#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NPHP4	261734	hgsc.bcm.edu	37	1	5927958	5927958	+	Splice_Site	SNP	T	T	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:5927958T>G	ENST00000378156.4	-	24	3581		c.e24-2		NPHP4_ENST00000478423.2_Splice_Site	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4						actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		GAACAAGACCTGTGAGGAGGC	0.602																																					.		Atlas-SNP	.											.	NPHP4	119	.	0			c.3316-2A>C						.						49.0	57.0	55.0					1																	5927958		2163	4260	6423	SO:0001630	splice_region_variant	261734	exon25			AAGACCTGTGAGG	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.3316-2A>C	chr1.hg19:g.5927958T>G		99.0	0.0		67.0	35.0	NM_015102	Q8IWC0	Splice_Site	SNP	ENST00000378156.4	hg19	CCDS44052.1	.	.	.	.	.	.	.	.	.	.	T	12.21	1.870377	0.33069	.	.	ENSG00000131697	ENST00000378156	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9117	0.70761	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NPHP4	5850545	1.000000	0.71417	0.994000	0.49952	0.052000	0.14988	7.900000	0.87376	2.117000	0.64856	0.459000	0.35465	.	.	.		0.602	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001715.2		Intron
ERRFI1	54206	hgsc.bcm.edu	37	1	8073423	8073423	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:8073423C>A	ENST00000377482.5	-	4	1459	c.1236G>T	c.(1234-1236)agG>agT	p.R412S	ERRFI1_ENST00000474874.1_Intron	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	412					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		CTTCTGCTTCCCTAAAAAATT	0.408																																					p.R412S		Atlas-SNP	.											.	ERRFI1	42	.	0			c.G1236T						.						144.0	140.0	141.0					1																	8073423		2203	4300	6503	SO:0001583	missense	54206	exon4			TGCTTCCCTAAAA	BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.1236G>T	chr1.hg19:g.8073423C>A	ENSP00000366702:p.Arg412Ser	158.0	0.0		129.0	47.0	NM_018948	B2RDX9|Q9NTG9|Q9UD05	Missense_Mutation	SNP	ENST00000377482.5	hg19	CCDS94.1	.	.	.	.	.	.	.	.	.	.	C	15.07	2.724773	0.48833	.	.	ENSG00000116285	ENST00000377482	T	0.18338	2.22	5.9	4.0	0.46444	.	0.141384	0.48286	D	0.000200	T	0.17152	0.0412	L	0.57536	1.79	0.80722	D	1	B	0.19706	0.038	B	0.14023	0.01	T	0.03534	-1.1027	10	0.72032	D	0.01	-3.5302	7.6674	0.28439	0.0:0.7082:0.1371:0.1547	.	412	Q9UJM3	ERRFI_HUMAN	S	412	ENSP00000366702:R412S	ENSP00000366702:R412S	R	-	3	2	ERRFI1	7996010	0.978000	0.34361	0.736000	0.30914	0.923000	0.55619	1.818000	0.39012	0.802000	0.34089	0.650000	0.86243	AGG	.	.		0.408	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003617.1	NM_018948	
PADI1	29943	hgsc.bcm.edu	37	1	17555182	17555182	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:17555182G>T	ENST00000375471.4	+	7	807	c.715G>T	c.(715-717)Gag>Tag	p.E239*		NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	239					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	CTATGAAGTTGAGCGACAGCC	0.567																																					p.E239X	Esophageal Squamous(80;414 1257 4580 27746 50832)	Atlas-SNP	.											.	PADI1	77	.	0			c.G715T						.						147.0	156.0	153.0					1																	17555182		2203	4300	6503	SO:0001587	stop_gained	29943	exon7			GAAGTTGAGCGAC	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.715G>T	chr1.hg19:g.17555182G>T	ENSP00000364620:p.Glu239*	109.0	0.0		71.0	19.0	NM_013358	A1L4K6|Q70SX6	Nonsense_Mutation	SNP	ENST00000375471.4	hg19	CCDS178.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.991974	0.54041	.	.	ENSG00000142623	ENST00000375471	.	.	.	4.83	1.85	0.25348	.	0.553031	0.19267	N	0.118520	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-13.3718	5.5782	0.17235	0.2492:0.1406:0.6102:0.0	.	.	.	.	X	239	.	ENSP00000364620:E239X	E	+	1	0	PADI1	17427769	0.001000	0.12720	0.017000	0.16124	0.065000	0.16274	0.323000	0.19593	0.441000	0.26529	0.561000	0.74099	GAG	.	.		0.567	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006621.1	NM_013358	
LRRC41	10489	hgsc.bcm.edu	37	1	46751145	46751145	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:46751145T>C	ENST00000343304.6	-	4	1669	c.1384A>G	c.(1384-1386)Atc>Gtc	p.I462V	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	462					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					AAGGTGGAGATGCTGCGGAAT	0.557																																					p.I462V		Atlas-SNP	.											.	LRRC41	74	.	0			c.A1384G						.						101.0	95.0	97.0					1																	46751145		2203	4300	6503	SO:0001583	missense	10489	exon4			TGGAGATGCTGCG	AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1384A>G	chr1.hg19:g.46751145T>C	ENSP00000343298:p.Ile462Val	74.0	0.0		50.0	25.0	NM_006369	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	hg19	CCDS533.1	.	.	.	.	.	.	.	.	.	.	t	1.866	-0.461401	0.04508	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	T	0.53640	0.61	5.16	4.04	0.47022	.	0.089161	0.46145	D	0.000317	T	0.17323	0.0416	N	0.03608	-0.345	0.26917	N	0.966763	B;B;B	0.18461	0.013;0.028;0.013	B;B;B	0.22386	0.019;0.039;0.011	T	0.34378	-0.9831	10	0.02654	T	1	8.1046	4.3228	0.11025	0.0:0.3013:0.0:0.6987	.	462;440;462	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	V	462;440	ENSP00000343298:I462V	ENSP00000343298:I462V	I	-	1	0	LRRC41	46523732	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.472000	0.45136	1.962000	0.57031	0.370000	0.22315	ATC	.	.		0.557	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021438.1	NM_006369	
OLFM3	118427	hgsc.bcm.edu	37	1	102271685	102271685	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:102271685T>C	ENST00000338858.5	-	5	705	c.706A>G	c.(706-708)Acc>Gcc	p.T236A	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.T216A			Q96PB7	NOE3_HUMAN	olfactomedin 3	236	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CCAAATCGGGTTCCAGATGTC	0.418																																					p.T216A		Atlas-SNP	.											.	OLFM3	178	.	0			c.A646G						.						166.0	150.0	155.0					1																	102271685		2203	4300	6503	SO:0001583	missense	118427	exon5			ATCGGGTTCCAGA	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.706A>G	chr1.hg19:g.102271685T>C	ENSP00000345192:p.Thr236Ala	95.0	0.0		103.0	47.0	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	hg19		.	.	.	.	.	.	.	.	.	.	T	15.13	2.742796	0.49151	.	.	ENSG00000118733	ENST00000424771;ENST00000370103;ENST00000338858	D;D	0.88431	-2.38;-2.38	5.17	5.17	0.71159	Olfactomedin-like (3);	0.050460	0.85682	D	0.000000	T	0.76730	0.4028	L	0.42245	1.32	0.80722	D	1	B;B	0.20052	0.019;0.041	B;B	0.26614	0.071;0.063	T	0.73322	-0.4019	10	0.23891	T	0.37	.	11.0763	0.48034	0.0:0.0:0.1551:0.8449	.	216;236	Q5T3V6;Q96PB7	.;NOE3_HUMAN	A	87;216;236	ENSP00000359121:T216A;ENSP00000345192:T236A	ENSP00000345192:T236A	T	-	1	0	OLFM3	102044273	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.979000	0.56888	1.962000	0.57031	0.482000	0.46254	ACC	.	.		0.418	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
LRIF1	55791	hgsc.bcm.edu	37	1	111494486	111494486	+	Silent	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:111494486G>T	ENST00000369763.4	-	2	1410	c.1020C>A	c.(1018-1020)atC>atA	p.I340I	LRIF1_ENST00000494675.1_Intron|LRIF1_ENST00000485275.2_Intron|RP11-96K19.2_ENST00000440689.1_RNA	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						CACTAGGATCGATGGTACTCA	0.338																																					p.I340I		Atlas-SNP	.											.	LRIF1	65	.	0			c.C1020A						.						72.0	74.0	73.0					1																	111494486		2202	4300	6502	SO:0001819	synonymous_variant	55791	exon2			AGGATCGATGGTA	AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1020C>A	chr1.hg19:g.111494486G>T		68.0	0.0		46.0	22.0	NM_018372	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Silent	SNP	ENST00000369763.4	hg19	CCDS30800.1																																																																																			.	.		0.338	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372	
BCL9	607	hgsc.bcm.edu	37	1	147092530	147092530	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:147092530T>C	ENST00000234739.3	+	8	3309	c.2569T>C	c.(2569-2571)Tcc>Ccc	p.S857P		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	857	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCAGGTGCATTCCCCAGGCAT	0.612			T	"""IGH@, IGL@"""	B-ALL																																p.S857P		Atlas-SNP	.		Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	.	BCL9	150	.	0			c.T2569C						.						64.0	62.0	63.0					1																	147092530		2203	4300	6503	SO:0001583	missense	607	exon8			GTGCATTCCCCAG	Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.2569T>C	chr1.hg19:g.147092530T>C	ENSP00000234739:p.Ser857Pro	39.0	0.0		69.0	21.0	NM_004326	Q5T489	Missense_Mutation	SNP	ENST00000234739.3	hg19	CCDS30833.1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.807150	0.50421	.	.	ENSG00000116128	ENST00000234739	T	0.63744	-0.06	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.65133	0.2662	L	0.36672	1.1	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.78314	0.991;0.991	T	0.70662	-0.4810	10	0.87932	D	0	-16.7505	15.5185	0.75846	0.0:0.0:0.0:1.0	.	857;857	Q1JQ81;O00512	.;BCL9_HUMAN	P	857	ENSP00000234739:S857P	ENSP00000234739:S857P	S	+	1	0	BCL9	145559154	1.000000	0.71417	0.990000	0.47175	0.245000	0.25701	6.113000	0.71553	2.246000	0.74042	0.533000	0.62120	TCC	.	.		0.612	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039468.1	NM_004326	
TCHH	7062	hgsc.bcm.edu	37	1	152083351	152083351	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:152083351C>A	ENST00000368804.1	-	2	2341	c.2342G>T	c.(2341-2343)cGt>cTt	p.R781L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	781					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGCCTCTGACGGCCCCTCTC	0.687																																					p.R781L		Atlas-SNP	.											.	TCHH	275	.	0			c.G2342T						.						24.0	32.0	29.0					1																	152083351		2032	4197	6229	SO:0001583	missense	7062	exon3			CTCTGACGGCCCC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2342G>T	chr1.hg19:g.152083351C>A	ENSP00000357794:p.Arg781Leu	65.0	0.0		96.0	27.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	c	2.502	-0.314972	0.05422	.	.	ENSG00000159450	ENST00000368804	T	0.07216	3.21	2.98	1.93	0.25924	.	.	.	.	.	T	0.02380	0.0073	N	0.24115	0.695	0.09310	N	1	P	0.52842	0.956	P	0.46110	0.504	T	0.46978	-0.9152	9	0.25106	T	0.35	.	7.2234	0.26002	0.0:0.7212:0.2788:0.0	.	781	Q07283	TRHY_HUMAN	L	781	ENSP00000357794:R781L	ENSP00000357794:R781L	R	-	2	0	TCHH	150349975	0.000000	0.05858	0.088000	0.20740	0.006000	0.05464	-1.409000	0.02483	1.681000	0.50988	0.306000	0.20318	CGT	.	.		0.687	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
FLG	2312	hgsc.bcm.edu	37	1	152281292	152281292	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:152281292G>A	ENST00000368799.1	-	3	6105	c.6070C>T	c.(6070-6072)Cat>Tat	p.H2024Y	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2024	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTTGTCCATGCCCAATGCCT	0.537									Ichthyosis																												p.H2024Y		Atlas-SNP	.											.	FLG	900	.	0			c.C6070T						.						623.0	519.0	554.0					1																	152281292		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GTCCATGCCCAAT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6070C>T	chr1.hg19:g.152281292G>A	ENSP00000357789:p.His2024Tyr	102.0	0.0		145.0	16.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	6.483	0.457222	0.12342	.	.	ENSG00000143631	ENST00000368799	T	0.03717	3.83	3.73	2.8	0.32819	.	.	.	.	.	T	0.00724	0.0024	N	0.08118	0	0.09310	N	1	B	0.22541	0.071	B	0.25759	0.063	T	0.48080	-0.9066	9	0.26408	T	0.33	-7.6777	7.4586	0.27280	0.1229:0.0:0.8771:0.0	.	2024	P20930	FILA_HUMAN	Y	2024	ENSP00000357789:H2024Y	ENSP00000357789:H2024Y	H	-	1	0	FLG	150547916	0.013000	0.17824	0.001000	0.08648	0.001000	0.01503	2.227000	0.42972	0.896000	0.36366	0.485000	0.47835	CAT	.	.		0.537	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
LCE2D	353141	hgsc.bcm.edu	37	1	152636635	152636635	+	Silent	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:152636635C>A	ENST00000368784.1	+	2	109	c.54C>A	c.(52-54)ccC>ccA	p.P18P		NM_178430.2	NP_848517.1	Q5TA82	LCE2D_HUMAN	late cornified envelope 2D	18	Cys-rich.				keratinization (GO:0031424)					large_intestine(1)|lung(7)|prostate(2)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			AATGTCCTCCCAAGTGTACCC	0.522																																					p.P18P		Atlas-SNP	.											.	LCE2D	26	.	0			c.C54A						.						107.0	113.0	111.0					1																	152636635		2203	4300	6503	SO:0001819	synonymous_variant	353141	exon2			TCCTCCCAAGTGT	BI670513	CCDS1018.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000187223	ENSG00000187223		"""Late cornified envelopes"""	16518	protein-coding gene	gene with protein product		612612	"""small proline rich-like (epidermal differentiation complex) 1A"""	SPRL1A		11698679	Standard	NM_178430		Approved	LEP12	uc001fag.4	Q5TA82	OTTHUMG00000014400	ENST00000368784.1:c.54C>A	chr1.hg19:g.152636635C>A		207.0	0.0		275.0	59.0	NM_178430	A1L4M8	Silent	SNP	ENST00000368784.1	hg19	CCDS1018.1																																																																																			.	.		0.522	LCE2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040058.1	NM_178430	
PYGO2	90780	hgsc.bcm.edu	37	1	154931793	154931793	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:154931793T>A	ENST00000368457.2	-	3	854	c.683A>T	c.(682-684)cAg>cTg	p.Q228L	RP11-307C12.12_ENST00000605085.1_RNA|PYGO2_ENST00000368456.1_Missense_Mutation_p.Q191L|PYGO2_ENST00000483463.1_5'Flank	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	228	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACCAGGTCTCTGGAGAGGAGA	0.637																																					p.Q228L	NSCLC(87;357 1460 1955 21029 23522)	Atlas-SNP	.											.	PYGO2	32	.	0			c.A683T						.						29.0	34.0	32.0					1																	154931793		2203	4300	6503	SO:0001583	missense	90780	exon3			GGTCTCTGGAGAG	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.683A>T	chr1.hg19:g.154931793T>A	ENSP00000357442:p.Gln228Leu	134.0	0.0		183.0	42.0	NM_138300	Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	hg19	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.227446	0.39399	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.48522	0.81;0.83	4.72	4.72	0.59763	.	0.383874	0.21678	N	0.070764	T	0.17408	0.0418	N	0.19112	0.55	0.45962	D	0.998789	P	0.37864	0.61	B	0.34873	0.191	T	0.05354	-1.0890	10	0.31617	T	0.26	-4.3103	11.8504	0.52407	0.0:0.0:0.0:1.0	.	228	Q9BRQ0	PYGO2_HUMAN	L	228;191	ENSP00000357442:Q228L;ENSP00000357441:Q191L	ENSP00000357441:Q191L	Q	-	2	0	PYGO2	153198417	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.648000	0.46647	1.988000	0.58038	0.379000	0.24179	CAG	.	.		0.637	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1	NM_138300	
RUSC1	23623	hgsc.bcm.edu	37	1	155292300	155292300	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:155292300T>C	ENST00000368352.5	+	2	887	c.736T>C	c.(736-738)Tgg>Cgg	p.W246R	RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000292254.4_5'Flank|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368349.4_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1_ENST00000368347.4_5'Flank|RUSC1_ENST00000368354.3_Missense_Mutation_p.W246R	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	246					positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			TAAAGCTGAATGGAAAACCAC	0.413																																					p.W246R		Atlas-SNP	.											.	RUSC1	85	.	0			c.T736C						.						98.0	100.0	99.0					1																	155292300		1844	4076	5920	SO:0001583	missense	23623	exon2			GCTGAATGGAAAA	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.736T>C	chr1.hg19:g.155292300T>C	ENSP00000357336:p.Trp246Arg	252.0	0.0		349.0	92.0	NM_001105203	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	hg19	CCDS41410.1	.	.	.	.	.	.	.	.	.	.	T	7.491	0.650587	0.14516	.	.	ENSG00000160753	ENST00000368354;ENST00000368352	T;T	0.38887	1.19;1.11	4.6	2.13	0.27403	.	0.599178	0.14252	N	0.331411	T	0.13670	0.0331	L	0.29908	0.895	0.45594	D	0.998532	P	0.36616	0.561	B	0.34242	0.178	T	0.06232	-1.0838	10	0.72032	D	0.01	-11.3603	5.1765	0.15137	0.0:0.0969:0.3538:0.5493	.	246	Q9BVN2	RUSC1_HUMAN	R	246	ENSP00000357338:W246R;ENSP00000357336:W246R	ENSP00000357336:W246R	W	+	1	0	RUSC1	153558924	0.931000	0.31567	0.459000	0.27081	0.045000	0.14185	1.110000	0.31147	0.747000	0.32809	0.454000	0.30748	TGG	.	.		0.413	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
BRINP2	57795	hgsc.bcm.edu	37	1	177199111	177199111	+	Silent	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:177199111T>A	ENST00000361539.4	+	2	411	c.99T>A	c.(97-99)gcT>gcA	p.A33A		NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	33					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GGGTGTTGGCTGTCTCAGCCA	0.692																																					p.A33A		Atlas-SNP	.											.	FAM5B	191	.	0			c.T99A						.						28.0	33.0	32.0					1																	177199111		2202	4298	6500	SO:0001819	synonymous_variant	57795	exon2			GTTGGCTGTCTCA		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.99T>A	chr1.hg19:g.177199111T>A		222.0	0.0		301.0	93.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	hg19	CCDS1320.1																																																																																			.	.		0.692	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
TEX35	84066	hgsc.bcm.edu	37	1	178485749	178485749	+	Splice_Site	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:178485749G>T	ENST00000319416.2	+	5	328		c.e5-1		TEX35_ENST00000367643.3_Splice_Site|TEX35_ENST00000258298.2_Splice_Site|TEX35_ENST00000367639.1_Splice_Site|TEX35_ENST00000367641.3_Splice_Site|TEX35_ENST00000367642.3_Intron	NM_032126.4	NP_115502.2			testis expressed 35																		TTCCTTGTTAGATAAAGGATC	0.408																																					.		Atlas-SNP	.											C1orf49_ENST00000367643,NS,carcinoma,0,2	TEX35	15	.	0			c.217-1G>T						.						124.0	105.0	111.0					1																	178485749		2203	4300	6503	SO:0001630	splice_region_variant	84066	exon5			TTGTTAGATAAAG	AL136694	CCDS1323.1, CCDS53433.1, CCDS53434.1	1q25.2	2014-01-28	2012-06-29	2012-06-29	ENSG00000240021	ENSG00000240021			25366	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 24kDa"""		"""chromosome 1 open reading frame 49"""	C1orf49		11230166, 17077512	Standard	NM_032126		Approved	DKFZP564J047, TSC24	uc001glt.2	Q5T0J7	OTTHUMG00000035023	ENST00000319416.2:c.217-1G>T	chr1.hg19:g.178485749G>T		114.0	0.0		170.0	43.0	NM_001170724		Splice_Site	SNP	ENST00000319416.2	hg19	CCDS1323.1	.	.	.	.	.	.	.	.	.	.	G	9.408	1.079864	0.20309	.	.	ENSG00000240021	ENST00000319416;ENST00000367643;ENST00000367641;ENST00000367639	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4459	0.67349	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf49	176752372	1.000000	0.71417	0.996000	0.52242	0.048000	0.14542	4.225000	0.58600	2.542000	0.85734	0.655000	0.94253	.	.	.		0.408	TEX35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084917.1	NM_032126	Intron
RGSL1	353299	hgsc.bcm.edu	37	1	182517465	182517465	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:182517465G>A	ENST00000294854.8	+	16	2703	c.2683G>A	c.(2683-2685)Gtc>Atc	p.V895I	RGSL1_ENST00000542961.1_Missense_Mutation_p.V930I	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	895					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						TAATGATCTGGTCAGTTCAGC	0.418																																					p.V895I	Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	Atlas-SNP	.											RGSL1_ENST00000294854,colon,carcinoma,0,2	RGSL1	111	.	0			c.G2683A						.						110.0	90.0	96.0					1																	182517465		692	1591	2283	SO:0001583	missense	353299	exon16			GATCTGGTCAGTT	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.2683G>A	chr1.hg19:g.182517465G>A	ENSP00000457748:p.Val895Ile	96.0	0.0		127.0	30.0	NM_001137669	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	ENST00000294854.8	hg19	CCDS58049.1																																																																																			.	.		0.418	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320710.3	NM_181572	
TPR	7175	hgsc.bcm.edu	37	1	186329450	186329450	+	Silent	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:186329450T>C	ENST00000367478.4	-	11	1442	c.1146A>G	c.(1144-1146)gcA>gcG	p.A382A	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	382					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		CTACAGCTGCTGCAGTAGGAG	0.368			T	NTRK1	papillary thyroid																																p.A382A		Atlas-SNP	.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	441	.	0			c.A1146G						.						76.0	77.0	77.0					1																	186329450		1850	4106	5956	SO:0001819	synonymous_variant	7175	exon11			AGCTGCTGCAGTA	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1146A>G	chr1.hg19:g.186329450T>C		374.0	0.0		592.0	66.0	NM_003292	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	hg19	CCDS41446.1																																																																																			.	.		0.368	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
RGS1	5996	hgsc.bcm.edu	37	1	192548402	192548402	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:192548402G>T	ENST00000367459.3	+	5	646	c.580G>T	c.(580-582)Gat>Tat	p.D194Y		NM_002922.3	NP_002913.3	Q08116	RGS1_HUMAN	regulator of G-protein signaling 1	194	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.			D -> H (in Ref. 5; CAA51826). {ECO:0000305}.	adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|immune response (GO:0006955)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			kidney(8)|large_intestine(1)|lung(13)	22		Breast(1374;0.188)				CCTCAAATCAGATATTTACTT	0.398																																					p.D194Y		Atlas-SNP	.											.	RGS1	75	.	0			c.G580T						.						63.0	66.0	65.0					1																	192548402		2203	4300	6503	SO:0001583	missense	5996	exon5			AAATCAGATATTT	AF493925	CCDS1375.2	1q31	2008-02-05	2007-08-14		ENSG00000090104	ENSG00000090104		"""Regulators of G-protein signaling"""	9991	protein-coding gene	gene with protein product		600323	"""regulator of G-protein signalling 1"""	IER1		8241276, 8602223	Standard	NM_002922		Approved	1R20, IR20, BL34	uc001gsi.1	Q08116	OTTHUMG00000035598	ENST00000367459.3:c.580G>T	chr1.hg19:g.192548402G>T	ENSP00000356429:p.Asp194Tyr	340.0	1.0		549.0	252.0	NM_002922	B2RDM9|B4DZY0|Q07918|Q9H1W2	Missense_Mutation	SNP	ENST00000367459.3	hg19	CCDS1375.2	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995080	0.74703	.	.	ENSG00000090104	ENST00000367459	T	0.02140	4.43	5.68	0.195	0.15151	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.491930	0.21786	N	0.069138	T	0.10594	0.0259	M	0.87381	2.88	0.80722	D	1	P	0.47302	0.893	P	0.60286	0.872	T	0.00516	-1.1694	10	0.72032	D	0.01	.	9.9548	0.41660	0.4975:0.0:0.5025:0.0	.	194	Q08116	RGS1_HUMAN	Y	194	ENSP00000356429:D194Y	ENSP00000356429:D194Y	D	+	1	0	RGS1	190815025	0.932000	0.31603	0.989000	0.46669	0.996000	0.88848	1.163000	0.31798	-0.156000	0.11079	0.591000	0.81541	GAT	.	.		0.398	RGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086391.1	NM_002922	
KIF14	9928	hgsc.bcm.edu	37	1	200550340	200550340	+	Silent	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:200550340A>G	ENST00000367350.4	-	20	3762	c.3324T>C	c.(3322-3324)taT>taC	p.Y1108Y		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1108	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TGCCAAAAACATAGTATGTTT	0.313																																					p.Y1108Y		Atlas-SNP	.											.	KIF14	156	.	0			c.T3324C						.						89.0	91.0	91.0					1																	200550340		2202	4300	6502	SO:0001819	synonymous_variant	9928	exon20			AAAAACATAGTAT	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.3324T>C	chr1.hg19:g.200550340A>G		190.0	0.0		335.0	67.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Silent	SNP	ENST00000367350.4	hg19	CCDS30963.1																																																																																			.	.		0.313	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
PFKFB2	5208	hgsc.bcm.edu	37	1	207245694	207245694	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:207245694A>T	ENST00000367080.3	+	15	1620	c.1496A>T	c.(1495-1497)gAc>gTc	p.D499V	PFKFB2_ENST00000411990.2_Intron|PFKFB2_ENST00000541914.1_Intron|PFKFB2_ENST00000545806.1_Missense_Mutation_p.D466V|PFKFB2_ENST00000367079.2_Intron|PFKFB2_ENST00000473310.1_Intron	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	499	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					CGTGCCCAGGACATGCAAGAA	0.567																																					p.D499V		Atlas-SNP	.											.	PFKFB2	70	.	0			c.A1496T						.						49.0	54.0	52.0					1																	207245694		2203	4300	6503	SO:0001583	missense	5208	exon15			CCCAGGACATGCA		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.1496A>T	chr1.hg19:g.207245694A>T	ENSP00000356047:p.Asp499Val	140.0	0.0		237.0	60.0	NM_006212	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	ENST00000367080.3	hg19	CCDS31004.1	.	.	.	.	.	.	.	.	.	.	A	16.71	3.198715	0.58126	.	.	ENSG00000123836	ENST00000367080;ENST00000545806	.	.	.	5.46	5.46	0.80206	.	0.183413	0.49305	D	0.000159	T	0.38161	0.1030	N	0.22421	0.69	0.80722	D	1	P	0.37015	0.578	B	0.33196	0.159	T	0.38714	-0.9648	9	0.54805	T	0.06	.	13.2546	0.60070	1.0:0.0:0.0:0.0	.	499	O60825	F262_HUMAN	V	499;466	.	ENSP00000356047:D499V	D	+	2	0	PFKFB2	205312317	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.396000	0.44468	2.215000	0.71742	0.529000	0.55759	GAC	.	.		0.567	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087838.1		
CR2	1380	hgsc.bcm.edu	37	1	207643282	207643282	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:207643282C>A	ENST00000367058.3	+	6	1249	c.1060C>A	c.(1060-1062)Ccc>Acc	p.P354T	CR2_ENST00000367059.3_Missense_Mutation_p.P354T|CR2_ENST00000367057.3_Missense_Mutation_p.P354T|CR2_ENST00000458541.2_Missense_Mutation_p.P354T	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	354	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						GTGTCCACATCCCCAGATCCT	0.502																																					p.P354T		Atlas-SNP	.											.	CR2	164	.	0			c.C1060A						.						137.0	121.0	126.0					1																	207643282		2203	4300	6503	SO:0001583	missense	1380	exon6			CCACATCCCCAGA	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.1060C>A	chr1.hg19:g.207643282C>A	ENSP00000356025:p.Pro354Thr	110.0	0.0		216.0	27.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	hg19	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462109	0.43736	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	5.09	5.09	0.68999	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.93822	0.8024	M	0.92219	3.285	0.38394	D	0.945491	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.95446	0.8530	9	0.87932	D	0	.	14.7242	0.69332	0.0:1.0:0.0:0.0	.	354;354;354	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	T	354	ENSP00000356025:P354T;ENSP00000356024:P354T;ENSP00000356026:P354T;ENSP00000404222:P354T	ENSP00000356024:P354T	P	+	1	0	CR2	205709905	0.806000	0.28996	0.214000	0.23707	0.092000	0.18411	3.970000	0.56824	2.756000	0.94617	0.561000	0.74099	CCC	.	.		0.502	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
ZP4	57829	hgsc.bcm.edu	37	1	238048573	238048573	+	Silent	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:238048573A>T	ENST00000366570.4	-	9	1361	c.1203T>A	c.(1201-1203)ccT>ccA	p.P401P	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	401	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CTTTCTGGACAGGGATCAGCT	0.517																																					p.P401P	NSCLC(166;160 2029 11600 18754 19936)	Atlas-SNP	.											.	ZP4	161	.	0			c.T1203A						.						75.0	74.0	74.0					1																	238048573		2203	4300	6503	SO:0001819	synonymous_variant	57829	exon9			CTGGACAGGGATC	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.1203T>A	chr1.hg19:g.238048573A>T		171.0	0.0		274.0	129.0	NM_021186	B2RAE1	Silent	SNP	ENST00000366570.4	hg19	CCDS1615.1																																																																																			.	.		0.517	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		
FMN2	56776	hgsc.bcm.edu	37	1	240601442	240601442	+	Silent	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr1:240601442C>A	ENST00000319653.9	+	16	5222	c.4992C>A	c.(4990-4992)atC>atA	p.I1664I	FMN2_ENST00000545751.1_Silent_p.I260I	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1664	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCTTCAGTATCTGGCATGAAT	0.388																																					p.I1664I		Atlas-SNP	.											.	FMN2	451	.	0			c.C4992A						.						132.0	129.0	130.0					1																	240601442		2203	4300	6503	SO:0001819	synonymous_variant	56776	exon16			CAGTATCTGGCAT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4992C>A	chr1.hg19:g.240601442C>A		85.0	0.0		142.0	39.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	hg19	CCDS31069.2																																																																																			.	.		0.388	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
MYT1L	23040	hgsc.bcm.edu	37	2	1926174	1926174	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:1926174G>A	ENST00000399161.2	-	10	2114	c.1367C>T	c.(1366-1368)gCt>gTt	p.A456V	MYT1L_ENST00000428368.2_Missense_Mutation_p.A456V	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	456					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CCTCCTCCCAGCTTCCATGGC	0.527																																					p.A456V		Atlas-SNP	.											.	MYT1L	241	.	0			c.C1367T						.						181.0	176.0	178.0					2																	1926174		2002	4159	6161	SO:0001583	missense	23040	exon10			CTCCCAGCTTCCA	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1367C>T	chr2.hg19:g.1926174G>A	ENSP00000382114:p.Ala456Val	86.0	0.0		105.0	43.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	G	13.88	2.370526	0.42003	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.45668	0.9;0.89	5.91	5.91	0.95273	.	0.158944	0.56097	D	0.000033	T	0.32285	0.0824	L	0.27053	0.805	0.80722	D	1	B;B	0.29988	0.172;0.264	B;B	0.21151	0.015;0.033	T	0.05852	-1.0860	10	0.21014	T	0.42	-28.3964	20.2936	0.98544	0.0:0.0:1.0:0.0	.	456;456	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	V	456;404;456	ENSP00000382114:A456V;ENSP00000396103:A456V	ENSP00000295067:A404V	A	-	2	0	MYT1L	1905181	1.000000	0.71417	0.351000	0.25721	0.045000	0.14185	9.781000	0.99029	2.801000	0.96364	0.655000	0.94253	GCT	.	.		0.527	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
KIDINS220	57498	hgsc.bcm.edu	37	2	8919137	8919137	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:8919137G>T	ENST00000256707.3	-	19	2684	c.2503C>A	c.(2503-2505)Cgc>Agc	p.R835S	KIDINS220_ENST00000319688.5_Missense_Mutation_p.R836S|KIDINS220_ENST00000427284.1_Missense_Mutation_p.R835S|KIDINS220_ENST00000418530.1_Missense_Mutation_p.R793S|KIDINS220_ENST00000473731.1_Missense_Mutation_p.R835S	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	835	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACTATGTTGCGCATGTAGTCA	0.403																																					p.R835S		Atlas-SNP	.											KIDINS220,NS,carcinoma,0,1	KIDINS220	136	.	0			c.C2503A						.						250.0	224.0	232.0					2																	8919137		1894	4122	6016	SO:0001583	missense	57498	exon19			TGTTGCGCATGTA	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.2503C>A	chr2.hg19:g.8919137G>T	ENSP00000256707:p.Arg835Ser	67.0	0.0		82.0	30.0	NM_020738	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	hg19	CCDS42650.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228423	0.58777	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000319688	T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.64	5.64	0.86602	KAP P-loop (1);	0.000000	0.85682	D	0.000000	T	0.54255	0.1847	M	0.66939	2.045	0.80722	D	1	D;D;D;D	0.89917	0.999;0.989;1.0;1.0	D;P;D;D	0.97110	0.997;0.854;0.999;1.0	T	0.51100	-0.8748	10	0.52906	T	0.07	.	15.6595	0.77174	0.0:0.0:0.8623:0.1377	.	836;836;793;835	B4DK94;E9PH70;Q9ULH0-2;Q9ULH0	.;.;.;KDIS_HUMAN	S	582;519;835;835;793;835;836;836	ENSP00000420364:R582S;ENSP00000256707:R835S;ENSP00000411849:R835S;ENSP00000414923:R793S;ENSP00000418974:R835S;ENSP00000419964:R836S;ENSP00000319947:R836S	ENSP00000256707:R835S	R	-	1	0	KIDINS220	8836588	1.000000	0.71417	1.000000	0.80357	0.328000	0.28507	4.165000	0.58196	2.820000	0.97059	0.650000	0.86243	CGC	.	.		0.403	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
DTNB	1838	hgsc.bcm.edu	37	2	25819006	25819006	+	Silent	SNP	C	C	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:25819006C>T	ENST00000406818.3	-	6	801	c.552G>A	c.(550-552)ggG>ggA	p.G184G	DTNB_ENST00000288642.8_Silent_p.G184G|DTNB_ENST00000496972.2_Silent_p.G127G|DTNB_ENST00000405222.1_Silent_p.G184G|DTNB_ENST00000404103.3_Silent_p.G184G|DTNB_ENST00000545439.1_Intron|DTNB_ENST00000407186.1_Silent_p.G184G|DTNB_ENST00000407038.3_Silent_p.G184G|DTNB_ENST00000407661.3_Silent_p.G184G|DTNB_ENST00000472690.1_5'UTR	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	184						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAAAGATGGCCCTTCAAAGA	0.453																																					p.G184G		Atlas-SNP	.											.	DTNB	43	.	0			c.G552A						.						71.0	70.0	70.0					2																	25819006		1856	4106	5962	SO:0001819	synonymous_variant	1838	exon6			AGATGGCCCTTCA	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.552G>A	chr2.hg19:g.25819006C>T		143.0	0.0		146.0	25.0	NM_021907	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Silent	SNP	ENST00000406818.3	hg19	CCDS46237.1																																																																																			.	.		0.453	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147	
EFEMP1	2202	hgsc.bcm.edu	37	2	56098002	56098002	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:56098002C>A	ENST00000394555.2	-	10	1608	c.1173G>T	c.(1171-1173)caG>caT	p.Q391H	EFEMP1_ENST00000394554.1_Missense_Mutation_p.Q391H|EFEMP1_ENST00000424836.2_Missense_Mutation_p.Q253H|EFEMP1_ENST00000355426.3_Missense_Mutation_p.Q391H	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	391	Mediates interaction with TIMP3.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AGACTATTGACTGGGGCAGTT	0.448																																					p.Q391H	GBM(92;934 1319 7714 28760 40110)	Atlas-SNP	.											.	EFEMP1	81	.	0			c.G1173T						.						95.0	93.0	94.0					2																	56098002		2203	4300	6503	SO:0001583	missense	2202	exon10			TATTGACTGGGGC	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.1173G>T	chr2.hg19:g.56098002C>A	ENSP00000378058:p.Gln391His	119.0	0.0		152.0	48.0	NM_001039349	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	hg19	CCDS1857.1	.	.	.	.	.	.	.	.	.	.	C	11.73	1.726567	0.30593	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;T;D	0.83992	-1.79;-1.79;-1.26;-1.79	5.65	1.76	0.24704	.	0.199045	0.35585	N	0.003117	T	0.69495	0.3117	N	0.14661	0.345	0.30058	N	0.811164	D;P	0.53312	0.959;0.788	P;B	0.49301	0.606;0.406	T	0.65360	-0.6187	10	0.15499	T	0.54	.	6.3334	0.21282	0.0:0.4565:0.213:0.3305	.	253;391	B4DW75;Q12805	.;FBLN3_HUMAN	H	391;391;247;253;391	ENSP00000378058:Q391H;ENSP00000378057:Q391H;ENSP00000399145:Q253H;ENSP00000347596:Q391H	ENSP00000347596:Q391H	Q	-	3	2	EFEMP1	55951506	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.550000	0.23345	0.404000	0.25506	0.655000	0.94253	CAG	.	.		0.448	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
ARHGEF4	50649	hgsc.bcm.edu	37	2	131797621	131797621	+	Silent	SNP	C	C	T	rs150958124		TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:131797621C>T	ENST00000326016.5	+	7	1299	c.780C>T	c.(778-780)gaC>gaT	p.D260D	ARHGEF4_ENST00000409303.1_Silent_p.D260D|ARHGEF4_ENST00000392953.3_Silent_p.D260D|ARHGEF4_ENST00000355771.3_Silent_p.D189D|ARHGEF4_ENST00000439368.2_3'UTR|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000525839.1_Silent_p.D260D	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	260					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CCGCGGATGACGACGCCCCTC	0.701																																					p.D260D		Atlas-SNP	.											ARHGEF4_ENST00000392953,NS,carcinoma,0,2	ARHGEF4	89	.	0			c.C780T						.						31.0	33.0	32.0					2																	131797621		2188	4282	6470	SO:0001819	synonymous_variant	50649	exon7			GGATGACGACGCC	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.780C>T	chr2.hg19:g.131797621C>T		127.0	1.0		165.0	7.0	NM_032995	Q9HDC6|Q9UPP0	Silent	SNP	ENST00000326016.5	hg19	CCDS2165.1																																																																																			.	C|1.000;A|0.000		0.701	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254554.4		
NEB	4703	hgsc.bcm.edu	37	2	152473927	152473927	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:152473927T>A	ENST00000172853.10	-	71	10550	c.10403A>T	c.(10402-10404)gAt>gTt	p.D3468V	NEB_ENST00000603639.1_Missense_Mutation_p.D3711V|NEB_ENST00000397345.3_Missense_Mutation_p.D3711V|NEB_ENST00000604864.1_Missense_Mutation_p.D3711V|NEB_ENST00000427231.2_Missense_Mutation_p.D3711V|NEB_ENST00000409198.1_Missense_Mutation_p.D3468V			P20929	NEBU_HUMAN	nebulin	3468					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCTGGTGTATCAGGCATGAC	0.338																																					p.D3711V		Atlas-SNP	.											.	NEB	1697	.	0			c.A11132T						.						138.0	121.0	127.0					2																	152473927		1868	4105	5973	SO:0001583	missense	4703	exon75			GGTGTATCAGGCA	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10403A>T	chr2.hg19:g.152473927T>A	ENSP00000172853:p.Asp3468Val	44.0	0.0		51.0	17.0	NM_001271208	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	T	21.1	4.099029	0.76870	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.85401	0.5688	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.88488	0.3073	10	0.54805	T	0.06	.	15.3854	0.74695	0.0:0.0:0.0:1.0	.	3468	P20929	NEBU_HUMAN	V	3468;3711;3711;3468	ENSP00000386259:D3468V;ENSP00000380505:D3711V;ENSP00000416578:D3711V;ENSP00000172853:D3468V	ENSP00000172853:D3468V	D	-	2	0	NEB	152182173	1.000000	0.71417	0.979000	0.43373	0.984000	0.73092	4.011000	0.57124	2.100000	0.63781	0.482000	0.46254	GAT	.	.		0.338	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NEB	4703	hgsc.bcm.edu	37	2	152534508	152534508	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:152534508T>A	ENST00000172853.10	-	33	3596	c.3449A>T	c.(3448-3450)aAg>aTg	p.K1150M	NEB_ENST00000603639.1_Missense_Mutation_p.K1150M|NEB_ENST00000397345.3_Missense_Mutation_p.K1150M|NEB_ENST00000604864.1_Missense_Mutation_p.K1150M|NEB_ENST00000427231.2_Missense_Mutation_p.K1150M|NEB_ENST00000409198.1_Missense_Mutation_p.K1150M			P20929	NEBU_HUMAN	nebulin	1150					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTGGGCTTTCTTAGCCGCCAC	0.453																																					p.K1150M		Atlas-SNP	.											.	NEB	1697	.	0			c.A3449T						.						105.0	112.0	110.0					2																	152534508		2004	4171	6175	SO:0001583	missense	4703	exon33			GCTTTCTTAGCCG	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.3449A>T	chr2.hg19:g.152534508T>A	ENSP00000172853:p.Lys1150Met	108.0	0.0		110.0	25.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	T	23.9	4.468036	0.84533	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70912	-0.4743	10	0.87932	D	0	.	15.1962	0.73092	0.0:0.0:0.0:1.0	.	1150	P20929	NEBU_HUMAN	M	1150	ENSP00000386259:K1150M;ENSP00000380505:K1150M;ENSP00000416578:K1150M;ENSP00000172853:K1150M	ENSP00000172853:K1150M	K	-	2	0	NEB	152242754	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	5.114000	0.64648	2.134000	0.65973	0.533000	0.62120	AAG	.	.		0.453	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
COBLL1	22837	hgsc.bcm.edu	37	2	165557052	165557052	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:165557052T>G	ENST00000392717.2	-	11	1675	c.1671A>C	c.(1669-1671)gaA>gaC	p.E557D	COBLL1_ENST00000194871.6_Missense_Mutation_p.E585D|COBLL1_ENST00000342193.4_Missense_Mutation_p.E519D|COBLL1_ENST00000375458.2_Missense_Mutation_p.E480D|COBLL1_ENST00000409184.3_Missense_Mutation_p.E518D|COBLL1_ENST00000491126.2_5'Flank			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	557						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						TGCTTTTAGTTTCTTGTTTTT	0.363																																					p.E519D		Atlas-SNP	.											.	COBLL1	122	.	0			c.A1557C						.						143.0	128.0	133.0					2																	165557052		2203	4300	6503	SO:0001583	missense	22837	exon10			TTTAGTTTCTTGT	AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.1671A>C	chr2.hg19:g.165557052T>G	ENSP00000376478:p.Glu557Asp	111.0	0.0		102.0	22.0	NM_014900	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	ENST00000392717.2	hg19		.	.	.	.	.	.	.	.	.	.	T	11.80	1.746627	0.30955	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	5.22	4.03	0.46877	.	0.345007	0.28312	N	0.015801	T	0.35480	0.0933	L	0.34521	1.04	0.31727	N	0.637501	B;B;B	0.26577	0.153;0.028;0.047	B;B;B	0.24974	0.057;0.027;0.054	T	0.38929	-0.9638	9	0.37606	T	0.19	-5.8748	10.5183	0.44903	0.1442:0.0:0.0:0.8558	.	557;585;518	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	D	480;519;518;557;585	.	ENSP00000194871:E585D	E	-	3	2	COBLL1	165265298	1.000000	0.71417	0.532000	0.27989	0.272000	0.26649	1.251000	0.32862	0.899000	0.36444	0.260000	0.18958	GAA	.	.		0.363	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014900	
PLCL1	5334	hgsc.bcm.edu	37	2	198953586	198953586	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:198953586C>A	ENST00000428675.1	+	3	3118	c.2720C>A	c.(2719-2721)gCa>gAa	p.A907E	PLCL1_ENST00000437704.2_Missense_Mutation_p.A809E	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	907					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	TCACAGAATGCAATCGTGTCT	0.443																																					p.A907E		Atlas-SNP	.											.	PLCL1	358	.	0			c.C2720A						.						386.0	387.0	386.0					2																	198953586		2203	4300	6503	SO:0001583	missense	5334	exon3			AGAATGCAATCGT	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2720C>A	chr2.hg19:g.198953586C>A	ENSP00000402861:p.Ala907Glu	77.0	0.0		66.0	18.0	NM_006226	Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	ENST00000428675.1	hg19	CCDS2326.2	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155596	0.57259	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.22539	1.95;2.02	5.13	5.13	0.70059	.	0.000000	0.64402	D	0.000017	T	0.48554	0.1506	M	0.79805	2.47	0.80722	D	1	D;D	0.62365	0.991;0.991	D;D	0.64321	0.924;0.924	T	0.47947	-0.9077	9	.	.	.	.	18.7752	0.91908	0.0:1.0:0.0:0.0	.	907;833	Q15111;B4DYZ4	PLCL1_HUMAN;.	E	907;809	ENSP00000402861:A907E;ENSP00000414138:A809E	.	A	+	2	0	PLCL1	198661831	1.000000	0.71417	0.403000	0.26384	0.051000	0.14879	7.641000	0.83368	2.661000	0.90470	0.650000	0.86243	GCA	.	.		0.443	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340210.1	NM_006226	
COL6A3	1293	hgsc.bcm.edu	37	2	238287845	238287845	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr2:238287845A>G	ENST00000295550.4	-	6	2383	c.1931T>C	c.(1930-1932)tTg>tCg	p.L644S	COL6A3_ENST00000346358.4_Intron|COL6A3_ENST00000353578.4_Missense_Mutation_p.L438S|COL6A3_ENST00000392004.3_Missense_Mutation_p.L438S|COL6A3_ENST00000392003.2_Missense_Mutation_p.L237S|COL6A3_ENST00000472056.1_Intron|COL6A3_ENST00000409809.1_Missense_Mutation_p.L438S|COL6A3_ENST00000347401.3_Missense_Mutation_p.L443S	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	644	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGATCCATCCAAAAGAAAGAT	0.388																																					p.L644S		Atlas-SNP	.											.	COL6A3	608	.	0			c.T1931C						.						61.0	60.0	61.0					2																	238287845		2203	4300	6503	SO:0001583	missense	1293	exon6			CCATCCAAAAGAA	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.1931T>C	chr2.hg19:g.238287845A>G	ENSP00000295550:p.Leu644Ser	224.0	0.0		222.0	45.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	hg19	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.439223	0.83885	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000409809;ENST00000392004;ENST00000392003	D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	5.52	5.52	0.82312	von Willebrand factor, type A (3);	0.000000	0.39146	U	0.001454	D	0.94082	0.8103	M	0.92219	3.285	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;1.0;0.99	D	0.95404	0.8492	10	0.87932	D	0	.	15.6766	0.77332	1.0:0.0:0.0:0.0	.	237;438;438;644	A8MT30;E9PGQ9;P12111-2;P12111	.;.;.;CO6A3_HUMAN	S	644;443;438;438;438;237	ENSP00000295550:L644S;ENSP00000315609:L443S;ENSP00000315873:L438S;ENSP00000386844:L438S;ENSP00000375861:L438S;ENSP00000375860:L237S	ENSP00000295550:L644S	L	-	2	0	COL6A3	237952584	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.262000	0.95591	2.099000	0.63709	0.533000	0.62120	TTG	.	.		0.388	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CCDC54	84692	hgsc.bcm.edu	37	3	107097090	107097090	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr3:107097090C>A	ENST00000261058.1	+	1	903	c.656C>A	c.(655-657)aCt>aAt	p.T219N		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	219										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						CAAATGAAAACTCTGAAGAAA	0.383																																					p.T219N		Atlas-SNP	.											.	CCDC54	56	.	0			c.C656A						.						71.0	73.0	73.0					3																	107097090		2203	4300	6503	SO:0001583	missense	84692	exon1			TGAAAACTCTGAA	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.656C>A	chr3.hg19:g.107097090C>A	ENSP00000261058:p.Thr219Asn	325.0	0.0		251.0	130.0	NM_032600	Q96A43	Missense_Mutation	SNP	ENST00000261058.1	hg19	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	C	10.38	1.335225	0.24253	.	.	ENSG00000138483	ENST00000261058	T	0.48522	0.81	5.09	3.23	0.37069	.	0.272597	0.26048	N	0.026653	T	0.42291	0.1196	L	0.59436	1.845	0.09310	N	1	B	0.26809	0.16	B	0.31290	0.127	T	0.41752	-0.9491	10	0.56958	D	0.05	-0.4695	6.5026	0.22178	0.1771:0.7279:0.0:0.095	.	219	Q8NEL0	CCD54_HUMAN	N	219	ENSP00000261058:T219N	ENSP00000261058:T219N	T	+	2	0	CCDC54	108579780	0.093000	0.21703	0.016000	0.15963	0.236000	0.25371	0.781000	0.26774	1.141000	0.42275	0.460000	0.39030	ACT	.	.		0.383	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600	
HTR3C	170572	hgsc.bcm.edu	37	3	183776324	183776324	+	Silent	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr3:183776324C>A	ENST00000318351.1	+	6	703	c.669C>A	c.(667-669)gcC>gcA	p.A223A		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	223					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	TCAACAAGGCCACCCCAAAGA	0.532																																					p.A223A		Atlas-SNP	.											.	HTR3C	65	.	0			c.C669A						.						125.0	116.0	119.0					3																	183776324		2203	4300	6503	SO:0001819	synonymous_variant	170572	exon6			CAAGGCCACCCCA	AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.669C>A	chr3.hg19:g.183776324C>A		194.0	0.0		147.0	41.0	NM_130770	A2RRR5	Silent	SNP	ENST00000318351.1	hg19	CCDS3250.1																																																																																			.	.		0.532	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346296.1	NM_130770	
TADA2B	93624	hgsc.bcm.edu	37	4	7045509	7045509	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr4:7045509G>A	ENST00000310074.7	+	1	392	c.203G>A	c.(202-204)gGc>gAc	p.G68D	RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000512388.1_Intron|CCDC96_ENST00000310085.4_5'Flank	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	68	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						GAGGCCGAGGGCGGCTGGACC	0.731																																					p.G68D		Atlas-SNP	.											.	TADA2B	29	.	0			c.G203A						.						8.0	10.0	10.0					4																	7045509		1879	4006	5885	SO:0001583	missense	93624	exon1			CCGAGGGCGGCTG	AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.203G>A	chr4.hg19:g.7045509G>A	ENSP00000308022:p.Gly68Asp	84.0	0.0		96.0	37.0	NM_152293	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Missense_Mutation	SNP	ENST00000310074.7	hg19	CCDS47007.1	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434180	0.62955	.	.	ENSG00000173011	ENST00000310074	T	0.41758	0.99	3.13	2.16	0.27623	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.067384	0.64402	U	0.000015	T	0.31104	0.0786	L	0.31371	0.925	0.80722	D	1	P	0.45240	0.854	P	0.46144	0.505	T	0.03103	-1.1072	10	0.13853	T	0.58	-26.8665	9.6762	0.40043	0.0:0.0:0.7916:0.2084	.	68	Q86TJ2	TAD2B_HUMAN	D	68	ENSP00000308022:G68D	ENSP00000308022:G68D	G	+	2	0	TADA2B	7096410	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	6.163000	0.71880	1.446000	0.47643	0.484000	0.47621	GGC	.	.		0.731	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358687.2	NM_152293	
CPEB2	132864	hgsc.bcm.edu	37	4	15004505	15004505	+	5'Flank	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr4:15004505G>A	ENST00000507071.1	+	0	0				CPEB2_ENST00000541112.1_Missense_Mutation_p.G70S|CPEB2_ENST00000538197.1_Missense_Mutation_p.G70S|CPEB2_ENST00000345451.3_5'Flank|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000382395.3_5'Flank|CPEB2_ENST00000382401.3_5'Flank|CPEB2_ENST00000259997.5_5'Flank|CPEB2_ENST00000442003.2_Missense_Mutation_p.G70S			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2						cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						CGTCCCCCTcggcggcggcgc	0.711																																					p.G70S		Atlas-SNP	.											.	CPEB2	77	.	0			c.G208A						.																																			SO:0001631	upstream_gene_variant	132864	exon1			CCCCTCGGCGGCG	AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669		chr4.hg19:g.15004505G>A	Exception_encountered	1.0	0.0		5.0	5.0	NM_001177381	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Missense_Mutation	SNP	ENST00000507071.1	hg19		.	.	.	.	.	.	.	.	.	.	G	10.26	1.301768	0.23736	.	.	ENSG00000137449	ENST00000538197;ENST00000541112;ENST00000442003	T;T;T	0.55588	0.51;0.51;0.53	2.51	2.51	0.30379	.	.	.	.	.	T	0.36608	0.0973	N	0.08118	0	0.25027	N	0.991299	.	.	.	.	.	.	T	0.38329	-0.9666	7	0.87932	D	0	.	10.723	0.46050	0.0:0.0:1.0:0.0	.	.	.	.	S	70	ENSP00000443985:G70S;ENSP00000437884:G70S;ENSP00000414270:G70S	ENSP00000414270:G70S	G	+	1	0	CPEB2	14613603	0.234000	0.23783	0.956000	0.39512	0.945000	0.59286	0.315000	0.19451	1.398000	0.46701	0.416000	0.27883	GGC	.	.		0.711	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000207349.2	XM_059607	
WDR19	57728	hgsc.bcm.edu	37	4	39201126	39201126	+	Silent	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr4:39201126A>G	ENST00000399820.3	+	6	589	c.435A>G	c.(433-435)ggA>ggG	p.G145G	WDR19_ENST00000506503.1_Silent_p.G145G|WDR19_ENST00000288634.7_5'UTR	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	145					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						TCACTTGTGGATGTTGGAATG	0.338																																					p.G145G		Atlas-SNP	.											.	WDR19	96	.	0			c.A435G						.						131.0	124.0	127.0					4																	39201126		1852	4088	5940	SO:0001819	synonymous_variant	57728	exon6			TTGTGGATGTTGG	AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.435A>G	chr4.hg19:g.39201126A>G		95.0	0.0		94.0	12.0	NM_025132	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Silent	SNP	ENST00000399820.3	hg19	CCDS47042.1																																																																																			.	.		0.338	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360689.1		
N4BP2	55728	hgsc.bcm.edu	37	4	40123848	40123848	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr4:40123848A>G	ENST00000261435.6	+	9	4533	c.4117A>G	c.(4117-4119)Ata>Gta	p.I1373V		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1373					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ATCTCTGACCATAGACTGTCT	0.408																																					p.I1373V		Atlas-SNP	.											.	N4BP2	166	.	0			c.A4117G						.						131.0	139.0	136.0					4																	40123848		2203	4300	6503	SO:0001583	missense	55728	exon9			CTGACCATAGACT	AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4117A>G	chr4.hg19:g.40123848A>G	ENSP00000261435:p.Ile1373Val	325.0	0.0		363.0	82.0	NM_018177	A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	ENST00000261435.6	hg19	CCDS3457.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.52|12.52	1.963130|1.963130	0.34659|0.34659	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.26660	.|1.72	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	.|0.124247	.|0.53938	.|D	.|0.000041	T|T	0.40956|0.40956	0.1138|0.1138	L|L	0.43152|0.43152	1.355|1.355	0.39022|0.39022	D|D	0.959766|0.959766	.|D;D	.|0.64830	.|0.994;0.99	.|D;D	.|0.69479	.|0.964;0.921	T|T	0.35992|0.35992	-0.9766|-0.9766	5|10	.|0.62326	.|D	.|0.03	-21.2043|-21.2043	11.4906|11.4906	0.50379|0.50379	0.866:0.0:0.0:0.134|0.866:0.0:0.0:0.134	.|.	.|1373;1373	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	R|V	1019|1373;1293	.|ENSP00000261435:I1373V	.|ENSP00000261435:I1373V	H|I	+|+	2|1	0|0	N4BP2|N4BP2	39800243|39800243	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.026000|0.026000	0.11368|0.11368	3.519000|3.519000	0.53458|0.53458	2.278000|2.278000	0.76064|0.76064	0.477000|0.477000	0.44152|0.44152	CAT|ATA	.	.		0.408	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250458.2	NM_018177	
GRXCR1	389207	hgsc.bcm.edu	37	4	42965143	42965143	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr4:42965143T>A	ENST00000399770.2	+	2	619	c.619T>A	c.(619-621)Tac>Aac	p.Y207N		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	207	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						TGATGGCCATTACCTTGGGGT	0.438																																					p.Y207N		Atlas-SNP	.											.	GRXCR1	78	.	0			c.T619A						.						319.0	317.0	317.0					4																	42965143		1901	4122	6023	SO:0001583	missense	389207	exon2			GGCCATTACCTTG		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.619T>A	chr4.hg19:g.42965143T>A	ENSP00000382670:p.Tyr207Asn	148.0	0.0		124.0	46.0	NM_001080476		Missense_Mutation	SNP	ENST00000399770.2	hg19	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.331310	0.81690	.	.	ENSG00000215203	ENST00000399770	T	0.31769	1.48	5.98	5.98	0.97165	Glutaredoxin (2);Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000006	T	0.59155	0.2173	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.63844	-0.6545	10	0.72032	D	0.01	-13.9405	15.6508	0.77091	0.0:0.0:0.0:1.0	.	207	A8MXD5	GRCR1_HUMAN	N	207	ENSP00000382670:Y207N	ENSP00000382670:Y207N	Y	+	1	0	GRXCR1	42659900	1.000000	0.71417	0.999000	0.59377	0.876000	0.50452	7.698000	0.84413	2.289000	0.77006	0.482000	0.46254	TAC	.	.		0.438	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
ENPP6	133121	hgsc.bcm.edu	37	4	185033941	185033941	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr4:185033941C>A	ENST00000296741.2	-	6	1018	c.877G>T	c.(877-879)Gtg>Ttg	p.V293L		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	293					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		ATGTGTTCCACTGTGCTCAGT	0.403																																					p.V293L		Atlas-SNP	.											.	ENPP6	61	.	0			c.G877T						.						150.0	145.0	147.0					4																	185033941		2203	4300	6503	SO:0001583	missense	133121	exon6			GTTCCACTGTGCT	AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.877G>T	chr4.hg19:g.185033941C>A	ENSP00000296741:p.Val293Leu	81.0	0.0		73.0	11.0	NM_153343	Q4W5Q1|Q96M57	Missense_Mutation	SNP	ENST00000296741.2	hg19	CCDS3834.1	.	.	.	.	.	.	.	.	.	.	C	14.39	2.520253	0.44866	.	.	ENSG00000164303	ENST00000296741	T	0.72051	-0.62	5.97	5.97	0.96955	Alkaline-phosphatase-like, core domain (1);	0.308954	0.35067	N	0.003472	T	0.60521	0.2275	N	0.25426	0.745	0.46011	D	0.998815	P	0.38223	0.623	B	0.41036	0.346	T	0.56829	-0.7914	10	0.22706	T	0.39	-37.5289	13.2716	0.60164	0.0:0.9274:0.0:0.0726	.	293	Q6UWR7	ENPP6_HUMAN	L	293	ENSP00000296741:V293L	ENSP00000296741:V293L	V	-	1	0	ENPP6	185270935	1.000000	0.71417	0.959000	0.39883	0.006000	0.05464	5.054000	0.64275	2.836000	0.97738	0.655000	0.94253	GTG	.	.		0.403	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361428.1	NM_153343	
CDH18	1016	hgsc.bcm.edu	37	5	19571838	19571838	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:19571838G>C	ENST00000507958.1	-	10	2093	c.1103C>G	c.(1102-1104)aCt>aGt	p.T368S	CDH18_ENST00000506372.1_Missense_Mutation_p.T368S|CDH18_ENST00000511273.1_Missense_Mutation_p.T368S|CDH18_ENST00000382275.1_Missense_Mutation_p.T368S|CDH18_ENST00000274170.4_Missense_Mutation_p.T368S|CDH18_ENST00000502796.1_Missense_Mutation_p.T368S			Q13634	CAD18_HUMAN	cadherin 18, type 2	368	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTTCAGCATAGTAGCATCTTT	0.408																																					p.T368S		Atlas-SNP	.											.	CDH18	561	.	0			c.C1103G						.						133.0	115.0	121.0					5																	19571838		2203	4300	6503	SO:0001583	missense	1016	exon8			AGCATAGTAGCAT	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1103C>G	chr5.hg19:g.19571838G>C	ENSP00000425093:p.Thr368Ser	198.0	0.0		237.0	70.0	NM_001167667	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	hg19	CCDS3889.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.568208	0.86439	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000515257;ENST00000511273	T;T;T;T;T;T;T	0.62364	0.1;0.1;0.1;0.08;0.09;0.28;0.03	5.17	5.17	0.71159	Cadherin (2);Cadherin-like (1);	0.052565	0.85682	D	0.000000	T	0.69033	0.3066	M	0.74389	2.26	0.51012	D	0.999905	B;P	0.36438	0.24;0.553	B;B	0.42959	0.403;0.392	T	0.68584	-0.5370	9	.	.	.	.	17.5963	0.88013	0.0:0.0:1.0:0.0	.	368;368	B4DHG6;Q13634	.;CAD18_HUMAN	S	368;368;368;368;368;368;314;368	ENSP00000371710:T368S;ENSP00000425093:T368S;ENSP00000274170:T368S;ENSP00000424931:T368S;ENSP00000422138:T368S;ENSP00000427383:T314S;ENSP00000425854:T368S	.	T	-	2	0	CDH18	19607595	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.312000	0.96287	2.591000	0.87537	0.655000	0.94253	ACT	.	.		0.408	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
TAF9	6880	hgsc.bcm.edu	37	5	68651607	68651607	+	Silent	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:68651607T>C	ENST00000380822.4	-	4	246	c.195A>G	c.(193-195)ttA>ttG	p.L65L	TAF9_ENST00000380818.3_Silent_p.L62L|TAF9_ENST00000502819.1_Intron|TAF9_ENST00000512561.1_Silent_p.L34L	NM_016283.4	NP_057367.1	Q16594	TAF9_HUMAN	TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa	0					cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of cell growth (GO:0030307)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein stabilization (GO:0050821)|response to interleukin-1 (GO:0070555)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|pre-snoRNP complex (GO:0070761)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	activating transcription factor binding (GO:0033613)|C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|urinary_tract(1)	8		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.1e-56)|Epithelial(20;9.54e-53)|all cancers(19;2.2e-48)|Lung(70;0.0176)		TTTGGTTATCTAACTCATCAA	0.323																																					p.L65L		Atlas-SNP	.											.	TAF9	28	.	0			c.A195G						.						96.0	94.0	94.0					5																	68651607		2203	4300	6503	SO:0001819	synonymous_variant	6880	exon4			GTTATCTAACTCA	U21858	CCDS4001.1, CCDS4002.1, CCDS43324.1	5q13.2	2013-09-26	2002-08-29	2001-12-07	ENSG00000085231	ENSG00000085231			11542	protein-coding gene	gene with protein product		600822	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, G, 32kD"""	TAF2G		10191103, 15630091, 16079131	Standard	NM_001015892		Approved	TAFII31, TAFII32, TAFIID32, MGC5067, CGI-137, MGC1603, MGC3647, AD-004	uc003jwa.3	Q16594	OTTHUMG00000099359	ENST00000380822.4:c.195A>G	chr5.hg19:g.68651607T>C		201.0	0.0		218.0	86.0	NM_016283	D3DWA3|Q5U0D1|Q9BTS1	Silent	SNP	ENST00000380822.4	hg19	CCDS4001.1																																																																																			.	.		0.323	TAF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216793.1	NM_003187	
MSH3	4437	hgsc.bcm.edu	37	5	79950745	79950745	+	Missense_Mutation	SNP	C	C	G	rs144629981|rs3045983|rs557874766	byFrequency	TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:79950745C>G	ENST00000265081.6	+	1	279	c.199C>G	c.(199-201)Cca>Gca	p.P67A	DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000505337.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	67					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CCCAGCGCCCCCAGCTCCCGC	0.731								Mismatch excision repair (MMR)					C|||	1091	0.217851	0.2678	0.1916	5008	,	,		6483	0.0476		0.2356	False		,,,				2504	0.3262				p.P67A	Melanoma(88;1010 1399 13793 26548 36275)	Atlas-SNP	.											MSH3,NS,carcinoma,0,1	MSH3	129	.	0			c.C199G						.						3.0	4.0	3.0					5																	79950745		1702	3410	5112	SO:0001583	missense	4437	exon1			GCGCCCCCAGCTC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.199C>G	chr5.hg19:g.79950745C>G	ENSP00000265081:p.Pro67Ala	67.0	0.0		71.0	9.0	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	hg19	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	C	6.333	0.429466	0.11987	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.85484	-1.99	.	.	.	.	.	.	.	.	T	0.70150	0.3191	N	0.19112	0.55	0.19945	N	0.999946	B	0.18741	0.03	B	0.17098	0.017	T	0.53507	-0.8429	6	.	.	.	0.6693	.	.	.	.	67	P20585	MSH3_HUMAN	A	67;58	ENSP00000265081:P67A	.	P	+	1	0	MSH3	79986501	0.560000	0.26570	0.857000	0.33713	0.119000	0.20118	0.055000	0.14229	0.064000	0.16427	0.064000	0.15345	CCA	.	.		0.731	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
BRD8	10902	hgsc.bcm.edu	37	5	137485368	137485368	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:137485368A>G	ENST00000254900.5	-	23	3610	c.3239T>C	c.(3238-3240)tTg>tCg	p.L1080S		NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	1080					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGTATCCACCAAGGGAGTCTC	0.453																																					p.L1080S		Atlas-SNP	.											.	BRD8	192	.	0			c.T3239C						.						126.0	107.0	114.0					5																	137485368		2203	4300	6503	SO:0001583	missense	10902	exon23			TCCACCAAGGGAG	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3239T>C	chr5.hg19:g.137485368A>G	ENSP00000254900:p.Leu1080Ser	187.0	0.0		204.0	68.0	NM_139199	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	hg19	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	A	12.81	2.048224	0.36181	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	T;T	0.33216	1.77;1.42	5.13	5.13	0.70059	.	0.000000	0.36519	N	0.002552	T	0.29423	0.0733	L	0.29908	0.895	0.80722	D	1	D	0.53151	0.958	P	0.48873	0.593	T	0.01972	-1.1237	10	0.31617	T	0.26	-4.3791	12.9429	0.58357	1.0:0.0:0.0:0.0	.	1080	Q9H0E9	BRD8_HUMAN	S	1080;186	ENSP00000254900:L1080S;ENSP00000392646:L186S	ENSP00000254900:L1080S	L	-	2	0	BRD8	137513267	0.971000	0.33674	0.986000	0.45419	0.040000	0.13550	4.628000	0.61282	2.154000	0.67381	0.528000	0.53228	TTG	.	.		0.453	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
PCDHB16	57717	hgsc.bcm.edu	37	5	140562308	140562308	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:140562308G>C	ENST00000361016.2	+	1	1329	c.174G>C	c.(172-174)gaG>gaC	p.E58D		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	58	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTTGACAGAGATGTCCACCC	0.527																																					p.E58D		Atlas-SNP	.											.	PCDHB16	159	.	0			c.G174C						.						83.0	93.0	89.0					5																	140562308		2203	4300	6503	SO:0001583	missense	57717	exon1			GACAGAGATGTCC	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.174G>C	chr5.hg19:g.140562308G>C	ENSP00000354293:p.Glu58Asp	129.0	0.0		133.0	45.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	G	8.701	0.909785	0.17833	.	.	ENSG00000196963	ENST00000361016	T	0.32272	1.46	4.84	1.84	0.25277	Cadherin, N-terminal (1);Cadherin (1);	0.237484	0.21632	N	0.071469	T	0.22513	0.0543	L	0.41961	1.31	0.09310	N	1	B	0.02656	0.0	B	0.19391	0.025	T	0.18335	-1.0340	10	0.49607	T	0.09	.	4.8603	0.13581	0.077:0.2765:0.5041:0.1424	.	58	Q9NRJ7	PCDBG_HUMAN	D	58	ENSP00000354293:E58D	ENSP00000354293:E58D	E	+	3	2	PCDHB16	140542492	0.000000	0.05858	0.017000	0.16124	0.283000	0.27025	0.062000	0.14389	0.435000	0.26365	-0.140000	0.14226	GAG	.	.		0.527	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHGB1	56104	hgsc.bcm.edu	37	5	140731163	140731163	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:140731163C>A	ENST00000523390.1	+	1	1336	c.1336C>A	c.(1336-1338)Cct>Act	p.P446T	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	446	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGACAATGCACCTGTTTTCCA	0.552																																					p.P446T		Atlas-SNP	.											.	PCDHGB1	198	.	0			c.C1336A						.						85.0	97.0	93.0					5																	140731163		2174	4275	6449	SO:0001583	missense	56104	exon1			AATGCACCTGTTT	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1336C>A	chr5.hg19:g.140731163C>A	ENSP00000429273:p.Pro446Thr	98.0	0.0		130.0	59.0	NM_018922	Q3SY75|Q9Y5C8	Missense_Mutation	SNP	ENST00000523390.1	hg19	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	15.94	2.980371	0.53827	.	.	ENSG00000254221	ENST00000523390	D	0.84730	-1.89	5.49	4.62	0.57501	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.96200	0.8761	H	0.99732	4.735	0.38792	D	0.955004	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99840	1.1061	9	0.87932	D	0	.	16.3327	0.83049	0.0:0.8674:0.1326:0.0	.	446;446	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	T	446	ENSP00000429273:P446T	ENSP00000429273:P446T	P	+	1	0	PCDHGB1	140711347	1.000000	0.71417	0.052000	0.19188	0.683000	0.39861	5.956000	0.70315	1.431000	0.47355	0.563000	0.77884	CCT	.	.		0.552	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922	
PCDHGA7	56108	hgsc.bcm.edu	37	5	140763436	140763436	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:140763436G>T	ENST00000518325.1	+	1	970	c.970G>T	c.(970-972)Ggt>Tgt	p.G324C	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	324	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCTCAAGATGGTCCTGGTAG	0.388																																					p.G324C		Atlas-SNP	.											.	PCDHGA7	130	.	0			c.G970T						.						102.0	100.0	101.0					5																	140763436		1940	4169	6109	SO:0001583	missense	56108	exon1			CAAGATGGTCCTG	AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.970G>T	chr5.hg19:g.140763436G>T	ENSP00000430024:p.Gly324Cys	154.0	0.0		190.0	69.0	NM_032087	B2RN87|Q9Y5D0	Missense_Mutation	SNP	ENST00000518325.1	hg19	CCDS54927.1	.	.	.	.	.	.	.	.	.	.	.	16.62	3.174129	0.57692	.	.	ENSG00000253537	ENST00000518325	T	0.04603	3.59	5.15	4.27	0.50696	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.23410	0.0566	M	0.84683	2.71	0.33311	D	0.566079	D;D	0.64830	0.994;0.984	D;D	0.79108	0.992;0.924	T	0.23440	-1.0188	9	0.87932	D	0	.	13.1071	0.59253	0.0787:0.0:0.9213:0.0	.	324;324	Q9Y5G6;Q9Y5G6-2	PCDG7_HUMAN;.	C	324	ENSP00000430024:G324C	ENSP00000430024:G324C	G	+	1	0	PCDHGA7	140743620	0.010000	0.17322	0.992000	0.48379	0.799000	0.45148	1.359000	0.34113	2.546000	0.85860	0.655000	0.94253	GGT	.	.		0.388	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	NM_018920	
SLIT3	6586	hgsc.bcm.edu	37	5	168727673	168727673	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:168727673G>C	ENST00000519560.1	-	1	460	c.41C>G	c.(40-42)gCc>gGc	p.A14G	SLIT3_ENST00000521130.1_5'UTR|SLIT3_ENST00000332966.8_Missense_Mutation_p.A14G|SLIT3_ENST00000404867.3_Missense_Mutation_p.A14G	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	14					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGCCAGGCGGGCGCGCACGGC	0.761																																					p.A14G	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.C41G						.						2.0	3.0	3.0					5																	168727673		1252	2497	3749	SO:0001583	missense	6586	exon1			AGGCGGGCGCGCA	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.41C>G	chr5.hg19:g.168727673G>C	ENSP00000430333:p.Ala14Gly	55.0	0.0		74.0	22.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	hg19	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270324	0.23221	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.76316	-1.01;-1.01;-1.0	3.55	1.52	0.23074	.	1.220170	0.06514	U	0.738493	T	0.55545	0.1927	N	0.08118	0	0.21220	N	0.99975	B;B	0.15141	0.009;0.012	B;B	0.16289	0.014;0.015	T	0.43261	-0.9402	10	0.18710	T	0.47	.	4.7619	0.13111	0.3114:0.0:0.6886:0.0	.	14;14	O75094-2;O75094	.;SLIT3_HUMAN	G	14	ENSP00000430333:A14G;ENSP00000332164:A14G;ENSP00000384890:A14G	ENSP00000332164:A14G	A	-	2	0	SLIT3	168660251	0.851000	0.29673	1.000000	0.80357	0.558000	0.35554	0.302000	0.19192	0.719000	0.32188	-0.344000	0.07964	GCC	.	.		0.761	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
DOCK2	1794	hgsc.bcm.edu	37	5	169267834	169267834	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:169267834T>C	ENST00000256935.8	+	27	2857	c.2777T>C	c.(2776-2778)aTg>aCg	p.M926T	DOCK2_ENST00000520908.1_Missense_Mutation_p.M418T|DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	926					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTCATCACCATGGGCCGGGAT	0.453																																					p.M926T		Atlas-SNP	.											.	DOCK2	389	.	0			c.T2777C						.						132.0	112.0	119.0					5																	169267834		2203	4300	6503	SO:0001583	missense	1794	exon27			TCACCATGGGCCG	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2777T>C	chr5.hg19:g.169267834T>C	ENSP00000256935:p.Met926Thr	89.0	0.0		99.0	38.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.532226	0.45073	.	.	ENSG00000134516	ENST00000256935;ENST00000343291;ENST00000520908;ENST00000519628	T;T	0.03635	3.86;3.86	5.28	5.28	0.74379	.	0.075281	0.85682	D	0.000000	T	0.04318	0.0119	L	0.38175	1.15	0.80722	D	1	B;B	0.17038	0.02;0.002	B;B	0.14023	0.01;0.003	T	0.45041	-0.9288	10	0.34782	T	0.22	.	12.7092	0.57080	0.0:0.0:0.0:1.0	.	418;926	E7ERW7;Q92608	.;DOCK2_HUMAN	T	926;307;418;130	ENSP00000256935:M926T;ENSP00000429283:M418T	ENSP00000256935:M926T	M	+	2	0	DOCK2	169200412	1.000000	0.71417	0.995000	0.50966	0.854000	0.48673	5.129000	0.64739	1.990000	0.58119	0.477000	0.44152	ATG	.	.		0.453	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
FAM153B	202134	hgsc.bcm.edu	37	5	175530270	175530270	+	Silent	SNP	C	C	T	rs367572504		TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr5:175530270C>T	ENST00000253490.4	+	13	762	c.705C>T	c.(703-705)aaC>aaT	p.N235N	FAM153B_ENST00000512862.1_Intron|FAM153B_ENST00000515817.1_Silent_p.N158N|FAM153B_ENST00000510151.1_Silent_p.N158N			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	235										endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		CCAGTTACAACGGCGAGGAGG	0.448													c|||	1	0.000199681	0.0008	0.0	5008	,	,		38352	0.0		0.0	False		,,,				2504	0.0				p.N158N		Atlas-SNP	.											.	FAM153B	28	.	0			c.C474T						.	C		1,4405	2.1+/-5.4	0,1,2202	293.0	301.0	298.0		705	-1.2	0.0	5		298	0,8600		0,0,4300	no	coding-synonymous	FAM153B	NM_001079529.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		235/388	175530270	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	202134	exon12			TTACAACGGCGAG	AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.705C>T	chr5.hg19:g.175530270C>T		1266.0	0.0		1591.0	310.0	NM_001265615	A8MTI1	Silent	SNP	ENST00000253490.4	hg19																																																																																				.	.		0.448	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001079529	
SYNGAP1	8831	hgsc.bcm.edu	37	6	33414444	33414444	+	Silent	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:33414444C>A	ENST00000418600.2	+	17	3776	c.3675C>A	c.(3673-3675)tcC>tcA	p.S1225S	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Silent_p.S1166S|SYNGAP1_ENST00000293748.5_Silent_p.S1225S	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1225					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GGCTGCTGTCCCAGGAAGAAC	0.557																																					p.S1225S		Atlas-SNP	.											.	SYNGAP1	202	.	0			c.C3675A						.						102.0	81.0	88.0					6																	33414444		2203	4300	6503	SO:0001819	synonymous_variant	8831	exon17			GCTGTCCCAGGAA	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3675C>A	chr6.hg19:g.33414444C>A		173.0	0.0		123.0	27.0	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Silent	SNP	ENST00000418600.2	hg19	CCDS34434.2																																																																																			.	.		0.557	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
TTBK1	84630	hgsc.bcm.edu	37	6	43226800	43226800	+	Silent	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:43226800T>A	ENST00000259750.4	+	11	1124	c.1041T>A	c.(1039-1041)ccT>ccA	p.P347P	TTBK1_ENST00000304139.5_Silent_p.P296P	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	347					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CGCCAGTGCCTGGGGACCTGC	0.647																																					p.P347P		Atlas-SNP	.											.	TTBK1	124	.	0			c.T1041A						.						48.0	53.0	51.0					6																	43226800		2203	4300	6503	SO:0001819	synonymous_variant	84630	exon11			AGTGCCTGGGGAC	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1041T>A	chr6.hg19:g.43226800T>A		186.0	0.0		123.0	28.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Silent	SNP	ENST00000259750.4	hg19	CCDS34455.1																																																																																			.	.		0.647	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
PKHD1	5314	hgsc.bcm.edu	37	6	51917968	51917968	+	Silent	SNP	T	T	A	rs4715271	byFrequency	TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:51917968T>A	ENST00000371117.3	-	21	2321	c.2046A>T	c.(2044-2046)ccA>ccT	p.P682P	PKHD1_ENST00000340994.4_Silent_p.P682P	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	682					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GAACCAGCACTGGGGAGTTTG	0.527																																					p.P682P		Atlas-SNP	.											.	PKHD1	927	.	0			c.A2046T						.						71.0	73.0	72.0					6																	51917968		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon21			CAGCACTGGGGAG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.2046A>T	chr6.hg19:g.51917968T>A		166.0	0.0		141.0	30.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	T|0.921;G|0.079		0.527	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
EYS	346007	hgsc.bcm.edu	37	6	66005906	66005906	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:66005906G>A	ENST00000370621.3	-	12	2399	c.1873C>T	c.(1873-1875)Cac>Tac	p.H625Y	EYS_ENST00000503581.1_Missense_Mutation_p.H625Y|EYS_ENST00000370616.2_Missense_Mutation_p.H625Y			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	625					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTACAATTGTGCGAAAGGGCC	0.433																																					p.H625Y		Atlas-SNP	.											.	EYS	527	.	0			c.C1873T						.						144.0	112.0	122.0					6																	66005906		692	1591	2283	SO:0001583	missense	346007	exon12			AATTGTGCGAAAG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1873C>T	chr6.hg19:g.66005906G>A	ENSP00000359655:p.His625Tyr	122.0	0.0		78.0	18.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	.	0.946	-0.707923	0.03230	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	T;T;T	0.80304	-1.36;-1.36;-1.36	5.48	3.35	0.38373	.	.	.	.	.	T	0.44286	0.1286	N	0.08118	0	0.09310	N	0.999998	B	0.14438	0.01	B	0.17722	0.019	T	0.41106	-0.9527	9	0.41790	T	0.15	.	9.396	0.38404	0.091:0.1501:0.7588:0.0	.	625	Q5T1H1-1	.	Y	625	ENSP00000424243:H625Y;ENSP00000359655:H625Y;ENSP00000359650:H625Y	ENSP00000359650:H625Y	H	-	1	0	EYS	66062627	0.949000	0.32298	0.057000	0.19452	0.020000	0.10135	0.785000	0.26830	1.312000	0.45043	-0.226000	0.12346	CAC	.	.		0.433	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
BAI3	577	hgsc.bcm.edu	37	6	69349286	69349286	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:69349286G>C	ENST00000370598.1	+	3	1540	c.719G>C	c.(718-720)tGc>tCc	p.C240S		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	240					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.C240Y(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ACCCAAGTCTGCAATCTTACC	0.537																																					p.C240S		Atlas-SNP	.											BAI3,NS,carcinoma,0,1	BAI3	451	.	1	Substitution - Missense(1)	lung(1)	c.G719C						.						22.0	22.0	22.0					6																	69349286		2201	4299	6500	SO:0001583	missense	577	exon3			AAGTCTGCAATCT	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.719G>C	chr6.hg19:g.69349286G>C	ENSP00000359630:p.Cys240Ser	55.0	0.0		26.0	6.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	hg19	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.778475	0.70107	.	.	ENSG00000135298	ENST00000370598	T	0.19532	2.14	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	L	0.36672	1.1	0.80722	D	1	P	0.50156	0.932	P	0.60789	0.879	T	0.01360	-1.1375	10	0.18276	T	0.48	.	19.1668	0.93561	0.0:0.0:1.0:0.0	.	240	O60242	BAI3_HUMAN	S	240	ENSP00000359630:C240S	ENSP00000359630:C240S	C	+	2	0	BAI3	69406007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.599000	0.87857	0.563000	0.77884	TGC	.	.		0.537	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
MDN1	23195	hgsc.bcm.edu	37	6	90408665	90408665	+	Silent	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:90408665T>C	ENST00000369393.3	-	59	9202	c.9087A>G	c.(9085-9087)ccA>ccG	p.P3029P	MDN1_ENST00000428876.1_Silent_p.P3029P			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	3029					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCCAGTACTCTGGATTTGTGG	0.418																																					p.P3029P		Atlas-SNP	.											.	MDN1	478	.	0			c.A9087G						.						92.0	90.0	91.0					6																	90408665		2203	4300	6503	SO:0001819	synonymous_variant	23195	exon59			GTACTCTGGATTT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.9087A>G	chr6.hg19:g.90408665T>C		74.0	0.0		71.0	19.0	NM_014611	O15019|Q5T794	Silent	SNP	ENST00000369393.3	hg19	CCDS5024.1																																																																																			.	.		0.418	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
TRDN	10345	hgsc.bcm.edu	37	6	123696761	123696761	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:123696761T>A	ENST00000398178.3	-	19	1283	c.1262A>T	c.(1261-1263)cAa>cTa	p.Q421L	TRDN_ENST00000334268.4_Missense_Mutation_p.Q421L	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	421					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		TGCTTTTACTTGTTTGTCACT	0.284																																					p.Q422L		Atlas-SNP	.											.	TRDN	88	.	0			c.A1265T						.						58.0	60.0	60.0					6																	123696761		1773	3998	5771	SO:0001583	missense	10345	exon19			TTTACTTGTTTGT	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1262A>T	chr6.hg19:g.123696761T>A	ENSP00000381240:p.Gln421Leu	109.0	0.0		105.0	20.0	NM_001251987	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	hg19	CCDS55053.1	.	.	.	.	.	.	.	.	.	.	T	11.21	1.572145	0.28092	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268	T;T	0.18810	2.19;2.19	5.5	3.07	0.35406	.	0.650503	0.13683	N	0.370051	T	0.03608	0.0103	N	0.12182	0.205	0.80722	D	1	B;B;B	0.10296	0.003;0.003;0.003	B;B;B	0.06405	0.002;0.002;0.002	T	0.28808	-1.0032	10	0.33141	T	0.24	-10.7856	4.9613	0.14068	0.1605:0.0858:0.0:0.7537	.	421;422;421	Q5SWK9;Q8IVK2;Q13061	.;.;TRDN_HUMAN	L	421;423;421	ENSP00000381240:Q421L;ENSP00000333984:Q421L	ENSP00000333984:Q421L	Q	-	2	0	TRDN	123738460	0.798000	0.28890	0.933000	0.37362	0.863000	0.49368	0.491000	0.22419	0.490000	0.27771	-0.263000	0.10527	CAA	.	.		0.284	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
PTPRK	5796	hgsc.bcm.edu	37	6	128388829	128388829	+	Silent	SNP	C	C	T	rs150985952		TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:128388829C>T	ENST00000368215.3	-	12	1991	c.1992G>A	c.(1990-1992)ggG>ggA	p.G664G	PTPRK_ENST00000368226.4_Silent_p.G664G|PTPRK_ENST00000368210.3_Silent_p.G664G|PTPRK_ENST00000368213.5_Silent_p.G664G|PTPRK_ENST00000524481.1_5'UTR|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000368227.3_Silent_p.G664G|PTPRK_ENST00000532331.1_Silent_p.G664G|PTPRK_ENST00000368207.3_Silent_p.G664G			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	664	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		ACGGTGCACCCCCACTCATGG	0.542																																					p.G664G		Atlas-SNP	.											.	PTPRK	330	.	0			c.G1992A						.	C	,	0,4406		0,0,2203	110.0	109.0	110.0		1992,1992	-0.7	0.2	6	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	PTPRK	NM_001135648.1,NM_002844.3	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	664/1447,664/1441	128388829	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5796	exon12			TGCACCCCCACTC	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1992G>A	chr6.hg19:g.128388829C>T		96.0	0.0		78.0	20.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	ENST00000368215.3	hg19																																																																																				.	C|1.000;T|0.000		0.542	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
FNDC1	84624	hgsc.bcm.edu	37	6	159654122	159654122	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr6:159654122A>G	ENST00000297267.9	+	11	2778	c.2578A>G	c.(2578-2580)Agg>Ggg	p.R860G	FNDC1_ENST00000340366.6_Missense_Mutation_p.R797G	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	860					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AGCCCACCCCAGGGTTCCCTC	0.617																																					p.R860G		Atlas-SNP	.											.	FNDC1	250	.	0			c.A2578G						.						23.0	28.0	26.0					6																	159654122		1964	4139	6103	SO:0001583	missense	84624	exon11			CACCCCAGGGTTC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2578A>G	chr6.hg19:g.159654122A>G	ENSP00000297267:p.Arg860Gly	70.0	0.0		60.0	16.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	hg19	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.54|11.54	1.669276|1.669276	0.29604|0.29604	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000329629|ENST00000297267;ENST00000340366	.|T;T	.|0.09073	.|3.02;3.77	4.61|4.61	0.675|0.675	0.17952|0.17952	.|.	.|0.571497	.|0.18148	.|N	.|0.150172	T|T	0.01592|0.01592	0.0051|0.0051	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	.|B;B	.|0.13594	.|0.008;0.002	.|B;B	.|0.13407	.|0.009;0.003	T|T	0.47420|0.47420	-0.9119|-0.9119	5|10	.|0.23891	.|T	.|0.37	-21.4251|-21.4251	5.7661|5.7661	0.18227|0.18227	0.5867:0.3252:0.0881:0.0|0.5867:0.3252:0.0881:0.0	.|.	.|797;860	.|Q4ZHG4-2;Q4ZHG4	.|.;FNDC1_HUMAN	R|G	755|860;797	.|ENSP00000297267:R860G;ENSP00000342460:R797G	.|ENSP00000297267:R860G	Q|R	+|+	2|1	0|2	FNDC1|FNDC1	159574112|159574112	0.762000|0.762000	0.28451|0.28451	0.020000|0.020000	0.16555|0.16555	0.006000|0.006000	0.05464|0.05464	1.253000|1.253000	0.32886|0.32886	-0.022000|-0.022000	0.13986|0.13986	-0.290000|-0.290000	0.09829|0.09829	CAG|AGG	.	.		0.617	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
PDE1C	5137	hgsc.bcm.edu	37	7	31904592	31904592	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr7:31904592C>A	ENST00000396191.1	-	7	1169	c.714G>T	c.(712-714)caG>caT	p.Q238H	PDE1C_ENST00000321453.7_Missense_Mutation_p.Q238H|PDE1C_ENST00000396184.3_Missense_Mutation_p.Q238H|PDE1C_ENST00000396193.1_Missense_Mutation_p.Q298H|PDE1C_ENST00000396182.2_Missense_Mutation_p.Q238H	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	238	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	AATGCACTGTCTGTGTAACAT	0.448																																					p.Q298H		Atlas-SNP	.											.	PDE1C	465	.	0			c.G894T						.						183.0	160.0	168.0					7																	31904592		2203	4300	6503	SO:0001583	missense	5137	exon8			CACTGTCTGTGTA	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.714G>T	chr7.hg19:g.31904592C>A	ENSP00000379494:p.Gln238His	105.0	0.0		177.0	48.0	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	hg19	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638265	0.87760	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53	5.88	5.88	0.94601	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.88451	0.6440	M	0.69823	2.125	0.80722	D	1	P;D;D	0.89917	0.924;0.969;1.0	P;P;D	0.81914	0.631;0.747;0.995	D	0.88276	0.2933	10	0.54805	T	0.06	.	14.3976	0.67022	0.0:0.9276:0.0:0.0724	.	238;298;238	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	H	298;238;238;238;238	ENSP00000379496:Q298H;ENSP00000379494:Q238H;ENSP00000318105:Q238H;ENSP00000379487:Q238H;ENSP00000379485:Q238H	ENSP00000318105:Q238H	Q	-	3	2	PDE1C	31871117	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	3.349000	0.52217	2.781000	0.95711	0.591000	0.81541	CAG	.	.		0.448	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
ZNF3	7551	hgsc.bcm.edu	37	7	99674959	99674959	+	Missense_Mutation	SNP	C	C	T	rs372465031		TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr7:99674959C>T	ENST00000424697.1	-	3	328	c.22G>A	c.(22-24)Gta>Ata	p.V8I	ZNF3_ENST00000413658.2_Missense_Mutation_p.V8I|ZNF3_ENST00000303915.6_Missense_Mutation_p.V8I|ZNF3_ENST00000299667.4_Missense_Mutation_p.V8I	NM_001278284.1|NM_001278287.1|NM_001278290.1|NM_001278291.1|NM_001278292.1|NM_032924.3	NP_001265213.1|NP_001265216.1|NP_001265219.1|NP_001265220.1|NP_001265221.1|NP_116313.3	P17036	ZNF3_HUMAN	zinc finger protein 3	8					cell differentiation (GO:0030154)|leukocyte activation (GO:0045321)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(8)|ovary(1)|skin(2)	25	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)	Ovarian(593;2.06e-05)|Myeloproliferative disorder(862;0.0122)|Breast(660;0.029)	STAD - Stomach adenocarcinoma(171;0.129)			TCCTGAGATACGAGATCAGCC	0.493																																					p.V8I		Atlas-SNP	.											.	ZNF3	54	.	0			c.G22A						.						151.0	155.0	154.0					7																	99674959		1997	4178	6175	SO:0001583	missense	7551	exon3			GAGATACGAGATC	AF027136	CCDS43618.1, CCDS43619.1	7q22.1	2013-01-08	2006-05-05					"""Zinc fingers, C2H2-type"", ""-"""	13089	protein-coding gene	gene with protein product		194510	"""zinc finger protein 3 (A8-51)"""				Standard	NM_032924		Approved	A8-51, KOX25, PP838, FLJ20216, HF.12, Zfp113	uc003usr.4	P17036		ENST00000424697.1:c.22G>A	chr7.hg19:g.99674959C>T	ENSP00000415358:p.Val8Ile	115.0	0.0		140.0	45.0	NM_032924	D6W5U0|P13683|Q9HBR4|Q9NNX8|Q9NXJ1|Q9UC15|Q9UC16	Missense_Mutation	SNP	ENST00000424697.1	hg19	CCDS43619.1	.	.	.	.	.	.	.	.	.	.	C	12.61	1.990662	0.35131	.	.	ENSG00000166526	ENST00000413658;ENST00000424697;ENST00000303915;ENST00000299667;ENST00000449785;ENST00000428683;ENST00000415068	T;T;T;T;T;T;T	0.06068	4.8;3.35;3.35;3.35;5.35;5.35;5.05	5.53	4.65	0.58169	.	0.398926	0.18433	N	0.141390	T	0.05686	0.0149	L	0.34521	1.04	0.09310	N	1	B;B	0.21821	0.001;0.061	B;B	0.17722	0.001;0.019	T	0.36065	-0.9763	10	0.22706	T	0.39	-4.8621	10.3091	0.43697	0.0:0.9117:0.0:0.0883	.	8;8	P17036;P17036-2	ZNF3_HUMAN;.	I	8	ENSP00000399951:V8I;ENSP00000415358:V8I;ENSP00000306372:V8I;ENSP00000299667:V8I;ENSP00000405970:V8I;ENSP00000388042:V8I;ENSP00000416686:V8I	ENSP00000299667:V8I	V	-	1	0	ZNF3	99512895	0.021000	0.18746	0.203000	0.23512	0.888000	0.51559	1.172000	0.31908	1.576000	0.49790	0.655000	0.94253	GTA	.	.		0.493	ZNF3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336247.3	NM_017715	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117375412	117375412	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr7:117375412A>G	ENST00000160373.3	-	15	3690	c.3599T>C	c.(3598-3600)tTa>tCa	p.L1200S		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1200					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AGATTTTTCTAAATTTTCTAA	0.363																																					p.L1200S		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.T3599C						.						50.0	56.0	54.0					7																	117375412		2203	4299	6502	SO:0001583	missense	83992	exon15			TTTTCTAAATTTT		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3599T>C	chr7.hg19:g.117375412A>G	ENSP00000160373:p.Leu1200Ser	158.0	0.0		189.0	29.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	hg19	CCDS5774.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.81|16.81	3.225843|3.225843	0.58668|0.58668	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000435233	T|.	0.55760|.	0.5|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.063539|.	0.64402|.	D|.	0.000004|.	T|.	0.80065|.	0.4555|.	M|M	0.86805|0.86805	2.84|2.84	0.51012|0.51012	D|D	0.999908|0.999908	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|.	0.83029|.	-0.0163|.	10|.	0.87932|.	D|.	0|.	-0.2297|-0.2297	15.9458|15.9458	0.79792|0.79792	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1200|.	Q8WZ74|.	CTTB2_HUMAN|.	S|Q	1200|185	ENSP00000160373:L1200S|.	ENSP00000160373:L1200S|.	L|X	-|-	2|1	0|0	CTTNBP2|CTTNBP2	117162648|117162648	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	6.361000|6.361000	0.73070|0.73070	2.216000|2.216000	0.71823|0.71823	0.533000|0.533000	0.62120|0.62120	TTA|TAG	.	.		0.363	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
MGAM	8972	hgsc.bcm.edu	37	7	141795408	141795408	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr7:141795408C>A	ENST00000549489.2	+	41	4909	c.4814C>A	c.(4813-4815)tCc>tAc	p.S1605Y	MGAM_ENST00000475668.2_Missense_Mutation_p.S2501Y	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1605	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GTGAATATTTCCAGAACTGTC	0.493																																					p.S1605Y		Atlas-SNP	.											.	MGAM	767	.	0			c.C4814A						.						160.0	139.0	145.0					7																	141795408		1899	4129	6028	SO:0001583	missense	8972	exon41			ATATTTCCAGAAC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4814C>A	chr7.hg19:g.141795408C>A	ENSP00000447378:p.Ser1605Tyr	96.0	0.0		94.0	17.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000549489.2	hg19	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413122	0.62511	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.91577	-2.87	5.48	5.48	0.80851	Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.95345	0.8489	M	0.78801	2.425	0.45403	D	0.998388	D	0.89917	1.0	D	0.79108	0.992	D	0.95429	0.8514	9	0.72032	D	0.01	.	18.4728	0.90781	0.0:1.0:0.0:0.0	.	1605	O43451	MGA_HUMAN	Y	1605;2502	ENSP00000447378:S1605Y	ENSP00000373973:S1605Y	S	+	2	0	MGAM	141441877	1.000000	0.71417	0.957000	0.39632	0.132000	0.20833	4.833000	0.62766	2.724000	0.93272	0.655000	0.94253	TCC	.	.		0.493	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
CUL1	8454	hgsc.bcm.edu	37	7	148484107	148484108	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr7:148484107_148484108CA>TG	ENST00000325222.4	+	13	1653_1654	c.1374_1375CA>TG	c.(1372-1377)gaCAaa>gaTGaa	p.K459E	CUL1_ENST00000409469.1_Missense_Mutation_p.K459E|CUL1_ENST00000602748.1_Missense_Mutation_p.K459E	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	459					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			ACATAGAAGACAAAGACGTATT	0.5																																					p.D458D|p.K459E		Atlas-SNP	.											.	CUL1	80	.	0			c.C1374T|c.A1375G						.																																			SO:0001583	missense	8454	exon13			AGAAGACAAAGAC|GAAGACAAAGACG	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	Exception_encountered	chr7.hg19:g.148484107_148484108delinsTG	ENSP00000326804:p.Lys459Glu	48.0|49.0	0.0		56.0	22.0	NM_003592	D3DWG3|O60719|Q08AL6|Q8IYW1	Silent|Missense_Mutation	SNP	ENST00000325222.4	hg19	CCDS34772.1																																																																																			.	.		0.500	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467785.1	NM_003592	
GIMAP6	474344	hgsc.bcm.edu	37	7	150325099	150325099	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr7:150325099T>C	ENST00000328902.5	-	3	803	c.587A>G	c.(586-588)cAt>cGt	p.H196R	GIMAP6_ENST00000493969.1_3'UTR	NM_001244072.1|NM_024711.5	NP_001231001.1|NP_078987.3	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	196	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			endometrium(4)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GAAGCCGCAATGGCGCCGTGC	0.587																																					p.H266R		Atlas-SNP	.											.	GIMAP6	60	.	0			c.A797G						.						118.0	123.0	121.0					7																	150325099		2203	4300	6503	SO:0001583	missense	474344	exon3			CCGCAATGGCGCC	AK026343	CCDS34778.1, CCDS59087.1, CCDS75676.1	7q36.1	2014-04-04			ENSG00000133561	ENSG00000133561		"""GTPases, IMAP"""	21918	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 6"""					15474311	Standard	NM_001244072		Approved	FLJ22690, IAN6	uc022apv.1	Q6P9H5	OTTHUMG00000159137	ENST00000328902.5:c.587A>G	chr7.hg19:g.150325099T>C	ENSP00000330374:p.His196Arg	70.0	0.0		84.0	30.0	NM_001244072	C9J7B6|D3DWZ4|Q5ZPR6|Q9H612	Missense_Mutation	SNP	ENST00000328902.5	hg19	CCDS34778.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.058128	0.36277	.	.	ENSG00000133561	ENST00000328902;ENST00000392862	T	0.05081	3.5	4.29	4.29	0.51040	AIG1 (1);	0.063141	0.64402	D	0.000003	T	0.14527	0.0351	L	0.39633	1.23	0.80722	D	1	P;D	0.76494	0.904;0.999	P;D	0.74674	0.837;0.984	T	0.01232	-1.1411	10	0.48119	T	0.1	.	9.7378	0.40399	0.0:0.0:0.0:1.0	.	196;116	Q6P9H5;Q6P9H5-2	GIMA6_HUMAN;.	R	196;257	ENSP00000330374:H196R	ENSP00000330374:H196R	H	-	2	0	GIMAP6	149956032	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	3.009000	0.49552	1.820000	0.53075	0.459000	0.35465	CAT	.	.		0.587	GIMAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353457.1	NM_024711	
RB1CC1	9821	hgsc.bcm.edu	37	8	53596502	53596502	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr8:53596502T>C	ENST00000025008.5	-	4	666	c.143A>G	c.(142-144)aAt>aGt	p.N48S	RB1CC1_ENST00000539297.1_Missense_Mutation_p.N48S|RB1CC1_ENST00000435644.2_Missense_Mutation_p.N48S|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	48					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTCTCCTCCATTGACCACCAG	0.418																																					p.N48S	GBM(180;1701 2102 13475 42023 52570)	Atlas-SNP	.											.	RB1CC1	163	.	0			c.A143G						.						119.0	94.0	103.0					8																	53596502		2203	4300	6503	SO:0001583	missense	9821	exon4			CCTCCATTGACCA	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.143A>G	chr8.hg19:g.53596502T>C	ENSP00000025008:p.Asn48Ser	69.0	0.0		88.0	44.0	NM_001083617	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	hg19	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	T	17.80	3.479187	0.63849	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297;ENST00000517963	T;T;T	0.41065	1.01;1.01;1.01	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.46268	0.1384	N	0.20401	0.57	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.80764	0.994;0.985	T	0.30060	-0.9991	10	0.13108	T	0.6	-21.6464	14.99	0.71381	0.0:0.0:0.0:1.0	.	48;48	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	S	48;48;48;44	ENSP00000025008:N48S;ENSP00000396067:N48S;ENSP00000445960:N48S	ENSP00000025008:N48S	N	-	2	0	RB1CC1	53759055	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.926000	0.70070	1.999000	0.58509	0.455000	0.32223	AAT	.	.		0.418	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
CCNE2	9134	hgsc.bcm.edu	37	8	95900175	95900175	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr8:95900175A>G	ENST00000520509.1	-	7	832	c.580T>C	c.(580-582)Ttc>Ctc	p.F194L	RP11-347C18.5_ENST00000605911.1_RNA|CCNE2_ENST00000308108.4_Missense_Mutation_p.F194L|CCNE2_ENST00000396133.3_Missense_Mutation_p.F194L|CCNE2_ENST00000523476.1_5'UTR			O96020	CCNE2_HUMAN	cyclin E2	194					cell cycle checkpoint (GO:0000075)|cell division (GO:0051301)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|prostate(1)	11	Breast(36;8.75e-07)					GAAGCAATGAATAATGAGGTA	0.264																																					p.F194L		Atlas-SNP	.											.	CCNE2	29	.	0			c.T580C						.						59.0	65.0	63.0					8																	95900175		2198	4280	6478	SO:0001583	missense	9134	exon7			CAATGAATAATGA	AF091433	CCDS6264.1	8q22.1	2005-10-18			ENSG00000175305	ENSG00000175305			1590	protein-coding gene	gene with protein product		603775				9840927, 9840943	Standard	NM_057749		Approved	CYCE2	uc003yhc.3	O96020	OTTHUMG00000164696	ENST00000520509.1:c.580T>C	chr8.hg19:g.95900175A>G	ENSP00000429089:p.Phe194Leu	349.0	0.0		382.0	106.0	NM_057749	O95439	Missense_Mutation	SNP	ENST00000520509.1	hg19	CCDS6264.1	.	.	.	.	.	.	.	.	.	.	A	33	5.209567	0.95069	.	.	ENSG00000175305	ENST00000520509;ENST00000308108;ENST00000542725;ENST00000396133	T;T;T	0.10099	2.91;2.91;2.91	5.63	5.63	0.86233	Cyclin, N-terminal (1);Cyclin-like (3);	0.000000	0.85682	D	0.000000	T	0.25306	0.0615	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.04885	-1.0920	10	0.11485	T	0.65	.	15.8419	0.78852	1.0:0.0:0.0:0.0	.	194;194	Q8WUE3;O96020	.;CCNE2_HUMAN	L	194;194;86;194	ENSP00000429089:F194L;ENSP00000309181:F194L;ENSP00000379437:F194L	ENSP00000309181:F194L	F	-	1	0	CCNE2	95969351	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.530000	0.81962	2.137000	0.66172	0.533000	0.62120	TTC	.	.		0.264	CCNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379808.1	NM_057749, NM_004702	
CNTFR	1271	hgsc.bcm.edu	37	9	34568951	34568951	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr9:34568951C>A	ENST00000378980.3	-	3	322	c.29G>T	c.(28-30)tGt>tTt	p.C10F	CNTFR-AS1_ENST00000438244.1_RNA|CNTFR-AS1_ENST00000454187.1_RNA|CNTFR-AS1_ENST00000453642.1_RNA|CNTFR_ENST00000351266.4_Missense_Mutation_p.C10F|CNTFR-AS1_ENST00000436360.1_RNA	NM_001207011.1|NM_147164.2	NP_001193940.1|NP_671693.1	P26992	CNTFR_HUMAN	ciliary neurotrophic factor receptor	10					brainstem development (GO:0003360)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|skeletal muscle organ development (GO:0060538)|suckling behavior (GO:0001967)	anchored component of membrane (GO:0031225)|CNTFR-CLCF1 complex (GO:0097059)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|cytokine binding (GO:0019955)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(4)|skin(1)	15	all_epithelial(49;0.0899)		STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.00494)		AAGCACAGCACAGCAGGCCCA	0.677																																					p.C10F		Atlas-SNP	.											.	CNTFR	46	.	0			c.G29T						.						20.0	23.0	22.0					9																	34568951		2194	4291	6485	SO:0001583	missense	1271	exon3			ACAGCACAGCAGG	M73238	CCDS6558.1	9p13	2013-02-11			ENSG00000122756	ENSG00000122756		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2170	protein-coding gene	gene with protein product		118946				1648265	Standard	NM_001842		Approved		uc003zuq.2	P26992	OTTHUMG00000019821	ENST00000378980.3:c.29G>T	chr9.hg19:g.34568951C>A	ENSP00000368265:p.Cys10Phe	91.0	0.0		116.0	37.0	NM_147164	Q5U050	Missense_Mutation	SNP	ENST00000378980.3	hg19	CCDS6558.1	.	.	.	.	.	.	.	.	.	.	C	14.51	2.558315	0.45590	.	.	ENSG00000122756	ENST00000378980;ENST00000351266;ENST00000417345	T;T;T	0.30182	1.54;1.54;1.54	4.83	3.86	0.44501	.	0.085367	0.45126	D	0.000393	T	0.24586	0.0596	L	0.45581	1.43	0.40167	D	0.977139	B	0.02656	0.0	B	0.01281	0.0	T	0.17471	-1.0368	9	0.30854	T	0.27	.	9.3853	0.38338	0.2282:0.7718:0.0:0.0	.	10	P26992	CNTFR_HUMAN	F	10	ENSP00000368265:C10F;ENSP00000242338:C10F;ENSP00000388082:C10F	ENSP00000242338:C10F	C	-	2	0	CNTFR	34558951	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.011000	0.40922	2.504000	0.84457	0.655000	0.94253	TGT	.	.		0.677	CNTFR-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052176.1		
CA9	768	hgsc.bcm.edu	37	9	35680975	35680975	+	Missense_Mutation	SNP	G	G	A	rs374397867		TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr9:35680975G>A	ENST00000378357.4	+	11	1437	c.1333G>A	c.(1333-1335)Ggg>Agg	p.G445R	CA9_ENST00000493245.1_3'UTR	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	445					bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	GGGAACCAAAGGGGGTGTGAG	0.552																																					p.G445R		Atlas-SNP	.											.	CA9	48	.	0			c.G1333A						.						79.0	88.0	85.0					9																	35680975		2203	4300	6503	SO:0001583	missense	768	exon11			ACCAAAGGGGGTG	X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.1333G>A	chr9.hg19:g.35680975G>A	ENSP00000367608:p.Gly445Arg	56.0	0.0		57.0	6.0	NM_001216	Q5T4R1	Missense_Mutation	SNP	ENST00000378357.4	hg19	CCDS6585.1	.	.	.	.	.	.	.	.	.	.	G	10.57	1.387492	0.25031	.	.	ENSG00000107159	ENST00000378357	T	0.63255	-0.03	4.91	4.02	0.46733	.	0.629032	0.14957	N	0.288583	T	0.47097	0.1427	L	0.39898	1.24	0.29079	N	0.882839	P	0.36199	0.543	B	0.28916	0.096	T	0.40572	-0.9556	10	0.29301	T	0.29	.	9.1051	0.36692	0.0995:0.0:0.9005:0.0	.	445	Q16790	CAH9_HUMAN	R	445	ENSP00000367608:G445R	ENSP00000367608:G445R	G	+	1	0	CA9	35670975	0.996000	0.38824	0.884000	0.34674	0.022000	0.10575	2.849000	0.48286	1.427000	0.47276	0.591000	0.81541	GGG	.	.		0.552	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216	
TOMM5	401505	hgsc.bcm.edu	37	9	37588927	37588927	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr9:37588927G>C	ENST00000321301.6	-	2	233	c.124C>G	c.(124-126)Cca>Gca	p.P42A	RP11-613M10.8_ENST00000537239.2_Missense_Mutation_p.P55A|TOMM5_ENST00000377773.5_Missense_Mutation_p.P76A|TOMM5_ENST00000401811.3_Missense_Mutation_p.S82C|FBXO10_ENST00000541829.1_5'Flank|TOMM5_ENST00000544379.1_3'UTR|RP11-613M10.9_ENST00000540557.1_3'UTR|RP11-613M10.8_ENST00000544475.1_5'Flank	NM_001001790.2	NP_001001790.1	Q8N4H5	TOM5_HUMAN	translocase of outer mitochondrial membrane 5 homolog (yeast)	42					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)											AAGATAAATGGAGCTGAAAGA	0.328																																					p.P76A		Atlas-SNP	.											.	TOMM5	3	.	0			c.C226G						.						59.0	57.0	58.0					9																	37588927		1823	4081	5904	SO:0001583	missense	401505	exon2			TAAATGGAGCTGA	BC029423	CCDS43803.1, CCDS47967.1, CCDS47968.1	9p13.2	2008-08-21	2008-08-21	2008-08-21	ENSG00000175768	ENSG00000175768			31369	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 105"""	C9orf105		18331822	Standard	NM_001001790		Approved	bA613M10.3	uc011lql.2	Q8N4H5	OTTHUMG00000019923	ENST00000321301.6:c.124C>G	chr9.hg19:g.37588927G>C	ENSP00000313584:p.Pro42Ala	70.0	0.0		96.0	29.0	NM_001134485	B2DG07|F6S928|Q5JRT7	Missense_Mutation	SNP	ENST00000321301.6	hg19	CCDS43803.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.095999|4.095999	0.76870|0.76870	.|.	.|.	ENSG00000175768|ENSG00000175768	ENST00000377773;ENST00000321301|ENST00000401811	.|.	.|.	.|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.072023|.	0.53938|.	D|.	0.000043|.	T|T	0.74045|0.74045	0.3665|0.3665	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.998;1.0|.	D;D|.	0.87578|.	0.994;0.998|.	T|T	0.76413|0.76413	-0.2968|-0.2968	8|5	0.87932|0.87932	D|D	0|0	.|.	14.2857|14.2857	0.66245|0.66245	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	42;76|.	Q8N4H5;Q5JRT7|.	TOM5_HUMAN;.|.	A|C	76;42|82	.|.	ENSP00000439443:P55A|ENSP00000384411:S82C	P|S	-|-	1|2	0|0	TOMM5|TOMM5	37578927|37578927	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	6.993000|6.993000	0.76245|0.76245	2.833000|2.833000	0.97629|0.97629	0.555000|0.555000	0.69702|0.69702	CCA|TCC	.	.		0.328	TOMM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052468.2		
SFMBT2	57713	hgsc.bcm.edu	37	10	7318928	7318928	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr10:7318928A>T	ENST00000361972.4	-	7	886	c.796T>A	c.(796-798)Tct>Act	p.S266T	SFMBT2_ENST00000397167.1_Missense_Mutation_p.S266T	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	266					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TTCCATTCAGAGGCCATCTTC	0.398																																					p.S266T		Atlas-SNP	.											.	SFMBT2	209	.	0			c.T796A						.						143.0	136.0	139.0					10																	7318928		2203	4300	6503	SO:0001583	missense	57713	exon7			ATTCAGAGGCCAT	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.796T>A	chr10.hg19:g.7318928A>T	ENSP00000355109:p.Ser266Thr	69.0	0.0		73.0	11.0	NM_001029880	A7MD09|Q9HCF5	Missense_Mutation	SNP	ENST00000361972.4	hg19	CCDS31138.1	.	.	.	.	.	.	.	.	.	.	A	10.80	1.452028	0.26074	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.42513	0.97;0.97	5.83	4.68	0.58851	.	0.211412	0.51477	D	0.000090	T	0.34542	0.0901	L	0.56769	1.78	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12528	-1.0544	10	0.15066	T	0.55	.	7.8787	0.29610	0.6425:0.1223:0.0:0.2352	.	266	Q5VUG0	SMBT2_HUMAN	T	266	ENSP00000355109:S266T;ENSP00000380353:S266T	ENSP00000355109:S266T	S	-	1	0	SFMBT2	7358934	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	3.332000	0.52083	1.006000	0.39211	0.533000	0.62120	TCT	.	.		0.398	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046673.1	NM_001029880	
OTUD1	220213	hgsc.bcm.edu	37	10	23729363	23729363	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr10:23729363G>C	ENST00000376495.3	+	1	1166	c.977G>C	c.(976-978)aGc>aCc	p.S326T		NM_001145373.2	NP_001138845.1	Q5VV17	OTUD1_HUMAN	OTU deubiquitinase 1	326	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K63-linked deubiquitination (GO:0070536)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	5						CGAGCTGTCAGCAAGACGGTG	0.577																																					p.S326T		Atlas-SNP	.											.	OTUD1	9	.	0			c.G977C						.						43.0	48.0	46.0					10																	23729363		692	1591	2283	SO:0001583	missense	220213	exon1			CTGTCAGCAAGAC	AK096389	CCDS44366.1	10p12.31	2014-02-24	2014-02-24		ENSG00000165312	ENSG00000165312		"""OTU domain containing"""	27346	protein-coding gene	gene with protein product		612022	"""OTU domain containing 1"""	OTDC1		23827681	Standard	NM_001145373		Approved	DUBA7	uc001irr.2	Q5VV17	OTTHUMG00000017819	ENST00000376495.3:c.977G>C	chr10.hg19:g.23729363G>C	ENSP00000365678:p.Ser326Thr	74.0	0.0		78.0	5.0	NM_001145373		Missense_Mutation	SNP	ENST00000376495.3	hg19	CCDS44366.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919455	0.73098	.	.	ENSG00000165312	ENST00000376495	T	0.36699	1.24	4.54	4.54	0.55810	Ovarian tumour, otubain (2);	0.065026	0.64402	U	0.000010	T	0.50990	0.1648	M	0.64997	1.995	0.33815	D	0.628322	D	0.63880	0.993	P	0.54499	0.754	T	0.67998	-0.5525	10	0.66056	D	0.02	-6.0858	17.2801	0.87126	0.0:0.0:1.0:0.0	.	326	Q5VV17	OTUD1_HUMAN	T	326	ENSP00000365678:S326T	ENSP00000365678:S326T	S	+	2	0	OTUD1	23769369	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.999000	0.63934	2.049000	0.60858	0.655000	0.94253	AGC	.	.		0.577	OTUD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047215.1	XM_166659	
PRF1	5551	hgsc.bcm.edu	37	10	72357836	72357836	+	Silent	SNP	T	T	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr10:72357836T>G	ENST00000441259.1	-	3	1801	c.1641A>C	c.(1639-1641)ccA>ccC	p.P547P	PRF1_ENST00000373209.2_Silent_p.P547P	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	547					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						TCCGGTTTCCTGGAGGCTCCC	0.587			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.P547P		Atlas-SNP	.	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	PRF1	64	.	0			c.A1641C						.						50.0	53.0	52.0					10																	72357836		2203	4300	6503	SO:0001819	synonymous_variant	5551	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GTTTCCTGGAGGC	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1641A>C	chr10.hg19:g.72357836T>G		50.0	0.0		52.0	6.0	NM_001083116	B2R6X4|Q59F57|Q86WX7	Silent	SNP	ENST00000441259.1	hg19	CCDS7305.1																																																																																			.	.		0.587	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
SYNPO2L	79933	hgsc.bcm.edu	37	10	75407632	75407632	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr10:75407632C>T	ENST00000394810.2	-	4	1927	c.1778G>A	c.(1777-1779)cGc>cAc	p.R593H	SYNPO2L_ENST00000372873.4_Missense_Mutation_p.R369H	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	593	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					CGCCTCTGGGCGCGCAGAGGG	0.697																																					p.R593H		Atlas-SNP	.											.	SYNPO2L	118	.	0			c.G1778A						.						14.0	17.0	16.0					10																	75407632		2097	4222	6319	SO:0001583	missense	79933	exon4			TCTGGGCGCGCAG	AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.1778G>A	chr10.hg19:g.75407632C>T	ENSP00000378289:p.Arg593His	124.0	0.0		90.0	15.0	NM_001114133	A5PKV9|Q68A20	Missense_Mutation	SNP	ENST00000394810.2	hg19	CCDS44438.1	.	.	.	.	.	.	.	.	.	.	C	1.653	-0.513599	0.04200	.	.	ENSG00000166317	ENST00000372873;ENST00000394810	T;T	0.23348	1.91;2.24	5.02	0.816	0.18768	.	0.704670	0.13824	N	0.360217	T	0.14184	0.0343	N	0.22421	0.69	0.09310	N	1	B;B	0.13594	0.008;0.008	B;B	0.06405	0.001;0.002	T	0.19614	-1.0300	10	0.41790	T	0.15	-6.1817	5.0297	0.14404	0.1467:0.4438:0.0:0.4095	.	593;369	Q9H987;Q9H987-2	SYP2L_HUMAN;.	H	369;593	ENSP00000361964:R369H;ENSP00000378289:R593H	ENSP00000361964:R369H	R	-	2	0	SYNPO2L	75077638	0.001000	0.12720	0.355000	0.25773	0.010000	0.07245	-0.169000	0.09911	0.318000	0.23185	-0.272000	0.10252	CGC	.	.		0.697	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316562.2	NM_024875	
SORCS3	22986	hgsc.bcm.edu	37	10	107006989	107006989	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr10:107006989C>A	ENST00000369701.3	+	22	3232	c.3005C>A	c.(3004-3006)tCc>tAc	p.S1002Y	SORCS3_ENST00000369699.4_3'UTR	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	1002					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		TATTTCCAGTCCCAGCTTTTA	0.458																																					p.S1002Y	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.C3005A						.						102.0	93.0	96.0					10																	107006989		2203	4300	6503	SO:0001583	missense	22986	exon22			TCCAGTCCCAGCT	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.3005C>A	chr10.hg19:g.107006989C>A	ENSP00000358715:p.Ser1002Tyr	92.0	0.0		67.0	25.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	hg19	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635534	0.87760	.	.	ENSG00000156395	ENST00000369701	T	0.16457	2.34	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.45955	0.1368	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.29731	-1.0002	9	.	.	.	.	19.7426	0.96238	0.0:1.0:0.0:0.0	.	1002	Q9UPU3	SORC3_HUMAN	Y	1002	ENSP00000358715:S1002Y	.	S	+	2	0	SORCS3	106996979	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.252000	0.78309	2.741000	0.93983	0.650000	0.86243	TCC	.	.		0.458	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
FAM160B1	57700	hgsc.bcm.edu	37	10	116603573	116603573	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr10:116603573A>G	ENST00000369248.4	+	7	1225	c.890A>G	c.(889-891)aAg>aGg	p.K297R	FAM160B1_ENST00000369250.3_Missense_Mutation_p.K297R	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	297										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						GCGGCTGCAAAGTGCCTTACA	0.473																																					p.K297R		Atlas-SNP	.											.	FAM160B1	107	.	0			c.A890G						.						99.0	82.0	87.0					10																	116603573		2203	4300	6503	SO:0001583	missense	57700	exon7			CTGCAAAGTGCCT	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.890A>G	chr10.hg19:g.116603573A>G	ENSP00000358251:p.Lys297Arg	99.0	0.0		68.0	8.0	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	hg19	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.625866	0.66901	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.30981	1.51;1.51	5.39	3.07	0.35406	.	0.043310	0.85682	N	0.000000	T	0.30541	0.0768	L	0.50333	1.59	0.80722	D	1	P;P	0.49961	0.894;0.93	P;P	0.49301	0.606;0.53	T	0.09907	-1.0653	10	0.10111	T	0.7	-12.9582	9.3458	0.38107	0.855:0.0:0.145:0.0	.	297;297	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	R	297	ENSP00000358251:K297R;ENSP00000358253:K297R	ENSP00000358251:K297R	K	+	2	0	FAM160B1	116593563	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.199000	0.42715	0.371000	0.24564	0.533000	0.62120	AAG	.	.		0.473	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
KNDC1	85442	hgsc.bcm.edu	37	10	135009312	135009312	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr10:135009312C>A	ENST00000304613.3	+	10	1742	c.1721C>A	c.(1720-1722)gCt>gAt	p.A574D	KNDC1_ENST00000368572.2_Missense_Mutation_p.A574D|KNDC1_ENST00000368571.2_Missense_Mutation_p.A509D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	574	KIND 2. {ECO:0000255|PROSITE- ProRule:PRU00709}.				cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCGTCCGCGGCTGAGGCCATC	0.692																																					p.A574D		Atlas-SNP	.											.	KNDC1	155	.	0			c.C1721A						.						16.0	16.0	16.0					10																	135009312		2177	4275	6452	SO:0001583	missense	85442	exon10			CCGCGGCTGAGGC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1721C>A	chr10.hg19:g.135009312C>A	ENSP00000304437:p.Ala574Asp	98.0	0.0		106.0	20.0	NM_152643	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	hg19	CCDS7674.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802372	0.50315	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.33216	1.42;1.42;1.42	4.84	4.84	0.62591	KIND (2);	0.393157	0.22150	N	0.063936	T	0.50154	0.1599	L	0.59436	1.845	0.51767	D	0.999938	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.989	T	0.32241	-0.9914	10	0.22109	T	0.4	-18.7477	15.8121	0.78573	0.0:1.0:0.0:0.0	.	509;574	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	D	574;574;509	ENSP00000304437:A574D;ENSP00000357561:A574D;ENSP00000357560:A509D	ENSP00000304437:A574D	A	+	2	0	KNDC1	134859302	0.065000	0.20965	0.151000	0.22473	0.026000	0.11368	0.949000	0.29109	2.433000	0.82419	0.306000	0.20318	GCT	.	.		0.692	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
CDHR5	53841	hgsc.bcm.edu	37	11	621353	621353	+	Silent	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:621353G>A	ENST00000358353.3	-	7	932	c.610C>T	c.(610-612)Ctg>Ttg	p.L204L	CDHR5_ENST00000397542.2_Silent_p.L204L|CDHR5_ENST00000529337.1_5'Flank|CDHR5_ENST00000349570.7_Silent_p.L204L			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	204	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						ACCCGCACCAGCAGCCAGAAG	0.662																																					p.L204L		Atlas-SNP	.											.	CDHR5	77	.	0			c.C610T						.						39.0	43.0	42.0					11																	621353		2203	4300	6503	SO:0001819	synonymous_variant	53841	exon6			GCACCAGCAGCCA	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.610C>T	chr11.hg19:g.621353G>A		70.0	0.0		77.0	20.0	NM_031264	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Silent	SNP	ENST00000358353.3	hg19	CCDS7707.1																																																																																			.	.		0.662	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255023.2	NM_021924	
PRDM11	56981	hgsc.bcm.edu	37	11	45246411	45246411	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:45246411G>A	ENST00000530656.1	+	7	1488	c.1488G>A	c.(1486-1488)atG>atA	p.M496I	CTD-2560E9.3_ENST00000527450.1_RNA|PRDM11_ENST00000263765.4_Missense_Mutation_p.M496I|PRDM11_ENST00000528980.1_Intron|PRDM11_ENST00000424263.2_Missense_Mutation_p.M462I			Q9NQV5	PRD11_HUMAN	PR domain containing 11	496							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						TGGTTTGGATGAGATTATTGT	0.547																																					p.M462I	NSCLC(118;1511 1736 6472 36603 43224)	Atlas-SNP	.											.	PRDM11	53	.	0			c.G1386A						.						55.0	58.0	57.0					11																	45246411		2203	4299	6502	SO:0001583	missense	56981	exon7			TTGGATGAGATTA	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.1488G>A	chr11.hg19:g.45246411G>A	ENSP00000435976:p.Met496Ile	37.0	0.0		30.0	11.0	NM_001256696	Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	hg19		.	.	.	.	.	.	.	.	.	.	G	2.177	-0.388591	0.04932	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000424263	T;T;T	0.20332	2.08;2.08;2.08	5.45	3.58	0.41010	.	0.547731	0.17171	N	0.184296	T	0.10723	0.0262	N	0.14661	0.345	0.09310	N	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.16041	-1.0416	10	0.72032	D	0.01	-14.0673	3.2445	0.06792	0.2802:0.0:0.5313:0.1885	.	496	Q9NQV5	PRD11_HUMAN	I	496;496;462	ENSP00000263765:M496I;ENSP00000435976:M496I;ENSP00000394314:M462I	ENSP00000263765:M496I	M	+	3	0	PRDM11	45202987	0.998000	0.40836	0.830000	0.32933	0.085000	0.17905	1.510000	0.35790	1.300000	0.44818	-0.140000	0.14226	ATG	.	.		0.547	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229	
PTPRJ	5795	hgsc.bcm.edu	37	11	48142579	48142579	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:48142579A>G	ENST00000418331.2	+	4	729	c.377A>G	c.(376-378)aAa>aGa	p.K126R	PTPRJ_ENST00000440289.2_Missense_Mutation_p.K126R|PTPRJ_ENST00000526550.1_3'UTR	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	126	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TTTGACATTAAAGCTGTTTCC	0.338																																					p.K126R		Atlas-SNP	.											.	PTPRJ	225	.	0			c.A377G						.						66.0	60.0	62.0					11																	48142579		2201	4298	6499	SO:0001583	missense	5795	exon4			ACATTAAAGCTGT	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.377A>G	chr11.hg19:g.48142579A>G	ENSP00000400010:p.Lys126Arg	209.0	0.0		173.0	71.0	NM_001098503	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	hg19	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	A	12.57	1.977500	0.34848	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289;ENST00000534219	T;T;T	0.57436	0.4;0.4;0.4	5.41	5.41	0.78517	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42359	0.1199	L	0.28115	0.83	0.22737	N	0.998798	P;P	0.36086	0.503;0.536	B;B	0.37144	0.242;0.145	T	0.39165	-0.9627	9	0.51188	T	0.08	.	11.8428	0.52364	1.0:0.0:0.0:0.0	.	126;126	Q12913;Q6P4H4	PTPRJ_HUMAN;.	R	126;126;126;47	ENSP00000400010:K126R;ENSP00000409733:K126R;ENSP00000432686:K47R	ENSP00000278456:K126R	K	+	2	0	PTPRJ	48099155	0.654000	0.27367	0.068000	0.19968	0.034000	0.12701	2.142000	0.42177	2.064000	0.61679	0.482000	0.46254	AAA	.	.		0.338	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
PRPF19	27339	hgsc.bcm.edu	37	11	60670109	60670109	+	Silent	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:60670109T>C	ENST00000227524.4	-	5	613	c.408A>G	c.(406-408)ccA>ccG	p.P136P		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						GGCCAGCCTGTGGTTTCAGGG	0.552																																					p.P136P		Atlas-SNP	.											.	PRPF19	62	.	0			c.A408G						.						81.0	78.0	79.0					11																	60670109		2203	4299	6502	SO:0001819	synonymous_variant	27339	exon5			AGCCTGTGGTTTC	BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.408A>G	chr11.hg19:g.60670109T>C		161.0	0.0		162.0	23.0	NM_014502		Silent	SNP	ENST00000227524.4	hg19	CCDS7995.1																																																																																			.	.		0.552	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396334.1	NM_014502	
CDC42BPG	55561	hgsc.bcm.edu	37	11	64600763	64600763	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:64600763T>C	ENST00000342711.5	-	24	2670	c.2671A>G	c.(2671-2673)Aag>Gag	p.K891E	CDC42BPG_ENST00000491280.1_5'Flank	NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CGGAGACACTTGGTCGGGGAT	0.697																																					p.K891E		Atlas-SNP	.											.	CDC42BPG	101	.	0			c.A2671G						.						17.0	17.0	17.0					11																	64600763		2004	3915	5919	SO:0001583	missense	55561	exon24			GACACTTGGTCGG	AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.2671A>G	chr11.hg19:g.64600763T>C	ENSP00000345133:p.Lys891Glu	110.0	0.0		91.0	30.0	NM_017525		Missense_Mutation	SNP	ENST00000342711.5	hg19	CCDS31601.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.186733	0.78789	.	.	ENSG00000171219	ENST00000342711	D	0.93307	-3.2	5.3	4.13	0.48395	Protein kinase C-like, phorbol ester/diacylglycerol binding (4);	0.147172	0.31821	N	0.007020	D	0.93759	0.8005	M	0.75447	2.3	0.34223	D	0.675595	D	0.53619	0.961	P	0.49752	0.621	D	0.95542	0.8613	10	0.87932	D	0	.	10.7102	0.45980	0.0:0.0:0.1603:0.8397	.	891	Q6DT37	MRCKG_HUMAN	E	891	ENSP00000345133:K891E	ENSP00000345133:K891E	K	-	1	0	CDC42BPG	64357339	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	0.922000	0.28734	0.919000	0.36945	0.454000	0.30748	AAG	.	.		0.697	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105352.4	XM_290516	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73068372	73068372	+	Splice_Site	SNP	G	G	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:73068372G>C	ENST00000263674.3	+	9	4437	c.4087G>C	c.(4087-4089)Ggg>Cgg	p.G1363R	AP002761.1_ENST00000582555.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1363					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CATCATCAAAGGTGGGTTTGA	0.577																																					p.G1363R		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.G4087C						.						41.0	43.0	43.0					11																	73068372		2200	4293	6493	SO:0001630	splice_region_variant	9828	exon9			ATCAAAGGTGGGT	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4087+1G>C	chr11.hg19:g.73068372G>C		97.0	0.0		77.0	10.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587309	0.66105	.	.	ENSG00000110237	ENST00000263674	T	0.31247	1.5	5.44	5.44	0.79542	.	0.053182	0.85682	D	0.000000	T	0.50854	0.1640	L	0.50333	1.59	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.48958	-0.8988	10	0.62326	D	0.03	-26.664	18.2609	0.90035	0.0:0.0:1.0:0.0	.	1363	Q96PE2	ARHGH_HUMAN	R	1363	ENSP00000263674:G1363R	ENSP00000263674:G1363R	G	+	1	0	ARHGEF17	72746020	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	7.077000	0.76814	2.559000	0.86315	0.591000	0.81541	GGG	.	.		0.577	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	Missense_Mutation
DYNC2H1	79659	hgsc.bcm.edu	37	11	103060402	103060402	+	Splice_Site	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:103060402T>C	ENST00000375735.2	+	45	7438	c.7294T>C	c.(7294-7296)Tac>Cac	p.Y2432H	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Splice_Site_p.Y2432H	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	2432	AAA 3. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTTTTTTAGTTACCCAGAAAG	0.313																																					p.Y2432H		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.T7294C						.						62.0	61.0	61.0					11																	103060402		1804	4067	5871	SO:0001630	splice_region_variant	79659	exon45			TTTAGTTACCCAG	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.7293-1T>C	chr11.hg19:g.103060402T>C		71.0	0.0		83.0	8.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.379663	0.61845	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.36878	1.23;1.23	5.46	4.33	0.51752	.	.	.	.	.	T	0.61148	0.2324	M	0.86268	2.805	0.49483	D	0.999799	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.987	T	0.63189	-0.6693	9	0.41790	T	0.15	.	11.657	0.51324	0.0:0.07:0.0:0.93	.	2432;2432	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	H	2432	ENSP00000364887:Y2432H;ENSP00000381167:Y2432H	ENSP00000364887:Y2432H	Y	+	1	0	DYNC2H1	102565612	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	4.666000	0.61554	1.009000	0.39289	-0.274000	0.10170	TAC	.	.		0.313	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	Missense_Mutation
KMT2A	4297	hgsc.bcm.edu	37	11	118376851	118376851	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:118376851C>T	ENST00000389506.5	+	27	10235	c.10235C>T	c.(10234-10236)tCa>tTa	p.S3412L	KMT2A_ENST00000534358.1_Missense_Mutation_p.S3415L|KMT2A_ENST00000354520.4_Missense_Mutation_p.S3374L			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3412					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CTGGGGACATCACAGACCCCC	0.532																																					p.S3415L		Atlas-SNP	.											.	MLL	548	.	0			c.C10244T						.						92.0	94.0	93.0					11																	118376851		2200	4295	6495	SO:0001583	missense	4297	exon27			GGACATCACAGAC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.10235C>T	chr11.hg19:g.118376851C>T	ENSP00000374157:p.Ser3412Leu	104.0	0.0		87.0	19.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	14.09	2.433053	0.43224	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.84660	-1.87;-1.88;-1.83	5.87	4.96	0.65561	.	0.152354	0.47093	N	0.000250	T	0.81370	0.4808	L	0.46157	1.445	0.54753	D	0.999987	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.76737	-0.2849	10	0.42905	T	0.14	.	15.0128	0.71562	0.0:0.9319:0.0:0.0681	.	3415;3412	E9PQG7;Q03164	.;MLL1_HUMAN	L	3415;3412;3374;2322	ENSP00000436786:S3415L;ENSP00000374157:S3412L;ENSP00000346516:S3374L	ENSP00000346516:S3374L	S	+	2	0	MLL	117882061	0.998000	0.40836	0.495000	0.27527	0.997000	0.91878	4.640000	0.61368	1.493000	0.48517	0.591000	0.81541	TCA	.	.		0.532	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
DDX6	1656	hgsc.bcm.edu	37	11	118650350	118650350	+	Silent	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr11:118650350A>T	ENST00000526070.2	-	4	720	c.360T>A	c.(358-360)tcT>tcA	p.S120S	DDX6_ENST00000534980.1_Silent_p.S120S|DDX6_ENST00000264018.4_Silent_p.S120S	NM_001257191.1	NP_001244120.1	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 6	120					cytoplasmic mRNA processing body assembly (GO:0033962)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	13	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		CCTGAATAGGAGATGGCTTTT	0.373			T	IGH@	B-NHL																																p.S120S		Atlas-SNP	.		Dom	yes		11	11q23.3	1656	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6		L	.	DDX6	64	.	0			c.T360A						.						79.0	71.0	73.0					11																	118650350		1842	4091	5933	SO:0001819	synonymous_variant	1656	exon4			AATAGGAGATGGC	D17532	CCDS44751.1	11q23.3	2012-02-23	2012-02-23		ENSG00000110367	ENSG00000110367		"""DEAD-boxes"""	2747	protein-coding gene	gene with protein product		600326	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 6"""	HLR2		1579499, 11839790	Standard	NM_004397		Approved	RCK	uc001pub.2	P26196	OTTHUMG00000166411	ENST00000526070.2:c.360T>A	chr11.hg19:g.118650350A>T		295.0	0.0		272.0	49.0	NM_004397	Q5D048	Silent	SNP	ENST00000526070.2	hg19	CCDS44751.1																																																																																			.	.		0.373	DDX6-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000389647.2	NM_004397	
BICD1	636	hgsc.bcm.edu	37	12	32491901	32491901	+	Missense_Mutation	SNP	G	G	T	rs141754177	byFrequency	TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr12:32491901G>T	ENST00000281474.5	+	8	2855	c.2752G>T	c.(2752-2754)Gtg>Ttg	p.V918L	BICD1_ENST00000548411.1_Intron	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	918					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			AAGGTTAACCGTGGCTCCACC	0.507																																					p.V918L		Atlas-SNP	.											.	BICD1	89	.	0			c.G2752T						.						51.0	52.0	52.0					12																	32491901		2203	4300	6503	SO:0001583	missense	636	exon8			TTAACCGTGGCTC	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2752G>T	chr12.hg19:g.32491901G>T	ENSP00000281474:p.Val918Leu	45.0	0.0		43.0	24.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	hg19	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005308	0.74932	.	.	ENSG00000151746	ENST00000281474	T	0.50277	0.75	5.73	5.73	0.89815	.	0.000000	0.41500	D	0.000866	T	0.48642	0.1511	N	0.08118	0	0.80722	D	1	P	0.50066	0.931	P	0.60286	0.872	T	0.58702	-0.7590	10	0.87932	D	0	.	18.0686	0.89398	0.0:0.0:1.0:0.0	.	918	Q96G01	BICD1_HUMAN	L	918	ENSP00000281474:V918L	ENSP00000281474:V918L	V	+	1	0	BICD1	32383168	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.808000	0.69165	2.720000	0.93068	0.591000	0.81541	GTG	.	G|1.000;A|0.000		0.507	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
KMT2D	8085	hgsc.bcm.edu	37	12	49433342	49433342	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr12:49433342T>A	ENST00000301067.7	-	32	8104	c.8105A>T	c.(8104-8106)cAg>cTg	p.Q2702L	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2702					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TTCCTTCTCCTGCCGCAGGGT	0.597																																					p.Q2702L		Atlas-SNP	.											.	MLL2	1173	.	0			c.A8105T						.						15.0	17.0	16.0					12																	49433342		2009	4184	6193	SO:0001583	missense	8085	exon32			TTCTCCTGCCGCA	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8105A>T	chr12.hg19:g.49433342T>A	ENSP00000301067:p.Gln2702Leu	43.0	0.0		21.0	9.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	T	16.44	3.124905	0.56613	.	.	ENSG00000167548	ENST00000301067	D	0.94576	-3.46	5.53	5.53	0.82687	.	0.000000	0.36409	N	0.002604	D	0.95427	0.8515	L	0.38175	1.15	0.52099	D	0.999943	D	0.76494	0.999	D	0.78314	0.991	D	0.96070	0.9045	10	0.87932	D	0	.	14.9582	0.71135	0.0:0.0:0.0:1.0	.	2702	O14686	MLL2_HUMAN	L	2702	ENSP00000301067:Q2702L	ENSP00000301067:Q2702L	Q	-	2	0	MLL2	47719609	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.125000	0.77193	2.236000	0.73375	0.496000	0.49642	CAG	.	.		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
CEP290	80184	hgsc.bcm.edu	37	12	88534999	88534999	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr12:88534999A>T	ENST00000552810.1	-	2	429	c.86T>A	c.(85-87)tTg>tAg	p.L29*	CEP290_ENST00000309041.7_Nonsense_Mutation_p.L29*|TMTC3_ENST00000266712.6_5'Flank	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	29					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						TAAGGAAATCAATAAATTATC	0.294																																					p.L29X		Atlas-SNP	.											.	CEP290	195	.	0			c.T86A						.						96.0	84.0	87.0					12																	88534999		1812	4065	5877	SO:0001587	stop_gained	80184	exon2			GAAATCAATAAAT	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.86T>A	chr12.hg19:g.88534999A>T	ENSP00000448012:p.Leu29*	346.0	0.0		326.0	70.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Nonsense_Mutation	SNP	ENST00000552810.1	hg19	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	A	37	5.993412	0.97184	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000550962	.	.	.	6.07	6.07	0.98685	.	0.250591	0.32952	N	0.005455	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6817	0.51461	0.8679:0.0:0.0:0.1321	.	.	.	.	X	29	.	ENSP00000308021:L29X	L	-	2	0	CEP290	87059130	0.996000	0.38824	1.000000	0.80357	0.995000	0.86356	4.041000	0.57339	2.330000	0.79161	0.477000	0.44152	TTG	.	.		0.294	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
ASCL4	121549	hgsc.bcm.edu	37	12	108168997	108168997	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr12:108168997T>C	ENST00000342331.4	+	1	836	c.5T>C	c.(4-6)aTg>aCg	p.M2T		NM_203436.2	NP_982260.2	Q6XD76	ASCL4_HUMAN	achaete-scute family bHLH transcription factor 4	1					regulation of transcription from RNA polymerase II promoter (GO:0006357)|skin development (GO:0043588)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	13						CGGCAAATGATGGAGACGCGT	0.592																																					p.M2T	GBM(170;776 3695 11650)	Atlas-SNP	.											.	ASCL4	28	.	0			c.T5C						.						74.0	82.0	79.0					12																	108168997		2203	4300	6503	SO:0001583	missense	121549	exon1			AAATGATGGAGAC	AY238895	CCDS31894.2	12q24.11	2013-10-17	2013-10-17		ENSG00000187855	ENSG00000187855		"""Basic helix-loop-helix proteins"""	24311	protein-coding gene	gene with protein product		609155	"""achaete-scute complex-like 4 (Drosophila)"", ""achaete-scute complex homolog 4 (Drosophila)"""				Standard	NM_203436		Approved	HASH4, bHLHa44	uc001tmr.3	Q6XD76	OTTHUMG00000156964	ENST00000342331.4:c.5T>C	chr12.hg19:g.108168997T>C	ENSP00000345420:p.Met2Thr	169.0	0.0		150.0	64.0	NM_203436	Q7RTS2	Missense_Mutation	SNP	ENST00000342331.4	hg19	CCDS31894.2	.	.	.	.	.	.	.	.	.	.	T	13.88	2.369072	0.42003	.	.	ENSG00000187855	ENST00000342331	D	0.96856	-4.15	4.74	4.74	0.60224	.	0.091646	0.48286	D	0.000197	D	0.96479	0.8851	.	.	.	0.31333	N	0.684587	D	0.58620	0.983	P	0.53401	0.725	D	0.96125	0.9088	9	0.72032	D	0.01	-11.7909	12.7764	0.57451	0.0:0.0:0.0:1.0	.	1	Q6XD76	ASCL4_HUMAN	T	2	ENSP00000345420:M2T	ENSP00000345420:M2T	M	+	2	0	ASCL4	106693127	1.000000	0.71417	0.996000	0.52242	0.053000	0.15095	4.085000	0.57657	1.906000	0.55180	0.397000	0.26171	ATG	.	.		0.592	ASCL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346845.1	NM_203436	
NCOR2	9612	hgsc.bcm.edu	37	12	124821697	124821697	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr12:124821697G>A	ENST00000405201.1	-	38	5717	c.5717C>T	c.(5716-5718)cCg>cTg	p.P1906L	NCOR2_ENST00000356219.3_Missense_Mutation_p.P1913L|NCOR2_ENST00000404121.2_Missense_Mutation_p.P1467L|NCOR2_ENST00000397355.1_Missense_Mutation_p.P1897L|NCOR2_ENST00000404621.1_Missense_Mutation_p.P1896L|NCOR2_ENST00000429285.2_Missense_Mutation_p.P1896L			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1917					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TGTGGCAGCCGGGCGAACGGG	0.672																																					p.P1906L		Atlas-SNP	.											.	NCOR2	475	.	0			c.C5717T						.						11.0	16.0	15.0					12																	124821697		1948	3998	5946	SO:0001583	missense	9612	exon40			GCAGCCGGGCGAA	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5717C>T	chr12.hg19:g.124821697G>A	ENSP00000384018:p.Pro1906Leu	158.0	0.0		112.0	45.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	hg19	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	g	11.13	1.548590	0.27652	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285	T;T;T;T;T;T	0.16457	2.34;2.6;2.34;2.6;2.34;2.6	4.36	3.46	0.39613	.	0.534882	0.16106	U	0.229337	T	0.10380	0.0254	N	0.14661	0.345	0.46044	D	0.99883	B;B;B	0.27068	0.167;0.064;0.038	B;B;B	0.17098	0.011;0.017;0.008	T	0.12604	-1.0541	10	0.44086	T	0.13	-13.2026	11.9482	0.52940	0.0856:0.0:0.9144:0.0	.	1897;1906;1917	C9J239;C9JFD3;Q9Y618	.;.;NCOR2_HUMAN	L	1906;1896;1913;1897;1905;1467;1896	ENSP00000384018:P1906L;ENSP00000384202:P1896L;ENSP00000348551:P1913L;ENSP00000380513:P1897L;ENSP00000385618:P1467L;ENSP00000400281:P1896L	ENSP00000348551:P1913L	P	-	2	0	NCOR2	123387650	1.000000	0.71417	0.776000	0.31678	0.799000	0.45148	5.844000	0.69430	0.810000	0.34279	0.556000	0.70494	CCG	.	.		0.672	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
ATP8A2	51761	hgsc.bcm.edu	37	13	26152991	26152991	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr13:26152991A>T	ENST00000381655.2	+	21	1963	c.1821A>T	c.(1819-1821)aaA>aaT	p.K607N	ATP8A2_ENST00000255283.8_Missense_Mutation_p.K567N|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	567					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AAGACTCAAAATATATGGAGG	0.388																																					p.K607N		Atlas-SNP	.											.	ATP8A2	181	.	0			c.A1821T						.						127.0	120.0	122.0					13																	26152991		1853	4099	5952	SO:0001583	missense	51761	exon21			CTCAAAATATATG	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1821A>T	chr13.hg19:g.26152991A>T	ENSP00000371070:p.Lys607Asn	67.0	0.0		66.0	28.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	hg19	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	A	13.54	2.266536	0.40095	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.70399	-0.48;-0.48	5.61	-2.11	0.07187	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.159237	0.56097	D	0.000025	T	0.57373	0.2049	N	0.25789	0.76	0.44395	D	0.997304	B;B;B	0.29805	0.195;0.257;0.195	B;B;B	0.35770	0.21;0.189;0.21	T	0.51012	-0.8759	10	0.40728	T	0.16	.	14.3082	0.66397	0.204:0.0:0.796:0.0	.	567;387;567	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	N	607;567;387	ENSP00000371070:K607N;ENSP00000255283:K567N	ENSP00000255283:K567N	K	+	3	2	ATP8A2	25050991	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	1.288000	0.33296	-0.156000	0.11079	-0.250000	0.11733	AAA	.	.		0.388	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
FRY	10129	hgsc.bcm.edu	37	13	32776494	32776494	+	Splice_Site	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr13:32776494T>C	ENST00000380250.3	+	31	4344	c.3848T>C	c.(3847-3849)aTc>aCc	p.I1283T		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	1283						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TCTTTATAGATCCTTGAAGCA	0.383																																					p.I1283T		Atlas-SNP	.											.	FRY	312	.	0			c.T3848C						.						71.0	71.0	71.0					13																	32776494		1828	4077	5905	SO:0001630	splice_region_variant	10129	exon31			TATAGATCCTTGA	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.3847-1T>C	chr13.hg19:g.32776494T>C		168.0	0.0		139.0	63.0	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	hg19	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084492	0.76642	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.63913	-0.07	5.24	5.24	0.73138	.	0.116735	0.64402	D	0.000020	T	0.57844	0.2081	L	0.45137	1.4	0.80722	D	1	B	0.33940	0.433	B	0.39339	0.297	T	0.54009	-0.8357	10	0.19590	T	0.45	.	15.141	0.72609	0.0:0.0:0.0:1.0	.	1283	Q5TBA9	FRY_HUMAN	T	1283;122	ENSP00000369600:I1283T	ENSP00000369600:I1283T	I	+	2	0	FRY	31674494	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.640000	0.83355	1.996000	0.58369	0.374000	0.22700	ATC	.	.		0.383	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	Missense_Mutation
THSD1	55901	hgsc.bcm.edu	37	13	52971697	52971697	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr13:52971697T>C	ENST00000258613.4	-	3	869	c.691A>G	c.(691-693)Aca>Gca	p.T231A	RNY4P24_ENST00000362735.1_RNA|THSD1_ENST00000544466.1_Intron|THSD1_ENST00000349258.4_Missense_Mutation_p.T231A	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	231					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		ATGGGTCCTGTGGAGGTAATG	0.557																																					p.T231A		Atlas-SNP	.											.	THSD1	89	.	0			c.A691G						.						65.0	59.0	61.0					13																	52971697		2203	4300	6503	SO:0001583	missense	55901	exon3			GTCCTGTGGAGGT	AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.691A>G	chr13.hg19:g.52971697T>C	ENSP00000258613:p.Thr231Ala	133.0	0.0		155.0	51.0	NM_018676	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	ENST00000258613.4	hg19	CCDS9432.1	.	.	.	.	.	.	.	.	.	.	T	11.42	1.632592	0.29068	.	.	ENSG00000136114	ENST00000349258;ENST00000258613;ENST00000378095	T;T	0.17213	2.29;2.47	5.48	1.13	0.20643	.	0.626866	0.15887	N	0.239723	T	0.16514	0.0397	M	0.68317	2.08	0.09310	N	1	P;B	0.37663	0.604;0.021	B;B	0.38264	0.269;0.012	T	0.12091	-1.0561	10	0.40728	T	0.16	-1.8223	4.0599	0.09834	0.1457:0.2091:0.0:0.6452	.	231;231	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	A	231	ENSP00000340650:T231A;ENSP00000258613:T231A	ENSP00000258613:T231A	T	-	1	0	THSD1	51869698	0.000000	0.05858	0.001000	0.08648	0.980000	0.70556	0.482000	0.22276	0.272000	0.22027	0.459000	0.35465	ACA	.	.		0.557	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045058.3		
SYNE2	23224	hgsc.bcm.edu	37	14	64494342	64494342	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr14:64494342T>C	ENST00000344113.4	+	43	6757	c.6545T>C	c.(6544-6546)tTa>tCa	p.L2182S	SYNE2_ENST00000358025.3_Missense_Mutation_p.L2182S|SYNE2_ENST00000554584.1_Missense_Mutation_p.L2182S|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2182					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAAGCTCAGTTAAAGATTTAT	0.383																																					p.L2182S		Atlas-SNP	.											.	SYNE2	577	.	0			c.T6545C						.						98.0	95.0	96.0					14																	64494342		1817	4079	5896	SO:0001583	missense	23224	exon43			CTCAGTTAAAGAT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6545T>C	chr14.hg19:g.64494342T>C	ENSP00000341781:p.Leu2182Ser	309.0	0.0		262.0	53.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.730511	0.48939	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.50001	0.76;0.76;0.76	5.48	5.48	0.80851	.	0.000000	0.40818	N	0.001010	T	0.57036	0.2026	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.976;0.99	T	0.61402	-0.7070	10	0.87932	D	0	.	14.1357	0.65287	0.0:0.0:0.0:1.0	.	2182;2182	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	S	2182	ENSP00000350719:L2182S;ENSP00000341781:L2182S;ENSP00000452570:L2182S	ENSP00000261678:L2182S	L	+	2	0	SYNE2	63564095	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	4.896000	0.63222	2.081000	0.62600	0.482000	0.46254	TTA	.	.		0.383	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102446137	102446137	+	Silent	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr14:102446137T>C	ENST00000360184.4	+	4	764	c.600T>C	c.(598-600)atT>atC	p.I200I		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	200	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGCAAAATATTGAAATTCCGG	0.403																																					p.I200I		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.T600C						.						124.0	131.0	129.0					14																	102446137		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon4			AAATATTGAAATT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.600T>C	chr14.hg19:g.102446137T>C		173.0	0.0		152.0	26.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	hg19	CCDS9966.1																																																																																			.	.		0.403	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
UNC13C	440279	hgsc.bcm.edu	37	15	54305889	54305889	+	Silent	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr15:54305889A>G	ENST00000260323.11	+	1	789	c.789A>G	c.(787-789)ctA>ctG	p.L263L	UNC13C_ENST00000537900.1_Silent_p.L263L|UNC13C_ENST00000545554.1_Silent_p.L263L	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	263					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTTCTGAACTACGAGGGCACG	0.453																																					p.L263L		Atlas-SNP	.											.	UNC13C	674	.	0			c.A789G						.						87.0	85.0	86.0					15																	54305889		1972	4161	6133	SO:0001819	synonymous_variant	440279	exon1			TGAACTACGAGGG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.789A>G	chr15.hg19:g.54305889A>G		86.0	0.0		55.0	20.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	hg19	CCDS45264.1																																																																																			.	.		0.453	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
MRPL46	26589	hgsc.bcm.edu	37	15	89003046	89003046	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr15:89003046T>C	ENST00000312475.4	-	4	679	c.638A>G	c.(637-639)tAc>tGc	p.Y213C	MRPL46_ENST00000559538.1_5'UTR	NM_022163.3	NP_071446.2	Q9H2W6	RM46_HUMAN	mitochondrial ribosomal protein L46	213						mitochondrion (GO:0005739)|ribosome (GO:0005840)	hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)	5	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			CTTGAATGTGTAGTGCCCACA	0.473																																					p.Y213C		Atlas-SNP	.											.	MRPL46	13	.	0			c.A638G						.						81.0	77.0	79.0					15																	89003046		2201	4299	6500	SO:0001583	missense	26589	exon4			AATGTGTAGTGCC	AF210056	CCDS10341.1	15q25.3	2012-10-08	2001-12-10	2001-12-14	ENSG00000259494	ENSG00000259494		"""Mitochondrial ribosomal proteins / large subunits"""	1192	protein-coding gene	gene with protein product		611851	"""chromosome 15 open reading frame 4"""	C15orf4		11761714, 11551941	Standard	NM_022163		Approved	LIECG2, P2ECSL	uc002bmj.2	Q9H2W6	OTTHUMG00000148683	ENST00000312475.4:c.638A>G	chr15.hg19:g.89003046T>C	ENSP00000312311:p.Tyr213Cys	81.0	0.0		83.0	20.0	NM_022163	B2RD75|Q9HBU8	Missense_Mutation	SNP	ENST00000312475.4	hg19	CCDS10341.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.779233	0.49891	.	.	ENSG00000173867	ENST00000312475	T	0.54279	0.58	6.17	5.04	0.67666	NUDIX hydrolase domain (1);	0.000000	0.85682	D	0.000000	T	0.76090	0.3939	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79617	-0.1729	10	0.56958	D	0.05	.	12.1762	0.54186	0.128:0.0:0.0:0.872	.	213	Q9H2W6	RM46_HUMAN	C	213	ENSP00000312311:Y213C	ENSP00000312311:Y213C	Y	-	2	0	MRPL46	86804050	1.000000	0.71417	1.000000	0.80357	0.149000	0.21700	7.572000	0.82409	1.129000	0.42072	-0.336000	0.08194	TAC	.	.		0.473	MRPL46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309073.1	NM_022163	
GSPT1	2935	hgsc.bcm.edu	37	16	11991860	11991860	+	5'UTR	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr16:11991860A>G	ENST00000420576.2	-	0	73				RP11-166B2.8_ENST00000574364.1_RNA|GSPT1_ENST00000439887.2_Silent_p.L129L|GSPT1_ENST00000563468.1_5'Flank|GSPT1_ENST00000434724.2_Silent_p.L129L	NM_001130007.1	NP_001123479.1	P15170	ERF3A_HUMAN	G1 to S phase transition 1						G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						CCTTCACACAATGACTGTTCC	0.313																																					p.L129L		Atlas-SNP	.											.	GSPT1	71	.	0			c.T385C						.						83.0	68.0	73.0					16																	11991860		1560	3549	5109	SO:0001623	5_prime_UTR_variant	2935	exon2			CACACAATGACTG	BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000420576.2:c.-30T>C	chr16.hg19:g.11991860A>G		135.0	0.0		126.0	35.0	NM_001130006	J3KQG6|Q96GF2	Silent	SNP	ENST00000420576.2	hg19	CCDS45414.1																																																																																			.	.		0.313	GSPT1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421514.1	NM_002094	
ACSM2A	123876	hgsc.bcm.edu	37	16	20489989	20489989	+	Missense_Mutation	SNP	C	C	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr16:20489989C>G	ENST00000573854.1	+	10	1385	c.1271C>G	c.(1270-1272)tCt>tGt	p.S424C	ACSM2A_ENST00000575690.1_Missense_Mutation_p.S424C|ACSM2A_ENST00000219054.6_Missense_Mutation_p.S424C|ACSM2A_ENST00000536134.1_Missense_Mutation_p.S196C|ACSM2A_ENST00000417235.2_Missense_Mutation_p.S345C|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000396104.2_Missense_Mutation_p.S424C	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	424					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						GGCATCTTCTCTGGCTATGTG	0.517																																					p.S424C		Atlas-SNP	.											.	ACSM2A	120	.	0			c.C1271G						.						137.0	108.0	118.0					16																	20489989		2203	4300	6503	SO:0001583	missense	123876	exon11			TCTTCTCTGGCTA	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1271C>G	chr16.hg19:g.20489989C>G	ENSP00000459451:p.Ser424Cys	87.0	0.0		73.0	23.0	NM_001010845	B3KTT9|O75202	Missense_Mutation	SNP	ENST00000573854.1	hg19	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	C	6.284	0.420551	0.11928	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	3.33	1.26	0.21427	AMP-dependent synthetase/ligase (1);	0.000000	0.49916	D	0.000139	T	0.34890	0.0913	L	0.53249	1.67	0.80722	D	1	B;B	0.20368	0.007;0.044	B;B	0.25506	0.011;0.061	T	0.12167	-1.0558	10	0.54805	T	0.06	-12.7384	6.8245	0.23874	0.0:0.7217:0.1754:0.1029	.	345;424	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	C	345;424;196;424	ENSP00000392169:S345C;ENSP00000219054:S424C;ENSP00000445082:S196C;ENSP00000379411:S424C	ENSP00000219054:S424C	S	+	2	0	ACSM2A	20397490	0.000000	0.05858	0.973000	0.42090	0.384000	0.30261	0.306000	0.19279	0.082000	0.17018	-1.043000	0.02367	TCT	.	.		0.517	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	
VPS4A	27183	hgsc.bcm.edu	37	16	69353433	69353433	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr16:69353433G>T	ENST00000254950.11	+	6	763	c.607G>T	c.(607-609)Ggg>Tgg	p.G203W	COG8_ENST00000564419.1_5'Flank|RP11-343C2.11_ENST00000570054.2_Missense_Mutation_p.G227W	NM_013245.2	NP_037377.1			vacuolar protein sorting 4 homolog A (S. cerevisiae)											NS(1)|central_nervous_system(1)|large_intestine(2)|lung(3)	7		Ovarian(137;0.101)				CAAGTGGCTGGGGGAGAGTGA	0.597																																					p.G203W		Atlas-SNP	.											.	VPS4A	18	.	0			c.G607T						.						33.0	36.0	35.0					16																	69353433		2084	4224	6308	SO:0001583	missense	27183	exon6			TGGCTGGGGGAGA	AF112215	CCDS45517.1	16q23.1	2010-04-21	2006-04-04		ENSG00000132612	ENSG00000132612		"""ATPases / AAA-type"""	13488	protein-coding gene	gene with protein product		609982	"""vacuolar protein sorting 4A (yeast homolog)"", ""vacuolar protein sorting 4A (yeast)"""			10637304, 11563910	Standard	NM_013245		Approved	VPS4, VPS4-1, FLJ22197, SKD2, SKD1, SKD1A	uc002eww.3	Q9UN37		ENST00000254950.11:c.607G>T	chr16.hg19:g.69353433G>T	ENSP00000254950:p.Gly203Trp	68.0	0.0		68.0	13.0	NM_013245		Missense_Mutation	SNP	ENST00000254950.11	hg19	CCDS45517.1	.	.	.	.	.	.	.	.	.	.	G	31	5.068134	0.93950	.	.	ENSG00000132612	ENST00000254950	D	0.95272	-3.66	6.06	6.06	0.98353	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98950	0.9643	H	0.99927	4.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98748	1.0719	10	0.87932	D	0	-43.4151	20.2159	0.98296	0.0:0.0:1.0:0.0	.	203	Q9UN37	VPS4A_HUMAN	W	203	ENSP00000254950:G203W	ENSP00000254950:G203W	G	+	1	0	VPS4A	67910934	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.858000	0.99539	2.882000	0.98803	0.655000	0.94253	GGG	.	.		0.597	VPS4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430563.3	NM_013245	
GEMIN4	50628	hgsc.bcm.edu	37	17	650889	650889	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:650889G>T	ENST00000319004.5	-	2	512	c.394C>A	c.(394-396)Ctg>Atg	p.L132M	GEMIN4_ENST00000437269.1_Missense_Mutation_p.L132M|GEMIN4_ENST00000576778.1_Missense_Mutation_p.L121M	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	132					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GTGGTGGGCAGGGCCATCAGG	0.557																																					p.L132M		Atlas-SNP	.											.	GEMIN4	116	.	0			c.C394A						.						80.0	84.0	83.0					17																	650889		2030	4186	6216	SO:0001583	missense	50628	exon2			TGGGCAGGGCCAT	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.394C>A	chr17.hg19:g.650889G>T	ENSP00000321706:p.Leu132Met	192.0	0.0		111.0	5.0	NM_015721	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	hg19	CCDS45559.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010800	0.54361	.	.	ENSG00000179409	ENST00000319004;ENST00000437269	T;T	0.36340	1.26;1.26	5.66	3.65	0.41850	.	0.069975	0.64402	D	0.000015	T	0.56016	0.1957	M	0.66939	2.045	0.43750	D	0.996254	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	T	0.57579	-0.7787	10	0.72032	D	0.01	-11.1415	11.807	0.52161	0.146:0.0:0.854:0.0	.	132;132	E7EN12;P57678	.;GEMI4_HUMAN	M	132	ENSP00000321706:L132M;ENSP00000392460:L132M	ENSP00000321706:L132M	L	-	1	2	GEMIN4	597639	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	2.701000	0.47094	0.744000	0.32741	0.655000	0.94253	CTG	.	.		0.557	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721	
MYOCD	93649	hgsc.bcm.edu	37	17	12608447	12608447	+	Silent	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:12608447T>C	ENST00000343344.4	+	2	58	c.58T>C	c.(58-60)Tta>Cta	p.L20L	MYOCD_ENST00000425538.1_Silent_p.L20L|AC005358.3_ENST00000445508.1_RNA			Q8IZQ8	MYCD_HUMAN	myocardin	20					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		TTTCTAAGTTTTACAGTTAAG	0.338																																					p.L20L		Atlas-SNP	.											.	MYOCD	291	.	0			c.T58C						.						99.0	83.0	88.0					17																	12608447		2203	4300	6503	SO:0001819	synonymous_variant	93649	exon2			TAAGTTTTACAGT	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.58T>C	chr17.hg19:g.12608447T>C		364.0	0.0		295.0	88.0	NM_001146312	Q5UBU5|Q8N7Q1	Silent	SNP	ENST00000343344.4	hg19	CCDS11163.1																																																																																			.	.		0.338	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
SUPT6H	6830	hgsc.bcm.edu	37	17	27030972	27030972	+	IGR	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:27030972G>A	ENST00000314616.6	+	0	6518				PROCA1_ENST00000581289.1_3'UTR|PROCA1_ENST00000439862.3_Silent_p.I207I|PROCA1_ENST00000301039.2_Silent_p.I205I|PROCA1_ENST00000579650.1_5'Flank	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ttaccttcttGATCACCTTGC	0.512																																					p.I205I		Atlas-SNP	.											.	PROCA1	28	.	0			c.C615T						.						43.0	42.0	43.0					17																	27030972		2203	4300	6503	SO:0001628	intergenic_variant	147011	exon4			CTTCTTGATCACC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85			chr17.hg19:g.27030972G>A		58.0	0.0		51.0	16.0	NM_152465	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	hg19	CCDS32596.1																																																																																			.	.		0.512	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
LHX1	3975	hgsc.bcm.edu	37	17	35300131	35300131	+	Silent	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:35300131A>G	ENST00000254457.5	+	5	2335	c.924A>G	c.(922-924)ccA>ccG	p.P308P	RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1	308					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				CCCAGACACCAGTGGACCTAC	0.716																																					p.P308P		Atlas-SNP	.											.	LHX1	48	.	0			c.A924G						.						15.0	16.0	16.0					17																	35300131		2201	4293	6494	SO:0001819	synonymous_variant	3975	exon5			GACACCAGTGGAC	U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.924A>G	chr17.hg19:g.35300131A>G		291.0	0.0		253.0	55.0	NM_005568	Q3MIW0	Silent	SNP	ENST00000254457.5	hg19	CCDS11316.1																																																																																			.	.		0.716	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256704.3	NM_005568	
KRT27	342574	hgsc.bcm.edu	37	17	38936060	38936060	+	Silent	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:38936060G>A	ENST00000301656.3	-	4	778	c.738C>T	c.(736-738)aaC>aaT	p.N246N	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				CGGGGGCCGCGTTCATCTCCA	0.517																																					p.N246N		Atlas-SNP	.											.	KRT27	41	.	0			c.C738T						.						53.0	55.0	55.0					17																	38936060		2203	4300	6503	SO:0001819	synonymous_variant	342574	exon4			GGCCGCGTTCATC	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.738C>T	chr17.hg19:g.38936060G>A		124.0	0.0		81.0	24.0	NM_181537		Silent	SNP	ENST00000301656.3	hg19	CCDS11375.1																																																																																			.	.		0.517	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257216.1	NM_181537	
HAP1	9001	hgsc.bcm.edu	37	17	39890781	39890781	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:39890781C>A	ENST00000310778.5	-	1	115	c.106G>T	c.(106-108)Gag>Tag	p.E36*	HAP1_ENST00000393939.2_Nonsense_Mutation_p.E36*|JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Nonsense_Mutation_p.E36*|HAP1_ENST00000347901.4_Nonsense_Mutation_p.E36*			P54257	HAP1_HUMAN	huntingtin-associated protein 1	36					anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			GCAGAGGGCTCCGGAGCGGGA	0.711																																					p.E36X		Atlas-SNP	.											.	HAP1	48	.	0			c.G106T						.						13.0	14.0	14.0					17																	39890781		2158	4242	6400	SO:0001587	stop_gained	9001	exon1			AGGGCTCCGGAGC	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.106G>T	chr17.hg19:g.39890781C>A	ENSP00000309392:p.Glu36*	78.0	0.0		75.0	19.0	NM_177977	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Nonsense_Mutation	SNP	ENST00000310778.5	hg19		.	.	.	.	.	.	.	.	.	.	C	18.06	3.538931	0.65085	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	.	.	.	2.63	1.65	0.23941	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-12.3453	5.4635	0.16630	0.0:0.8413:0.0:0.1587	.	.	.	.	X	36	.	ENSP00000309392:E36X	E	-	1	0	HAP1	37144307	0.000000	0.05858	0.435000	0.26784	0.036000	0.12997	0.299000	0.19138	0.670000	0.31165	0.467000	0.42956	GAG	.	.		0.711	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949	
CACNG4	27092	hgsc.bcm.edu	37	17	64961144	64961144	+	Silent	SNP	C	C	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:64961144C>T	ENST00000262138.3	+	1	119	c.117C>T	c.(115-117)caC>caT	p.H39H		NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	39					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			CCAGCGCGCACATCTGCAACG	0.701																																					p.H39H		Atlas-SNP	.											.	CACNG4	44	.	0			c.C117T						.						36.0	31.0	33.0					17																	64961144		2203	4300	6503	SO:0001819	synonymous_variant	27092	exon1			CGCGCACATCTGC	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.117C>T	chr17.hg19:g.64961144C>T		185.0	0.0		152.0	42.0	NM_014405	B2RCK0	Silent	SNP	ENST00000262138.3	hg19	CCDS11667.1																																																																																			.	.		0.701	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
GRIN2C	2905	hgsc.bcm.edu	37	17	72842250	72842250	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:72842250A>T	ENST00000293190.5	-	11	2451	c.2305T>A	c.(2305-2307)Tgg>Agg	p.W769R	GRIN2C_ENST00000347612.4_Missense_Mutation_p.W769R	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	769					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCCCGCTTCCAGTGGGAGTCC	0.622																																					p.W769R		Atlas-SNP	.											.	GRIN2C	144	.	0			c.T2305A						.						166.0	125.0	139.0					17																	72842250		2203	4300	6503	SO:0001583	missense	2905	exon11			GCTTCCAGTGGGA		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.2305T>A	chr17.hg19:g.72842250A>T	ENSP00000293190:p.Trp769Arg	101.0	0.0		69.0	16.0	NM_000835	B2RTT1	Missense_Mutation	SNP	ENST00000293190.5	hg19	CCDS32724.1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.368492	0.42003	.	.	ENSG00000161509	ENST00000293190;ENST00000347612	T	0.27890	1.64	4.45	4.45	0.53987	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.193708	0.48286	D	0.000181	T	0.53932	0.1827	M	0.72894	2.215	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.59386	-0.7464	10	0.87932	D	0	.	13.8334	0.63395	1.0:0.0:0.0:0.0	.	803;769	Q8IW23;Q14957	.;NMDE3_HUMAN	R	769;803	ENSP00000293190:W769R	ENSP00000293190:W769R	W	-	1	0	GRIN2C	70353845	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.075000	0.94004	1.980000	0.57719	0.459000	0.35465	TGG	.	.		0.622	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1		
PGS1	9489	hgsc.bcm.edu	37	17	76399940	76399940	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr17:76399940T>C	ENST00000262764.6	+	7	1198	c.1172T>C	c.(1171-1173)cTg>cCg	p.L391P	PGS1_ENST00000329897.7_Missense_Mutation_p.L256P|PGS1_ENST00000588281.1_3'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	391					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			TATTTCAACCTGACCCAGGCC	0.572																																					p.L391P	Esophageal Squamous(45;182 1126 10685 43198)	Atlas-SNP	.											.	PGS1	30	.	0			c.T1172C						.						97.0	101.0	100.0					17																	76399940		2022	4167	6189	SO:0001583	missense	9489	exon7			TCAACCTGACCCA		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.1172T>C	chr17.hg19:g.76399940T>C	ENSP00000262764:p.Leu391Pro	97.0	0.0		87.0	25.0	NM_024419	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Missense_Mutation	SNP	ENST00000262764.6	hg19	CCDS42391.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.361570	0.82353	.	.	ENSG00000087157	ENST00000262764;ENST00000329897;ENST00000335081	D;D	0.92397	-3.03;-3.03	5.59	5.59	0.84812	.	0.000000	0.64402	D	0.000002	D	0.94653	0.8276	L	0.48986	1.54	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95018	0.8158	10	0.62326	D	0.03	-14.5175	15.7604	0.78076	0.0:0.0:0.0:1.0	.	391	Q32NB8	PGPS1_HUMAN	P	391;256;256	ENSP00000262764:L391P;ENSP00000330039:L256P	ENSP00000262764:L391P	L	+	2	0	PGS1	73911535	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.646000	0.83445	2.125000	0.65367	0.460000	0.39030	CTG	.	.		0.572	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
LAMA1	284217	hgsc.bcm.edu	37	18	6956653	6956653	+	Silent	SNP	T	T	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr18:6956653T>G	ENST00000389658.3	-	56	8169	c.8076A>C	c.(8074-8076)ccA>ccC	p.P2692P	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2692				P -> R (in Ref. 1 and 4). {ECO:0000305}.	axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCCGGGGCTCTGGCAAGAGCT	0.567																																					p.P2692P		Atlas-SNP	.											.	LAMA1	458	.	0			c.A8076C						.						63.0	68.0	67.0					18																	6956653		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon56			GGGCTCTGGCAAG	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8076A>C	chr18.hg19:g.6956653T>G		40.0	0.0		67.0	19.0	NM_005559		Silent	SNP	ENST00000389658.3	hg19	CCDS32787.1																																																																																			.	.		0.567	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
CXXC1	30827	hgsc.bcm.edu	37	18	47809307	47809307	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr18:47809307G>A	ENST00000285106.6	-	14	2455	c.1741C>T	c.(1741-1743)Cgc>Tgc	p.R581C	MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000398495.2_5'Flank|MBD1_ENST00000424334.2_5'Flank|CXXC1_ENST00000412036.2_Missense_Mutation_p.R585C|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000591535.1_5'Flank|MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000585595.1_5'Flank|MBD1_ENST00000269471.5_5'Flank|MBD1_ENST00000588937.1_5'Flank|MBD1_ENST00000590208.1_5'Flank|CXXC1_ENST00000589940.1_Silent_p.A568A|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000339998.6_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000398488.1_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	581					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						TTGGGCAGGCGGCAGAAGTCA	0.612																																					p.R585C		Atlas-SNP	.											.	CXXC1	50	.	0			c.C1753T						.						92.0	83.0	86.0					18																	47809307		2203	4300	6503	SO:0001583	missense	30827	exon14			GCAGGCGGCAGAA	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1741C>T	chr18.hg19:g.47809307G>A	ENSP00000285106:p.Arg581Cys	93.0	0.0		108.0	20.0	NM_001101654	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	ENST00000285106.6	hg19	CCDS11945.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.579244	0.46006	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.26660	1.73;1.72	4.2	4.2	0.49525	CpG binding protein, C-terminal (1);	0.066796	0.56097	D	0.000034	T	0.22781	0.0550	L	0.58428	1.81	0.80722	D	1	P;P;P	0.41131	0.694;0.739;0.487	B;B;B	0.34779	0.119;0.189;0.085	T	0.06232	-1.0838	10	0.62326	D	0.03	-5.6841	9.805	0.40789	0.0:0.0:0.7944:0.2056	.	585;581;448	Q9P0U4-2;Q9P0U4;Q59EC8	.;CXXC1_HUMAN;.	C	581;585	ENSP00000285106:R581C;ENSP00000390475:R585C	ENSP00000285106:R581C	R	-	1	0	CXXC1	46063305	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.569000	0.53827	2.033000	0.60031	0.453000	0.30009	CGC	.	.		0.612	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255927.2	NM_014593	
CDH19	28513	hgsc.bcm.edu	37	18	64211362	64211362	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr18:64211362T>A	ENST00000540086.1	-	7	1306	c.1060A>T	c.(1060-1062)Acc>Tcc	p.T354S	CDH19_ENST00000262150.2_Missense_Mutation_p.T354S	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	456	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				ATGAAAGTGGTGGAAGCCTCA	0.423																																					p.T354S		Atlas-SNP	.											.	CDH19	141	.	0			c.A1060T						.						135.0	119.0	124.0					18																	64211362		2203	4300	6503	SO:0001583	missense	28513	exon7			AAGTGGTGGAAGC	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.1060A>T	chr18.hg19:g.64211362T>A	ENSP00000439593:p.Thr354Ser	103.0	0.0		108.0	42.0	NM_021153	O15098	Missense_Mutation	SNP	ENST00000540086.1	hg19	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	T	7.991	0.753203	0.15778	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	T;T	0.55760	0.5;0.5	5.62	3.18	0.36537	Cadherin (4);Cadherin-like (1);	0.376285	0.30109	N	0.010387	T	0.50888	0.1642	M	0.69185	2.1	0.09310	N	1	B;B	0.32604	0.126;0.377	B;B	0.38616	0.053;0.277	T	0.48210	-0.9055	10	0.51188	T	0.08	.	6.8684	0.24106	0.1347:0.0741:0.0:0.7912	.	354;354	F5H1K0;Q9H159	.;CAD19_HUMAN	S	354;354;299	ENSP00000262150:T354S;ENSP00000439593:T354S	ENSP00000262150:T354S	T	-	1	0	CDH19	62362342	0.989000	0.36119	0.196000	0.23383	0.564000	0.35744	1.958000	0.40402	0.481000	0.27557	0.528000	0.53228	ACC	.	.		0.423	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000442285.1	NM_021153	
SALL3	27164	hgsc.bcm.edu	37	18	76757118	76757118	+	Silent	SNP	C	C	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr18:76757118C>T	ENST00000537592.2	+	3	3699	c.3699C>T	c.(3697-3699)atC>atT	p.I1233I	SALL3_ENST00000575389.2_Silent_p.I1161I|SALL3_ENST00000536229.3_Silent_p.I1028I	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1233					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		TCTCCGTCATCCAGAACGGCG	0.617																																					p.I1233I		Atlas-SNP	.											.	SALL3	162	.	0			c.C3699T						.						109.0	100.0	103.0					18																	76757118		2203	4300	6503	SO:0001819	synonymous_variant	27164	exon3			CGTCATCCAGAAC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3699C>T	chr18.hg19:g.76757118C>T		171.0	0.0		166.0	55.0	NM_171999	Q9UGH1	Silent	SNP	ENST00000537592.2	hg19	CCDS12013.1																																																																																			.	.		0.617	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ADAMTSL5	339366	hgsc.bcm.edu	37	19	1510211	1510211	+	Missense_Mutation	SNP	A	A	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr19:1510211A>C	ENST00000413997.2	-	5	328	c.329T>G	c.(328-330)cTg>cGg	p.L110R	CTB-25B13.9_ENST00000590252.1_RNA|ADAMTSL5_ENST00000590562.1_5'UTR|ADAMTSL5_ENST00000395467.2_5'UTR|ADAMTSL5_ENST00000330475.4_Missense_Mutation_p.L100R			Q6ZMM2	ATL5_HUMAN	ADAMTS-like 5	110						extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCATTGTACAGGGCACACTG	0.627																																					p.L100R		Atlas-SNP	.											.	ADAMTSL5	24	.	0			c.T299G						.						39.0	39.0	39.0					19																	1510211		2202	4300	6502	SO:0001583	missense	339366	exon5			TTGTACAGGGCAC	BC040620	CCDS12071.1	19p13.3	2008-02-05	2006-02-07	2006-02-07		ENSG00000185761			27912	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain containing 6"""	THSD6			Standard	NM_213604		Approved		uc002ltd.2	Q6ZMM2		ENST00000413997.2:c.329T>G	chr19.hg19:g.1510211A>C	ENSP00000399364:p.Leu110Arg	77.0	0.0		81.0	11.0	NM_213604	B4DXK7|Q8IW95	Missense_Mutation	SNP	ENST00000413997.2	hg19		.	.	.	.	.	.	.	.	.	.	A	7.769	0.706963	0.15239	.	.	ENSG00000185761	ENST00000413997;ENST00000330475	T;T	0.62498	0.02;0.02	4.6	4.6	0.57074	.	0.260088	0.31450	N	0.007635	T	0.54806	0.1881	N	0.20530	0.585	0.80722	D	1	D;D	0.54772	0.968;0.968	P;P	0.51016	0.656;0.656	T	0.57394	-0.7819	10	0.46703	T	0.11	.	11.3547	0.49609	1.0:0.0:0.0:0.0	.	110;100	B4DXK7;Q6ZMM2	.;ATL5_HUMAN	R	110;100	ENSP00000399364:L110R;ENSP00000327608:L100R	ENSP00000327608:L100R	L	-	2	0	ADAMTSL5	1461211	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.799000	0.55529	1.691000	0.51100	0.374000	0.22700	CTG	.	.		0.627	ADAMTSL5-202	KNOWN	basic	protein_coding	protein_coding		XM_294919	
ATCAY	85300	hgsc.bcm.edu	37	19	3913803	3913803	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr19:3913803T>C	ENST00000450849.2	+	9	1381	c.914T>C	c.(913-915)cTg>cCg	p.L305P	ATCAY_ENST00000301260.6_Missense_Mutation_p.L305P|ATCAY_ENST00000398448.3_Missense_Mutation_p.L311P|ATCAY_ENST00000600960.1_Missense_Mutation_p.L305P	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	305	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Mediates interaction with GLS.				apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		TTGGAAGACCTGGAGCAACTC	0.577																																					p.L305P		Atlas-SNP	.											.	ATCAY	84	.	0			c.T914C						.						93.0	101.0	99.0					19																	3913803		2071	4198	6269	SO:0001583	missense	85300	exon9			AAGACCTGGAGCA		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.914T>C	chr19.hg19:g.3913803T>C	ENSP00000390941:p.Leu305Pro	79.0	0.0		82.0	24.0	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	hg19	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097301	0.76870	.	.	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.58506	0.33;0.33;0.33	4.4	4.4	0.53042	Cellular retinaldehyde-binding/triple function, C-terminal (4);	0.167610	0.40908	D	0.000995	D	0.82384	0.5025	H	0.96015	3.755	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.87554	0.2467	10	0.87932	D	0	.	12.7855	0.57502	0.0:0.0:0.0:1.0	.	311;305;305	B4DS11;Q86WG3-3;Q86WG3	.;.;ATCAY_HUMAN	P	305;305;305;311;283	ENSP00000390941:L305P;ENSP00000301260:L305P;ENSP00000381466:L311P	ENSP00000301260:L305P	L	+	2	0	ATCAY	3864803	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	7.767000	0.85331	1.629000	0.50426	0.247000	0.18012	CTG	.	.		0.577	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
ZNF506	440515	hgsc.bcm.edu	37	19	19906192	19906192	+	Silent	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr19:19906192A>T	ENST00000540806.2	-	4	592	c.504T>A	c.(502-504)acT>acA	p.T168T	ZNF506_ENST00000450683.2_Silent_p.T136T|CTC-559E9.4_ENST00000590274.1_lincRNA|ZNF506_ENST00000443905.2_Silent_p.T168T|ZNF506_ENST00000587461.1_Intron|CTC-559E9.6_ENST00000591884.1_RNA|CTC-559E9.6_ENST00000589657.1_RNA			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	168					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						ATTTTTTTCCAGTATCTCTTA	0.289																																					p.T168T		Atlas-SNP	.											.	ZNF506	36	.	0			c.T504A						.						39.0	37.0	38.0					19																	19906192		1874	4127	6001	SO:0001819	synonymous_variant	440515	exon4			TTTTCCAGTATCT	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.504T>A	chr19.hg19:g.19906192A>T		102.0	0.0		118.0	37.0	NM_001099269	B3KTH6	Silent	SNP	ENST00000540806.2	hg19	CCDS42531.1																																																																																			.	.		0.289	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218	
B9D2	80776	hgsc.bcm.edu	37	19	41858864	41858864	+	IGR	SNP	C	C	T	rs199758510|rs66551611	byFrequency	TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr19:41858864C>T	ENST00000243578.3	-	0	1027				TGFB1_ENST00000221930.5_Missense_Mutation_p.G29E|CTC-435M10.3_ENST00000604424.1_Intron|TMEM91_ENST00000604123.1_5'Flank|TMEM91_ENST00000539627.1_Intron	NM_030578.3	NP_085055.2	Q9BPU9	B9D2_HUMAN	B9 protein domain 2						cilium assembly (GO:0042384)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)	gamma-tubulin binding (GO:0043015)			large_intestine(1)|ovary(1)	2						GGTGGATAGTCCCGCGGCCGG	0.711													C|||	2	0.000399361	0.0008	0.0	5008	,	,		12405	0.0		0.001	False		,,,				2504	0.0				p.G29E		Atlas-SNP	.											.	TGFB1	27	.	0			c.G86A	GRCh37	CM090931|CM090932	TGFB1	M		.	C	GLU/GLY	2,4240		0,2,2119	13.0	10.0	11.0		86	1.3	1.0	19		11	3,8293		0,3,4145	yes	missense	TGFB1	NM_000660.4	98	0,5,6264	TT,TC,CC		0.0362,0.0471,0.0399	possibly-damaging	29/391	41858864	5,12533	2121	4148	6269	SO:0001628	intergenic_variant	7040	exon1			GATAGTCCCGCGG	BC004157	CCDS12579.1	19q13.2	2014-01-28				ENSG00000123810			28636	protein-coding gene	gene with protein product		611951				21763481	Standard	NM_030578		Approved	MGC4093, MKS10	uc002oqj.2	Q9BPU9			chr19.hg19:g.41858864C>T		54.0	0.0		65.0	22.0	NM_000660		Missense_Mutation	SNP	ENST00000243578.3	hg19	CCDS12579.1	.	.	.	.	.	.	.	.	.	.	C	18.97	3.735595	0.69189	4.71E-4	3.62E-4	ENSG00000105329	ENST00000221930	T	0.31769	1.48	3.74	1.29	0.21616	Transforming growth factor-beta, N-terminal (1);	0.473959	0.22160	N	0.063783	T	0.33585	0.0868	M	0.62723	1.935	0.80722	D	1	P	0.42161	0.772	B	0.43575	0.424	T	0.30149	-0.9988	10	0.49607	T	0.09	-15.6854	12.0894	0.53717	0.0:0.5772:0.4228:0.0	.	29	P01137	TGFB1_HUMAN	E	29	ENSP00000221930:G29E	ENSP00000221930:G29E	G	-	2	0	TGFB1	46550704	0.004000	0.15560	0.981000	0.43875	0.943000	0.58893	0.541000	0.23207	0.724000	0.32296	0.462000	0.41574	GGA	.	.		0.711	B9D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463489.1	NM_030578	
ZNF229	7772	hgsc.bcm.edu	37	19	44933761	44933761	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr19:44933761G>T	ENST00000588931.1	-	6	1628	c.1195C>A	c.(1195-1197)Cac>Aac	p.H399N	ZNF229_ENST00000291187.4_Missense_Mutation_p.H393N|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000591289.1_Intron	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	399					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TCTCCAGTGTGGACCCTCTGA	0.507																																					p.H399N		Atlas-SNP	.											.	ZNF229	123	.	0			c.C1195A						.						93.0	104.0	100.0					19																	44933761		2203	4300	6503	SO:0001583	missense	7772	exon6			CAGTGTGGACCCT	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1195C>A	chr19.hg19:g.44933761G>T	ENSP00000466519:p.His399Asn	115.0	0.0		152.0	48.0	NM_014518	B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	ENST00000588931.1	hg19	CCDS42574.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998096	0.93227	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.86	2.71	0.32032	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.76227	0.3958	M	0.93763	3.455	0.30332	N	0.786536	D	0.71674	0.998	D	0.66602	0.945	T	0.75470	-0.3306	8	0.87932	D	0	.	11.5979	0.50984	0.0:0.182:0.818:0.0	.	399	Q9UJW7	ZN229_HUMAN	N	399	.	ENSP00000291187:H399N	H	-	1	0	ZNF229	49625601	1.000000	0.71417	0.336000	0.25522	0.974000	0.67602	4.809000	0.62591	1.694000	0.51137	0.609000	0.83330	CAC	.	.		0.507	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518	
FAM71E2	284418	hgsc.bcm.edu	37	19	55869581	55869581	+	Silent	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr19:55869581A>G	ENST00000424985.3	-	9	2848	c.2655T>C	c.(2653-2655)acT>acC	p.T885T	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.L435P	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	885										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						TGTTCCTCACAGTTTCAAGTT	0.557																																					p.T885T		Atlas-SNP	.											.	FAM71E2	41	.	0			c.T2655C						.						75.0	67.0	70.0					19																	55869581		692	1591	2283	SO:0001819	synonymous_variant	284418	exon9			CCTCACAGTTTCA	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2655T>C	chr19.hg19:g.55869581A>G		130.0	0.0		139.0	47.0	NM_001145402	Q8ND99	Silent	SNP	ENST00000424985.3	hg19																																																																																				.	.		0.557	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000409063.4	NM_001145402	
NLRP4	147945	hgsc.bcm.edu	37	19	56388508	56388508	+	Missense_Mutation	SNP	C	C	T	rs572392165		TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr19:56388508C>T	ENST00000301295.6	+	8	3094	c.2672C>T	c.(2671-2673)aCg>aTg	p.T891M	NLRP4_ENST00000346986.5_Missense_Mutation_p.T835M|NLRP4_ENST00000587891.1_Missense_Mutation_p.T816M	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	891					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CTGACGCATACGGATTGCCGC	0.473													C|||	1	0.000199681	0.0	0.0	5008	,	,		20970	0.0		0.0	False		,,,				2504	0.001				p.T891M		Atlas-SNP	.											.	NLRP4	331	.	0			c.C2672T						.						201.0	189.0	193.0					19																	56388508		2203	4300	6503	SO:0001583	missense	147945	exon8			CGCATACGGATTG	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2672C>T	chr19.hg19:g.56388508C>T	ENSP00000301295:p.Thr891Met	151.0	0.0		153.0	36.0	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	hg19	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853296	0.32699	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	T;T	0.48836	0.8;0.8	3.91	3.91	0.45181	.	.	.	.	.	T	0.40448	0.1117	L	0.38175	1.15	0.09310	N	1	P;P;P	0.52170	0.715;0.84;0.951	B;B;B	0.42798	0.231;0.398;0.224	T	0.33059	-0.9883	9	0.87932	D	0	.	11.6309	0.51173	0.0:1.0:0.0:0.0	.	835;816;891	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	M	891;835	ENSP00000301295:T891M;ENSP00000344787:T835M	ENSP00000301295:T891M	T	+	2	0	NLRP4	61080320	0.020000	0.18652	0.017000	0.16124	0.002000	0.02628	3.378000	0.52432	2.195000	0.70347	0.585000	0.79938	ACG	.	.		0.473	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
NINL	22981	hgsc.bcm.edu	37	20	25478971	25478971	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr20:25478971G>T	ENST00000278886.6	-	9	1117	c.1044C>A	c.(1042-1044)ttC>ttA	p.F348L	NINL_ENST00000422516.1_Missense_Mutation_p.F348L	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	348					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CGTCCACGCTGAAGTCCAGGC	0.612																																					p.F348L		Atlas-SNP	.											.	NINL	148	.	0			c.C1044A						.						79.0	58.0	65.0					20																	25478971		2203	4300	6503	SO:0001583	missense	22981	exon9			CACGCTGAAGTCC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.1044C>A	chr20.hg19:g.25478971G>T	ENSP00000278886:p.Phe348Leu	41.0	0.0		39.0	15.0	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	hg19	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235389	0.58886	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.41758	1.24;0.99	5.12	3.19	0.36642	.	0.000000	0.85682	D	0.000000	T	0.54143	0.1840	M	0.79258	2.445	0.54753	D	0.999986	D;D	0.59767	0.986;0.966	P;P	0.56163	0.793;0.452	T	0.54721	-0.8251	10	0.52906	T	0.07	-18.4003	8.1315	0.31029	0.2501:0.0:0.7499:0.0	.	348;348	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	L	348	ENSP00000278886:F348L;ENSP00000410431:F348L	ENSP00000278886:F348L	F	-	3	2	NINL	25426971	0.998000	0.40836	0.786000	0.31890	0.664000	0.39144	2.510000	0.45468	0.754000	0.32968	-0.251000	0.11542	TTC	.	.		0.612	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
BPIFB3	359710	hgsc.bcm.edu	37	20	31643273	31643273	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr20:31643273G>T	ENST00000375494.3	+	1	44	c.44G>T	c.(43-45)tGg>tTg	p.W15L	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	15	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										CTTCTGCTCTGGGGCCTGGCG	0.607																																					p.W15L		Atlas-SNP	.											.	.	.	.	0			c.G44T						.						103.0	99.0	100.0					20																	31643273		2203	4300	6503	SO:0001583	missense	359710	exon1			TGCTCTGGGGCCT	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.44G>T	chr20.hg19:g.31643273G>T	ENSP00000364643:p.Trp15Leu	49.0	0.0		63.0	9.0	NM_182658	Q5TDX7	Missense_Mutation	SNP	ENST00000375494.3	hg19	CCDS13212.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705141	0.68615	.	.	ENSG00000186190	ENST00000375494	T	0.01287	5.05	4.9	3.89	0.44902	.	0.426267	0.20041	N	0.100509	T	0.01353	0.0044	L	0.44542	1.39	0.28072	N	0.932555	B	0.26935	0.164	B	0.25405	0.06	T	0.42799	-0.9430	10	0.02654	T	1	-3.5556	9.5259	0.39165	0.0:0.0:0.7748:0.2252	.	15	P59826	BPIB3_HUMAN	L	15	ENSP00000364643:W15L	ENSP00000364643:W15L	W	+	2	0	BPIFB3	31106934	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.785000	0.38684	2.548000	0.85928	0.655000	0.94253	TGG	.	.		0.607	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078654.2	NM_182658	
CBFA2T2	9139	hgsc.bcm.edu	37	20	32207337	32207337	+	Silent	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr20:32207337A>G	ENST00000346541.3	+	5	999	c.462A>G	c.(460-462)acA>acG	p.T154T	CBFA2T2_ENST00000397800.1_Silent_p.T125T|CBFA2T2_ENST00000344201.3_Silent_p.T125T|CBFA2T2_ENST00000397798.2_Silent_p.T125T|CBFA2T2_ENST00000375279.2_Silent_p.T154T|CBFA2T2_ENST00000342704.6_Silent_p.T145T|CBFA2T2_ENST00000492345.1_Silent_p.T125T|CBFA2T2_ENST00000359606.3_Silent_p.T164T	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	154	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						CAACAGTGACAATTGAGGAAT	0.328																																					p.T154T	Esophageal Squamous(174;142 1955 14837 21276 28041)	Atlas-SNP	.											.	CBFA2T2	93	.	0			c.A462G						.						80.0	82.0	81.0					20																	32207337		2203	4300	6503	SO:0001819	synonymous_variant	9139	exon5			AGTGACAATTGAG	AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.462A>G	chr20.hg19:g.32207337A>G		101.0	0.0		103.0	22.0	NM_005093	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Silent	SNP	ENST00000346541.3	hg19	CCDS13221.1																																																																																			.	.		0.328	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078708.2	NM_001032999	
MYBL2	4605	hgsc.bcm.edu	37	20	42343871	42343871	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr20:42343871A>T	ENST00000217026.4	+	13	2049	c.1922A>T	c.(1921-1923)gAg>gTg	p.E641V	MYBL2_ENST00000396863.4_Missense_Mutation_p.E617V	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	641					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			GCCAAGCCCGAGAAGGCAGCA	0.597																																					p.E641V		Atlas-SNP	.											.	MYBL2	82	.	0			c.A1922T						.						136.0	144.0	142.0					20																	42343871		2203	4300	6503	SO:0001583	missense	4605	exon13			AGCCCGAGAAGGC		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1922A>T	chr20.hg19:g.42343871A>T	ENSP00000217026:p.Glu641Val	247.0	0.0		233.0	90.0	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Missense_Mutation	SNP	ENST00000217026.4	hg19	CCDS13322.1	.	.	.	.	.	.	.	.	.	.	a	9.604	1.129558	0.21041	.	.	ENSG00000101057	ENST00000396863;ENST00000217026	T;T	0.15256	2.44;2.44	4.43	4.43	0.53597	.	1.462090	0.04095	N	0.311925	T	0.22781	0.0550	L	0.55481	1.735	0.31788	N	0.630056	B;B	0.34103	0.018;0.437	B;B	0.35470	0.047;0.203	T	0.18304	-1.0341	10	0.28530	T	0.3	-17.0091	11.5313	0.50612	1.0:0.0:0.0:0.0	.	617;641	F8W6N6;P10244	.;MYBB_HUMAN	V	617;641	ENSP00000380072:E617V;ENSP00000217026:E641V	ENSP00000217026:E641V	E	+	2	0	MYBL2	41777285	1.000000	0.71417	0.947000	0.38551	0.111000	0.19643	4.033000	0.57282	1.772000	0.52199	0.398000	0.26397	GAG	.	.		0.597	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
PHACTR3	116154	hgsc.bcm.edu	37	20	58348348	58348348	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr20:58348348T>C	ENST00000371015.1	+	6	1233	c.766T>C	c.(766-768)Ttc>Ctc	p.F256L	PHACTR3_ENST00000359926.3_Missense_Mutation_p.F253L|PHACTR3_ENST00000355648.4_Missense_Mutation_p.F215L|PHACTR3_ENST00000541461.1_Missense_Mutation_p.F215L|PHACTR3_ENST00000395636.2_Missense_Mutation_p.F215L|PHACTR3_ENST00000361300.4_Missense_Mutation_p.F145L|PHACTR3_ENST00000395639.4_Missense_Mutation_p.F145L	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	256						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			AGCCACACTCTTCCAAGCCTC	0.622																																					p.F256L		Atlas-SNP	.											.	PHACTR3	104	.	0			c.T766C						.						83.0	86.0	85.0					20																	58348348		2203	4300	6503	SO:0001583	missense	116154	exon6			ACACTCTTCCAAG	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.766T>C	chr20.hg19:g.58348348T>C	ENSP00000360054:p.Phe256Leu	127.0	0.0		110.0	27.0	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	ENST00000371015.1	hg19	CCDS13480.1	.	.	.	.	.	.	.	.	.	.	T	7.847	0.723123	0.15439	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.27890	2.02;2.05;1.64;2.03;2.03;2.03;1.64	5.02	3.92	0.45320	.	0.325285	0.34777	N	0.003686	T	0.29126	0.0724	M	0.63428	1.95	0.43688	D	0.996137	B;B;B	0.15141	0.012;0.003;0.003	B;B;B	0.12156	0.007;0.002;0.004	T	0.05566	-1.0877	10	0.27785	T	0.31	-14.4625	9.7549	0.40498	0.0:0.0815:0.0:0.9185	.	145;256;253	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	L	253;256;145;215;215;215;145	ENSP00000353002:F253L;ENSP00000360054:F256L;ENSP00000379001:F145L;ENSP00000442483:F215L;ENSP00000347866:F215L;ENSP00000378998:F215L;ENSP00000354555:F145L	ENSP00000347866:F215L	F	+	1	0	PHACTR3	57781743	1.000000	0.71417	0.991000	0.47740	0.029000	0.11900	4.287000	0.59001	0.767000	0.33267	0.533000	0.62120	TTC	.	.		0.622	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
B3GALT5	10317	hgsc.bcm.edu	37	21	41032874	41032874	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr21:41032874A>G	ENST00000380620.4	+	5	980	c.388A>G	c.(388-390)Aat>Gat	p.N130D	B3GALT5_ENST00000343118.4_Missense_Mutation_p.N130D|B3GALT5_ENST00000398714.2_Missense_Mutation_p.N130D|AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000380618.1_Missense_Mutation_p.N130D			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	130					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				CGTCTATTACAATCTGACCCT	0.512																																					p.N130D		Atlas-SNP	.											.	B3GALT5	40	.	0			c.A388G						.						103.0	102.0	102.0					21																	41032874		2203	4300	6503	SO:0001583	missense	10317	exon3			TATTACAATCTGA	AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.388A>G	chr21.hg19:g.41032874A>G	ENSP00000369994:p.Asn130Asp	103.0	0.0		87.0	14.0	NM_033170	A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Missense_Mutation	SNP	ENST00000380620.4	hg19	CCDS13667.1	.	.	.	.	.	.	.	.	.	.	A	18.21	3.574278	0.65878	.	.	ENSG00000183778	ENST00000380620;ENST00000380618;ENST00000343118;ENST00000398714	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.72	5.72	0.89469	.	0.000000	0.64402	D	0.000001	T	0.79070	0.4384	H	0.96301	3.8	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86091	0.1550	10	0.87932	D	0	.	16.0156	0.80439	1.0:0.0:0.0:0.0	.	130	Q9Y2C3	B3GT5_HUMAN	D	130	ENSP00000369994:N130D;ENSP00000369992:N130D;ENSP00000343318:N130D;ENSP00000381699:N130D	ENSP00000343318:N130D	N	+	1	0	B3GALT5	39954744	1.000000	0.71417	0.115000	0.21578	0.044000	0.14063	9.144000	0.94629	2.189000	0.69895	0.533000	0.62120	AAT	.	.		0.512	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195008.2	NM_033170	
MCM3AP	8888	hgsc.bcm.edu	37	21	47692553	47692553	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr21:47692553T>G	ENST00000397708.1	-	9	2641	c.2387A>C	c.(2386-2388)aAg>aCg	p.K796T	MCM3AP_ENST00000291688.1_Missense_Mutation_p.K796T			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	796	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					GAAGACACCCTTGTTTCTCAG	0.488																																					p.K796T		Atlas-SNP	.											.	MCM3AP	146	.	0			c.A2387C						.						184.0	161.0	169.0					21																	47692553		2203	4300	6503	SO:0001583	missense	8888	exon8			ACACCCTTGTTTC	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2387A>C	chr21.hg19:g.47692553T>G	ENSP00000380820:p.Lys796Thr	103.0	0.0		89.0	21.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	hg19	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	T	12.29	1.892968	0.33442	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.03889	3.77;3.77	5.93	-3.45	0.04781	.	0.579934	0.20128	N	0.098660	T	0.06781	0.0173	L	0.46157	1.445	0.19775	N	0.99996	B	0.34399	0.452	P	0.45138	0.471	T	0.24512	-1.0158	10	0.52906	T	0.07	-5.7953	7.9937	0.30256	0.1151:0.451:0.0:0.4339	.	796	O60318	MCM3A_HUMAN	T	796	ENSP00000380820:K796T;ENSP00000291688:K796T	ENSP00000291688:K796T	K	-	2	0	MCM3AP	46516981	0.215000	0.23574	0.024000	0.17045	0.001000	0.01503	0.439000	0.21575	-0.619000	0.05648	-0.336000	0.08194	AAG	.	.		0.488	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
CRYBB2	1415	hgsc.bcm.edu	37	22	25627596	25627596	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr22:25627596T>A	ENST00000398215.2	+	6	646	c.475T>A	c.(475-477)Tac>Aac	p.Y159N		NM_000496.2	NP_000487.1	P43320	CRBB2_HUMAN	crystallin, beta B2	159	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		identical protein binding (GO:0042802)|structural constituent of eye lens (GO:0005212)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	10						GTACCCCGGCTACCGTGGGCT	0.642																																					p.Y159N		Atlas-SNP	.											.	CRYBB2	18	.	0			c.T475A						.						93.0	89.0	91.0					22																	25627596		2203	4300	6503	SO:0001583	missense	1415	exon6			CCCGGCTACCGTG		CCDS13831.1	22q11.23	2008-06-10			ENSG00000244752	ENSG00000244752			2398	protein-coding gene	gene with protein product		123620		CCA2, CRYB2A, CRYB2		9158139, 8224918	Standard	XM_006724141		Approved		uc003abp.1	P43320	OTTHUMG00000150905	ENST00000398215.2:c.475T>A	chr22.hg19:g.25627596T>A	ENSP00000381273:p.Tyr159Asn	176.0	0.0		184.0	44.0	NM_000496	Q9UCM8	Missense_Mutation	SNP	ENST00000398215.2	hg19	CCDS13831.1	.	.	.	.	.	.	.	.	.	.	t	15.62	2.886049	0.51908	.	.	ENSG00000244752	ENST00000398215	D	0.82893	-1.66	4.22	4.22	0.49857	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.85682	D	0.000000	D	0.94032	0.8088	H	0.98199	4.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95433	0.8518	10	0.87932	D	0	.	12.4953	0.55925	0.0:0.0:0.0:1.0	.	159	P43320	CRBB2_HUMAN	N	159	ENSP00000381273:Y159N	ENSP00000381273:Y159N	Y	+	1	0	CRYBB2	23957596	1.000000	0.71417	0.998000	0.56505	0.065000	0.16274	7.664000	0.83830	1.535000	0.49220	0.379000	0.24179	TAC	.	.		0.642	CRYBB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320350.1	NM_000496	
CHEK2	11200	hgsc.bcm.edu	37	22	29130702	29130702	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr22:29130702C>T	ENST00000405598.1	-	3	199	c.8G>A	c.(7-9)cGg>cAg	p.R3Q	CHEK2_ENST00000382578.1_Missense_Mutation_p.R3Q|CHEK2_ENST00000404276.1_Missense_Mutation_p.R3Q|CHEK2_ENST00000382565.1_Missense_Mutation_p.R3Q|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000382566.1_Missense_Mutation_p.R3Q|CHEK2_ENST00000402731.1_Missense_Mutation_p.R3Q|CHEK2_ENST00000328354.6_Missense_Mutation_p.R3Q|CHEK2_ENST00000348295.3_Missense_Mutation_p.R3Q|CHEK2_ENST00000382580.2_Missense_Mutation_p.R3Q|CHEK2_ENST00000403642.1_Missense_Mutation_p.R3Q			O96017	CHK2_HUMAN	checkpoint kinase 2	3					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						ATCCGACTCCCGAGACATCAC	0.493			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																													p.R3Q		Atlas-SNP	.	yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	.	CHEK2	438	.	0			c.G8A						.						79.0	69.0	72.0					22																	29130702		2203	4300	6503	SO:0001583	missense	11200	exon2			GACTCCCGAGACA	AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.8G>A	chr22.hg19:g.29130702C>T	ENSP00000386087:p.Arg3Gln	52.0	0.0		55.0	20.0	NM_145862	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000405598.1	hg19	CCDS13843.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.532779	0.45073	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000382565;ENST00000382563;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731;ENST00000447421;ENST00000439200;ENST00000398017	T;T;T;D;T;T;T;T;T;T;T;D;D	0.95205	0.57;-0.24;-0.4;-3.63;-0.4;-0.4;-0.4;-0.5;-0.24;0.57;0.01;-3.64;-2.7	4.4	1.14	0.20703	.	0.550725	0.19541	N	0.111799	D	0.83225	0.5208	N	0.14661	0.345	0.25501	N	0.987555	B;B;B;B;B;P	0.45672	0.012;0.011;0.001;0.005;0.001;0.864	B;B;B;B;B;B	0.32624	0.003;0.005;0.001;0.003;0.001;0.149	T	0.76416	-0.2967	10	0.20519	T	0.43	.	8.9181	0.35594	0.0:0.6733:0.0:0.3267	.	3;3;3;3;3;3	O96017-7;O96017-4;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;CHK2_HUMAN;.	Q	3;3;3;3;3;3;3;3;3;3;3;3;3;13	ENSP00000329012:R3Q;ENSP00000372021:R3Q;ENSP00000372006:R3Q;ENSP00000372007:R3Q;ENSP00000329178:R3Q;ENSP00000385747:R3Q;ENSP00000386087:R3Q;ENSP00000372023:R3Q;ENSP00000384919:R3Q;ENSP00000384835:R3Q;ENSP00000397478:R3Q;ENSP00000408065:R3Q;ENSP00000381099:R13Q	ENSP00000329178:R3Q	R	-	2	0	CHEK2	27460702	0.163000	0.22920	0.993000	0.49108	0.978000	0.69477	0.131000	0.15870	0.222000	0.20900	0.563000	0.77884	CGG	.	.		0.493	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321150.1	NM_001005735	
HMGXB4	10042	hgsc.bcm.edu	37	22	35661318	35661318	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr22:35661318T>C	ENST00000216106.5	+	5	1065	c.937T>C	c.(937-939)Tac>Cac	p.Y313H	HMGXB4_ENST00000444518.2_Missense_Mutation_p.Y204H	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	313					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AGATGATTCTTACCGAGAAAT	0.418																																					p.Y313H		Atlas-SNP	.											.	HMGXB4	52	.	0			c.T937C						.						67.0	72.0	70.0					22																	35661318		2203	4300	6503	SO:0001583	missense	10042	exon5			GATTCTTACCGAG	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.937T>C	chr22.hg19:g.35661318T>C	ENSP00000216106:p.Tyr313His	151.0	0.0		153.0	27.0	NM_001003681	O75672|O75673|Q9UMT5	Missense_Mutation	SNP	ENST00000216106.5	hg19	CCDS33641.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894945	0.72639	.	.	ENSG00000100281	ENST00000420166;ENST00000444518;ENST00000455359;ENST00000216106	T;T;T;T	0.63744	-0.05;2.0;-0.06;2.01	6.01	6.01	0.97437	.	0.360991	0.33382	N	0.004971	T	0.69433	0.3110	L	0.29908	0.895	0.44316	D	0.997197	D	0.76494	0.999	D	0.66196	0.942	T	0.72701	-0.4214	10	0.72032	D	0.01	-15.5509	16.5285	0.84344	0.0:0.0:0.0:1.0	.	313	Q9UGU5	HMGX4_HUMAN	H	204;204;204;313	ENSP00000401658:Y204H;ENSP00000398302:Y204H;ENSP00000415500:Y204H;ENSP00000216106:Y313H	ENSP00000216106:Y313H	Y	+	1	0	HMGXB4	33991318	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.940000	0.75917	2.307000	0.77673	0.528000	0.53228	TAC	.	.		0.418	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487	
SREBF2	6721	hgsc.bcm.edu	37	22	42280874	42280874	+	Silent	SNP	C	C	T	rs200493376		TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr22:42280874C>T	ENST00000361204.4	+	11	2233	c.2067C>T	c.(2065-2067)tcC>tcT	p.S689S		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	689					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CCGCCTGTTCCGATGTACACA	0.537																																					p.S689S		Atlas-SNP	.											.	SREBF2	99	.	0			c.C2067T						.						114.0	93.0	100.0					22																	42280874		2203	4300	6503	SO:0001819	synonymous_variant	6721	exon11			CTGTTCCGATGTA	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.2067C>T	chr22.hg19:g.42280874C>T		122.0	0.0		116.0	26.0	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Silent	SNP	ENST00000361204.4	hg19	CCDS14023.1																																																																																			.	C|0.999;T|0.001		0.537	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
FRMPD4	9758	hgsc.bcm.edu	37	X	12516855	12516855	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chrX:12516855A>T	ENST00000380682.1	+	2	604	c.98A>T	c.(97-99)cAg>cTg	p.Q33L		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	33	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						GGCTTGAGCCAGGTGCCGCCC	0.517																																					p.Q33L		Atlas-SNP	.											.	FRMPD4	214	.	0			c.A98T						.						64.0	61.0	62.0					X																	12516855		2203	4300	6503	SO:0001583	missense	9758	exon2			TGAGCCAGGTGCC	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.98A>T	chrX.hg19:g.12516855A>T	ENSP00000370057:p.Gln33Leu	197.0	0.0		233.0	92.0	NM_014728	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	hg19	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	A	16.00	2.999598	0.54147	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.06218	3.33	5.13	5.13	0.70059	WW/Rsp5/WWP (1);	0.081862	0.49305	D	0.000141	T	0.15262	0.0368	L	0.54323	1.7	0.44337	D	0.997229	D;B	0.57257	0.979;0.061	P;B	0.54270	0.747;0.018	T	0.00412	-1.1755	10	0.62326	D	0.03	.	14.3389	0.66611	1.0:0.0:0.0:0.0	.	25;33	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	L	33;24;22	ENSP00000370057:Q33L	ENSP00000304583:Q22L	Q	+	2	0	FRMPD4	12426776	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.978000	0.88095	1.834000	0.53371	0.486000	0.48141	CAG	.	.		0.517	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
PDHA1	5160	hgsc.bcm.edu	37	X	19367462	19367462	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chrX:19367462T>G	ENST00000422285.2	+	2	195	c.90T>G	c.(88-90)ttT>ttG	p.F30L	PDHA1_ENST00000545074.1_Missense_Mutation_p.F30L|PDHA1_ENST00000379806.5_Missense_Mutation_p.F68L|PDHA1_ENST00000379805.3_Missense_Mutation_p.F30L|PDHA1_ENST00000540249.1_Missense_Mutation_p.F30L			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	30					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					CCCGTAATTTTGCAAATGATG	0.299																																					p.F68L		Atlas-SNP	.											.	PDHA1	85	.	0			c.T204G						.						81.0	72.0	75.0					X																	19367462		2203	4300	6503	SO:0001583	missense	5160	exon3			TAATTTTGCAAAT		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.90T>G	chrX.hg19:g.19367462T>G	ENSP00000394382:p.Phe30Leu	349.0	0.0		354.0	104.0	NM_001173454	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Missense_Mutation	SNP	ENST00000422285.2	hg19	CCDS14192.1	.	.	.	.	.	.	.	.	.	.	T	14.48	2.547046	0.45383	.	.	ENSG00000131828	ENST00000379806;ENST00000545074;ENST00000540249;ENST00000423505;ENST00000417819;ENST00000422285;ENST00000355808;ENST00000379815;ENST00000379805	D;D;D;D;D;D;D;D	0.98633	-4.55;-4.5;-4.37;-4.72;-3.2;-4.54;-5.04;-4.86	5.31	1.54	0.23209	.	0.106752	0.64402	D	0.000004	D	0.95837	0.8645	L	0.50333	1.59	0.46061	D	0.998846	B;B;B;B;B	0.22003	0.017;0.063;0.016;0.052;0.016	B;B;B;B;B	0.18263	0.021;0.011;0.008;0.016;0.008	D	0.90506	0.4477	10	0.11794	T	0.64	-27.1807	9.3325	0.38030	0.0:0.297:0.0:0.703	.	30;30;30;68;30	B7Z3X5;B7Z3T7;B2R5P7;A5YVE9;P08559	.;.;.;.;ODPA_HUMAN	L	68;30;30;68;58;30;30;58;30	ENSP00000369134:F68L;ENSP00000438550:F30L;ENSP00000440761:F30L;ENSP00000406473:F68L;ENSP00000404616:F58L;ENSP00000394382:F30L;ENSP00000348062:F30L;ENSP00000369133:F30L	ENSP00000348062:F30L	F	+	3	2	PDHA1	19277383	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.852000	0.27764	0.245000	0.21373	0.486000	0.48141	TTT	.	.		0.299	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1		
USP27X	389856	hgsc.bcm.edu	37	X	49646154	49646154	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chrX:49646154T>C	ENST00000508866.2	+	1	1685	c.1244T>C	c.(1243-1245)tTa>tCa	p.L415S	USP27X-AS1_ENST00000437322.2_lincRNA	NM_001145073.1	NP_001138545.1	A6NNY8	UBP27_HUMAN	ubiquitin specific peptidase 27, X-linked	415	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(7)	7						GAAGGGTATTTACTGTTCTAT	0.458																																					p.L415S		Atlas-SNP	.											.	USP27X	25	.	0			c.T1244C						.						31.0	21.0	24.0					X																	49646154		692	1591	2283	SO:0001583	missense	389856	exon1			GGTATTTACTGTT	AW851065	CCDS65260.1	Xp11.23	2007-10-05	2005-08-08			ENSG00000273820		"""Ubiquitin-specific peptidases"""	13486	protein-coding gene	gene with protein product			"""ubiquitin specific protease 27, X chromosome"", ""ubiquitin specific protease 27, X-linked"""			12838346	Standard	NM_001145073		Approved	USP27	uc004dop.3	A6NNY8		ENST00000508866.2:c.1244T>C	chrX.hg19:g.49646154T>C	ENSP00000475071:p.Leu415Ser	225.0	0.0		267.0	74.0	NM_001145073		Missense_Mutation	SNP	ENST00000508866.2	hg19																																																																																				.	.		0.458	USP27X-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000060837.3	XM_372213	
ARR3	407	hgsc.bcm.edu	37	X	69497340	69497340	+	Silent	SNP	A	A	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chrX:69497340A>T	ENST00000307959.8	+	9	621	c.570A>T	c.(568-570)tcA>tcT	p.S190S	ARR3_ENST00000374495.3_Silent_p.S190S	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	190					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						TCCTTCTGTCAGCTCAGCCCC	0.597																																					p.S190S		Atlas-SNP	.											.	ARR3	41	.	0			c.A570T						.						54.0	49.0	51.0					X																	69497340		2203	4300	6503	SO:0001819	synonymous_variant	407	exon9			TCTGTCAGCTCAG		CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.570A>T	chrX.hg19:g.69497340A>T		337.0	1.0		388.0	119.0	NM_004312	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Silent	SNP	ENST00000307959.8	hg19	CCDS14399.1																																																																																			.	.		0.597	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057055.2	NM_004312	
CUL4B	8450	hgsc.bcm.edu	37	X	119677623	119677623	+	Silent	SNP	T	T	C			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chrX:119677623T>C	ENST00000404115.3	-	10	1670	c.1269A>G	c.(1267-1269)gaA>gaG	p.E423E	snoU13_ENST00000605987.1_RNA|CUL4B_ENST00000371322.5_Silent_p.E405E|CUL4B_ENST00000336592.6_Silent_p.E410E	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	423					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGTCTGCTTCTTCTTCTAGAC	0.343																																					p.E423E		Atlas-SNP	.											.	CUL4B	181	.	0			c.A1269G						.						252.0	243.0	246.0					X																	119677623		2203	4300	6503	SO:0001819	synonymous_variant	8450	exon10			TGCTTCTTCTTCT	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.1269A>G	chrX.hg19:g.119677623T>C		144.0	0.0		153.0	50.0	NM_003588	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Silent	SNP	ENST00000404115.3	hg19	CCDS35379.1																																																																																			.	.		0.343	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588	
SLITRK2	84631	hgsc.bcm.edu	37	X	144905172	144905172	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chrX:144905172G>T	ENST00000370490.1	+	1	5484	c.1229G>T	c.(1228-1230)aGg>aTg	p.R410M	SLITRK2_ENST00000434188.2_Missense_Mutation_p.R410M|SLITRK2_ENST00000413937.2_Missense_Mutation_p.R410M|SLITRK2_ENST00000447897.2_Missense_Mutation_p.R410M|SLITRK2_ENST00000428560.2_Missense_Mutation_p.R410M			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	410					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGAAACAACAGGATTGCAGTC	0.398																																					p.R410M		Atlas-SNP	.											.	SLITRK2	221	.	0			c.G1229T						.						112.0	107.0	108.0					X																	144905172		2203	4300	6503	SO:0001583	missense	84631	exon5			ACAACAGGATTGC	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1229G>T	chrX.hg19:g.144905172G>T	ENSP00000359521:p.Arg410Met	229.0	0.0		229.0	66.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	hg19	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765441	0.69878	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.73721	0.3623	M	0.64997	1.995	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.76545	-0.2920	10	0.87932	D	0	-7.9199	15.6062	0.76672	0.0:0.0:1.0:0.0	.	410	Q9H156	SLIK2_HUMAN	M	410	ENSP00000334374:R410M;ENSP00000411681:R410M;ENSP00000359521:R410M;ENSP00000397015:R410M;ENSP00000407347:R410M;ENSP00000412010:R410M	ENSP00000334374:R410M	R	+	2	0	SLITRK2	144712864	1.000000	0.71417	0.998000	0.56505	0.860000	0.49131	9.869000	0.99810	2.280000	0.76307	0.594000	0.82650	AGG	.	.		0.398	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
SLITRK2	84631	hgsc.bcm.edu	37	X	144906450	144906450	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chrX:144906450T>A	ENST00000370490.1	+	1	6762	c.2507T>A	c.(2506-2508)cTg>cAg	p.L836Q	SLITRK2_ENST00000434188.2_Missense_Mutation_p.L836Q|SLITRK2_ENST00000413937.2_Missense_Mutation_p.L836Q|SLITRK2_ENST00000447897.2_Missense_Mutation_p.L836Q|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000428560.2_Missense_Mutation_p.L836Q			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	836					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					CTCGAAGTTCTGGAAAAACAA	0.463																																					p.L836Q		Atlas-SNP	.											.	SLITRK2	221	.	0			c.T2507A						.						58.0	54.0	56.0					X																	144906450		2203	4300	6503	SO:0001583	missense	84631	exon5			AAGTTCTGGAAAA	Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2507T>A	chrX.hg19:g.144906450T>A	ENSP00000359521:p.Leu836Gln	388.0	0.0		454.0	145.0	NM_001144005	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	ENST00000370490.1	hg19	CCDS14680.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806306	0.70682	.	.	ENSG00000185985	ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.66	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000004	T	0.81631	0.4863	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.83586	0.0120	10	0.87932	D	0	-4.179	12.2755	0.54733	0.0:0.0:0.0:1.0	.	836	Q9H156	SLIK2_HUMAN	Q	836	ENSP00000411681:L836Q;ENSP00000359521:L836Q;ENSP00000397015:L836Q;ENSP00000407347:L836Q;ENSP00000412010:L836Q	ENSP00000359521:L836Q	L	+	2	0	SLITRK2	144714142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.803000	0.52742	0.486000	0.48141	CTG	.	.		0.463	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058633.1	NM_032539	
DSG4	147409	hgsc.bcm.edu	37	18	28992917	28992917	+	Frame_Shift_Del	DEL	T	T	-			TCGA-ZP-A9D1-01A-11D-A382-10	TCGA-ZP-A9D1-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2460c441-afaf-48ea-b29d-e1ec16a2b246	a8172d2a-1255-4865-938b-5a96f7faf691	g.chr18:28992917delT	ENST00000308128.4	+	16	2617	c.2482delT	c.(2482-2484)ttafs	p.L828fs	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Frame_Shift_Del_p.L847fs|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	828					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGTGGATGACTTAGATGAAAG	0.453																																					p.D846fs		Atlas-INDEL	.											.	DSG4	343	.	0			c.2538delC						.						135.0	125.0	128.0					18																	28992917		2203	4300	6503	SO:0001589	frameshift_variant	147409	exon15			.	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2482delT	chr18.hg19:g.28992917delT	ENSP00000311859:p.Leu828fs	84.0	0.0		121.0	40.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Frame_Shift_Del	DEL	ENST00000308128.4	hg19	CCDS11897.1																																																																																			.	.		0.453	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
