18	2426	c.2187C>T	c.(2185-2187)agC>agT	p.S729S	MAP3K6_ENST00000357582.2_Silent_p.S729S|MAP3K6_ENST00000374040.3_Silent_p.S721S	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	729	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		AGGAGGACAGGCTGCCTGGGT	0.597																																					p.S729S		Atlas-SNP	.											.	MAP3K6	134	.	0			c.C2187T						.						97.0	96.0	96.0					1																	27686481		2203	4300	6503	SO:0001819	synonymous_variant	9064	exon17			GGACAGGCTGCCT	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2187C>T	chr1.hg19:g.27686481G>A		76.0	0.0		69.0	8.0	NM_004672	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Silent	SNP	ENST00000493901.1	hg19	CCDS299.1	.	.	.	.	.	.	.	.	.	.	G	9.396	1.076745	0.20227	.	.	ENSG00000142733	ENST00000472410	.	.	.	5.03	3.16	0.36331	.	.	.	.	.	T	0.57504	0.2058	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51671	-0.8676	4	.	.	.	.	7.8465	0.29428	0.2581:0.0:0.7419:0.0	.	.	.	.	V	453	.	.	A	-	2	0	MAP3K6	27559068	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	1.414000	0.34736	0.709000	0.31976	0.561000	0.74099	GCC	.	.		0.597	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672	
PUM1	9698	hgsc.bcm.edu	37	1	31414910	31414910	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:31414910A>G	ENST00000257075.5	-	19	3142	c.3049T>C	c.(3049-3051)Tgt>Cgt	p.C1017R	PUM1_ENST00000440538.2_Missense_Mutation_p.C993R|PUM1_ENST00000424085.2_Missense_Mutation_p.C775R|PUM1_ENST00000373741.4_Missense_Mutation_p.C1055R|PUM1_ENST00000423018.2_Missense_Mutation_p.C875R|PUM1_ENST00000373742.2_Missense_Mutation_p.C958R|PUM1_ENST00000426105.2_Missense_Mutation_p.C1019R|PUM1_ENST00000373747.3_Missense_Mutation_p.C1020R	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	1017	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TCAGGGAGACAGTGCTCCAGG	0.483																																					p.C1019R		Atlas-SNP	.											.	PUM1	107	.	0			c.T3055C						.						103.0	97.0	99.0					1																	31414910		2203	4300	6503	SO:0001583	missense	9698	exon19			GGAGACAGTGCTC	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.3049T>C	chr1.hg19:g.31414910A>G	ENSP00000257075:p.Cys1017Arg	119.0	0.0		92.0	4.0	NM_001020658	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	hg19	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.7|20.7	4.037592|4.037592	0.75617|0.75617	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742|ENST00000525843;ENST00000498419	T;T;T;T;T;T;T;T|.	0.14640|.	2.49;2.49;2.49;2.49;2.49;2.49;2.49;2.49|.	5.53|5.53	4.4|4.4	0.53042|0.53042	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.043496|.	0.85682|.	D|.	0.000000|.	D|D	0.87059|0.87059	0.6083|0.6083	H|H	0.97635|0.97635	4.045|4.045	0.80722|0.80722	D|D	1|1	D;D;P;D;D;D;D;D|.	0.89917|.	0.999;1.0;0.879;1.0;0.994;0.995;0.994;0.994|.	D;D;P;D;D;D;D;D|.	0.87578|.	0.991;0.998;0.787;0.975;0.977;0.946;0.982;0.982|.	D|D	0.89551|0.89551	0.3799|0.3799	10|5	0.87932|.	D|.	0|.	-6.3069|-6.3069	11.2503|11.2503	0.49022|0.49022	0.9275:0.0:0.0725:0.0|0.9275:0.0:0.0725:0.0	.|.	958;875;1055;993;1017;1019;1020;1019|.	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5|.	.;.;.;.;PUM1_HUMAN;.;.;.|.	R|P	775;1017;1020;757;1019;993;1055;875;958|955;730	ENSP00000400141:C775R;ENSP00000257075:C1017R;ENSP00000362852:C1020R;ENSP00000391723:C1019R;ENSP00000401777:C993R;ENSP00000362846:C1055R;ENSP00000399440:C875R;ENSP00000362847:C958R|.	ENSP00000257075:C1017R|.	C|L	-|-	1|2	0|0	PUM1|PUM1	31187497|31187497	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.287000|9.287000	0.95975|0.95975	1.031000|1.031000	0.39867|0.39867	0.528000|0.528000	0.53228|0.53228	TGT|CTG	.	.		0.483	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000010671.1		
JAK1	3716	hgsc.bcm.edu	37	1	65316572	65316573	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:65316572_65316573GC>AA	ENST00000342505.4	-	12	1917_1918	c.1669_1670GC>TT	c.(1669-1671)GCt>TTt	p.A557F	JAK1_ENST00000465376.1_5'Flank	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	557					cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TTTCTTAGTAGCCACCAGCAGG	0.584			Mis		ALL																																p.A557V|p.A557S		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	.	JAK1	209	.	0			c.C1670T|c.G1669T						.																																			SO:0001583	missense	3716	exon12			TTAGTAGCCACCA|TAGTAGCCACCAG	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.1669_1670delinsAA	chr1.hg19:g.65316572_65316573delinsAA	ENSP00000343204:p.Ala557Phe	79.0|78.0	0.0		70.0|71.0	11.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1																																																																																			.	.		0.584	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
ELTD1	64123	hgsc.bcm.edu	37	1	79387445	79387445	+	Silent	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:79387445A>G	ENST00000370742.3	-	9	1173	c.1110T>C	c.(1108-1110)tgT>tgC	p.C370C		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	370	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TCCAAAATGCACATAGACTCC	0.378																																					p.C370C		Atlas-SNP	.											.	ELTD1	143	.	0			c.T1110C						.						116.0	109.0	112.0					1																	79387445		1942	4135	6077	SO:0001819	synonymous_variant	64123	exon9			AAATGCACATAGA	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.1110T>C	chr1.hg19:g.79387445A>G		246.0	0.0		247.0	88.0	NM_022159	B1AR71|Q5KU34	Silent	SNP	ENST00000370742.3	hg19	CCDS41352.1																																																																																			.	.		0.378	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
PDZK1	5174	hgsc.bcm.edu	37	1	145748530	145748530	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:145748530C>G	ENST00000344770.2	+	3	476	c.403C>G	c.(403-405)Ctc>Gtc	p.L135V	PDZK1_ENST00000451928.2_Missense_Mutation_p.L135V|PDZK1_ENST00000417171.1_Missense_Mutation_p.L135V	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	135	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			CCAGCCCCGGCTCTGCTATCT	0.517																																					p.L135V		Atlas-SNP	.											.	PDZK1	15	.	0			c.C403G						.						63.0	68.0	66.0					1																	145748530		2203	4300	6503	SO:0001583	missense	5174	exon4			CCCCGGCTCTGCT	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.403C>G	chr1.hg19:g.145748530C>G	ENSP00000342143:p.Leu135Val	359.0	0.0		522.0	212.0	NM_002614	B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Missense_Mutation	SNP	ENST00000344770.2	hg19	CCDS924.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.362039	0.41902	.	.	ENSG00000174827	ENST00000443667;ENST00000417171;ENST00000451928;ENST00000344770	T;T;T;T	0.33654	1.4;1.58;1.53;1.58	5.84	2.97	0.34412	PDZ/DHR/GLGF (2);	0.065664	0.64402	D	0.000014	T	0.34832	0.0911	M	0.65677	2.01	0.25018	N	0.991357	B;D	0.71674	0.017;0.998	B;D	0.71184	0.013;0.972	T	0.14727	-1.0462	10	0.19147	T	0.46	-2.7934	9.7601	0.40526	0.0:0.7956:0.0:0.2044	.	135;135	E7EU02;Q5T2W1	.;NHRF3_HUMAN	V	135	ENSP00000409291:L135V;ENSP00000394485:L135V;ENSP00000403422:L135V;ENSP00000342143:L135V	ENSP00000342143:L135V	L	+	1	0	PDZK1	144459887	1.000000	0.71417	0.912000	0.35992	0.128000	0.20619	1.314000	0.33597	0.818000	0.34468	0.591000	0.81541	CTC	.	.		0.517	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038502.2	NM_002614	
DCST2	127579	hgsc.bcm.edu	37	1	155003072	155003072	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:155003072C>T	ENST00000368424.3	-	6	913	c.855G>A	c.(853-855)atG>atA	p.M285I	DCST2_ENST00000295536.5_Missense_Mutation_p.M285I	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	285						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GGGTGGCTGTCATGTTGAACT	0.592																																					p.M285I		Atlas-SNP	.											.	DCST2	80	.	0			c.G855A						.						80.0	56.0	65.0					1																	155003072		2203	4300	6503	SO:0001583	missense	127579	exon6			GGCTGTCATGTTG	AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.855G>A	chr1.hg19:g.155003072C>T	ENSP00000357409:p.Met285Ile	260.0	0.0		404.0	67.0	NM_144622	Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	ENST00000368424.3	hg19	CCDS1082.2	.	.	.	.	.	.	.	.	.	.	C	3.637	-0.074336	0.07184	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.18502	2.21;2.26	5.08	1.93	0.25924	.	0.634759	0.14777	N	0.299009	T	0.01940	0.0061	N	0.12182	0.205	0.24817	N	0.992607	B	0.02656	0.0	B	0.01281	0.0	T	0.46898	-0.9158	10	0.06099	T	0.92	-8.5874	8.6799	0.34203	0.0:0.6319:0.2842:0.0839	.	285	Q5T1A1	DCST2_HUMAN	I	285	ENSP00000357409:M285I;ENSP00000295536:M285I	ENSP00000295536:M285I	M	-	3	0	DCST2	153269696	0.977000	0.34250	0.974000	0.42286	0.983000	0.72400	0.029000	0.13666	0.636000	0.30508	0.655000	0.94253	ATG	.	.		0.592	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090953.3	NM_144622	
OR6K6	128371	hgsc.bcm.edu	37	1	158725375	158725375	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:158725375C>T	ENST00000368144.2	+	1	866	c.770C>T	c.(769-771)tCa>tTa	p.S257L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					GGAATGCACTCAGCTGAAGGT	0.463																																					p.S257L		Atlas-SNP	.											.	OR6K6	81	.	0			c.C770T						.						250.0	203.0	219.0					1																	158725375		2203	4300	6503	SO:0001583	missense	128371	exon1			TGCACTCAGCTGA	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.770C>T	chr1.hg19:g.158725375C>T	ENSP00000357126:p.Ser257Leu	155.0	0.0		270.0	44.0	NM_001005184	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	hg19	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337308	0.60963	.	.	ENSG00000180433	ENST00000368144	T	0.00330	8.08	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37530	N	0.002053	T	0.00875	0.0029	H	0.94620	3.56	0.45806	D	0.998687	D	0.89917	1.0	D	0.97110	1.0	T	0.55373	-0.8151	10	0.87932	D	0	-8.391	18.27	0.90065	0.0:1.0:0.0:0.0	.	257	Q8NGW6	OR6K6_HUMAN	L	257	ENSP00000357126:S257L	ENSP00000357126:S257L	S	+	2	0	OR6K6	156991999	0.006000	0.16342	0.883000	0.34634	0.043000	0.13939	2.164000	0.42387	2.848000	0.98002	0.655000	0.94253	TCA	.	.		0.463	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
SERTAD4	56256	hgsc.bcm.edu	37	1	210414919	210414919	+	Missense_Mutation	SNP	A	A	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:210414919A>C	ENST00000367012.3	+	4	538	c.308A>C	c.(307-309)gAg>gCg	p.E103A	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	103	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.					nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		TCAATTTTTGAGGAACGAGCC	0.328																																					p.E103A		Atlas-SNP	.											.	SERTAD4	53	.	0			c.A308C						.						56.0	59.0	58.0					1																	210414919		2203	4300	6503	SO:0001583	missense	56256	exon4			TTTTTGAGGAACG	BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.308A>C	chr1.hg19:g.210414919A>C	ENSP00000355979:p.Glu103Ala	126.0	0.0		187.0	61.0	NM_019605	B2RD32	Missense_Mutation	SNP	ENST00000367012.3	hg19	CCDS1494.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155832	0.57259	.	.	ENSG00000082497	ENST00000367012	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.76190	0.3953	L	0.58101	1.795	0.47584	D	0.99946	D	0.63880	0.993	D	0.74674	0.984	T	0.78635	-0.2127	9	0.87932	D	0	-11.7237	15.9023	0.79387	1.0:0.0:0.0:0.0	.	103	Q9NUC0	SRTD4_HUMAN	A	103	.	ENSP00000355979:E103A	E	+	2	0	SERTAD4	208481542	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.452000	0.80683	2.153000	0.67306	0.533000	0.62120	GAG	.	.		0.328	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088577.1	NM_019605	
AKT3	10000	hgsc.bcm.edu	37	1	244006586	244006586	+	Splice_Site	SNP	T	T	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:244006586T>A	ENST00000366539.1	-	2	89		c.e2-2		AKT3_ENST00000336199.5_5'Flank|AKT3_ENST00000366540.1_Splice_Site|AKT3_ENST00000263826.5_5'Flank			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3						mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			TGACTCAGCCTGGAAGGAAGT	0.423																																					.		Atlas-SNP	.											.	AKT3	177	.	0			.						.																																			SO:0001630	splice_region_variant	10000	.			TCAGCCTGGAAGG	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.112-2A>T	chr1.hg19:g.244006586T>A		22.0	0.0		31.0	9.0	.	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Splice_Site	SNP	ENST00000366539.1	hg19	CCDS31077.1																																																																																			.	.		0.423	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690	Intron
ZNF670	93474	hgsc.bcm.edu	37	1	247201279	247201279	+	Silent	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:247201279T>C	ENST00000366503.2	-	4	800	c.642A>G	c.(640-642)gaA>gaG	p.E214E		NM_001204220.1|NM_033213.4	NP_001191149.1|NP_149990.1	Q9BS34	ZN670_HUMAN	zinc finger protein 670	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			TTCTTTCATGTTCACGAAGAT	0.348																																					p.E214E		Atlas-SNP	.											.	ZNF670	52	.	0			c.A642G						.						68.0	69.0	69.0					1																	247201279		2203	4300	6503	SO:0001819	synonymous_variant	93474	exon4			TTCATGTTCACGA		CCDS31087.1	1q44	2013-01-08			ENSG00000135747	ENSG00000135747		"""Zinc fingers, C2H2-type"", ""-"""	28167	protein-coding gene	gene with protein product						12477932	Standard	NM_033213		Approved	MGC12466	uc001icd.2	Q9BS34	OTTHUMG00000040868	ENST00000366503.2:c.642A>G	chr1.hg19:g.247201279T>C		86.0	0.0		161.0	27.0	NM_033213		Silent	SNP	ENST00000366503.2	hg19	CCDS31087.1																																																																																			.	.		0.348	ZNF670-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098183.3	NM_033213	
RTN4	57142	hgsc.bcm.edu	37	2	55253876	55253876	+	Silent	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:55253876A>G	ENST00000337526.6	-	3	1602	c.1359T>C	c.(1357-1359)ggT>ggC	p.G453G	RTN4_ENST00000394611.2_Silent_p.G247G|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357376.3_Silent_p.G247G|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000405240.1_Silent_p.G247G|RTN4_ENST00000404909.1_Silent_p.G247G|RTN4_ENST00000354474.6_Silent_p.G221G	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	453					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						GATCCTTTATACCTTCTGGCG	0.393																																					p.G453G		Atlas-SNP	.											.	RTN4	189	.	0			c.T1359C						.						204.0	193.0	197.0					2																	55253876		2202	4300	6502	SO:0001819	synonymous_variant	57142	exon3			CTTTATACCTTCT	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1359T>C	chr2.hg19:g.55253876A>G		80.0	0.0		82.0	27.0	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Silent	SNP	ENST00000337526.6	hg19	CCDS42684.1																																																																																			.	.		0.393	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
CCDC85A	114800	hgsc.bcm.edu	37	2	56611449	56611449	+	Silent	SNP	A	A	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:56611449A>C	ENST00000407595.2	+	6	2123	c.1621A>C	c.(1621-1623)Agg>Cgg	p.R541R	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	541										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCCTGGAATTAGGCAACATTT	0.413																																					p.R541R		Atlas-SNP	.											.	CCDC85A	70	.	0			c.A1621C						.						106.0	104.0	105.0					2																	56611449		1951	4140	6091	SO:0001819	synonymous_variant	114800	exon6			GGAATTAGGCAAC	AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1621A>C	chr2.hg19:g.56611449A>C		86.0	0.0		87.0	30.0	NM_001080433		Silent	SNP	ENST00000407595.2	hg19	CCDS46290.1																																																																																			.	.		0.413	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324993.1		
ADD2	119	hgsc.bcm.edu	37	2	70910804	70910804	+	Silent	SNP	G	G	A	rs376528363		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:70910804G>A	ENST00000264436.4	-	10	1488	c.1044C>T	c.(1042-1044)gcC>gcT	p.A348A	ADD2_ENST00000430656.1_Silent_p.A364A|ADD2_ENST00000355733.3_Silent_p.A348A|ADD2_ENST00000407644.2_Silent_p.A348A|ADD2_ENST00000413157.2_Silent_p.A348A	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	348					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						AGGTGCTCCCGGCCCACTGCA	0.627																																					p.A364A		Atlas-SNP	.											ADD2_ENST00000430656,NS,carcinoma,0,3	ADD2	261	.	0			c.C1092T						.	G	,,,,	1,4405	2.1+/-5.4	0,1,2202	43.0	41.0	42.0		1044,1092,1044,1044,1044	-9.7	0.0	2		42	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ADD2	NM_001185054.1,NM_001185055.1,NM_001617.3,NM_017482.3,NM_017488.3	,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,	348/727,364/576,348/727,348/560,348/644	70910804	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	119	exon9			GCTCCCGGCCCAC	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1044C>T	chr2.hg19:g.70910804G>A		231.0	0.0		210.0	55.0	NM_001185055	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Silent	SNP	ENST00000264436.4	hg19	CCDS1906.1																																																																																			.	.		0.627	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
CERS6	253782	hgsc.bcm.edu	37	2	169626068	169626068	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:169626068G>T	ENST00000305747.6	+	10	1638	c.1051G>T	c.(1051-1053)Gac>Tac	p.D351Y	CERS6_ENST00000392687.4_Missense_Mutation_p.D359Y|CERS6-AS1_ENST00000425636.2_RNA	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	351					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										AGATGAGGAGGACTCAGAACC	0.507																																					p.D359Y		Atlas-SNP	.											.	.	.	.	0			c.G1075T						.						112.0	107.0	109.0					2																	169626068		2203	4300	6503	SO:0001583	missense	253782	exon11			GAGGAGGACTCAG	BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.1051G>T	chr2.hg19:g.169626068G>T	ENSP00000306579:p.Asp351Tyr	167.0	0.0		139.0	39.0	NM_001256126	Q32M63|Q8N617	Missense_Mutation	SNP	ENST00000305747.6	hg19	CCDS2228.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645239	0.67358	.	.	ENSG00000172292	ENST00000305747;ENST00000392687	T;T	0.13089	2.79;2.62	5.97	5.97	0.96955	.	0.261937	0.48767	D	0.000162	T	0.31040	0.0784	M	0.89601	3.045	0.58432	D	0.999998	P;P	0.44090	0.826;0.826	P;P	0.45037	0.467;0.467	T	0.15665	-1.0429	10	0.59425	D	0.04	-11.6636	14.5506	0.68065	0.0697:0.0:0.9303:0.0	.	359;351	Q32M63;Q6ZMG9	.;CERS6_HUMAN	Y	351;359	ENSP00000306579:D351Y;ENSP00000376453:D359Y	ENSP00000306579:D351Y	D	+	1	0	CERS6	169334314	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.348000	0.79366	2.831000	0.97527	0.655000	0.94253	GAC	.	.		0.507	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255235.2	NM_203463	
GORASP2	26003	hgsc.bcm.edu	37	2	171822386	171822386	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:171822386C>G	ENST00000234160.4	+	10	1920	c.1105C>G	c.(1105-1107)Ccc>Gcc	p.P369A	GORASP2_ENST00000452526.2_Missense_Mutation_p.P381A|GORASP2_ENST00000493692.1_3'UTR	NM_001201428.1|NM_015530.4	NP_001188357.1|NP_056345.3	Q9H8Y8	GORS2_HUMAN	golgi reassembly stacking protein 2, 55kDa	369	Pro-rich.				mitotic cell cycle (GO:0000278)|organelle organization (GO:0006996)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	14						CCCGTCATTCCCCTTGGTTCC	0.597																																					p.P369A		Atlas-SNP	.											.	GORASP2	40	.	0			c.C1105G						.						154.0	120.0	132.0					2																	171822386		2203	4300	6503	SO:0001583	missense	26003	exon10			TCATTCCCCTTGG		CCDS33325.1	2q31.1	2012-09-20	2002-08-29		ENSG00000115806	ENSG00000115806			17500	protein-coding gene	gene with protein product		608693	"""golgi reassembly stacking protein 2, 55 kDa"""			10487747	Standard	NM_015530		Approved	GRASP55, GRS2, GOLPH6	uc002ugj.3	Q9H8Y8	OTTHUMG00000154072	ENST00000234160.4:c.1105C>G	chr2.hg19:g.171822386C>G	ENSP00000234160:p.Pro369Ala	68.0	0.0		80.0	33.0	NM_015530	B4DKT0|Q53TE3|Q96I74|Q96K84|Q9H946|Q9UFW4	Missense_Mutation	SNP	ENST00000234160.4	hg19	CCDS33325.1	.	.	.	.	.	.	.	.	.	.	C	19.73	3.882262	0.72294	.	.	ENSG00000115806	ENST00000234160;ENST00000452526	T;T	0.59364	0.38;0.27	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.75882	0.3910	M	0.67953	2.075	0.50813	D	0.99989	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.994;0.994	T	0.73697	-0.3901	10	0.45353	T	0.12	-13.8958	20.1649	0.98147	0.0:1.0:0.0:0.0	.	325;381;369	B4DNR1;B4DKT0;Q9H8Y8	.;.;GORS2_HUMAN	A	369;381	ENSP00000234160:P369A;ENSP00000410208:P381A	ENSP00000234160:P369A	P	+	1	0	GORASP2	171530632	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	5.114000	0.64648	2.753000	0.94483	0.655000	0.94253	CCC	.	.		0.597	GORASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333719.2		
SPATA3	130560	hgsc.bcm.edu	37	2	231861053	231861054	+	Missense_Mutation	DNP	CA	CA	TC	rs72362780		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:231861053_231861054CA>TC	ENST00000452881.1	+	1	213_214	c.105_106CA>TC	c.(103-108)tcCAca>tcTCca	p.T36P	SPATA3_ENST00000424440.1_Missense_Mutation_p.T36P|SPATA3_ENST00000433428.2_Missense_Mutation_p.T36P|SPATA3_ENST00000455816.1_Missense_Mutation_p.T36P|AC105344.2_ENST00000414876.1_lincRNA			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	36										endometrium(2)|lung(1)	3						GCCCTGAATCCACACCACAGCA	0.569																																					p.S35S|p.T36P		Atlas-SNP	.											.	SPATA3	52	.	0			c.C105T|c.A106C						.																																			SO:0001583	missense	130560	exon1			TGAATCCACACCA|GAATCCACACCAC	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	Exception_encountered	chr2.hg19:g.231861053_231861054delinsTC	ENSP00000388895:p.Thr36Pro	111.0|110.0	0.0		97.0|98.0	10.0|16.0	NM_139073	Q86WX5|Q8N9Y6	Silent|Missense_Mutation	SNP	ENST00000452881.1	hg19	CCDS2481.1																																																																																			.	.		0.569	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
PASK	23178	hgsc.bcm.edu	37	2	242054738	242054738	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:242054738T>C	ENST00000405260.1	-	13	3861	c.3163A>G	c.(3163-3165)Att>Gtt	p.I1055V	PASK_ENST00000544142.1_Missense_Mutation_p.I869V|PASK_ENST00000234040.4_Missense_Mutation_p.I1055V|PASK_ENST00000475666.1_5'Flank|PASK_ENST00000358649.4_Missense_Mutation_p.I1055V|PASK_ENST00000403638.3_Missense_Mutation_p.I1055V|PASK_ENST00000539818.1_Missense_Mutation_p.I839V	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1055	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		CTGGATAGAATTGCGATCTCT	0.428																																					p.I1055V		Atlas-SNP	.											.	PASK	230	.	0			c.A3163G						.						175.0	159.0	164.0					2																	242054738		2203	4300	6503	SO:0001583	missense	23178	exon13			ATAGAATTGCGAT	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3163A>G	chr2.hg19:g.242054738T>C	ENSP00000384016:p.Ile1055Val	141.0	0.0		122.0	32.0	NM_015148	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	hg19	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	T	18.39	3.613407	0.66672	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.39	5.39	0.77823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000058	T	0.69178	0.3082	L	0.31526	0.94	0.48087	D	0.999586	B;B;B;P;B	0.52842	0.227;0.334;0.19;0.956;0.227	P;B;B;D;P	0.66716	0.5;0.324;0.367;0.946;0.5	T	0.72947	-0.4137	10	0.72032	D	0.01	.	15.3955	0.74790	0.0:0.0:0.0:1.0	.	1020;869;1055;1055;1055	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	V	1055;869;1055;1055;839;1055	ENSP00000234040:I1055V;ENSP00000441374:I869V;ENSP00000384016:I1055V;ENSP00000351475:I1055V;ENSP00000443083:I839V;ENSP00000384438:I1055V	ENSP00000234040:I1055V	I	-	1	0	PASK	241703411	1.000000	0.71417	0.174000	0.22961	0.536000	0.34869	4.716000	0.61916	2.040000	0.60383	0.460000	0.39030	ATT	.	.		0.428	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000323753.1	NM_015148	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266137	41266137	+	Missense_Mutation	SNP	C	C	T	rs121913409		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr3:41266137C>T	ENST00000349496.5	+	3	414	c.134C>T	c.(133-135)tCt>tTt	p.S45F	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38F|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGT	0.498	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45F	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1,2	CTNNB1	4904	.	601	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(4)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134T						.						84.0	74.0	77.0					3																	41266137		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.134C>T	chr3.hg19:g.41266137C>T	ENSP00000344456:p.Ser45Phe	161.0	0.0		114.0	35.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569754	0.86439	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68165	0.2971	M	0.65677	2.01	0.80722	D	1	D	0.67145	0.996	D	0.64687	0.928	T	0.68895	-0.5288	10	0.87932	D	0	-13.6823	20.2983	0.98569	0.0:1.0:0.0:0.0	.	45	P35222	CTNB1_HUMAN	F	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38F;ENSP00000385604:S45F;ENSP00000412219:S45F;ENSP00000379486:S45F;ENSP00000344456:S45F;ENSP00000411226:S38F;ENSP00000379488:S45F;ENSP00000409302:S45F;ENSP00000401599:S45F	ENSP00000344456:S45F	S	+	2	0	CTNNB1	41241141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
TRAK1	22906	hgsc.bcm.edu	37	3	42264841	42264841	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr3:42264841A>G	ENST00000327628.5	+	16	2874	c.2474A>G	c.(2473-2475)aAg>aGg	p.K825R	TRAK1_ENST00000396175.1_Missense_Mutation_p.K767R|TRAK1_ENST00000487159.1_3'UTR|RNU4-78P_ENST00000410940.1_RNA	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	825					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						GTGAGAGAAAAGAACGTCCGC	0.572																																					p.K825R	GBM(44;195 884 22595 31865 41850)	Atlas-SNP	.											.	TRAK1	188	.	0			c.A2474G						.						47.0	53.0	51.0					3																	42264841		2025	4184	6209	SO:0001583	missense	22906	exon16			GAGAAAAGAACGT		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.2474A>G	chr3.hg19:g.42264841A>G	ENSP00000328998:p.Lys825Arg	86.0	0.0		65.0	5.0	NM_001042646	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	ENST00000327628.5	hg19	CCDS43072.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.583426	0.28268	.	.	ENSG00000182606	ENST00000327628;ENST00000396175	T;T	0.42513	0.97;0.97	5.11	2.65	0.31530	Trafficking kinesin-binding protein domain (1);	0.439904	0.23314	N	0.049534	T	0.19087	0.0458	N	0.08118	0	0.80722	D	1	B;B	0.09022	0.002;0.0	B;B	0.10450	0.005;0.001	T	0.05435	-1.0885	10	0.11485	T	0.65	.	8.6073	0.33782	0.8391:0.0:0.1609:0.0	.	767;825	C9JC32;Q9UPV9	.;TRAK1_HUMAN	R	825;767	ENSP00000328998:K825R;ENSP00000379478:K767R	ENSP00000328998:K825R	K	+	2	0	TRAK1	42239845	1.000000	0.71417	0.940000	0.37924	0.984000	0.73092	3.002000	0.49496	0.756000	0.33013	0.482000	0.46254	AAG	.	.		0.572	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
KALRN	8997	hgsc.bcm.edu	37	3	124201708	124201708	+	Silent	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr3:124201708G>A	ENST00000240874.3	+	28	4396	c.4239G>A	c.(4237-4239)aaG>aaA	p.K1413K	KALRN_ENST00000460856.1_Silent_p.K1404K|KALRN_ENST00000360013.3_Silent_p.K1413K	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1413	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						ACCTAATTAAGCCTGTCCAAA	0.537																																					p.K1413K		Atlas-SNP	.											.	KALRN	556	.	0			c.G4239A						.						254.0	202.0	219.0					3																	124201708		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon28			AATTAAGCCTGTC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4239G>A	chr3.hg19:g.124201708G>A		152.0	0.0		92.0	38.0	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	hg19	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	G	9.327	1.059575	0.19987	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.31	3.52	0.40303	.	.	.	.	.	T	0.57961	0.2089	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52815	-0.8525	4	.	.	.	.	8.0062	0.30325	0.3046:0.0:0.6954:0.0	.	.	.	.	N	1382	.	.	S	+	2	0	KALRN	125684398	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.813000	0.27225	0.813000	0.34350	0.655000	0.94253	AGC	.	.		0.537	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
PRR23A	729627	hgsc.bcm.edu	37	3	138724705	138724705	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr3:138724705C>T	ENST00000383163.2	-	1	405	c.406G>A	c.(406-408)Gtc>Atc	p.V136I	MRPS22_ENST00000495075.1_5'UTR	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	136										endometrium(3)|kidney(1)|lung(7)	11						TGCTCAACGACGACGTCCTCC	0.632																																					p.V136I		Atlas-SNP	.											.	PRR23A	35	.	0			c.G406A						.						53.0	50.0	51.0					3																	138724705		692	1591	2283	SO:0001583	missense	729627	exon1			CAACGACGACGTC		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.406G>A	chr3.hg19:g.138724705C>T	ENSP00000372649:p.Val136Ile	192.0	0.0		198.0	63.0	NM_001134659		Missense_Mutation	SNP	ENST00000383163.2	hg19	CCDS46923.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.594299	0.28445	.	.	ENSG00000206260	ENST00000383163	.	.	.	2.92	-1.28	0.09318	.	0.261619	0.20067	N	0.099951	T	0.25717	0.0626	M	0.64997	1.995	0.09310	N	1	P	0.43519	0.809	B	0.36289	0.221	T	0.15867	-1.0422	9	0.56958	D	0.05	.	4.0248	0.09682	0.0:0.369:0.3856:0.2454	.	136	A6NEV1	PR23A_HUMAN	I	136	.	ENSP00000372649:V136I	V	-	1	0	PRR23A	140207395	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.264000	0.08658	-0.294000	0.08973	-1.185000	0.01705	GTC	.	.		0.632	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	
PABPC4L	132430	hgsc.bcm.edu	37	4	135121098	135121098	+	Silent	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:135121098G>T	ENST00000421491.3	-	2	1333	c.1077C>A	c.(1075-1077)tcC>tcA	p.S359S	PABPC4L_ENST00000529122.2_Silent_p.S417S			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	359	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						TAAGAGGTTTGGAGCCCAAGA	0.498																																					p.S417S		Atlas-SNP	.											.	PABPC4L	60	.	0			c.C1251A						.						54.0	46.0	49.0					4																	135121098		692	1591	2283	SO:0001819	synonymous_variant	132430	exon2			AGGTTTGGAGCCC	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.1077C>A	chr4.hg19:g.135121098G>T		120.0	0.0		110.0	33.0	NM_001114734		Silent	SNP	ENST00000421491.3	hg19																																																																																				.	.		0.498	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364399.2	NM_001114734	
PCDH18	54510	hgsc.bcm.edu	37	4	138451883	138451883	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:138451883G>T	ENST00000344876.4	-	1	1746	c.1360C>A	c.(1360-1362)Caa>Aaa	p.Q454K	PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.Q454K|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000507846.1_Missense_Mutation_p.Q234K	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	454	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TCATTGATTTGAACTGTAAAA	0.413																																					p.Q454K		Atlas-SNP	.											.	PCDH18	229	.	0			c.C1360A						.						142.0	135.0	137.0					4																	138451883		2203	4300	6503	SO:0001583	missense	54510	exon1			TGATTTGAACTGT	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1360C>A	chr4.hg19:g.138451883G>T	ENSP00000355082:p.Gln454Lys	85.0	0.0		91.0	27.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	hg19	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545241	0.27652	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.49432	0.78;0.78;0.78	6.04	6.04	0.98038	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.41938	D	0.000784	T	0.39545	0.1082	N	0.26130	0.795	0.80722	D	1	B;B;P	0.41345	0.32;0.036;0.746	B;B;B	0.40702	0.248;0.059;0.338	T	0.09100	-1.0690	10	0.11794	T	0.64	.	20.5948	0.99439	0.0:0.0:1.0:0.0	.	234;454;454	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	K	454;454;234	ENSP00000355082:Q454K;ENSP00000390688:Q454K;ENSP00000425903:Q234K	ENSP00000355082:Q454K	Q	-	1	0	PCDH18	138671333	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.824000	0.86668	2.873000	0.98535	0.563000	0.77884	CAA	.	.		0.413	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
TENM3	55714	hgsc.bcm.edu	37	4	183658118	183658118	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:183658118G>A	ENST00000511685.1	+	17	3248	c.3125G>A	c.(3124-3126)gGa>gAa	p.G1042E	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.G1042E			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1042					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GCTGTAGTAGGAAGACTCTTC	0.388																																					p.G1042E		Atlas-SNP	.											.	.	.	.	0			c.G3125A						.						127.0	120.0	122.0					4																	183658118		1827	4088	5915	SO:0001583	missense	55714	exon16			TAGTAGGAAGACT	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3125G>A	chr4.hg19:g.183658118G>A	ENSP00000424226:p.Gly1042Glu	161.0	0.0		202.0	11.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	hg19	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659031	0.88154	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.99207	-5.56;-5.56	4.48	4.48	0.54585	.	.	.	.	.	D	0.99501	0.9822	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98221	1.0478	9	0.87932	D	0	.	17.3322	0.87268	0.0:0.0:1.0:0.0	.	1042	Q9P273	TEN3_HUMAN	E	1042	ENSP00000424226:G1042E;ENSP00000385276:G1042E	ENSP00000385276:G1042E	G	+	2	0	ODZ3	183895112	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	9.611000	0.98342	2.326000	0.78906	0.561000	0.74099	GGA	.	.		0.388	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
FAT1	2195	hgsc.bcm.edu	37	4	187628067	187628067	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:187628067C>G	ENST00000441802.2	-	2	3124	c.2915G>C	c.(2914-2916)gGa>gCa	p.G972A		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	972	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ATCGAAGTTTCCTTCTCCGTG	0.483										HNSCC(5;0.00058)																											p.G972A	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.G2915C						.						167.0	161.0	163.0					4																	187628067		1931	4141	6072	SO:0001583	missense	2195	exon2			AAGTTTCCTTCTC	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.2915G>C	chr4.hg19:g.187628067C>G	ENSP00000406229:p.Gly972Ala	140.0	0.0		110.0	6.0	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	hg19	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027527	0.54683	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.53857	0.6	4.67	4.67	0.58626	Cadherin (4);Cadherin-like (1);	0.052914	0.85682	D	0.000000	T	0.68476	0.3005	L	0.55017	1.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67078	-0.5761	10	0.40728	T	0.16	.	18.1062	0.89520	0.0:1.0:0.0:0.0	.	972	Q14517	FAT1_HUMAN	A	972	ENSP00000406229:G972A	ENSP00000260147:G972A	G	-	2	0	FAT1	187865061	1.000000	0.71417	0.954000	0.39281	0.035000	0.12851	4.713000	0.61895	2.579000	0.87056	0.491000	0.48974	GGA	.	.		0.483	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
TRIML2	205860	hgsc.bcm.edu	37	4	189022387	189022387	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:189022387A>T	ENST00000512729.1	-	3	527	c.153T>A	c.(151-153)ttT>ttA	p.F51L	TRIML2_ENST00000326754.3_Missense_Mutation_p.F51L|TRIML2_ENST00000536972.1_Missense_Mutation_p.F101L	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	51					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TCATCTTTTTAAAATTTTGTT	0.363																																					p.F51L		Atlas-SNP	.											.	TRIML2	80	.	0			c.T153A						.						135.0	123.0	127.0					4																	189022387		2203	4300	6503	SO:0001583	missense	205860	exon3			CTTTTTAAAATTT	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.153T>A	chr4.hg19:g.189022387A>T	ENSP00000422581:p.Phe51Leu	70.0	0.0		74.0	23.0	NM_173553	B7Z6J6	Missense_Mutation	SNP	ENST00000512729.1	hg19	CCDS3850.1	.	.	.	.	.	.	.	.	.	.	A	4.425	0.078590	0.08533	.	.	ENSG00000179046	ENST00000512729;ENST00000326754;ENST00000536972	T;T;T	0.56103	0.66;0.48;4.08	5.23	3.96	0.45880	.	0.810801	0.10621	N	0.653331	T	0.31420	0.0796	N	0.25201	0.72	0.28399	N	0.918739	B;B;B	0.31459	0.324;0.012;0.034	B;B;B	0.27076	0.076;0.012;0.006	T	0.20739	-1.0266	10	0.02654	T	1	.	8.5702	0.33565	0.8051:0.1949:0.0:0.0	.	101;51;51	B7Z6J6;B7ZLC3;Q8N7C3	.;.;TRIMM_HUMAN	L	51;51;101	ENSP00000422581:F51L;ENSP00000317498:F51L;ENSP00000441236:F101L	ENSP00000317498:F51L	F	-	3	2	TRIML2	189259381	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	0.555000	0.23422	2.279000	0.76181	0.533000	0.62120	TTT	.	.		0.363	TRIML2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359733.1	NM_173553	
FBXL7	23194	hgsc.bcm.edu	37	5	15928342	15928342	+	Silent	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr5:15928342C>T	ENST00000504595.1	+	3	952	c.471C>T	c.(469-471)atC>atT	p.I157I	FBXL7_ENST00000510662.1_Silent_p.I110I|FBXL7_ENST00000329673.7_Silent_p.I145I	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	157	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GGAGGACTATCCGCCTGACGG	0.657																																					p.I157I		Atlas-SNP	.											.	FBXL7	138	.	0			c.C471T						.						18.0	23.0	21.0					5																	15928342		2084	4204	6288	SO:0001819	synonymous_variant	23194	exon3			GACTATCCGCCTG	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.471C>T	chr5.hg19:g.15928342C>T		92.0	0.0		65.0	18.0	NM_012304	B9EGF1|D6RDY7|O94926	Silent	SNP	ENST00000504595.1	hg19	CCDS54833.1																																																																																			.	.		0.657	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
FYB	2533	hgsc.bcm.edu	37	5	39141216	39141216	+	Silent	SNP	A	A	G	rs533406048		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr5:39141216A>G	ENST00000351578.6	-	4	1510	c.1320T>C	c.(1318-1320)gaT>gaC	p.D440D	FYB_ENST00000505428.1_Silent_p.D440D|FYB_ENST00000540520.1_Silent_p.D450D|FYB_ENST00000512982.1_Silent_p.D440D|FYB_ENST00000515010.1_Silent_p.D440D	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	440	Interaction with SKAP1.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			GCGTGACACCATCTTGATTGT	0.358													a|||	1	0.000199681	0.0	0.0	5008	,	,		19531	0.001		0.0	False		,,,				2504	0.0				p.D450D		Atlas-SNP	.											.	FYB	354	.	0			c.T1350C						.						66.0	59.0	61.0					5																	39141216		1880	4122	6002	SO:0001819	synonymous_variant	2533	exon4			GACACCATCTTGA	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1320T>C	chr5.hg19:g.39141216A>G		350.0	0.0		302.0	99.0	NM_001243093	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	ENST00000351578.6	hg19	CCDS47200.1																																																																																			.	.		0.358	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
FCHSD1	89848	hgsc.bcm.edu	37	5	141027040	141027040	+	Silent	SNP	G	G	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr5:141027040G>C	ENST00000435817.2	-	9	803	c.753C>G	c.(751-753)tcC>tcG	p.S251S	FCHSD1_ENST00000522126.1_Silent_p.S175S|FCHSD1_ENST00000522783.1_Silent_p.S249S|FCHSD1_ENST00000523856.1_5'UTR	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	251									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGGCTCAGGGAGGTCAGGG	0.612																																					p.S251S		Atlas-SNP	.											.	FCHSD1	51	.	0			c.C753G						.						35.0	39.0	38.0					5																	141027040		1930	4141	6071	SO:0001819	synonymous_variant	89848	exon9			GCTCAGGGAGGTC	AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.753C>G	chr5.hg19:g.141027040G>C		149.0	0.0		121.0	41.0	NM_033449	Q6UX75|Q86Y77|Q9NXX8	Silent	SNP	ENST00000435817.2	hg19	CCDS47295.1																																																																																			.	.		0.612	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375282.2	NM_033449	
SH3RF2	153769	hgsc.bcm.edu	37	5	145435595	145435595	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr5:145435595G>A	ENST00000511217.1	+	7	1426	c.1374G>A	c.(1372-1374)tgG>tgA	p.W458*	SH3RF2_ENST00000359120.4_Nonsense_Mutation_p.W458*|SH3RF2_ENST00000511705.1_3'UTR			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	458					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACACCACATGGACGTTATCCA	0.463																																					p.W458X		Atlas-SNP	.											.	SH3RF2	58	.	0			c.G1374A						.						178.0	177.0	177.0					5																	145435595		2203	4300	6503	SO:0001587	stop_gained	153769	exon8			CACATGGACGTTA	AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1374G>A	chr5.hg19:g.145435595G>A	ENSP00000424497:p.Trp458*	105.0	0.0		109.0	46.0	NM_152550	A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Nonsense_Mutation	SNP	ENST00000511217.1	hg19	CCDS4280.1	.	.	.	.	.	.	.	.	.	.	G	40	8.270784	0.98735	.	.	ENSG00000156463	ENST00000359120;ENST00000511217	.	.	.	5.67	5.67	0.87782	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-14.5098	18.5412	0.91029	0.0:0.0:1.0:0.0	.	.	.	.	X	458	.	ENSP00000352028:W458X	W	+	3	0	SH3RF2	145415788	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	6.313000	0.72844	2.659000	0.90383	0.655000	0.94253	TGG	.	.		0.463	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372804.1	NM_152550	
CLK4	57396	hgsc.bcm.edu	37	5	178043943	178043943	+	Missense_Mutation	SNP	A	A	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr5:178043943A>C	ENST00000316308.4	-	5	650	c.482T>G	c.(481-483)aTc>aGc	p.I161S	CLK4_ENST00000522749.1_5'UTR|RN7SKP70_ENST00000516655.1_RNA	NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	161	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		AGTGTCCACGATTTCATCTAG	0.368																																					p.I161S		Atlas-SNP	.											.	CLK4	103	.	0			c.T482G						.						100.0	93.0	95.0					5																	178043943		2203	4300	6503	SO:0001583	missense	57396	exon5			TCCACGATTTCAT	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.482T>G	chr5.hg19:g.178043943A>C	ENSP00000316948:p.Ile161Ser	313.0	0.0		304.0	89.0	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	hg19	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.709522	0.48517	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.23348	1.91	5.38	5.38	0.77491	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	M	0.71920	2.185	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.53308	-0.8457	10	0.87932	D	0	.	13.3639	0.60671	1.0:0.0:0.0:0.0	.	161;161;161	B7ZL31;B9EG64;Q9HAZ1	.;.;CLK4_HUMAN	S	161	ENSP00000316948:I161S	ENSP00000316948:I161S	I	-	2	0	CLK4	177976549	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.157000	0.94714	2.047000	0.60756	0.528000	0.53228	ATC	.	.		0.368	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
BTN2A2	10385	hgsc.bcm.edu	37	6	26388421	26388421	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr6:26388421C>T	ENST00000356709.4	+	4	734	c.623C>T	c.(622-624)aCc>aTc	p.T208I	BTN2A2_ENST00000432533.2_Intron|BTN2A2_ENST00000352867.2_Missense_Mutation_p.T92I|BTN2A2_ENST00000469230.1_Missense_Mutation_p.T208I|BTN2A2_ENST00000416795.2_Missense_Mutation_p.T208I|BTN2A2_ENST00000482536.1_Intron	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	208	Ig-like C2-type.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						TTCATGGTCACCACAGCTGTG	0.542																																					p.T208I		Atlas-SNP	.											.	BTN2A2	87	.	0			c.C623T						.						163.0	136.0	145.0					6																	26388421		2203	4300	6503	SO:0001583	missense	10385	exon4			TGGTCACCACAGC	U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.623C>T	chr6.hg19:g.26388421C>T	ENSP00000349143:p.Thr208Ile	110.0	0.0		109.0	37.0	NM_001197238	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	ENST00000356709.4	hg19	CCDS4606.1	.	.	.	.	.	.	.	.	.	.	c	16.01	3.000407	0.54147	.	.	ENSG00000124508	ENST00000469230;ENST00000490025;ENST00000356709;ENST00000352867;ENST00000493275;ENST00000472507;ENST00000482842;ENST00000416795;ENST00000483410	T;T;T;T;T;T;T;T;T	0.56103	2.53;0.48;2.53;2.53;2.53;2.53;2.13;2.53;2.53	4.11	2.16	0.27623	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like fold (1);	0.391203	0.22451	N	0.059894	T	0.52141	0.1716	M	0.67953	2.075	0.09310	N	1	D;D;D;P	0.71674	0.998;0.99;0.991;0.707	D;P;P;P	0.73380	0.98;0.843;0.903;0.703	T	0.38607	-0.9653	10	0.51188	T	0.08	.	8.4152	0.32668	0.174:0.6576:0.1684:0.0	.	92;208;92;208	B4E3J1;Q8WVV5-2;A6NM84;Q8WVV5	.;.;.;BT2A2_HUMAN	I	208;3;208;92;208;92;3;208;92	ENSP00000417472:T208I;ENSP00000418965:T3I;ENSP00000349143:T208I;ENSP00000337117:T92I;ENSP00000418857:T208I;ENSP00000419226:T92I;ENSP00000417676:T3I;ENSP00000399308:T208I;ENSP00000418176:T92I	ENSP00000337117:T92I	T	+	2	0	BTN2A2	26496400	0.000000	0.05858	0.101000	0.21167	0.023000	0.10783	-0.160000	0.10041	0.705000	0.31890	0.454000	0.30748	ACC	.	.		0.542	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040117.1		
GPR110	266977	hgsc.bcm.edu	37	6	46977900	46977900	+	Missense_Mutation	SNP	A	A	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr6:46977900A>C	ENST00000371253.2	-	11	1486	c.1271T>G	c.(1270-1272)tTt>tGt	p.F424C	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Missense_Mutation_p.F227C	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	424					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						TTTCCGAGAAAAATTCAGAGG	0.428																																					p.F424C		Atlas-SNP	.											.	GPR110	102	.	0			c.T1271G						.						78.0	76.0	77.0					6																	46977900		2203	4300	6503	SO:0001583	missense	266977	exon11			CGAGAAAAATTCA	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.1271T>G	chr6.hg19:g.46977900A>C	ENSP00000360299:p.Phe424Cys	141.0	0.0		105.0	43.0	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	ENST00000371253.2	hg19	CCDS34471.1	.	.	.	.	.	.	.	.	.	.	A	14.91	2.677028	0.47886	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000283297	T;T	0.35048	1.34;1.33	5.35	5.35	0.76521	.	0.343109	0.25408	N	0.030888	T	0.23094	0.0558	L	0.59436	1.845	0.34765	D	0.73309	P	0.51791	0.948	B	0.43155	0.41	T	0.28996	-1.0026	10	0.66056	D	0.02	-5.3984	9.1886	0.37184	0.796:0.0:0.0:0.204	.	424	Q5T601	GP110_HUMAN	C	424;424;227	ENSP00000360299:F424C;ENSP00000283297:F227C	ENSP00000283297:F227C	F	-	2	0	GPR110	47085859	0.958000	0.32768	0.701000	0.30321	0.501000	0.33797	4.207000	0.58480	2.150000	0.67090	0.454000	0.30748	TTT	.	.		0.428	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
SNX14	57231	hgsc.bcm.edu	37	6	86277255	86277255	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr6:86277255T>A	ENST00000314673.3	-	5	634	c.458A>T	c.(457-459)tAc>tTc	p.Y153F	SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000505648.1_Missense_Mutation_p.Y101F|SNX14_ENST00000369627.2_Missense_Mutation_p.Y153F|RP11-321N4.5_ENST00000503906.1_3'UTR|SNX14_ENST00000513865.1_Missense_Mutation_p.Y153F|SNX14_ENST00000346348.3_Intron	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	153	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		AACATACCTGTACCACGGATA	0.269																																					p.Y153F		Atlas-SNP	.											.	SNX14	58	.	0			c.A458T						.						74.0	77.0	76.0					6																	86277255		2203	4298	6501	SO:0001583	missense	57231	exon5			TACCTGTACCACG	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.458A>T	chr6.hg19:g.86277255T>A	ENSP00000313121:p.Tyr153Phe	807.0	0.0		704.0	221.0	NM_153816	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	ENST00000314673.3	hg19	CCDS5004.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.754308	0.89843	.	.	ENSG00000135317	ENST00000314673;ENST00000513865;ENST00000505648;ENST00000369627;ENST00000515216;ENST00000514419	T;T;T;T;T	0.64260	0.24;-0.09;0.29;0.25;0.28	5.77	5.77	0.91146	Phox-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.59487	0.2197	L	0.50993	1.605	0.80722	D	1	B;P;B	0.39883	0.22;0.693;0.22	B;P;B	0.48982	0.108;0.597;0.1	T	0.63791	-0.6557	10	0.54805	T	0.06	.	16.1043	0.81209	0.0:0.0:0.0:1.0	.	153;153;101	Q9Y5W7-4;Q9Y5W7;Q9Y5W7-3	.;SNX14_HUMAN;.	F	153;153;101;153;80;152	ENSP00000313121:Y153F;ENSP00000420938:Y153F;ENSP00000427380:Y101F;ENSP00000358641:Y153F;ENSP00000425630:Y80F	ENSP00000313121:Y153F	Y	-	2	0	SNX14	86333974	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.501000	0.81600	2.201000	0.70794	0.528000	0.53228	TAC	.	.		0.269	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041393.2	NM_153816	
TPD52L1	7164	hgsc.bcm.edu	37	6	125584049	125584049	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr6:125584049A>G	ENST00000534000.1	+	7	852	c.556A>G	c.(556-558)Agt>Ggt	p.S186G	TPD52L1_ENST00000524679.1_3'UTR|TPD52L1_ENST00000532429.1_Missense_Mutation_p.S157G|HDDC2_ENST00000608456.1_Intron|TPD52L1_ENST00000392482.2_3'UTR|TPD52L1_ENST00000530868.1_3'UTR|TPD52L1_ENST00000527711.1_Missense_Mutation_p.S173G|TPD52L1_ENST00000368388.2_3'UTR|TPD52L1_ENST00000368402.5_3'UTR|TPD52L1_ENST00000304877.13_Missense_Mutation_p.S191G|TPD52L1_ENST00000534199.1_3'UTR|TPD52L1_ENST00000528193.1_3'UTR	NM_003287.2	NP_003278.1	Q16890	TPD53_HUMAN	tumor protein D52-like 1	186					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|prostate(1)	5			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0265)		GGCCCATGCCAGTGCCCAGAG	0.582																																					p.S186G		Atlas-SNP	.											.	TPD52L1	14	.	0			c.A556G						.						51.0	47.0	49.0					6																	125584049		2203	4300	6503	SO:0001583	missense	7164	exon7			CATGCCAGTGCCC	U44427	CCDS5130.1, CCDS34527.1, CCDS34528.1, CCDS43502.1, CCDS75513.1, CCDS75514.1	6q22-q23	2008-07-29			ENSG00000111907	ENSG00000111907			12006	protein-coding gene	gene with protein product		604069				8812487, 16112108	Standard	NM_003287		Approved	D53, hD53	uc003pzu.1	Q16890	OTTHUMG00000015505	ENST00000534000.1:c.556A>G	chr6.hg19:g.125584049A>G	ENSP00000434142:p.Ser186Gly	98.0	0.0		79.0	28.0	NM_003287	A8K757|A8K772|A8MUD2|A8MUJ7|A8MW70|F6V707|O43397|Q5TC99|Q5TDQ0|Q9BUQ6|Q9C054	Missense_Mutation	SNP	ENST00000534000.1	hg19	CCDS5130.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.237369	0.79800	.	.	ENSG00000111907	ENST00000304877;ENST00000534000;ENST00000527711;ENST00000532429;ENST00000392484	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.53	5.53	0.82687	.	0.038889	0.85682	D	0.000000	T	0.44993	0.1320	M	0.70275	2.135	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	T	0.41124	-0.9526	10	0.17832	T	0.49	-3.3036	13.1952	0.59734	1.0:0.0:0.0:0.0	.	186	Q16890	TPD53_HUMAN	G	191;186;173;157;186	ENSP00000306285:S191G;ENSP00000434142:S186G;ENSP00000436953:S173G;ENSP00000435447:S157G	ENSP00000306285:S191G	S	+	1	0	TPD52L1	125625748	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.115000	0.57865	2.104000	0.64026	0.528000	0.53228	AGT	.	.		0.582	TPD52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042065.2		
LAMA2	3908	hgsc.bcm.edu	37	6	129468191	129468191	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr6:129468191A>T	ENST00000421865.2	+	6	956	c.907A>T	c.(907-909)Aat>Tat	p.N303Y		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	303	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TCCAGCGACAAATGTATGTAT	0.428																																					p.N303Y		Atlas-SNP	.											.	LAMA2	481	.	0			c.A907T						.						167.0	157.0	161.0					6																	129468191		2203	4299	6502	SO:0001583	missense	3908	exon6			GCGACAAATGTAT	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.907A>T	chr6.hg19:g.129468191A>T	ENSP00000400365:p.Asn303Tyr	120.0	0.0		72.0	26.0	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	hg19	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.353406	0.82243	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.63744	-0.06	5.61	5.61	0.85477	EGF-like, laminin (3);	0.054064	0.64402	D	0.000001	T	0.58495	0.2126	N	0.16266	0.395	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.71184	0.972;0.948	T	0.68168	-0.5480	10	0.72032	D	0.01	.	16.101	0.81172	1.0:0.0:0.0:0.0	.	303;303	A6NF00;P24043	.;LAMA2_HUMAN	Y	303	ENSP00000400365:N303Y	ENSP00000346769:N303Y	N	+	1	0	LAMA2	129509884	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.851000	0.92205	2.263000	0.75096	0.528000	0.53228	AAT	.	.		0.428	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
LFNG	3955	hgsc.bcm.edu	37	7	2559888	2559888	+	Silent	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr7:2559888C>T	ENST00000222725.5	+	1	413	c.393C>T	c.(391-393)gaC>gaT	p.D131D	LFNG_ENST00000402045.1_Intron|LFNG_ENST00000338732.3_Intron|LFNG_ENST00000359574.3_Silent_p.D131D|LFNG_ENST00000402506.1_Intron	NM_001040167.1	NP_001035257.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	131					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		CGCGCCTCGACCTGCTGCTGG	0.721																																					p.D131D		Atlas-SNP	.											.	LFNG	57	.	0			c.C393T						.						18.0	23.0	21.0					7																	2559888		2063	4182	6245	SO:0001819	synonymous_variant	3955	exon1			CCTCGACCTGCTG	BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	ENST00000222725.5:c.393C>T	chr7.hg19:g.2559888C>T		1341.0	2.0		1149.0	358.0	NM_001040167	B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Silent	SNP	ENST00000222725.5	hg19	CCDS34587.1																																																																																			.	.		0.721	LFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325021.1	NM_002304	
RFC2	5982	hgsc.bcm.edu	37	7	73663436	73663436	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr7:73663436T>A	ENST00000055077.3	-	4	298	c.238A>T	c.(238-240)Acc>Tcc	p.T80S	RFC2_ENST00000352131.3_Missense_Mutation_p.T80S	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	80					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						GTCTTGCCGGTTCCTGGAGGG	0.527																																					p.T80S		Atlas-SNP	.											.	RFC2	27	.	0			c.A238T						.						69.0	73.0	72.0					7																	73663436		2203	4300	6503	SO:0001583	missense	5982	exon4			TGCCGGTTCCTGG		CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.238A>T	chr7.hg19:g.73663436T>A	ENSP00000055077:p.Thr80Ser	48.0	0.0		53.0	15.0	NM_181471	B5BU07|D3DXG3|P32846|Q9BU93	Missense_Mutation	SNP	ENST00000055077.3	hg19	CCDS5568.1	.	.	.	.	.	.	.	.	.	.	T	17.98	3.520300	0.64747	.	.	ENSG00000049541	ENST00000352131;ENST00000055077	T;D	0.94650	0.96;-3.48	4.65	4.65	0.58169	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.094647	0.64402	D	0.000001	D	0.92368	0.7578	L	0.31578	0.945	0.58432	D	0.999999	B;B;P	0.37276	0.38;0.434;0.589	B;P;B	0.46208	0.373;0.507;0.41	D	0.92806	0.6260	10	0.87932	D	0	.	11.7504	0.51845	0.0:0.0:0.0:1.0	.	80;80;80	P35250-2;Q75MT5;P35250	.;.;RFC2_HUMAN	S	80	ENSP00000275627:T80S;ENSP00000055077:T80S	ENSP00000055077:T80S	T	-	1	0	RFC2	73301372	1.000000	0.71417	0.728000	0.30774	0.518000	0.34316	7.656000	0.83736	1.879000	0.54435	0.374000	0.22700	ACC	.	.		0.527	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2	NM_181471	
MUC17	140453	hgsc.bcm.edu	37	7	100681407	100681407	+	Missense_Mutation	SNP	C	C	T	rs201523803		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr7:100681407C>T	ENST00000306151.4	+	3	6774	c.6710C>T	c.(6709-6711)gCt>gTt	p.A2237V		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2237	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTTCTGAGGCTAGCACCCTT	0.502																																					p.A2237V		Atlas-SNP	.											.	MUC17	804	.	0			c.C6710T						.						346.0	342.0	343.0					7																	100681407		2203	4300	6503	SO:0001583	missense	140453	exon3			CTGAGGCTAGCAC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6710C>T	chr7.hg19:g.100681407C>T	ENSP00000302716:p.Ala2237Val	81.0	0.0		82.0	7.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	0.948	-0.707469	0.03230	.	.	ENSG00000169876	ENST00000306151	T	0.02656	4.21	1.3	-2.61	0.06171	.	.	.	.	.	T	0.01765	0.0056	L	0.27053	0.805	0.09310	N	1	B	0.21821	0.061	B	0.10450	0.005	T	0.46992	-0.9151	9	0.21014	T	0.42	.	2.1159	0.03713	0.2458:0.3783:0.0:0.3758	.	2237	Q685J3	MUC17_HUMAN	V	2237	ENSP00000302716:A2237V	ENSP00000302716:A2237V	A	+	2	0	MUC17	100468127	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	0.508000	0.22692	-1.786000	0.01269	-1.404000	0.01136	GCT	.	.		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
RNF133	168433	hgsc.bcm.edu	37	7	122338822	122338822	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr7:122338822G>A	ENST00000340112.2	-	1	388	c.151C>T	c.(151-153)Cat>Tat	p.H51Y	CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	51					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						GACAACACATGATTCCCAACA	0.423																																					p.H51Y	Colon(198;1778 2057 7449 19869 45985)	Atlas-SNP	.											.	RNF133	41	.	0			c.C151T						.						118.0	115.0	116.0					7																	122338822		2203	4300	6503	SO:0001583	missense	168433	exon1			ACACATGATTCCC	AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.151C>T	chr7.hg19:g.122338822G>A	ENSP00000344489:p.His51Tyr	111.0	0.0		88.0	25.0	NM_139175	A4D0W2|Q8N7G7	Missense_Mutation	SNP	ENST00000340112.2	hg19	CCDS5784.1	.	.	.	.	.	.	.	.	.	.	G	8.492	0.862178	0.17178	.	.	ENSG00000188050	ENST00000340112	T	0.13657	2.57	6.06	6.06	0.98353	.	0.238580	0.32444	N	0.006082	T	0.07188	0.0182	N	0.08118	0	0.28435	N	0.917088	B	0.02656	0.0	B	0.01281	0.0	T	0.26744	-1.0094	10	0.09590	T	0.72	.	14.0173	0.64531	0.0:0.0:0.7505:0.2495	.	51	Q8WVZ7	RN133_HUMAN	Y	51	ENSP00000344489:H51Y	ENSP00000344489:H51Y	H	-	1	0	RNF133	122126058	0.503000	0.26115	0.971000	0.41717	0.555000	0.35460	1.719000	0.38011	2.882000	0.98803	0.655000	0.94253	CAT	.	.		0.423	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347413.1	NM_139175	
DNAJB6	10049	hgsc.bcm.edu	37	7	157155909	157155909	+	Missense_Mutation	SNP	A	A	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr7:157155909A>C	ENST00000262177.4	+	3	325	c.120A>C	c.(118-120)gaA>gaC	p.E40D	DNAJB6_ENST00000429029.2_Missense_Mutation_p.E40D|DNAJB6_ENST00000443280.1_Missense_Mutation_p.E40D|DNAJB6_ENST00000452797.2_Intron	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	40	Interaction with HSP70.|J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AGAATAAAGAAGAAGCAGAGA	0.453																																					p.E40D	Esophageal Squamous(46;195 967 1350 20350 43814)	Atlas-SNP	.											.	DNAJB6	39	.	0			c.A120C						.						46.0	46.0	46.0					7																	157155909		2203	4297	6500	SO:0001583	missense	10049	exon3			TAAAGAAGAAGCA	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.120A>C	chr7.hg19:g.157155909A>C	ENSP00000262177:p.Glu40Asp	168.0	0.0		179.0	58.0	NM_058246	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Missense_Mutation	SNP	ENST00000262177.4	hg19	CCDS5946.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.957214	0.73902	.	.	ENSG00000105993	ENST00000441561;ENST00000429029;ENST00000262177;ENST00000417758;ENST00000443280;ENST00000421417;ENST00000437030;ENST00000412557;ENST00000453383;ENST00000439402	T;T;T;T;T;T;T;T;T	0.75704	1.41;1.41;1.41;1.41;1.41;1.41;1.41;1.41;-0.96	4.78	2.31	0.28768	Heat shock protein DnaJ, N-terminal (5);	0.603238	0.13016	U	0.420467	T	0.74726	0.3754	L	0.37561	1.115	0.80722	D	1	B;D;D;B	0.64830	0.196;0.994;0.988;0.0	B;D;D;B	0.66847	0.38;0.922;0.947;0.002	T	0.68108	-0.5496	10	0.42905	T	0.14	.	4.0204	0.09664	0.4009:0.0:0.1582:0.441	.	40;40;40;40	E9PH18;A8KAG0;O75190;O75190-2	.;.;DNJB6_HUMAN;.	D	40	ENSP00000410643:E40D;ENSP00000397556:E40D;ENSP00000262177:E40D;ENSP00000400665:E40D;ENSP00000396267:E40D;ENSP00000391690:E40D;ENSP00000403407:E40D;ENSP00000396240:E40D;ENSP00000389599:E40D	ENSP00000262177:E40D	E	+	3	2	DNAJB6	156848670	0.081000	0.21417	1.000000	0.80357	0.984000	0.73092	-0.832000	0.04400	0.255000	0.21593	0.528000	0.53228	GAA	.	.		0.453	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
RP1L1	94137	hgsc.bcm.edu	37	8	10466108	10466108	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr8:10466108C>T	ENST00000382483.3	-	4	5723	c.5500G>A	c.(5500-5502)Ggc>Agc	p.G1834S		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1914					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GCCTCTATGCCTTCGGCCCCA	0.637																																					p.G1834S		Atlas-SNP	.											.	RP1L1	453	.	0			c.G5500A						.						149.0	166.0	161.0					8																	10466108		2007	4158	6165	SO:0001583	missense	94137	exon4			CTATGCCTTCGGC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5500G>A	chr8.hg19:g.10466108C>T	ENSP00000371923:p.Gly1834Ser	54.0	0.0		27.0	11.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	hg19	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	3.788	-0.044322	0.07452	.	.	ENSG00000183638	ENST00000382483	T	0.03772	3.81	2.95	2.95	0.34219	.	.	.	.	.	T	0.02494	0.0076	N	0.14661	0.345	0.09310	N	1	P	0.41524	0.753	B	0.35688	0.208	T	0.26155	-1.0111	9	0.07030	T	0.85	.	9.2877	0.37766	0.0:1.0:0.0:0.0	.	1834	A6NKC6	.	S	1834	ENSP00000371923:G1834S	ENSP00000371923:G1834S	G	-	1	0	RP1L1	10503518	.	.	0.007000	0.13788	0.026000	0.11368	.	.	1.156000	0.42514	0.455000	0.32223	GGC	.	.		0.637	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
PURG	29942	hgsc.bcm.edu	37	8	30890148	30890148	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr8:30890148C>T	ENST00000475541.1	-	1	1083	c.151G>A	c.(151-153)Gcc>Acc	p.A51T	PURG_ENST00000339382.2_Missense_Mutation_p.A51T|WRN_ENST00000298139.5_5'Flank	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	51						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		GCGCCCCCGGCCTGATTAGGG	0.597																																					p.A51T		Atlas-SNP	.											.	PURG	79	.	0			c.G151A						.						23.0	25.0	24.0					8																	30890148		2203	4300	6503	SO:0001583	missense	29942	exon1			CCCCGGCCTGATT	AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.151G>A	chr8.hg19:g.30890148C>T	ENSP00000418721:p.Ala51Thr	83.0	0.0		48.0	23.0	NM_013357	Q8TE64	Missense_Mutation	SNP	ENST00000475541.1	hg19	CCDS6081.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.488962	0.26686	.	.	ENSG00000172733	ENST00000339382;ENST00000475541	T;T	0.22134	1.97;1.98	4.9	-0.777	0.10981	.	0.836318	0.10506	N	0.666717	T	0.07863	0.0197	N	0.08118	0	0.21740	N	0.999569	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.35574	-0.9783	10	0.23891	T	0.37	2.8603	1.8219	0.03112	0.2532:0.3665:0.2348:0.1455	.	51;51	Q9UJV8;Q9UJV8-2	PURG_HUMAN;.	T	51	ENSP00000345168:A51T;ENSP00000418721:A51T	ENSP00000345168:A51T	A	-	1	0	PURG	31009690	0.424000	0.25490	0.199000	0.23439	0.950000	0.60333	-0.158000	0.10070	-0.204000	0.10235	0.313000	0.20887	GCC	.	.		0.597	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348565.1	NM_013357	
TTI2	80185	hgsc.bcm.edu	37	8	33356779	33356779	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr8:33356779A>T	ENST00000431156.2	-	8	2057	c.1439T>A	c.(1438-1440)aTt>aAt	p.I480N	TTI2_ENST00000519356.1_Intron|TTI2_ENST00000360742.5_Missense_Mutation_p.I480N|MAK16_ENST00000360128.6_3'UTR|TTI2_ENST00000520636.1_Missense_Mutation_p.I449N	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	480																	GCTTTGGGGAATTTTGGCCAG	0.388																																					p.I480N		Atlas-SNP	.											.	.	.	.	0			c.T1439A						.						86.0	85.0	86.0					8																	33356779		2203	4300	6503	SO:0001583	missense	80185	exon8			TGGGGAATTTTGG	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1439T>A	chr8.hg19:g.33356779A>T	ENSP00000411169:p.Ile480Asn	121.0	0.0		81.0	39.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	A	12.00	1.805625	0.31961	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636;ENST00000520397	T;T;T	0.61040	0.14;0.14;0.16	5.94	1.91	0.25777	.	0.318102	0.28470	N	0.015238	T	0.47303	0.1438	M	0.67953	2.075	0.09310	N	1	P;P;P	0.45902	0.718;0.779;0.868	B;B;B	0.36808	0.125;0.233;0.233	T	0.49133	-0.8971	10	0.87932	D	0	-6.4158	6.0646	0.19856	0.6804:0.1512:0.1684:0.0	.	315;480;449	E5RH83;Q6NXR4;E5RIH5	.;TTI2_HUMAN;.	N	480;480;469;449;315	ENSP00000353971:I480N;ENSP00000411169:I480N;ENSP00000428401:I449N	ENSP00000353971:I480N	I	-	2	0	C8orf41	33476321	0.000000	0.05858	0.026000	0.17262	0.656000	0.38851	0.329000	0.19698	0.507000	0.28148	0.460000	0.39030	ATT	.	.		0.388	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
DPYS	1807	hgsc.bcm.edu	37	8	105456619	105456619	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr8:105456619T>A	ENST00000351513.2	-	4	782	c.650A>T	c.(649-651)cAc>cTc	p.H217L		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	217					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GCACAGCTCGTGGCCCTCAGG	0.532																																					p.H217L		Atlas-SNP	.											.	DPYS	107	.	0			c.A650T						.						63.0	60.0	61.0					8																	105456619		2203	4300	6503	SO:0001583	missense	1807	exon4			AGCTCGTGGCCCT	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.650A>T	chr8.hg19:g.105456619T>A	ENSP00000276651:p.His217Leu	89.0	0.0		89.0	18.0	NM_001385		Missense_Mutation	SNP	ENST00000351513.2	hg19	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	T	33	5.226619	0.95173	.	.	ENSG00000147647	ENST00000351513	D	0.91124	-2.79	5.67	5.67	0.87782	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.95689	0.8598	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96225	0.9163	10	0.72032	D	0.01	-16.638	15.9141	0.79496	0.0:0.0:0.0:1.0	.	217	Q14117	DPYS_HUMAN	L	217	ENSP00000276651:H217L	ENSP00000276651:H217L	H	-	2	0	DPYS	105525795	1.000000	0.71417	0.955000	0.39395	0.979000	0.70002	7.543000	0.82106	2.154000	0.67381	0.533000	0.62120	CAC	.	.		0.532	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	
ASAP1	50807	hgsc.bcm.edu	37	8	131146576	131146576	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr8:131146576G>A	ENST00000518721.1	-	15	1410	c.1183C>T	c.(1183-1185)Cac>Tac	p.H395Y	ASAP1_ENST00000357668.1_Missense_Mutation_p.H395Y	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	395	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						GCCTGAAAGTGATATGTTCTA	0.343																																					p.H395Y		Atlas-SNP	.											.	ASAP1	133	.	0			c.C1183T						.						123.0	112.0	115.0					8																	131146576		2202	4300	6502	SO:0001583	missense	50807	exon15			GAAAGTGATATGT	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1183C>T	chr8.hg19:g.131146576G>A	ENSP00000429900:p.His395Tyr	80.0	0.0		92.0	25.0	NM_018482	B2RNV3	Missense_Mutation	SNP	ENST00000518721.1	hg19	CCDS6362.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.766829|4.766829	0.90020|0.90020	.|.	.|.	ENSG00000153317|ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721|ENST00000524124	T;T|.	0.74526|.	-0.85;-0.85|.	5.95|5.95	5.95|5.95	0.96441|0.96441	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72011|0.72011	0.3408|0.3408	L|L	0.53671|0.53671	1.685|1.685	0.80722|0.80722	D|D	1|1	D;D;D|.	0.62365|.	0.991;0.991;0.988|.	D;D;D|.	0.74348|.	0.933;0.933;0.983|.	T|T	0.66881|0.66881	-0.5811|-0.5811	10|5	0.87932|.	D|.	0|.	.|.	19.3579|19.3579	0.94422|0.94422	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	395;395;398|.	B2RNV3;Q9ULH1;Q9ULH1-2|.	.;ASAP1_HUMAN;.|.	Y|L	398;395;395|215	ENSP00000350297:H395Y;ENSP00000429900:H395Y|.	ENSP00000344591:H398Y|.	H|S	-|-	1|2	0|0	ASAP1|ASAP1	131215758|131215758	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.959000|0.959000	0.62525|0.62525	9.230000|9.230000	0.95299|0.95299	2.811000|2.811000	0.96726|0.96726	0.655000|0.655000	0.94253|0.94253	CAC|TCA	.	.		0.343	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	
JRK	8629	hgsc.bcm.edu	37	8	143746721	143746721	+	RNA	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr8:143746721C>T	ENST00000507178.2	-	0	1089							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				gccttataggcgacgggcagg	0.577																																					p.A253T		Atlas-SNP	.											.	.	.	.	0			c.G757A						.						13.0	16.0	15.0					8																	143746721		1390	2781	4171			8629	exon2			TATAGGCGACGGG	AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			chr8.hg19:g.143746721C>T		101.0	0.0		132.0	27.0	NM_003724	O75565	Missense_Mutation	SNP	ENST00000507178.2	hg19																																																																																				.	.		0.577	JRK-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000362914.1	NM_003724	
SPATA31A3	727830	hgsc.bcm.edu	37	9	40702834	40702834	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr9:40702834A>T	ENST00000356699.5	+	4	520	c.491A>T	c.(490-492)gAt>gTt	p.D164V	SPATA31A3_ENST00000463536.1_3'UTR|RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	164	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.D164A(4)									CATCCTCAGGATCTGGCCTCC	0.587																																					p.D164V		Atlas-SNP	.											FAM75A3_ENST00000356699,NS,carcinoma,0,2	.	.	.	4	Substitution - Missense(4)	lung(4)	c.A491T						.						35.0	42.0	40.0					9																	40702834		1903	4100	6003	SO:0001583	missense	727830	exon4			CTCAGGATCTGGC			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.491A>T	chr9.hg19:g.40702834A>T	ENSP00000349132:p.Asp164Val	233.0	0.0		211.0	40.0	NM_001083124		Missense_Mutation	SNP	ENST00000356699.5	hg19	CCDS47969.1	.	.	.	.	.	.	.	.	.	.	A	3.105	-0.183859	0.06340	.	.	ENSG00000147926	ENST00000356699	T	0.04551	3.6	2.19	-1.07	0.09968	.	3.930080	0.00819	N	0.001570	T	0.03305	0.0096	L	0.34521	1.04	0.09310	N	1	P	0.41910	0.764	B	0.33295	0.161	T	0.37865	-0.9687	10	0.16420	T	0.52	0.3962	2.2476	0.04035	0.2503:0.4255:0.0:0.3242	.	164	Q5VYP0	F75A3_HUMAN	V	164	ENSP00000349132:D164V	ENSP00000349132:D164V	D	+	2	0	FAM75A3	40692834	0.020000	0.18652	0.002000	0.10522	0.019000	0.09904	-0.177000	0.09796	-0.262000	0.09392	-0.836000	0.03065	GAT	.	.		0.587	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036919.1	NM_001083124	
NTRK2	4915	hgsc.bcm.edu	37	9	87359941	87359941	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr9:87359941A>T	ENST00000323115.4	+	10	1602	c.1249A>T	c.(1249-1251)Atc>Ttc	p.I417F	NTRK2_ENST00000304053.6_Missense_Mutation_p.I417F|NTRK2_ENST00000395882.1_Missense_Mutation_p.I417F|NTRK2_ENST00000277120.3_Missense_Mutation_p.I417F|NTRK2_ENST00000376214.1_Missense_Mutation_p.I417F|NTRK2_ENST00000376208.1_Missense_Mutation_p.I417F|NTRK2_ENST00000376213.1_Missense_Mutation_p.I417F|NTRK2_ENST00000395866.2_Missense_Mutation_p.I261F|NTRK2_ENST00000359847.3_Missense_Mutation_p.I417F			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	417					activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	AAGTAATGAAATCCCTTCCAC	0.458										TSP Lung(25;0.17)																											p.I417F		Atlas-SNP	.											.	NTRK2	331	.	0			c.A1249T						.						191.0	177.0	181.0					9																	87359941		2203	4300	6503	SO:0001583	missense	4915	exon11			AATGAAATCCCTT	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1249A>T	chr9.hg19:g.87359941A>T	ENSP00000314586:p.Ile417Phe	183.0	0.0		175.0	44.0	NM_001018065	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	hg19	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	A	11.48	1.652788	0.29336	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	T;T;T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.45;-0.44;-0.43;-0.83;-0.83;-0.45;-0.43	6.17	6.17	0.99709	.	0.549739	0.20726	N	0.086818	T	0.61924	0.2386	L	0.28115	0.83	0.46981	D	0.999279	B;B;B;B;B;B;B;B	0.28258	0.041;0.041;0.068;0.13;0.0;0.021;0.103;0.205	B;B;B;B;B;B;B;B	0.32342	0.023;0.077;0.093;0.068;0.0;0.021;0.035;0.144	T	0.60449	-0.7261	10	0.39692	T	0.17	.	7.7612	0.28953	0.8522:0.0:0.1478:0.0	.	261;417;417;417;417;417;463;417	B4DFV9;Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;.;NTRK2_HUMAN;.;.;.	F	417;417;417;417;417;417;417;417;261	ENSP00000365387:I417F;ENSP00000365386:I417F;ENSP00000379221:I417F;ENSP00000365381:I417F;ENSP00000306167:I417F;ENSP00000277120:I417F;ENSP00000314586:I417F;ENSP00000352906:I417F;ENSP00000379207:I261F	ENSP00000277120:I417F	I	+	1	0	NTRK2	86549761	0.987000	0.35691	0.956000	0.39512	0.429000	0.31625	2.992000	0.49417	2.371000	0.80710	0.533000	0.62120	ATC	.	.		0.458	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
MSANTD3	91283	hgsc.bcm.edu	37	9	103212870	103212870	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr9:103212870C>A	ENST00000395067.2	+	3	721	c.450C>A	c.(448-450)tgC>tgA	p.C150*	MSANTD3_ENST00000374885.1_3'UTR|MSANTD3-TMEFF1_ENST00000502978.1_Intron|TMEFF1_ENST00000334943.6_Intron|MSANTD3_ENST00000489377.1_3'UTR	NM_001198805.1|NM_001198806.1|NM_080655.2	NP_001185734.1|NP_001185735.1|NP_542386.1	Q96H12	MSD3_HUMAN	Myb/SANT-like DNA-binding domain containing 3	150										endometrium(2)|lung(2)	4						GAGAACTGTGCGATGATGAGA	0.368																																					p.C150X		Atlas-SNP	.											.	MSANTD3	10	.	0			c.C450A						.						55.0	55.0	55.0					9																	103212870		2203	4300	6503	SO:0001587	stop_gained	91283	exon3			ACTGTGCGATGAT	BC008993	CCDS6749.1, CCDS56579.1	9q31.1	2012-03-13	2012-03-13	2012-03-13	ENSG00000066697	ENSG00000066697			23370	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 30"""	C9orf30			Standard	NM_080655		Approved	MGC17337		Q96H12	OTTHUMG00000020365	ENST00000395067.2:c.450C>A	chr9.hg19:g.103212870C>A	ENSP00000378506:p.Cys150*	144.0	0.0		134.0	54.0	NM_001198805	B2RC35|Q5T726|Q5T727|Q5T728	Nonsense_Mutation	SNP	ENST00000395067.2	hg19	CCDS6749.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799719	0.70567	.	.	ENSG00000066697	ENST00000395067;ENST00000374886	.	.	.	5.55	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.7043	6.2738	0.20969	0.0:0.7226:0.0:0.2774	.	.	.	.	X	150	.	ENSP00000364021:C150X	C	+	3	2	C9orf30	102252691	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.635000	0.46537	2.604000	0.88044	0.467000	0.42956	TGC	.	.		0.368	MSANTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053410.1	NM_080655	
KIAA0368	23392	hgsc.bcm.edu	37	9	114182326	114182326	+	Silent	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr9:114182326T>C	ENST00000338205.5	-	15	1749	c.1530A>G	c.(1528-1530)agA>agG	p.R510R	KIAA0368_ENST00000259335.4_Silent_p.R688R			Q5VYK3	ECM29_HUMAN	KIAA0368	516					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						GCAGCAAATATCTGGAAGGGA	0.358																																					p.R688R		Atlas-SNP	.											.	KIAA0368	144	.	0			c.A2064G						.						99.0	95.0	96.0					9																	114182326		1865	4105	5970	SO:0001819	synonymous_variant	23392	exon17			CAAATATCTGGAA	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1530A>G	chr9.hg19:g.114182326T>C		166.0	0.0		131.0	40.0	NM_001080398	O15074|Q8WU82	Silent	SNP	ENST00000338205.5	hg19																																																																																				.	.		0.358	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
TNC	3371	hgsc.bcm.edu	37	9	117848857	117848857	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr9:117848857C>T	ENST00000350763.4	-	3	1564	c.1153G>A	c.(1153-1155)Ggc>Agc	p.G385S	TNC_ENST00000346706.3_Missense_Mutation_p.G385S|TNC_ENST00000340094.3_Missense_Mutation_p.G385S|TNC_ENST00000423613.2_Missense_Mutation_p.G385S|TNC_ENST00000542877.1_Missense_Mutation_p.G385S|TNC_ENST00000345230.3_Missense_Mutation_p.G385S|TNC_ENST00000341037.4_Missense_Mutation_p.G385S|TNC_ENST00000535648.1_Missense_Mutation_p.G385S|TNC_ENST00000537320.1_Missense_Mutation_p.G385S	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	385	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						ACACAGCGGCCACGATTGTGA	0.607																																					p.G385S		Atlas-SNP	.											.	TNC	282	.	0			c.G1153A						.						127.0	111.0	117.0					9																	117848857		2203	4300	6503	SO:0001583	missense	3371	exon3			AGCGGCCACGATT		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.1153G>A	chr9.hg19:g.117848857C>T	ENSP00000265131:p.Gly385Ser	43.0	0.0		61.0	8.0	NM_002160	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	hg19	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	C	18.39	3.613747	0.66672	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	D;D;D;D;D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98;-1.98	5.44	5.44	0.79542	EGF, extracellular (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.93979	0.8072	M	0.90145	3.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94737	0.7915	10	0.87932	D	0	.	18.6123	0.91290	0.0:1.0:0.0:0.0	.	385;385	E9PC84;P24821	.;TENA_HUMAN	S	385	ENSP00000344400:G385S;ENSP00000438152:G385S;ENSP00000344555:G385S;ENSP00000345861:G385S;ENSP00000265131:G385S;ENSP00000339553:G385S;ENSP00000411406:G385S;ENSP00000443478:G385S;ENSP00000442242:G385S	ENSP00000344400:G385S	G	-	1	0	TNC	116888678	1.000000	0.71417	0.964000	0.40570	0.015000	0.08874	7.745000	0.85046	2.712000	0.92718	0.563000	0.77884	GGC	.	.		0.607	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
SMNDC1	10285	hgsc.bcm.edu	37	10	112055050	112055050	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr10:112055050T>C	ENST00000369603.5	-	5	718	c.515A>G	c.(514-516)gAg>gGg	p.E172G	SMNDC1_ENST00000471297.1_5'Flank|SMNDC1_ENST00000369592.1_Missense_Mutation_p.E172G	NM_005871.3	NP_005862.1	O75940	SPF30_HUMAN	survival motor neuron domain containing 1	172					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	4		Breast(234;0.174)		Epithelial(162;6.86e-05)|all cancers(201;0.00149)|BRCA - Breast invasive adenocarcinoma(275;0.119)		TTTCTGGTCCTCTCTTTCCTG	0.343																																					p.E172G		Atlas-SNP	.											.	SMNDC1	9	.	0			c.A515G						.						125.0	114.0	118.0					10																	112055050		2202	4299	6501	SO:0001583	missense	10285	exon5			TGGTCCTCTCTTT	AF083385	CCDS7565.1	10q23	2013-01-23			ENSG00000119953	ENSG00000119953		"""Tudor domain containing"""	16900	protein-coding gene	gene with protein product	"""splicing factor 30, survival of motor neuron-related"", ""tudor domain containing 16C"""	603519				9731529, 9817934	Standard	NM_005871		Approved	SPF30, SMNR, TDRD16C	uc001kzc.4	O75940	OTTHUMG00000019036	ENST00000369603.5:c.515A>G	chr10.hg19:g.112055050T>C	ENSP00000358616:p.Glu172Gly	116.0	0.0		103.0	23.0	NM_005871	B2RA27|D3DRB1|Q5T3K6	Missense_Mutation	SNP	ENST00000369603.5	hg19	CCDS7565.1	.	.	.	.	.	.	.	.	.	.	T	29.7	5.026528	0.93518	.	.	ENSG00000119953	ENST00000369603;ENST00000369592	D;D	0.88818	-2.43;-2.43	5.76	5.76	0.90799	.	0.113338	0.64402	D	0.000004	D	0.94689	0.8287	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.95248	0.8357	10	0.72032	D	0.01	-16.0076	16.0701	0.80919	0.0:0.0:0.0:1.0	.	172	O75940	SPF30_HUMAN	G	172	ENSP00000358616:E172G;ENSP00000358605:E172G	ENSP00000358605:E172G	E	-	2	0	SMNDC1	112045040	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.008000	0.88588	2.196000	0.70406	0.533000	0.62120	GAG	.	.		0.343	SMNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050325.2	NM_005871	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135101696	135101696	+	Silent	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr10:135101696C>T	ENST00000252936.3	-	10	1698	c.1659G>A	c.(1657-1659)gcG>gcA	p.A553A	TUBGCP2_ENST00000543663.1_Silent_p.A581A|TUBGCP2_ENST00000417178.2_Silent_p.A423A|TUBGCP2_ENST00000368563.2_Silent_p.A553A|TUBGCP2_ENST00000368562.1_Silent_p.A146A			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	553					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCTCCAGGAGCGCTTCCAGGC	0.667																																					p.A581A		Atlas-SNP	.											.	TUBGCP2	79	.	0			c.G1743A						.						61.0	59.0	60.0					10																	135101696		2203	4300	6503	SO:0001819	synonymous_variant	10844	exon12			CAGGAGCGCTTCC	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1659G>A	chr10.hg19:g.135101696C>T		109.0	0.0		92.0	6.0	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	ENST00000252936.3	hg19	CCDS7676.1																																																																																			.	.		0.667	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
OR5P3	120066	hgsc.bcm.edu	37	11	7847513	7847513	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:7847513T>C	ENST00000328375.1	-	1	6	c.7A>G	c.(7-9)Act>Gct	p.T3A	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153445.1	NP_703146.1	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P, member 3	3						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	15				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCATTTCCAGTCCCCATCTAT	0.328																																					p.T3A		Atlas-SNP	.											.	OR5P3	44	.	0			c.A7G						.						34.0	33.0	34.0					11																	7847513		2006	4067	6073	SO:0001583	missense	120066	exon1			TTCCAGTCCCCAT	AF158377	CCDS7783.1	11p15.4	2012-08-09			ENSG00000182334	ENSG00000182334		"""GPCR / Class A : Olfactory receptors"""	14784	protein-coding gene	gene with protein product							Standard	NM_153445		Approved	JCG1	uc010rbg.2	Q8WZ94	OTTHUMG00000165669	ENST00000328375.1:c.7A>G	chr11.hg19:g.7847513T>C	ENSP00000332068:p.Thr3Ala	61.0	0.0		64.0	24.0	NM_153445	Q6IFE1|Q8NGM2	Missense_Mutation	SNP	ENST00000328375.1	hg19	CCDS7783.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340713	0.05243	.	.	ENSG00000182334	ENST00000328375	T	0.00573	6.48	5.1	-5.8	0.02347	.	1.251370	0.05929	U	0.634871	T	0.00300	0.0009	N	0.04994	-0.135	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42799	-0.9430	10	0.09590	T	0.72	-5.849	3.7724	0.08647	0.2374:0.4727:0.121:0.169	.	3	Q8WZ94	OR5P3_HUMAN	A	3	ENSP00000332068:T3A	ENSP00000332068:T3A	T	-	1	0	OR5P3	7804089	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.155000	0.03163	-0.941000	0.03700	0.477000	0.44152	ACT	.	.		0.328	OR5P3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385697.1	NM_153445	
ABCC8	6833	hgsc.bcm.edu	37	11	17496572	17496572	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:17496572A>G	ENST00000389817.3	-	2	219	c.151T>C	c.(151-153)Tgg>Cgg	p.W51R	ABCC8_ENST00000302539.4_Missense_Mutation_p.W51R			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	51					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TGACTTCCCCATCCTGCAGGG	0.577																																					p.W51R		Atlas-SNP	.											.	ABCC8	170	.	0			c.T151C						.						153.0	96.0	116.0					11																	17496572		2200	4293	6493	SO:0001583	missense	6833	exon2			TTCCCCATCCTGC	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.151T>C	chr11.hg19:g.17496572A>G	ENSP00000374467:p.Trp51Arg	93.0	0.0		108.0	34.0	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	hg19	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.944147	0.73672	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.96104	-3.91;-3.91	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.95617	0.8575	M	0.63843	1.955	0.80722	D	1	P;D	0.56035	0.931;0.974	P;P	0.58577	0.566;0.841	D	0.94106	0.7366	10	0.02654	T	1	.	15.0494	0.71854	1.0:0.0:0.0:0.0	.	51;51	B7Z4N0;Q09428	.;ABCC8_HUMAN	R	51;51;65	ENSP00000374467:W51R;ENSP00000303960:W51R	ENSP00000303960:W51R	W	-	1	0	ABCC8	17453148	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.325000	0.96381	1.955000	0.56771	0.477000	0.44152	TGG	.	.		0.577	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33628362	33628362	+	Silent	SNP	C	C	T	rs375293606		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:33628362C>T	ENST00000321505.4	+	13	4344	c.4164C>T	c.(4162-4164)aaC>aaT	p.N1388N	KIAA1549L_ENST00000389726.3_Silent_p.N1394N			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1388						integral component of membrane (GO:0016021)		p.N1388N(1)									CAGTCCTCAACGGCGAGGTAA	0.587													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17845	0.0		0.0	False		,,,				2504	0.0				p.N1388N		Atlas-SNP	.											C11orf41_ENST00000321505,rectum,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4164T						.	C		5,4069		0,5,2032	20.0	22.0	21.0		4164	-6.9	0.9	11		21	1,8395		0,1,4197	no	coding-synonymous	C11orf41	NM_012194.2		0,6,6229	TT,TC,CC		0.0119,0.1227,0.0481		1388/1850	33628362	6,12464	2037	4198	6235	SO:0001819	synonymous_variant	25758	exon13			CCTCAACGGCGAG	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4164C>T	chr11.hg19:g.33628362C>T		116.0	0.0		79.0	23.0	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	hg19	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	C	4.733	0.136376	0.09032	0.001227	1.19E-4	ENSG00000110427	ENST00000526400	.	.	.	5.42	-6.9	0.01655	.	.	.	.	.	T	0.59542	0.2201	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63350	-0.6657	4	.	.	.	-17.5858	13.4248	0.61020	0.0:0.486:0.0:0.514	.	.	.	.	M	786	.	.	T	+	2	0	C11orf41	33584938	0.001000	0.12720	0.917000	0.36280	0.325000	0.28411	-2.225000	0.01212	-1.148000	0.02847	-0.263000	0.10527	ACG	.	.		0.587	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
OR5M3	219482	hgsc.bcm.edu	37	11	56237304	56237304	+	Silent	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:56237304G>A	ENST00000312240.2	-	1	710	c.670C>T	c.(670-672)Ctg>Ttg	p.L224L		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					CGCATTCGCAGAATGGCAATG	0.403																																					p.L224L		Atlas-SNP	.											.	OR5M3	103	.	0			c.C670T						.						69.0	68.0	68.0					11																	56237304		2201	4292	6493	SO:0001819	synonymous_variant	219482	exon1			TTCGCAGAATGGC	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.670C>T	chr11.hg19:g.56237304G>A		229.0	0.0		208.0	69.0	NM_001004742	B2RNM7|Q6IEW4|Q96RC0	Silent	SNP	ENST00000312240.2	hg19	CCDS31532.1																																																																																			.	.		0.403	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
SLC43A1	8501	hgsc.bcm.edu	37	11	57258721	57258721	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:57258721T>C	ENST00000278426.3	-	11	1524	c.1169A>G	c.(1168-1170)cAg>cGg	p.Q390R	SLC43A1_ENST00000528450.1_Missense_Mutation_p.Q390R|SLC43A1_ENST00000533515.1_5'Flank	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GACAGTGCCCTGAGTTGGGGC	0.572																																					p.Q390R		Atlas-SNP	.											.	SLC43A1	48	.	0			c.A1169G						.						57.0	51.0	53.0					11																	57258721		2201	4296	6497	SO:0001583	missense	8501	exon11			GTGCCCTGAGTTG	AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.1169A>G	chr11.hg19:g.57258721T>C	ENSP00000278426:p.Gln390Arg	130.0	0.0		118.0	40.0	NM_001198810		Missense_Mutation	SNP	ENST00000278426.3	hg19	CCDS7958.1	.	.	.	.	.	.	.	.	.	.	T	13.37	2.218096	0.39201	.	.	ENSG00000149150	ENST00000278426;ENST00000528450	T;T	0.21734	1.99;1.99	5.43	3.05	0.35203	Major facilitator superfamily domain, general substrate transporter (1);	1.192340	0.06122	N	0.668993	T	0.10852	0.0265	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37619	-0.9698	10	0.20046	T	0.44	-2.6129	5.4052	0.16318	0.0:0.0915:0.1766:0.732	.	390	O75387	LAT3_HUMAN	R	390	ENSP00000278426:Q390R;ENSP00000435673:Q390R	ENSP00000278426:Q390R	Q	-	2	0	SLC43A1	57015297	0.001000	0.12720	0.110000	0.21437	0.193000	0.23685	0.841000	0.27613	0.345000	0.23873	0.454000	0.30748	CAG	.	.		0.572	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392541.1	NM_003627	
MS4A5	64232	hgsc.bcm.edu	37	11	60197289	60197289	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:60197289A>G	ENST00000300190.2	+	1	228	c.142A>G	c.(142-144)Aaa>Gaa	p.K48E	MS4A5_ENST00000534071.1_3'UTR	NM_023945.2	NP_076434.2	Q9H3V2	MS4A5_HUMAN	membrane-spanning 4-domains, subfamily A, member 5	48						integral component of membrane (GO:0016021)				large_intestine(7)|lung(7)|ovary(1)|skin(1)	16						TAGAAAAATGAAAATCTTAGG	0.413																																					p.K48E		Atlas-SNP	.											.	MS4A5	35	.	0			c.A142G						.						57.0	62.0	60.0					11																	60197289		2203	4300	6503	SO:0001583	missense	64232	exon1			AAAATGAAAATCT	AB013103	CCDS7987.1	11q12	2008-03-25			ENSG00000166930	ENSG00000166930			13374	protein-coding gene	gene with protein product		606499				11245982, 11401424	Standard	NM_023945		Approved	CD20L2	uc001npo.3	Q9H3V2	OTTHUMG00000167613	ENST00000300190.2:c.142A>G	chr11.hg19:g.60197289A>G	ENSP00000300190:p.Lys48Glu	86.0	0.0		77.0	28.0	NM_023945	Q9BZH1	Missense_Mutation	SNP	ENST00000300190.2	hg19	CCDS7987.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.380|8.380	0.837376|0.837376	0.16891|0.16891	.|.	.|.	ENSG00000166930|ENSG00000166930	ENST00000528905;ENST00000528093|ENST00000300190	.|T	.|0.14766	.|2.48	4.66|4.66	3.49|3.49	0.39957|0.39957	.|.	.|0.380794	.|0.27595	.|N	.|0.018664	T|T	0.08935|0.08935	0.0221|0.0221	N|N	0.20986|0.20986	0.625|0.625	0.22591|0.22591	N|N	0.998956|0.998956	.|B	.|0.21225	.|0.053	.|B	.|0.20184	.|0.028	T|T	0.24190|0.24190	-1.0167|-1.0167	5|10	.|0.46703	.|T	.|0.11	-5.4078|-5.4078	7.4129|7.4129	0.27027|0.27027	0.8993:0.0:0.1007:0.0|0.8993:0.0:0.1007:0.0	.|.	.|48	.|Q9H3V2	.|MS4A5_HUMAN	G|E	21;14|48	.|ENSP00000300190:K48E	.|ENSP00000300190:K48E	E|K	+|+	2|1	0|0	MS4A5|MS4A5	59953865|59953865	0.997000|0.997000	0.39634|0.39634	0.941000|0.941000	0.38009|0.38009	0.124000|0.124000	0.20399|0.20399	2.321000|2.321000	0.43805|0.43805	0.872000|0.872000	0.35775|0.35775	0.383000|0.383000	0.25322|0.25322	GAA|AAA	.	.		0.413	MS4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395392.1		
RCOR2	283248	hgsc.bcm.edu	37	11	63680390	63680390	+	Silent	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:63680390G>A	ENST00000301459.4	-	9	1308	c.921C>T	c.(919-921)agC>agT	p.S307S	RCOR2_ENST00000473926.2_5'Flank	NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	307					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						CTTGGCGCAGGCTGCTGTTCG	0.587																																					p.S307S		Atlas-SNP	.											.	RCOR2	43	.	0			c.C921T						.						56.0	44.0	48.0					11																	63680390		2201	4297	6498	SO:0001819	synonymous_variant	283248	exon9			GCGCAGGCTGCTG	BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.921C>T	chr11.hg19:g.63680390G>A		104.0	0.0		74.0	27.0	NM_173587	Q96FP3	Silent	SNP	ENST00000301459.4	hg19	CCDS8052.1																																																																																			.	.		0.587	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318233.1	NM_173587	
RPS6KA4	8986	hgsc.bcm.edu	37	11	64137353	64137353	+	Silent	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:64137353G>A	ENST00000334205.4	+	14	1850	c.1785G>A	c.(1783-1785)ctG>ctA	p.L595L	MIR1237_ENST00000408346.1_RNA|RPS6KA4_ENST00000294261.4_Intron|RPS6KA4_ENST00000528057.1_Silent_p.L588L	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	595	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						TCTGGAGCCTGGGCGTCATTC	0.687																																					p.L595L		Atlas-SNP	.											.	RPS6KA4	85	.	0			c.G1785A						.						17.0	18.0	18.0					11																	64137353		2145	4185	6330	SO:0001819	synonymous_variant	8986	exon14			GAGCCTGGGCGTC	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.1785G>A	chr11.hg19:g.64137353G>A		75.0	0.0		60.0	21.0	NM_003942	A8K7Z8|O75585|Q53ES8	Silent	SNP	ENST00000334205.4	hg19	CCDS8073.1																																																																																			.	.		0.687	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106246.2	NM_003942	
GPR152	390212	hgsc.bcm.edu	37	11	67220107	67220107	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:67220107C>G	ENST00000312457.2	-	1	93	c.89G>C	c.(88-90)gGc>gCc	p.G30A	CABP4_ENST00000542025.2_3'UTR|CABP4_ENST00000325656.5_5'Flank|CABP4_ENST00000438189.2_5'UTR	NM_206997.1	NP_996880.1	Q8TDT2	GP152_HUMAN	G protein-coupled receptor 152	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			CGTGTCCCAGCCACCTTGGGG	0.657																																					p.G30A	Pancreas(102;800 1581 2723 7382 33622)	Atlas-SNP	.											.	GPR152	41	.	0			c.G89C						.						49.0	50.0	49.0					11																	67220107		2196	4289	6485	SO:0001583	missense	390212	exon1			TCCCAGCCACCTT	AY255600	CCDS8165.1	11q13.2	2013-09-20			ENSG00000175514	ENSG00000175514		"""GPCR / Class A : Orphans"""	23622	protein-coding gene	gene with protein product						12679517	Standard	NM_206997		Approved	PGR5	uc001olm.3	Q8TDT2	OTTHUMG00000168032	ENST00000312457.2:c.89G>C	chr11.hg19:g.67220107C>G	ENSP00000310255:p.Gly30Ala	184.0	0.0		222.0	64.0	NM_206997	Q0VD88|Q86SM0	Missense_Mutation	SNP	ENST00000312457.2	hg19	CCDS8165.1	.	.	.	.	.	.	.	.	.	.	C	12.38	1.921591	0.33908	.	.	ENSG00000175514	ENST00000312457	T	0.14516	2.5	5.28	4.36	0.52297	.	0.174032	0.27522	N	0.019000	T	0.06962	0.0177	N	0.19112	0.55	0.80722	D	1	P	0.38597	0.639	B	0.28916	0.096	T	0.40289	-0.9571	10	0.16420	T	0.52	.	10.8249	0.46627	0.3444:0.6556:0.0:0.0	.	30	Q8TDT2	GP152_HUMAN	A	30	ENSP00000310255:G30A	ENSP00000310255:G30A	G	-	2	0	GPR152	66976683	0.974000	0.33945	1.000000	0.80357	0.988000	0.76386	1.790000	0.38734	1.440000	0.47531	0.561000	0.74099	GGC	.	.		0.657	GPR152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397623.1		
LRRC32	2615	hgsc.bcm.edu	37	11	76372166	76372166	+	Silent	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:76372166C>T	ENST00000407242.2	-	3	713	c.471G>A	c.(469-471)gcG>gcA	p.A157A	LRRC32_ENST00000404995.1_Silent_p.A157A|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000260061.5_Silent_p.A157A|LRRC32_ENST00000464145.1_Intron	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	157					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)		p.A157A(1)		endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GACTGTTCTCCGCCAGTGAGA	0.642																																					p.A157A		Atlas-SNP	.											.	LRRC32	74	.	1	Substitution - coding silent(1)	lung(1)	c.G471A						.						66.0	68.0	67.0					11																	76372166		2200	4292	6492	SO:0001819	synonymous_variant	2615	exon3			GTTCTCCGCCAGT	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.471G>A	chr11.hg19:g.76372166C>T		58.0	0.0		40.0	9.0	NM_005512	Q86V06	Silent	SNP	ENST00000407242.2	hg19	CCDS8245.1																																																																																			.	.		0.642	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
ARHGEF12	23365	hgsc.bcm.edu	37	11	120280158	120280158	+	Splice_Site	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:120280158T>C	ENST00000397843.2	+	4	364	c.198T>C	c.(196-198)taT>taC	p.Y66Y	ARHGEF12_ENST00000532993.1_5'UTR|ARHGEF12_ENST00000356641.3_Intron	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	66					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CCGAGATATATGGTAAGCTAA	0.388			T	MLL	AML																																p.Y66Y		Atlas-SNP	.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	133	.	0			c.T198C						.						136.0	134.0	135.0					11																	120280158		1877	4099	5976	SO:0001630	splice_region_variant	23365	exon4			GATATATGGTAAG	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.199+1T>C	chr11.hg19:g.120280158T>C		75.0	0.0		77.0	29.0	NM_015313	O15086|Q6P526	Silent	SNP	ENST00000397843.2	hg19	CCDS41727.1																																																																																			.	.		0.388	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	Silent
CD163	9332	hgsc.bcm.edu	37	12	7639354	7639354	+	Silent	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr12:7639354C>T	ENST00000359156.4	-	10	2401	c.2199G>A	c.(2197-2199)gaG>gaA	p.E733E	CD163_ENST00000396620.3_Silent_p.E766E|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000432237.2_Silent_p.E733E|CD163_ENST00000541972.1_Silent_p.E721E	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	733	SRCR 7. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	CATGATAGATCTCTACTCTCC	0.507																																					p.E733E		Atlas-SNP	.											.	CD163	221	.	0			c.G2199A						.						99.0	95.0	97.0					12																	7639354		2203	4300	6503	SO:0001819	synonymous_variant	9332	exon10			ATAGATCTCTACT	Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.2199G>A	chr12.hg19:g.7639354C>T		113.0	0.0		79.0	19.0	NM_203416	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Silent	SNP	ENST00000359156.4	hg19	CCDS8578.1																																																																																			.	.		0.507	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000399396.2	NM_004244, NM_203416	
PDZRN4	29951	hgsc.bcm.edu	37	12	41961651	41961651	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr12:41961651G>T	ENST00000402685.2	+	9	1542	c.1534G>T	c.(1534-1536)Gaa>Taa	p.E512*	PDZRN4_ENST00000298919.7_Nonsense_Mutation_p.E252*|PDZRN4_ENST00000539469.2_Nonsense_Mutation_p.E254*	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	512							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GGAGATGTTGGAAGAAGAGCA	0.393																																					p.E512X		Atlas-SNP	.											.	PDZRN4	346	.	0			c.G1534T						.						102.0	91.0	95.0					12																	41961651		2203	4300	6503	SO:0001587	stop_gained	29951	exon9			ATGTTGGAAGAAG	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1534G>T	chr12.hg19:g.41961651G>T	ENSP00000384197:p.Glu512*	95.0	0.0		96.0	27.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Nonsense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	39	7.685975	0.98431	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	.	.	.	4.85	3.96	0.45880	.	0.153041	0.45126	D	0.000396	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-12.4928	13.7702	0.63019	0.0762:0.0:0.9238:0.0	.	.	.	.	X	512;254;252	.	ENSP00000298919:E252X	E	+	1	0	PDZRN4	40247918	1.000000	0.71417	0.994000	0.49952	0.867000	0.49689	7.802000	0.85969	1.358000	0.45922	-0.225000	0.12378	GAA	.	.		0.393	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
ARID2	196528	hgsc.bcm.edu	37	12	46230548	46230548	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr12:46230548G>A	ENST00000334344.6	+	8	969	c.797G>A	c.(796-798)tGg>tAg	p.W266*	ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Nonsense_Mutation_p.W117*	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	266					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GAATGGATTTGGGAGTCTTTA	0.333			"""N, S, F"""		hepatocellular carcinoma																																p.W266X		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.G797A						.						124.0	126.0	125.0					12																	46230548		2203	4300	6503	SO:0001587	stop_gained	196528	exon8			GGATTTGGGAGTC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.797G>A	chr12.hg19:g.46230548G>A	ENSP00000335044:p.Trp266*	231.0	0.0		210.0	62.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	G	39	7.715201	0.98450	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	.	.	.	5.87	5.87	0.94306	.	0.056138	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-2.9687	20.2009	0.98259	0.0:0.0:1.0:0.0	.	.	.	.	X	266;117	.	ENSP00000335044:W266X	W	+	2	0	ARID2	44516815	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.245000	0.65405	2.767000	0.95098	0.591000	0.81541	TGG	.	.		0.333	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
H1FNT	341567	hgsc.bcm.edu	37	12	48723425	48723425	+	Silent	SNP	C	C	T	rs372377328		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr12:48723425C>T	ENST00000335017.1	+	1	663	c.351C>T	c.(349-351)gcC>gcT	p.A117A		NM_181788.1	NP_861453.1	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	117					chromosome condensation (GO:0030261)|multicellular organismal development (GO:0007275)|sperm chromatin condensation (GO:0035092)|spermatid nucleus elongation (GO:0007290)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	13						GCGACGCCGCCGGCTACTTCA	0.721																																					p.A117A		Atlas-SNP	.											.	H1FNT	30	.	0			c.C351T						.	C		0,4390		0,0,2195	11.0	15.0	13.0		351	-10.3	0.0	12		13	2,8566		0,2,4282	no	coding-synonymous	H1FNT	NM_181788.1		0,2,6477	TT,TC,CC		0.0233,0.0,0.0154		117/256	48723425	2,12956	2195	4284	6479	SO:0001819	synonymous_variant	341567	exon1			CGCCGCCGGCTAC	AY302593	CCDS8762.1	12q13.11	2011-01-27				ENSG00000187166		"""Histones / Replication-independent"""	24893	protein-coding gene	gene with protein product						15710904	Standard	NM_181788		Approved	HANP1, H1T2	uc001rrm.3	Q75WM6		ENST00000335017.1:c.351C>T	chr12.hg19:g.48723425C>T		134.0	0.0		143.0	43.0	NM_181788	Q147U8|Q5GKZ5|Q7Z694	Silent	SNP	ENST00000335017.1	hg19	CCDS8762.1																																																																																			.	.		0.721	H1FNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406516.1	NM_181788	
TIMELESS	8914	hgsc.bcm.edu	37	12	56812013	56812013	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr12:56812013C>T	ENST00000553532.1	-	27	3509	c.3359G>A	c.(3358-3360)gGc>gAc	p.G1120D	TIMELESS_ENST00000229201.4_Missense_Mutation_p.G1119D|TIMELESS_ENST00000554616.1_Missense_Mutation_p.G617D					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CTCATCAGAGCCTTGCTCTCC	0.582																																					p.G1120D		Atlas-SNP	.											.	TIMELESS	107	.	0			c.G3359A						.						138.0	147.0	144.0					12																	56812013		2203	4300	6503	SO:0001583	missense	8914	exon27			TCAGAGCCTTGCT	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.3359G>A	chr12.hg19:g.56812013C>T	ENSP00000450607:p.Gly1120Asp	104.0	0.0		83.0	28.0	NM_003920		Missense_Mutation	SNP	ENST00000553532.1	hg19	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	C	4.591	0.109816	0.08780	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.11277	3.33;3.33;2.79	5.26	-2.64	0.06114	Timeless C-terminal (1);	1.903580	0.02229	N	0.064696	T	0.05502	0.0145	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.22977	-1.0201	10	0.05833	T	0.94	0.0407	1.3823	0.02233	0.1217:0.2779:0.2379:0.3625	.	1120	Q9UNS1	TIM_HUMAN	D	1119;1120;617	ENSP00000229201:G1119D;ENSP00000450607:G1120D;ENSP00000450848:G617D	ENSP00000229201:G1120D	G	-	2	0	TIMELESS	55098280	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.614000	0.05604	-0.819000	0.04323	-0.137000	0.14449	GGC	.	.		0.582	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
DNAH10	196385	hgsc.bcm.edu	37	12	124358197	124358197	+	Silent	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr12:124358197T>C	ENST00000409039.3	+	45	7549	c.7524T>C	c.(7522-7524)acT>acC	p.T2508T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2508	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CCAAAGATACTTACGGCCCAC	0.478																																					p.T2508T		Atlas-SNP	.											.	DNAH10	888	.	0			c.T7524C						.						62.0	59.0	60.0					12																	124358197		1929	4142	6071	SO:0001819	synonymous_variant	196385	exon45			AGATACTTACGGC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7524T>C	chr12.hg19:g.124358197T>C		138.0	0.0		97.0	34.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	hg19	CCDS9255.2																																																																																			.	.		0.478	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH10	196385	hgsc.bcm.edu	37	12	124413834	124413834	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr12:124413834C>T	ENST00000409039.3	+	70	11990	c.11965C>T	c.(11965-11967)Cca>Tca	p.P3989S	DNAH10OS_ENST00000514254.2_3'UTR|CCDC92_ENST00000544798.1_Intron	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3989	AAA 6. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGTCACCGAGCCACCCAATGG	0.537																																					p.P3989S		Atlas-SNP	.											.	DNAH10	888	.	0			c.C11965T						.						27.0	28.0	28.0					12																	124413834		2049	4194	6243	SO:0001583	missense	196385	exon70			ACCGAGCCACCCA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11965C>T	chr12.hg19:g.124413834C>T	ENSP00000386770:p.Pro3989Ser	84.0	0.0		85.0	29.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	hg19	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496467	0.85069	.	.	ENSG00000197653	ENST00000409039	T	0.14766	2.48	5.09	4.13	0.48395	Dynein heavy chain (1);	0.060979	0.64402	D	0.000002	T	0.42108	0.1188	M	0.86343	2.81	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.50642	-0.8804	10	0.87932	D	0	.	15.3131	0.74053	0.0:0.8599:0.1401:0.0	.	3989	Q8IVF4	DYH10_HUMAN	S	3989	ENSP00000386770:P3989S	ENSP00000386770:P3989S	P	+	1	0	DNAH10	122979787	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	6.001000	0.70685	2.528000	0.85240	0.591000	0.81541	CCA	.	.		0.537	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
FLT3	2322	hgsc.bcm.edu	37	13	28601301	28601301	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr13:28601301G>A	ENST00000241453.7	-	17	2212	c.2131C>T	c.(2131-2133)Cac>Tac	p.H711Y	FLT3_ENST00000380982.4_Missense_Mutation_p.H711Y|FLT3_ENST00000537084.1_Missense_Mutation_p.H711Y	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	711	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAAGTCCTGTGAAATTTTTCT	0.363			"""Mis, O"""		"""AML, ALL"""																																p.H711Y		Atlas-SNP	.		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	FLT3	15525	.	0			c.C2131T						.						142.0	146.0	144.0					13																	28601301		2203	4300	6503	SO:0001583	missense	2322	exon17			TCCTGTGAAATTT	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2131C>T	chr13.hg19:g.28601301G>A	ENSP00000241453:p.His711Tyr	132.0	0.0		120.0	6.0	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Missense_Mutation	SNP	ENST00000241453.7	hg19	CCDS31953.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002385	0.74932	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	D;D;D	0.88818	-2.43;-2.43;-2.43	6.03	6.03	0.97812	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91563	0.7335	L	0.36672	1.1	0.49389	D	0.999781	D;D	0.89917	1.0;0.995	D;D	0.85130	0.997;0.976	D	0.86981	0.2104	10	0.13853	T	0.58	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	711;711	P36888-2;P36888	.;FLT3_HUMAN	Y	711	ENSP00000241453:H711Y;ENSP00000370369:H711Y;ENSP00000438139:H711Y	ENSP00000241453:H711Y	H	-	1	0	FLT3	27499301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.786000	0.62425	2.861000	0.98227	0.655000	0.94253	CAC	.	.		0.363	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
LINC00283	100874057	hgsc.bcm.edu	37	13	103398669	103398669	+	RNA	SNP	A	A	G	rs552147278		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr13:103398669A>G	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		CCATCTTGCAATTTTTCCTCT	0.448													A|||	1	0.000199681	0.0008	0.0	5008	,	,		21371	0.0		0.0	False		,,,				2504	0.0				p.L1460L		Atlas-SNP	.											.	.	.	.	0			c.T4378C						.						87.0	65.0	72.0					13																	103398669		692	1590	2282			643677	exon4			CTTGCAATTTTTC			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103398669A>G		111.0	0.0		106.0	40.0	NM_001146197		Silent	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.448	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
MYH7	4625	hgsc.bcm.edu	37	14	23884310	23884310	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr14:23884310C>G	ENST00000355349.3	-	37	5615	c.5453G>C	c.(5452-5454)cGg>cCg	p.R1818P	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1818					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTCCCGCACCCGCGCTTCCAG	0.622																																					p.R1818P		Atlas-SNP	.											.	MYH7	349	.	0			c.G5453C						.						87.0	87.0	87.0					14																	23884310		2203	4300	6503	SO:0001583	missense	4625	exon37			CGCACCCGCGCTT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.5453G>C	chr14.hg19:g.23884310C>G	ENSP00000347507:p.Arg1818Pro	36.0	0.0		44.0	15.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895207	0.72639	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.84800	-1.9	5.27	5.27	0.74061	Myosin tail (1);	.	.	.	.	D	0.94447	0.8213	H	0.95712	3.71	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.95442	0.8526	9	0.87932	D	0	.	14.369	0.66826	0.0:0.927:0.0:0.073	.	1818	P12883	MYH7_HUMAN	P	1818;1823	ENSP00000347507:R1818P	ENSP00000347507:R1818P	R	-	2	0	MYH7	22954150	0.605000	0.26941	1.000000	0.80357	0.775000	0.43874	1.362000	0.34148	2.750000	0.94351	0.563000	0.77884	CGG	.	.		0.622	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
SFTA3	253970	hgsc.bcm.edu	37	14	36943085	36943085	+	Splice_Site	SNP	A	A	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr14:36943085A>T	ENST00000518529.2	-	4	938	c.263T>A	c.(262-264)aTg>aAg	p.M88K	RP11-896J10.3_ENST00000521945.1_RNA|SFTA3_ENST00000518987.1_5'Flank	NM_001101341.1	NP_001094811.1	P0C7M3	SFTA3_HUMAN	surfactant associated 3	88										breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7						AATAATTAACATCTGAAAATG	0.373																																					p.M88K		Atlas-SNP	.											.	SFTA3	9	.	0			c.T263A						.						83.0	75.0	78.0					14																	36943085		1856	4105	5961	SO:0001630	splice_region_variant	253970	exon4			ATTAACATCTGAA	AY102071	CCDS45097.1	14q13.3	2014-06-19	2008-08-26	2008-08-26	ENSG00000229415	ENSG00000229415			18387	protein-coding gene	gene with protein product			"""surfactant associated protein H"""	SFTPH			Standard	NM_001101341		Approved	NANCI	uc001wtr.3	P0C7M3	OTTHUMG00000170540	ENST00000518529.2:c.262-1T>A	chr14.hg19:g.36943085A>T		229.0	0.0		217.0	68.0	NM_001101341		Missense_Mutation	SNP	ENST00000518529.2	hg19	CCDS45097.1	.	.	.	.	.	.	.	.	.	.	A	12.79	2.042307	0.35989	.	.	ENSG00000229415	ENST00000518529	.	.	.	4.23	3.07	0.35406	.	.	.	.	.	T	0.27765	0.0683	.	.	.	0.23747	N	0.99696	P	0.36535	0.557	B	0.33521	0.165	T	0.16630	-1.0396	7	0.87932	D	0	.	7.9443	0.29976	0.7914:0.2086:0.0:0.0	.	88	P0C7M3	SFTA3_HUMAN	K	88	.	ENSP00000428331:M88K	M	-	2	0	SFTA3	36012836	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	1.423000	0.34837	0.937000	0.37394	0.482000	0.46254	ATG	.	.		0.373	SFTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376217.2	NM_001101341	Missense_Mutation
SYNE2	23224	hgsc.bcm.edu	37	14	64608713	64608713	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr14:64608713G>T	ENST00000344113.4	+	82	15425	c.15213G>T	c.(15211-15213)tgG>tgT	p.W5071C	SYNE2_ENST00000394768.2_Missense_Mutation_p.W1456C|SYNE2_ENST00000554584.1_Missense_Mutation_p.W4988C|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.W1705C|SYNE2_ENST00000358025.3_Missense_Mutation_p.W5071C|SYNE2_ENST00000357395.3_Missense_Mutation_p.W1456C	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5071					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGATTAGCTGGATGAACAATG	0.373																																					p.W5071C		Atlas-SNP	.											.	SYNE2	577	.	0			c.G15213T						.						88.0	80.0	83.0					14																	64608713		2203	4300	6503	SO:0001583	missense	23224	exon82			TAGCTGGATGAAC	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.15213G>T	chr14.hg19:g.64608713G>T	ENSP00000341781:p.Trp5071Cys	301.0	0.0		234.0	66.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168251	0.78339	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.70749	-0.48;-0.51;-0.48;-0.48;-0.48;-0.51	5.93	5.93	0.95920	.	0.000000	0.50627	D	0.000110	D	0.85168	0.5635	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;0.999;0.994;0.999	D	0.85515	0.1200	10	0.87932	D	0	.	20.3422	0.98769	0.0:0.0:1.0:0.0	.	1456;4988;5071;5071	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	C	5071;1456;5071;4988;4994;1705;1456	ENSP00000350719:W5071C;ENSP00000349969:W1456C;ENSP00000341781:W5071C;ENSP00000452570:W4988C;ENSP00000450831:W1705C;ENSP00000378249:W1456C	ENSP00000261678:W4994C	W	+	3	0	SYNE2	63678466	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.751000	0.98889	2.810000	0.96702	0.655000	0.94253	TGG	.	.		0.373	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
AHNAK2	113146	hgsc.bcm.edu	37	14	105409536	105409536	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr14:105409536C>A	ENST00000333244.5	-	7	12371	c.12252G>T	c.(12250-12252)aaG>aaT	p.K4084N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4084						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCACTTCCGCCTTGGGGCCTT	0.597																																					p.K4084N		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G12252T						.						158.0	162.0	161.0					14																	105409536		1868	4093	5961	SO:0001583	missense	113146	exon7			TTCCGCCTTGGGG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12252G>T	chr14.hg19:g.105409536C>A	ENSP00000353114:p.Lys4084Asn	258.0	0.0		226.0	60.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	13.58	2.280285	0.40294	.	.	ENSG00000185567	ENST00000333244	T	0.00711	5.8	4.13	-2.2	0.06994	.	0.238084	0.20122	U	0.098795	T	0.02380	0.0073	M	0.83692	2.655	0.09310	N	1	D	0.65815	0.995	D	0.68943	0.961	T	0.41016	-0.9532	10	0.23302	T	0.38	.	4.1823	0.10381	0.2641:0.4368:0.0:0.2991	.	4084	Q8IVF2	AHNK2_HUMAN	N	4084	ENSP00000353114:K4084N	ENSP00000353114:K4084N	K	-	3	2	AHNAK2	104480581	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-2.709000	0.00819	-0.024000	0.13941	0.485000	0.47835	AAG	.	.		0.597	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
GABPB1	2553	hgsc.bcm.edu	37	15	50578220	50578220	+	Intron	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr15:50578220T>C	ENST00000220429.8	-	8	1204				GABPB1_ENST00000396464.3_Silent_p.K348K|GABPB1_ENST00000560825.1_Silent_p.K347K|GABPB1_ENST00000429662.2_Silent_p.K360K|GABPB1_ENST00000359031.4_Silent_p.K348K|GABPB1_ENST00000543881.1_Intron|GABPB1_ENST00000380877.3_Intron			Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta subunit 1						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(1)|large_intestine(7)|lung(5)	14						ATTGAATTTATTTTGGATGAC	0.318																																					p.K360K		Atlas-SNP	.											.	GABPB1	33	.	0			c.A1080G						.						83.0	87.0	86.0					15																	50578220		2195	4294	6489	SO:0001627	intron_variant	2553	exon8			AATTTATTTTGGA	D13316	CCDS10135.1, CCDS10136.1, CCDS32239.1, CCDS45258.1	15q21.2	2013-01-10	2008-02-25	2008-02-25	ENSG00000104064	ENSG00000104064		"""Ankyrin repeat domain containing"""	4074	protein-coding gene	gene with protein product		600610	"""GA binding protein transcription factor, beta subunit 2"""	GABPB2		7958862	Standard	NM_016655		Approved	E4TF1-47, GABPB	uc001zyb.3	Q06547	OTTHUMG00000131642	ENST00000220429.8:c.1035+44A>G	chr15.hg19:g.50578220T>C		91.0	0.0		85.0	30.0	NM_002041	A8IE52|Q06545|Q12940|Q12941|Q12942|Q8IYD0	Silent	SNP	ENST00000220429.8	hg19	CCDS32239.1																																																																																			.	.		0.318	GABPB1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000418294.1		
TLE3	7090	hgsc.bcm.edu	37	15	70366931	70366931	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr15:70366931C>T	ENST00000558939.1	-	6	1690	c.313G>A	c.(313-315)Gcg>Acg	p.A105T	TLE3_ENST00000559929.1_Missense_Mutation_p.A105T|TLE3_ENST00000558379.1_Missense_Mutation_p.A105T|TLE3_ENST00000539550.1_Missense_Mutation_p.A39T|TLE3_ENST00000451782.2_Missense_Mutation_p.A105T|TLE3_ENST00000440567.3_Missense_Mutation_p.A98T|TLE3_ENST00000317509.8_Missense_Mutation_p.A105T|TLE3_ENST00000560589.1_Missense_Mutation_p.A49T|TLE3_ENST00000442299.2_Missense_Mutation_p.A105T|TLE3_ENST00000559191.1_Intron|TLE3_ENST00000557997.1_Missense_Mutation_p.A105T|TLE3_ENST00000559048.1_Missense_Mutation_p.A111T|TLE3_ENST00000558201.1_Missense_Mutation_p.A111T|TLE3_ENST00000557907.1_Missense_Mutation_p.A105T|TLE3_ENST00000560939.1_Missense_Mutation_p.A111T	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	105	Gln-rich.				Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACTGCCTGCGCCACCTGCTGC	0.617																																					p.A105T		Atlas-SNP	.											TLE3_ENST00000558939,NS,carcinoma,0,2	TLE3	104	.	0			c.G313A						.						51.0	56.0	55.0					15																	70366931		2190	4294	6484	SO:0001583	missense	7090	exon6			CCTGCGCCACCTG	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.313G>A	chr15.hg19:g.70366931C>T	ENSP00000452871:p.Ala105Thr	56.0	0.0		45.0	12.0	NM_001105192	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	ENST00000558939.1	hg19	CCDS45293.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.370315	0.82573	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550;ENST00000537387	T;T;T;T;T	0.57595	0.66;0.69;0.75;0.69;0.39	5.41	5.41	0.78517	Groucho/TLE, N-terminal Q-rich domain (1);	0.000000	0.85682	D	0.000000	T	0.71753	0.3377	M	0.89353	3.025	0.54753	D	0.999984	P;P;P;P;P;P;P;P	0.46512	0.604;0.803;0.604;0.803;0.855;0.879;0.731;0.731	P;P;P;P;P;P;B;B	0.51516	0.462;0.672;0.543;0.672;0.516;0.672;0.287;0.381	T	0.76179	-0.3054	10	0.49607	T	0.09	-4.8715	19.1972	0.93695	0.0:1.0:0.0:0.0	.	98;105;105;105;105;105;111;39	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	T	105;105;105;98;39;2	ENSP00000390007:A105T;ENSP00000394717:A105T;ENSP00000319233:A105T;ENSP00000415057:A98T;ENSP00000442594:A39T	ENSP00000319233:A105T	A	-	1	0	TLE3	68153985	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	5.963000	0.70372	2.537000	0.85549	0.561000	0.74099	GCG	.	.		0.617	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416913.1	NM_005078	
NMRAL1	57407	hgsc.bcm.edu	37	16	4511950	4511950	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr16:4511950T>G	ENST00000574733.1	-	6	1460	c.731A>C	c.(730-732)gAg>gCg	p.E244A	NMRAL1_ENST00000404295.3_Missense_Mutation_p.E244A|NMRAL1_ENST00000574425.1_Missense_Mutation_p.E244A|NMRAL1_ENST00000283429.6_Missense_Mutation_p.E244A|NMRAL1_ENST00000572391.1_5'Flank			Q9HBL8	NMRL1_HUMAN	NmrA-like family domain containing 1	244						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|prostate(2)|stomach(1)	15						TTCGTAGTCCTCAGGAGTCAT	0.652																																					p.E244A		Atlas-SNP	.											.	NMRAL1	31	.	0			c.A731C						.						82.0	85.0	84.0					16																	4511950		2197	4300	6497	SO:0001583	missense	57407	exon6			TAGTCCTCAGGAG	AF225419	CCDS10516.1	16p13.3	2013-10-11			ENSG00000153406	ENSG00000153406		"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	24987	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 48A, member 1"""					19027726	Standard	NM_020677		Approved	FLJ25918, HSCARG, SDR48A1	uc002cwo.3	Q9HBL8	OTTHUMG00000129468	ENST00000574733.1:c.731A>C	chr16.hg19:g.4511950T>G	ENSP00000458762:p.Glu244Ala	130.0	0.0		129.0	39.0	NM_020677		Missense_Mutation	SNP	ENST00000574733.1	hg19	CCDS10516.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.065908	0.76187	.	.	ENSG00000153406	ENST00000283429;ENST00000404295	T;T	0.34072	1.38;1.38	5.7	5.7	0.88788	.	0.065640	0.64402	D	0.000007	T	0.43634	0.1256	L	0.53780	1.695	0.50632	D	0.999882	D	0.55605	0.972	P	0.49708	0.62	T	0.35076	-0.9803	10	0.48119	T	0.1	-38.0139	13.7109	0.62667	0.0:0.0:0.0:1.0	.	244	Q9HBL8	NMRL1_HUMAN	A	244	ENSP00000283429:E244A;ENSP00000383962:E244A	ENSP00000283429:E244A	E	-	2	0	NMRAL1	4451951	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	2.932000	0.48940	2.189000	0.69895	0.459000	0.35465	GAG	.	.		0.652	NMRAL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438579.1	NM_020677	
XPO6	23214	hgsc.bcm.edu	37	16	28188641	28188641	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr16:28188641T>C	ENST00000304658.5	-	3	607	c.107A>G	c.(106-108)aAt>aGt	p.N36S	XPO6_ENST00000565698.1_Missense_Mutation_p.N22S|SNORA25_ENST00000363782.1_RNA	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	36	Importin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00115}.				protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						GGCAAAGTTATTAAGAAGCTC	0.353																																					p.N36S		Atlas-SNP	.											.	XPO6	177	.	0			c.A107G						.						63.0	57.0	59.0					16																	28188641		1796	4070	5866	SO:0001583	missense	23214	exon3			AAGTTATTAAGAA	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.107A>G	chr16.hg19:g.28188641T>C	ENSP00000302790:p.Asn36Ser	187.0	0.0		206.0	68.0	NM_015171	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	hg19	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	T	15.04	2.715405	0.48622	.	.	ENSG00000169180	ENST00000304658	T	0.68025	-0.3	5.95	5.95	0.96441	Armadillo-like helical (1);Armadillo-type fold (1);Importin-beta, N-terminal (3);	0.045103	0.85682	D	0.000000	T	0.57607	0.2065	L	0.38175	1.15	0.58432	D	0.999999	B;P	0.44090	0.203;0.826	B;B	0.41946	0.123;0.371	T	0.55062	-0.8199	10	0.18276	T	0.48	-11.4385	14.359	0.66757	0.0:0.0:0.0:1.0	.	36;36	B7ZM10;Q96QU8	.;XPO6_HUMAN	S	36	ENSP00000302790:N36S	ENSP00000302790:N36S	N	-	2	0	XPO6	28096142	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.831000	0.86748	2.272000	0.75746	0.460000	0.39030	AAT	.	.		0.353	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433732.1	XM_055195	
SRCAP	10847	hgsc.bcm.edu	37	16	30731600	30731600	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr16:30731600A>G	ENST00000262518.4	+	19	3320	c.2935A>G	c.(2935-2937)Act>Gct	p.T979A	SRCAP_ENST00000344771.4_Missense_Mutation_p.T979A|SRCAP_ENST00000395059.2_Missense_Mutation_p.T979A	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	979					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AGAAGTGGCTACTGCTCCTGA	0.547																																					p.T979A		Atlas-SNP	.											.	SRCAP	298	.	0			c.A2935G						.						109.0	119.0	116.0					16																	30731600		2197	4300	6497	SO:0001583	missense	10847	exon19			GTGGCTACTGCTC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2935A>G	chr16.hg19:g.30731600A>G	ENSP00000262518:p.Thr979Ala	95.0	0.0		107.0	45.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	hg19	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	A	17.28	3.348819	0.61183	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.90955	-2.76;-2.71;-2.69	5.45	5.45	0.79879	.	0.122741	0.37136	N	0.002221	T	0.80076	0.4557	N	0.12182	0.205	0.23984	N	0.996266	B;B;B	0.16166	0.016;0.016;0.006	B;B;B	0.15484	0.013;0.013;0.006	T	0.67852	-0.5563	10	0.45353	T	0.12	-7.6062	6.9074	0.24317	0.8334:0.0:0.1665:0.0	.	979;979;979	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	A	979	ENSP00000262518:T979A;ENSP00000378499:T979A;ENSP00000343042:T979A	ENSP00000262518:T979A	T	+	1	0	SRCAP	30639101	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.722000	0.68485	2.062000	0.61559	0.477000	0.44152	ACT	.	.		0.547	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
EDC4	23644	hgsc.bcm.edu	37	16	67916665	67916665	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr16:67916665G>A	ENST00000358933.5	+	26	3765	c.3526G>A	c.(3526-3528)Ggc>Agc	p.G1176S	CTC-479C5.10_ENST00000572067.1_lincRNA|NRN1L_ENST00000339176.3_5'Flank|NRN1L_ENST00000576147.1_5'Flank	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1176					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CCAGCTGCGGGGCCTGGTCAG	0.642											OREG0023890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G1176S		Atlas-SNP	.											.	EDC4	101	.	0			c.G3526A						.						52.0	53.0	53.0					16																	67916665		2198	4300	6498	SO:0001583	missense	23644	exon26			CTGCGGGGCCTGG	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3526G>A	chr16.hg19:g.67916665G>A	ENSP00000351811:p.Gly1176Ser	114.0	0.0	1103	109.0	35.0	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	hg19	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420838	0.42918	.	.	ENSG00000038358	ENST00000358933	.	.	.	5.74	4.78	0.61160	.	0.099971	0.64402	D	0.000002	T	0.29783	0.0744	L	0.36672	1.1	0.33204	D	0.552521	B	0.34015	0.435	B	0.24974	0.057	T	0.35895	-0.9770	9	0.09338	T	0.73	-23.0541	9.415	0.38517	0.0792:0.2486:0.6722:0.0	.	1176	Q6P2E9	EDC4_HUMAN	S	1176	.	ENSP00000351811:G1176S	G	+	1	0	EDC4	66474166	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.607000	0.61133	1.437000	0.47472	0.591000	0.81541	GGC	.	.		0.642	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
DNAH9	1770	hgsc.bcm.edu	37	17	11593239	11593239	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:11593239T>C	ENST00000262442.4	+	20	4168	c.4100T>C	c.(4099-4101)cTg>cCg	p.L1367P	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1367P	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1367	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGGAACACGCTGAGCTCCCTG	0.592																																					p.L1367P		Atlas-SNP	.											.	DNAH9	695	.	0			c.T4100C						.						28.0	22.0	24.0					17																	11593239		2203	4300	6503	SO:0001583	missense	1770	exon20			ACACGCTGAGCTC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4100T>C	chr17.hg19:g.11593239T>C	ENSP00000262442:p.Leu1367Pro	102.0	0.0		109.0	5.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.537292	0.45176	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.62498	0.02;0.02	5.72	5.72	0.89469	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	D	0.000009	D	0.83926	0.5360	M	0.94101	3.495	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	D	0.87659	0.2533	10	0.56958	D	0.05	.	16.0168	0.80445	0.0:0.0:0.0:1.0	.	1367	Q9NYC9	DYH9_HUMAN	P	1367	ENSP00000262442:L1367P;ENSP00000414874:L1367P	ENSP00000262442:L1367P	L	+	2	0	DNAH9	11533964	1.000000	0.71417	0.449000	0.26957	0.002000	0.02628	7.997000	0.88414	2.194000	0.70268	0.528000	0.53228	CTG	.	.		0.592	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
EVI2B	2124	hgsc.bcm.edu	37	17	29632116	29632116	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:29632116G>A	ENST00000330927.4	-	2	666	c.512C>T	c.(511-513)aCa>aTa	p.T171I	EVI2B_ENST00000544462.1_Missense_Mutation_p.T186I|NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron|EVI2B_ENST00000577894.1_Missense_Mutation_p.T171I	NM_006495.3	NP_006486.3	P34910	EVI2B_HUMAN	ecotropic viral integration site 2B	171						integral component of plasma membrane (GO:0005887)		p.0?(8)|p.?(3)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	12		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;6.88e-13)|Epithelial(4;8.95e-12)|OV - Ovarian serous cystadenocarcinoma(4;1.01e-11)|GBM - Glioblastoma multiforme(4;0.184)		GACAGTTGATGTTGGTTGTGT	0.343																																					p.T171I		Atlas-SNP	.											.	EVI2B	33	.	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.C512T						.						202.0	199.0	200.0					17																	29632116		2203	4300	6503	SO:0001583	missense	2124	exon2			GTTGATGTTGGTT		CCDS11266.1	17q11.2	2011-08-11			ENSG00000185862	ENSG00000185862		"""CD molecules"""	3500	protein-coding gene	gene with protein product		158381				1903357	Standard	NM_006495		Approved	D17S376, EVDB, CD361	uc002hgk.2	P34910	OTTHUMG00000132869	ENST00000330927.4:c.512C>T	chr17.hg19:g.29632116G>A	ENSP00000333779:p.Thr171Ile	308.0	0.0		245.0	76.0	NM_006495	B7Z4A7	Missense_Mutation	SNP	ENST00000330927.4	hg19	CCDS11266.1	.	.	.	.	.	.	.	.	.	.	G	9.806	1.181903	0.21787	.	.	ENSG00000185862	ENST00000330927;ENST00000544462	T;T	0.59906	0.24;0.23	5.55	-1.28	0.09318	.	0.843555	0.10035	N	0.724172	T	0.51517	0.1679	M	0.69823	2.125	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.42766	-0.9432	10	0.42905	T	0.14	-10.9741	6.7321	0.23388	0.3401:0.0:0.5486:0.1113	.	186;171	B7Z4A7;P34910	.;EVI2B_HUMAN	I	171;186	ENSP00000333779:T171I;ENSP00000439738:T186I	ENSP00000333779:T171I	T	-	2	0	EVI2B	26656242	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.208000	0.09371	-0.756000	0.04703	-1.134000	0.01955	ACA	.	.		0.343	EVI2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256349.2	NM_006495	
ERBB2	2064	hgsc.bcm.edu	37	17	37882886	37882886	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:37882886G>T	ENST00000269571.5	+	24	3103	c.2944G>T	c.(2944-2946)Gac>Tac	p.D982Y	ERBB2_ENST00000584450.1_Missense_Mutation_p.D982Y|MIEN1_ENST00000474210.1_5'Flank|ERBB2_ENST00000445658.2_Missense_Mutation_p.D706Y|ERBB2_ENST00000541774.1_Missense_Mutation_p.D967Y|ERBB2_ENST00000406381.2_Missense_Mutation_p.D952Y|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000584601.1_Missense_Mutation_p.D952Y|ERBB2_ENST00000540147.1_Missense_Mutation_p.D952Y			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	982	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CATGGCCAGGGACCCCCAGCG	0.597		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.D982Y		Atlas-SNP	.		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2	429	.	0			c.G2944T						.						114.0	95.0	101.0					17																	37882886		2203	4300	6503	SO:0001583	missense	2064	exon24			GCCAGGGACCCCC	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2944G>T	chr17.hg19:g.37882886G>T	ENSP00000269571:p.Asp982Tyr	103.0	0.0		94.0	28.0	NM_004448	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	ENST00000269571.5	hg19	CCDS32642.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970485	0.53614	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03	5.29	5.29	0.74685	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.81702	0.4878	M	0.85197	2.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.977;0.994	D	0.84855	0.0816	9	0.87932	D	0	.	17.7407	0.88406	0.0:0.0:1.0:0.0	.	706;967;982	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	Y	952;967;706;982;952	ENSP00000385185:D952Y;ENSP00000446466:D967Y;ENSP00000404047:D706Y;ENSP00000269571:D982Y;ENSP00000443562:D952Y	ENSP00000269571:D982Y	D	+	1	0	ERBB2	35136412	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.860000	0.99555	2.473000	0.83533	0.655000	0.94253	GAC	.	.		0.597	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445621.2		
MED24	9862	hgsc.bcm.edu	37	17	38189360	38189360	+	Silent	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:38189360T>C	ENST00000394128.2	-	8	852	c.771A>G	c.(769-771)acA>acG	p.T257T	MED24_ENST00000501516.3_Silent_p.T276T|MED24_ENST00000394126.1_Silent_p.T282T|MED24_ENST00000394127.2_Silent_p.T244T|MED24_ENST00000356271.3_Silent_p.T244T|MED24_ENST00000479829.1_5'Flank	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	257					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GCGTCTCGCCTGTCAGGTTCA	0.637																																					p.T257T		Atlas-SNP	.											.	MED24	89	.	0			c.A771G						.						61.0	52.0	55.0					17																	38189360		2203	4300	6503	SO:0001819	synonymous_variant	9862	exon8			CTCGCCTGTCAGG	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.771A>G	chr17.hg19:g.38189360T>C		51.0	0.0		44.0	18.0	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	ENST00000394128.2	hg19	CCDS11359.1																																																																																			.	.		0.637	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
SPATA20	64847	hgsc.bcm.edu	37	17	48625802	48625802	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:48625802A>G	ENST00000356488.4	+	2	319	c.236A>G	c.(235-237)aAt>aGt	p.N79S	SPATA20_ENST00000006658.6_Missense_Mutation_p.N95S|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000393244.3_Missense_Mutation_p.N35S	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	79					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CATGCCTACAATCCTGTGGAC	0.622																																					p.N95S		Atlas-SNP	.											.	SPATA20	59	.	0			c.A284G						.						115.0	104.0	108.0					17																	48625802		2203	4300	6503	SO:0001583	missense	64847	exon3			CCTACAATCCTGT		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.236A>G	chr17.hg19:g.48625802A>G	ENSP00000348878:p.Asn79Ser	92.0	0.0		78.0	8.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	hg19	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702713	0.88924	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.48522	0.81;0.81;0.81	4.73	4.73	0.59995	Thioredoxin-like fold (2);Domain of unknown function DUF255 (1);	0.000000	0.85682	D	0.000000	T	0.74344	0.3704	M	0.91249	3.19	0.53688	D	0.999974	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	T	0.81378	-0.0960	10	0.87932	D	0	-21.8816	14.384	0.66931	1.0:0.0:0.0:0.0	.	79;79;95	B4DZC5;Q8TB22;Q8TB22-2	.;SPT20_HUMAN;.	S	95;79;35	ENSP00000006658:N95S;ENSP00000348878:N79S;ENSP00000376935:N35S	ENSP00000006658:N95S	N	+	2	0	SPATA20	45980801	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.687000	0.91255	1.988000	0.58038	0.459000	0.35465	AAT	.	.		0.622	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
SMARCD2	6603	hgsc.bcm.edu	37	17	61911879	61911879	+	Silent	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:61911879T>C	ENST00000448276.2	-	7	1141	c.876A>G	c.(874-876)ggA>ggG	p.G292G	SMARCD2_ENST00000225742.9_Silent_p.G217G|SMARCD2_ENST00000323347.10_Silent_p.G244G	NM_001098426.1	NP_001091896.1	Q92925	SMRD2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2	292					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)	8						CGTTGAGGTCTCCAGGCCGTT	0.612											OREG0024642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G292G		Atlas-SNP	.											.	SMARCD2	29	.	0			c.A876G						.						171.0	164.0	166.0					17																	61911879		2051	4224	6275	SO:0001819	synonymous_variant	6603	exon7			GAGGTCTCCAGGC	U66618	CCDS45756.1	17q23.3	2014-07-16			ENSG00000108604	ENSG00000108604			11107	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60B"", ""Swp73-like protein"", ""chromatin remodeling complex BAF60B subunit"", ""SWI/SNF complex 60 kDa subunit B"""	601736				8804307, 9693044	Standard	NM_001098426		Approved	BAF60B, Rsc6p, CRACD2, PRO2451	uc010deb.1	Q92925	OTTHUMG00000179045	ENST00000448276.2:c.876A>G	chr17.hg19:g.61911879T>C		76.0	0.0	1057	82.0	23.0	NM_001098426	A5PLL5|A6NNQ7|B4DV56|B4E1R6|Q7L2I6|Q9UHZ1	Silent	SNP	ENST00000448276.2	hg19	CCDS45756.1																																																																																			.	.		0.612	SMARCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444544.1	NM_001098426	
ABCA10	10349	hgsc.bcm.edu	37	17	67212380	67212380	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:67212380T>C	ENST00000269081.4	-	8	1559	c.650A>G	c.(649-651)tAt>tGt	p.Y217C	ABCA10_ENST00000416101.2_Missense_Mutation_p.Y217C|ABCA10_ENST00000432313.2_Missense_Mutation_p.Y217C	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	217					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ATATAAGCTATAGAGTGTGAA	0.343																																					p.Y217C		Atlas-SNP	.											.	ABCA10	209	.	0			c.A650G						.						156.0	161.0	159.0					17																	67212380		2203	4300	6503	SO:0001583	missense	10349	exon8			AAGCTATAGAGTG	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.650A>G	chr17.hg19:g.67212380T>C	ENSP00000269081:p.Tyr217Cys	252.0	0.0		241.0	72.0	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	ENST00000269081.4	hg19	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	A	14.82	2.650649	0.47362	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;D	0.87887	-2.31;-2.31;-2.31	3.34	3.34	0.38264	.	0.000000	0.34906	U	0.003581	D	0.82504	0.5051	N	0.14661	0.345	0.09310	N	1	B;P	0.40282	0.365;0.711	B;P	0.52627	0.062;0.704	T	0.73720	-0.3894	10	0.87932	D	0	.	6.757	0.23520	0.7904:0.0:0.0:0.2096	.	217;217	E5RFP5;Q8WWZ4	.;ABCAA_HUMAN	C	217	ENSP00000269081:Y217C;ENSP00000407772:Y217C;ENSP00000387674:Y217C	ENSP00000269081:Y217C	Y	-	2	0	ABCA10	64723975	0.019000	0.18553	0.002000	0.10522	0.493000	0.33554	1.342000	0.33919	0.379000	0.24794	-0.311000	0.09066	TAT	.	.		0.343	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
PKN1	5585	hgsc.bcm.edu	37	19	14580605	14580605	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr19:14580605A>G	ENST00000242783.6	+	17	2360	c.2195A>G	c.(2194-2196)cAc>cGc	p.H732R	PKN1_ENST00000342216.4_Missense_Mutation_p.H738R	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	732	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						CAGTTTCTTCACGAACACAAG	0.597																																					p.H738R	NSCLC(185;2539 2965 10733 52867)	Atlas-SNP	.											.	PKN1	99	.	0			c.A2213G						.						128.0	130.0	129.0					19																	14580605		2093	4214	6307	SO:0001583	missense	5585	exon17			TTCTTCACGAACA	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.2195A>G	chr19.hg19:g.14580605A>G	ENSP00000242783:p.His732Arg	87.0	0.0		57.0	4.0	NM_213560	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	hg19	CCDS42513.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.020478	0.54576	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	D;D	0.84516	-1.86;-1.86	4.06	4.06	0.47325	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	U	0.000001	D	0.92691	0.7677	M	0.90145	3.09	0.45580	D	0.998527	D;D	0.76494	0.999;0.999	D;D	0.81914	0.991;0.995	D	0.93591	0.6921	10	0.87932	D	0	-23.9526	11.2607	0.49080	1.0:0.0:0.0:0.0	.	738;732	Q16512-2;Q16512	.;PKN1_HUMAN	R	732;738	ENSP00000242783:H732R;ENSP00000343325:H738R	ENSP00000242783:H732R	H	+	2	0	PKN1	14441605	1.000000	0.71417	0.976000	0.42696	0.332000	0.28634	8.362000	0.90100	1.828000	0.53243	0.402000	0.26972	CAC	.	.		0.597	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	
URI1	8725	hgsc.bcm.edu	37	19	30496346	30496346	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr19:30496346A>G	ENST00000542441.2	+	5	743	c.446A>G	c.(445-447)cAg>cGg	p.Q149R	URI1_ENST00000360605.4_Missense_Mutation_p.Q131R|URI1_ENST00000392271.1_Missense_Mutation_p.Q73R|URI1_ENST00000312051.6_Missense_Mutation_p.Q109R|URI1_ENST00000574176.1_3'UTR			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	149					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										GAAGATTTGCAGAAAATGAGC	0.274																																					p.Q149R		Atlas-SNP	.											.	.	.	.	0			c.A446G						.						47.0	49.0	48.0					19																	30496346		2202	4294	6496	SO:0001583	missense	8725	exon5			ATTTGCAGAAAAT	AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.446A>G	chr19.hg19:g.30496346A>G	ENSP00000442436:p.Gln149Arg	468.0	0.0		417.0	129.0	NM_003796	A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	ENST00000542441.2	hg19	CCDS12420.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629006	0.46944	.	.	ENSG00000105176	ENST00000360605;ENST00000392271;ENST00000542441;ENST00000312051	T;T;T	0.08008	3.14;3.14;3.14	5.53	5.53	0.82687	Prefoldin (1);	0.156761	0.64402	D	0.000020	T	0.12008	0.0292	L	0.54323	1.7	0.43255	D	0.995187	P;B;P	0.51057	0.818;0.075;0.941	B;B;P	0.45167	0.311;0.076;0.472	T	0.21177	-1.0253	10	0.15066	T	0.55	-16.7344	15.6521	0.77104	1.0:0.0:0.0:0.0	.	109;149;147	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	R	147;73;149;109	ENSP00000376097:Q73R;ENSP00000442436:Q149R;ENSP00000312530:Q109R	ENSP00000312530:Q109R	Q	+	2	0	C19orf2	35188186	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.602000	0.90868	2.096000	0.63516	0.454000	0.30748	CAG	.	.		0.274	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439756.1	NM_134447	
TSHZ3	57616	hgsc.bcm.edu	37	19	31768721	31768721	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr19:31768721T>C	ENST00000240587.4	-	2	2305	c.1978A>G	c.(1978-1980)Agc>Ggc	p.S660G		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	660					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCCCCATCGCTGGATGCCTCC	0.657																																					p.S660G		Atlas-SNP	.											.	TSHZ3	549	.	0			c.A1978G						.						15.0	17.0	16.0					19																	31768721		2190	4279	6469	SO:0001583	missense	57616	exon2			CATCGCTGGATGC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1978A>G	chr19.hg19:g.31768721T>C	ENSP00000240587:p.Ser660Gly	53.0	0.0		45.0	19.0	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	hg19	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	T	6.024	0.372807	0.11409	.	.	ENSG00000121297	ENST00000240587	T	0.40756	1.02	5.5	2.3	0.28687	.	0.520911	0.24373	N	0.039081	T	0.27169	0.0666	L	0.27053	0.805	0.26666	N	0.971811	B	0.02656	0.0	B	0.01281	0.0	T	0.14952	-1.0454	10	0.33141	T	0.24	-11.4673	9.1577	0.37002	0.0:0.2066:0.0:0.7934	.	660	Q63HK5	TSH3_HUMAN	G	660	ENSP00000240587:S660G	ENSP00000240587:S660G	S	-	1	0	TSHZ3	36460561	1.000000	0.71417	0.051000	0.19133	0.266000	0.26442	2.296000	0.43584	0.074000	0.16767	0.528000	0.53228	AGC	.	.		0.657	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
CEBPA	1050	hgsc.bcm.edu	37	19	33792731	33792731	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr19:33792731G>T	ENST00000498907.2	-	1	739	c.590C>A	c.(589-591)cCg>cAg	p.P197Q	CTD-2540B15.11_ENST00000589932.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.7_ENST00000587312.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	197					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P185_P197del(1)|p.S190_P198del(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					GTGCGCGGGCGGCGGGTGCGG	0.771			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.P197Q		Atlas-SNP	.		Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	.	CEBPA	986	.	2	Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(2)	c.C590A						.						2.0	2.0	2.0					19																	33792731		646	1482	2128	SO:0001583	missense	1050	exon1	Familial Cancer Database	Familial AML	GCGGGCGGCGGGT	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.590C>A	chr19.hg19:g.33792731G>T	ENSP00000427514:p.Pro197Gln	323.0	0.0		183.0	13.0	NM_004364	A7LNP2|P78319|Q05CA4	Missense_Mutation	SNP	ENST00000498907.2	hg19	CCDS54243.1	.	.	.	.	.	.	.	.	.	.	G	5.481	0.273783	0.10403	.	.	ENSG00000245848	ENST00000498907	T	0.18174	2.23	4.04	4.04	0.47022	.	.	.	.	.	T	0.07863	0.0197	N	0.08118	0	0.26767	N	0.969872	B	0.26147	0.143	B	0.17979	0.02	T	0.28776	-1.0033	9	0.14252	T	0.57	.	9.2485	0.37541	0.0:0.0:0.7839:0.2161	.	197	P49715	CEBPA_HUMAN	Q	197	ENSP00000427514:P197Q	ENSP00000427514:P197Q	P	-	2	0	CEBPA	38484571	0.997000	0.39634	0.974000	0.42286	0.061000	0.15899	3.946000	0.56644	1.799000	0.52666	0.289000	0.19496	CCG	.	.		0.771	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365012.1	NM_004364	
CCDC114	93233	hgsc.bcm.edu	37	19	48821778	48821778	+	Missense_Mutation	SNP	C	C	T	rs376555574		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr19:48821778C>T	ENST00000315396.7	-	3	797	c.115G>A	c.(115-117)Gca>Aca	p.A39T	CCDC114_ENST00000497803.1_5'UTR	NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	39					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		TTCTGGGCTGCGCTGATCTGC	0.657																																					p.A39T		Atlas-SNP	.											.	CCDC114	100	.	0			c.G115A						.	C	THR/ALA	1,1383		0,1,691	27.0	29.0	29.0		115	-1.6	0.0	19		29	0,3182		0,0,1591	no	missense	CCDC114	NM_144577.3	58	0,1,2282	TT,TC,CC		0.0,0.0723,0.0219	benign	39/671	48821778	1,4565	692	1591	2283	SO:0001583	missense	93233	exon3			GGGCTGCGCTGAT	BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.115G>A	chr19.hg19:g.48821778C>T	ENSP00000318429:p.Ala39Thr	43.0	0.0		35.0	5.0	NM_144577	Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	ENST00000315396.7	hg19	CCDS12714.2	.	.	.	.	.	.	.	.	.	.	C	10.35	1.326454	0.24080	7.23E-4	0.0	ENSG00000105479	ENST00000315396	T	0.22743	1.94	4.56	-1.63	0.08345	.	.	.	.	.	T	0.09069	0.0224	N	0.14661	0.345	0.09310	N	1	P;P	0.47302	0.893;0.745	B;B	0.35182	0.197;0.123	T	0.27434	-1.0074	9	0.42905	T	0.14	-6.7784	7.666	0.28432	0.0:0.4221:0.0:0.5779	.	39;39	Q96M63;Q96M63-5	CC114_HUMAN;.	T	39	ENSP00000318429:A39T	ENSP00000318429:A39T	A	-	1	0	CCDC114	53513590	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.043000	0.03535	-0.039000	0.13602	-0.482000	0.04802	GCA	.	.		0.657	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343207.1	NM_144577	
MYH14	79784	hgsc.bcm.edu	37	19	50812373	50812373	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr19:50812373G>A	ENST00000596571.1	+	39	5776	c.5776G>A	c.(5776-5778)Gat>Aat	p.D1926N	MYH14_ENST00000440075.2_Missense_Mutation_p.D1967N|MYH14_ENST00000262269.8_Missense_Mutation_p.D1967N|MYH14_ENST00000376970.2_Missense_Mutation_p.D1959N|MYH14_ENST00000601313.1_Missense_Mutation_p.D1967N|MYH14_ENST00000598205.1_Missense_Mutation_p.D1934N|MYH14_ENST00000425460.1_Missense_Mutation_p.D1934N|CTB-191K22.5_ENST00000595563.1_RNA			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1926					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGAGCTGGAAGATGTCACAGA	0.642																																					p.D1967N		Atlas-SNP	.											.	MYH14	261	.	0			c.G5899A						.						83.0	86.0	85.0					19																	50812373		2103	4231	6334	SO:0001583	missense	79784	exon42			CTGGAAGATGTCA	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.5776G>A	chr19.hg19:g.50812373G>A	ENSP00000472819:p.Asp1926Asn	221.0	0.0		194.0	64.0	NM_001145809	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	hg19	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847853	0.91277	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38	3.82	3.82	0.43975	Myosin tail (1);	.	.	.	.	D	0.86719	0.6000	M	0.72118	2.19	0.52501	D	0.99995	D;D;D	0.59357	0.968;0.974;0.985	P;P;P	0.61003	0.57;0.842;0.882	D	0.88467	0.3059	9	0.87932	D	0	.	13.5874	0.61940	0.0:0.0:1.0:0.0	.	1967;1926;1934	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	N	1967;1959;1934;1710;1967	ENSP00000406273:D1967N;ENSP00000366169:D1959N;ENSP00000407879:D1934N;ENSP00000262269:D1967N	ENSP00000262269:D1967N	D	+	1	0	MYH14	55504185	1.000000	0.71417	0.999000	0.59377	0.925000	0.55904	9.003000	0.93577	2.151000	0.67156	0.462000	0.41574	GAT	.	.		0.642	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
ZNF321P	399669	hgsc.bcm.edu	37	19	53432469	53432469	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr19:53432469G>A	ENST00000391777.3	-	4	510	c.389C>T	c.(388-390)aCa>aTa	p.T130I	ZNF816-ZNF321P_ENST00000313956.4_RNA|ZNF816_ENST00000434371.2_Missense_Mutation_p.T130I|ZNF816_ENST00000549216.1_Missense_Mutation_p.T61I			Q8N8H1	ZN321_HUMAN	zinc finger protein 321, pseudogene	61										endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						TTTGATTTCTGTCATGGGTGC	0.408																																					p.T130I		Atlas-SNP	.											.	.	.	.	0			c.C389T						.						186.0	186.0	186.0					19																	53432469		2203	4300	6503	SO:0001583	missense	100529240	exon4			ATTTCTGTCATGG	AK096828		19q13.4	2013-01-08	2011-04-19	2011-04-19	ENSG00000221874	ENSG00000221874			13827	pseudogene	pseudogene			"""zinc finger protein 321"""	ZNF321			Standard	NR_037805		Approved	MGC35402		Q8N8H1	OTTHUMG00000167760	ENST00000391777.3:c.389C>T	chr19.hg19:g.53432469G>A	ENSP00000375656:p.Thr130Ile	111.0	0.0		97.0	40.0	NM_001202473	B7ZB38|Q68DZ0|Q86SS5	Missense_Mutation	SNP	ENST00000391777.3	hg19	CCDS56101.1	.	.	.	.	.	.	.	.	.	.	g	10.51	1.371635	0.24771	.	.	ENSG00000180257;ENSG00000180257;ENSG00000221874	ENST00000549216;ENST00000434371;ENST00000391777	T;T;T	0.02280	4.36;5.64;5.64	1.23	0.147	0.14838	.	.	.	.	.	T	0.05731	0.0150	L	0.58810	1.83	0.09310	N	1	D	0.61697	0.99	P	0.61592	0.891	T	0.36578	-0.9742	9	0.36615	T	0.2	.	3.4192	0.07386	0.2802:0.0:0.7198:0.0	.	61	Q8N8H1	ZN321_HUMAN	I	61;130;130	ENSP00000449832:T61I;ENSP00000438519:T130I;ENSP00000375656:T130I	ENSP00000375656:T130I	T	-	2	0	ZNF321P;ZNF816	58124281	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.173000	0.16724	0.107000	0.17824	0.134000	0.15878	ACA	.	.		0.408	ZNF321P-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000396130.1	NR_037805	
PMEPA1	56937	hgsc.bcm.edu	37	20	56284608	56284608	+	Missense_Mutation	SNP	C	C	T	rs532526691		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr20:56284608C>T	ENST00000341744.3	-	1	350	c.31G>A	c.(31-33)Gcc>Acc	p.A11T	PMEPA1_ENST00000265626.4_Intron|PMEPA1_ENST00000472841.1_Intron|PMEPA1_ENST00000347215.4_Intron|PMEPA1_ENST00000395816.3_Intron	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	11					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						gcggcggcggcggTGCTGTTG	0.751													.|||	1	0.000199681	0.0	0.0	5008	,	,		3302	0.0		0.0	False		,,,				2504	0.001				p.A11T		Atlas-SNP	.											.	PMEPA1	29	.	0			c.G31A						.						21.0	18.0	19.0					20																	56284608		2097	4124	6221	SO:0001583	missense	56937	exon1			CGGCGGCGGTGCT	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.31G>A	chr20.hg19:g.56284608C>T	ENSP00000345826:p.Ala11Thr	116.0	0.0		96.0	4.0	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Missense_Mutation	SNP	ENST00000341744.3	hg19	CCDS13463.1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.739763	0.49045	.	.	ENSG00000124225	ENST00000341744;ENST00000395819	T;T	0.54279	0.84;0.58	2.87	2.87	0.33458	.	.	.	.	.	T	0.27900	0.0687	N	0.08118	0	0.80722	D	1	B	0.24576	0.106	B	0.11329	0.006	T	0.05971	-1.0853	9	0.14656	T	0.56	-6.3608	11.1595	0.48507	0.0:1.0:0.0:0.0	.	11	Q969W9	PMEPA_HUMAN	T	11	ENSP00000345826:A11T;ENSP00000379164:A11T	ENSP00000345826:A11T	A	-	1	0	PMEPA1	55718014	0.998000	0.40836	0.975000	0.42487	0.817000	0.46193	1.549000	0.36212	1.142000	0.42291	0.163000	0.16589	GCC	.	.		0.751	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
XG	7499	hgsc.bcm.edu	37	X	2724766	2724766	+	Intron	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:2724766C>T	ENST00000381174.5	+	8	598				XG_ENST00000426774.1_Intron|XG_ENST00000419513.2_Missense_Mutation_p.S133F			P55808	XG_HUMAN	Xg blood group							integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGACTCAACTCTCGTTATGGA	0.408																																					p.S133F		Atlas-SNP	.											.	XG	22	.	0			c.C398T						.						151.0	106.0	120.0					X																	2724766		692	1590	2282	SO:0001627	intron_variant	7499	exon8			TCAACTCTCGTTA	AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.374-1460C>T	chrX.hg19:g.2724766C>T		259.0	0.0		223.0	30.0	NM_001141919	E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	hg19	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	C	0.025	-1.376260	0.01214	.	.	ENSG00000124343	ENST00000419513	T	0.47177	0.85	1.93	1.93	0.25924	.	0.857039	0.10061	U	0.720940	T	0.41419	0.1158	N	0.14661	0.345	0.19775	N	0.999957	D	0.58620	0.983	P	0.55303	0.773	T	0.24083	-1.0170	10	0.59425	D	0.04	.	7.0818	0.25235	0.0:1.0:0.0:0.0	.	133	P55808-3	.	F	133	ENSP00000411004:S133F	ENSP00000411004:S133F	S	+	2	0	XG	2734766	0.001000	0.12720	0.005000	0.12908	0.061000	0.15899	0.366000	0.20365	1.034000	0.39945	0.384000	0.25694	TCT	.	.		0.408	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569	
AP1S2	8905	hgsc.bcm.edu	37	X	15864090	15864090	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:15864090T>C	ENST00000329235.2	-	3	467	c.224A>G	c.(223-225)aAt>aGt	p.N75S	AP1S2_ENST00000421527.2_Missense_Mutation_p.N117S|AP1S2_ENST00000380291.1_Missense_Mutation_p.N75S|AP1S2_ENST00000479184.1_5'Flank|AP1S2_ENST00000545766.1_Missense_Mutation_p.N117S	NM_001272071.1|NM_003916.3	NP_001259000.1|NP_003907.3	P56377	AP1S2_HUMAN	adaptor-related protein complex 1, sigma 2 subunit	75					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)			large_intestine(1)	1	Hepatocellular(33;0.183)					AATTAGTTCATTGTCCTGATC	0.313																																					p.N75S		Atlas-SNP	.											.	AP1S2	9	.	0			c.A224G						.						86.0	88.0	88.0					X																	15864090		2202	4294	6496	SO:0001583	missense	8905	exon3			AGTTCATTGTCCT	AB015320	CCDS14173.1, CCDS75958.1	Xp22	2014-01-31			ENSG00000182287	ENSG00000182287			560	protein-coding gene	gene with protein product		300629	"""mental retardation, X-linked 59"", ""mental retardation, X-linked, syndromic 5"", ""Pettigrew X-linked mental retardation syndrome"""	MRX59, MRXS5, PGS		9733768, 17186471, 23756445	Standard	NM_003916		Approved	SIGMA1B	uc010nex.4	P56377	OTTHUMG00000021186	ENST00000329235.2:c.224A>G	chrX.hg19:g.15864090T>C	ENSP00000328789:p.Asn75Ser	375.0	1.0		297.0	194.0	NM_001272071	B4DSU4|O95326|Q9H2N6	Missense_Mutation	SNP	ENST00000329235.2	hg19	CCDS14173.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	18.66|18.66	3.671407|3.671407	0.67814|0.67814	.|.	.|.	ENSG00000182287|ENSG00000182287	ENST00000450644|ENST00000329235;ENST00000380291;ENST00000545766;ENST00000421527;ENST00000340245	.|.	.|.	.|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|Longin-like (1);AP complex, mu/sigma subunit (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66426|0.66426	0.2788|0.2788	M|M	0.74467|0.74467	2.265|2.265	0.80722|0.80722	D|D	1|1	.|B;P;B;P;P;P	.|0.49862	.|0.012;0.929;0.066;0.62;0.62;0.58	.|B;P;B;P;P;B	.|0.49226	.|0.078;0.529;0.154;0.603;0.603;0.377	T|T	0.68202|0.68202	-0.5471|-0.5471	5|9	.|0.40728	.|T	.|0.16	-24.5985|-24.5985	15.1946|15.1946	0.73078|0.73078	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|75;117;117;75;75;72	.|B7Z853;B4DSU4;B7Z3M9;Q549M9;P56377;E9PE78	.|.;.;.;.;AP1S2_HUMAN;.	V|S	68|75;75;117;117;72	.|.	.|ENSP00000328789:N75S	M|N	-|-	1|2	0|0	AP1S2|AP1S2	15774011|15774011	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.606000|7.606000	0.82863|0.82863	1.971000|1.971000	0.57363|0.57363	0.483000|0.483000	0.47432|0.47432	ATG|AAT	.	.		0.313	AP1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055893.1	NM_003916	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20187600	20187600	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:20187600T>A	ENST00000379565.3	-	16	1570	c.1363A>T	c.(1363-1365)Aaa>Taa	p.K455*	RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000544447.1_Nonsense_Mutation_p.K427*|RPS6KA3_ENST00000379548.4_Nonsense_Mutation_p.K425*|RPS6KA3_ENST00000540702.1_Nonsense_Mutation_p.K426*	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	455	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	CTCTTGCTTTTATCAATAATC	0.308																																					p.K455X		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.A1363T						.						133.0	130.0	131.0					X																	20187600		2203	4300	6503	SO:0001587	stop_gained	6197	exon16			TGCTTTTATCAAT	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1363A>T	chrX.hg19:g.20187600T>A	ENSP00000368884:p.Lys455*	75.0	0.0		67.0	7.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Nonsense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	38	7.191203	0.98125	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	.	.	.	5.41	4.21	0.49690	.	0.112294	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.7149	0.51647	0.0:0.0:0.1459:0.8541	.	.	.	.	X	455;427;425;426	.	ENSP00000368865:K425X	K	-	1	0	RPS6KA3	20097521	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.934000	0.87649	0.756000	0.33013	0.486000	0.48141	AAA	.	.		0.308	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
ZNF630	57232	hgsc.bcm.edu	37	X	47918452	47918452	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:47918452A>G	ENST00000409324.3	-	5	1605	c.1379T>C	c.(1378-1380)gTg>gCg	p.V460A	ZNF630_ENST00000276054.4_Missense_Mutation_p.V336A|ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000442455.3_Missense_Mutation_p.V446A	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	460					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						GTCAGTACACACATAAGGTTT	0.443																																					p.V460A		Atlas-SNP	.											.	ZNF630	71	.	0			c.T1379C						.						66.0	65.0	65.0					X																	47918452		2194	4287	6481	SO:0001583	missense	57232	exon5			GTACACACATAAG	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1379T>C	chrX.hg19:g.47918452A>G	ENSP00000386393:p.Val460Ala	49.0	0.0		56.0	33.0	NM_001037735	F8WAG4|Q5H8Z5	Missense_Mutation	SNP	ENST00000409324.3	hg19	CCDS35237.2	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.750664	0.00669	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324	T;T;T	0.37411	3.22;1.2;3.22	2.38	-2.75	0.05914	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15825	0.0381	N	0.11651	0.15	0.09310	N	1	B	0.18863	0.031	B	0.19391	0.025	T	0.21484	-1.0244	9	0.51188	T	0.08	.	2.5065	0.04646	0.264:0.0:0.3169:0.4191	.	460	Q2M218	ZN630_HUMAN	A	446;336;460	ENSP00000393163:V446A;ENSP00000354683:V336A;ENSP00000386393:V460A	ENSP00000354683:V336A	V	-	2	0	ZNF630	47803396	0.000000	0.05858	0.031000	0.17742	0.166000	0.22503	-1.982000	0.01489	-0.322000	0.08615	0.433000	0.28618	GTG	.	.		0.443	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735	
TEX11	56159	hgsc.bcm.edu	37	X	69960592	69960592	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:69960592A>G	ENST00000395889.2	-	12	1002	c.847T>C	c.(847-849)Tat>Cat	p.Y283H	TEX11_ENST00000374333.2_Missense_Mutation_p.Y268H|TEX11_ENST00000344304.3_Missense_Mutation_p.Y283H	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	283					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TTATCATAATATTTGGTGTCA	0.323																																					p.Y283H		Atlas-SNP	.											.	TEX11	132	.	0			c.T847C						.						94.0	81.0	85.0					X																	69960592		2203	4300	6503	SO:0001583	missense	56159	exon12			CATAATATTTGGT	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.847T>C	chrX.hg19:g.69960592A>G	ENSP00000379226:p.Tyr283His	185.0	0.0		158.0	95.0	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	hg19	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.320604	0.41096	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.32515	1.45;1.46;1.46	4.74	3.57	0.40892	Tetratricopeptide-like helical (1);	0.077576	0.53938	D	0.000042	T	0.42966	0.1226	M	0.68952	2.095	0.26533	N	0.974213	P;P	0.52316	0.94;0.952	P;P	0.58130	0.798;0.833	T	0.28004	-1.0057	9	.	.	.	-9.438	6.0842	0.19958	0.8836:0.0:0.1164:0.0	.	268;283	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	H	268;283;283	ENSP00000363453:Y268H;ENSP00000379226:Y283H;ENSP00000340995:Y283H	.	Y	-	1	0	TEX11	69877317	0.967000	0.33354	0.820000	0.32676	0.386000	0.30323	1.592000	0.36676	0.656000	0.30886	0.417000	0.27973	TAT	.	.		0.323	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
ITM2A	9452	hgsc.bcm.edu	37	X	78616864	78616864	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:78616864C>T	ENST00000373298.2	-	5	808	c.665G>A	c.(664-666)aGa>aAa	p.R222K	ITM2A_ENST00000434584.2_Missense_Mutation_p.R178K|ITM2A_ENST00000469541.1_5'UTR	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A	222	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.					integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						GAAGGACTTTCTGTTATTGCA	0.443																																					p.R222K		Atlas-SNP	.											.	ITM2A	51	.	0			c.G665A						.						106.0	91.0	96.0					X																	78616864		2203	4299	6502	SO:0001583	missense	9452	exon5			GACTTTCTGTTAT	BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.665G>A	chrX.hg19:g.78616864C>T	ENSP00000362395:p.Arg222Lys	273.0	0.0		302.0	58.0	NM_004867	B2R7X5|B4E062|Q6IBC9	Missense_Mutation	SNP	ENST00000373298.2	hg19	CCDS14444.1	.	.	.	.	.	.	.	.	.	.	C	0.553	-0.848467	0.02651	.	.	ENSG00000078596	ENST00000373298;ENST00000434584	T;T	0.78707	-1.2;-1.2	4.11	2.95	0.34219	BRICHOS (2);	0.135951	0.43919	D	0.000520	T	0.45796	0.1360	N	0.02802	-0.49	0.37139	D	0.901612	B;B	0.10296	0.003;0.001	B;B	0.11329	0.006;0.006	T	0.47195	-0.9136	10	0.06365	T	0.9	-8.3944	5.8741	0.18819	0.0:0.7284:0.0:0.2716	.	178;222	B4E062;O43736	.;ITM2A_HUMAN	K	222;178	ENSP00000362395:R222K;ENSP00000415533:R178K	ENSP00000362395:R222K	R	-	2	0	ITM2A	78503520	0.989000	0.36119	0.984000	0.44739	0.527000	0.34593	0.722000	0.25925	1.789000	0.52484	0.513000	0.50165	AGA	.	.		0.443	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057329.1	NM_004867	
ARMCX3	51566	hgsc.bcm.edu	37	X	100880946	100880946	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:100880946A>G	ENST00000341189.4	+	5	1843	c.977A>G	c.(976-978)aAt>aGt	p.N326S	ARMCX3_ENST00000537169.1_Missense_Mutation_p.N326S|RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3-AS1_ENST00000454228.1_RNA|ARMCX3_ENST00000471229.2_Missense_Mutation_p.N326S	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	326					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						CCTACTCAGAATCAATTCGGT	0.303																																					p.N326S		Atlas-SNP	.											.	ARMCX3	33	.	0			c.A977G						.						49.0	54.0	52.0					X																	100880946		2190	4289	6479	SO:0001583	missense	51566	exon5			CTCAGAATCAATT	AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.977A>G	chrX.hg19:g.100880946A>G	ENSP00000340672:p.Asn326Ser	163.0	0.0		296.0	244.0	NM_016607	Q53HC6|Q7LCF5|Q9NPE4	Missense_Mutation	SNP	ENST00000341189.4	hg19	CCDS14489.1	.	.	.	.	.	.	.	.	.	.	A	1.383	-0.583008	0.03827	.	.	ENSG00000102401	ENST00000341189;ENST00000537169	T;T	0.28895	1.59;1.59	4.44	3.26	0.37387	Armadillo-type fold (1);	0.477766	0.25711	N	0.028803	T	0.14442	0.0349	N	0.08118	0	0.24920	N	0.991989	B	0.17852	0.024	B	0.28385	0.089	T	0.27773	-1.0064	9	.	.	.	-7.3172	6.3575	0.21410	0.7779:0.0:0.0:0.2221	.	326	Q9UH62	ARMX3_HUMAN	S	326	ENSP00000340672:N326S;ENSP00000439032:N326S	.	N	+	2	0	ARMCX3	100767602	1.000000	0.71417	0.987000	0.45799	0.980000	0.70556	1.053000	0.30442	0.797000	0.33971	0.486000	0.48141	AAT	.	.		0.303	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	NM_016607	
SMIM10	644538	hgsc.bcm.edu	37	X	134125216	134125216	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:134125216C>A	ENST00000330288.4	+	1	249	c.91C>A	c.(91-93)Cgc>Agc	p.R31S		NM_001163438.1	NP_001156910.1	Q96HG1	SIM10_HUMAN	small integral membrane protein 10	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GCGGCTGTCGCGCCCGCAGGG	0.697																																					p.R31S		Atlas-SNP	.											.	.	.	.	0			c.C91A						.						18.0	19.0	19.0					X																	134125216		692	1590	2282	SO:0001583	missense	644538	exon1			CTGTCGCGCCCGC		CCDS55502.1	Xq26.3	2012-11-29	2012-11-29	2012-11-29	ENSG00000184785	ENSG00000184785			41913	protein-coding gene	gene with protein product			"""chromosome X open reading frame 69"""	CXorf69			Standard	NM_001163438		Approved		uc011mvs.2	Q96HG1		ENST00000330288.4:c.91C>A	chrX.hg19:g.134125216C>A	ENSP00000328335:p.Arg31Ser	77.0	0.0		148.0	67.0	NM_001163438		Missense_Mutation	SNP	ENST00000330288.4	hg19	CCDS55502.1	.	.	.	.	.	.	.	.	.	.	C	10.97	1.501437	0.26861	.	.	ENSG00000184785	ENST00000330288	.	.	.	2.98	2.05	0.26809	.	0.765303	0.10960	N	0.615082	T	0.25754	0.0627	.	.	.	0.09310	N	1	B	0.29253	0.239	B	0.28385	0.089	T	0.20140	-1.0284	8	0.19590	T	0.45	.	9.0251	0.36224	0.0:0.7751:0.2248:0.0	.	31	Q96HG1	CX069_HUMAN	S	31	.	ENSP00000328335:R31S	R	+	1	0	Z83826.1	133952882	0.345000	0.24835	0.001000	0.08648	0.003000	0.03518	1.067000	0.30616	0.627000	0.30340	0.550000	0.68814	CGC	.	.		0.697	SMIM10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001163438	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718337	142718337	+	Silent	SNP	G	G	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:142718337G>A	ENST00000381779.4	-	2	813	c.588C>T	c.(586-588)atC>atT	p.I196I	SLITRK4_ENST00000338017.4_Silent_p.I196I|SLITRK4_ENST00000356928.1_Silent_p.I196I	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	196						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGAACCCCGATATAAGGGA	0.433																																					p.I196I		Atlas-SNP	.											.	SLITRK4	162	.	0			c.C588T						.						78.0	75.0	76.0					X																	142718337		2203	4300	6503	SO:0001819	synonymous_variant	139065	exon2			AACCCCGATATAA	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.588C>T	chrX.hg19:g.142718337G>A		153.0	0.0		224.0	163.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Silent	SNP	ENST00000381779.4	hg19	CCDS14679.1																																																																																			.	.		0.433	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718339	142718339	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:142718339T>A	ENST00000381779.4	-	2	811	c.586A>T	c.(586-588)Atc>Ttc	p.I196F	SLITRK4_ENST00000338017.4_Missense_Mutation_p.I196F|SLITRK4_ENST00000356928.1_Missense_Mutation_p.I196F	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	196						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					AGAACCCCGATATAAGGGAGC	0.428																																					p.I196F		Atlas-SNP	.											.	SLITRK4	162	.	0			c.A586T						.						78.0	75.0	76.0					X																	142718339		2203	4300	6503	SO:0001583	missense	139065	exon2			CCCCGATATAAGG	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.586A>T	chrX.hg19:g.142718339T>A	ENSP00000371198:p.Ile196Phe	152.0	0.0		221.0	162.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	T	11.02	1.517065	0.27123	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.53206	0.63;0.63;0.63	5.59	5.59	0.84812	.	0.067032	0.56097	D	0.000030	T	0.33789	0.0875	N	0.11845	0.185	0.53005	D	0.999968	P	0.38195	0.622	B	0.39299	0.296	T	0.31420	-0.9944	10	0.54805	T	0.06	-10.3098	13.5237	0.61582	0.0:0.0:0.0:1.0	.	196	Q8IW52	SLIK4_HUMAN	F	196	ENSP00000371198:I196F;ENSP00000349400:I196F;ENSP00000336627:I196F	ENSP00000336627:I196F	I	-	1	0	SLITRK4	142546005	0.998000	0.40836	0.991000	0.47740	0.986000	0.74619	2.207000	0.42788	1.877000	0.54381	0.486000	0.48141	ATC	.	.		0.428	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
CNGA2	1260	hgsc.bcm.edu	37	X	150912121	150912121	+	Silent	SNP	G	G	T			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:150912121G>T	ENST00000329903.4	+	6	1179	c.1146G>T	c.(1144-1146)cgG>cgT	p.R382R		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	382					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					ATGCCACCCGGGCAGAGTTCC	0.498																																					p.R382R		Atlas-SNP	.											.	CNGA2	136	.	0			c.G1146T						.						108.0	99.0	102.0					X																	150912121		2203	4300	6503	SO:0001819	synonymous_variant	1260	exon7			CACCCGGGCAGAG	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1146G>T	chrX.hg19:g.150912121G>T		45.0	0.0		66.0	28.0	NM_005140	A0AVD0	Silent	SNP	ENST00000329903.4	hg19	CCDS14701.1																																																																																			.	.		0.498	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
CNGA2	1260	hgsc.bcm.edu	37	X	150912140	150912140	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:150912140A>G	ENST00000329903.4	+	6	1198	c.1165A>G	c.(1165-1167)Atc>Gtc	p.I389V		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	389					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGGCTAAGATCGATGCCGT	0.507																																					p.I389V		Atlas-SNP	.											.	CNGA2	136	.	0			c.A1165G						.						109.0	98.0	102.0					X																	150912140		2203	4300	6503	SO:0001583	missense	1260	exon7			GCTAAGATCGATG	S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.1165A>G	chrX.hg19:g.150912140A>G	ENSP00000328478:p.Ile389Val	44.0	0.0		63.0	48.0	NM_005140	A0AVD0	Missense_Mutation	SNP	ENST00000329903.4	hg19	CCDS14701.1	.	.	.	.	.	.	.	.	.	.	A	9.324	1.058721	0.19987	.	.	ENSG00000183862	ENST00000329903	D	0.96685	-4.09	4.96	4.96	0.65561	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.91516	0.7321	N	0.21508	0.67	0.40174	D	0.97721	B	0.21753	0.06	B	0.18263	0.021	D	0.88493	0.3077	10	0.30078	T	0.28	.	11.7614	0.51905	1.0:0.0:0.0:0.0	.	389	Q16280	CNGA2_HUMAN	V	389	ENSP00000328478:I389V	ENSP00000328478:I389V	I	+	1	0	CNGA2	150662796	1.000000	0.71417	0.983000	0.44433	0.833000	0.47200	5.956000	0.70315	1.749000	0.51849	0.430000	0.28490	ATC	.	.		0.507	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060888.1	NM_005140	
SEC31A	22872	hgsc.bcm.edu	37	4	83778256	83778267	+	In_Frame_Del	DEL	AAAGCCTGAGTA	AAAGCCTGAGTA	-			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	AAAGCCTGAGTA	AAAGCCTGAGTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:83778256_83778267delAAAGCCTGAGTA	ENST00000395310.2	-	16	1901_1912	c.1719_1730delTACTCAGGCTTT	c.(1717-1731)attactcaggctttg>atg	p.573_577ITQAL>M	SEC31A_ENST00000326950.5_In_Frame_Del_p.534_538ITQAL>M|SEC31A_ENST00000355196.2_In_Frame_Del_p.573_577ITQAL>M|SEC31A_ENST00000448323.1_In_Frame_Del_p.573_577ITQAL>M|SEC31A_ENST00000311785.7_In_Frame_Del_p.573_577ITQAL>M|SEC31A_ENST00000508502.1_In_Frame_Del_p.573_577ITQAL>M|SEC31A_ENST00000505984.1_In_Frame_Del_p.534_538ITQAL>M|SEC31A_ENST00000505472.1_In_Frame_Del_p.573_577ITQAL>M|SEC31A_ENST00000513858.1_In_Frame_Del_p.534_538ITQAL>M|SEC31A_ENST00000509142.1_In_Frame_Del_p.573_577ITQAL>M|SEC31A_ENST00000500777.2_In_Frame_Del_p.534_538ITQAL>M|SEC31A_ENST00000264405.5_In_Frame_Del_p.306_310ITQAL>M|SEC31A_ENST00000443462.2_In_Frame_Del_p.568_572ITQAL>M|SEC31A_ENST00000348405.4_In_Frame_Del_p.534_538ITQAL>M|SEC31A_ENST00000432794.1_In_Frame_Del_p.573_577ITQAL>M|SEC31A_ENST00000508479.1_In_Frame_Del_p.573_577ITQAL>M	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	573					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				GCCCGTCAGCAAAGCCTGAGTAATTAAACCAT	0.373																																					p.574_577del		Atlas-INDEL	.											.	SEC31A	227	.	0			c.1720_1731del						.																																			SO:0001651	inframe_deletion	22872	exon16			.	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.1719_1730delTACTCAGGCTTT	chr4.hg19:g.83778256_83778267delAAAGCCTGAGTA	ENSP00000378721:p.Ile573_Leu577delinsMet	237.0	0.0		167.0	34.0	NM_001077206	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	In_Frame_Del	DEL	ENST00000395310.2	hg19	CCDS3596.1																																																																																			.	.		0.373	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	
SPATA3	130560	hgsc.bcm.edu	37	2	231861059	231861060	+	Frame_Shift_Ins	INS	-	-	CT	rs72362780		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr2:231861059_231861060insCT	ENST00000452881.1	+	1	219_220	c.111_112insCT	c.(112-114)cagfs	p.Q38fs	SPATA3_ENST00000424440.1_Frame_Shift_Ins_p.Q38fs|SPATA3_ENST00000433428.2_Frame_Shift_Ins_p.Q38fs|SPATA3_ENST00000455816.1_Frame_Shift_Ins_p.Q38fs|AC105344.2_ENST00000414876.1_lincRNA			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	38										endometrium(2)|lung(1)	3						AATCCACACCACAGCAGCCTAG	0.574																																					p.P37fs		Atlas-INDEL	.											SPATA3,NS,carcinoma,0,3	SPATA3	52	.	0			c.111_112insCT						.																																			SO:0001589	frameshift_variant	130560	exon1			.	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	Exception_encountered	chr2.hg19:g.231861059_231861060insCT	ENSP00000388895:p.Gln38fs	108.0	0.0		107.0	27.0	NM_139073	Q86WX5|Q8N9Y6	Frame_Shift_Ins	INS	ENST00000452881.1	hg19	CCDS2481.1																																																																																			.	.		0.574	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256956.2	NM_139073	
TTC13	79573	hgsc.bcm.edu	37	1	231048481	231048481	+	Frame_Shift_Del	DEL	A	A	-			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr1:231048481delA	ENST00000366661.4	-	19	2124	c.2117delT	c.(2116-2118)gtgfs	p.V706fs	TTC13_ENST00000366662.4_Frame_Shift_Del_p.V652fs|TTC13_ENST00000414259.1_Frame_Shift_Del_p.V653fs	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	706										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		TTGAGTTTCCACAGAAAATAA	0.294																																					p.V706fs		Atlas-INDEL	.											.	TTC13	74	.	0			c.2118delG						.						115.0	118.0	117.0					1																	231048481		2202	4300	6502	SO:0001589	frameshift_variant	79573	exon19			.		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.2117delT	chr1.hg19:g.231048481delA	ENSP00000355621:p.Val706fs	83.0	0.0		110.0	47.0	NM_024525	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Frame_Shift_Del	DEL	ENST00000366661.4	hg19	CCDS1588.1																																																																																			.	.		0.294	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	NM_024525	
MUC2	4583	hgsc.bcm.edu	37	11	1092602	1092619	+	In_Frame_Del	DEL	CCACCACTCCCAGCCCTC	CCACCACTCCCAGCCCTC	-	rs201595190|rs201608750|rs547682241	byFrequency	TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	CCACCACTCCCAGCCCTC	CCACCACTCCCAGCCCTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr11:1092602_1092619delCCACCACTCCCAGCCCTC	ENST00000441003.2	+	30	4448_4465	c.4421_4438delCCACCACTCCCAGCCCTC	c.(4420-4440)accaccactcccagccctcca>aca	p.TTPSPP1475del	MUC2_ENST00000359061.5_In_Frame_Del_p.TTPSPP1476del|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4210	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	agccctccaaccaccactcccagccctccaaccaccac	0.628																																					p.1474_1479del		Atlas-INDEL	.											.	MUC2	614	.	0			c.4420_4437del						.			764,1992		44,676,658						-2.6	0.0		dbSNP_134	244	1546,3660		46,1454,1103	no	coding	MUC2	NM_002457.2		90,2130,1761	A1A1,A1R,RR		29.6965,27.7213,29.0128				2310,5652				SO:0001651	inframe_deletion	4583	exon30			.	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4421_4438delCCACCACTCCCAGCCCTC	chr11.hg19:g.1092602_1092619delCCACCACTCCCAGCCCTC	ENSP00000415183:p.Thr1475_Pro1480del	110.0	0.0		83.0	11.0	NM_002457	Q14878	In_Frame_Del	DEL	ENST00000441003.2	hg19																																																																																				.	.		0.628	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
NCBP1	4686	hgsc.bcm.edu	37	9	100403939	100403963	+	Splice_Site	DEL	TACAGTGTATGTATGCAAAAGATTT	TACAGTGTATGTATGCAAAAGATTT	-	rs141438765	byFrequency	TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	TACAGTGTATGTATGCAAAAGATTT	TACAGTGTATGTATGCAAAAGATTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr9:100403939_100403963delTACAGTGTATGTATGCAAAAGATTT	ENST00000375147.3	+	3	475_480	c.219_224delTACAGTGTATGTATGCAAAAGATTT	c.(217-225)tgtacagtg>tgg	p.CTV73fs		NM_002486.4	NP_002477.1	Q09161	NCBP1_HUMAN	nuclear cap binding protein subunit 1, 80kDa	73	MIF4G.				7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA cap binding (GO:0000339)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)	19		Acute lymphoblastic leukemia(62;0.158)				GGCTTCTTTGTACAGTGTATGTATGCAAAAGATTTATGAATCCAG	0.378																																					p.73_75del	Ovarian(36;879 898 2893 44212 50307)	Atlas-INDEL	.											.	NCBP1	64	.	0			c.218_224del						.																																			SO:0001630	splice_region_variant	4686	exon3			.	BC001450	CCDS6728.1	9q34.1	2010-01-26	2002-08-29		ENSG00000136937	ENSG00000136937			7658	protein-coding gene	gene with protein product		600469	"""nuclear cap binding protein subunit 1, 80kD"""	NCBP		7937105, 8812508	Standard	NM_002486		Approved	CBP80, Sto1	uc004axq.3	Q09161	OTTHUMG00000020332	ENST00000375147.3:c.224+1TACAGTGTATGTATGCAAAAGATTT>-	chr9.hg19:g.100403939_100403963delTACAGTGTATGTATGCAAAAGATTT		68.0	0.0		52.0	10.0	NM_002486	B2R718|Q59G76|Q5T1V0|Q5T7X2	Frame_Shift_Del	DEL	ENST00000375147.3	hg19	CCDS6728.1																																																																																			.	.		0.378	NCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053337.1	NM_002486	Frame_Shift_Del
DSPP	1834	hgsc.bcm.edu	37	4	88535940	88535941	+	In_Frame_Ins	INS	-	-	TAG			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:88535940_88535941insTAG	ENST00000282478.7	+	4	2159_2160	c.2126_2127insTAG	c.(2125-2130)gatagt>gaTAGtagt	p.710_711insS	DSPP_ENST00000399271.1_In_Frame_Ins_p.710_711insS|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	710	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcagtgatagtgacagca	0.49																																					p.D709delinsDS		Atlas-INDEL	.											.	DSPP	174	.	0			c.2126_2127insTAG						.																																			SO:0001652	inframe_insertion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2127_2129dupTAG	chr4.hg19:g.88535941_88535943dupTAG	ENSP00000282478:p.Ser712_Ser713dup	231.0	0.0		204.0	14.0	NM_014208	A8MUI0|O95815	In_Frame_Ins	INS	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.490	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	hgsc.bcm.edu	37	4	88535923	88535925	+	In_Frame_Del	DEL	TAG	TAG	-			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	TAG	TAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr4:88535923_88535925delTAG	ENST00000282478.7	+	4	2142_2144	c.2109_2111delTAG	c.(2107-2112)gatagt>gat	p.S705del	DSPP_ENST00000399271.1_In_Frame_Del_p.S705del|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	705	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		agagcagtgatagtagtgacagc	0.488																																					p.703_704del		Atlas-INDEL	.											.	DSPP	174	.	0			c.2108_2110del						.																																			SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2109_2111delTAG	chr4.hg19:g.88535926_88535928delTAG	ENSP00000282478:p.Ser705del	230.0	0.0		198.0	32.0	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.488	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SLITRK4	139065	hgsc.bcm.edu	37	X	142718332	142718333	+	Frame_Shift_Ins	INS	-	-	C			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chrX:142718332_142718333insC	ENST00000381779.4	-	2	817_818	c.592_593insG	c.(592-594)gttfs	p.V198fs	SLITRK4_ENST00000338017.4_Frame_Shift_Ins_p.V198fs|SLITRK4_ENST00000356928.1_Frame_Shift_Ins_p.V198fs	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	198						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					GTGTTCCAGAACCCCGATATAA	0.436																																					p.V198fs		Atlas-INDEL	.											.	SLITRK4	162	.	0			c.593_594insG						.																																			SO:0001589	frameshift_variant	139065	exon2			.	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.593dupG	chrX.hg19:g.142718336_142718336dupC	ENSP00000371198:p.Val198fs	150.0	0.0		228.0	159.0	NM_173078	Q5JXG3|Q8TCM8|Q96DL3	Frame_Shift_Ins	INS	ENST00000381779.4	hg19	CCDS14679.1																																																																																			.	.		0.436	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
ELAC1	55520	hgsc.bcm.edu	37	18	48500817	48500820	+	Frame_Shift_Del	DEL	CCAT	CCAT	-			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	CCAT	CCAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr18:48500817_48500820delCCAT	ENST00000269466.3	+	2	150_153	c.43_46delCCAT	c.(43-48)ccatctfs	p.PS15fs	RP11-729L2.2_ENST00000590722.2_Frame_Shift_Del_p.PS15fs|SMAD4_ENST00000452201.2_5'UTR|ELAC1_ENST00000591429.1_Frame_Shift_Del_p.PS15fs|ELAC1_ENST00000588577.1_Frame_Shift_Del_p.PS15fs|RP11-729L2.2_ENST00000588256.1_3'UTR	NM_018696.2	NP_061166.1	Q9H777	RNZ1_HUMAN	elaC ribonuclease Z 1	15					tRNA 3'-trailer cleavage (GO:0042779)	cytosol (GO:0005829)|nucleus (GO:0005634)	endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(4)|prostate(1)	6		Colorectal(6;0.0269)|all_epithelial(6;0.0729)		Colorectal(21;0.000943)|COAD - Colon adenocarcinoma(17;0.0398)|READ - Rectum adenocarcinoma(32;0.0894)|STAD - Stomach adenocarcinoma(97;0.18)		TGCAGCATACCCATCTCCAACCCG	0.515																																					p.14_15del		Atlas-INDEL	.											.	ELAC1	17	.	0			c.42_45del						.																																			SO:0001589	frameshift_variant	55520	exon2			.	AB029151	CCDS11949.1	18q21	2013-05-24	2013-05-24		ENSG00000141642	ENSG00000141642	3.1.26.11		14197	protein-coding gene	gene with protein product	"""tRNA Z (short form)"", ""RNaseZ(S)"""	608079	"""elaC (E. coli) homolog 1"", ""elaC homolog 1 (E. coli)"""			12711671, 21559454	Standard	NM_018696		Approved	D29	uc002lez.3	Q9H777	OTTHUMG00000132695	ENST00000269466.3:c.43_46delCCAT	chr18.hg19:g.48500817_48500820delCCAT	ENSP00000269466:p.Pro15fs	129.0	0.0		111.0	36.0	NM_018696	Q9NS99	Frame_Shift_Del	DEL	ENST00000269466.3	hg19	CCDS11949.1																																																																																			.	.		0.515	ELAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255992.2		
MAZ	4150	hgsc.bcm.edu	37	16	29819111	29819111	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr16:29819111delG	ENST00000322945.6	+	2	1170	c.1005delG	c.(1003-1005)aagfs	p.K335fs	AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000568544.1_5'Flank|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000569978.1_5'Flank|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000219782.6_Frame_Shift_Del_p.K335fs|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000568282.1_5'Flank|MAZ_ENST00000566906.2_Intron|MAZ_ENST00000562337.1_Intron|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000545521.1_Frame_Shift_Del_p.K312fs	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	335					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						CTGTGCACAAGCCCTACAACT	0.682																																					p.K335fs	Colon(72;875 1167 15364 30899 37091)	Atlas-INDEL	.											.	MAZ	48	.	0			c.1004delA						.																																			SO:0001589	frameshift_variant	4150	exon2			.	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1005delG	chr16.hg19:g.29819111delG	ENSP00000313362:p.Lys335fs	50.0	0.0		52.0	21.0	NM_002383	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Frame_Shift_Del	DEL	ENST00000322945.6	hg19	CCDS42143.1																																																																																			.	.		0.682	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435536.1	NM_002383	
GPS2	2874	hgsc.bcm.edu	37	17	7216083	7216095	+	Frame_Shift_Del	DEL	GGTAGAATCGCGG	GGTAGAATCGCGG	-	rs3180570|rs147653865|rs201341909|rs142252898		TCGA-ZP-A9CV-01A-11D-A382-10	TCGA-ZP-A9CV-10B-01D-A385-10	GGTAGAATCGCGG	GGTAGAATCGCGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41039f88-9d78-4c6c-b429-d1c87cd8e568	917fa983-ed0a-4cee-b281-caabdc37221b	g.chr17:7216083_7216095delGGTAGAATCGCGG	ENST00000380728.2	-	11	1264_1276	c.964_976delCCGCGATTCTACC	c.(964-978)ccgcgattctaccacfs	p.PRFYH322fs	GPS2_ENST00000391950.3_Intron|GPS2_ENST00000389167.5_Frame_Shift_Del_p.PRFYH322fs|RP11-542C16.2_ENST00000575474.1_3'UTR			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	322					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)	p.R323*(1)		breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GGTCACTTGTGGTAGAATCGCGGGTTCTGGCTG	0.559																																					p.322_326del		Atlas-INDEL	.											.	GPS2	44	.	1	Substitution - Nonsense(1)	endometrium(1)	c.965_977del						.																																			SO:0001589	frameshift_variant	2874	exon11			.	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.964_976delCCGCGATTCTACC	chr17.hg19:g.7216083_7216095delGGTAGAATCGCGG	ENSP00000370104:p.Pro322fs	62.0	0.0		57.0	10.0	NM_004489	B4DXA1|Q6FHM8	Frame_Shift_Del	DEL	ENST00000380728.2	hg19	CCDS11100.1																																																																																			.	.		0.559	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489	
