#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77334301	77334301	+	Silent	SNP	A	A	G			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr1:77334301A>G	ENST00000477717.1	+	2	370	c.135A>G	c.(133-135)caA>caG	p.Q45Q	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	45	Poly-Gln.				glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						agcagcagcaacagcagcagc	0.716																																					p.Q45Q		Atlas-SNP	.											.	ST6GALNAC5	59	.	0			c.A135G						.						11.0	12.0	12.0					1																	77334301		2032	3963	5995	SO:0001819	synonymous_variant	81849	exon2			GCAGCAACAGCAG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.135A>G	chr1.hg19:g.77334301A>G		141.0	0.0		156.0	8.0	NM_030965	B1AK82	Silent	SNP	ENST00000477717.1	hg19	CCDS673.1																																																																																			.	.		0.716	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156918128	156918128	+	Silent	SNP	G	G	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr1:156918128G>A	ENST00000361409.2	-	22	2710	c.1968C>T	c.(1966-1968)acC>acT	p.T656T	ARHGEF11_ENST00000368194.3_Silent_p.T696T|ARHGEF11_ENST00000487682.1_5'Flank|ARHGEF11_ENST00000315174.8_Silent_p.T72T	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	656					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGAGGCTGGAGGTAGAGGACG	0.612																																					p.T696T		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.C2088T						.						97.0	85.0	89.0					1																	156918128		2203	4300	6503	SO:0001819	synonymous_variant	9826	exon23			GCTGGAGGTAGAG	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.1968C>T	chr1.hg19:g.156918128G>A		113.0	0.0		146.0	22.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	hg19	CCDS1162.1																																																																																			.	.		0.612	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
DCAF6	55827	hgsc.bcm.edu	37	1	167944101	167944101	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr1:167944101A>G	ENST00000312263.6	+	4	490	c.286A>G	c.(286-288)Aac>Gac	p.N96D	DCAF6_ENST00000367843.3_Missense_Mutation_p.N96D|DCAF6_ENST00000470919.1_3'UTR|DCAF6_ENST00000367840.3_Missense_Mutation_p.N96D|DCAF6_ENST00000432587.2_Missense_Mutation_p.N65D	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	96					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						GCACCGAGCAAACATATTTAG	0.328																																					p.N96D		Atlas-SNP	.											.	DCAF6	99	.	0			c.A286G						.						103.0	98.0	100.0					1																	167944101		2203	4300	6503	SO:0001583	missense	55827	exon4			CGAGCAAACATAT	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.286A>G	chr1.hg19:g.167944101A>G	ENSP00000311949:p.Asn96Asp	431.0	0.0		590.0	299.0	NM_001198956	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	ENST00000312263.6	hg19	CCDS30933.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694303	0.88830	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45	4.92	4.92	0.64577	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.099690	0.64402	D	0.000003	D	0.89396	0.6703	M	0.89478	3.035	0.80722	D	1.000000	D;D;D;D	0.76494	0.999;0.998;0.999;0.997	D;D;D;D	0.85130	0.995;0.991;0.997;0.981	D	0.91879	0.5514	9	0.87932	D	0	.	14.8612	0.70382	1.0:0.0:0.0:0.0	.	65;96;96;96	B4DNB8;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;DCAF6_HUMAN;.	D	96;65;96;96	ENSP00000356817:N96D;ENSP00000396238:N65D;ENSP00000311949:N96D;ENSP00000356814:N96D	ENSP00000311949:N96D	N	+	1	0	DCAF6	166210725	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.648000	0.91062	1.954000	0.56735	0.454000	0.30748	AAC	.	.		0.328	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083661.2	NM_018442	
KIFAP3	22920	hgsc.bcm.edu	37	1	170003616	170003616	+	Silent	SNP	A	A	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr1:170003616A>T	ENST00000361580.2	-	7	866	c.639T>A	c.(637-639)ctT>ctA	p.L213L	KIFAP3_ENST00000367767.1_Silent_p.L169L|KIFAP3_ENST00000490550.1_5'Flank|KIFAP3_ENST00000367765.1_Silent_p.L173L|KIFAP3_ENST00000538366.1_Silent_p.L135L	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	213					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AGTGAGTAATAAGTCCATGAA	0.294																																					p.L213L		Atlas-SNP	.											.	KIFAP3	102	.	0			c.T639A						.						55.0	54.0	54.0					1																	170003616		2202	4295	6497	SO:0001819	synonymous_variant	22920	exon7			AGTAATAAGTCCA	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.639T>A	chr1.hg19:g.170003616A>T		438.0	0.0		561.0	133.0	NM_014970	B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Silent	SNP	ENST00000361580.2	hg19	CCDS1288.1																																																																																			.	.		0.294	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970	
NFASC	23114	hgsc.bcm.edu	37	1	204985578	204985578	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr1:204985578T>C	ENST00000401399.1	+	29	3833	c.3634T>C	c.(3634-3636)Tac>Cac	p.Y1212H	NFASC_ENST00000339876.6_Missense_Mutation_p.Y1212H|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000404076.1_Missense_Mutation_p.Y1129H|NFASC_ENST00000367171.4_Missense_Mutation_p.Y1304H|NFASC_ENST00000338586.6_Missense_Mutation_p.Y1196H|NFASC_ENST00000539706.1_Missense_Mutation_p.Y1146H|NFASC_ENST00000513543.1_Missense_Mutation_p.Y1141H|NFASC_ENST00000367172.4_Missense_Mutation_p.Y1319H|NFASC_ENST00000338515.6_Missense_Mutation_p.Y1229H|NFASC_ENST00000404907.1_Missense_Mutation_p.Y1146H|NFASC_ENST00000367170.4_Missense_Mutation_p.Y1240H|NFASC_ENST00000367169.4_Missense_Mutation_p.Y1043H|NFASC_ENST00000360049.4_Missense_Mutation_p.Y1141H			O94856	NFASC_HUMAN	neurofascin	1319					axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CATCGGCCAGTACACGGTCAA	0.572																																					p.Y1212H		Atlas-SNP	.											.	NFASC	396	.	0			c.T3634C						.						183.0	162.0	169.0					1																	204985578		2203	4300	6503	SO:0001583	missense	23114	exon30			GGCCAGTACACGG	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.3634T>C	chr1.hg19:g.204985578T>C	ENSP00000385637:p.Tyr1212His	154.0	0.0		203.0	50.0	NM_001005388	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	hg19	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	T	27.1	4.804331	0.90623	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393;ENST00000447819	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	5.34	5.34	0.76211	.	0.000000	0.46442	D	0.000299	D	0.96941	0.9001	M	0.87547	2.89	0.29834	N	0.829762	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;0.997;0.994;0.997;1.0	D	0.94626	0.7817	10	0.87932	D	0	.	14.9906	0.71384	0.0:0.0:0.0:1.0	.	1319;1161;1146;1196;1038;1212;1141	O94856;O94856-11;O94856-8;F8W8X7;O94856-4;O94856-9;O94856-3	NFASC_HUMAN;.;.;.;.;.;.	H	1319;1304;1240;1229;1212;1196;1161;1146;1141;1043;1129;1212;1146;1141;1137;190	ENSP00000356140:Y1319H;ENSP00000356139:Y1304H;ENSP00000356138:Y1240H;ENSP00000342128:Y1229H;ENSP00000344786:Y1212H;ENSP00000343509:Y1196H;ENSP00000438614:Y1146H;ENSP00000353154:Y1141H;ENSP00000356137:Y1043H;ENSP00000385676:Y1129H;ENSP00000385637:Y1212H;ENSP00000384061:Y1146H;ENSP00000425908:Y1141H;ENSP00000415031:Y1137H;ENSP00000416891:Y190H	ENSP00000295776:Y1161H	Y	+	1	0	NFASC	203252201	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.013000	0.88655	2.011000	0.59026	0.460000	0.39030	TAC	.	.		0.572	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
DSTYK	25778	hgsc.bcm.edu	37	1	205131199	205131199	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr1:205131199T>C	ENST00000367162.3	-	6	1813	c.1783A>G	c.(1783-1785)Agt>Ggt	p.S595G	DSTYK_ENST00000367161.3_Missense_Mutation_p.S595G|DSTYK_ENST00000367160.4_Intron	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	595					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TCGTGGGAACTATTGAGCCGA	0.527																																					p.S595G		Atlas-SNP	.											.	DSTYK	87	.	0			c.A1783G						.						60.0	56.0	57.0					1																	205131199		2203	4300	6503	SO:0001583	missense	25778	exon6			GGGAACTATTGAG	AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1783A>G	chr1.hg19:g.205131199T>C	ENSP00000356130:p.Ser595Gly	133.0	0.0		209.0	55.0	NM_199462	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Missense_Mutation	SNP	ENST00000367162.3	hg19	CCDS1451.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.418841	0.83559	.	.	ENSG00000133059	ENST00000367161;ENST00000367162	T;T	0.80123	-1.26;-1.34	5.9	5.9	0.94986	.	0.085942	0.85682	D	0.000000	D	0.85767	0.5773	L	0.58101	1.795	0.80722	D	1	P;D;P	0.54601	0.628;0.967;0.902	B;P;P	0.57101	0.184;0.813;0.554	D	0.86915	0.2063	10	0.66056	D	0.02	-11.2991	15.9847	0.80142	0.0:0.0:0.0:1.0	.	56;595;595	Q6XUX3-4;Q6XUX3-2;Q6XUX3	.;.;DUSTY_HUMAN	G	595	ENSP00000356129:S595G;ENSP00000356130:S595G	ENSP00000356129:S595G	S	-	1	0	DSTYK	203397822	1.000000	0.71417	0.993000	0.49108	0.968000	0.65278	5.056000	0.64287	2.254000	0.74563	0.482000	0.46254	AGT	.	.		0.527	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090345.1	NM_015375	
MAL	4118	hgsc.bcm.edu	37	2	95719156	95719156	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr2:95719156G>A	ENST00000309988.4	+	4	527	c.418G>A	c.(418-420)Gtg>Atg	p.V140M	MAL_ENST00000353004.3_Missense_Mutation_p.V98M|MAL_ENST00000349807.3_Missense_Mutation_p.V42M|MAL_ENST00000354078.3_Missense_Mutation_p.V84M|AC103563.9_ENST00000442200.1_RNA	NM_002371.3	NP_002362.1	P21145	MAL_HUMAN	mal, T-cell differentiation protein	140	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|central nervous system development (GO:0007417)|membrane raft polarization (GO:0001766)|myelination (GO:0042552)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	channel activity (GO:0015267)|lipid binding (GO:0008289)|peptidase activator activity involved in apoptotic process (GO:0016505)|structural constituent of myelin sheath (GO:0019911)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(2)	10				STAD - Stomach adenocarcinoma(1183;0.18)		TCTGCTCTACGTGGTCCATGC	0.512																																					p.V140M		Atlas-SNP	.											.	MAL	21	.	0			c.G418A						.						228.0	212.0	217.0					2																	95719156		2203	4300	6503	SO:0001583	missense	4118	exon4			CTCTACGTGGTCC		CCDS2006.1, CCDS2007.1, CCDS2008.1, CCDS2009.1	2q11.1	2008-07-29			ENSG00000172005	ENSG00000172005			6817	protein-coding gene	gene with protein product		188860					Standard	NM_002371		Approved		uc002stx.2	P21145	OTTHUMG00000132011	ENST00000309988.4:c.418G>A	chr2.hg19:g.95719156G>A	ENSP00000310880:p.Val140Met	63.0	0.0		71.0	47.0	NM_002371	Q6FH77	Missense_Mutation	SNP	ENST00000309988.4	hg19	CCDS2006.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.361864	0.41801	.	.	ENSG00000172005	ENST00000309988;ENST00000353004;ENST00000354078;ENST00000349807	T;T	0.45668	1.64;0.89	5.57	2.84	0.33178	Marvel (1);MARVEL-like domain (1);	0.229924	0.46145	D	0.000317	T	0.29321	0.0730	L	0.48642	1.525	0.21897	N	0.99948	B;P;P;P	0.46656	0.389;0.719;0.882;0.875	B;B;B;B	0.36766	0.023;0.104;0.232;0.218	T	0.12656	-1.0539	10	0.34782	T	0.22	.	7.9755	0.30153	0.2543:0.0:0.7457:0.0	.	42;98;84;140	P21145-4;P21145-2;P21145-3;P21145	.;.;.;MAL_HUMAN	M	140;98;84;42	ENSP00000310880:V140M;ENSP00000306568:V98M	ENSP00000310880:V140M	V	+	1	0	MAL	95082883	0.999000	0.42202	1.000000	0.80357	0.967000	0.64934	2.464000	0.45067	0.429000	0.26202	0.650000	0.86243	GTG	.	.		0.512	MAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254982.3	NM_002371	
CCDC13	152206	hgsc.bcm.edu	37	3	42750482	42750482	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr3:42750482C>A	ENST00000310232.6	-	16	2221	c.2138G>T	c.(2137-2139)gGc>gTc	p.G713V	HHATL-AS1_ENST00000600839.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	713										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CTATTGCTTGCCTGTCTTCTG	0.597																																					p.G713V		Atlas-SNP	.											.	CCDC13	71	.	0			c.G2138T						.						93.0	88.0	89.0					3																	42750482		2203	4300	6503	SO:0001583	missense	152206	exon16			TGCTTGCCTGTCT	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.2138G>T	chr3.hg19:g.42750482C>A	ENSP00000309836:p.Gly713Val	30.0	0.0		34.0	11.0	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	hg19	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	C	9.641	1.139079	0.21205	.	.	ENSG00000244607	ENST00000310232	T	0.24538	1.85	3.71	2.55	0.30701	.	0.289069	0.32287	N	0.006317	T	0.15522	0.0374	N	0.19112	0.55	0.19775	N	0.999957	B	0.25105	0.118	B	0.31245	0.126	T	0.20672	-1.0268	10	0.30854	T	0.27	.	7.2759	0.26283	0.0:0.1846:0.0:0.8154	.	713	Q8IYE1	CCD13_HUMAN	V	713	ENSP00000309836:G713V	ENSP00000309836:G713V	G	-	2	0	CCDC13	42725486	0.884000	0.30299	0.116000	0.21606	0.014000	0.08584	2.525000	0.45598	0.774000	0.33427	-0.416000	0.06073	GGC	.	.		0.597	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
CP	1356	hgsc.bcm.edu	37	3	148925166	148925166	+	Missense_Mutation	SNP	A	A	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr3:148925166A>C	ENST00000264613.6	-	5	1282	c.1020T>G	c.(1018-1020)aaT>aaG	p.N340K		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	340	F5/8 type A 1.|Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GATGGTTTAGATTCTGACAGC	0.413																																					p.N340K		Atlas-SNP	.											.	CP	112	.	0			c.T1020G						.						104.0	100.0	101.0					3																	148925166		2203	4299	6502	SO:0001583	missense	1356	exon5			GTTTAGATTCTGA	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1020T>G	chr3.hg19:g.148925166A>C	ENSP00000264613:p.Asn340Lys	107.0	0.0		112.0	34.0	NM_000096	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	hg19	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	A	19.37	3.814159	0.70912	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.99758	-6.65;-6.65	5.96	1.08	0.20341	Cupredoxin (2);Multicopper oxidase, type 1 (1);	0.106813	0.64402	D	0.000006	D	0.99336	0.9767	M	0.61703	1.905	0.29110	N	0.880911	D;D;D;D	0.65815	0.995;0.995;0.995;0.995	P;P;P;P	0.59595	0.86;0.792;0.86;0.823	D	0.99892	1.1137	10	0.30078	T	0.28	-29.9854	6.6893	0.23161	0.3781:0.1644:0.4575:0.0	.	340;340;340;340	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	K	340;123	ENSP00000264613:N340K;ENSP00000420545:N123K	ENSP00000264613:N340K	N	-	3	2	CP	150407856	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	0.900000	0.28431	0.170000	0.19704	0.533000	0.62120	AAT	.	.		0.413	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
LSG1	55341	hgsc.bcm.edu	37	3	194369468	194369468	+	Missense_Mutation	SNP	T	T	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr3:194369468T>A	ENST00000265245.5	-	11	1799	c.1485A>T	c.(1483-1485)agA>agT	p.R495S	AC046143.2_ENST00000582474.1_RNA	NM_018385.2	NP_060855.2	Q9H089	LSG1_HUMAN	large 60S subunit nuclear export GTPase 1	495					GTP catabolic process (GO:0006184)|nuclear export (GO:0051168)|protein transport (GO:0015031)|ribosome biogenesis (GO:0042254)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)	16	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		CTTCATCCTCTCTAGGCGTTA	0.418																																					p.R495S		Atlas-SNP	.											.	LSG1	38	.	0			c.A1485T						.						206.0	177.0	187.0					3																	194369468		2203	4300	6503	SO:0001583	missense	55341	exon11			ATCCTCTCTAGGC		CCDS33922.1	3q29	2013-08-21	2013-08-21		ENSG00000041802	ENSG00000041802			25652	protein-coding gene	gene with protein product		610780	"""large subunit GTPase 1 homolog (S. cerevisiae)"""			11230166	Standard	NM_018385		Approved	FLJ11301	uc003fui.3	Q9H089	OTTHUMG00000156021	ENST00000265245.5:c.1485A>T	chr3.hg19:g.194369468T>A	ENSP00000265245:p.Arg495Ser	107.0	0.0		108.0	35.0	NM_018385	A0JLT4|A0PJK3|A6NI18|Q7L9H8|Q9NUK8	Missense_Mutation	SNP	ENST00000265245.5	hg19	CCDS33922.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.389|8.389	0.839338|0.839338	0.16891|0.16891	.|.	.|.	ENSG00000041802|ENSG00000041802	ENST00000437613|ENST00000265245	.|T	.|0.13538	.|2.58	5.79|5.79	4.64|4.64	0.57946|0.57946	.|.	.|0.098489	.|0.64402	.|D	.|0.000002	T|T	0.06962|0.06962	0.0177|0.0177	N|N	0.12182|0.12182	0.205|0.205	0.58432|0.58432	D|D	0.999994|0.999994	.|B	.|0.16603	.|0.018	.|B	.|0.19666	.|0.026	T|T	0.21348|0.21348	-1.0248|-1.0248	5|10	.|0.09084	.|T	.|0.74	.|.	9.257|9.257	0.37590|0.37590	0.0:0.1556:0.0:0.8444|0.0:0.1556:0.0:0.8444	.|.	.|495	.|Q9H089	.|LSG1_HUMAN	V|S	212|495	.|ENSP00000265245:R495S	.|ENSP00000265245:R495S	E|R	-|-	2|3	0|2	LSG1|LSG1	195850757|195850757	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.378000|0.378000	0.30076|0.30076	1.796000|1.796000	0.38794|0.38794	1.037000|1.037000	0.40024|0.40024	0.528000|0.528000	0.53228|0.53228	GAG|AGA	.	.		0.418	LSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342740.1	NM_018385	
FAM193A	8603	hgsc.bcm.edu	37	4	2664933	2664933	+	Missense_Mutation	SNP	A	A	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr4:2664933A>C	ENST00000324666.5	+	10	1475	c.1124A>C	c.(1123-1125)gAa>gCa	p.E375A	FAM193A_ENST00000502458.1_Missense_Mutation_p.E397A|FAM193A_ENST00000545951.1_Missense_Mutation_p.E375A|FAM193A_ENST00000505311.1_Missense_Mutation_p.E375A|FAM193A_ENST00000382839.3_Missense_Mutation_p.E375A	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	375										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						GCCCCGAAGGAAGATGGAGTG	0.577																																					p.E397A		Atlas-SNP	.											.	FAM193A	103	.	0			c.A1190C						.						53.0	65.0	61.0					4																	2664933		2203	4300	6503	SO:0001583	missense	8603	exon11			CGAAGGAAGATGG	AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1124A>C	chr4.hg19:g.2664933A>C	ENSP00000324587:p.Glu375Ala	472.0	0.0		312.0	176.0	NM_001256667	B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Missense_Mutation	SNP	ENST00000324666.5	hg19	CCDS58875.1	.	.	.	.	.	.	.	.	.	.	A	11.52	1.661842	0.29515	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	T;T;T;T;T	0.36520	1.26;1.66;1.25;1.25;1.25	5.57	4.36	0.52297	.	0.147796	0.64402	D	0.000011	T	0.33000	0.0848	L	0.51422	1.61	0.34498	D	0.705735	B;B;B;B;B	0.10296	0.003;0.003;0.003;0.001;0.001	B;B;B;B;B	0.09377	0.004;0.004;0.004;0.004;0.004	T	0.36529	-0.9744	10	0.45353	T	0.12	-16.1954	11.9581	0.52993	0.8548:0.1452:0.0:0.0	.	375;397;375;397;375	B9EGR0;E9PFA1;P78312;B7ZM85;P78312-2	.;.;F193A_HUMAN;.;.	A	375;375;375;397;229	ENSP00000372290:E375A;ENSP00000324587:E375A;ENSP00000443617:E375A;ENSP00000427505:E397A;ENSP00000427260:E229A	ENSP00000324587:E375A	E	+	2	0	FAM193A	2634731	1.000000	0.71417	0.376000	0.26042	0.016000	0.09150	4.343000	0.59348	0.903000	0.36546	0.528000	0.53228	GAA	.	.		0.577	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360903.1	NM_003704	
ENPEP	2028	hgsc.bcm.edu	37	4	111397874	111397874	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr4:111397874T>C	ENST00000265162.5	+	1	646	c.304T>C	c.(304-306)Tac>Cac	p.Y102H		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	102					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		CCCAGTCCACTACGACCTGCA	0.612																																					p.Y102H		Atlas-SNP	.											.	ENPEP	149	.	0			c.T304C						.						92.0	97.0	95.0					4																	111397874		2203	4300	6503	SO:0001583	missense	2028	exon1			GTCCACTACGACC	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.304T>C	chr4.hg19:g.111397874T>C	ENSP00000265162:p.Tyr102His	93.0	0.0		57.0	29.0	NM_001977	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	hg19	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	T	17.75	3.466308	0.63625	.	.	ENSG00000138792	ENST00000265162	T	0.04454	3.62	5.83	5.83	0.93111	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.41834	0.1176	H	0.99516	4.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68078	-0.5504	10	0.87932	D	0	.	16.1922	0.82000	0.0:0.0:0.0:1.0	.	102	Q07075	AMPE_HUMAN	H	102	ENSP00000265162:Y102H	ENSP00000265162:Y102H	Y	+	1	0	ENPEP	111617323	1.000000	0.71417	1.000000	0.80357	0.037000	0.13140	7.633000	0.83260	2.226000	0.72624	0.459000	0.35465	TAC	.	.		0.612	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
EXOC3	11336	hgsc.bcm.edu	37	5	457080	457080	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr5:457080G>A	ENST00000512944.1	+	5	1312	c.1123G>A	c.(1123-1125)Gtg>Atg	p.V375M	EXOC3_ENST00000315013.5_Missense_Mutation_p.V375M	NM_007277.4	NP_009208.2	O60645	EXOC3_HUMAN	exocyst complex component 3	386					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|secretory granule membrane (GO:0030667)				breast(2)|cervix(1)|endometrium(4)|large_intestine(1)|lung(13)|ovary(1)|urinary_tract(1)	23		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			TTCTCCACACGTGGTCTCTGA	0.567																																					p.V375M		Atlas-SNP	.											.	EXOC3	54	.	0			c.G1123A						.						94.0	98.0	96.0					5																	457080		2128	4225	6353	SO:0001583	missense	11336	exon5			CCACACGTGGTCT	BC034427	CCDS54830.1	5p15.33	2013-01-22	2005-11-01	2005-11-01	ENSG00000180104	ENSG00000180104			30378	protein-coding gene	gene with protein product		608186	"""SEC6-like 1 (S. cerevisiae)"""	SEC6L1		8619474	Standard	XM_005248238		Approved	Sec6p	uc003jba.3	O60645	OTTHUMG00000162205	ENST00000512944.1:c.1123G>A	chr5.hg19:g.457080G>A	ENSP00000425587:p.Val375Met	123.0	0.0		233.0	147.0	NM_007277	Q6P2E8|Q8TEN6|Q8WUW0|Q96DI4	Missense_Mutation	SNP	ENST00000512944.1	hg19	CCDS54830.1	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890638	0.33348	.	.	ENSG00000180104	ENST00000512944;ENST00000315013	T;T	0.07216	3.21;3.21	5.87	4.07	0.47477	.	0.267034	0.36972	N	0.002313	T	0.07773	0.0195	L	0.54323	1.7	0.39155	D	0.9623	P	0.38551	0.636	B	0.30646	0.118	T	0.22836	-1.0205	10	0.45353	T	0.12	-35.1588	8.2681	0.31827	0.2439:0.0:0.7561:0.0	.	386	O60645	EXOC3_HUMAN	M	375	ENSP00000425587:V375M;ENSP00000323377:V375M	ENSP00000323377:V375M	V	+	1	0	EXOC3	510080	0.999000	0.42202	0.669000	0.29828	0.620000	0.37586	2.880000	0.48530	0.797000	0.33971	0.655000	0.94253	GTG	.	.		0.567	EXOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367882.1	NM_007277	
IRX1	79192	hgsc.bcm.edu	37	5	3596440	3596440	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr5:3596440C>A	ENST00000302006.3	+	1	273	c.221C>A	c.(220-222)cCc>cAc	p.P74H	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	74					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GCGGGCGCGCCCAACTACAGC	0.751																																					p.P74H		Atlas-SNP	.											.	IRX1	106	.	0			c.C221A						.						8.0	10.0	9.0					5																	3596440		1892	3864	5756	SO:0001583	missense	79192	exon1			GCGCGCCCAACTA	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.221C>A	chr5.hg19:g.3596440C>A	ENSP00000305244:p.Pro74His	35.0	0.0		92.0	12.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	hg19	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	9.634	1.137173	0.21123	.	.	ENSG00000170549	ENST00000302006	T	0.58210	0.35	2.34	2.34	0.29019	.	0.062950	0.64402	U	0.000005	T	0.30823	0.0777	N	0.05510	-0.035	0.41829	D	0.990062	B	0.22851	0.076	B	0.19148	0.024	T	0.17992	-1.0351	10	0.44086	T	0.13	.	12.6417	0.56712	0.0:1.0:0.0:0.0	.	74	P78414	IRX1_HUMAN	H	74	ENSP00000305244:P74H	ENSP00000305244:P74H	P	+	2	0	IRX1	3649440	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	1.564000	0.36375	1.290000	0.44636	0.485000	0.47835	CCC	.	.		0.751	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
TRIO	7204	hgsc.bcm.edu	37	5	14304637	14304637	+	Missense_Mutation	SNP	A	A	G			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr5:14304637A>G	ENST00000344204.4	+	8	1460	c.1436A>G	c.(1435-1437)gAc>gGc	p.D479G	TRIO_ENST00000509967.2_Missense_Mutation_p.D430G|TRIO_ENST00000537187.1_Missense_Mutation_p.D479G	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	479					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GAGCTGCAGGACCTAGAAGAT	0.413																																					p.D479G		Atlas-SNP	.											.	TRIO	305	.	0			c.A1436G						.						213.0	178.0	190.0					5																	14304637		2203	4300	6503	SO:0001583	missense	7204	exon8			TGCAGGACCTAGA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.1436A>G	chr5.hg19:g.14304637A>G	ENSP00000339299:p.Asp479Gly	150.0	0.0		292.0	51.0	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	hg19	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	A	16.81	3.224747	0.58668	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.65732	-0.17;-0.17;0.46	5.18	5.18	0.71444	.	0.052170	0.85682	D	0.000000	T	0.59918	0.2229	L	0.51422	1.61	0.80722	D	1	B;B;P	0.43392	0.112;0.167;0.805	B;B;B	0.43413	0.138;0.127;0.419	T	0.58651	-0.7599	10	0.28530	T	0.3	.	15.0541	0.71897	1.0:0.0:0.0:0.0	.	430;479;479	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	G	479;479;430;166	ENSP00000339299:D479G;ENSP00000446348:D479G;ENSP00000445592:D430G	ENSP00000339299:D479G	D	+	2	0	TRIO	14357637	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	9.307000	0.96226	1.966000	0.57179	0.528000	0.53228	GAC	.	.		0.413	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
PCDHB5	26167	hgsc.bcm.edu	37	5	140515199	140515199	+	Silent	SNP	T	T	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr5:140515199T>A	ENST00000231134.5	+	1	400	c.183T>A	c.(181-183)acT>acA	p.T61T		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AACTGGCCACTCGGGGCGCGC	0.493																																					p.T61T		Atlas-SNP	.											.	PCDHB5	184	.	0			c.T183A						.						63.0	70.0	68.0					5																	140515199		2203	4300	6503	SO:0001819	synonymous_variant	26167	exon1			GGCCACTCGGGGC	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.183T>A	chr5.hg19:g.140515199T>A		160.0	0.0		101.0	38.0	NM_015669	Q549F4|Q9UFU9	Silent	SNP	ENST00000231134.5	hg19	CCDS4247.1																																																																																			.	.		0.493	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
HIST1H4G	8369	hgsc.bcm.edu	37	6	26247104	26247104	+	Silent	SNP	A	A	G			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr6:26247104A>G	ENST00000244537.4	-	1	155	c.102T>C	c.(100-102)acT>acC	p.T34T		NM_003547.2	NP_003538.1	Q99525	H4G_HUMAN	histone cluster 1, H4g	34						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	7		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				AGCGCCGGATAGTGCACTTGG	0.562																																					p.T34T		Atlas-SNP	.											.	HIST1H4G	18	.	0			c.T102C						.						51.0	47.0	49.0					6																	26247104		2203	4300	6503	SO:0001819	synonymous_variant	8369	exon1			CCGGATAGTGCAC	Z80788	CCDS4599.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124578	ENSG00000275663		"""Histones / Replication-dependent"""	4792	protein-coding gene	gene with protein product		602832	"""H4 histone family, member L"", ""histone 1, H4g"""	H4FL		9119399, 12408966	Standard	NM_003547		Approved	H4/l	uc003nhf.3	Q99525	OTTHUMG00000014444	ENST00000244537.4:c.102T>C	chr6.hg19:g.26247104A>G		76.0	0.0		98.0	35.0	NM_003547		Silent	SNP	ENST00000244537.4	hg19	CCDS4599.1																																																																																			.	.		0.562	HIST1H4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040107.1	NM_003547	
MDC1	9656	hgsc.bcm.edu	37	6	30672288	30672288	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr6:30672288C>A	ENST00000376406.3	-	10	5319	c.4672G>T	c.(4672-4674)Ggc>Tgc	p.G1558C	MDC1_ENST00000376405.2_Missense_Mutation_p.G1294C|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1558	Interaction with the PRKDC complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TTTGTCCTGCCCCTAGTGGCC	0.582								Other conserved DNA damage response genes																													p.G1558C		Atlas-SNP	.											MDC1_ENST00000376406,bladder,carcinoma,0,2	MDC1	218	.	0			c.G4672T						.						123.0	139.0	133.0					6																	30672288		2203	4300	6503	SO:0001583	missense	9656	exon10			TCCTGCCCCTAGT	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4672G>T	chr6.hg19:g.30672288C>A	ENSP00000365588:p.Gly1558Cys	144.0	1.0		111.0	14.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	hg19	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	C	16.70	3.196338	0.58126	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.10477	2.87;2.87	4.17	1.34	0.21922	.	.	.	.	.	T	0.10809	0.0264	L	0.58810	1.83	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	T	0.10497	-1.0627	9	0.42905	T	0.14	-2.6071	3.8008	0.08757	0.1907:0.6028:0.0:0.2066	.	1294;1558	Q14676-2;Q14676	.;MDC1_HUMAN	C	1558;1294;1271;1124	ENSP00000365588:G1558C;ENSP00000365587:G1294C	ENSP00000365587:G1294C	G	-	1	0	MDC1	30780267	0.000000	0.05858	0.001000	0.08648	0.590000	0.36582	-0.298000	0.08265	0.291000	0.22468	0.449000	0.29647	GGC	.	.		0.582	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
MDC1	9656	hgsc.bcm.edu	37	6	30672323	30672323	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr6:30672323G>A	ENST00000376406.3	-	10	5284	c.4637C>T	c.(4636-4638)cCt>cTt	p.P1546L	MDC1_ENST00000376405.2_Missense_Mutation_p.P1282L|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1546	Interaction with the PRKDC complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						AGGGGTGACAGGTTGGTCTGT	0.572								Other conserved DNA damage response genes																													p.P1546L		Atlas-SNP	.											.	MDC1	218	.	0			c.C4637T						.						120.0	139.0	132.0					6																	30672323		2203	4300	6503	SO:0001583	missense	9656	exon10			GTGACAGGTTGGT	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4637C>T	chr6.hg19:g.30672323G>A	ENSP00000365588:p.Pro1546Leu	147.0	0.0		146.0	32.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	hg19	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.567538	0.28003	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.23552	1.9;1.9	4.26	3.26	0.37387	.	.	.	.	.	T	0.30541	0.0768	M	0.72894	2.215	0.09310	N	1	D;B	0.89917	1.0;0.366	D;B	0.74023	0.982;0.038	T	0.04767	-1.0928	9	0.41790	T	0.15	.	7.9752	0.30151	0.1228:0.0:0.8772:0.0	.	1282;1546	Q14676-2;Q14676	.;MDC1_HUMAN	L	1546;1282;1259;1112	ENSP00000365588:P1546L;ENSP00000365587:P1282L	ENSP00000365587:P1282L	P	-	2	0	MDC1	30780302	0.006000	0.16342	0.007000	0.13788	0.014000	0.08584	0.108000	0.15396	1.239000	0.43787	0.449000	0.29647	CCT	.	.		0.572	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
MDC1	9656	hgsc.bcm.edu	37	6	30672332	30672332	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr6:30672332G>C	ENST00000376406.3	-	10	5275	c.4628C>G	c.(4627-4629)aCa>aGa	p.T1543R	MDC1_ENST00000376405.2_Missense_Mutation_p.T1279R|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1543	Interaction with the PRKDC complex.				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						AGGTTGGTCTGTGGAGGTGGA	0.572								Other conserved DNA damage response genes																													p.T1543R		Atlas-SNP	.											.	MDC1	218	.	0			c.C4628G						.						119.0	138.0	132.0					6																	30672332		2203	4300	6503	SO:0001583	missense	9656	exon10			TGGTCTGTGGAGG	D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.4628C>G	chr6.hg19:g.30672332G>C	ENSP00000365588:p.Thr1543Arg	146.0	0.0		151.0	39.0	NM_014641	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	ENST00000376406.3	hg19	CCDS34384.1	.	.	.	.	.	.	.	.	.	.	G	9.207	1.029859	0.19512	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.10099	2.91;2.91	4.06	-4.43	0.03568	.	.	.	.	.	T	0.08179	0.0204	M	0.71581	2.175	0.09310	N	1	D;P	0.65815	0.995;0.881	P;B	0.60609	0.877;0.164	T	0.05517	-1.0880	9	0.49607	T	0.09	.	0.7113	0.00925	0.2516:0.1202:0.2236:0.4046	.	1279;1543	Q14676-2;Q14676	.;MDC1_HUMAN	R	1543;1279;1256;1109	ENSP00000365588:T1543R;ENSP00000365587:T1279R	ENSP00000365587:T1279R	T	-	2	0	MDC1	30780311	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.104000	0.01340	-0.995000	0.03459	-0.398000	0.06409	ACA	.	.		0.572	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076103.1	NM_014641	
ASCC3	10973	hgsc.bcm.edu	37	6	101073148	101073148	+	Missense_Mutation	SNP	G	G	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr6:101073148G>A	ENST00000369162.2	-	30	5049	c.4705C>T	c.(4705-4707)Cgt>Tgt	p.R1569C		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1569	Helicase C-terminal 2. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GCAGTAAGACGAGTTTGACGT	0.383																																					p.R1569C		Atlas-SNP	.											.	ASCC3	205	.	0			c.C4705T						.						113.0	107.0	109.0					6																	101073148		2203	4300	6503	SO:0001583	missense	10973	exon30			TAAGACGAGTTTG	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4705C>T	chr6.hg19:g.101073148G>A	ENSP00000358159:p.Arg1569Cys	153.0	0.0		146.0	43.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	hg19	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363799	0.82353	.	.	ENSG00000112249	ENST00000369162	D	0.85258	-1.96	5.87	4.99	0.66335	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94079	0.8102	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.70716	0.97	D	0.95933	0.8940	10	0.87932	D	0	.	14.248	0.66001	0.0:0.0:0.6752:0.3248	.	1569	Q8N3C0	HELC1_HUMAN	C	1569	ENSP00000358159:R1569C	ENSP00000358159:R1569C	R	-	1	0	ASCC3	101179869	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.389000	0.73199	1.461000	0.47929	0.585000	0.79938	CGT	.	.		0.383	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
UNC93A	54346	hgsc.bcm.edu	37	6	167705003	167705003	+	Missense_Mutation	SNP	T	T	C	rs374730365		TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr6:167705003T>C	ENST00000230256.3	+	1	201	c.26T>C	c.(25-27)cTt>cCt	p.L9P	UNC93A_ENST00000366830.2_3'UTR|UNC93A_ENST00000366829.2_Missense_Mutation_p.L9P	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		AGGAACGTCCTTGTGGTTTCC	0.453																																					p.L9P		Atlas-SNP	.											UNC93A,NS,carcinoma,0,1	UNC93A	66	.	0			c.T26C						.	T	PRO/LEU,PRO/LEU	0,4406		0,0,2203	208.0	188.0	195.0		26,26	5.6	0.1	6		195	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	UNC93A	NM_001143947.1,NM_018974.3	98,98	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging,probably-damaging	9/416,9/458	167705003	1,13005	2203	4300	6503	SO:0001583	missense	54346	exon1			ACGTCCTTGTGGT	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.26T>C	chr6.hg19:g.167705003T>C	ENSP00000230256:p.Leu9Pro	73.0	0.0		79.0	30.0	NM_018974	B3KRP5|Q4QQJ4|Q5JZD6	Missense_Mutation	SNP	ENST00000230256.3	hg19	CCDS5300.1	.	.	.	.	.	.	.	.	.	.	T	12.94	2.087996	0.36855	0.0	1.16E-4	ENSG00000112494	ENST00000503433;ENST00000230256;ENST00000366829	D;D;D	0.82526	-1.62;-1.62;-1.62	5.57	5.57	0.84162	Major facilitator superfamily domain, general substrate transporter (1);	0.162513	0.37304	N	0.002154	D	0.89199	0.6647	M	0.83012	2.62	0.50313	D	0.99986	D;D	0.76494	0.998;0.999	D;D	0.65573	0.915;0.936	D	0.90563	0.4517	10	0.59425	D	0.04	-27.3271	14.9068	0.70727	0.0:0.0:0.0:1.0	.	9;9	Q4QQJ4;Q86WB7	.;UN93A_HUMAN	P	9	ENSP00000421484:L9P;ENSP00000230256:L9P;ENSP00000355794:L9P	ENSP00000230256:L9P	L	+	2	0	UNC93A	167624993	0.844000	0.29557	0.065000	0.19835	0.005000	0.04900	6.317000	0.72862	2.123000	0.65237	0.533000	0.62120	CTT	.	.		0.453	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
INTS1	26173	hgsc.bcm.edu	37	7	1510839	1510839	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr7:1510839T>C	ENST00000404767.3	-	46	6362	c.6277A>G	c.(6277-6279)Agc>Ggc	p.S2093G	INTS1_ENST00000389470.4_Missense_Mutation_p.S2297G	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	2093					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		TCGGCCGAGCTCATCAGCCGC	0.672																																					p.S2093G		Atlas-SNP	.											.	INTS1	145	.	0			c.A6277G						.						13.0	19.0	17.0					7																	1510839		2045	4162	6207	SO:0001583	missense	26173	exon46			CCGAGCTCATCAG	AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.6277A>G	chr7.hg19:g.1510839T>C	ENSP00000385722:p.Ser2093Gly	122.0	0.0		129.0	34.0	NM_001080453	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	ENST00000404767.3	hg19	CCDS47526.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.175221	0.57692	.	.	ENSG00000164880	ENST00000404767;ENST00000389470;ENST00000483196	T;T	0.66995	-0.24;-0.24	5.38	5.38	0.77491	.	0.166079	0.64402	D	0.000004	T	0.62756	0.2454	L	0.59436	1.845	0.40761	D	0.983006	B	0.28439	0.212	B	0.27380	0.079	T	0.60855	-0.7180	10	0.23891	T	0.37	.	15.375	0.74598	0.0:0.0:0.0:1.0	.	2093	Q8N201	INT1_HUMAN	G	2093;2297;106	ENSP00000385722:S2093G;ENSP00000374121:S2297G	ENSP00000374121:S2297G	S	-	1	0	INTS1	1477365	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.902000	0.56310	2.041000	0.60428	0.379000	0.24179	AGC	.	.		0.672	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323683.1		
MACC1	346389	hgsc.bcm.edu	37	7	20199854	20199854	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr7:20199854C>A	ENST00000400331.5	-	5	438	c.130G>T	c.(130-132)Gac>Tac	p.D44Y	MACC1_ENST00000589011.1_Missense_Mutation_p.D44Y|MACC1_ENST00000332878.4_Missense_Mutation_p.D44Y	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	44					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						TGAAGCAAGTCTGGGTCCTGG	0.393																																					p.D44Y		Atlas-SNP	.											.	MACC1	99	.	0			c.G130T						.						74.0	76.0	75.0					7																	20199854		2202	4298	6500	SO:0001583	missense	346389	exon5			GCAAGTCTGGGTC		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.130G>T	chr7.hg19:g.20199854C>A	ENSP00000383185:p.Asp44Tyr	53.0	0.0		49.0	15.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	hg19	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	C	6.964	0.547810	0.13312	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.10860	2.83;2.83	5.61	-1.88	0.07713	.	1.250890	0.05323	N	0.526993	T	0.07098	0.0180	N	0.19112	0.55	0.09310	N	1	B	0.33448	0.412	B	0.35353	0.201	T	0.34428	-0.9829	10	0.72032	D	0.01	7.0831	2.3855	0.04364	0.1065:0.444:0.2068:0.2427	.	44	Q6ZN28	MACC1_HUMAN	Y	44	ENSP00000383185:D44Y;ENSP00000328410:D44Y	ENSP00000328410:D44Y	D	-	1	0	MACC1	20166379	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-1.031000	0.03578	-0.410000	0.07542	0.585000	0.79938	GAC	.	.		0.393	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
CCDC129	223075	hgsc.bcm.edu	37	7	31618002	31618002	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr7:31618002T>C	ENST00000407970.3	+	8	1162	c.1124T>C	c.(1123-1125)tTg>tCg	p.L375S	CCDC129_ENST00000409210.1_Missense_Mutation_p.L283S|CCDC129_ENST00000319386.3_Intron|CCDC129_ENST00000451887.2_Missense_Mutation_p.L401S	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	375										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						CTCAAGAGCTTGTCTCATCTT	0.498																																					p.L401S		Atlas-SNP	.											.	CCDC129	127	.	0			c.T1202C						.						49.0	49.0	49.0					7																	31618002		1991	4165	6156	SO:0001583	missense	223075	exon8			AGAGCTTGTCTCA	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.1124T>C	chr7.hg19:g.31618002T>C	ENSP00000384416:p.Leu375Ser	86.0	0.0		138.0	56.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	hg19	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	T	15.04	2.716345	0.48622	.	.	ENSG00000180347	ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T	0.27256	1.94;1.94;1.68	5.61	1.93	0.25924	.	.	.	.	.	T	0.24812	0.0602	M	0.66939	2.045	0.09310	N	1	B;B;B	0.22683	0.073;0.073;0.073	B;B;B	0.23716	0.048;0.048;0.048	T	0.26744	-1.0094	8	.	.	.	-6.5141	5.7321	0.18047	0.0:0.1504:0.1551:0.6944	.	401;385;375	F5H3V5;F5H2J8;Q6ZRS4	.;.;CC129_HUMAN	S	375;401;385;283	ENSP00000384416:L375S;ENSP00000395835:L401S;ENSP00000387214:L283S	.	L	+	2	0	CCDC129	31584527	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.857000	0.27831	0.146000	0.19002	0.533000	0.62120	TTG	.	.		0.498	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
RELN	5649	hgsc.bcm.edu	37	7	103251167	103251167	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr7:103251167T>C	ENST00000428762.1	-	22	3142	c.2983A>G	c.(2983-2985)Ata>Gta	p.I995V	RELN_ENST00000424685.2_Missense_Mutation_p.I995V|RELN_ENST00000343529.5_Missense_Mutation_p.I995V	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	995					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGAAGCACTATGACTCTCCTC	0.393																																					p.I995V	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.A2983G						.						176.0	141.0	153.0					7																	103251167		2203	4300	6503	SO:0001583	missense	5649	exon22			GCACTATGACTCT		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.2983A>G	chr7.hg19:g.103251167T>C	ENSP00000392423:p.Ile995Val	59.0	0.0		57.0	19.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	hg19	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	T	15.68	2.905559	0.52333	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21932	2.0;2.0;1.98	6.17	6.17	0.99709	.	0.296669	0.38111	N	0.001818	T	0.09686	0.0238	N	0.01352	-0.895	0.25587	N	0.986733	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.001	T	0.29181	-1.0020	10	0.62326	D	0.03	.	15.3933	0.74767	0.0:0.0:0.0:1.0	.	995;995	P78509-2;P78509	.;RELN_HUMAN	V	995	ENSP00000392423:I995V;ENSP00000345694:I995V;ENSP00000388446:I995V	ENSP00000345694:I995V	I	-	1	0	RELN	103038403	1.000000	0.71417	0.904000	0.35570	0.992000	0.81027	5.663000	0.68038	2.371000	0.80710	0.533000	0.62120	ATA	.	.		0.393	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PRSS1	5644	hgsc.bcm.edu	37	7	142460804	142460804	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr7:142460804C>T	ENST00000311737.7	+	5	683	c.677C>T	c.(676-678)cCt>cTt	p.P226L	PRSS1_ENST00000486171.1_Missense_Mutation_p.P240L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	226	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	AAGAACAAGCCTGGAGTCTAC	0.507																																					p.P226L		Atlas-SNP	.											.	PRSS1	68	.	0			c.C677T						.						86.0	87.0	87.0					7																	142460804		2203	4300	6503	SO:0001583	missense	5644	exon5			ACAAGCCTGGAGT	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.677C>T	chr7.hg19:g.142460804C>T	ENSP00000308720:p.Pro226Leu	249.0	0.0		316.0	125.0	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	hg19	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673440	0.47781	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.95137	-3.62;-3.62	3.18	3.18	0.36537	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.97663	0.9234	M	0.94101	3.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.99;0.993	D	0.98507	1.0617	10	0.87932	D	0	.	13.7261	0.62759	0.0:1.0:0.0:0.0	.	240;226	E7EQ64;P07477	.;TRY1_HUMAN	L	240;226;216	ENSP00000417854:P240L;ENSP00000308720:P226L	ENSP00000308720:P226L	P	+	2	0	PRSS1	142140378	1.000000	0.71417	0.996000	0.52242	0.062000	0.15995	7.492000	0.81482	1.721000	0.51461	0.195000	0.17529	CCT	.	.		0.507	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
TNFRSF10B	8795	hgsc.bcm.edu	37	8	22884792	22884792	+	Nonsense_Mutation	SNP	G	G	A	rs138183043		TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr8:22884792G>A	ENST00000276431.4	-	7	1074	c.790C>T	c.(790-792)Cga>Tga	p.R264*	TNFRSF10B_ENST00000347739.3_Nonsense_Mutation_p.R235*|TNFRSF10B_ENST00000519910.1_5'Flank|TNFRSF10B_ENST00000542226.1_Nonsense_Mutation_p.R84*	NM_003842.4|NM_147187.2	NP_003833.4|NP_671716.2	O14763	TR10B_HUMAN	tumor necrosis factor receptor superfamily, member 10b	264					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to endoplasmic reticulum stress (GO:0034976)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|TRAIL binding (GO:0045569)			NS(1)|endometrium(2)|large_intestine(7)|liver(1)|lung(3)|skin(1)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0179)|COAD - Colon adenocarcinoma(73;0.0703)		GCCCCAGGTCGTTGTGAGCTC	0.567																																					p.R264X	GBM(94;1064 1342 1839 21060 42553)	Atlas-SNP	.											.	TNFRSF10B	34	.	0			c.C790T						.	G	stop/ARG,stop/ARG	0,4406		0,0,2203	68.0	66.0	67.0		790,703	-0.2	0.0	8	dbSNP_134	67	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained	TNFRSF10B	NM_003842.4,NM_147187.2	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	264/441,235/412	22884792	1,13005	2203	4300	6503	SO:0001587	stop_gained	8795	exon7			CAGGTCGTTGTGA	AF012628	CCDS6035.1, CCDS6036.1	8p22-p21	2006-02-22			ENSG00000120889	ENSG00000120889		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11905	protein-coding gene	gene with protein product		603612				9285725, 9311998	Standard	NM_003842		Approved	DR5, KILLER, TRICK2A, TRAIL-R2, TRICKB, CD262	uc003xcu.2	O14763	OTTHUMG00000097826	ENST00000276431.4:c.790C>T	chr8.hg19:g.22884792G>A	ENSP00000276431:p.Arg264*	65.0	0.0		59.0	28.0	NM_003842	O14720|O15508|O15517|O15531|Q6UXM8|Q7Z360|Q9BVE0	Nonsense_Mutation	SNP	ENST00000276431.4	hg19	CCDS6035.1	.	.	.	.	.	.	.	.	.	.	g	16.59	3.166475	0.57476	0.0	1.16E-4	ENSG00000120889	ENST00000276431;ENST00000347739;ENST00000542226	.	.	.	1.77	-0.235	0.13071	.	9.625390	0.01527	U	0.018637	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	3.0633	0.06206	0.0:0.5031:0.2997:0.1973	.	.	.	.	X	264;235;84	.	ENSP00000276431:R264X	R	-	1	2	TNFRSF10B	22940737	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.181000	0.09740	-0.081000	0.12662	-0.226000	0.12346	CGA	.	G|1.000;A|0.000		0.567	TNFRSF10B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215099.2	NM_147187	
FBXO43	286151	hgsc.bcm.edu	37	8	101153292	101153292	+	Missense_Mutation	SNP	T	T	G			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr8:101153292T>G	ENST00000428847.2	-	2	1506	c.1190A>C	c.(1189-1191)gAa>gCa	p.E397A		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	397					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			CTTTTCCTCTTCTGTCTCTGA	0.507																																					p.E397A		Atlas-SNP	.											.	FBXO43	155	.	0			c.A1190C						.						114.0	111.0	112.0					8																	101153292		1989	4179	6168	SO:0001583	missense	286151	exon2			TCCTCTTCTGTCT	BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.1190A>C	chr8.hg19:g.101153292T>G	ENSP00000403293:p.Glu397Ala	103.0	0.0		109.0	31.0	NM_001029860		Missense_Mutation	SNP	ENST00000428847.2	hg19	CCDS47904.1	.	.	.	.	.	.	.	.	.	.	T	18.31	3.595499	0.66219	.	.	ENSG00000156509	ENST00000428847	T	0.40756	1.02	5.01	5.01	0.66863	.	0.114509	0.56097	D	0.000021	T	0.52419	0.1733	L	0.56769	1.78	0.46437	D	0.999042	D;D	0.62365	0.991;0.991	P;P	0.53760	0.734;0.734	T	0.54794	-0.8240	10	0.49607	T	0.09	-11.9298	15.0166	0.71591	0.0:0.0:0.0:1.0	.	363;397	C9J908;Q4G163	.;FBX43_HUMAN	A	397	ENSP00000403293:E397A	ENSP00000403293:E397A	E	-	2	0	FBXO43	101222468	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	7.069000	0.76755	2.003000	0.58678	0.533000	0.62120	GAA	.	.		0.507	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	XM_209918	
CSMD3	114788	hgsc.bcm.edu	37	8	113599446	113599446	+	Missense_Mutation	SNP	G	G	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr8:113599446G>C	ENST00000297405.5	-	23	3978	c.3734C>G	c.(3733-3735)gCa>gGa	p.A1245G	CSMD3_ENST00000352409.3_Missense_Mutation_p.A1245G|CSMD3_ENST00000343508.3_Missense_Mutation_p.A1205G|CSMD3_ENST00000455883.2_Missense_Mutation_p.A1141G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1245	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATTATTCGTTGCAGATGCACC	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.A1245G		Atlas-SNP	.											.	CSMD3	2325	.	0			c.C3734G						.						110.0	105.0	107.0					8																	113599446		2203	4300	6503	SO:0001583	missense	114788	exon23			TTCGTTGCAGATG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3734C>G	chr8.hg19:g.113599446G>C	ENSP00000297405:p.Ala1245Gly	112.0	0.0		106.0	43.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.946786	0.53186	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6	4.14	4.14	0.48551	Complement control module (1);CUB (5);	0.167271	0.40640	N	0.001057	T	0.24198	0.0586	L	0.32530	0.975	0.29213	N	0.874458	P;B;B	0.37824	0.609;0.433;0.099	B;B;B	0.35413	0.185;0.202;0.096	T	0.09487	-1.0672	10	0.25751	T	0.34	.	16.9637	0.86280	0.0:0.0:1.0:0.0	.	1141;1245;1205	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	G	1205;1245;585;1141;1245	ENSP00000345799:A1205G;ENSP00000297405:A1245G;ENSP00000341558:A585G;ENSP00000412263:A1141G;ENSP00000343124:A1245G	ENSP00000297405:A1245G	A	-	2	0	CSMD3	113668622	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.161000	0.58170	2.303000	0.77524	0.591000	0.81541	GCA	.	.		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
AKR1C3	8644	hgsc.bcm.edu	37	10	5136645	5136645	+	Silent	SNP	C	C	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr10:5136645C>T	ENST00000380554.3	+	1	661	c.9C>T	c.(7-9)tcC>tcT	p.S3S	U8_ENST00000459536.1_RNA|AKR1C3_ENST00000439082.2_Intron|AKR1C3_ENST00000605149.1_Intron|AKR1C3_ENST00000470862.2_Intron	NM_001253908.1|NM_003739.5	NP_001240837.1|NP_003730.4	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3	3				S -> P (in Ref. 3; no nucleotide entry). {ECO:0000305}.	arachidonic acid metabolic process (GO:0019369)|cellular response to cadmium ion (GO:0071276)|cellular response to calcium ion (GO:0071277)|cellular response to corticosteroid stimulus (GO:0071384)|cellular response to jasmonic acid stimulus (GO:0071395)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to reactive oxygen species (GO:0034614)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|G-protein coupled receptor signaling pathway (GO:0007186)|keratinocyte differentiation (GO:0030216)|male gonad development (GO:0008584)|multicellular organismal macromolecule metabolic process (GO:0044259)|negative regulation of retinoic acid biosynthetic process (GO:1900053)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|protein import into nucleus, translocation (GO:0000060)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of testosterone biosynthetic process (GO:2000224)|renal absorption (GO:0070293)|response to nutrient (GO:0007584)|response to prostaglandin (GO:0034694)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	15-hydroxyprostaglandin-D dehydrogenase (NADP+) activity (GO:0047020)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|dihydrotestosterone 17-beta-dehydrogenase activity (GO:0035410)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|ketoreductase activity (GO:0045703)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin D2 11-ketoreductase activity (GO:0036131)|prostaglandin F receptor activity (GO:0004958)|prostaglandin-F synthase activity (GO:0047017)|retinal dehydrogenase activity (GO:0001758)|retinol dehydrogenase activity (GO:0004745)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)|testosterone dehydrogenase (NAD+) activity (GO:0047035)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|skin(1)	14					Bimatoprost(DB00905)|Doxorubicin(DB00997)	GAATGGATTCCAAACACCAGT	0.458																																					p.S3S		Atlas-SNP	.											.	AKR1C3	21	.	0			c.C9T						.						208.0	180.0	190.0					10																	5136645		2203	4299	6502	SO:0001819	synonymous_variant	8644	exon1			GGATTCCAAACAC	L43839	CCDS7063.1, CCDS73062.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000196139	ENSG00000196139	1.1.1.213, 1.1.1.188	"""Aldo-keto reductases"""	386	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase X"", ""prostaglandin F synthase"", ""3-alpha hydroxysteroid dehydrogenase, type II"""	603966	"""hydroxysteroid (17-beta) dehydrogenase 5"", ""aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)"""	HSD17B5		7650035, 9792917	Standard	NM_003739		Approved	KIAA0119, DDX, HAKRB, PGFS	uc021pml.1	P42330	OTTHUMG00000017585	ENST00000380554.3:c.9C>T	chr10.hg19:g.5136645C>T		108.0	0.0		113.0	38.0	NM_001253909	A8K2V0|B4DL37|Q5T2L1|Q96DJ1|Q96KI8|Q99530|Q9UCX1|Q9UII3|Q9UKL9	Silent	SNP	ENST00000380554.3	hg19	CCDS7063.1																																																																																			.	.		0.458	AKR1C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046533.2	NM_003739	
PARD3	56288	hgsc.bcm.edu	37	10	34671515	34671515	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr10:34671515T>C	ENST00000374789.3	-	9	1677	c.1352A>G	c.(1351-1353)tAt>tGt	p.Y451C	PARD3_ENST00000544292.1_Missense_Mutation_p.Y181C|PARD3_ENST00000374776.1_Missense_Mutation_p.Y451C|PARD3_ENST00000340077.5_Missense_Mutation_p.Y451C|PARD3_ENST00000545260.1_Missense_Mutation_p.Y407C|PARD3_ENST00000545693.1_Missense_Mutation_p.Y451C|PARD3_ENST00000350537.4_Missense_Mutation_p.Y451C|PARD3_ENST00000374790.3_Missense_Mutation_p.Y407C|PARD3_ENST00000346874.4_Missense_Mutation_p.Y451C|PARD3_ENST00000374788.3_Missense_Mutation_p.Y451C|PARD3_ENST00000374794.3_Missense_Mutation_p.Y407C|PARD3_ENST00000374773.1_Missense_Mutation_p.Y451C	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	451					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				TTTGGTGTTATAACCACTGCT	0.443																																					p.Y451C		Atlas-SNP	.											.	PARD3	131	.	0			c.A1352G						.						121.0	116.0	118.0					10																	34671515		2203	4300	6503	SO:0001583	missense	56288	exon9			GTGTTATAACCAC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1352A>G	chr10.hg19:g.34671515T>C	ENSP00000363921:p.Tyr451Cys	87.0	0.0		67.0	21.0	NM_001184788	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	hg19	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.212609	0.58452	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292	T;T;T;T;T;T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21;2.21;2.21;2.21;2.21;2.21	5.88	5.88	0.94601	PDZ/DHR/GLGF (1);	0.224065	0.47852	D	0.000210	T	0.39118	0.1066	M	0.62723	1.935	0.45762	D	0.998656	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.76494	0.997;0.999;0.999;0.997;0.999;0.997;0.997;0.963;0.963;0.994;0.998;0.987;0.984;0.991;0.966	P;D;D;P;D;P;P;P;P;P;P;P;P;P;P	0.71184	0.895;0.93;0.972;0.852;0.972;0.852;0.852;0.537;0.631;0.716;0.867;0.841;0.873;0.902;0.873	T	0.04565	-1.0942	10	0.37606	T	0.19	.	16.3009	0.82811	0.0:0.0:0.0:1.0	.	407;407;451;451;451;451;451;451;407;451;451;451;451;451;181	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0;Q5VWV2;Q6IQ47;Q5VWU8;Q8TEW0-8;Q8TEW0-9;Q8TEW0-10;F5GZI3	.;.;.;.;.;.;.;PARD3_HUMAN;.;.;.;.;.;.;.	C	451;407;451;451;451;407;451;407;451;451;451;181	ENSP00000443147:Y451C;ENSP00000440857:Y407C;ENSP00000363921:Y451C;ENSP00000363920:Y451C;ENSP00000340591:Y451C;ENSP00000363926:Y407C;ENSP00000311986:Y451C;ENSP00000363922:Y407C;ENSP00000363908:Y451C;ENSP00000341844:Y451C;ENSP00000363905:Y451C;ENSP00000444429:Y181C	ENSP00000341844:Y451C	Y	-	2	0	PARD3	34711521	1.000000	0.71417	0.650000	0.29550	0.655000	0.38815	5.210000	0.65214	2.246000	0.74042	0.533000	0.62120	TAT	.	.		0.443	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	
TBC1D12	23232	hgsc.bcm.edu	37	10	96163102	96163102	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr10:96163102G>T	ENST00000225235.4	+	1	842	c.732G>T	c.(730-732)gaG>gaT	p.E244D		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	244							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GGGGTCCCGAGGAGGGCGCGC	0.706																																					p.E244D		Atlas-SNP	.											.	TBC1D12	51	.	0			c.G732T						.						4.0	7.0	6.0					10																	96163102		1623	3594	5217	SO:0001583	missense	23232	exon1			TCCCGAGGAGGGC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.732G>T	chr10.hg19:g.96163102G>T	ENSP00000225235:p.Glu244Asp	203.0	0.0		210.0	79.0	NM_015188	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Missense_Mutation	SNP	ENST00000225235.4	hg19	CCDS41553.1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464795	0.26335	.	.	ENSG00000108239	ENST00000225235	T	0.05447	3.44	3.26	1.34	0.21922	.	1.938870	0.03361	U	0.197532	T	0.03871	0.0109	N	0.08118	0	0.09310	N	1	B	0.17667	0.023	B	0.12156	0.007	T	0.41680	-0.9495	10	0.15499	T	0.54	.	6.9076	0.24317	0.2459:0.0:0.7541:0.0	.	244	O60347	TBC12_HUMAN	D	244	ENSP00000225235:E244D	ENSP00000225235:E244D	E	+	3	2	TBC1D12	96153092	0.979000	0.34478	0.014000	0.15608	0.067000	0.16453	1.762000	0.38451	0.212000	0.20703	0.462000	0.41574	GAG	.	.		0.706	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
TRPM5	29850	hgsc.bcm.edu	37	11	2434047	2434047	+	Silent	SNP	G	G	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr11:2434047G>A	ENST00000155858.6	-	15	2300	c.2292C>T	c.(2290-2292)ccC>ccT	p.P764P	TRPM5_ENST00000452833.1_Silent_p.P766P|TRPM5_ENST00000533060.1_Silent_p.P764P|TRPM5_ENST00000528453.1_Silent_p.P764P	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CGGGCCCTGAGGGGCCCTGGG	0.627																																					p.P764P	NSCLC(1;49 61 17205 18850 43201)	Atlas-SNP	.											.	TRPM5	86	.	0			c.C2292T						.						19.0	20.0	19.0					11																	2434047		2187	4294	6481	SO:0001819	synonymous_variant	29850	exon15			CCCTGAGGGGCCC	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2292C>T	chr11.hg19:g.2434047G>A		153.0	0.0		148.0	44.0	NM_014555		Silent	SNP	ENST00000155858.6	hg19	CCDS31340.1																																																																																			.	.		0.627	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	
MS4A6A	64231	hgsc.bcm.edu	37	11	59949192	59949192	+	Silent	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr11:59949192T>C	ENST00000530839.1	-	3	501	c.9A>G	c.(7-9)tcA>tcG	p.S3S	MS4A6A_ENST00000529054.1_Silent_p.S31S|MS4A6A_ENST00000533023.1_Silent_p.S3S|MS4A6A_ENST00000420732.2_Silent_p.S3S|MS4A6A_ENST00000412309.2_Silent_p.S31S|MS4A6A_ENST00000528851.1_Silent_p.S3S|MS4A6A_ENST00000529906.1_5'Flank|MS4A6A_ENST00000426738.2_Silent_p.S3S|MS4A6A_ENST00000323961.3_Silent_p.S3S|MS4A6A_ENST00000532169.1_Silent_p.S3S	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	3						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAACAGGTTGTGATGTCATGA	0.448																																					p.S31S		Atlas-SNP	.											.	MS4A6A	85	.	0			c.A93G						.						210.0	188.0	196.0					11																	59949192		2201	4295	6496	SO:0001819	synonymous_variant	64231	exon3			AGGTTGTGATGTC	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.9A>G	chr11.hg19:g.59949192T>C		185.0	0.0		173.0	60.0	NM_001247999	A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Silent	SNP	ENST00000530839.1	hg19	CCDS7981.1																																																																																			.	.		0.448	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1		
BAZ2A	11176	hgsc.bcm.edu	37	12	56993613	56993613	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr12:56993613T>C	ENST00000551812.1	-	26	5244	c.5051A>G	c.(5050-5052)aAg>aGg	p.K1684R	BAZ2A_ENST00000553222.1_5'Flank|BAZ2A_ENST00000549884.1_Missense_Mutation_p.K1682R|BAZ2A_ENST00000179765.5_Missense_Mutation_p.K1652R|BAZ2A_ENST00000379441.3_Missense_Mutation_p.K1654R	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1684					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						ATTGTCACCCTTCCGGCAGAC	0.572																																					p.K1684R		Atlas-SNP	.											.	BAZ2A	263	.	0			c.A5051G						.						76.0	78.0	77.0					12																	56993613		2068	4212	6280	SO:0001583	missense	11176	exon26			TCACCCTTCCGGC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.5051A>G	chr12.hg19:g.56993613T>C	ENSP00000446880:p.Lys1684Arg	89.0	0.0		100.0	29.0	NM_013449	B3KN66|O00536|O15030|Q68DI8|Q96H26	Missense_Mutation	SNP	ENST00000551812.1	hg19	CCDS44924.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.706213	0.89018	.	.	ENSG00000076108	ENST00000379441;ENST00000179765;ENST00000551812;ENST00000549787;ENST00000549884	D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91	5.01	5.01	0.66863	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.87845	0.6280	L	0.34521	1.04	0.58432	D	0.999998	D;P;P;D	0.89917	0.998;0.676;0.771;1.0	D;P;P;D	0.85130	0.991;0.711;0.644;0.997	D	0.87757	0.2596	10	0.44086	T	0.13	-22.0809	14.3902	0.66973	0.0:0.0:0.0:1.0	.	1682;1680;1684;1657	F8VU39;Q9UIF9-3;Q9UIF9;Q9UIF9-2	.;.;BAZ2A_HUMAN;.	R	1654;1652;1684;616;1682	ENSP00000368754:K1654R;ENSP00000179765:K1652R;ENSP00000446880:K1684R;ENSP00000448760:K616R;ENSP00000447941:K1682R	ENSP00000179765:K1652R	K	-	2	0	BAZ2A	55279880	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.602000	0.54066	2.177000	0.69029	0.533000	0.62120	AAG	.	.		0.572	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408561.1	NM_013449	
ELK3	2004	hgsc.bcm.edu	37	12	96641039	96641039	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr12:96641039G>T	ENST00000228741.3	+	3	855	c.529G>T	c.(529-531)Gaa>Taa	p.E177*	ELK3_ENST00000552142.1_Intron	NM_005230.2	NP_005221.2	P41970	ELK3_HUMAN	ELK3, ETS-domain protein (SRF accessory protein 2)	177					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|wound healing (GO:0042060)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(5)|ovary(2)|prostate(1)|stomach(2)	20	all_cancers(2;0.00173)					CCCCCCCGTGGAAGAAGTCAG	0.597																																					p.E177X		Atlas-SNP	.											.	ELK3	36	.	0			c.G529T						.						55.0	57.0	56.0					12																	96641039		2203	4300	6503	SO:0001587	stop_gained	2004	exon3			CCCGTGGAAGAAG	BC017371	CCDS9060.1	12q23	2006-12-30				ENSG00000111145			3325	protein-coding gene	gene with protein product		600247				7851904	Standard	NM_005230		Approved	ERP, NET, SAP2	uc001teo.1	P41970		ENST00000228741.3:c.529G>T	chr12.hg19:g.96641039G>T	ENSP00000228741:p.Glu177*	90.0	0.0		90.0	38.0	NM_005230	B2R6S6|Q6FG57|Q6GU29|Q9UD17	Nonsense_Mutation	SNP	ENST00000228741.3	hg19	CCDS9060.1	.	.	.	.	.	.	.	.	.	.	G	39	7.612086	0.98390	.	.	ENSG00000111145	ENST00000228741	.	.	.	5.65	5.65	0.86999	.	0.382249	0.32343	N	0.006229	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.7205	0.96142	0.0:0.0:1.0:0.0	.	.	.	.	X	177	.	ENSP00000228741:E177X	E	+	1	0	ELK3	95165170	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.594000	0.74104	2.671000	0.90904	0.462000	0.41574	GAA	.	.		0.597	ELK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408694.1	NM_005230	
FZD10	11211	hgsc.bcm.edu	37	12	130648052	130648052	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr12:130648052C>T	ENST00000229030.4	+	1	1049	c.565C>T	c.(565-567)Cgc>Tgc	p.R189C	FZD10-AS1_ENST00000505807.2_RNA|FZD10_ENST00000539839.1_Missense_Mutation_p.A156V			Q9ULW2	FZD10_HUMAN	frizzled class receptor 10	189					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|gonad development (GO:0008406)|negative regulation of Rho GTPase activity (GO:0034259)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of actin cytoskeleton organization (GO:0032956)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|pancreas(1)|prostate(3)|urinary_tract(1)	35	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		gggccccgggcgcggcggcTG	0.761																																					p.R189C		Atlas-SNP	.											.	FZD10	95	.	0			c.C565T						.						7.0	9.0	8.0					12																	130648052		2060	4016	6076	SO:0001583	missense	11211	exon1			CCCGGGCGCGGCG	AB027464	CCDS9267.1	12q24.33	2014-01-29	2014-01-29			ENSG00000111432		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4039	protein-coding gene	gene with protein product		606147	"""frizzled (Drosophila) homolog 10"", ""frizzled homolog 10 (Drosophila)"", ""frizzled 10, seven transmembrane spanning receptor"", ""frizzled family receptor 10"""			10448064	Standard	NM_007197		Approved	CD350	uc001uii.3	Q9ULW2		ENST00000229030.4:c.565C>T	chr12.hg19:g.130648052C>T	ENSP00000229030:p.Arg189Cys	98.0	0.0		79.0	9.0	NM_007197		Missense_Mutation	SNP	ENST00000229030.4	hg19	CCDS9267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.416|8.416	0.845394|0.845394	0.16963|0.16963	.|.	.|.	ENSG00000111432|ENSG00000111432	ENST00000539839|ENST00000229030	.|T	.|0.76968	.|-1.06	4.94|4.94	4.94|4.94	0.65067|0.65067	.|.	.|0.701794	.|0.11876	.|U	.|0.520940	T|T	0.70798|0.70798	0.3265|0.3265	L|L	0.44542|0.44542	1.39|1.39	0.53688|0.53688	D|D	0.999978|0.999978	.|B	.|0.16396	.|0.017	.|B	.|0.11329	.|0.006	T|T	0.64398|0.64398	-0.6417|-0.6417	6|10	0.87932|0.37606	D|T	0|0.19	.|.	11.1185|11.1185	0.48275|0.48275	0.2976:0.7024:0.0:0.0|0.2976:0.7024:0.0:0.0	.|.	.|189	.|Q9ULW2	.|FZD10_HUMAN	V|C	156|189	.|ENSP00000229030:R189C	ENSP00000438460:A156V|ENSP00000229030:R189C	A|R	+|+	2|1	0|0	FZD10|FZD10	129214005|129214005	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.289000|0.289000	0.27227|0.27227	3.350000|3.350000	0.52224|0.52224	2.270000|2.270000	0.75569|0.75569	0.491000|0.491000	0.48974|0.48974	GCG|CGC	.	.		0.761	FZD10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
MLH3	27030	hgsc.bcm.edu	37	14	75514826	75514826	+	Silent	SNP	A	A	G			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr14:75514826A>G	ENST00000556740.1	-	1	1568	c.1533T>C	c.(1531-1533)ccT>ccC	p.P511P	MLH3_ENST00000238662.7_Silent_p.P511P|MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000355774.2_Silent_p.P511P|MLH3_ENST00000556257.1_Silent_p.P511P			Q9UHC1	MLH3_HUMAN	mutL homolog 3	511					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GTGTCTGAAAAGGGCTTAAAA	0.378								Mismatch excision repair (MMR)																													p.P511P		Atlas-SNP	.											.	MLH3	200	.	0			c.T1533C						.						76.0	80.0	79.0					14																	75514826		2203	4300	6503	SO:0001819	synonymous_variant	27030	exon2			CTGAAAAGGGCTT	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.1533T>C	chr14.hg19:g.75514826A>G		129.0	0.0		90.0	4.0	NM_014381	P49751|Q56DK9|Q9P292|Q9UHC0	Silent	SNP	ENST00000556740.1	hg19	CCDS32123.1																																																																																			.	.		0.378	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
COG8	84342	hgsc.bcm.edu	37	16	69368984	69368984	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr16:69368984T>C	ENST00000306875.4	-	3	967	c.853A>G	c.(853-855)Atc>Gtc	p.I285V	COG8_ENST00000562081.1_Missense_Mutation_p.I285V|RP11-343C2.12_ENST00000562949.1_5'Flank	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	285					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						TGGGTGATGATATCAAAGAGA	0.522																																					p.I285V		Atlas-SNP	.											.	COG8	32	.	0			c.A853G						.						90.0	74.0	79.0					16																	69368984		2198	4300	6498	SO:0001583	missense	84342	exon3			TGATGATATCAAA	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.853A>G	chr16.hg19:g.69368984T>C	ENSP00000305459:p.Ile285Val	172.0	0.0		173.0	58.0	NM_032382	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	ENST00000306875.4	hg19	CCDS10876.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.386123	0.42308	.	.	ENSG00000213380	ENST00000306875	T	0.47869	0.83	5.93	3.66	0.41972	Cullin repeat-like-containing domain (1);	0.137590	0.64402	N	0.000003	T	0.41026	0.1141	L	0.33189	0.99	0.44677	D	0.997665	B;B	0.26258	0.058;0.145	B;B	0.40825	0.152;0.341	T	0.18524	-1.0334	10	0.22706	T	0.39	11.3878	7.7494	0.28888	0.0:0.3213:0.0:0.6787	.	312;285	B4DYU2;Q96MW5	.;COG8_HUMAN	V	285	ENSP00000305459:I285V	ENSP00000305459:I285V	I	-	1	0	COG8	67926485	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.670000	0.37502	1.035000	0.39972	0.460000	0.39030	ATC	.	.		0.522	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
ANKRD11	29123	hgsc.bcm.edu	37	16	89348575	89348575	+	Missense_Mutation	SNP	T	T	C			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr16:89348575T>C	ENST00000301030.4	-	9	4835	c.4375A>G	c.(4375-4377)Aag>Gag	p.K1459E	ANKRD11_ENST00000378330.2_Missense_Mutation_p.K1459E	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1459	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		ctcttcttcttctctttTAGG	0.468																																					p.K1459E		Atlas-SNP	.											.	ANKRD11	195	.	0			c.A4375G						.						109.0	76.0	87.0					16																	89348575		2198	4300	6498	SO:0001583	missense	29123	exon9			TCTTCTTCTCTTT	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.4375A>G	chr16.hg19:g.89348575T>C	ENSP00000301030:p.Lys1459Glu	62.0	0.0		63.0	20.0	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	hg19	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	9.505	1.104280	0.20632	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.47528	0.84;0.84	5.11	5.11	0.69529	.	0.125201	0.52532	D	0.000065	T	0.53318	0.1789	M	0.69823	2.125	0.80722	D	1	P	0.48694	0.914	P	0.48030	0.564	T	0.52245	-0.8601	10	0.18710	T	0.47	.	14.8585	0.70359	0.0:0.0:0.0:1.0	.	1459	Q6UB99	ANR11_HUMAN	E	1459	ENSP00000301030:K1459E;ENSP00000367581:K1459E	ENSP00000301030:K1459E	K	-	1	0	ANKRD11	87876076	1.000000	0.71417	0.986000	0.45419	0.073000	0.16967	5.767000	0.68850	2.045000	0.60652	0.460000	0.39030	AAG	.	.		0.468	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
TP53	7157	hgsc.bcm.edu	37	17	7577099	7577099	+	Missense_Mutation	SNP	C	C	T	rs121912660		TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr17:7577099C>T	ENST00000269305.4	-	8	1028	c.839G>A	c.(838-840)aGa>aAa	p.R280K	TP53_ENST00000359597.4_Missense_Mutation_p.R280K|TP53_ENST00000445888.2_Missense_Mutation_p.R280K|TP53_ENST00000420246.2_Missense_Mutation_p.R280K|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R280K|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	280	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> K (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|R -> P (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1631151}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R280T(65)|p.R280K(49)|p.R280I(16)|p.0?(8)|p.?(2)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCGCCGGTCTCTCCCAGGACA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R280K	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,carcinoma,-1,147	TP53	33396	.	154	Substitution - Missense(130)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(2)	urinary_tract(50)|breast(22)|lung(20)|upper_aerodigestive_tract(14)|haematopoietic_and_lymphoid_tissue(8)|large_intestine(5)|central_nervous_system(5)|stomach(4)|biliary_tract(4)|oesophagus(4)|skin(4)|ovary(4)|bone(4)|prostate(3)|small_intestine(1)|endometrium(1)|vagina(1)	c.G839A	GRCh37	CM993218	TP53	M	rs121912660	.						77.0	67.0	70.0					17																	7577099		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGGTCTCTCCCAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.839G>A	chr17.hg19:g.7577099C>T	ENSP00000269305:p.Arg280Lys	112.0	0.0		70.0	34.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	36	5.663043	0.96745	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.92649	3.33	0.80722	D	1	D;D;D;P	0.69078	0.972;0.997;0.977;0.896	D;D;D;D	0.85130	0.942;0.997;0.941;0.921	D	0.96400	0.9296	10	0.87932	D	0	-21.0303	16.1198	0.81342	0.0:1.0:0.0:0.0	.	280;280;280;280	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	280;280;280;280;280;269;148	ENSP00000352610:R280K;ENSP00000269305:R280K;ENSP00000398846:R280K;ENSP00000391127:R280K;ENSP00000391478:R280K;ENSP00000425104:R148K	ENSP00000269305:R280K	R	-	2	0	TP53	7517824	0.978000	0.34361	1.000000	0.80357	0.980000	0.70556	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	AGA	.	.		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
POLG2	11232	hgsc.bcm.edu	37	17	62492649	62492649	+	Missense_Mutation	SNP	C	C	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr17:62492649C>A	ENST00000539111.2	-	1	505	c.438G>T	c.(436-438)agG>agT	p.R146S		NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	146					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			CAGAAACTAACCTGAAGGCAC	0.507																																					p.R146S	Colon(3;18 21 435 17652 48887)	Atlas-SNP	.											.	POLG2	29	.	0			c.G438T						.						96.0	93.0	94.0					17																	62492649		2203	4300	6503	SO:0001583	missense	11232	exon1			AACTAACCTGAAG	U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.438G>T	chr17.hg19:g.62492649C>A	ENSP00000442563:p.Arg146Ser	165.0	0.0		247.0	114.0	NM_007215	O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	ENST00000539111.2	hg19	CCDS32706.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.386787	0.61956	.	.	ENSG00000256525	ENST00000539111	T	0.77358	-1.09	5.15	3.04	0.35103	.	0.217217	0.41396	D	0.000888	T	0.75481	0.3855	L	0.48642	1.525	0.50632	D	0.999888	P;P	0.47253	0.892;0.892	P;P	0.52598	0.703;0.703	T	0.72868	-0.4162	10	0.39692	T	0.17	-13.5186	7.3304	0.26580	0.1258:0.6789:0.1224:0.0729	.	146;146	E5KS15;Q9UHN1	.;DPOG2_HUMAN	S	146	ENSP00000442563:R146S	ENSP00000442563:R146S	R	-	3	2	POLG2	59923111	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.745000	0.38278	2.428000	0.82296	0.555000	0.69702	AGG	.	.		0.507	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443820.1	NM_007215	
CEP95	90799	hgsc.bcm.edu	37	17	62522209	62522209	+	Missense_Mutation	SNP	C	C	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr17:62522209C>T	ENST00000556440.2	+	10	1553	c.1043C>T	c.(1042-1044)gCc>gTc	p.A348V	CEP95_ENST00000553412.1_Missense_Mutation_p.A184V|CEP95_ENST00000577476.1_3'UTR	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	348						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AGAGCTACAGCCTCATCCTGC	0.353																																					p.A348V		Atlas-SNP	.											.	CEP95	103	.	0			c.C1043T						.						116.0	113.0	114.0					17																	62522209		1848	4092	5940	SO:0001583	missense	90799	exon10			CTACAGCCTCATC	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1043C>T	chr17.hg19:g.62522209C>T	ENSP00000450461:p.Ala348Val	140.0	0.0		183.0	33.0	NM_138363	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	hg19	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.806742	0.00606	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.31247	1.5;1.5	5.19	-1.27	0.09347	.	1.613740	0.03097	N	0.160567	T	0.13756	0.0333	N	0.05383	-0.06	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10474	-1.0628	10	0.26408	T	0.33	2.2769	0.8833	0.01239	0.2949:0.1364:0.1325:0.4363	.	348	Q96GE4	CEP95_HUMAN	V	283;348;184	ENSP00000450461:A348V;ENSP00000450906:A184V	ENSP00000438458:A283V	A	+	2	0	CEP95	59952671	0.103000	0.21917	0.007000	0.13788	0.021000	0.10359	0.056000	0.14256	-0.376000	0.07943	0.563000	0.77884	GCC	.	.		0.353	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363	
KHSRP	8570	hgsc.bcm.edu	37	19	6427484	6427484	+	5'Flank	SNP	C	C	T	rs370967882	byFrequency	TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr19:6427484C>T	ENST00000398148.3	-	0	0				SLC25A41_ENST00000321510.6_Missense_Mutation_p.R218Q	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein						gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						CTGGCCCGTCCGACGCAAGGT	0.617													C|||	6	0.00119808	0.0	0.0014	5008	,	,		17211	0.0		0.002	False		,,,				2504	0.0031				p.R218Q	Colon(55;593 1006 2067 9135 22980)	Atlas-SNP	.											.	SLC25A41	26	.	0			c.G653A						.	C	GLN/ARG	0,4400		0,0,2200	21.0	25.0	24.0		653	1.8	0.0	19		24	1,8591		0,1,4295	no	missense	SLC25A41	NM_173637.3	43	0,1,6495	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	218/371	6427484	1,12991	2200	4296	6496	SO:0001631	upstream_gene_variant	284427	exon5			CCCGTCCGACGCA	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945			chr19.hg19:g.6427484C>T	Exception_encountered	163.0	0.0		153.0	46.0	NM_173637	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	hg19	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976333	0.34848	0.0	1.16E-4	ENSG00000181240	ENST00000321510	T	0.78246	-1.16	4.07	1.82	0.25136	Mitochondrial carrier domain (2);	.	.	.	.	T	0.57888	0.2084	L	0.28608	0.87	0.80722	D	1	P	0.37083	0.581	B	0.28784	0.094	T	0.50448	-0.8827	9	0.44086	T	0.13	-12.87	4.9452	0.13985	0.1761:0.6309:0.0:0.1931	.	218	Q8N5S1	S2541_HUMAN	Q	218	ENSP00000322649:R218Q	ENSP00000322649:R218Q	R	-	2	0	SLC25A41	6378484	0.097000	0.21791	0.036000	0.18154	0.317000	0.28152	1.067000	0.30616	0.320000	0.23234	0.462000	0.41574	CGG	.	.		0.617	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
CLEC4M	10332	hgsc.bcm.edu	37	19	7830731	7830731	+	Missense_Mutation	SNP	G	G	A	rs76899402		TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr19:7830731G>A	ENST00000327325.5	+	4	540	c.422G>A	c.(421-423)cGg>cAg	p.R141Q	CLEC4M_ENST00000595496.1_Missense_Mutation_p.R120Q|CLEC4M_ENST00000394122.2_Missense_Mutation_p.R129Q|CLEC4M_ENST00000357361.2_Missense_Mutation_p.R141Q|CLEC4M_ENST00000334806.5_Intron|CLEC4M_ENST00000597522.1_Missense_Mutation_p.R141Q|CLEC4M_ENST00000359059.5_Intron|CLEC4M_ENST00000596707.1_Missense_Mutation_p.R120Q|CLEC4M_ENST00000596363.1_Missense_Mutation_p.R113Q|CLEC4M_ENST00000248228.4_Intron	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	141	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)	p.R141Q(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						GAGCTGACCCGGCTGAAGGCT	0.582																																					p.R141Q		Atlas-SNP	.											CLEC4M,colon,carcinoma,0,1	CLEC4M	58	.	1	Substitution - Missense(1)	large_intestine(1)	c.G422A						.						13.0	13.0	13.0					19																	7830731		1642	3266	4908	SO:0001583	missense	10332	exon4			TGACCCGGCTGAA	AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.422G>A	chr19.hg19:g.7830731G>A	ENSP00000316228:p.Arg141Gln	29.0	0.0		34.0	3.0	NM_001144908	A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	ENST00000327325.5	hg19	CCDS12187.1	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.920834	0.00498	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000357361;ENST00000358690	T;T;T	0.22336	1.97;1.96;1.97	0.905	-1.81	0.07882	.	.	.	.	.	T	0.07188	0.0182	N	0.04636	-0.2	0.09310	N	1	B;B;B;B;B;B;B	0.17268	0.004;0.001;0.001;0.0;0.007;0.021;0.001	B;B;B;B;B;B;B	0.10450	0.003;0.005;0.001;0.0;0.002;0.003;0.005	T	0.33059	-0.9883	9	0.07482	T	0.82	.	6.6496	0.22955	0.409:0.0:0.591:0.0	.	120;113;141;113;120;141;85	Q9H2X3-5;B4DNV9;Q9H2X3;Q9H2X3-9;Q9H2X3-7;Q9H2X3-4;Q9H2X3-10	.;.;CLC4M_HUMAN;.;.;.;.	Q	141;129;141;85	ENSP00000316228:R141Q;ENSP00000377680:R129Q;ENSP00000349924:R141Q	ENSP00000316228:R141Q	R	+	2	0	CLEC4M	7736731	0.001000	0.12720	0.004000	0.12327	0.024000	0.10985	-1.792000	0.01756	-2.527000	0.00494	-2.768000	0.00120	CGG	.	G|0.250;A|0.750		0.582	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	NM_014257	
MUC16	94025	hgsc.bcm.edu	37	19	9060294	9060294	+	Missense_Mutation	SNP	G	G	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr19:9060294G>T	ENST00000397910.4	-	3	27355	c.27152C>A	c.(27151-27153)tCc>tAc	p.S9051Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9053	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGACATTGTGGACTGATCAGG	0.488																																					p.S9051Y		Atlas-SNP	.											.	MUC16	4315	.	0			c.C27152A						.						161.0	150.0	153.0					19																	9060294		2014	4192	6206	SO:0001583	missense	94025	exon3			ATTGTGGACTGAT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27152C>A	chr19.hg19:g.9060294G>T	ENSP00000381008:p.Ser9051Tyr	77.0	0.0		94.0	26.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	7.963	0.747399	0.15710	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.53	1.53	0.23141	.	.	.	.	.	T	0.07369	0.0186	L	0.46157	1.445	.	.	.	D	0.62365	0.991	P	0.62649	0.905	T	0.17167	-1.0378	8	0.87932	D	0	.	6.4855	0.22087	0.0:0.0:1.0:0.0	.	9051	B5ME49	.	Y	9051	ENSP00000381008:S9051Y	ENSP00000381008:S9051Y	S	-	2	0	MUC16	8921294	0.000000	0.05858	0.001000	0.08648	0.536000	0.34869	-0.201000	0.09464	1.157000	0.42530	0.306000	0.20318	TCC	.	.		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
PPAN	56342	hgsc.bcm.edu	37	19	10221280	10221280	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr19:10221280G>T	ENST00000253107.7	+	10	1127	c.1021G>T	c.(1021-1023)Gag>Tag	p.E341*	PPAN-P2RY11_ENST00000393796.4_Nonsense_Mutation_p.E341*|SNORD105_ENST00000386910.1_RNA|PPAN-P2RY11_ENST00000428358.1_Nonsense_Mutation_p.E341*|SNORD105B_ENST00000458770.1_RNA|P2RY11_ENST00000321826.4_5'Flank|PPAN_ENST00000556468.1_Nonsense_Mutation_p.E341*|PPAN_ENST00000393793.1_Nonsense_Mutation_p.E288*	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	341					RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			GGAGCAGCGGGAGGCCCACAG	0.667																																					p.E341X		Atlas-SNP	.											.	PPAN	43	.	0			c.G1021T						.						12.0	16.0	15.0					19																	10221280		2189	4290	6479	SO:0001587	stop_gained	56342	exon10			CAGCGGGAGGCCC	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.1021G>T	chr19.hg19:g.10221280G>T	ENSP00000253107:p.Glu341*	114.0	0.0		142.0	44.0	NM_020230	C9J3F9|Q9BW97|Q9H170	Nonsense_Mutation	SNP	ENST00000253107.7	hg19	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	G	38	6.747008	0.97809	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-42.6564	16.6071	0.84832	0.0:0.0:1.0:0.0	.	.	.	.	X	341;341;341;341;341;288	.	ENSP00000253107:E341X	E	+	1	0	PPAN;PPAN-P2RY11	10082280	1.000000	0.71417	0.990000	0.47175	0.580000	0.36256	3.364000	0.52328	2.203000	0.70933	0.561000	0.74099	GAG	.	.		0.667	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230	
ZNF493	284443	hgsc.bcm.edu	37	19	21607547	21607547	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr19:21607547C>T	ENST00000355504.4	+	2	1968	c.1702C>T	c.(1702-1704)Cga>Tga	p.R568*	ZNF493_ENST00000392288.2_Nonsense_Mutation_p.R696*|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	568					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						AACTTTCTACCGATTCTCAAA	0.343																																					p.R696X		Atlas-SNP	.											.	ZNF493	178	.	0			c.C2086T						.						32.0	35.0	34.0					19																	21607547		2202	4295	6497	SO:0001587	stop_gained	284443	exon4			TTCTACCGATTCT	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1702C>T	chr19.hg19:g.21607547C>T	ENSP00000347691:p.Arg568*	281.0	0.0		257.0	78.0	NM_001076678	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Nonsense_Mutation	SNP	ENST00000355504.4	hg19	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	22.0	4.225634	0.79576	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	.	.	.	1.14	-2.28	0.06826	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	3.0269	0.06094	0.2093:0.201:0.0:0.5898	.	.	.	.	X	696;568	.	ENSP00000347691:R568X	R	+	1	2	ZNF493	21399387	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-7.134000	0.00043	-1.207000	0.02637	-1.192000	0.01694	CGA	.	.		0.343	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
ZNF227	7770	hgsc.bcm.edu	37	19	44740511	44740511	+	Missense_Mutation	SNP	A	A	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr19:44740511A>T	ENST00000313040.7	+	6	2133	c.1928A>T	c.(1927-1929)cAg>cTg	p.Q643L	ZNF227_ENST00000391961.2_Missense_Mutation_p.Q592L|ZNF227_ENST00000589005.1_Missense_Mutation_p.Q592L|ZNF235_ENST00000589799.1_3'UTR	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	643					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				GGCTTCAGTCAGTCCTCTGGT	0.463																																					p.Q643L		Atlas-SNP	.											.	ZNF227	62	.	0			c.A1928T						.						66.0	67.0	67.0					19																	44740511		2203	4300	6503	SO:0001583	missense	7770	exon6			TCAGTCAGTCCTC	AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.1928A>T	chr19.hg19:g.44740511A>T	ENSP00000321049:p.Gln643Leu	102.0	0.0		121.0	44.0	NM_182490	B3KRU7|B7Z5P9	Missense_Mutation	SNP	ENST00000313040.7	hg19	CCDS12636.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.243687	0.58995	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980;ENST00000377916	T;T	0.35236	1.32;1.32	4.07	3.02	0.34903	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37376	0.1001	L	0.28649	0.875	0.80722	D	1	D;D;D;D	0.71674	0.998;0.988;0.988;0.998	D;P;P;D	0.63113	0.911;0.717;0.624;0.911	T	0.11743	-1.0575	9	0.32370	T	0.25	.	5.3507	0.16034	0.7093:0.0:0.2906:0.0	.	564;622;595;643	B7Z6M2;Q658S5;Q9NS43;Q86WZ6	.;.;.;ZN227_HUMAN	L	643;600;592;622;282	ENSP00000321049:Q643L;ENSP00000375823:Q592L	ENSP00000321049:Q643L	Q	+	2	0	ZNF227	49432351	0.000000	0.05858	0.963000	0.40424	0.997000	0.91878	0.127000	0.15790	1.625000	0.50366	0.455000	0.32223	CAG	.	.		0.463	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460720.1	NM_182490	
PPP6R1	22870	hgsc.bcm.edu	37	19	55756722	55756722	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr19:55756722G>A	ENST00000412770.2	-	4	1029	c.463C>T	c.(463-465)Cag>Tag	p.Q155*	PPP6R1_ENST00000587283.1_Nonsense_Mutation_p.Q155*	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	155	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CCAATGTGCTGCAGCAGCAGG	0.637																																					p.Q155X		Atlas-SNP	.											.	PPP6R1	63	.	0			c.C463T						.						43.0	50.0	47.0					19																	55756722		2168	4279	6447	SO:0001587	stop_gained	22870	exon4			TGTGCTGCAGCAG	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.463C>T	chr19.hg19:g.55756722G>A	ENSP00000414202:p.Gln155*	69.0	0.0		70.0	16.0	NM_014931	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Nonsense_Mutation	SNP	ENST00000412770.2	hg19	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	G	38	6.977884	0.97975	.	.	ENSG00000105063	ENST00000444538;ENST00000412770	.	.	.	4.95	2.7	0.31948	.	0.350692	0.23554	N	0.046939	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8703	5.5798	0.17243	0.1792:0.0:0.6617:0.1591	.	.	.	.	X	155	.	ENSP00000414202:Q155X	Q	-	1	0	PPP6R1	60448534	0.970000	0.33590	0.998000	0.56505	0.991000	0.79684	2.322000	0.43814	0.711000	0.32018	0.655000	0.94253	CAG	.	.		0.637	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
HNF4A	3172	hgsc.bcm.edu	37	20	43052656	43052656	+	Splice_Site	SNP	A	A	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr20:43052656A>T	ENST00000316099.4	+	8	981		c.e8-1		HNF4A_ENST00000415691.2_Splice_Site|AL132772.1_ENST00000581483.1_RNA|HNF4A_ENST00000443598.2_Splice_Site|HNF4A_ENST00000316673.4_Splice_Site|HNF4A_ENST00000457232.1_Splice_Site|HNF4A_ENST00000609795.1_Splice_Site	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha						blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CTTCCATTGTAGATGCCAAGG	0.587																																					.	Colon(79;2 1269 8820 14841 52347)	Atlas-SNP	.											.	HNF4A	150	.	0			c.827-2A>T						.						26.0	20.0	22.0					20																	43052656		2194	4289	6483	SO:0001630	splice_region_variant	3172	exon8			CATTGTAGATGCC	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.893-1A>T	chr20.hg19:g.43052656A>T		99.0	0.0		123.0	45.0	NM_001030004	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Splice_Site	SNP	ENST00000316099.4	hg19	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.358626	0.82243	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4152	0.74960	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HNF4A	42486070	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	9.339000	0.96797	2.034000	0.60081	0.460000	0.39030	.	.	.		0.587	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		Intron
TBX1	6899	hgsc.bcm.edu	37	22	19754071	19754071	+	Intron	SNP	G	G	T			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr22:19754071G>T	ENST00000329705.7	+	8	1138				TBX1_ENST00000359500.3_Intron|TBX1_ENST00000332710.4_Missense_Mutation_p.G390V	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				ggcgcgcccggaggccggccc	0.781																																					p.G390V		Atlas-SNP	.											.	TBX1	62	.	0			c.G1169T						.						1.0	1.0	1.0					22																	19754071		789	1895	2684	SO:0001627	intron_variant	6899	exon9			CGCCCGGAGGCCG	AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.1009+546G>T	chr22.hg19:g.19754071G>T		387.0	1.0		458.0	182.0	NM_080647	C6G493|C6G494|O43436|Q96RJ2	Missense_Mutation	SNP	ENST00000329705.7	hg19	CCDS13766.1	.	.	.	.	.	.	.	.	.	.	G	13.27	2.188036	0.38609	.	.	ENSG00000184058	ENST00000332710	D	0.85339	-1.97	2.85	1.75	0.24633	.	2.560210	0.02131	U	0.056401	T	0.77491	0.4138	L	0.36672	1.1	0.80722	D	1	P	0.35575	0.51	B	0.23275	0.045	T	0.58662	-0.7597	10	0.20046	T	0.44	.	11.1907	0.48683	0.0:0.1889:0.811:0.0	.	390	D9ZGG0	.	V	390	ENSP00000331791:G390V	ENSP00000331791:G390V	G	+	2	0	TBX1	18134071	0.711000	0.27906	0.332000	0.25469	0.892000	0.51952	1.189000	0.32114	0.477000	0.27464	0.416000	0.27883	GGA	.	.		0.781	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318033.1	NM_080647	
C22orf15	150248	hgsc.bcm.edu	37	22	24106453	24106453	+	Missense_Mutation	SNP	T	T	C	rs553969002		TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr22:24106453T>C	ENST00000402217.3	+	3	372	c.119T>C	c.(118-120)aTt>aCt	p.I40T	C22orf15_ENST00000305199.5_Missense_Mutation_p.I40T|C22orf15_ENST00000382821.3_Missense_Mutation_p.I40T	NM_182520.2	NP_872326.2	Q8WYQ4	CV015_HUMAN	chromosome 22 open reading frame 15	40										breast(1)|pancreas(1)	2		Medulloblastoma(6;6.27e-05)|all_neural(6;0.00518)				CCAGCGACCATTGCTCTCCTG	0.642													T|||	1	0.000199681	0.0	0.0	5008	,	,		20227	0.0		0.0	False		,,,				2504	0.001				p.I40T		Atlas-SNP	.											.	C22orf15	5	.	0			c.T119C						.						54.0	63.0	60.0					22																	24106453		692	1591	2283	SO:0001583	missense	150248	exon3			CGACCATTGCTCT	AB050773	CCDS13814.2	22q11.23	2012-11-13			ENSG00000169314	ENSG00000169314			15558	protein-coding gene	gene with protein product							Standard	NM_182520		Approved	FLJ36561, N27C7-3	uc011aja.2	Q8WYQ4	OTTHUMG00000150740	ENST00000402217.3:c.119T>C	chr22.hg19:g.24106453T>C	ENSP00000384965:p.Ile40Thr	76.0	0.0		83.0	28.0	NM_182520	Q6ICJ7	Missense_Mutation	SNP	ENST00000402217.3	hg19	CCDS13814.2	.	.	.	.	.	.	.	.	.	.	T	11.36	1.617206	0.28801	.	.	ENSG00000169314	ENST00000336186;ENST00000402217;ENST00000305199;ENST00000382821	T	0.43294	0.95	2.79	2.79	0.32731	.	0.638862	0.13251	N	0.402042	T	0.41351	0.1155	M	0.73962	2.25	0.09310	N	1	B;P;P	0.50819	0.447;0.939;0.939	B;B;B	0.41174	0.266;0.349;0.349	T	0.42224	-0.9464	10	0.72032	D	0.01	-11.1421	7.4919	0.27466	0.0:0.0:0.0:1.0	.	40;40;40	Q8WYQ4;C9JMV7;Q8WYQ4-2	CV015_HUMAN;.;.	T	40	ENSP00000384965:I40T	ENSP00000305096:I40T	I	+	2	0	C22orf15	22436453	0.062000	0.20869	0.013000	0.15412	0.063000	0.16089	0.812000	0.27211	1.540000	0.49301	0.454000	0.30748	ATT	.	.		0.642	C22orf15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319887.2	NM_182520	
REPIN1	29803	hgsc.bcm.edu	37	7	150068831	150068835	+	Frame_Shift_Del	DEL	CCACC	CCACC	-			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	CCACC	CCACC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr7:150068831_150068835delCCACC	ENST00000425389.2	+	1	579_583	c.501_505delCCACC	c.(499-507)tgccaccctfs	p.HP168fs	REPIN1_ENST00000444957.1_Frame_Shift_Del_p.HP168fs|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000489432.2_Frame_Shift_Del_p.HP225fs|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000482680.1_3'UTR|REPIN1_ENST00000540729.1_Frame_Shift_Del_p.HP168fs|REPIN1_ENST00000397281.2_Frame_Shift_Del_p.HP168fs|REPIN1_ENST00000479668.1_3'UTR	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	168					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TGCGGCGGTGCCACCCTCCCGCCCC	0.644																																					p.224_225del		Atlas-INDEL	.											.	REPIN1	74	.	0			c.671_675del						.																																			SO:0001589	frameshift_variant	29803	exon3			.	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.501_505delCCACC	chr7.hg19:g.150068831_150068835delCCACC	ENSP00000388287:p.His168fs	59.0	0.0		59.0	17.0	NM_001099695	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Frame_Shift_Del	DEL	ENST00000425389.2	hg19	CCDS43677.1																																																																																			.	.		0.644	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376940.1	NM_014374	
CTTNBP2NL	55917	hgsc.bcm.edu	37	1	112999349	112999364	+	Frame_Shift_Del	DEL	CACTGTCTCCCAGCAG	CACTGTCTCCCAGCAG	-			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	CACTGTCTCCCAGCAG	CACTGTCTCCCAGCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr1:112999349_112999364delCACTGTCTCCCAGCAG	ENST00000271277.6	+	6	1460_1475	c.1235_1250delCACTGTCTCCCAGCAG	c.(1234-1251)tcactgtctcccagcagcfs	p.SLSPSS412fs		NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	412					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGTGGGAGCTCACTGTCTCCCAGCAGCACTGCCTCC	0.569																																					p.412_417del		Atlas-INDEL	.											.	CTTNBP2NL	65	.	0			c.1234_1249del						.																																			SO:0001589	frameshift_variant	55917	exon6			.	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.1235_1250delCACTGTCTCCCAGCAG	chr1.hg19:g.112999349_112999364delCACTGTCTCCCAGCAG	ENSP00000271277:p.Ser412fs	103.0	0.0		60.0	28.0	NM_018704	B3KMS5|Q96B40	Frame_Shift_Del	DEL	ENST00000271277.6	hg19	CCDS845.1																																																																																			.	.		0.569	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030686.1	NM_018704	
ZNF318	24149	hgsc.bcm.edu	37	6	43316238	43316238	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr6:43316238delC	ENST00000361428.2	-	6	2973	c.2896delG	c.(2896-2898)gcafs	p.A966fs	ZNF318_ENST00000318149.3_Frame_Shift_Del_p.A966fs	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	966					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TTCTTTTCTGCCTCTTCTGCC	0.463																																					p.A966fs		Atlas-INDEL	.											.	ZNF318	175	.	0			c.2897delC						.						255.0	224.0	234.0					6																	43316238		2203	4300	6503	SO:0001589	frameshift_variant	24149	exon6			.	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.2896delG	chr6.hg19:g.43316238delC	ENSP00000354964:p.Ala966fs	74.0	0.0		126.0	34.0	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Frame_Shift_Del	DEL	ENST00000361428.2	hg19	CCDS4895.2																																																																																			.	.		0.463	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
PRR21	643905	hgsc.bcm.edu	37	2	240982306	240982307	+	In_Frame_Ins	INS	-	-	AGG			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr2:240982306_240982307insAGG	ENST00000408934.1	-	1	92_93	c.93_94insCCT	c.(91-96)ggctca>ggcCCTtca	p.31_32GS>GPS		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	31										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GCCGTGGATGAGCCGTGGGGGA	0.564																																					p.S32delinsPS		Atlas-INDEL	.											.	PRR21	53	.	0			c.94_95insCCT						.																																			SO:0001652	inframe_insertion	643905	exon1			.	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.93_94insCCT	chr2.hg19:g.240982306_240982307insAGG	ENSP00000386166:p.Gly31_Ser32insPro	72.0	0.0		100.0	11.0	NM_001080835		In_Frame_Ins	INS	ENST00000408934.1	hg19	CCDS33417.1																																																																																			.	.		0.564	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
NEFH	4744	hgsc.bcm.edu	37	22	29885571	29885572	+	In_Frame_Ins	INS	-	-	CCCCTGAGAAGGCCAAGT			TCGA-ZP-A9D2-01A-11D-A382-10	TCGA-ZP-A9D2-10B-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f0eb7de5-8ea1-4f7c-82b5-c216979bef5b	517ff09a-3831-4085-b380-60a157b3840f	g.chr22:29885571_29885572insCCCCTGAGAAGGCCAAGT	ENST00000310624.6	+	4	1975_1976	c.1942_1943insCCCCTGAGAAGGCCAAGT	c.(1942-1944)tcc>tCCCCTGAGAAGGCCAAGTcc	p.648_648S>SPEKAKS		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	654	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.			Missing (in Ref. 1; CAA33366 and 5; AC000035). {ECO:0000305}.	axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GGAAGCAAAGTCCCCTGAGAAG	0.569																																					p.S648delinsSPEKAKS		Atlas-INDEL	.											.	NEFH	178	.	0			c.1942_1943insCCCCTGAGAAGGCCAAGT						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1943_1960dupCCCCTGAGAAGGCCAAGT	chr22.hg19:g.29885571_29885572insCCCCTGAGAAGGCCAAGT	Exception_encountered	241.0	0.0		266.0	39.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.569	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
