#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARID1A	8289	hgsc.bcm.edu	37	1	27106649	27106649	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr1:27106649G>A	ENST00000324856.7	+	20	6631	c.6260G>A	c.(6259-6261)gGa>gAa	p.G2087E	ARID1A_ENST00000457599.2_Missense_Mutation_p.G1870E|ARID1A_ENST00000374152.2_Missense_Mutation_p.G1704E|ARID1A_ENST00000540690.1_Missense_Mutation_p.G415E	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2087			G -> R (found in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:22009941}.		androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.G2087E(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GTCCTGGACGGACTCCTACAC	0.587			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.G2087E		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,NS,adenocarcinoma,0,2	ARID1A	842	.	1	Substitution - Missense(1)	liver(1)	c.G6260A						.						89.0	87.0	88.0					1																	27106649		2203	4300	6503	SO:0001583	missense	8289	exon20			TGGACGGACTCCT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6260G>A	chr1.hg19:g.27106649G>A	ENSP00000320485:p.Gly2087Glu	125.0	1.0		104.0	28.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.528439	0.64860	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.07	5.07	0.68467	.	0.051909	0.85682	D	0.000000	T	0.76054	0.3934	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.79291	-0.1864	10	0.87932	D	0	-4.2604	19.0485	0.93032	0.0:0.0:1.0:0.0	.	1704;2087;1870	O14497-3;O14497;O14497-2	.;ARI1A_HUMAN;.	E	2087;1870;1704;415	ENSP00000320485:G2087E;ENSP00000387636:G1870E;ENSP00000363267:G1704E;ENSP00000442437:G415E	ENSP00000320485:G2087E	G	+	2	0	ARID1A	26979236	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.413000	0.97351	2.814000	0.96858	0.585000	0.79938	GGA	.	.		0.587	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
CSMD2	114784	hgsc.bcm.edu	37	1	34204787	34204787	+	Silent	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr1:34204787C>T	ENST00000373381.4	-	15	2498	c.2322G>A	c.(2320-2322)ctG>ctA	p.L774L		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	734	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGCCCTCCTTCAGGACGCAGG	0.617																																					p.L734L		Atlas-SNP	.											.	CSMD2	946	.	0			c.G2202A						.						54.0	49.0	50.0					1																	34204787		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon15			CTCCTTCAGGACG	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.2322G>A	chr1.hg19:g.34204787C>T		100.0	0.0		83.0	22.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	hg19																																																																																				.	.		0.617	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
KCNC4	3749	hgsc.bcm.edu	37	1	110766436	110766436	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr1:110766436C>T	ENST00000369787.3	+	2	1556	c.1529C>T	c.(1528-1530)tCt>tTt	p.S510F	KCNC4_ENST00000438661.2_Missense_Mutation_p.S510F|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000413138.3_Missense_Mutation_p.S510F	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	510					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		TACTGCAAGTCTGAGGAGACT	0.607																																					p.S510F		Atlas-SNP	.											.	KCNC4	113	.	0			c.C1529T						.						71.0	78.0	75.0					1																	110766436		2203	4300	6503	SO:0001583	missense	3749	exon2			GCAAGTCTGAGGA	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1529C>T	chr1.hg19:g.110766436C>T	ENSP00000358802:p.Ser510Phe	114.0	0.0		118.0	31.0	NM_001039574	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	ENST00000369787.3	hg19	CCDS821.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305965	0.81247	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.97378	-4.36;-4.36;-4.36	4.89	4.89	0.63831	.	2.911490	0.01276	N	0.009589	D	0.98077	0.9366	L	0.57536	1.79	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.961	D;D;P	0.67382	0.929;0.951;0.875	D	0.90954	0.4807	10	0.62326	D	0.03	.	18.0014	0.89198	0.0:1.0:0.0:0.0	.	510;510;510	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	F	510	ENSP00000358802:S510F;ENSP00000388029:S510F;ENSP00000393655:S510F	ENSP00000358802:S510F	S	+	2	0	KCNC4	110567959	1.000000	0.71417	0.942000	0.38095	0.990000	0.78478	7.818000	0.86416	2.422000	0.82143	0.462000	0.41574	TCT	.	.		0.607	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
LCE1F	353137	hgsc.bcm.edu	37	1	152749007	152749007	+	Missense_Mutation	SNP	T	T	A	rs544759833	byFrequency	TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr1:152749007T>A	ENST00000334371.2	+	1	160	c.160T>A	c.(160-162)Tcc>Acc	p.S54T		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	54					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTGTGGCTCCAGCTCTGG	0.682																																					p.S54T		Atlas-SNP	.											.	LCE1F	42	.	0			c.T160A						.						37.0	40.0	39.0					1																	152749007		2202	4300	6502	SO:0001583	missense	353137	exon1			TGTGGCTCCAGCT		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.160T>A	chr1.hg19:g.152749007T>A	ENSP00000334187:p.Ser54Thr	320.0	0.0		285.0	17.0	NM_178354		Missense_Mutation	SNP	ENST00000334371.2	hg19	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	T	8.025	0.760389	0.15914	.	.	ENSG00000240386	ENST00000334371	T	0.04360	3.64	2.56	-2.1	0.07210	.	.	.	.	.	T	0.01800	0.0057	L	0.59436	1.845	0.09310	N	0.999992	B	0.20988	0.05	B	0.15870	0.014	T	0.42616	-0.9441	9	0.87932	D	0	.	6.7639	0.23556	0.0:0.5552:0.0:0.4448	.	54	Q5T754	LCE1F_HUMAN	T	54	ENSP00000334187:S54T	ENSP00000334187:S54T	S	+	1	0	LCE1F	151015631	0.024000	0.19004	0.207000	0.23584	0.986000	0.74619	0.132000	0.15891	-0.478000	0.06823	-0.380000	0.06706	TCC	.	.		0.682	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
DUSP27	92235	hgsc.bcm.edu	37	1	167095804	167095804	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr1:167095804C>T	ENST00000361200.2	+	6	1602	c.1436C>T	c.(1435-1437)gCa>gTa	p.A479V	DUSP27_ENST00000443333.1_Missense_Mutation_p.A479V|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.A479V			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	479					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACCTGGGACGCATGGAACGAG	0.642																																					p.A479V		Atlas-SNP	.											.	DUSP27	235	.	0			c.C1436T						.						31.0	31.0	31.0					1																	167095804		2203	4300	6503	SO:0001583	missense	92235	exon5			GGGACGCATGGAA	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.1436C>T	chr1.hg19:g.167095804C>T	ENSP00000354483:p.Ala479Val	262.0	0.0		249.0	101.0	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	hg19	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577097	0.28092	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.02656	4.21;4.21;4.21	5.27	-1.26	0.09376	.	0.976965	0.08432	N	0.946804	T	0.00608	0.0020	N	0.08118	0	0.23506	N	0.997539	B	0.02656	0.0	B	0.01281	0.0	T	0.45731	-0.9241	10	0.54805	T	0.06	-4.8606	10.0593	0.42263	0.0:0.3425:0.0:0.6575	.	479	Q5VZP5	DUS27_HUMAN	V	479	ENSP00000354483:A479V;ENSP00000271385:A479V;ENSP00000404874:A479V	ENSP00000271385:A479V	A	+	2	0	DUSP27	165362428	0.999000	0.42202	0.323000	0.25347	0.357000	0.29423	2.544000	0.45761	-0.541000	0.06257	-0.796000	0.03273	GCA	.	.		0.642	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
DNAH14	127602	hgsc.bcm.edu	37	1	225373092	225373092	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr1:225373092T>C	ENST00000445597.2	+	24	4354	c.4354T>C	c.(4354-4356)Ttc>Ctc	p.F1452L	DNAH14_ENST00000439375.2_Missense_Mutation_p.F1857L|DNAH14_ENST00000430092.1_Missense_Mutation_p.F1857L			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1452					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AATTGCAGACTTCTTATCAGT	0.333																																					p.F1857L		Atlas-SNP	.											.	DNAH14	300	.	0			c.T5569C						.						124.0	109.0	114.0					1																	225373092		692	1591	2283	SO:0001583	missense	127602	exon36			GCAGACTTCTTAT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.4354T>C	chr1.hg19:g.225373092T>C	ENSP00000409472:p.Phe1452Leu	184.0	0.0		242.0	54.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	T	4.979	0.181789	0.09495	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.28454	3.42;1.61;1.61;1.82	4.91	-9.83	0.00482	.	.	.	.	.	T	0.08223	0.0205	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19712	-1.0297	9	0.11182	T	0.66	.	0.9952	0.01465	0.4416:0.2157:0.178:0.1648	.	1857	Q0VDD8-4	.	L	1452;1857;1857;951	ENSP00000409472:F1452L;ENSP00000414402:F1857L;ENSP00000392061:F1857L;ENSP00000332424:F951L	ENSP00000332424:F951L	F	+	1	0	DNAH14	223439715	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-1.205000	0.03014	-2.154000	0.00792	-0.484000	0.04775	TTC	.	.		0.333	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
TTC7A	57217	hgsc.bcm.edu	37	2	47184111	47184111	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:47184111A>G	ENST00000319190.5	+	3	850	c.482A>G	c.(481-483)cAg>cGg	p.Q161R	TTC7A_ENST00000409245.1_Missense_Mutation_p.Q127R|TTC7A_ENST00000394850.2_Missense_Mutation_p.Q161R|TTC7A_ENST00000461601.1_3'UTR|RP11-15I20.1_ENST00000607950.1_RNA|TTC7A_ENST00000263737.6_5'UTR	NM_020458.2	NP_065191.2	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	161					cellular iron ion homeostasis (GO:0006879)|hemopoiesis (GO:0030097)					breast(4)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			CCCCTGTATCAGATGCGGCTG	0.577																																					p.Q161R		Atlas-SNP	.											.	TTC7A	80	.	0			c.A482G						.						121.0	118.0	119.0					2																	47184111		2203	4300	6503	SO:0001583	missense	57217	exon3			TGTATCAGATGCG	AB032966	CCDS33193.1, CCDS74510.1, CCDS74511.1	2p16.3	2013-01-10	2004-06-02	2004-06-02	ENSG00000068724	ENSG00000068724		"""Tetratricopeptide (TTC) repeat domain containing"""	19750	protein-coding gene	gene with protein product		609332	"""tetratricopeptide repeat domain 7"""	TTC7		10574461	Standard	XM_005264439		Approved	KIAA1140	uc002rvo.3	Q9ULT0	OTTHUMG00000153121	ENST00000319190.5:c.482A>G	chr2.hg19:g.47184111A>G	ENSP00000316699:p.Gln161Arg	124.0	0.0		128.0	26.0	NM_020458	Q6PIX4|Q8ND67|Q9BUS3	Missense_Mutation	SNP	ENST00000319190.5	hg19	CCDS33193.1	.	.	.	.	.	.	.	.	.	.	A	5.672	0.308568	0.10733	.	.	ENSG00000068724	ENST00000409245;ENST00000319190;ENST00000394850	T;T;T	0.28454	2.02;2.03;1.61	5.84	5.84	0.93424	Tetratricopeptide-like helical (1);	0.311397	0.33515	N	0.004839	T	0.19248	0.0462	N	0.26042	0.785	0.80722	D	1	B;B;B	0.18610	0.029;0.015;0.0	B;B;B	0.12837	0.006;0.008;0.002	T	0.12116	-1.0560	10	0.13853	T	0.58	-24.2038	9.1628	0.37032	0.7413:0.0:0.0:0.2587	.	161;161;127	Q2T9J9;Q9ULT0;G5E9G4	.;TTC7A_HUMAN;.	R	127;161;161	ENSP00000386307:Q127R;ENSP00000316699:Q161R;ENSP00000378320:Q161R	ENSP00000316699:Q161R	Q	+	2	0	TTC7A	47037615	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.223000	0.51231	2.234000	0.73211	0.459000	0.35465	CAG	.	.		0.577	TTC7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329667.2	XM_372927	
CNGA3	1261	hgsc.bcm.edu	37	2	99013428	99013428	+	Missense_Mutation	SNP	G	G	A	rs376992789		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:99013428G>A	ENST00000272602.2	+	7	1834	c.1795G>A	c.(1795-1797)Gag>Aag	p.E599K	CNGA3_ENST00000393504.1_Missense_Mutation_p.E599K|CNGA3_ENST00000436404.2_Missense_Mutation_p.E581K|CNGA3_ENST00000409937.1_Missense_Mutation_p.E603K			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	599					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GAAGGCCCTGGAGGAGAAAGG	0.592																																					p.E599K		Atlas-SNP	.											.	CNGA3	118	.	0			c.G1795A						.	G	LYS/GLU,LYS/GLU	2,4404	4.2+/-10.8	0,2,2201	39.0	41.0	40.0		1741,1795	5.4	1.0	2		40	0,8600		0,0,4300	no	missense,missense	CNGA3	NM_001079878.1,NM_001298.2	56,56	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging,probably-damaging	581/677,599/695	99013428	2,13004	2203	4300	6503	SO:0001583	missense	1261	exon8			GCCCTGGAGGAGA	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1795G>A	chr2.hg19:g.99013428G>A	ENSP00000272602:p.Glu599Lys	102.0	0.0		88.0	28.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	hg19	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055037	0.75960	4.54E-4	0.0	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.96587	-4.06;-4.06;-4.06;-4.06	5.42	5.42	0.78866	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	M	0.85299	2.745	0.80722	D	1	D;P;B	0.58620	0.983;0.944;0.255	P;P;B	0.61477	0.889;0.76;0.095	D	0.97873	1.0287	10	0.49607	T	0.09	.	18.154	0.89686	0.0:0.0:1.0:0.0	.	603;581;599	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	K	599;581;599;603	ENSP00000377140:E599K;ENSP00000410070:E581K;ENSP00000272602:E599K;ENSP00000386761:E603K	ENSP00000272602:E599K	E	+	1	0	CNGA3	98379860	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.263000	0.95617	2.826000	0.97356	0.563000	0.77884	GAG	.	.		0.592	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
REV1	51455	hgsc.bcm.edu	37	2	100058822	100058822	+	Silent	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:100058822G>A	ENST00000258428.3	-	5	688	c.460C>T	c.(460-462)Ctg>Ttg	p.L154L	REV1_ENST00000393445.3_Silent_p.L154L|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	154					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGACCTGGCAGAGGATCCTCA	0.443								Direct reversal of damage																													p.L154L		Atlas-SNP	.											.	REV1	100	.	0			c.C460T						.						104.0	93.0	97.0					2																	100058822		2203	4300	6503	SO:0001819	synonymous_variant	51455	exon5			CTGGCAGAGGATC	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.460C>T	chr2.hg19:g.100058822G>A		141.0	0.0		122.0	38.0	NM_001037872	O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	ENST00000258428.3	hg19	CCDS2045.1																																																																																			.	.		0.443	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
BAZ2B	29994	hgsc.bcm.edu	37	2	160181399	160181399	+	Silent	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:160181399T>C	ENST00000392783.2	-	36	6771	c.6276A>G	c.(6274-6276)aaA>aaG	p.K2092K	BAZ2B_ENST00000392782.1_Silent_p.K2056K|BAZ2B_ENST00000355831.2_Silent_p.K2058K|BAZ2B_ENST00000343439.5_Silent_p.K1992K	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	2092	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CAGGAACAAGTTTCAAGTTTA	0.328																																					p.K2092K		Atlas-SNP	.											.	BAZ2B	196	.	0			c.A6276G						.						65.0	61.0	62.0					2																	160181399		1801	4066	5867	SO:0001819	synonymous_variant	29994	exon36			AACAAGTTTCAAG	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.6276A>G	chr2.hg19:g.160181399T>C		379.0	0.0		349.0	14.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Silent	SNP	ENST00000392783.2	hg19	CCDS2209.2																																																																																			.	.		0.328	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
LRP2	4036	hgsc.bcm.edu	37	2	170002368	170002368	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:170002368C>G	ENST00000263816.3	-	70	13162	c.12877G>C	c.(12877-12879)Gaa>Caa	p.E4293Q		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4293					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTCCATACTTCTCCCTTTTCC	0.408																																					p.E4293Q		Atlas-SNP	.											.	LRP2	751	.	0			c.G12877C						.						93.0	87.0	89.0					2																	170002368		2203	4300	6503	SO:0001583	missense	4036	exon70			ATACTTCTCCCTT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12877G>C	chr2.hg19:g.170002368C>G	ENSP00000263816:p.Glu4293Gln	119.0	0.0		95.0	19.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	hg19	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453537	0.84209	.	.	ENSG00000081479	ENST00000263816	D	0.91011	-2.77	5.33	5.33	0.75918	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.93025	0.7780	L	0.52266	1.64	0.80722	D	1	D	0.71674	0.998	P	0.59357	0.856	D	0.92338	0.5879	10	0.44086	T	0.13	.	19.397	0.94611	0.0:1.0:0.0:0.0	.	4293	P98164	LRP2_HUMAN	Q	4293	ENSP00000263816:E4293Q	ENSP00000263816:E4293Q	E	-	1	0	LRP2	169710614	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.929000	0.70096	2.665000	0.90641	0.655000	0.94253	GAA	.	.		0.408	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
FASTKD2	22868	hgsc.bcm.edu	37	2	207639082	207639082	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:207639082A>C	ENST00000236980.6	+	7	1736	c.1388A>C	c.(1387-1389)tAc>tCc	p.Y463S	FASTKD2_ENST00000403094.3_Missense_Mutation_p.Y463S|FASTKD2_ENST00000402774.3_Missense_Mutation_p.Y463S	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	463					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		CTTCATACTTACTCTTCTCTC	0.318																																					p.Y463S		Atlas-SNP	.											.	FASTKD2	49	.	0			c.A1388C						.						115.0	119.0	118.0					2																	207639082		2202	4298	6500	SO:0001583	missense	22868	exon7			ATACTTACTCTTC	BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1388A>C	chr2.hg19:g.207639082A>C	ENSP00000236980:p.Tyr463Ser	82.0	0.0		108.0	27.0	NM_001136193	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	ENST00000236980.6	hg19	CCDS2371.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.520380	0.44866	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.45276	0.9;0.9;0.9	5.99	4.83	0.62350	FAST kinase leucine-rich (1);	0.201998	0.44483	N	0.000452	T	0.62502	0.2433	M	0.73598	2.24	0.49130	D	0.999754	D;D	0.89917	0.976;1.0	P;D	0.87578	0.87;0.998	T	0.64407	-0.6415	10	0.59425	D	0.04	-8.1288	11.0657	0.47974	0.9268:0.0:0.0732:0.0	.	463;463	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	S	463	ENSP00000236980:Y463S;ENSP00000385990:Y463S;ENSP00000384929:Y463S	ENSP00000236980:Y463S	Y	+	2	0	FASTKD2	207347327	1.000000	0.71417	0.466000	0.27168	0.164000	0.22412	5.038000	0.64177	1.083000	0.41159	0.533000	0.62120	TAC	.	.		0.318	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256428.2	NM_014929	
DOCK10	55619	hgsc.bcm.edu	37	2	225750511	225750511	+	Silent	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:225750511C>T	ENST00000258390.7	-	7	691	c.624G>A	c.(622-624)aaG>aaA	p.K208K	DOCK10_ENST00000409592.3_Silent_p.K202K	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	208	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GGAAGTAGCGCTTTTTGAATG	0.318																																					p.K208K		Atlas-SNP	.											.	DOCK10	308	.	0			c.G624A						.						92.0	85.0	87.0					2																	225750511		1822	4099	5921	SO:0001819	synonymous_variant	55619	exon7			GTAGCGCTTTTTG	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.624G>A	chr2.hg19:g.225750511C>T		108.0	0.0		91.0	28.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	hg19	CCDS46528.1																																																																																			.	.		0.318	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
DIS3L2	129563	hgsc.bcm.edu	37	2	233114009	233114009	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:233114009G>A	ENST00000409307.1	+	11	1378	c.1378G>A	c.(1378-1380)Gac>Aac	p.D460N	DIS3L2_ENST00000325385.7_Missense_Mutation_p.D460N|DIS3L2_ENST00000273009.6_Missense_Mutation_p.D460N					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CCCCATGTCCGACAAGCTGAC	0.517																																					p.D460N		Atlas-SNP	.											.	DIS3L2	77	.	0			c.G1378A						.						78.0	85.0	82.0					2																	233114009		2194	4291	6485	SO:0001583	missense	129563	exon12			ATGTCCGACAAGC	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1378G>A	chr2.hg19:g.233114009G>A	ENSP00000386799:p.Asp460Asn	85.0	0.0		65.0	4.0	NM_152383		Missense_Mutation	SNP	ENST00000409307.1	hg19	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	G	32	5.185256	0.94885	.	.	ENSG00000144535	ENST00000273009;ENST00000542873;ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.8	5.8	0.92144	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.67097	0.2857	M	0.85099	2.735	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.71002	-0.4718	10	0.87932	D	0	-24.1311	20.0706	0.97721	0.0:0.0:1.0:0.0	.	460	Q8IYB7	DI3L2_HUMAN	N	460;460;460;460;460;95	ENSP00000273009:D460N;ENSP00000315569:D460N;ENSP00000386799:D460N;ENSP00000415419:D95N	ENSP00000273009:D460N	D	+	1	0	DIS3L2	232822253	1.000000	0.71417	0.982000	0.44146	0.981000	0.71138	9.164000	0.94755	2.744000	0.94065	0.655000	0.94253	GAC	.	.		0.517	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383	
FGD5	152273	hgsc.bcm.edu	37	3	14860691	14860691	+	Missense_Mutation	SNP	G	G	T	rs368711724	byFrequency	TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:14860691G>T	ENST00000285046.5	+	1	223	c.113G>T	c.(112-114)cGg>cTg	p.R38L	FGD5_ENST00000543601.1_5'Flank	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	38					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						AGCAACGGGCGGCTGCCCTGT	0.612																																					p.R38L		Atlas-SNP	.											.	FGD5	248	.	0			c.G113T						.						29.0	31.0	30.0					3																	14860691		692	1591	2283	SO:0001583	missense	152273	exon1			ACGGGCGGCTGCC	AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.113G>T	chr3.hg19:g.14860691G>T	ENSP00000285046:p.Arg38Leu	259.0	0.0		199.0	64.0	NM_152536	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	ENST00000285046.5	hg19	CCDS46767.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.293278	0.40594	.	.	ENSG00000154783	ENST00000285046	T	0.75704	-0.96	5.76	1.25	0.21368	.	0.302725	0.27609	N	0.018607	T	0.50905	0.1643	N	0.14661	0.345	0.28045	N	0.933587	B	0.27166	0.17	B	0.20577	0.03	T	0.44817	-0.9303	10	0.72032	D	0.01	-15.0555	4.8283	0.13427	0.623:0.1655:0.2114:0.0	.	38	Q6ZNL6	FGD5_HUMAN	L	38	ENSP00000285046:R38L	ENSP00000285046:R38L	R	+	2	0	FGD5	14835695	0.302000	0.24454	0.910000	0.35882	0.549000	0.35272	0.396000	0.20867	-0.002000	0.14469	0.591000	0.81541	CGG	.	.		0.612	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340628.1	NM_152536	
BTD	686	hgsc.bcm.edu	37	3	15686574	15686574	+	Missense_Mutation	SNP	C	C	A	rs397514405		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:15686574C>A	ENST00000303498.5	+	4	1320	c.1211C>A	c.(1210-1212)aCc>aAc	p.T404N	BTD_ENST00000383778.4_Missense_Mutation_p.T384N|BTD_ENST00000437172.1_Missense_Mutation_p.T406N|BTD_ENST00000449107.1_Missense_Mutation_p.T406N	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	404					biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						GACAATTTCACCCTGGTCCCT	0.498																																					p.T404N		Atlas-SNP	.											.	BTD	49	.	0			c.C1211A	GRCh37	CM021516	BTD	M		.						166.0	159.0	161.0					3																	15686574		2203	4300	6503	SO:0001583	missense	686	exon4			ATTTCACCCTGGT	AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.1211C>A	chr3.hg19:g.15686574C>A	ENSP00000306477:p.Thr404Asn	99.0	0.0		121.0	27.0	NM_000060	A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Missense_Mutation	SNP	ENST00000303498.5	hg19	CCDS2628.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569398	0.86439	.	.	ENSG00000169814	ENST00000449107;ENST00000303498;ENST00000437172;ENST00000383778	D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.93200	0.7834	M	0.72479	2.2	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.92466	0.5981	10	0.46703	T	0.11	-44.3738	19.5597	0.95367	0.0:1.0:0.0:0.0	.	406;406;404	A6NHF2;B4DLJ9;P43251	.;.;BTD_HUMAN	N	406;404;406;384	ENSP00000388212:T406N;ENSP00000306477:T404N;ENSP00000400995:T406N;ENSP00000373288:T384N	ENSP00000306477:T404N	T	+	2	0	BTD	15661578	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.940000	0.70187	2.641000	0.89580	0.561000	0.74099	ACC	.	.		0.498	BTD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252103.2	NM_000060	
BTD	686	hgsc.bcm.edu	37	3	15686579	15686579	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:15686579G>T	ENST00000303498.5	+	4	1325	c.1216G>T	c.(1216-1218)Gtc>Ttc	p.V406F	BTD_ENST00000383778.4_Missense_Mutation_p.V386F|BTD_ENST00000437172.1_Missense_Mutation_p.V408F|BTD_ENST00000449107.1_Missense_Mutation_p.V408F	NM_000060.2|NM_001281723.1	NP_000051.1|NP_001268652.1	P43251	BTD_HUMAN	biotinidase	406					biotin metabolic process (GO:0006768)|central nervous system development (GO:0007417)|epidermis development (GO:0008544)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleolus (GO:0005730)|perikaryon (GO:0043204)	biotin carboxylase activity (GO:0004075)|biotinidase activity (GO:0047708)			breast(2)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	18						TTTCACCCTGGTCCCTGTCTG	0.498																																					p.V406F		Atlas-SNP	.											.	BTD	49	.	0			c.G1216T						.						166.0	158.0	161.0					3																	15686579		2203	4300	6503	SO:0001583	missense	686	exon4			ACCCTGGTCCCTG	AF018631	CCDS2628.1, CCDS63563.1, CCDS63564.1, CCDS63565.1	3p25	2007-03-26			ENSG00000169814	ENSG00000169814	3.5.1.12		1122	protein-coding gene	gene with protein product		609019				8001986	Standard	NM_001281723		Approved		uc003cah.3	P43251	OTTHUMG00000129861	ENST00000303498.5:c.1216G>T	chr3.hg19:g.15686579G>T	ENSP00000306477:p.Val406Phe	96.0	0.0		122.0	26.0	NM_000060	A6NHF2|B2R865|B4DFX1|B4DLJ9|B7Z7C9|F8W1Q3|Q96EM9	Missense_Mutation	SNP	ENST00000303498.5	hg19	CCDS2628.1	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881859	0.72294	.	.	ENSG00000169814	ENST00000449107;ENST00000303498;ENST00000437172;ENST00000383778	D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28	5.58	4.69	0.59074	.	0.182959	0.47455	D	0.000228	D	0.91683	0.7371	M	0.80847	2.515	0.48395	D	0.999647	D;D;D	0.65815	0.995;0.995;0.995	P;P;P	0.62382	0.901;0.901;0.901	D	0.90986	0.4831	10	0.45353	T	0.12	-39.4077	10.9369	0.47251	0.1436:0.0:0.8564:0.0	.	408;408;406	A6NHF2;B4DLJ9;P43251	.;.;BTD_HUMAN	F	408;406;408;386	ENSP00000388212:V408F;ENSP00000306477:V406F;ENSP00000400995:V408F;ENSP00000373288:V386F	ENSP00000306477:V406F	V	+	1	0	BTD	15661583	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.260000	0.51523	2.641000	0.89580	0.561000	0.74099	GTC	.	.		0.498	BTD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252103.2	NM_000060	
PDCD6IP	10015	hgsc.bcm.edu	37	3	33883512	33883512	+	Silent	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:33883512G>A	ENST00000307296.3	+	10	1682	c.1305G>A	c.(1303-1305)caG>caA	p.Q435Q	PDCD6IP_ENST00000457054.2_Silent_p.Q440Q			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	435	Interaction with CHMP4A, CHMP4B and CHMP4C.|Interaction with EIAV p9.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						CTGTTGATCAGTTGATTAAAG	0.388																																					p.Q440Q		Atlas-SNP	.											.	PDCD6IP	62	.	0			c.G1320A						.						87.0	85.0	86.0					3																	33883512		2203	4300	6503	SO:0001819	synonymous_variant	10015	exon10			TGATCAGTTGATT	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.1305G>A	chr3.hg19:g.33883512G>A		362.0	0.0		301.0	80.0	NM_001162429	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Silent	SNP	ENST00000307296.3	hg19	CCDS2660.1																																																																																			.	.		0.388	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
RAD54L2	23132	hgsc.bcm.edu	37	3	51671348	51671348	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:51671348G>A	ENST00000409535.2	+	10	1636	c.1511G>A	c.(1510-1512)tGc>tAc	p.C504Y	RAD54L2_ENST00000296477.3_Missense_Mutation_p.C198Y	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	504	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		GAGTACTGGTGCATGGTGGAC	0.557																																					p.C504Y		Atlas-SNP	.											RAD54L2,NS,carcinoma,0,1	RAD54L2	94	.	0			c.G1511A						.						90.0	73.0	79.0					3																	51671348		2203	4300	6503	SO:0001583	missense	23132	exon10			ACTGGTGCATGGT	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.1511G>A	chr3.hg19:g.51671348G>A	ENSP00000386520:p.Cys504Tyr	123.0	0.0		98.0	19.0	NM_015106	Q8TB57|Q9BV54	Missense_Mutation	SNP	ENST00000409535.2	hg19	CCDS33765.2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551771	0.86127	.	.	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.93247	-3.19;-3.19	5.31	5.31	0.75309	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.96537	0.8870	M	0.75150	2.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96990	0.9721	10	0.87932	D	0	-12.8036	17.9697	0.89110	0.0:0.0:1.0:0.0	.	504;95	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	Y	504;198	ENSP00000386520:C504Y;ENSP00000296477:C198Y	ENSP00000296477:C198Y	C	+	2	0	RAD54L2	51646388	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.807000	0.99171	2.490000	0.84030	0.561000	0.74099	TGC	.	.		0.557	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328700.2	NM_015106	
ROBO2	6092	hgsc.bcm.edu	37	3	77612353	77612353	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:77612353A>G	ENST00000461745.1	+	11	2455	c.1555A>G	c.(1555-1557)Agt>Ggt	p.S519G	ROBO2_ENST00000332191.8_Missense_Mutation_p.S519G|ROBO2_ENST00000487694.3_Missense_Mutation_p.S535G	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	519					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CTATGATTTAAGTGACCTGCC	0.458																																					p.S519G		Atlas-SNP	.											.	ROBO2	527	.	0			c.A1555G						.						65.0	62.0	63.0					3																	77612353		1874	4105	5979	SO:0001583	missense	6092	exon11			GATTTAAGTGACC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1555A>G	chr3.hg19:g.77612353A>G	ENSP00000417164:p.Ser519Gly	84.0	0.0		93.0	22.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	hg19	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.112578	0.56398	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	D;D;D	0.82526	-1.62;-1.62;-1.62	6.07	6.07	0.98685	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.566176	0.15431	N	0.262703	T	0.77212	0.4097	L	0.28344	0.845	0.24281	N	0.995207	B;B;B	0.11235	0.0;0.004;0.0	B;B;B	0.18263	0.0;0.021;0.0	T	0.76044	-0.3103	9	0.54805	T	0.06	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	535;519;519	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	G	535;535;539;519;519;240	ENSP00000417335:S535G;ENSP00000417164:S519G;ENSP00000327536:S519G	ENSP00000327536:S519G	S	+	1	0	ROBO2	77695043	1.000000	0.71417	0.641000	0.29422	0.906000	0.53458	8.919000	0.92770	2.326000	0.78906	0.533000	0.62120	AGT	.	.		0.458	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
EPHA3	2042	hgsc.bcm.edu	37	3	89480491	89480491	+	Silent	SNP	A	A	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:89480491A>G	ENST00000336596.2	+	13	2553	c.2328A>G	c.(2326-2328)gaA>gaG	p.E776E	EPHA3_ENST00000494014.1_Silent_p.E776E	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	776	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		ATGACCCAGAAGCTGCTTATA	0.393										TSP Lung(6;0.00050)																											p.E776E		Atlas-SNP	.											.	EPHA3	501	.	0			c.A2328G						.						104.0	99.0	101.0					3																	89480491		2203	4300	6503	SO:0001819	synonymous_variant	2042	exon13			CCCAGAAGCTGCT	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2328A>G	chr3.hg19:g.89480491A>G		143.0	0.0		133.0	16.0	NM_005233	Q9H2V3|Q9H2V4	Silent	SNP	ENST00000336596.2	hg19	CCDS2922.1																																																																																			.	.		0.393	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
KALRN	8997	hgsc.bcm.edu	37	3	124160836	124160836	+	Silent	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:124160836C>T	ENST00000240874.3	+	19	3394	c.3237C>T	c.(3235-3237)taC>taT	p.Y1079Y	KALRN_ENST00000360013.3_Silent_p.Y1079Y|KALRN_ENST00000460856.1_Silent_p.Y1070Y	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1079					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TTCTCAAGTACATCCACAGGA	0.587																																					p.Y1079Y		Atlas-SNP	.											.	KALRN	556	.	0			c.C3237T						.						66.0	59.0	62.0					3																	124160836		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon19			CAAGTACATCCAC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3237C>T	chr3.hg19:g.124160836C>T		404.0	0.0		405.0	93.0	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	hg19	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.242283	0.22796	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	T	0.75133	0.3808	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72626	-0.4236	4	.	.	.	.	19.3361	0.94319	0.0:1.0:0.0:0.0	.	.	.	.	I	1048	.	.	T	+	2	0	KALRN	125643526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.120000	0.50430	2.878000	0.98634	0.650000	0.86243	ACA	.	.		0.587	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
KALRN	8997	hgsc.bcm.edu	37	3	124210191	124210191	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:124210191G>A	ENST00000240874.3	+	31	4760	c.4603G>A	c.(4603-4605)Gag>Aag	p.E1535K	KALRN_ENST00000360013.3_Missense_Mutation_p.E1535K|KALRN_ENST00000460856.1_Missense_Mutation_p.E1526K	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1535	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GGGTGTGACCGAGCACGTGGA	0.567																																					p.E1535K		Atlas-SNP	.											.	KALRN	556	.	0			c.G4603A						.						72.0	65.0	67.0					3																	124210191		2203	4300	6503	SO:0001583	missense	8997	exon31			GTGACCGAGCACG	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4603G>A	chr3.hg19:g.124210191G>A	ENSP00000240874:p.Glu1535Lys	97.0	0.0		95.0	27.0	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000240874.3	hg19	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316292	0.95655	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.29655	1.56;1.56;1.56	5.12	5.12	0.69794	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.66703	0.2816	M	0.93062	3.375	0.80722	D	1	D;P;D	0.89917	0.999;0.929;1.0	D;P;D	0.85130	0.994;0.802;0.997	T	0.75714	-0.3221	10	0.87932	D	0	.	18.7502	0.91810	0.0:0.0:1.0:0.0	.	1526;1535;1535	C9IZQ6;O60229;O60229-2	.;KALRN_HUMAN;.	K	1526;1535;1535	ENSP00000418611:E1526K;ENSP00000240874:E1535K;ENSP00000353109:E1535K	ENSP00000240874:E1535K	E	+	1	0	KALRN	125692881	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.651000	0.98493	2.664000	0.90586	0.655000	0.94253	GAG	.	.		0.567	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
ZNF732	654254	hgsc.bcm.edu	37	4	265506	265506	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr4:265506A>C	ENST00000419098.1	-	4	1150	c.1140T>G	c.(1138-1140)caT>caG	p.H380Q		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	380					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						GAATACTCTTATGTTTATTAA	0.383																																					p.H379Q		Atlas-SNP	.											.	ZNF732	117	.	0			c.T1137G						.						56.0	51.0	53.0					4																	265506		692	1591	2283	SO:0001583	missense	654254	exon3			ACTCTTATGTTTA	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1140T>G	chr4.hg19:g.265506A>C	ENSP00000415774:p.His380Gln	104.0	0.0		101.0	8.0	NM_001137608		Missense_Mutation	SNP	ENST00000419098.1	hg19	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	A	6.225	0.409720	0.11812	.	.	ENSG00000186777	ENST00000419098	D	0.86865	-2.18	0.977	0.977	0.19733	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94076	0.8101	H	0.95645	3.7	0.23555	N	0.997428	D	0.89917	1.0	D	0.97110	1.0	D	0.84316	0.0513	9	0.87932	D	0	.	5.7319	0.18045	1.0:0.0:0.0:0.0	.	380	B4DXR9	ZN732_HUMAN	Q	380	ENSP00000415774:H380Q	ENSP00000415774:H380Q	H	-	3	2	ZNF732	255506	0.184000	0.23200	0.030000	0.17652	0.027000	0.11550	0.295000	0.19065	0.338000	0.23692	0.329000	0.21502	CAT	.	.		0.383	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
HTT	3064	hgsc.bcm.edu	37	4	3208260	3208260	+	Missense_Mutation	SNP	T	T	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr4:3208260T>G	ENST00000355072.5	+	43	5901	c.5756T>G	c.(5755-5757)cTc>cGc	p.L1919R		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1919					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TTAACGTGGCTCATTGTAAAT	0.463																																					p.L1919R		Atlas-SNP	.											.	HTT	221	.	0			c.T5756G						.						104.0	100.0	101.0					4																	3208260		1964	4160	6124	SO:0001583	missense	3064	exon43			CGTGGCTCATTGT	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5756T>G	chr4.hg19:g.3208260T>G	ENSP00000347184:p.Leu1919Arg	131.0	0.0		129.0	43.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	hg19	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.937643	0.92458	.	.	ENSG00000197386	ENST00000355072	T	0.14391	2.51	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.40145	0.1105	M	0.78637	2.42	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.32693	-0.9897	10	0.87932	D	0	.	15.806	0.78513	0.0:0.0:0.0:1.0	.	1919	P42858	HD_HUMAN	R	1919	ENSP00000347184:L1919R	ENSP00000347184:L1919R	L	+	2	0	HTT	3178058	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.934000	0.87649	2.196000	0.70406	0.533000	0.62120	CTC	.	.		0.463	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
PCDH7	5099	hgsc.bcm.edu	37	4	30724272	30724272	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr4:30724272G>A	ENST00000361762.2	+	1	2236	c.1228G>A	c.(1228-1230)Gac>Aac	p.D410N	PCDH7_ENST00000543491.1_Missense_Mutation_p.D410N	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	410	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D363H(1)|p.D410H(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						AGACGAGAACGACAACGTGCC	0.637																																					p.D410N		Atlas-SNP	.											PCDH7_ENST00000361762,NS,carcinoma,0,1	PCDH7	215	.	2	Substitution - Missense(2)	lung(2)	c.G1228A						.						43.0	46.0	45.0					4																	30724272		2202	4300	6502	SO:0001583	missense	5099	exon1			GAGAACGACAACG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1228G>A	chr4.hg19:g.30724272G>A	ENSP00000355243:p.Asp410Asn	303.0	0.0		306.0	89.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	3.995379|3.995379	0.74703|0.74703	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.53640|.	0.61;0.61|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	D|D	0.87386|0.87386	0.6164|0.6164	H|H	0.94658|0.94658	3.565|3.565	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.998|.	D|D	0.90947|0.90947	0.4802|0.4802	9|5	0.87932|.	D|.	0|.	.|.	18.8233|18.8233	0.92106|0.92106	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	410;363;410|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	N|Q	410;410;363|99	ENSP00000355243:D410N;ENSP00000441802:D410N|.	ENSP00000330302:D363N|.	D|R	+|+	1|2	0|0	PCDH7|PCDH7	30333370|30333370	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.516000|0.516000	0.34256|0.34256	9.869000|9.869000	0.99810|0.99810	2.453000|2.453000	0.82957|0.82957	0.655000|0.655000	0.94253|0.94253	GAC|CGA	.	.		0.637	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
TMEM33	55161	hgsc.bcm.edu	37	4	41946817	41946817	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr4:41946817G>C	ENST00000504986.1	+	5	769	c.404G>C	c.(403-405)gGc>gCc	p.G135A	TMEM33_ENST00000325094.5_Missense_Mutation_p.G135A|TMEM33_ENST00000513702.1_Missense_Mutation_p.G135A	NM_018126.2	NP_060596.2	P57088	TMM33_HUMAN	transmembrane protein 33	135						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)				endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9						TAGGCAAGGGGCTCAAATAGT	0.338																																					p.G135A		Atlas-SNP	.											.	TMEM33	17	.	0			c.G404C						.						74.0	72.0	73.0					4																	41946817		2203	4299	6502	SO:0001583	missense	55161	exon5			CAAGGGGCTCAAA	BC000948	CCDS3464.1	4p14	2008-02-05			ENSG00000109133	ENSG00000109133			25541	protein-coding gene	gene with protein product						12477932	Standard	NM_018126		Approved	FLJ10525	uc003gwi.2	P57088	OTTHUMG00000099381	ENST00000504986.1:c.404G>C	chr4.hg19:g.41946817G>C	ENSP00000422473:p.Gly135Ala	105.0	0.0		73.0	21.0	NM_018126	B3KSS8|Q9H953	Missense_Mutation	SNP	ENST00000504986.1	hg19	CCDS3464.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.4|26.4	4.738667|4.738667	0.89573|0.89573	.|.	.|.	ENSG00000109133|ENSG00000109133	ENST00000513558|ENST00000504986;ENST00000508448;ENST00000513702;ENST00000325094	.|.	.|.	.|.	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70736|0.70736	0.3258|0.3258	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	.|B	.|0.29936	.|0.262	.|B	.|0.31686	.|0.134	T|T	0.69709|0.69709	-0.5072|-0.5072	5|9	.|0.14252	.|T	.|0.57	-12.5872|-12.5872	18.584|18.584	0.91182|0.91182	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|135	.|P57088	.|TMM33_HUMAN	P|A	69|135	.|.	.|ENSP00000441455:G135A	A|G	+|+	1|2	0|0	TMEM33|TMEM33	41641574|41641574	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	7.653000|7.653000	0.83643|0.83643	2.399000|2.399000	0.81585|0.81585	0.655000|0.655000	0.94253|0.94253	GCT|GGC	.	.		0.338	TMEM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216834.2	NM_018126	
ODAM	54959	hgsc.bcm.edu	37	4	71067172	71067172	+	Splice_Site	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr4:71067172T>C	ENST00000396094.2	+	7	578	c.530T>C	c.(529-531)aTa>aCa	p.I177T		NM_017855.3	NP_060325.3	A1E959	ODAM_HUMAN	odontogenic, ameloblast asssociated	177	Gln-rich.				biomineral tissue development (GO:0031214)|odontogenesis of dentin-containing tooth (GO:0042475)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|fibril (GO:0043205)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(8)|ovary(3)|skin(2)	20						ATCTGACAGATACCATTCTAT	0.249																																					p.I177T		Atlas-SNP	.											.	ODAM	38	.	0			c.T530C						.						36.0	38.0	38.0					4																	71067172		2197	4292	6489	SO:0001630	splice_region_variant	54959	exon7			GACAGATACCATT	AK000520	CCDS3536.2	4q13.3	2010-11-23			ENSG00000109205	ENSG00000109205			26043	protein-coding gene	gene with protein product		614843				14647039	Standard	NM_017855		Approved	APin, FLJ20513	uc003hfc.3	A1E959	OTTHUMG00000129406	ENST00000396094.2:c.529-1T>C	chr4.hg19:g.71067172T>C		681.0	1.0		618.0	152.0	NM_017855	Q8WWE5|Q9NWZ9	Missense_Mutation	SNP	ENST00000396094.2	hg19	CCDS3536.2	.	.	.	.	.	.	.	.	.	.	T	10.49	1.365660	0.24684	.	.	ENSG00000109205	ENST00000396094;ENST00000510709	T	0.52526	0.66	4.93	4.93	0.64822	.	0.536654	0.16291	N	0.220914	T	0.40956	0.1138	L	0.47716	1.5	0.33479	D	0.587191	P	0.36535	0.557	B	0.34242	0.178	T	0.59563	-0.7431	10	0.72032	D	0.01	-3.7397	10.8896	0.46988	0.0:0.0:0.0:1.0	.	177	A1E959	ODAM_HUMAN	T	177;163	ENSP00000379401:I177T	ENSP00000379401:I177T	I	+	2	0	ODAM	71101761	0.992000	0.36948	1.000000	0.80357	0.410000	0.31052	3.370000	0.52372	2.074000	0.62210	0.377000	0.23210	ATA	.	.		0.249	ODAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251562.1	NM_017855	Missense_Mutation
CCDC158	339965	hgsc.bcm.edu	37	4	77303825	77303825	+	Silent	SNP	A	A	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr4:77303825A>G	ENST00000388914.3	-	7	1004	c.852T>C	c.(850-852)acT>acC	p.T284T	CCDC158_ENST00000434846.2_Silent_p.T284T	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	284										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TAGCTTTCTCAGTAAGTCCTG	0.353																																					p.T284T		Atlas-SNP	.											.	CCDC158	114	.	0			c.T852C						.						149.0	140.0	143.0					4																	77303825		1869	4103	5972	SO:0001819	synonymous_variant	339965	exon7			TTTCTCAGTAAGT	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.852T>C	chr4.hg19:g.77303825A>G		57.0	0.0		65.0	21.0	NM_001042784	Q8IYQ1|Q8N7D4|Q8N7E3	Silent	SNP	ENST00000388914.3	hg19	CCDS43242.1																																																																																			.	.		0.353	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	
HMGXB3	22993	hgsc.bcm.edu	37	5	149389802	149389802	+	Silent	SNP	A	A	G	rs556640934		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr5:149389802A>G	ENST00000502717.1	+	4	905	c.441A>G	c.(439-441)ctA>ctG	p.L147L	HMGXB3_ENST00000503427.1_Silent_p.L147L	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	393	Arg-rich.				phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						GCCCTCAGCTAGAGCTATGTG	0.587													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19802	0.0		0.0	False		,,,				2504	0.0				p.L147L		Atlas-SNP	.											.	HMGXB3	31	.	0			c.A441G						.						64.0	57.0	59.0					5																	149389802		692	1591	2283	SO:0001819	synonymous_variant	22993	exon4			TCAGCTAGAGCTA	D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.441A>G	chr5.hg19:g.149389802A>G		103.0	0.0		105.0	26.0	NM_014983	G5E9Y4|Q86UG3|Q9UMF4	Silent	SNP	ENST00000502717.1	hg19	CCDS54935.1																																																																																			.	.		0.587	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373771.1	XM_001717202	
STC2	8614	hgsc.bcm.edu	37	5	172752987	172752987	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr5:172752987C>T	ENST00000265087.4	-	2	1487	c.178G>A	c.(178-180)Gct>Act	p.A60T	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	60					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ACATCGCCAGCGTTGACCAAA	0.453																																					p.A60T		Atlas-SNP	.											.	STC2	59	.	0			c.G178A						.						165.0	176.0	172.0					5																	172752987		2203	4300	6503	SO:0001583	missense	8614	exon2			CGCCAGCGTTGAC	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.178G>A	chr5.hg19:g.172752987C>T	ENSP00000265087:p.Ala60Thr	172.0	0.0		147.0	30.0	NM_003714		Missense_Mutation	SNP	ENST00000265087.4	hg19	CCDS4388.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.0|25.0	4.588007|4.588007	0.86851|0.86851	.|.	.|.	ENSG00000113739|ENSG00000113739	ENST00000265087|ENST00000520648	.|.	.|.	.|.	5.6|5.6	4.73|4.73	0.59995|0.59995	.|.	0.049807|.	0.85682|.	D|.	0.000000|.	T|T	0.76062|0.76062	0.3935|0.3935	M|M	0.78637|0.78637	2.42|2.42	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.37330|.	0.59|.	B|.	0.32465|.	0.146|.	T|T	0.77515|0.77515	-0.2559|-0.2559	9|5	0.62326|.	D|.	0.03|.	-4.6472|-4.6472	16.5284|16.5284	0.84344|0.84344	0.0:0.8691:0.1309:0.0|0.0:0.8691:0.1309:0.0	.|.	60|.	O76061|.	STC2_HUMAN|.	T|H	60|13	.|.	ENSP00000265087:A60T|.	A|R	-|-	1|2	0|0	STC2|STC2	172685593|172685593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.711000|3.711000	0.54868|0.54868	1.352000|1.352000	0.45808|0.45808	0.655000|0.655000	0.94253|0.94253	GCT|CGC	.	.		0.453	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714	
TBC1D22B	55633	hgsc.bcm.edu	37	6	37250093	37250093	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr6:37250093G>T	ENST00000373491.3	+	4	700	c.554G>T	c.(553-555)cGc>cTc	p.R185L		NM_017772.2	NP_060242.2	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	185							Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)	15			OV - Ovarian serous cystadenocarcinoma(102;0.241)			GAGAAAACCCGCCTAGAAAAA	0.572																																					p.R185L		Atlas-SNP	.											TBC1D22B,NS,carcinoma,0,1	TBC1D22B	37	.	0			c.G554T						.						35.0	40.0	38.0					6																	37250093		2203	4300	6503	SO:0001583	missense	55633	exon4			AAACCCGCCTAGA	AK096340	CCDS4832.1	6p21.2	2005-01-05	2005-01-05	2005-01-05	ENSG00000065491	ENSG00000065491			21602	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 197"""	C6orf197			Standard	NM_017772		Approved	FLJ20337, dJ744I24.2	uc003onn.3	Q9NU19	OTTHUMG00000014619	ENST00000373491.3:c.554G>T	chr6.hg19:g.37250093G>T	ENSP00000362590:p.Arg185Leu	104.0	0.0		133.0	42.0	NM_017772	A8KA28|Q32MQ8|Q5VUK9|Q6P4C3|Q7Z6P7|Q9BPV6|Q9BUT5|Q9NXB6	Missense_Mutation	SNP	ENST00000373491.3	hg19	CCDS4832.1	.	.	.	.	.	.	.	.	.	.	G	34	5.339675	0.95783	.	.	ENSG00000065491	ENST00000373491	T	0.20738	2.05	5.91	5.91	0.95273	Rab-GAP/TBC domain (1);	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	M	0.76574	2.34	0.80722	D	1	D	0.57899	0.981	P	0.55871	0.786	T	0.10776	-1.0615	10	0.87932	D	0	.	19.07	0.93130	0.0:0.0:1.0:0.0	.	185	Q9NU19	TB22B_HUMAN	L	185	ENSP00000362590:R185L	ENSP00000362590:R185L	R	+	2	0	TBC1D22B	37358071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.430000	0.97488	2.793000	0.96121	0.655000	0.94253	CGC	.	.		0.572	TBC1D22B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040402.1	NM_017772	
EPHA7	2045	hgsc.bcm.edu	37	6	93969086	93969086	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr6:93969086C>G	ENST00000369303.4	-	10	2094	c.1910G>C	c.(1909-1911)cGt>cCt	p.R637P		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	637	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ACCAATCACACGCTCAATTTT	0.433																																					p.R637P		Atlas-SNP	.											.	EPHA7	251	.	0			c.G1910C						.						164.0	148.0	153.0					6																	93969086		2203	4300	6503	SO:0001583	missense	2045	exon10			ATCACACGCTCAA	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1910G>C	chr6.hg19:g.93969086C>G	ENSP00000358309:p.Arg637Pro	210.0	0.0		194.0	77.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	hg19	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.077084	0.55753	.	.	ENSG00000135333	ENST00000369303	T	0.63913	-0.07	5.9	5.9	0.94986	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73233	0.3561	L	0.57536	1.79	0.80722	D	1	D;D;D	0.76494	0.995;0.999;0.999	P;D;D	0.68039	0.717;0.925;0.955	T	0.74179	-0.3749	10	0.87932	D	0	.	20.2821	0.98520	0.0:1.0:0.0:0.0	.	633;632;637	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	P	637	ENSP00000358309:R637P	ENSP00000358309:R637P	R	-	2	0	EPHA7	94025807	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.089000	0.71384	2.786000	0.95864	0.563000	0.77884	CGT	.	.		0.433	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
FUT9	10690	hgsc.bcm.edu	37	6	96651187	96651187	+	Silent	SNP	C	C	T	rs534420311		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr6:96651187C>T	ENST00000302103.5	+	3	482	c.156C>T	c.(154-156)aaC>aaT	p.N52N		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	52					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)	p.N52N(1)		NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		AAATGAAAAACTTCTTTTCCA	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		18806	0.001		0.0	False		,,,				2504	0.0				p.N52N	Melanoma(98;1369 1476 6592 22940 26587)	Atlas-SNP	.											FUT9,NS,carcinoma,0,1	FUT9	79	.	1	Substitution - coding silent(1)	prostate(1)	c.C156T						.						102.0	95.0	97.0					6																	96651187		2203	4300	6503	SO:0001819	synonymous_variant	10690	exon3			GAAAAACTTCTTT	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.156C>T	chr6.hg19:g.96651187C>T		101.0	0.0		126.0	8.0	NM_006581	Q5T0W4	Silent	SNP	ENST00000302103.5	hg19	CCDS5033.1																																																																																			.	.		0.423	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581	
FUT9	10690	hgsc.bcm.edu	37	6	96652040	96652040	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr6:96652040G>C	ENST00000302103.5	+	3	1335	c.1009G>C	c.(1009-1011)Gct>Cct	p.A337P		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	337					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		TGCATGTTTGGCTTGCGATCA	0.338																																					p.A337P	Melanoma(98;1369 1476 6592 22940 26587)	Atlas-SNP	.											.	FUT9	79	.	0			c.G1009C						.						88.0	88.0	88.0					6																	96652040		2203	4300	6503	SO:0001583	missense	10690	exon3			TGTTTGGCTTGCG	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.1009G>C	chr6.hg19:g.96652040G>C	ENSP00000302599:p.Ala337Pro	127.0	0.0		120.0	10.0	NM_006581	Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	hg19	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938587	0.73557	.	.	ENSG00000172461	ENST00000302103	T	0.26810	1.71	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.55114	0.1900	M	0.91510	3.215	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	T	0.64871	-0.6305	10	0.62326	D	0.03	-13.338	18.3764	0.90437	0.0:0.0:1.0:0.0	.	337	Q9Y231	FUT9_HUMAN	P	337	ENSP00000302599:A337P	ENSP00000302599:A337P	A	+	1	0	FUT9	96758761	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.354000	0.73036	2.586000	0.87340	0.467000	0.42956	GCT	.	.		0.338	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581	
ATG5	9474	hgsc.bcm.edu	37	6	106740950	106740951	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr6:106740950_106740951GA>AT	ENST00000369076.3	-	4	590_591	c.267_268TC>AT	c.(265-270)ctTCtt>ctATtt	p.L90F	ATG5_ENST00000369070.1_Missense_Mutation_p.L12F|ATG5_ENST00000343245.3_Missense_Mutation_p.L90F|ATG5_ENST00000360666.4_Intron	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	90					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		CTTGATGCAAGAAGATCAAATA	0.287																																					p.L90F|p.L89L		Atlas-SNP	.											.	ATG5	23	.	0			c.C268T|c.T267A						.																																			SO:0001583	missense	9474	exon4			ATGCAAGAAGATC|TGCAAGAAGATCA	Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.267_268delinsAT	chr6.hg19:g.106740950_106740951delinsAT	ENSP00000358072:p.Leu90Phe	299.0|298.0	0.0		367.0|365.0	21.0	NM_004849	O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation|Silent	SNP	ENST00000369076.3	hg19	CCDS5055.1																																																																																			.	.		0.287	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043476.1	NM_004849	
FNDC1	84624	hgsc.bcm.edu	37	6	159653741	159653741	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr6:159653741C>T	ENST00000297267.9	+	11	2397	c.2197C>T	c.(2197-2199)Cag>Tag	p.Q733*	FNDC1_ENST00000340366.6_Nonsense_Mutation_p.Q670*	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	733	Ser-rich.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCTGCCCACCCAGCCACACCT	0.632																																					p.Q733X		Atlas-SNP	.											.	FNDC1	250	.	0			c.C2197T						.						25.0	30.0	29.0					6																	159653741		2068	4201	6269	SO:0001587	stop_gained	84624	exon11			CCCACCCAGCCAC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2197C>T	chr6.hg19:g.159653741C>T	ENSP00000297267:p.Gln733*	97.0	0.0		83.0	13.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Nonsense_Mutation	SNP	ENST00000297267.9	hg19	CCDS47512.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.112551|6.112551	0.97296|0.97296	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000329629|ENST00000297267;ENST00000340366	.|.	.|.	.|.	3.83|3.83	0.145|0.145	0.14829|0.14829	.|.	.|0.956115	.|0.08612	.|N	.|0.919835	T|.	0.03136|.	0.0092|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.40251|.	-0.9573|.	3|.	.|0.02654	.|T	.|1	-3.4001|-3.4001	4.5935|4.5935	0.12319|0.12319	0.2677:0.3004:0.4319:0.0|0.2677:0.3004:0.4319:0.0	.|.	.|.	.|.	.|.	L|X	628|733;670	.|.	.|ENSP00000297267:Q733X	P|Q	+|+	2|1	0|0	FNDC1|FNDC1	159573731|159573731	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.054000|0.054000	0.15201|0.15201	0.030000|0.030000	0.13688|0.13688	0.189000|0.189000	0.20188|0.20188	0.655000|0.655000	0.94253|0.94253	CCA|CAG	.	.		0.632	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
TBP	6908	hgsc.bcm.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		Atlas-SNP	.											.	TBP	58	.	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	chr6.hg19:g.170871004G>A		68.0	0.0		58.0	5.0	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	hg19	CCDS5315.1																																																																																			.	.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
NEUROD6	63974	hgsc.bcm.edu	37	7	31378068	31378068	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr7:31378068G>A	ENST00000297142.3	-	2	1137	c.815C>T	c.(814-816)tCc>tTc	p.S272F		NM_022728.2	NP_073565.2	Q96NK8	NDF6_HUMAN	neuronal differentiation 6	272					cell differentiation (GO:0030154)|dentate gyrus development (GO:0021542)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	32						TTGCTTCAGGGAAAATATCCC	0.478																																					p.S272F		Atlas-SNP	.											.	NEUROD6	84	.	0			c.C815T						.						73.0	74.0	74.0					7																	31378068		2203	4300	6503	SO:0001583	missense	63974	exon2			TTCAGGGAAAATA	AF248954	CCDS5434.1	7p15.1	2013-05-21	2012-02-22		ENSG00000164600	ENSG00000164600		"""Basic helix-loop-helix proteins"""	13804	protein-coding gene	gene with protein product		611513	"""neurogenic differentiation 6"""			12357074	Standard	NM_022728		Approved	Atoh2, NEX1M, Math-2, bHLHa2, Nex1	uc003tch.4	Q96NK8	OTTHUMG00000022865	ENST00000297142.3:c.815C>T	chr7.hg19:g.31378068G>A	ENSP00000297142:p.Ser272Phe	90.0	0.0		79.0	29.0	NM_022728	Q548T9|Q9H3H6	Missense_Mutation	SNP	ENST00000297142.3	hg19	CCDS5434.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343885	0.61073	.	.	ENSG00000164600	ENST00000297142	T	0.74002	-0.8	5.14	5.14	0.70334	Neurogenic differentiation factor, domain of unknown function (1);	0.000000	0.85682	D	0.000000	D	0.87605	0.6219	M	0.83118	2.625	0.80722	D	1	D	0.63880	0.993	D	0.81914	0.995	D	0.89465	0.3739	10	0.87932	D	0	-18.6607	18.6029	0.91255	0.0:0.0:1.0:0.0	.	272	Q96NK8	NDF6_HUMAN	F	272	ENSP00000297142:S272F	ENSP00000297142:S272F	S	-	2	0	NEUROD6	31344593	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.414000	0.97362	2.379000	0.81126	0.650000	0.86243	TCC	.	.		0.478	NEUROD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215050.1	NM_022728	
WBSCR16	81554	hgsc.bcm.edu	37	7	74470082	74470082	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr7:74470082C>A	ENST00000329959.4	-	9	1212	c.1157G>T	c.(1156-1158)gGc>gTc	p.G386V	WBSCR16_ENST00000503250.2_Missense_Mutation_p.G386V	NM_030798.3	NP_110425.2	Q96I51	WBS16_HUMAN	Williams-Beuren syndrome chromosome region 16	386							poly(A) RNA binding (GO:0044822)			kidney(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CTCCGTCAAGCCAAAGAGAGT	0.522																																					p.G386V		Atlas-SNP	.											.	WBSCR16	16	.	0			c.G1157T						.						38.0	43.0	41.0					7																	74470082		2203	4297	6500	SO:0001583	missense	81554	exon9			GTCAAGCCAAAGA	AF410455	CCDS5577.1, CCDS64683.1, CCDS64684.1	7q11.23	2008-08-14			ENSG00000174374	ENSG00000274523			14948	protein-coding gene	gene with protein product						12073013	Standard	NM_030798		Approved		uc003ubr.3	Q96I51	OTTHUMG00000130373	ENST00000329959.4:c.1157G>T	chr7.hg19:g.74470082C>A	ENSP00000333799:p.Gly386Val	592.0	0.0		541.0	90.0	NM_030798	D3DXK0|F5GX55|F5H6C7|Q548B1|Q8IW88|Q8N572|Q9H0G7	Missense_Mutation	SNP	ENST00000329959.4	hg19	CCDS5577.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.510955	0.85389	.	.	ENSG00000174374	ENST00000503250;ENST00000329959	D;D	0.82893	-1.66;-1.66	4.96	4.96	0.65561	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.92828	0.7719	M	0.91196	3.185	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.988	D	0.94137	0.7393	10	0.59425	D	0.04	-25.7576	16.7688	0.85531	0.0:1.0:0.0:0.0	.	386;386	F5H6C7;Q96I51	.;WBS16_HUMAN	V	386	ENSP00000437702:G386V;ENSP00000333799:G386V	ENSP00000333799:G386V	G	-	2	0	WBSCR16	74108018	1.000000	0.71417	0.869000	0.34112	0.890000	0.51754	7.578000	0.82498	2.264000	0.75181	0.462000	0.41574	GGC	.	.		0.522	WBSCR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252740.1	NM_030798	
GIGYF1	64599	hgsc.bcm.edu	37	7	100281944	100281944	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr7:100281944T>C	ENST00000275732.5	-	14	2855	c.1646A>G	c.(1645-1647)gAg>gGg	p.E549G	GIGYF1_ENST00000471340.2_5'Flank	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	549	Gln-rich.				insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CTTCAGCCGCTCCTGGTCCAT	0.662																																					p.E549G		Atlas-SNP	.											.	GIGYF1	113	.	0			c.A1646G						.						22.0	22.0	22.0					7																	100281944		2201	4296	6497	SO:0001583	missense	64599	exon14			AGCCGCTCCTGGT	AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.1646A>G	chr7.hg19:g.100281944T>C	ENSP00000275732:p.Glu549Gly	48.0	0.0		56.0	22.0	NM_022574	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	ENST00000275732.5	hg19	CCDS34708.1	.	.	.	.	.	.	.	.	.	.	.	14.62	2.588489	0.46110	.	.	ENSG00000146830	ENST00000539430;ENST00000275732	D	0.84589	-1.87	4.52	4.52	0.55395	.	0.068034	0.56097	D	0.000025	T	0.81202	0.4773	L	0.54323	1.7	0.47153	D	0.999334	B	0.21071	0.051	B	0.19148	0.024	T	0.78492	-0.2183	10	0.45353	T	0.12	-31.8772	11.8296	0.52288	0.0:0.0:0.0:1.0	.	549	O75420	PERQ1_HUMAN	G	268;549	ENSP00000275732:E549G	ENSP00000275732:E549G	E	-	2	0	GIGYF1	100119880	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	4.012000	0.57131	1.907000	0.55213	0.260000	0.18958	GAG	.	.		0.662	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347205.2	NM_022574	
KCNU1	157855	hgsc.bcm.edu	37	8	36664901	36664901	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr8:36664901T>C	ENST00000399881.3	+	6	626	c.589T>C	c.(589-591)Ttc>Ctc	p.F197L		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	197					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		AGGTTTAAGGTTCCTAAGAGC	0.453																																					p.F197L		Atlas-SNP	.											.	KCNU1	359	.	0			c.T589C						.						145.0	146.0	146.0					8																	36664901		1869	4104	5973	SO:0001583	missense	157855	exon6			TTAAGGTTCCTAA	BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.589T>C	chr8.hg19:g.36664901T>C	ENSP00000382770:p.Phe197Leu	103.0	0.0		72.0	27.0	NM_001031836		Missense_Mutation	SNP	ENST00000399881.3	hg19	CCDS55220.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.839801	0.91117	.	.	ENSG00000215262	ENST00000523973;ENST00000399881	T;T	0.54675	0.56;0.56	5.03	5.03	0.67393	Ion transport (1);	0.000000	0.39341	U	0.001397	T	0.55369	0.1916	N	0.16037	0.36	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62567	-0.6827	10	0.87932	D	0	-4.7666	12.2942	0.54836	0.0:0.0:0.0:1.0	.	197	A8MYU2	KCNU1_HUMAN	L	197	ENSP00000429951:F197L;ENSP00000382770:F197L	ENSP00000382770:F197L	F	+	1	0	KCNU1	36784059	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.259000	0.72494	1.900000	0.55004	0.528000	0.53228	TTC	.	.		0.453	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376631.1	NM_001031836	
APBA1	320	hgsc.bcm.edu	37	9	72131800	72131800	+	Silent	SNP	C	C	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr9:72131800C>G	ENST00000265381.4	-	2	549	c.327G>C	c.(325-327)gcG>gcC	p.A109A		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	109					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CGGGGTCCTGCGCGCGCTCCG	0.726																																					p.A109A		Atlas-SNP	.											.	APBA1	96	.	0			c.G327C						.						16.0	15.0	15.0					9																	72131800		2199	4281	6480	SO:0001819	synonymous_variant	320	exon2			GTCCTGCGCGCGC	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.327G>C	chr9.hg19:g.72131800C>G		27.0	0.0		20.0	9.0	NM_001163	O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	hg19	CCDS6630.1																																																																																			.	.		0.726	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052589.2	NM_001163	
YME1L1	10730	hgsc.bcm.edu	37	10	27406578	27406578	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr10:27406578A>C	ENST00000326799.3	-	16	1965	c.1817T>G	c.(1816-1818)aTt>aGt	p.I606S	YME1L1_ENST00000375972.3_Missense_Mutation_p.I516S|YME1L1_ENST00000376016.3_Missense_Mutation_p.I549S	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	606					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						GTAATATGCAATAATGGCATG	0.383																																					p.I606S		Atlas-SNP	.											.	YME1L1	71	.	0			c.T1817G						.						324.0	273.0	291.0					10																	27406578		2203	4300	6503	SO:0001583	missense	10730	exon16			TATGCAATAATGG	AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.1817T>G	chr10.hg19:g.27406578A>C	ENSP00000318480:p.Ile606Ser	100.0	0.0		115.0	14.0	NM_139312	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Missense_Mutation	SNP	ENST00000326799.3	hg19	CCDS7152.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.052336	0.75960	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000546122	D;D;D	0.86230	-2.09;-2.09;-2.09	5.49	5.49	0.81192	Peptidase M41 (1);Peptidase M41, FtsH (2);	0.050151	0.85682	D	0.000000	D	0.88463	0.6443	L	0.55743	1.74	0.80722	D	1	P;B;B	0.47191	0.891;0.082;0.1	P;B;B	0.49012	0.598;0.037;0.098	D	0.89807	0.3979	10	0.87932	D	0	-26.4193	15.8844	0.79232	1.0:0.0:0.0:0.0	.	516;549;606	B4DNM1;Q96TA2-2;Q96TA2	.;.;YMEL1_HUMAN	S	549;606;606;516;352	ENSP00000365184:I549S;ENSP00000318480:I606S;ENSP00000365139:I516S	ENSP00000318480:I606S	I	-	2	0	YME1L1	27446584	1.000000	0.71417	1.000000	0.80357	0.391000	0.30476	9.236000	0.95360	2.218000	0.71995	0.533000	0.62120	ATT	.	.		0.383	YME1L1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047306.1	NM_139312	
LIPF	8513	hgsc.bcm.edu	37	10	90438430	90438430	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr10:90438430A>T	ENST00000238983.4	+	10	1235	c.1189A>T	c.(1189-1191)Aaa>Taa	p.K397*	LIPF_ENST00000608620.1_Nonsense_Mutation_p.K364*|LIPF_ENST00000355843.2_Nonsense_Mutation_p.K374*|LIPF_ENST00000394375.3_Nonsense_Mutation_p.K407*	NM_004190.3	NP_004181.1	P07098	LIPG_HUMAN	lipase, gastric	397					lipid catabolic process (GO:0016042)|malate metabolic process (GO:0006108)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)	lipid binding (GO:0008289)|malate dehydrogenase activity (GO:0016615)|triglyceride lipase activity (GO:0004806)			NS(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(6)	13		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)	Orlistat(DB01083)	ATCAGAAGATAAAAAGTAGTT	0.328																																					p.K407X		Atlas-SNP	.											.	LIPF	62	.	0			c.A1219T						.						40.0	43.0	42.0					10																	90438430		2203	4299	6502	SO:0001587	stop_gained	8513	exon11			GAAGATAAAAAGT	X05997	CCDS7389.1, CCDS55718.1, CCDS55719.1, CCDS65896.1	10q23	2005-10-30			ENSG00000182333	ENSG00000182333	3.1.1.3		6622	protein-coding gene	gene with protein product		601980				3304425, 9186906	Standard	NM_004190		Approved	HGL, HLAL	uc010qmt.2	P07098	OTTHUMG00000018695	ENST00000238983.4:c.1189A>T	chr10.hg19:g.90438430A>T	ENSP00000238983:p.Lys397*	64.0	0.0		81.0	23.0	NM_001198829	B7Z723|F5H1P4|Q2M1P6|Q5VXI7|Q5VXI8|Q658L8	Nonsense_Mutation	SNP	ENST00000238983.4	hg19	CCDS7389.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.085316	0.36758	.	.	ENSG00000182333	ENST00000394375;ENST00000238983;ENST00000355843	.	.	.	5.13	-8.19	0.01049	.	1.055910	0.07417	N	0.893362	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-0.0855	1.3157	0.02107	0.2742:0.0913:0.2683:0.3662	.	.	.	.	X	407;397;364	.	ENSP00000238983:K397X	K	+	1	0	LIPF	90428410	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.123000	0.10611	-1.687000	0.01437	-1.139000	0.01908	AAA	.	.		0.328	LIPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049256.1		
CHUK	1147	hgsc.bcm.edu	37	10	101945277	101945277	+	IGR	SNP	T	T	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr10:101945277T>A	ENST00000370397.7	-	0	3625				ERLIN1_ENST00000421367.2_Missense_Mutation_p.Y36F|ERLIN1_ENST00000407654.3_Missense_Mutation_p.Y36F|CHUK_ENST00000590930.1_5'Flank	NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase						anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TCACCTGTAGTACACAGCCAG	0.562																																					p.Y36F	Ovarian(159;52 1904 10536 35305 37148)	Atlas-SNP	.											.	.	.	.	0			c.A107T						.						159.0	144.0	149.0					10																	101945277		2203	4300	6503	SO:0001628	intergenic_variant	10613	exon1			CTGTAGTACACAG	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899		chr10.hg19:g.101945277T>A		149.0	0.0		129.0	27.0	NM_006459	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	hg19	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.785579	0.90282	.	.	ENSG00000107566	ENST00000421367;ENST00000407654;ENST00000370408	D;D;D	0.94417	-3.42;-3.42;-3.42	4.68	4.68	0.58851	.	0.000000	0.64402	U	0.000002	D	0.95579	0.8563	M	0.88241	2.94	0.80722	D	1	B	0.25351	0.124	B	0.37387	0.248	D	0.94725	0.7904	10	0.48119	T	0.1	-0.8814	12.424	0.55536	0.0:0.0:0.0:1.0	.	36	D3DR65	.	F	36	ENSP00000410964:Y36F;ENSP00000384900:Y36F;ENSP00000359436:Y36F	ENSP00000359436:Y36F	Y	-	2	0	ERLIN1	101935267	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.798000	0.85924	2.097000	0.63578	0.374000	0.22700	TAC	.	.		0.562	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
C10orf88	80007	hgsc.bcm.edu	37	10	124712495	124712495	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr10:124712495C>T	ENST00000481909.1	-	2	442	c.218G>A	c.(217-219)tGc>tAc	p.C73Y	C10orf88_ENST00000368891.5_5'UTR	NM_024942.3	NP_079218.2	Q9H8K7	CJ088_HUMAN	chromosome 10 open reading frame 88	73										breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)	18		all_neural(114;0.0765)|Lung NSC(174;0.163)|all_lung(145;0.205)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0735)		GTAAAGGAAGCAGGGGTTTTC	0.413																																					p.C73Y		Atlas-SNP	.											.	C10orf88	33	.	0			c.G218A						.						69.0	67.0	67.0					10																	124712495		2203	4300	6503	SO:0001583	missense	80007	exon2			AGGAAGCAGGGGT	AK023552	CCDS7632.1	10q26.13	2012-11-09			ENSG00000119965	ENSG00000119965			25822	protein-coding gene	gene with protein product						12477932	Standard	NM_024942		Approved	FLJ13490, Em:AC073585.5	uc001lgw.2	Q9H8K7	OTTHUMG00000019190	ENST00000481909.1:c.218G>A	chr10.hg19:g.124712495C>T	ENSP00000419126:p.Cys73Tyr	154.0	0.0		129.0	28.0	NM_024942	Q0P6C6|Q8N597	Missense_Mutation	SNP	ENST00000481909.1	hg19	CCDS7632.1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.480527	0.44044	.	.	ENSG00000119965	ENST00000481909	.	.	.	4.64	4.64	0.57946	.	0.000000	0.64402	U	0.000018	T	0.79161	0.4399	M	0.79475	2.455	0.50039	D	0.99984	D	0.89917	1.0	D	0.91635	0.999	T	0.82643	-0.0356	9	0.87932	D	0	.	15.3099	0.74023	0.0:1.0:0.0:0.0	.	73	Q9H8K7	CJ088_HUMAN	Y	73	.	ENSP00000419126:C73Y	C	-	2	0	C10orf88	124702485	1.000000	0.71417	1.000000	0.80357	0.229000	0.25112	3.072000	0.50049	2.098000	0.63641	0.555000	0.69702	TGC	.	.		0.413	C10orf88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050807.1	NM_024942	
FAM196A	642938	hgsc.bcm.edu	37	10	128973669	128973669	+	Silent	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr10:128973669G>A	ENST00000522781.1	-	4	1546	c.991C>T	c.(991-993)Ctg>Ttg	p.L331L	FAM196A_ENST00000424811.2_Silent_p.L331L|DOCK1_ENST00000280333.6_Intron	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	331										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TGGTTCCCCAGCCCCGGCGGG	0.622																																					p.L331L		Atlas-SNP	.											.	FAM196A	55	.	0			c.C991T						.						82.0	91.0	88.0					10																	128973669		2203	4300	6503	SO:0001819	synonymous_variant	642938	exon4			TCCCCAGCCCCGG		CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.991C>T	chr10.hg19:g.128973669G>A		64.0	0.0		66.0	14.0	NM_001039762	B2RNT4|B7ZME7	Silent	SNP	ENST00000522781.1	hg19	CCDS31312.1																																																																																			.	.		0.622	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762	
TRIM5	85363	hgsc.bcm.edu	37	11	5686301	5686301	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr11:5686301C>A	ENST00000380034.3	-	8	1476	c.1220G>T	c.(1219-1221)gGa>gTa	p.G407V	TRIM5_ENST00000396853.4_Intron|TRIM5_ENST00000380027.1_Intron|TRIM5_ENST00000396855.3_Intron|TRIM5_ENST00000483835.1_Intron|TRIM5_ENST00000305836.5_Missense_Mutation_p.G407V|TRIM5_ENST00000396847.3_3'UTR	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5	407	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		ACATTTAACTCCTTCCTCTAA	0.408																																					p.G407V		Atlas-SNP	.											.	TRIM5	111	.	0			c.G1220T						.						120.0	121.0	121.0					11																	5686301		2201	4297	6498	SO:0001583	missense	85363	exon8			TTAACTCCTTCCT	AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.1220G>T	chr11.hg19:g.5686301C>A	ENSP00000369373:p.Gly407Val	91.0	0.0		70.0	19.0	NM_033034	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	Missense_Mutation	SNP	ENST00000380034.3	hg19	CCDS31393.1	.	.	.	.	.	.	.	.	.	.	C	6.154	0.396588	0.11638	.	.	ENSG00000132256	ENST00000305836;ENST00000380034	T;T	0.63580	-0.05;-0.05	3.93	-7.86	0.01187	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	4.960520	0.00496	N	0.000152	T	0.61337	0.2339	L	0.58302	1.8	0.09310	N	1	B	0.30361	0.277	B	0.39339	0.297	T	0.58329	-0.7655	10	0.41790	T	0.15	.	9.7748	0.40612	0.0:0.4862:0.3399:0.1739	.	407	Q9C035	TRIM5_HUMAN	V	407	ENSP00000307031:G407V;ENSP00000369373:G407V	ENSP00000307031:G407V	G	-	2	0	TRIM5	5642877	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.917000	0.01575	-2.805000	0.00350	-2.258000	0.00281	GGA	.	.		0.408	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143360.3	NM_033034	
NAV2	89797	hgsc.bcm.edu	37	11	19955146	19955147	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr11:19955146_19955147GG>CT	ENST00000396087.3	+	8	1524_1525	c.1425_1426GG>CT	c.(1423-1428)gtGGgc>gtCTgc	p.G476C	NAV2_ENST00000349880.4_Missense_Mutation_p.G453C|NAV2_ENST00000527559.2_Missense_Mutation_p.G405C|NAV2_ENST00000540292.1_Missense_Mutation_p.G407C|NAV2_ENST00000360655.4_Missense_Mutation_p.G389C|NAV2_ENST00000396085.1_Missense_Mutation_p.G453C	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	476					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						TCACCACCGTGGGCCCTGCTTC	0.614																																					p.V475V|p.G476C		Atlas-SNP	.											.	NAV2	255	.	0			c.G1425C|c.G1426T						.																																			SO:0001583	missense	89797	exon8			CACCGTGGGCCCT|ACCGTGGGCCCTG	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	Exception_encountered	chr11.hg19:g.19955146_19955147delinsCT	ENSP00000379396:p.Gly476Cys	133.0|132.0	0.0		129.0	41.0|42.0	NM_001244963	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent|Missense_Mutation	SNP	ENST00000396087.3	hg19	CCDS58126.1																																																																																			.	.		0.614	NAV2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324112.1	NM_145117	
OR4C15	81309	hgsc.bcm.edu	37	11	55322138	55322138	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr11:55322138T>A	ENST00000314644.2	+	1	356	c.356T>A	c.(355-357)cTg>cAg	p.L119Q		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TTGGGCTTCCTGTCCTTCCTG	0.468										HNSCC(20;0.049)																											p.L119Q		Atlas-SNP	.											.	OR4C15	145	.	0			c.T356A						.						187.0	150.0	162.0					11																	55322138		2201	4296	6497	SO:0001583	missense	81309	exon1			GCTTCCTGTCCTT	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.356T>A	chr11.hg19:g.55322138T>A	ENSP00000324958:p.Leu119Gln	40.0	0.0		44.0	9.0	NM_001001920	Q6IFE2	Missense_Mutation	SNP	ENST00000314644.2	hg19	CCDS31501.1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.748846	0.69533	.	.	ENSG00000181939	ENST00000314644	T	0.00520	6.85	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.04724	0.0128	H	0.99712	4.72	0.37817	D	0.928254	D	0.89917	1.0	D	0.91635	0.999	T	0.01242	-1.1408	9	0.87932	D	0	.	12.6919	0.56980	0.0:0.0:0.0:1.0	.	65	Q8NGM1	OR4CF_HUMAN	Q	119	ENSP00000324958:L119Q	ENSP00000324958:L119Q	L	+	2	0	OR4C15	55078714	0.668000	0.27493	0.986000	0.45419	0.663000	0.39108	5.063000	0.64332	2.105000	0.64084	0.317000	0.21355	CTG	.	.		0.468	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
SERPING1	710	hgsc.bcm.edu	37	11	57367761	57367761	+	Missense_Mutation	SNP	A	A	C	rs281875168		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr11:57367761A>C	ENST00000278407.4	+	3	688	c.461A>C	c.(460-462)tAc>tCc	p.Y154S	SERPING1_ENST00000340687.6_Missense_Mutation_p.Y154S|SERPING1_ENST00000403558.1_Missense_Mutation_p.Y188S|SERPING1_ENST00000378323.4_Missense_Mutation_p.Y159S|SERPING1_ENST00000378324.2_Missense_Mutation_p.Y102S	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	154			Y -> C (in HAE; dbSNP:rs281875168). {ECO:0000269|PubMed:22994404}.		blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						CTGAAGCTCTACCACGCCTTC	0.542																																					p.Y154S		Atlas-SNP	.											SERPING1,bladder,carcinoma,0,1	SERPING1	57	.	0			c.A461C						.						109.0	111.0	110.0					11																	57367761		2201	4296	6497	SO:0001583	missense	710	exon2			AGCTCTACCACGC	X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.461A>C	chr11.hg19:g.57367761A>C	ENSP00000278407:p.Tyr154Ser	134.0	1.0		98.0	22.0	NM_001032295	A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Missense_Mutation	SNP	ENST00000278407.4	hg19	CCDS7962.1	.	.	.	.	.	.	.	.	.	.	A	18.13	3.555873	0.65425	.	.	ENSG00000149131	ENST00000405496;ENST00000278407;ENST00000340687;ENST00000378323;ENST00000378324;ENST00000403558	D;D;D;D;D;D	0.96334	-3.98;-2.57;-2.57;-2.57;-2.57;-2.57	5.94	5.94	0.96194	Serpin domain (3);	0.068425	0.64402	D	0.000011	D	0.98210	0.9408	M	0.88842	2.985	0.53688	D	0.999973	D;D;D;D	0.89917	0.992;1.0;0.992;0.992	D;D;D;D	0.97110	0.922;1.0;0.922;0.922	D	0.99050	1.0827	10	0.87932	D	0	.	12.7897	0.57526	1.0:0.0:0.0:0.0	.	159;188;154;154	B4E1F0;E9PGN7;E9KL26;P05155	.;.;.;IC1_HUMAN	S	154;154;154;159;102;188	ENSP00000384561:Y154S;ENSP00000278407:Y154S;ENSP00000341861:Y154S;ENSP00000367574:Y159S;ENSP00000367575:Y102S;ENSP00000384420:Y188S	ENSP00000278407:Y154S	Y	+	2	0	SERPING1	57124337	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	3.475000	0.53136	2.279000	0.76181	0.459000	0.35465	TAC	.	.		0.542	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317465.1	NM_000062	
OSBP	5007	hgsc.bcm.edu	37	11	59345631	59345631	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr11:59345631T>A	ENST00000263847.1	-	12	2530	c.2051A>T	c.(2050-2052)aAt>aTt	p.N684I		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	684					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CGGTAAAGGATTCCTTTTCCA	0.483																																					p.N684I		Atlas-SNP	.											.	OSBP	57	.	0			c.A2051T						.						237.0	183.0	201.0					11																	59345631		2201	4295	6496	SO:0001583	missense	5007	exon12			AAAGGATTCCTTT	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.2051A>T	chr11.hg19:g.59345631T>A	ENSP00000263847:p.Asn684Ile	124.0	0.0		90.0	35.0	NM_002556	Q6P524	Missense_Mutation	SNP	ENST00000263847.1	hg19	CCDS7974.1	.	.	.	.	.	.	.	.	.	.	T	15.26	2.781262	0.49891	.	.	ENSG00000110048	ENST00000263847;ENST00000378235	T	0.32988	1.43	5.72	5.72	0.89469	.	0.045544	0.85682	D	0.000000	T	0.48003	0.1476	M	0.80422	2.495	0.58432	D	0.999996	P	0.37276	0.589	P	0.46208	0.507	T	0.49312	-0.8953	10	0.49607	T	0.09	-25.2278	14.9838	0.71330	0.0:0.0:0.0:1.0	.	684	P22059	OSBP1_HUMAN	I	684;284	ENSP00000263847:N684I	ENSP00000263847:N684I	N	-	2	0	OSBP	59102207	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.979000	0.70508	2.183000	0.69458	0.528000	0.53228	AAT	.	.		0.483	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
CD6	923	hgsc.bcm.edu	37	11	60739363	60739363	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr11:60739363G>T	ENST00000313421.7	+	1	212	c.26G>T	c.(25-27)gGa>gTa	p.G9V	CD6_ENST00000352009.5_Missense_Mutation_p.G9V|CD6_ENST00000346437.4_Missense_Mutation_p.G9V|CD6_ENST00000344028.5_Missense_Mutation_p.G9V|CD6_ENST00000545105.1_3'UTR|CD6_ENST00000452451.2_Missense_Mutation_p.G9V	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	9					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						GGGATCACTGGATTGCTGACG	0.642																																					p.G9V	Pancreas(169;904 2017 4767 38890 42505)	Atlas-SNP	.											.	CD6	122	.	0			c.G26T						.						73.0	63.0	66.0					11																	60739363		2203	4299	6502	SO:0001583	missense	923	exon1			TCACTGGATTGCT		CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.26G>T	chr11.hg19:g.60739363G>T	ENSP00000323280:p.Gly9Val	48.0	0.0		37.0	14.0	NM_006725	A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	ENST00000313421.7	hg19	CCDS7999.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008037	0.54361	.	.	ENSG00000013725	ENST00000344028;ENST00000346437;ENST00000313421;ENST00000542157;ENST00000433107;ENST00000452451;ENST00000352009	T;T;T;T;T;T;T	0.01981	4.76;4.77;4.52;4.66;4.85;4.7;4.72	3.7	3.7	0.42460	.	15.212100	0.00166	N	0.000006	T	0.08313	0.0207	L	0.27053	0.805	0.40311	D	0.978718	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.993;0.964	D;D;D;P;P	0.91635	0.998;0.999;0.999;0.804;0.706	T	0.20940	-1.0260	10	0.59425	D	0.04	.	11.2533	0.49039	0.0:0.0:1.0:0.0	.	9;9;9;9;9	E7ER04;P30203-5;P30203-4;P30203;Q8N4Q7	.;.;.;CD6_HUMAN;.	V	9	ENSP00000344108:G9V;ENSP00000345566:G9V;ENSP00000323280:G9V;ENSP00000440055:G9V;ENSP00000410638:G9V;ENSP00000390676:G9V;ENSP00000340628:G9V	ENSP00000323280:G9V	G	+	2	0	CD6	60495939	0.888000	0.30383	0.423000	0.26634	0.009000	0.06853	2.530000	0.45641	2.348000	0.79779	0.655000	0.94253	GGA	.	.		0.642	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396449.1	NM_006725	
CNTN1	1272	hgsc.bcm.edu	37	12	41312465	41312465	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr12:41312465G>T	ENST00000551295.2	+	4	236	c.119G>T	c.(118-120)gGa>gTa	p.G40V	CNTN1_ENST00000360099.3_Missense_Mutation_p.G40V|CNTN1_ENST00000547849.1_Missense_Mutation_p.G40V|CNTN1_ENST00000348761.2_Missense_Mutation_p.G29V|CNTN1_ENST00000347616.1_Missense_Mutation_p.G40V|CNTN1_ENST00000547702.1_Missense_Mutation_p.G40V	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	40					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AAAGGATTTGGACCAATTTTT	0.368																																					p.G40V		Atlas-SNP	.											.	CNTN1	207	.	0			c.G119T						.						71.0	77.0	75.0					12																	41312465		2203	4300	6503	SO:0001583	missense	1272	exon4			GATTTGGACCAAT	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.119G>T	chr12.hg19:g.41312465G>T	ENSP00000447006:p.Gly40Val	286.0	0.0		320.0	70.0	NM_001256063	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	hg19	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817016	0.90790	.	.	ENSG00000018236	ENST00000547702;ENST00000551424;ENST00000551295;ENST00000548005;ENST00000552248;ENST00000547849;ENST00000552913;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T;T;T	0.67171	-0.25;0.16;0.91;0.91;-0.25;0.16;-0.25;0.12	5.36	5.36	0.76844	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	N	0.08118	0	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.75938	-0.3141	10	0.59425	D	0.04	.	19.4779	0.94996	0.0:0.0:1.0:0.0	.	40;29;40	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	V	40;40;40;40;40;40;40;40;40;29	ENSP00000448004:G40V;ENSP00000447006:G40V;ENSP00000447862:G40V;ENSP00000447860:G40V;ENSP00000448653:G40V;ENSP00000325660:G40V;ENSP00000353213:G40V;ENSP00000261160:G29V	ENSP00000325660:G40V	G	+	2	0	CNTN1	39598732	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.989000	0.93506	2.682000	0.91365	0.585000	0.79938	GGA	.	.		0.368	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
KRT73	319101	hgsc.bcm.edu	37	12	53012005	53012005	+	Missense_Mutation	SNP	C	C	A	rs199866943		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr12:53012005C>A	ENST00000305748.3	-	1	338	c.304G>T	c.(304-306)Ggg>Tgg	p.G102W	RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	102	Gly-rich.|Head.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.G102R(1)|p.G102W(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGGATACCCCCGGGCGGGCAC	0.632																																					p.G102W		Atlas-SNP	.											KRT73,colon,carcinoma,0,1	KRT73	101	.	2	Substitution - Missense(2)	large_intestine(1)|lung(1)	c.G304T						.						109.0	115.0	113.0					12																	53012005		2203	4300	6503	SO:0001583	missense	319101	exon1			TACCCCCGGGCGG	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.304G>T	chr12.hg19:g.53012005C>A	ENSP00000307014:p.Gly102Trp	163.0	0.0		120.0	38.0	NM_175068	Q32MB2	Missense_Mutation	SNP	ENST00000305748.3	hg19	CCDS8834.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892215	0.33442	.	.	ENSG00000186049	ENST00000305748	D	0.92495	-3.05	4.64	3.75	0.43078	.	0.000000	0.53938	D	0.000055	D	0.97040	0.9033	H	0.95260	3.645	0.31888	N	0.61763	D	0.89917	1.0	D	0.91635	0.999	D	0.97057	0.9768	10	0.87932	D	0	.	13.7729	0.63036	0.0:0.9237:0.0:0.0763	.	102	Q86Y46	K2C73_HUMAN	W	102	ENSP00000307014:G102W	ENSP00000307014:G102W	G	-	1	0	KRT73	51298272	0.013000	0.17824	0.801000	0.32222	0.004000	0.04260	2.627000	0.46469	1.276000	0.44395	-0.123000	0.14984	GGG	.	C|1.000;T|0.000		0.632	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1	NM_175068	
KRT79	338785	hgsc.bcm.edu	37	12	53225249	53225249	+	Silent	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr12:53225249C>A	ENST00000330553.5	-	2	673	c.639G>T	c.(637-639)cgG>cgT	p.R213R		NM_175834.2	NP_787028.1	Q5XKE5	K2C79_HUMAN	keratin 79	213	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	enzyme binding (GO:0019899)|structural molecule activity (GO:0005198)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCAGCCTCCCCCGCTCGCTCT	0.612																																					p.R213R		Atlas-SNP	.											.	KRT79	78	.	0			c.G639T						.						112.0	112.0	112.0					12																	53225249		2203	4300	6503	SO:0001819	synonymous_variant	338785	exon2			CCTCCCCCGCTCG	AJ564105	CCDS8839.1	12q13.13	2014-02-12	2007-07-03		ENSG00000185640	ENSG00000185640		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28930	protein-coding gene	gene with protein product	"""keratin 6-like"""	611160				11683385	Standard	NM_175834		Approved	K6L, KRT6L	uc001sbb.3	Q5XKE5	OTTHUMG00000169878	ENST00000330553.5:c.639G>T	chr12.hg19:g.53225249C>A		81.0	0.0		61.0	19.0	NM_175834	Q6P465|Q7Z793	Silent	SNP	ENST00000330553.5	hg19	CCDS8839.1																																																																																			.	.		0.612	KRT79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406376.1	NM_175834	
E2F7	144455	hgsc.bcm.edu	37	12	77444515	77444515	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr12:77444515C>A	ENST00000322886.7	-	4	614	c.379G>T	c.(379-381)Gtt>Ttt	p.V127F	E2F7_ENST00000416496.2_Missense_Mutation_p.V127F	NM_203394.2	NP_976328.2	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	127					chorionic trophoblast cell differentiation (GO:0060718)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|hepatocyte differentiation (GO:0070365)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokinesis (GO:0032466)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(15)|lung(14)|ovary(3)|upper_aerodigestive_tract(2)	42						CTGTCCCCAACAACATCAAGC	0.483																																					p.V127F		Atlas-SNP	.											.	E2F7	201	.	0			c.G379T						.						92.0	87.0	89.0					12																	77444515		2203	4300	6503	SO:0001583	missense	144455	exon4			CCCCAACAACATC	BC016658	CCDS9016.1	12q21.1	2008-02-05				ENSG00000165891			23820	protein-coding gene	gene with protein product		612046				12893818	Standard	NM_203394		Approved		uc001sym.4	Q96AV8	OTTHUMG00000169969	ENST00000322886.7:c.379G>T	chr12.hg19:g.77444515C>A	ENSP00000323246:p.Val127Phe	59.0	0.0		39.0	12.0	NM_203394	A6NC74|B2RMR7|B3KTZ5|B3KUP8|B5MED9	Missense_Mutation	SNP	ENST00000322886.7	hg19	CCDS9016.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.68|17.68	3.448734|3.448734	0.63178|0.63178	.|.	.|.	ENSG00000165891|ENSG00000165891	ENST00000551058|ENST00000322886;ENST00000416496;ENST00000550669	.|T;T;T	.|0.19105	.|2.43;2.17;2.18	5.7|5.7	4.8|4.8	0.61643|0.61643	.|.	.|0.371732	.|0.30028	.|N	.|0.010582	T|T	0.26159|0.26159	0.0638|0.0638	L|L	0.44542|0.44542	1.39|1.39	0.29557|0.29557	N|N	0.850913|0.850913	.|P;P	.|0.49961	.|0.925;0.93	.|P;P	.|0.48141	.|0.568;0.467	T|T	0.05852|0.05852	-1.0860|-1.0860	5|10	.|0.29301	.|T	.|0.29	-7.3522|-7.3522	15.8342|15.8342	0.78787|0.78787	0.0:0.8639:0.1361:0.0|0.0:0.8639:0.1361:0.0	.|.	.|127;127	.|F8VSE7;Q96AV8	.|.;E2F7_HUMAN	F|F	4|127	.|ENSP00000323246:V127F;ENSP00000393639:V127F;ENSP00000448245:V127F	.|ENSP00000323246:V127F	L|V	-|-	3|1	2|0	E2F7|E2F7	75968646|75968646	0.959000|0.959000	0.32827|0.32827	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.328000|3.328000	0.52052|0.52052	1.394000|1.394000	0.46624|0.46624	0.650000|0.650000	0.86243|0.86243	TTG|GTT	.	.		0.483	E2F7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406716.1	XM_084871	
STAB2	55576	hgsc.bcm.edu	37	12	104155082	104155082	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr12:104155082A>C	ENST00000388887.2	+	66	7457	c.7253A>C	c.(7252-7254)gAg>gCg	p.E2418A	RP11-341G23.4_ENST00000551299.1_RNA|RP11-341G23.4_ENST00000550029.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CCCTAGACGGAGACCAGGTTT	0.522																																					p.E2418A		Atlas-SNP	.											.	STAB2	370	.	0			c.A7253C						.						150.0	129.0	136.0					12																	104155082		2203	4300	6503	SO:0001583	missense	55576	exon66			AGACGGAGACCAG	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7253A>C	chr12.hg19:g.104155082A>C	ENSP00000373539:p.Glu2418Ala	85.0	0.0		83.0	22.0	NM_017564		Missense_Mutation	SNP	ENST00000388887.2	hg19	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	A	5.927	0.355088	0.11239	.	.	ENSG00000136011	ENST00000388887	D	0.91740	-2.9	4.95	4.95	0.65309	FAS1 domain (4);	0.357304	0.25230	N	0.032167	D	0.86527	0.5954	N	0.17800	0.525	0.35374	D	0.789317	P	0.46859	0.885	P	0.48770	0.589	D	0.85232	0.1033	10	0.08179	T	0.78	.	10.7619	0.46270	0.841:0.159:0.0:0.0	.	2418	Q8WWQ8	STAB2_HUMAN	A	2418	ENSP00000373539:E2418A	ENSP00000373539:E2418A	E	+	2	0	STAB2	102679212	1.000000	0.71417	0.996000	0.52242	0.455000	0.32408	4.033000	0.57282	1.855000	0.53841	0.533000	0.62120	GAG	.	.		0.522	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
TDG	6996	hgsc.bcm.edu	37	12	104378700	104378700	+	Splice_Site	SNP	T	T	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr12:104378700T>A	ENST00000392872.3	+	8	1198		c.e8+2		TDG_ENST00000544861.1_Splice_Site|TDG_ENST00000542036.1_Splice_Site|AC078819.1_ENST00000401157.1_RNA|TDG_ENST00000266775.9_Splice_Site	NM_003211.4	NP_003202.3	Q13569	TDG_HUMAN	thymine-DNA glycosylase						base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|chromatin modification (GO:0016568)|depyrimidination (GO:0045008)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|embryo development (GO:0009790)|mismatch repair (GO:0006298)|negative regulation of chromatin binding (GO:0035562)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression, epigenetic (GO:0040029)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|double-stranded DNA binding (GO:0003690)|mismatched DNA binding (GO:0030983)|protein homodimerization activity (GO:0042803)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|RNA polymerase II transcription cofactor activity (GO:0001104)|structure-specific DNA binding (GO:0043566)			large_intestine(2)|lung(14)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(302;0.00114)		TTGCCCAAGGTATGTTACTGT	0.313								Base excision repair (BER), DNA glycosylases																													.		Atlas-SNP	.											.	TDG	43	.	0			c.964+2T>A						.						119.0	112.0	115.0					12																	104378700		2203	4300	6503	SO:0001630	splice_region_variant	6996	exon8			CCAAGGTATGTTA	U51166	CCDS9095.1	12q24.1	2014-05-14			ENSG00000139372	ENSG00000139372	3.2.2.29		11700	protein-coding gene	gene with protein product	"""G/T mismatch-specific thymine DNA glycosylase"""	601423				8662714, 9299239	Standard	NM_003211		Approved		uc001tkg.3	Q13569	OTTHUMG00000168418	ENST00000392872.3:c.964+2T>A	chr12.hg19:g.104378700T>A		116.0	0.0		151.0	43.0	NM_003211	Q8IUZ6|Q8IZM3	Splice_Site	SNP	ENST00000392872.3	hg19	CCDS9095.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.860203	0.71834	.	.	ENSG00000139372	ENST00000392872;ENST00000266775;ENST00000544861;ENST00000542036	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4943	0.84223	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TDG	102902830	1.000000	0.71417	0.940000	0.37924	0.735000	0.41995	8.040000	0.89188	2.291000	0.77112	0.533000	0.62120	.	.	.		0.313	TDG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399673.2		Intron
NOC4L	79050	hgsc.bcm.edu	37	12	132636036	132636036	+	Missense_Mutation	SNP	C	C	T	rs554287010	byFrequency	TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr12:132636036C>T	ENST00000330579.1	+	12	1122	c.1081C>T	c.(1081-1083)Ccc>Tcc	p.P361S	NOC4L_ENST00000535343.1_3'UTR|NOC4L_ENST00000538784.1_5'UTR	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	361					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CAGCCACCTCCCCGCCTACCT	0.706																																					p.P361S		Atlas-SNP	.											NOC4L,mucosal,malignant_melanoma,0,1	NOC4L	31	.	0			c.C1081T						.						16.0	20.0	19.0					12																	132636036		2178	4284	6462	SO:0001583	missense	79050	exon12			CACCTCCCCGCCT		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.1081C>T	chr12.hg19:g.132636036C>T	ENSP00000328854:p.Pro361Ser	36.0	0.0		25.0	6.0	NM_024078	Q8N2S5|Q96I14	Missense_Mutation	SNP	ENST00000330579.1	hg19	CCDS9277.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.990210	0.74589	.	.	ENSG00000184967	ENST00000330579	T	0.23552	1.9	5.33	4.44	0.53790	CCAAT-binding factor (1);	0.000000	0.85682	D	0.000000	T	0.43077	0.1231	L	0.53617	1.68	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.18085	-1.0348	10	0.19590	T	0.45	-27.0096	13.6021	0.62026	0.0:0.9239:0.0:0.0761	.	361	Q9BVI4	NOC4L_HUMAN	S	361	ENSP00000328854:P361S	ENSP00000328854:P361S	P	+	1	0	NOC4L	131201989	1.000000	0.71417	0.874000	0.34290	0.498000	0.33706	5.399000	0.66314	1.251000	0.43983	0.561000	0.74099	CCC	.	.		0.706	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398999.1	NM_024078	
ATP8A2	51761	hgsc.bcm.edu	37	13	26594029	26594029	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr13:26594029G>T	ENST00000381655.2	+	37	3615	c.3473G>T	c.(3472-3474)gGg>gTg	p.G1158V	ATP8A2_ENST00000255283.8_Missense_Mutation_p.G1093V	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	1118					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CTTTCAGATGGGTATGCTTTT	0.438																																					p.G1158V		Atlas-SNP	.											.	ATP8A2	181	.	0			c.G3473T						.						104.0	97.0	99.0					13																	26594029		1919	4138	6057	SO:0001583	missense	51761	exon37			CAGATGGGTATGC	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3473G>T	chr13.hg19:g.26594029G>T	ENSP00000371070:p.Gly1158Val	109.0	0.0		68.0	21.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	hg19	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.804283	0.70682	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.78246	-0.25;-1.16	4.81	4.81	0.61882	.	0.270973	0.35096	N	0.003446	D	0.90027	0.6886	M	0.88031	2.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.91977	0.5591	10	0.87932	D	0	.	18.0766	0.89428	0.0:0.0:1.0:0.0	.	1093;1118	B7Z880;Q9NTI2	.;AT8A2_HUMAN	V	1158;1093;938	ENSP00000371070:G1158V;ENSP00000255283:G1093V	ENSP00000255283:G1093V	G	+	2	0	ATP8A2	25492029	1.000000	0.71417	0.987000	0.45799	0.894000	0.52154	6.910000	0.75741	2.507000	0.84556	0.555000	0.69702	GGG	.	.		0.438	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
ELF1	1997	hgsc.bcm.edu	37	13	41507803	41507803	+	Missense_Mutation	SNP	G	G	A	rs538458962	byFrequency	TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr13:41507803G>A	ENST00000239882.3	-	9	1932	c.1618C>T	c.(1618-1620)Cgc>Tgc	p.R540C	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.R516C	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	540					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TGTGAACTGCGAGGAGAAAAG	0.463													G|||	3	0.000599042	0.0	0.0	5008	,	,		21812	0.0		0.0	False		,,,				2504	0.0031				p.R540C		Atlas-SNP	.											.	ELF1	65	.	0			c.C1618T						.						95.0	89.0	91.0					13																	41507803		2203	4300	6503	SO:0001583	missense	1997	exon9			AACTGCGAGGAGA	M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1618C>T	chr13.hg19:g.41507803G>A	ENSP00000239882:p.Arg540Cys	90.0	0.0		72.0	22.0	NM_172373	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	ENST00000239882.3	hg19	CCDS9374.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720088	0.48728	.	.	ENSG00000120690	ENST00000442101;ENST00000379498;ENST00000239882	T;T	0.20463	2.07;2.07	5.23	4.33	0.51752	.	0.333731	0.31461	N	0.007611	T	0.16557	0.0398	L	0.27053	0.805	0.40465	D	0.980284	D;D	0.69078	0.993;0.997	B;P	0.46339	0.427;0.513	T	0.01007	-1.1483	10	0.56958	D	0.05	.	8.0336	0.30480	0.0:0.1271:0.5628:0.3101	.	516;540	E9PDQ9;P32519	.;ELF1_HUMAN	C	516;282;540	ENSP00000405580:R516C;ENSP00000239882:R540C	ENSP00000239882:R540C	R	-	1	0	ELF1	40405803	0.999000	0.42202	1.000000	0.80357	0.967000	0.64934	2.365000	0.44196	2.438000	0.82558	0.591000	0.81541	CGC	.	.		0.463	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044654.3	NM_172373	
ITGBL1	9358	hgsc.bcm.edu	37	13	102235651	102235651	+	Silent	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr13:102235651T>C	ENST00000376180.3	+	6	1032	c.813T>C	c.(811-813)tgT>tgC	p.C271C	ITGBL1_ENST00000376162.3_Silent_p.C178C|ITGBL1_ENST00000545560.2_Silent_p.C130C	NM_001271756.1|NM_004791.1	NP_001258685.1|NP_004782.1	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat domains)	271	Cysteine-rich tandem repeats.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)				breast(1)|large_intestine(6)|lung(16)|ovary(1)|prostate(4)|skin(3)	31	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CCTGTGAATGTGATGAGAGGG	0.502																																					p.C271C		Atlas-SNP	.											ITGBL1,bladder,carcinoma,0,1	ITGBL1	83	.	0			c.T813C						.						261.0	248.0	252.0					13																	102235651		2203	4300	6503	SO:0001819	synonymous_variant	9358	exon6			TGAATGTGATGAG	AF072752	CCDS9499.1, CCDS61361.1, CCDS61362.1, CCDS73594.1	13q33	2008-07-18			ENSG00000198542	ENSG00000198542			6164	protein-coding gene	gene with protein product	"""ten integrin EGF-like repeat domains protein"", ""ITGBL1, integrin beta-like 1"""	604234				10051402	Standard	NM_004791		Approved	TIED, OSCP	uc001vpb.4	O95965	OTTHUMG00000017296	ENST00000376180.3:c.813T>C	chr13.hg19:g.102235651T>C		146.0	0.0		104.0	26.0	NM_004791	A8K5M5|B3KTP1|B4DQ02|Q8N172|Q9NPR0	Silent	SNP	ENST00000376180.3	hg19	CCDS9499.1																																																																																			.	.		0.502	ITGBL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045669.2	NM_004791	
KLHL33	123103	hgsc.bcm.edu	37	14	20897109	20897109	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr14:20897109G>A	ENST00000344581.4	-	4	1723	c.1501C>T	c.(1501-1503)Cca>Tca	p.P501S		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	501												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		CGAGGCCTTGGCAGAGTTCCC	0.607																																					p.P501S		Atlas-SNP	.											.	KLHL33	37	.	0			c.C1501T						.						58.0	61.0	60.0					14																	20897109		692	1591	2283	SO:0001583	missense	123103	exon4			GCCTTGGCAGAGT		CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.1501C>T	chr14.hg19:g.20897109G>A	ENSP00000341549:p.Pro501Ser	98.0	0.0		78.0	18.0	NM_001109997		Missense_Mutation	SNP	ENST00000344581.4	hg19	CCDS53882.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934707	0.73442	.	.	ENSG00000185271	ENST00000344581	T	0.70516	-0.49	5.2	5.2	0.72013	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.74913	0.3779	L	0.37697	1.125	0.44485	D	0.997428	D	0.89917	1.0	D	0.91635	0.999	T	0.66995	-0.5782	10	0.08837	T	0.75	.	15.774	0.78193	0.0:0.0:1.0:0.0	.	501	A6NCF5	KLH33_HUMAN	S	501	ENSP00000341549:P501S	ENSP00000341549:P501S	P	-	1	0	KLHL33	19966949	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.370000	0.79589	2.722000	0.93159	0.655000	0.94253	CCA	.	.		0.607	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411038.1	XM_063481	
AP4S1	11154	hgsc.bcm.edu	37	14	31554030	31554030	+	Intron	SNP	G	G	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr14:31554030G>T	ENST00000542754.2	+	5	699				AP4S1_ENST00000554345.1_Missense_Mutation_p.C117F|AP4S1_ENST00000334725.4_3'UTR|AP4S1_ENST00000216366.4_Missense_Mutation_p.C141F|AP4S1_ENST00000313566.6_Intron|AP4S1_ENST00000554609.1_Intron	NM_001128126.2|NM_001254728.1	NP_001121598.1|NP_001241657.1	Q9Y587	AP4S1_HUMAN	adaptor-related protein complex 4, sigma 1 subunit							coated pit (GO:0005905)|Golgi apparatus (GO:0005794)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			lung(1)	1	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.221)	GBM - Glioblastoma multiforme(265;0.00553)		CAGCAGACTTGCTTTTCTCCA	0.438																																					p.C141F	Pancreas(128;620 2365 4508 44145)	Atlas-SNP	.											.	AP4S1	23	.	0			c.G422T						.						74.0	76.0	75.0					14																	31554030		2203	4300	6503	SO:0001627	intron_variant	11154	exon6			AGACTTGCTTTTC	AB030654	CCDS9642.1, CCDS45093.1, CCDS58309.1, CCDS58310.1	14q12	2012-06-29			ENSG00000100478	ENSG00000100478			575	protein-coding gene	gene with protein product		607243				10436028, 21620353	Standard	NM_007077		Approved	CLA20, AP47B, SPG52	uc001wqw.4	Q9Y587	OTTHUMG00000140202	ENST00000542754.2:c.306+4240G>T	chr14.hg19:g.31554030G>T		350.0	0.0		330.0	25.0	NM_007077	G3V2N8|Q6IAQ4|Q86U36|Q9BVE7	Missense_Mutation	SNP	ENST00000542754.2	hg19	CCDS45093.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184710	0.38609	.	.	ENSG00000100478	ENST00000216366;ENST00000554345	.	.	.	4.05	2.07	0.26955	.	6.477130	0.00718	N	0.000868	T	0.36908	0.0984	.	.	.	0.09310	N	0.999999	P;P	0.50528	0.828;0.936	B;P	0.44990	0.371;0.466	T	0.36648	-0.9739	8	0.33940	T	0.23	.	10.515	0.44885	0.0:0.4249:0.5751:0.0	.	117;141	G3V2N8;Q9Y587-2	.;.	F	141;117	.	ENSP00000216366:C141F	C	+	2	0	AP4S1	30623781	0.108000	0.22018	0.004000	0.12327	0.128000	0.20619	1.182000	0.32029	0.572000	0.29383	0.655000	0.94253	TGC	.	.		0.438	AP4S1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409723.1		
ACTN1	87	hgsc.bcm.edu	37	14	69358837	69358837	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr14:69358837G>A	ENST00000193403.6	-	10	1402	c.1019C>T	c.(1018-1020)aCg>aTg	p.T340M	ACTN1_ENST00000376839.3_Missense_Mutation_p.T275M|ACTN1_ENST00000554508.1_5'Flank|ACTN1_ENST00000538545.2_Missense_Mutation_p.T340M|ACTN1_ENST00000394419.4_Missense_Mutation_p.T340M|ACTN1_ENST00000438964.2_Missense_Mutation_p.T340M	NM_001102.3	NP_001093.1	P12814	ACTN1_HUMAN	actinin, alpha 1	340	Interaction with DDN.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of apoptotic process (GO:0042981)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|double-stranded RNA binding (GO:0003725)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|vinculin binding (GO:0017166)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(9)|prostate(2)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GGTCTGCAGCGTGTTGAAGTT	0.637																																					p.T340M		Atlas-SNP	.											.	ACTN1	77	.	0			c.C1019T						.						91.0	81.0	85.0					14																	69358837		2203	4300	6503	SO:0001583	missense	87	exon10			TGCAGCGTGTTGA	M95178	CCDS9792.1, CCDS45129.1, CCDS45130.1	14q24.1	2014-08-08			ENSG00000072110	ENSG00000072110		"""EF-hand domain containing"""	163	protein-coding gene	gene with protein product		102575				2349951	Standard	NM_001102		Approved		uc001xkm.3	P12814	OTTHUMG00000171386	ENST00000193403.6:c.1019C>T	chr14.hg19:g.69358837G>A	ENSP00000193403:p.Thr340Met	128.0	0.0		96.0	11.0	NM_001102	B3V8S3|B4DHH3|B7TY16|Q1HE25|Q9BTN1	Missense_Mutation	SNP	ENST00000193403.6	hg19	CCDS9792.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935430	0.92458	.	.	ENSG00000072110	ENST00000193403;ENST00000394419;ENST00000438964;ENST00000376839;ENST00000538545	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.76407	0.3983	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;P;D	0.79108	0.983;0.992;0.904;0.972	D	0.83383	0.0013	10	0.87932	D	0	.	17.9951	0.89181	0.0:0.0:1.0:0.0	.	340;340;340;340	B7TY16;P12814-2;Q1HE25;P12814	.;.;.;ACTN1_HUMAN	M	340;340;340;275;340	ENSP00000193403:T340M;ENSP00000377941:T340M;ENSP00000414272:T340M;ENSP00000366035:T275M;ENSP00000439828:T340M	ENSP00000193403:T340M	T	-	2	0	ACTN1	68428590	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	9.631000	0.98424	2.464000	0.83262	0.643000	0.83706	ACG	.	.		0.637	ACTN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413233.3	NM_001102	
PTPN21	11099	hgsc.bcm.edu	37	14	88967666	88967666	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr14:88967666C>T	ENST00000556564.1	-	7	918	c.634G>A	c.(634-636)Gag>Aag	p.E212K	RP11-507K2.2_ENST00000555444.1_RNA|PTPN21_ENST00000328736.3_Missense_Mutation_p.E212K|PTPN21_ENST00000554628.1_5'UTR	NM_007039.3	NP_008970.2	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type 21	212	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|liver(1)|lung(7)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TCCATTCTCTCTACCTCCTGC	0.448																																					p.E212K		Atlas-SNP	.											.	PTPN21	113	.	0			c.G634A						.						177.0	179.0	179.0					14																	88967666		2203	4300	6503	SO:0001583	missense	11099	exon7			TTCTCTCTACCTC	X79510	CCDS9884.1	14q31	2011-06-09				ENSG00000070778		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9651	protein-coding gene	gene with protein product		603271				7519780	Standard	NM_007039		Approved	PTPD1, PTPRL10	uc001xwv.4	Q16825		ENST00000556564.1:c.634G>A	chr14.hg19:g.88967666C>T	ENSP00000452414:p.Glu212Lys	234.0	0.0		191.0	54.0	NM_007039		Missense_Mutation	SNP	ENST00000556564.1	hg19	CCDS9884.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837863	0.91117	.	.	ENSG00000070778	ENST00000328736;ENST00000556564	T;T	0.77229	-1.08;-1.08	5.34	5.34	0.76211	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	T	0.77532	0.4144	N	0.10733	0.035	0.50313	D	0.999862	D	0.89917	1.0	D	0.87578	0.998	T	0.78406	-0.2216	10	0.28530	T	0.3	.	18.6691	0.91504	0.0:1.0:0.0:0.0	.	212	Q16825	PTN21_HUMAN	K	212	ENSP00000330276:E212K;ENSP00000452414:E212K	ENSP00000330276:E212K	E	-	1	0	PTPN21	88037419	1.000000	0.71417	0.988000	0.46212	0.778000	0.44026	7.248000	0.78268	2.511000	0.84671	0.655000	0.94253	GAG	.	.		0.448	PTPN21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410303.1		
DISP2	85455	hgsc.bcm.edu	37	15	40660759	40660759	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr15:40660759T>C	ENST00000267889.3	+	8	2533	c.2446T>C	c.(2446-2448)Tgt>Cgt	p.C816R	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	816					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		GCTGGCACTCTGTCACCGGGC	0.672																																					p.C816R		Atlas-SNP	.											.	DISP2	86	.	0			c.T2446C						.						35.0	41.0	39.0					15																	40660759		2201	4296	6497	SO:0001583	missense	85455	exon8			GCACTCTGTCACC	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2446T>C	chr15.hg19:g.40660759T>C	ENSP00000267889:p.Cys816Arg	63.0	0.0		58.0	11.0	NM_033510	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	hg19	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	T	16.38	3.106032	0.56291	.	.	ENSG00000140323	ENST00000267889	T	0.32023	1.47	5.29	5.29	0.74685	.	0.044253	0.85682	D	0.000000	T	0.59487	0.2197	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65747	-0.6093	10	0.72032	D	0.01	-30.1226	15.3877	0.74714	0.0:0.0:0.0:1.0	.	816	A7MBM2	DISP2_HUMAN	R	816	ENSP00000267889:C816R	ENSP00000267889:C816R	C	+	1	0	DISP2	38448051	1.000000	0.71417	0.146000	0.22360	0.697000	0.40408	7.862000	0.87013	2.224000	0.72417	0.459000	0.35465	TGT	.	.		0.672	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
PLA2G4F	255189	hgsc.bcm.edu	37	15	42434382	42434382	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr15:42434382C>T	ENST00000382396.4	-	20	2436	c.2350G>A	c.(2350-2352)Gag>Aag	p.E784K	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.E786K			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	784	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GCCTTCTCCTCAGCTGTTTGT	0.572																																					p.E784K		Atlas-SNP	.											.	PLA2G4F	75	.	0			c.G2350A						.						67.0	58.0	61.0					15																	42434382		2203	4299	6502	SO:0001583	missense	255189	exon20			TCTCCTCAGCTGT		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.2350G>A	chr15.hg19:g.42434382C>T	ENSP00000371833:p.Glu784Lys	112.0	0.0		92.0	29.0	NM_213600	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	hg19	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132183	0.77662	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000443825	T;T	0.04551	3.6;3.6	5.21	5.21	0.72293	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.377447	0.24652	N	0.036716	T	0.07683	0.0193	L	0.50333	1.59	0.46749	D	0.99918	B;B;B	0.30937	0.11;0.301;0.11	B;B;B	0.25884	0.016;0.064;0.011	T	0.16158	-1.0412	10	0.56958	D	0.05	-17.3755	19.1295	0.93399	0.0:1.0:0.0:0.0	.	571;786;784	A2RRC4;C9J281;Q68DD2	.;.;PA24F_HUMAN	K	780;786;784;784	ENSP00000380442:E786K;ENSP00000371833:E784K	ENSP00000290497:E780K	E	-	1	0	PLA2G4F	40221674	0.908000	0.30866	0.999000	0.59377	0.991000	0.79684	2.722000	0.47269	2.616000	0.88540	0.655000	0.94253	GAG	.	.		0.572	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000420463.1	NM_213600	
ADAL	161823	hgsc.bcm.edu	37	15	43643187	43643187	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr15:43643187A>G	ENST00000562188.1	+	9	837	c.821A>G	c.(820-822)gAc>gGc	p.D274G	ADAL_ENST00000422466.2_Missense_Mutation_p.D274G|ADAL_ENST00000428046.3_Missense_Mutation_p.D247G			Q6DHV7	ADAL_HUMAN	adenosine deaminase-like	274					adenosine catabolic process (GO:0006154)|drug metabolic process (GO:0017144)|inosine biosynthetic process (GO:0046103)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	adenosine deaminase activity (GO:0004000)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|lung(2)|prostate(1)|skin(1)	7		all_cancers(109;7.96e-11)|all_epithelial(112;2.96e-09)|Lung NSC(122;8.91e-07)|all_lung(180;8.8e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;9.31e-07)		CCATCTTATGACCAGCACCAT	0.408																																					p.D247G		Atlas-SNP	.											.	ADAL	48	.	0			c.A740G						.						422.0	342.0	366.0					15																	43643187		690	1590	2280	SO:0001583	missense	161823	exon11			CTTATGACCAGCA		CCDS32214.1, CCDS53936.1	15q15.3	2014-08-08			ENSG00000168803	ENSG00000168803			31853	protein-coding gene	gene with protein product							Standard	NM_001012969		Approved		uc010udo.2	Q6DHV7	OTTHUMG00000176646	ENST00000562188.1:c.821A>G	chr15.hg19:g.43643187A>G	ENSP00000456242:p.Asp274Gly	138.0	0.0		144.0	20.0	NM_001159280	A6NHZ3|B4DQM8	Missense_Mutation	SNP	ENST00000562188.1	hg19		.	.	.	.	.	.	.	.	.	.	A	13.50	2.256922	0.39896	.	.	ENSG00000168803	ENST00000422466;ENST00000428046	D;D	0.95482	-3.72;-3.72	5.69	2.09	0.27110	Adenosine/AMP deaminase (1);	.	.	.	.	D	0.91240	0.7239	L	0.38175	1.15	0.36743	D	0.882344	B;P	0.45957	0.12;0.869	B;P	0.45167	0.06;0.472	D	0.86794	0.1987	9	0.35671	T	0.21	-2.5682	4.8897	0.13721	0.7085:0.0:0.1541:0.1374	.	247;274	B4DQM8;Q6DHV7	.;ADAL_HUMAN	G	274;247	ENSP00000398744:D274G;ENSP00000413074:D247G	ENSP00000398744:D274G	D	+	2	0	ADAL	41430479	1.000000	0.71417	0.910000	0.35882	0.369000	0.29798	4.265000	0.58865	0.099000	0.17552	-0.344000	0.07964	GAC	.	.		0.408	ADAL-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000432960.1	XM_091156	
SORD	6652	hgsc.bcm.edu	37	15	45361208	45361208	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr15:45361208C>G	ENST00000267814.9	+	7	924	c.744C>G	c.(742-744)atC>atG	p.I248M	SORD_ENST00000558580.1_Missense_Mutation_p.I227M	NM_003104.5	NP_003095.2	Q00796	DHSO_HUMAN	sorbitol dehydrogenase	248					fructose biosynthetic process (GO:0046370)|glucose metabolic process (GO:0006006)|L-xylitol catabolic process (GO:0051160)|L-xylitol metabolic process (GO:0051164)|sorbitol catabolic process (GO:0006062)|sperm motility (GO:0030317)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)	carbohydrate binding (GO:0030246)|L-iditol 2-dehydrogenase activity (GO:0003939)|NAD binding (GO:0051287)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|lung(4)	9		all_cancers(109;3.43e-12)|all_epithelial(112;2.33e-10)|Lung NSC(122;6.01e-07)|all_lung(180;4.38e-06)|Melanoma(134;0.0122)		all cancers(107;1.6e-18)|GBM - Glioblastoma multiforme(94;4.95e-07)|COAD - Colon adenocarcinoma(120;0.0704)|Colorectal(133;0.0706)		AAGTCACCATCGAGTGCACGG	0.587																																					p.I248M		Atlas-SNP	.											.	SORD	24	.	0			c.C744G						.						43.0	43.0	43.0					15																	45361208		2198	4298	6496	SO:0001583	missense	6652	exon7			CACCATCGAGTGC		CCDS10116.1	15q15-q21.1	2012-10-02			ENSG00000140263	ENSG00000140263	1.1.1.14		11184	protein-coding gene	gene with protein product		182500				7782086	Standard	NM_003104		Approved		uc001zul.4	Q00796	OTTHUMG00000131265	ENST00000267814.9:c.744C>G	chr15.hg19:g.45361208C>G	ENSP00000267814:p.Ile248Met	273.0	0.0		297.0	42.0	NM_003104	B2R655|B7Z3A6|J3JZZ5|Q16682|Q9UMD6	Missense_Mutation	SNP	ENST00000267814.9	hg19	CCDS10116.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761955	0.31228	.	.	ENSG00000140263	ENST00000267814	T	0.47528	0.84	4.74	-6.57	0.01842	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.165302	0.51477	N	0.000089	T	0.48804	0.1520	M	0.62723	1.935	0.35602	D	0.807937	P;P	0.46064	0.872;0.604	P;P	0.53912	0.737;0.545	T	0.60469	-0.7257	10	0.62326	D	0.03	-8.2986	9.4171	0.38528	0.0:0.145:0.222:0.633	.	169;248	B4DKI2;Q00796	.;DHSO_HUMAN	M	248	ENSP00000267814:I248M	ENSP00000267814:I248M	I	+	3	3	SORD	43148500	0.003000	0.15002	0.571000	0.28486	0.286000	0.27126	-1.412000	0.02476	-1.233000	0.02551	-1.219000	0.01604	ATC	.	.		0.587	SORD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254033.3		
STOML1	9399	hgsc.bcm.edu	37	15	74281023	74281023	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr15:74281023G>C	ENST00000316900.5	-	4	635	c.511C>G	c.(511-513)Cag>Gag	p.Q171E	STOML1_ENST00000359750.4_Missense_Mutation_p.Q171E|STOML1_ENST00000316911.6_Missense_Mutation_p.Q121E|STOML1_ENST00000564777.1_Missense_Mutation_p.Q121E|STOML1_ENST00000541638.1_Missense_Mutation_p.Q129E|STOML1_ENST00000561656.1_Missense_Mutation_p.Q84E	NM_001256672.1|NM_001256675.1|NM_001256677.1|NM_004809.4	NP_001243601.1|NP_001243604.1|NP_001243606.1|NP_004800.2	Q9UBI4	STML1_HUMAN	stomatin (EPB72)-like 1	171						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						ATGGCGTTCTGGGCTGTCATG	0.597																																					p.Q171E		Atlas-SNP	.											.	STOML1	22	.	0			c.C511G						.						114.0	100.0	105.0					15																	74281023		2198	4297	6495	SO:0001583	missense	9399	exon4			CGTTCTGGGCTGT	Y16522	CCDS10254.1, CCDS58381.1, CCDS58382.1, CCDS58383.1, CCDS58384.1, CCDS58385.1	15q24-q25	2008-07-18			ENSG00000067221	ENSG00000067221			14560	protein-coding gene	gene with protein product	"""stomatin-like 1"", ""stomatin (EBP72)-like 1"""	608326				9931417	Standard	NM_004809		Approved	hUNC-24, SLP-1, STORP, FLJ36370	uc002awe.4	Q9UBI4	OTTHUMG00000137608	ENST00000316900.5:c.511C>G	chr15.hg19:g.74281023G>C	ENSP00000319323:p.Gln171Glu	73.0	0.0		80.0	19.0	NM_001256672	B3KQN0|B4DUU5|B4DXM9|E7ESC0|H3BRP3|O95675|Q4PNR4|Q6FGL8|Q8WYI7|Q9UMB9|Q9UMC0|Q9Y6H9	Missense_Mutation	SNP	ENST00000316900.5	hg19	CCDS10254.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.796685	0.70567	.	.	ENSG00000067221	ENST00000316900;ENST00000316911;ENST00000541638;ENST00000359750	D;D;D;D	0.93811	-3.29;-3.29;-3.29;-3.29	4.34	4.34	0.51931	.	0.229694	0.45867	D	0.000335	D	0.94301	0.8169	M	0.87900	2.915	0.51233	D	0.999913	B;P;B;P;B;B	0.39424	0.112;0.673;0.342;0.673;0.112;0.112	B;B;B;B;B;B	0.40702	0.119;0.338;0.202;0.338;0.119;0.119	D	0.95488	0.8566	10	0.72032	D	0.01	-12.8463	15.6083	0.76692	0.0:0.0:1.0:0.0	.	129;171;121;171;171;171	B4DUU5;E7ESC0;Q9UBI4-2;Q4PNR4;Q53HB6;Q9UBI4	.;.;.;.;.;STML1_HUMAN	E	171;121;129;171	ENSP00000319323:Q171E;ENSP00000319384:Q121E;ENSP00000442478:Q129E;ENSP00000352788:Q171E	ENSP00000319323:Q171E	Q	-	1	0	STOML1	72068076	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.483000	0.90442	2.250000	0.74265	0.655000	0.94253	CAG	.	.		0.597	STOML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269022.1	NM_004809	
ACAN	176	hgsc.bcm.edu	37	15	89398123	89398123	+	Missense_Mutation	SNP	G	G	C	rs191404107	byFrequency	TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr15:89398123G>C	ENST00000561243.1	+	11	2307	c.2307G>C	c.(2305-2307)gaG>gaC	p.E769D	ACAN_ENST00000352105.7_Missense_Mutation_p.E769D|ACAN_ENST00000439576.2_Missense_Mutation_p.E769D|ACAN_ENST00000559004.1_Missense_Mutation_p.E769D			P16112	PGCA_HUMAN	aggrecan	768	KS.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CAGCAACAGAGGAAAGTACAG	0.542																																					p.E769D		Atlas-SNP	.											.	ACAN	220	.	0			c.G2307C						.						24.0	26.0	25.0					15																	89398123		1925	4122	6047	SO:0001583	missense	176	exon12			AACAGAGGAAAGT	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2307G>C	chr15.hg19:g.89398123G>C	ENSP00000453342:p.Glu769Asp	177.0	0.0		135.0	11.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	hg19	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.545535	0.45280	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02763	4.42;4.17	5.53	0.232	0.15381	.	0.261462	0.20140	N	0.098393	T	0.09024	0.0223	M	0.71581	2.175	0.33456	D	0.584303	D;D	0.76494	0.999;0.999	D;D	0.63793	0.918;0.918	T	0.12811	-1.0533	10	0.44086	T	0.13	-23.5224	7.3096	0.26467	0.4742:0.0:0.5258:0.0	.	769;769	E7ENV9;E7EX88	.;.	D	769	ENSP00000387356:E769D;ENSP00000341615:E769D	ENSP00000268134:E769D	E	+	3	2	ACAN	87199127	1.000000	0.71417	0.781000	0.31783	0.682000	0.39822	1.386000	0.34419	0.158000	0.19367	0.655000	0.94253	GAG	.	G|0.999;A|0.001		0.542	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
METTL22	79091	hgsc.bcm.edu	37	16	8722963	8722963	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr16:8722963A>C	ENST00000381920.3	+	3	768	c.510A>C	c.(508-510)agA>agC	p.R170S	METTL22_ENST00000561758.1_Missense_Mutation_p.R114S	NM_024109.2	NP_077014.2	Q9BUU2	MET22_HUMAN	methyltransferase like 22	170						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			large_intestine(5)|lung(4)	9						ATATCATCAGAATAGGTAAAT	0.547																																					p.R170S		Atlas-SNP	.											.	METTL22	23	.	0			c.A510C						.						173.0	180.0	178.0					16																	8722963		2115	4230	6345	SO:0001583	missense	79091	exon3			CATCAGAATAGGT	AK022495	CCDS10533.2	16p13.2	2014-07-15	2011-03-03	2011-03-03	ENSG00000067365	ENSG00000067365			28368	protein-coding gene	gene with protein product		615261	"""chromosome 16 open reading frame 68"""	C16orf68		24140279	Standard	XM_005255570		Approved	FLJ12433,MGC2654	uc002cyz.3	Q9BUU2	OTTHUMG00000129694	ENST00000381920.3:c.510A>C	chr16.hg19:g.8722963A>C	ENSP00000371345:p.Arg170Ser	66.0	0.0		43.0	11.0	NM_024109	B2RD29|D3DUF2|Q6XYB4|Q9HA03	Missense_Mutation	SNP	ENST00000381920.3	hg19	CCDS10533.2	.	.	.	.	.	.	.	.	.	.	A	9.913	1.210067	0.22289	.	.	ENSG00000067365	ENST00000381920;ENST00000163678	T;T	0.52057	2.29;0.68	5.24	1.78	0.24846	.	0.410464	0.22993	N	0.053180	T	0.25901	0.0631	N	0.16368	0.405	0.25797	N	0.984553	P	0.35124	0.485	B	0.28553	0.091	T	0.11867	-1.0570	10	0.72032	D	0.01	-12.9404	7.3646	0.26766	0.7433:0.0:0.2567:0.0	.	170	Q9BUU2	MET22_HUMAN	S	170	ENSP00000371345:R170S;ENSP00000163678:R170S	ENSP00000163678:R170S	R	+	3	2	METTL22	8630464	0.999000	0.42202	0.429000	0.26710	0.029000	0.11900	2.122000	0.41987	0.031000	0.15407	-0.379000	0.06801	AGA	.	.		0.547	METTL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251901.1	NM_024109	
GRIN2A	2903	hgsc.bcm.edu	37	16	10274102	10274102	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr16:10274102C>A	ENST00000396573.2	-	3	476	c.167G>T	c.(166-168)gGc>gTc	p.G56V	GRIN2A_ENST00000404927.2_Missense_Mutation_p.G56V|GRIN2A_ENST00000396575.2_Missense_Mutation_p.G56V|GRIN2A_ENST00000562109.1_Missense_Mutation_p.G56V|GRIN2A_ENST00000330684.3_Missense_Mutation_p.G56V	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	56					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CTGCTCGGGGCCCCACAGTGT	0.667																																					p.G56V		Atlas-SNP	.											.	GRIN2A	366	.	0			c.G167T						.						57.0	62.0	61.0					16																	10274102		2197	4300	6497	SO:0001583	missense	2903	exon3			TCGGGGCCCCACA		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.167G>T	chr16.hg19:g.10274102C>A	ENSP00000379818:p.Gly56Val	84.0	0.0		76.0	15.0	NM_000833	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	hg19	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	14.24	2.477121	0.44044	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	4.54	4.54	0.55810	.	0.350805	0.25114	N	0.033040	T	0.81955	0.4932	L	0.36672	1.1	0.80722	D	1	P;B;B	0.50272	0.933;0.164;0.099	B;B;B	0.39706	0.307;0.035;0.056	T	0.80910	-0.1171	9	.	.	.	.	11.1048	0.48197	0.0:0.7956:0.2044:0.0	.	56;56;56	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	V	56	ENSP00000379818:G56V;ENSP00000385872:G56V;ENSP00000332549:G56V;ENSP00000379820:G56V	.	G	-	2	0	GRIN2A	10181603	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.489000	0.45285	2.088000	0.63022	0.561000	0.74099	GGC	.	.		0.667	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
C16orf58	64755	hgsc.bcm.edu	37	16	31519395	31519395	+	Splice_Site	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr16:31519395C>T	ENST00000327237.2	-	1	339	c.300G>A	c.(298-300)caG>caA	p.Q100Q	C16orf58_ENST00000570164.1_Splice_Site_p.Q100Q|C16orf58_ENST00000430477.2_5'UTR|RP11-452L6.7_ENST00000569782.1_RNA|C16orf58_ENST00000567994.1_Splice_Site_p.Q55Q			Q96GQ5	RUS1_HUMAN	chromosome 16 open reading frame 58	100						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)	14						CCGAGCTGACCTGCACGGAAT	0.672																																					p.P100P		Atlas-SNP	.											.	C16orf58	28	.	0			c.A300A						.																																			SO:0001630	splice_region_variant	64755	exon1			GCTGACCTGCACG	AK023930	CCDS10715.1	16p11.2	2013-03-04			ENSG00000140688	ENSG00000140688			25848	protein-coding gene	gene with protein product							Standard	NM_022744		Approved	FLJ13868	uc002eci.3	Q96GQ5	OTTHUMG00000132466	ENST00000327237.2:c.300+1G>A	chr16.hg19:g.31519395C>T		194.0	0.0		155.0	33.0	NM_022744	Q53GL8|Q8NAJ4|Q9BVY3|Q9H887	Silent	SNP	ENST00000327237.2	hg19	CCDS10715.1																																																																																			.	.		0.672	C16orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255629.2	NM_022744	Silent
FHOD1	29109	hgsc.bcm.edu	37	16	67281173	67281173	+	Silent	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr16:67281173C>A	ENST00000258201.4	-	1	388	c.141G>T	c.(139-141)ggG>ggT	p.G47G	SLC9A5_ENST00000299798.11_5'Flank	NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	47					positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		AGGGCAGCGCCCCGTCCAGGC	0.701																																					p.G47G		Atlas-SNP	.											.	FHOD1	86	.	0			c.G141T						.						19.0	21.0	21.0					16																	67281173		2194	4297	6491	SO:0001819	synonymous_variant	29109	exon1			CAGCGCCCCGTCC	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.141G>T	chr16.hg19:g.67281173C>A		84.0	0.0		75.0	15.0	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	hg19	CCDS10834.1																																																																																			.	.		0.701	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
MYH3	4621	hgsc.bcm.edu	37	17	10543991	10543991	+	Silent	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr17:10543991C>A	ENST00000583535.1	-	20	2265	c.2178G>T	c.(2176-2178)ctG>ctT	p.L726L	MYH3_ENST00000226209.7_Silent_p.L726L	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	726	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						cactggcattcagcactcggt	0.443																																					p.L726L		Atlas-SNP	.											.	MYH3	227	.	0			c.G2178T						.						97.0	84.0	88.0					17																	10543991		2203	4300	6503	SO:0001819	synonymous_variant	4621	exon20			GGCATTCAGCACT		CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2178G>T	chr17.hg19:g.10543991C>A		64.0	0.0		60.0	16.0	NM_002470	Q15492	Silent	SNP	ENST00000583535.1	hg19	CCDS11157.1																																																																																			.	.		0.443	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252734.2	NM_002470	
KIAA0100	9703	hgsc.bcm.edu	37	17	26970319	26970319	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr17:26970319C>A	ENST00000528896.2	-	4	333	c.259G>T	c.(259-261)Gca>Tca	p.A87S	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	87						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					AAGCACAATGCCACATAGTGT	0.512																																					p.A87S		Atlas-SNP	.											.	KIAA0100	175	.	0			c.G259T						.						101.0	101.0	101.0					17																	26970319		2203	4300	6503	SO:0001583	missense	9703	exon4			ACAATGCCACATA	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.259G>T	chr17.hg19:g.26970319C>A	ENSP00000436773:p.Ala87Ser	90.0	0.0		80.0	23.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.137767	0.37728	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896	T	0.25579	1.79	5.66	5.66	0.87406	FMP27, N-terminal (1);	0.050292	0.85682	D	0.000000	T	0.29783	0.0744	L	0.32530	0.975	0.80722	D	1	D;P	0.55605	0.972;0.58	P;B	0.51550	0.673;0.223	T	0.01033	-1.1474	10	0.19590	T	0.45	.	16.8925	0.86091	0.0:1.0:0.0:0.0	.	87;87	F6XS94;Q14667	.;K0100_HUMAN	S	87	ENSP00000436773:A87S	ENSP00000005905:A87S	A	-	1	0	KIAA0100	23994446	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.200000	0.65158	2.672000	0.90937	0.655000	0.94253	GCA	.	.		0.512	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
C17orf50	146853	hgsc.bcm.edu	37	17	34091295	34091295	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr17:34091295T>A	ENST00000285023.4	+	2	315	c.283T>A	c.(283-285)Tgg>Agg	p.W95R	C17orf50_ENST00000588628.1_Missense_Mutation_p.L102Q|C17orf50_ENST00000586491.1_Intron	NM_145272.3	NP_660315.2	Q8WW18	CQ050_HUMAN	chromosome 17 open reading frame 50	95													Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTTCTGGGGCTGGCTCGGCCC	0.756																																					p.W95R		Atlas-SNP	.											.	C17orf50	4	.	0			c.T283A						.						2.0	3.0	2.0					17																	34091295		974	2250	3224	SO:0001583	missense	146853	exon2			TGGGGCTGGCTCG	BC021727	CCDS42298.1	17q12	2014-05-06			ENSG00000154768	ENSG00000270806			29581	protein-coding gene	gene with protein product							Standard	NM_145272		Approved		uc002hjx.3	Q8WW18	OTTHUMG00000188389	ENST00000285023.4:c.283T>A	chr17.hg19:g.34091295T>A	ENSP00000285023:p.Trp95Arg	92.0	0.0		62.0	16.0	NM_145272	Q6Q621	Missense_Mutation	SNP	ENST00000285023.4	hg19	CCDS42298.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133117	0.77662	.	.	ENSG00000154768	ENST00000285023	T	0.59638	0.25	5.16	5.16	0.70880	.	0.000000	0.38837	N	0.001552	T	0.61451	0.2348	L	0.27053	0.805	0.33353	D	0.57136	D	0.67145	0.996	D	0.65573	0.936	T	0.72808	-0.4181	10	0.87932	D	0	-17.7624	11.3888	0.49802	0.0:0.0:0.0:1.0	.	95	Q8WW18	CQ050_HUMAN	R	95	ENSP00000285023:W95R	ENSP00000285023:W95R	W	+	1	0	C17orf50	31115408	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.583000	0.46094	1.943000	0.56356	0.460000	0.39030	TGG	.	.		0.756	C17orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449132.1	NM_145272	
ARHGAP27	201176	hgsc.bcm.edu	37	17	43474146	43474146	+	Silent	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr17:43474146G>A	ENST00000428638.1	-	12	1961	c.1962C>T	c.(1960-1962)gcC>gcT	p.A654A	ARHGAP27_ENST00000528384.1_Silent_p.A286A|ARHGAP27_ENST00000442348.1_Silent_p.A627A|ARHGAP27_ENST00000532038.1_Silent_p.A432A|CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000455881.1_Silent_p.A313A|ARHGAP27_ENST00000532891.2_Silent_p.A632A|ARHGAP27_ENST00000376922.2_Silent_p.A313A|ARHGAP27_ENST00000582826.1_5'Flank			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	654					positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					CGGGGCCCAGGGCGGGCGCGG	0.711																																					p.A313A		Atlas-SNP	.											.	ARHGAP27	37	.	0			c.C939T						.						15.0	19.0	18.0					17																	43474146		2197	4275	6472	SO:0001819	synonymous_variant	201176	exon12			GCCCAGGGCGGGC	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.1962C>T	chr17.hg19:g.43474146G>A		80.0	0.0		60.0	11.0	NM_199282	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Silent	SNP	ENST00000428638.1	hg19																																																																																				.	.		0.711	ARHGAP27-202	KNOWN	basic	protein_coding	protein_coding		NM_199282	
HN1	51155	hgsc.bcm.edu	37	17	73132208	73132208	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr17:73132208C>T	ENST00000409753.3	-	5	739	c.454G>A	c.(454-456)Gtc>Atc	p.V152I	HN1_ENST00000482348.1_Missense_Mutation_p.V106I|HN1_ENST00000392566.2_Missense_Mutation_p.V106I|HN1_ENST00000481647.1_Missense_Mutation_p.V106I|HN1_ENST00000405458.3_Missense_Mutation_p.V106I|HN1_ENST00000470924.1_Missense_Mutation_p.V106I|HN1_ENST00000476258.1_Missense_Mutation_p.V106I|RP11-649A18.5_ENST00000584339.1_RNA|HN1_ENST00000356033.4_Silent_p.S145S	NM_016185.2	NP_057269.1	Q9UK76	HN1_HUMAN	hematological and neurological expressed 1	152					developmental process (GO:0032502)	nucleus (GO:0005634)			HN1/USH1G(2)	breast(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					TAACCCAAGACGAGGCTGGAC	0.587																																					p.V152I		Atlas-SNP	.											.	HN1	17	.	0			c.G454A						.						80.0	77.0	78.0					17																	73132208		2203	4300	6503	SO:0001583	missense	51155	exon5			CCAAGACGAGGCT	AF086910	CCDS32729.1, CCDS45771.1, CCDS45772.1	17q25.1	2013-09-20			ENSG00000189159	ENSG00000189159			14569	protein-coding gene	gene with protein product	"""androgen-regulated protein 2"""					15094197	Standard	NM_001002032		Approved	ARM2, HN1A	uc002jnb.1	Q9UK76	OTTHUMG00000154521	ENST00000409753.3:c.454G>A	chr17.hg19:g.73132208C>T	ENSP00000387059:p.Val152Ile	310.0	0.0		251.0	66.0	NM_016185	B2R6K3|Q53FG7|Q7Z2D2|Q7Z2F0	Missense_Mutation	SNP	ENST00000409753.3	hg19	CCDS45771.1	.	.	.	.	.	.	.	.	.	.	C	18.27	3.586138	0.66105	.	.	ENSG00000189159	ENST00000405458;ENST00000409753;ENST00000392566	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	T	0.46560	0.1399	.	.	.	0.44908	D	0.997929	P	0.35527	0.507	B	0.24155	0.051	T	0.41910	-0.9482	7	0.34782	T	0.22	-42.9835	18.3821	0.90454	0.0:1.0:0.0:0.0	.	152	Q9UK76	HN1_HUMAN	I	106;152;106	.	ENSP00000440912:V106I	V	-	1	0	HN1	70643803	0.998000	0.40836	0.967000	0.41034	0.905000	0.53344	4.949000	0.63596	2.773000	0.95371	0.643000	0.83706	GTC	.	.		0.587	HN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335692.1	NM_001002032	
MISP	126353	hgsc.bcm.edu	37	19	757270	757270	+	Silent	SNP	A	A	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:757270A>G	ENST00000215582.6	+	2	427	c.324A>G	c.(322-324)acA>acG	p.T108T		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	108					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GACGTCCAACATGGGCACTCC	0.677																																					p.T108T		Atlas-SNP	.											.	C19orf21	56	.	0			c.A324G						.						57.0	49.0	52.0					19																	757270		2203	4300	6503	SO:0001819	synonymous_variant	126353	exon2			TCCAACATGGGCA	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.324A>G	chr19.hg19:g.757270A>G		191.0	0.0		148.0	41.0	NM_173481		Silent	SNP	ENST00000215582.6	hg19	CCDS12042.1																																																																																			.	.		0.677	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
MUM1	84939	hgsc.bcm.edu	37	19	1371003	1371003	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:1371003G>A	ENST00000415183.3	+	11	1941	c.1915G>A	c.(1915-1917)Gag>Aag	p.E639K	MUM1_ENST00000311401.5_Missense_Mutation_p.E570K|MUM1_ENST00000344663.3_Missense_Mutation_p.E639K|MUM1_ENST00000591806.1_Missense_Mutation_p.E639K			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	638					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTCTACCAGGAGGTGGGGGC	0.647																																					p.E639K		Atlas-SNP	.											.	MUM1	54	.	0			c.G1915A						.						59.0	42.0	48.0					19																	1371003		2185	4281	6466	SO:0001583	missense	84939	exon12			TACCAGGAGGTGG	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1915G>A	chr19.hg19:g.1371003G>A	ENSP00000394925:p.Glu639Lys	75.0	0.0		86.0	7.0	NM_032853	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	ENST00000415183.3	hg19		.	.	.	.	.	.	.	.	.	.	G	19.44	3.828326	0.71143	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183	T;T;T	0.50813	0.73;0.73;0.73	4.82	1.23	0.21249	.	1.190750	0.05791	N	0.610350	T	0.55970	0.1954	L	0.59436	1.845	0.09310	N	1	P;P;P;B	0.49783	0.675;0.675;0.928;0.43	B;B;P;B	0.47402	0.241;0.145;0.546;0.085	T	0.57688	-0.7768	10	0.66056	D	0.02	.	15.5375	0.76016	0.0:0.556:0.444:0.0	.	639;639;570;638	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	K	639;570;639	ENSP00000345789:E639K;ENSP00000309135:E570K;ENSP00000394925:E639K	ENSP00000309135:E570K	E	+	1	0	MUM1	1322003	0.357000	0.24938	0.000000	0.03702	0.479000	0.33129	1.229000	0.32600	0.132000	0.18615	0.462000	0.41574	GAG	.	.		0.647	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	
FUT3	2525	hgsc.bcm.edu	37	19	5844157	5844157	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:5844157C>T	ENST00000303225.6	-	3	1328	c.694G>A	c.(694-696)Ggg>Agg	p.G232R	FUT3_ENST00000589918.1_Missense_Mutation_p.G232R|FUT3_ENST00000589620.1_Missense_Mutation_p.G232R|FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000458379.2_Missense_Mutation_p.G232R	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	232					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						ATCATGGTCCCCTTGGGCAGG	0.607																																					p.G232R	Esophageal Squamous(82;745 1728 24593 44831)	Atlas-SNP	.											.	FUT3	30	.	0			c.G694A						.						87.0	85.0	86.0					19																	5844157		2201	4299	6500	SO:0001583	missense	2525	exon3			TGGTCCCCTTGGG		CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.694G>A	chr19.hg19:g.5844157C>T	ENSP00000305603:p.Gly232Arg	228.0	0.0		203.0	59.0	NM_001097640	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	ENST00000303225.6	hg19	CCDS12153.1	.	.	.	.	.	.	.	.	.	.	C	2.355	-0.348033	0.05208	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.27104	1.69;1.69	2.29	-3.59	0.04583	.	4.706620	0.00508	N	0.000179	T	0.17152	0.0412	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.10296	0.003;0.003;0.003;0.003	B;B;B;B	0.15052	0.012;0.012;0.012;0.012	T	0.13683	-1.0500	10	0.29301	T	0.29	.	4.39	0.11335	0.0:0.2092:0.1964:0.5944	.	232;232;232;232	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	R	232	ENSP00000305603:G232R;ENSP00000416443:G232R	ENSP00000305603:G232R	G	-	1	0	FUT3	5795157	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.590000	0.05760	-0.658000	0.05366	0.194000	0.17425	GGG	.	.		0.607	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
PEPD	5184	hgsc.bcm.edu	37	19	33892756	33892756	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:33892756C>A	ENST00000244137.7	-	12	871	c.838G>T	c.(838-840)Gag>Tag	p.E280*	PEPD_ENST00000436370.3_Nonsense_Mutation_p.E216*|PEPD_ENST00000397032.4_Nonsense_Mutation_p.E239*	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	280					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					CAGTAATACTCACCGCCCATG	0.622																																					p.E280X		Atlas-SNP	.											.	PEPD	48	.	0			c.G838T						.						61.0	70.0	67.0					19																	33892756		2111	4221	6332	SO:0001587	stop_gained	5184	exon12			AATACTCACCGCC	BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.838G>T	chr19.hg19:g.33892756C>A	ENSP00000244137:p.Glu280*	106.0	0.0		100.0	24.0	NM_000285	A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Nonsense_Mutation	SNP	ENST00000244137.7	hg19	CCDS42544.1	.	.	.	.	.	.	.	.	.	.	C	37	6.590919	0.97688	.	.	ENSG00000124299	ENST00000244137;ENST00000397032;ENST00000436370	.	.	.	5.38	5.38	0.77491	.	0.203246	0.50627	D	0.000110	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-34.7746	17.702	0.88298	0.0:1.0:0.0:0.0	.	.	.	.	X	280;239;216	.	ENSP00000244137:E280X	E	-	1	0	PEPD	38584596	1.000000	0.71417	0.944000	0.38274	0.842000	0.47809	6.909000	0.75735	2.507000	0.84556	0.462000	0.41574	GAG	.	.		0.622	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451432.3	NM_000285	
SCN1B	6324	hgsc.bcm.edu	37	19	35521747	35521747	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:35521747T>C	ENST00000262631.5	+	1	160	c.23T>C	c.(22-24)gTg>gCg	p.V8A	SCN1B_ENST00000595652.1_Missense_Mutation_p.V8A|SCN1B_ENST00000415950.3_Missense_Mutation_p.V8A	NM_001037.4	NP_001028.1	Q07699	SCN1B_HUMAN	sodium channel, voltage-gated, type I, beta subunit	8					axon guidance (GO:0007411)|cardiac conduction (GO:0061337)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|corticospinal neuron axon guidance (GO:0021966)|locomotion (GO:0040011)|membrane depolarization (GO:0051899)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during Purkinje myocyte cell action potential (GO:0086047)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to pyrethroid (GO:0046684)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|intercalated disc (GO:0014704)|node of Ranvier (GO:0033268)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)|voltage-gated sodium channel activity involved in Purkinje myocyte action potential (GO:0086062)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	11	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGGCCTTAGTGGTCGGCGCG	0.806																																					p.V8A		Atlas-SNP	.											.	SCN1B	32	.	0			c.T23C						.						1.0	1.0	1.0					19																	35521747		421	969	1390	SO:0001583	missense	6324	exon1			CCTTAGTGGTCGG		CCDS12441.1, CCDS46047.1	19q13.12	2014-09-17	2012-02-28		ENSG00000105711	ENSG00000105711		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10586	protein-coding gene	gene with protein product		600235	"""sodium channel, voltage-gated, type I, beta polypeptide"", ""sodium channel, voltage-gated, type I, beta"""			8394762	Standard	NM_001037		Approved		uc002nxo.2	Q07699	OTTHUMG00000182472	ENST00000262631.5:c.23T>C	chr19.hg19:g.35521747T>C	ENSP00000262631:p.Val8Ala	170.0	0.0		126.0	11.0	NM_001037	Q5TZZ4|Q6TN97	Missense_Mutation	SNP	ENST00000262631.5	hg19	CCDS12441.1	.	.	.	.	.	.	.	.	.	.	t	12.94	2.088307	0.36855	.	.	ENSG00000105711	ENST00000262631;ENST00000415950	D;D	0.97976	-4.64;-2.51	3.17	2.01	0.26516	.	0.421766	0.18829	U	0.130014	D	0.92381	0.7582	N	0.19112	0.55	0.23700	N	0.997074	B;B;B	0.30211	0.0;0.019;0.273	B;B;B	0.32980	0.001;0.003;0.156	D	0.85048	0.0927	10	0.18710	T	0.47	-4.242	5.7753	0.18275	0.2365:0.0:0.0:0.7635	.	8;8;8	B4DI92;Q07699;Q07699-2	.;SCN1B_HUMAN;.	A	8	ENSP00000262631:V8A;ENSP00000396915:V8A	ENSP00000262631:V8A	V	+	2	0	SCN1B	40213587	0.991000	0.36638	0.998000	0.56505	0.438000	0.31896	0.798000	0.27014	1.210000	0.43336	0.248000	0.18094	GTG	.	.		0.806	SCN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461567.1		
MARK4	57787	hgsc.bcm.edu	37	19	45790827	45790827	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:45790827C>T	ENST00000262891.4	+	13	1730	c.1399C>T	c.(1399-1401)Cga>Tga	p.R467*	MARK4_ENST00000300843.4_Nonsense_Mutation_p.R467*	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	467					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GAGTGGGAGTCGAGGGCTGCC	0.711																																					p.R467X		Atlas-SNP	.											.	MARK4	132	.	0			c.C1399T						.						27.0	33.0	31.0					19																	45790827		2184	4295	6479	SO:0001587	stop_gained	57787	exon13			GGGAGTCGAGGGC	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1399C>T	chr19.hg19:g.45790827C>T	ENSP00000262891:p.Arg467*	416.0	0.0		371.0	86.0	NM_001199867	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Nonsense_Mutation	SNP	ENST00000262891.4	hg19	CCDS56097.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.697991|5.697991	0.96802|0.96802	.|.	.|.	ENSG00000007047|ENSG00000007047	ENST00000262891;ENST00000300843|ENST00000262893	.|.	.|.	.|.	5.06|5.06	4.01|4.01	0.46588|0.46588	.|.	0.092055|.	0.44902|.	D|.	0.000406|.	.|T	.|0.66848	.|0.2831	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77156	.|-0.2691	.|4	0.09338|0.59425	T|D	0.73|0.04	.|.	12.5646|12.5646	0.56301|0.56301	0.1675:0.8325:0.0:0.0|0.1675:0.8325:0.0:0.0	.|.	.|.	.|.	.|.	X|L	467|431	.|.	ENSP00000262891:R467X|ENSP00000262893:S431L	R|S	+|+	1|2	2|0	MARK4|MARK4	50482667|50482667	0.991000|0.991000	0.36638|0.36638	0.328000|0.328000	0.25416|0.25416	0.675000|0.675000	0.39556|0.39556	1.747000|1.747000	0.38298|0.38298	1.348000|1.348000	0.45733|0.45733	0.591000|0.591000	0.81541|0.81541	CGA|TCG	.	.		0.711	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417	
VN1R2	317701	hgsc.bcm.edu	37	19	53761659	53761659	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:53761659G>T	ENST00000341702.3	+	1	115	c.31G>T	c.(31-33)Gct>Tct	p.A11S		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	11					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		taccccttttgctttgtatcc	0.532																																					p.A11S		Atlas-SNP	.											.	VN1R2	71	.	0			c.G31T						.						8.0	7.0	8.0					19																	53761659		1678	3053	4731	SO:0001583	missense	317701	exon1			CCTTTTGCTTTGT	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.31G>T	chr19.hg19:g.53761659G>T	ENSP00000351244:p.Ala11Ser	59.0	0.0		58.0	13.0	NM_173856	A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	hg19	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	-	3.417	-0.118937	0.06838	.	.	ENSG00000196131	ENST00000341702	T	0.10960	2.82	.	.	.	.	.	.	.	.	T	0.06188	0.0160	N	0.08118	0	0.09310	N	1	P	0.38711	0.643	B	0.41691	0.364	T	0.34725	-0.9817	7	0.87932	D	0	.	.	.	.	.	11	Q8NFZ6	VN1R2_HUMAN	S	11	ENSP00000351244:A11S	ENSP00000351244:A11S	A	+	1	0	VN1R2	58453471	0.121000	0.22262	0.230000	0.23976	0.230000	0.25150	0.170000	0.16663	0.119000	0.18210	0.121000	0.15741	GCT	.	.		0.532	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
LILRA2	11027	hgsc.bcm.edu	37	19	55087301	55087301	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:55087301C>A	ENST00000251377.3	+	7	1113	c.980C>A	c.(979-981)tCg>tAg	p.S327*	LILRA2_ENST00000391738.3_Nonsense_Mutation_p.S327*|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000251376.3_Nonsense_Mutation_p.S327*|LILRA2_ENST00000391737.1_Nonsense_Mutation_p.S315*|LILRB1_ENST00000448689.1_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	327	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCCTCTCTCTCGGTGCAGCCG	0.602																																					p.S327X		Atlas-SNP	.											.	LILRA2	99	.	0			c.C980A						.						52.0	47.0	49.0					19																	55087301		2203	4300	6503	SO:0001587	stop_gained	11027	exon6			CTCTCTCGGTGCA	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.980C>A	chr19.hg19:g.55087301C>A	ENSP00000251377:p.Ser327*	84.0	0.0		102.0	25.0	NM_001130917	O75020	Nonsense_Mutation	SNP	ENST00000251377.3	hg19	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566946	0.28003	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	.	.	.	2.06	-3.81	0.04294	.	2.015420	0.02866	N	0.130973	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.4375	0.07452	0.0:0.345:0.2092:0.4458	.	.	.	.	X	327;327;327;327;315	.	ENSP00000251376:S327X	S	+	2	0	LILRA2	59779113	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.663000	0.01968	-0.829000	0.04268	-1.540000	0.00911	TCG	.	.		0.602	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
LILRA2	11027	hgsc.bcm.edu	37	19	55087318	55087318	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr19:55087318A>G	ENST00000251377.3	+	7	1130	c.997A>G	c.(997-999)Aca>Gca	p.T333A	LILRA2_ENST00000391738.3_Missense_Mutation_p.T333A|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000251376.3_Missense_Mutation_p.T333A|LILRA2_ENST00000391737.1_Missense_Mutation_p.T321A|LILRB1_ENST00000448689.1_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	333	Ig-like C2-type 4.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GCCGGTCCCCACAGTAGCCCC	0.597																																					p.T333A		Atlas-SNP	.											.	LILRA2	99	.	0			c.A997G						.						62.0	56.0	58.0					19																	55087318		2203	4300	6503	SO:0001583	missense	11027	exon6			GTCCCCACAGTAG	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.997A>G	chr19.hg19:g.55087318A>G	ENSP00000251377:p.Thr333Ala	93.0	0.0		110.0	27.0	NM_001130917	O75020	Missense_Mutation	SNP	ENST00000251377.3	hg19	CCDS46179.1	.	.	.	.	.	.	.	.	.	.	A	8.482	0.860049	0.17178	.	.	ENSG00000239998	ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T	0.03386	3.95;3.95;3.95;3.95	2.19	0.944	0.19537	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.403190	0.02094	N	0.053344	T	0.09905	0.0243	M	0.82517	2.595	0.09310	N	1	B;B;B	0.32302	0.363;0.363;0.167	B;B;B	0.39152	0.217;0.292;0.196	T	0.34825	-0.9813	9	.	.	.	.	3.5932	0.07997	0.7234:0.0:0.2766:0.0	.	321;333;333	A8MZH0;Q8N149;Q8N149-2	.;LIRA2_HUMAN;.	A	333;333;333;321	ENSP00000251377:T333A;ENSP00000375618:T333A;ENSP00000251376:T333A;ENSP00000375617:T321A	.	T	+	1	0	LILRA2	59779130	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.210000	0.01227	0.191000	0.20236	0.416000	0.27883	ACA	.	.		0.597	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
CXorf22	170063	hgsc.bcm.edu	37	X	35969436	35969436	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chrX:35969436G>C	ENST00000297866.5	+	5	911	c.845G>C	c.(844-846)tGg>tCg	p.W282S		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	282										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						CCCATAAATTGGGTGGCCATC	0.398																																					p.W282S		Atlas-SNP	.											.	CXorf22	272	.	0			c.G845C						.						49.0	45.0	47.0					X																	35969436		2202	4300	6502	SO:0001583	missense	170063	exon5			TAAATTGGGTGGC	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.845G>C	chrX.hg19:g.35969436G>C	ENSP00000297866:p.Trp282Ser	242.0	0.0		201.0	110.0	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	hg19	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128588	0.56721	.	.	ENSG00000165164	ENST00000297866	T	0.18810	2.19	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	M	0.77103	2.36	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.52320	-0.8591	10	0.66056	D	0.02	-20.477	17.7748	0.88504	0.0:0.0:1.0:0.0	.	282	Q6ZTR5	CX022_HUMAN	S	282	ENSP00000297866:W282S	ENSP00000297866:W282S	W	+	2	0	CXorf22	35879357	1.000000	0.71417	1.000000	0.80357	0.458000	0.32498	6.957000	0.76019	2.416000	0.81992	0.513000	0.50165	TGG	.	.		0.398	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
MAOB	4129	hgsc.bcm.edu	37	X	43698217	43698217	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chrX:43698217G>A	ENST00000378069.4	-	3	323	c.176C>T	c.(175-177)tCc>tTc	p.S59F	MAOB_ENST00000538942.1_Missense_Mutation_p.S43F|MAOB_ENST00000536181.1_Missense_Mutation_p.S43F|MAOB_ENST00000487544.1_5'UTR	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	59					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	TCCAACATAGGATCCTCCAAG	0.368																																					p.S59F		Atlas-SNP	.											.	MAOB	52	.	0			c.C176T						.						128.0	110.0	116.0					X																	43698217		2203	4300	6503	SO:0001583	missense	4129	exon3			ACATAGGATCCTC		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.176C>T	chrX.hg19:g.43698217G>A	ENSP00000367309:p.Ser59Phe	78.0	0.0		86.0	4.0	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	ENST00000378069.4	hg19	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.237024	0.79800	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	D;D;D	0.93076	-3.16;-3.16;-3.16	5.13	5.13	0.70059	Amine oxidase (1);	0.110356	0.64402	D	0.000008	D	0.95940	0.8678	L	0.58810	1.83	0.46678	D	0.999158	D;D;D	0.89917	1.0;0.976;0.999	D;P;D	0.85130	0.997;0.864;0.993	D	0.96283	0.9208	10	0.62326	D	0.03	-7.0208	17.9488	0.89046	0.0:0.0:1.0:0.0	.	43;59;59	B7Z5H3;Q8TBI1;P27338	.;.;AOFB_HUMAN	F	59;43;43	ENSP00000367309:S59F;ENSP00000441613:S43F;ENSP00000442240:S43F	ENSP00000367309:S59F	S	-	2	0	MAOB	43583161	1.000000	0.71417	0.995000	0.50966	0.829000	0.46940	9.187000	0.94912	2.259000	0.74868	0.513000	0.50165	TCC	.	.		0.368	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
AR	367	hgsc.bcm.edu	37	X	66766368	66766368	+	Silent	SNP	C	C	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chrX:66766368C>T	ENST00000374690.3	+	1	1904	c.1380C>T	c.(1378-1380)ggC>ggT	p.G460G	AR_ENST00000396044.3_Silent_p.G460G|AR_ENST00000504326.1_Silent_p.G460G|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	458	Modulating.|Poly-Gly.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	gcggcggcggcggcggcggcg	0.756									Androgen Insensitivity Syndrome																												p.G460G		Atlas-SNP	.											.	AR	249	.	0			c.C1380T						.						1.0	1.0	1.0					X																	66766368		414	1064	1478	SO:0001819	synonymous_variant	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	CGGCGGCGGCGGC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1380C>T	chrX.hg19:g.66766368C>T		162.0	0.0		322.0	66.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.		0.756	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
SPRY3	10251	hgsc.bcm.edu	37	X	155004358	155004358	+	Silent	SNP	T	T	G			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chrX:155004358T>G	ENST00000302805.2	+	2	1256	c.825T>G	c.(823-825)tcT>tcG	p.S275S		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	275					multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGATCTCTTCTGGTAGTGCAC	0.547																																					p.S275S		Atlas-SNP	.											.	SPRY3	52	.	0			c.T825G						.						130.0	127.0	128.0					X																	155004358		2203	4296	6499	SO:0001819	synonymous_variant	10251	exon2			CTCTTCTGGTAGT	AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.825T>G	chrX.hg19:g.155004358T>G		133.0	0.0		160.0	35.0	NM_005840	A8K0H8	Silent	SNP	ENST00000302805.2	hg19	CCDS14769.4																																																																																			.	.		0.547	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058823.2	NM_005840	
ZNRF3	84133	hgsc.bcm.edu	37	22	29445468	29445469	+	Frame_Shift_Ins	INS	-	-	GGCCA	rs34671303	byFrequency	TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr22:29445468_29445469insGGCCA	ENST00000544604.2	+	8	1474_1475	c.1299_1300insGGCCA	c.(1300-1302)ggcfs	p.-434fs	ZNRF3_ENST00000402174.1_Frame_Shift_Ins_p.-334fs|ZNRF3_ENST00000332811.4_Frame_Shift_Ins_p.-334fs|ZNRF3_ENST00000406323.3_Frame_Shift_Ins_p.-334fs	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3						canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						CTCACCGCTGCGGCCTGGAGCA	0.678																																					p.C433fs		Atlas-INDEL	.											ZNRF3,caecum,carcinoma,0,1	ZNRF3	75	.	0			c.1299_1300insGGCCA						.																																			SO:0001589	frameshift_variant	84133	exon8			.	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	Exception_encountered	chr22.hg19:g.29445468_29445469insGGCCA	ENSP00000443824:p.Gly434fs	57.0	0.0		53.0	11.0	NM_001206998	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Frame_Shift_Ins	INS	ENST00000544604.2	hg19	CCDS56225.1																																																																																			.	.		0.678	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
ALB	213	hgsc.bcm.edu	37	4	74276080	74276096	+	Frame_Shift_Del	DEL	AAGTGTGCCAGTCTCCA	AAGTGTGCCAGTCTCCA	-	rs373929336		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	AAGTGTGCCAGTCTCCA	AAGTGTGCCAGTCTCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr4:74276080_74276096delAAGTGTGCCAGTCTCCA	ENST00000503124.1	+	4	424_440	c.217_233delAAGTGTGCCAGTCTCCA	c.(217-234)aagtgtgccagtctccaafs	p.KCASLQ73fs	ALB_ENST00000415165.2_Intron|ALB_ENST00000295897.4_Frame_Shift_Del_p.KCASLQ223fs|ALB_ENST00000401494.3_Frame_Shift_Del_p.KCASLQ108fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000509063.1_Frame_Shift_Del_p.KCASLQ223fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ACAGAGACTCAAGTGTGCCAGTCTCCAAAAATTTGGA	0.35																																					p.222_228del		Atlas-INDEL	.											.	ALB	132	.	0			c.666_682del						.																																			SO:0001589	frameshift_variant	213	exon6			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.217_233delAAGTGTGCCAGTCTCCA	chr4.hg19:g.74276080_74276096delAAGTGTGCCAGTCTCCA	ENSP00000421027:p.Lys73fs	371.0	0.0		298.0	40.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.350	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
ADAM30	11085	hgsc.bcm.edu	37	1	120436590	120436591	+	Frame_Shift_Ins	INS	-	-	T			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr1:120436590_120436591insT	ENST00000369400.1	-	1	2527_2528	c.2369_2370insA	c.(2368-2370)aagfs	p.K790fs		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	790					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		TGCCCGGTTACTTTTTTTGTTT	0.356																																					p.K790fs		Atlas-INDEL	.											.	ADAM30	88	.	0			c.2370_2371insA						.																																			SO:0001589	frameshift_variant	11085	exon1			.	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.2370dupA	chr1.hg19:g.120436597_120436597dupT	ENSP00000358407:p.Lys790fs	70.0	0.0		74.0	17.0	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Frame_Shift_Ins	INS	ENST00000369400.1	hg19	CCDS907.1																																																																																			.	.		0.356	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
APOB	338	hgsc.bcm.edu	37	2	21236228	21236228	+	Frame_Shift_Del	DEL	A	A	-			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr2:21236228delA	ENST00000233242.1	-	25	4147	c.4020delT	c.(4018-4020)tttfs	p.F1340fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1340					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGGAATGGTAAAAGTAGGGA	0.488																																					p.T1341fs		Atlas-INDEL	.											.	APOB	761	.	0			c.4021delA						.						153.0	147.0	149.0					2																	21236228		2203	4300	6503	SO:0001589	frameshift_variant	338	exon25			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4020delT	chr2.hg19:g.21236228delA	ENSP00000233242:p.Phe1340fs	122.0	0.0		136.0	26.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.488	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
AP2M1	1173	hgsc.bcm.edu	37	3	183898987	183899008	+	Frame_Shift_Del	DEL	AAGGCACAGCTGATGAAACAAG	AAGGCACAGCTGATGAAACAAG	-			TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	AAGGCACAGCTGATGAAACAAG	AAGGCACAGCTGATGAAACAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr3:183898987_183899008delAAGGCACAGCTGATGAAACAAG	ENST00000292807.5	+	7	828_849	c.680_701delAAGGCACAGCTGATGAAACAAG	c.(679-702)aaaggcacagctgatgaaacaagcfs	p.KGTADETS227fs	AP2M1_ENST00000439647.1_Frame_Shift_Del_p.KGTADETS225fs|AP2M1_ENST00000411763.2_Frame_Shift_Del_p.KGTADETS252fs|EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000461733.1_3'UTR|AP2M1_ENST00000382456.3_Frame_Shift_Del_p.KGTADETS225fs	NM_004068.3	NP_004059.2	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	227	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of protein localization to plasma membrane (GO:1903077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AAGCAGGGCAAAGGCACAGCTGATGAAACAAGCAAGAGGTGC	0.527																																					p.225_232del		Atlas-INDEL	.											.	AP2M1	35	.	0			c.673_694del						.																																			SO:0001589	frameshift_variant	1173	exon6			.	U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203			564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1		8595912	Standard	NM_004068		Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000292807.5:c.680_701delAAGGCACAGCTGATGAAACAAG	chr3.hg19:g.183898987_183899008delAAGGCACAGCTGATGAAACAAG	ENSP00000292807:p.Lys227fs	256.0	0.0		160.0	18.0	NM_001025205	A6NE12|D3DNT1|P20172|P53679	Frame_Shift_Del	DEL	ENST00000292807.5	hg19	CCDS43177.1																																																																																			.	.		0.527	AP2M1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346013.1	NM_004068	
WDR73	84942	hgsc.bcm.edu	37	15	85186706	85186707	+	Frame_Shift_Del	DEL	GG	GG	-	rs376622127		TCGA-ZS-A9CD-01A-11D-A36X-10	TCGA-ZS-A9CD-10A-01D-A370-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	58e384ba-b93a-45d0-af93-821c3717e9ec	bf3a7873-31f2-4a59-9c3e-61836f34ab07	g.chr15:85186706_85186707delGG	ENST00000434634.2	-	8	1191_1192	c.1131_1132delCC	c.(1129-1134)ccccgcfs	p.R378fs	SCAND2P_ENST00000348993.5_RNA|WDR73_ENST00000398528.3_5'UTR	NM_032856.2	NP_116245.2	Q6P4I2	WDR73_HUMAN	WD repeat domain 73	378										cervix(1)|large_intestine(1)|lung(1)	3						TGGTGTCAGCGGGGGGCACAAA	0.545																																					p.378_378del		Atlas-INDEL	.											WDR73,NS,carcinoma,0,1	WDR73	15	.	0			c.1132_1133del						.																																			SO:0001589	frameshift_variant	84942	exon8			.	AK027200	CCDS45339.1	15q25.2	2013-01-09				ENSG00000177082		"""WD repeat domain containing"""	25928	protein-coding gene	gene with protein product						12477932	Standard	NM_032856		Approved	FLJ14888, HSPC264	uc002bkw.2	Q6P4I2		ENST00000434634.2:c.1131_1132delCC	chr15.hg19:g.85186710_85186711delGG	ENSP00000387982:p.Arg378fs	78.0	0.0		87.0	28.0	NM_032856	Q96JZ1|Q9P0B7	Frame_Shift_Del	DEL	ENST00000434634.2	hg19	CCDS45339.1																																																																																			.	.		0.545	WDR73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418195.1	NM_032856	
