#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TCEA3	6920	hgsc.bcm.edu	37	1	23720511	23720511	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:23720511A>C	ENST00000450454.2	-	8	786	c.680T>G	c.(679-681)cTc>cGc	p.L227R		NM_003196.1	NP_003187.1	O75764	TCEA3_HUMAN	transcription elongation factor A (SII), 3	227	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;4.16e-05)|all_lung(284;6.68e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.0054)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.6e-25)|Colorectal(126;8.32e-08)|COAD - Colon adenocarcinoma(152;4.29e-06)|GBM - Glioblastoma multiforme(114;9e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00424)|STAD - Stomach adenocarcinoma(196;0.0145)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0963)|LUSC - Lung squamous cell carcinoma(448;0.198)		CGTGCTCTTGAGCTCTTGGTA	0.627																																					p.L227R		Atlas-SNP	.											.	TCEA3	20	.	0			c.T680G						.						61.0	62.0	62.0					1																	23720511		1968	4135	6103	SO:0001583	missense	6920	exon8			CTCTTGAGCTCTT	AJ223473	CCDS44086.1	1p36.11	2011-01-25			ENSG00000204219	ENSG00000204219			11615	protein-coding gene	gene with protein product		604128				9790746	Standard	NM_003196		Approved	TFIIS.H	uc021oig.1	O75764	OTTHUMG00000003233	ENST00000450454.2:c.680T>G	chr1.hg19:g.23720511A>C	ENSP00000406293:p.Leu227Arg	78.0	0.0		66.0	27.0	NM_003196	A8K2K7|Q5DR83	Missense_Mutation	SNP	ENST00000450454.2	hg19	CCDS44086.1	.	.	.	.	.	.	.	.	.	.	A	15.79	2.937894	0.52972	.	.	ENSG00000204219	ENST00000450454	T	0.47177	0.85	5.46	5.46	0.80206	Transcription elongation factor S-IIM (1);Transcription elongation factor S-II, central domain (4);	0.360158	0.29438	N	0.012141	T	0.60547	0.2277	M	0.82193	2.58	0.80722	D	1	P	0.36222	0.544	B	0.43680	0.427	T	0.65751	-0.6092	10	0.62326	D	0.03	-14.8948	14.7441	0.69477	1.0:0.0:0.0:0.0	.	227	O75764	TCEA3_HUMAN	R	227	ENSP00000406293:L227R	ENSP00000406293:L227R	L	-	2	0	TCEA3	23593098	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.199000	0.72112	2.232000	0.73038	0.529000	0.55759	CTC	.	.		0.627	TCEA3-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008911.2	NM_003196	
FUBP1	8880	hgsc.bcm.edu	37	1	78429310	78429310	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:78429310C>A	ENST00000370768.2	-	13	1213	c.1132G>T	c.(1132-1134)Gaa>Taa	p.E378*	FUBP1_ENST00000370767.1_Nonsense_Mutation_p.E378*|FUBP1_ENST00000436586.2_Nonsense_Mutation_p.E399*	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	378	Gly-rich.|KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						AAATTAAATTCCTGTAGTCCA	0.408			"""F, N"""		oligodendroglioma																																p.E378X		Atlas-SNP	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.,1	FUBP1	112	.	0			c.G1132T						.						81.0	83.0	82.0					1																	78429310		2203	4300	6503	SO:0001587	stop_gained	8880	exon13			TAAATTCCTGTAG	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1132G>T	chr1.hg19:g.78429310C>A	ENSP00000359804:p.Glu378*	281.0	0.0		324.0	128.0	NM_003902	Q12828	Nonsense_Mutation	SNP	ENST00000370768.2	hg19	CCDS683.1	.	.	.	.	.	.	.	.	.	.	C	38	6.918572	0.97936	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-23.7575	20.2241	0.98333	0.0:1.0:0.0:0.0	.	.	.	.	X	377;378;378;377;399	.	ENSP00000294623:E377X	E	-	1	0	FUBP1	78201898	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.785000	0.95823	0.655000	0.94253	GAA	.	.		0.408	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
PDZK1	5174	hgsc.bcm.edu	37	1	145747212	145747212	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:145747212A>G	ENST00000344770.2	+	2	242	c.169A>G	c.(169-171)Agg>Ggg	p.R57G	PDZK1_ENST00000451928.2_Missense_Mutation_p.R57G|PDZK1_ENST00000417171.1_Missense_Mutation_p.R57G	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	57	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			CAGAGTTCTTAGGATCAATGG	0.512																																					p.R57G		Atlas-SNP	.											.	PDZK1	15	.	0			c.A169G						.						130.0	129.0	129.0					1																	145747212		2203	4300	6503	SO:0001583	missense	5174	exon3			GTTCTTAGGATCA	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.169A>G	chr1.hg19:g.145747212A>G	ENSP00000342143:p.Arg57Gly	163.0	0.0		217.0	87.0	NM_002614	B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Missense_Mutation	SNP	ENST00000344770.2	hg19	CCDS924.1	.	.	.	.	.	.	.	.	.	.	A	11.93	1.785461	0.31593	.	.	ENSG00000174827	ENST00000443667;ENST00000417171;ENST00000451928;ENST00000344770	T;T;T;T	0.41758	0.99;1.76;1.76;1.76	5.82	0.29	0.15728	PDZ/DHR/GLGF (4);	0.356446	0.35320	N	0.003286	T	0.14356	0.0347	N	0.04820	-0.15	0.09310	N	1	B;B	0.28783	0.002;0.222	B;P	0.44990	0.052;0.466	T	0.35001	-0.9806	10	0.72032	D	0.01	-1.1169	8.3043	0.32034	0.485:0.3899:0.0:0.1251	.	57;57	E7EU02;Q5T2W1	.;NHRF3_HUMAN	G	57	ENSP00000409291:R57G;ENSP00000394485:R57G;ENSP00000403422:R57G;ENSP00000342143:R57G	ENSP00000342143:R57G	R	+	1	2	PDZK1	144458569	0.604000	0.26932	0.220000	0.23810	0.052000	0.14988	1.319000	0.33655	0.075000	0.16796	0.533000	0.62120	AGG	.	.		0.512	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038502.2	NM_002614	
HRNR	388697	hgsc.bcm.edu	37	1	152192560	152192561	+	Nonsense_Mutation	DNP	GG	GG	TT	rs146581615		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:152192560_152192561GG>TT	ENST00000368801.2	-	3	1619_1620	c.1544_1545CC>AA	c.(1543-1545)tCC>tAA	p.S515*	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	515					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCATAGCTGGAAGATGAACC	0.584																																					p.S515S|p.S515Y		Atlas-SNP	.											.	HRNR	403	.	0			c.C1545A|c.C1544A						.																																			SO:0001587	stop_gained	388697	exon3			ATAGCTGGAAGAT|TAGCTGGAAGATG	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.1544_1545delinsTT	chr1.hg19:g.152192560_152192561delinsTT	ENSP00000357791:p.Ser515*	89.0	0.0		107.0|106.0	45.0|46.0	NM_001009931	Q5DT20|Q5U1F4	Silent|Missense_Mutation	SNP	ENST00000368801.2	hg19	CCDS30859.1																																																																																			.	.|G|1.000;A|0.000		0.584	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
FLG2	388698	hgsc.bcm.edu	37	1	152327802	152327802	+	Missense_Mutation	SNP	A	A	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:152327802A>T	ENST00000388718.5	-	3	2532	c.2460T>A	c.(2458-2460)ttT>ttA	p.F820L	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	820	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGTTGTCCAAAGCCAGCGG	0.522																																					p.F820L		Atlas-SNP	.											.	FLG2	431	.	0			c.T2460A						.						291.0	286.0	288.0					1																	152327802		2203	4300	6503	SO:0001583	missense	388698	exon3			TTGTCCAAAGCCA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2460T>A	chr1.hg19:g.152327802A>T	ENSP00000373370:p.Phe820Leu	109.0	0.0		162.0	82.0	NM_001014342	Q9H4U1	Missense_Mutation	SNP	ENST00000388718.5	hg19	CCDS30861.1	.	.	.	.	.	.	.	.	.	.	A	9.626	1.135104	0.21123	.	.	ENSG00000143520	ENST00000388718	T	0.20881	2.04	4.72	2.21	0.28008	.	.	.	.	.	T	0.03520	0.0101	L	0.39020	1.185	0.09310	N	1	B	0.21225	0.053	B	0.17098	0.017	T	0.42699	-0.9436	9	0.11182	T	0.66	.	1.5429	0.02559	0.5537:0.1772:0.098:0.1711	.	820	Q5D862	FILA2_HUMAN	L	820	ENSP00000373370:F820L	ENSP00000373370:F820L	F	-	3	2	FLG2	150594426	0.000000	0.05858	0.016000	0.15963	0.071000	0.16799	0.291000	0.18994	0.797000	0.33971	0.529000	0.55759	TTT	.	.		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
RUSC1	23623	hgsc.bcm.edu	37	1	155290828	155290828	+	Intron	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:155290828C>A	ENST00000368352.5	+	1	65				RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368347.4_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368354.3_Intron	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			GACCTGGGCACGAGGGGCGGG	0.642																																					p.R151L		Atlas-SNP	.											.	.	.	.	0			c.G452T						.						51.0	61.0	58.0					1																	155290828		2026	4156	6182	SO:0001627	intron_variant	284618	exon2			TGGGCACGAGGGG	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.-87+46C>A	chr1.hg19:g.155290828C>A		194.0	0.0		295.0	92.0	NM_001039517	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	hg19	CCDS41410.1																																																																																			.	.		0.642	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
GON4L	54856	hgsc.bcm.edu	37	1	155720493	155720493	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:155720493A>C	ENST00000368331.1	-	32	6656	c.6608T>G	c.(6607-6609)cTc>cGc	p.L2203R	GON4L_ENST00000271883.5_Missense_Mutation_p.L2202R|GON4L_ENST00000437809.1_Missense_Mutation_p.L2202R	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	2203					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGTGTGGAAGAGCTGCATGAG	0.488																																					p.L2202R		Atlas-SNP	.											.	GON4L	392	.	0			c.T6605G						.						48.0	48.0	48.0					1																	155720493		1939	4134	6073	SO:0001583	missense	54856	exon32			TGGAAGAGCTGCA	AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.6608T>G	chr1.hg19:g.155720493A>C	ENSP00000357315:p.Leu2203Arg	219.0	0.0		367.0	61.0	NM_001037533	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	ENST00000368331.1	hg19		.	.	.	.	.	.	.	.	.	.	-	21.5	4.165463	0.78339	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883	T;T;T	0.37235	1.21;1.21;1.21	4.88	4.88	0.63580	SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000014	T	0.53190	0.1781	M	0.79123	2.44	0.47778	D	0.999512	D;D	0.89917	0.999;1.0	D;D	0.87578	0.996;0.998	T	0.60934	-0.7164	10	0.87932	D	0	.	14.3576	0.66748	1.0:0.0:0.0:0.0	.	2203;2202	Q3T8J9;Q3T8J9-3	GON4L_HUMAN;.	R	2202;2203;2202	ENSP00000396117:L2202R;ENSP00000357315:L2203R;ENSP00000271883:L2202R	ENSP00000271883:L2202R	L	-	2	0	GON4L	153987117	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.624000	0.74243	2.052000	0.61016	0.449000	0.29647	CTC	.	.		0.488	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_032292	
CRP	1401	hgsc.bcm.edu	37	1	159683527	159683527	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:159683527G>A	ENST00000255030.5	-	2	566	c.463C>T	c.(463-465)Cag>Tag	p.Q155*	CRP_ENST00000343919.2_Intron|CRP_ENST00000368112.1_Intron|CRP_ENST00000368111.1_Intron|CRP_ENST00000437342.1_5'UTR|CRP_ENST00000368110.1_Intron|CRP_ENST00000473196.1_5'UTR	NM_000567.2	NP_000558.2	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related	155	Pentaxin.				acute-phase response (GO:0006953)|aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|complement activation, classical pathway (GO:0006958)|defense response to Gram-positive bacterium (GO:0050830)|inflammatory response (GO:0006954)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|opsonization (GO:0008228)|positive regulation of dendrite development (GO:1900006)|protein polymerization (GO:0051258)|regulation of interleukin-8 secretion (GO:2000482)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lead ion (GO:0010288)|wound healing (GO:0042060)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)	calcium ion binding (GO:0005509)|cholesterol binding (GO:0015485)|choline binding (GO:0033265)|complement component C1q binding (GO:0001849)|low-density lipoprotein particle binding (GO:0030169)			breast(1)|endometrium(3)|kidney(1)|lung(15)|ovary(1)|skin(1)	22	all_hematologic(112;0.0429)				inhaled insulin(DB05278)	TCCTGCTCCTGCCCCAAGATG	0.537																																					p.Q155X		Atlas-SNP	.											.	CRP	49	.	0			c.C463T						.						245.0	245.0	245.0					1																	159683527		2203	4300	6503	SO:0001587	stop_gained	1401	exon2			GCTCCTGCCCCAA	M11725	CCDS30911.1	1q23.2	2013-05-13			ENSG00000132693	ENSG00000132693			2367	protein-coding gene	gene with protein product	"""pentraxin 1"""	123260				3840479, 6857266	Standard	NM_000567		Approved	PTX1	uc001ftw.3	P02741	OTTHUMG00000035344	ENST00000255030.5:c.463C>T	chr1.hg19:g.159683527G>A	ENSP00000255030:p.Gln155*	79.0	0.0		149.0	44.0	NM_000567	A8K078|D3DVD9|D3DVE0|Q08AK3|Q8WW75	Nonsense_Mutation	SNP	ENST00000255030.5	hg19	CCDS30911.1	.	.	.	.	.	.	.	.	.	.	G	37	6.373874	0.97515	.	.	ENSG00000132693	ENST00000255030	.	.	.	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-20.5758	14.3656	0.66803	0.0:0.0:1.0:0.0	.	.	.	.	X	155	.	ENSP00000255030:Q155X	Q	-	1	0	CRP	157950151	1.000000	0.71417	0.988000	0.46212	0.995000	0.86356	5.769000	0.68865	1.935000	0.56089	0.650000	0.86243	CAG	.	.		0.537	CRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085553.1	NM_000567	
PRRX1	5396	hgsc.bcm.edu	37	1	170705233	170705233	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:170705233C>T	ENST00000239461.6	+	4	957	c.644C>T	c.(643-645)gCa>gTa	p.A215V	PRRX1_ENST00000367760.3_3'UTR|PRRX1_ENST00000476867.2_3'UTR	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	215					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AATAGCCCTGCACAGGGCATC	0.488																																					p.A215V		Atlas-SNP	.											.	PRRX1	81	.	0			c.C644T						.						168.0	170.0	169.0					1																	170705233		2203	4300	6503	SO:0001583	missense	5396	exon4			GCCCTGCACAGGG	M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.644C>T	chr1.hg19:g.170705233C>T	ENSP00000239461:p.Ala215Val	336.0	0.0		547.0	88.0	NM_022716	B5BUM7|O60807	Missense_Mutation	SNP	ENST00000239461.6	hg19	CCDS1290.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142891	0.57044	.	.	ENSG00000116132	ENST00000239461;ENST00000476867	D;T	0.91521	-2.86;-1.3	6.06	6.06	0.98353	.	0.271361	0.41396	D	0.000897	T	0.81113	0.4755	L	0.50333	1.59	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.74405	-0.3676	10	0.17832	T	0.49	.	13.4416	0.61117	0.0:0.9249:0.0:0.0751	.	215	P54821	PRRX1_HUMAN	V	215;60	ENSP00000239461:A215V;ENSP00000451225:A60V	ENSP00000356734:A215V	A	+	2	0	PRRX1	168971857	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.579000	0.67457	2.871000	0.98454	0.655000	0.94253	GCA	.	.		0.488	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085236.3	NM_006902	
RNPEP	6051	hgsc.bcm.edu	37	1	201958548	201958548	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:201958548C>A	ENST00000295640.4	+	3	669	c.626C>A	c.(625-627)aCc>aAc	p.T209N	RNPEP_ENST00000367286.3_Missense_Mutation_p.T209N|RNPEP_ENST00000471105.1_Intron	NM_020216.3	NP_064601.3	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase (aminopeptidase B)	209				STW -> RPG (in Ref. 1; CAC12957). {ECO:0000305}.	leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|epoxide hydrolase activity (GO:0004301)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(4)|lung(6)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		AGTGCTAGCACCTGGGAGAAG	0.468																																					p.T209N	GBM(19;39 479 7473 13131 19462)	Atlas-SNP	.											.	RNPEP	39	.	0			c.C626A						.						125.0	120.0	122.0					1																	201958548		2203	4300	6503	SO:0001583	missense	6051	exon3			CTAGCACCTGGGA	BC001064	CCDS1418.1	1q32	2008-02-05			ENSG00000176393	ENSG00000176393	3.4.11.6		10078	protein-coding gene	gene with protein product		602675				9533033, 10467730	Standard	NM_020216		Approved		uc001gxd.3	Q9H4A4	OTTHUMG00000035866	ENST00000295640.4:c.626C>A	chr1.hg19:g.201958548C>A	ENSP00000295640:p.Thr209Asn	131.0	0.0		231.0	43.0	NM_020216	Q9BVM9|Q9H1D4|Q9NPT7	Missense_Mutation	SNP	ENST00000295640.4	hg19	CCDS1418.1	.	.	.	.	.	.	.	.	.	.	C	6.307	0.424713	0.11987	.	.	ENSG00000176393	ENST00000295640;ENST00000367286;ENST00000447312	T;T;T	0.04194	3.68;3.68;3.68	5.7	2.75	0.32379	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.442398	0.23604	N	0.046405	T	0.03011	0.0089	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.47636	-0.9102	10	0.13853	T	0.58	-17.253	4.5691	0.12202	0.2793:0.5118:0.1352:0.0737	.	209	Q9H4A4	AMPB_HUMAN	N	209;209;78	ENSP00000295640:T209N;ENSP00000356255:T209N;ENSP00000389602:T78N	ENSP00000295640:T209N	T	+	2	0	RNPEP	200225171	0.103000	0.21917	0.479000	0.27329	0.996000	0.88848	0.277000	0.18734	0.307000	0.22880	0.655000	0.94253	ACC	.	.		0.468	RNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087345.1	NM_020216	
MYBPH	4608	hgsc.bcm.edu	37	1	203144856	203144856	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:203144856G>A	ENST00000255416.4	-	1	85	c.28C>T	c.(28-30)Cct>Tct	p.P10S		NM_004997.2	NP_004988.2	Q13203	MYBPH_HUMAN	myosin binding protein H	10					cell adhesion (GO:0007155)|regulation of striated muscle contraction (GO:0006942)	myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			endometrium(5)|large_intestine(6)|lung(7)|skin(1)|urinary_tract(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		CTGCAGGCAGGGCCCTCGGAG	0.627																																					p.P10S	NSCLC(32;174 1025 14462 23899 42933)	Atlas-SNP	.											.	MYBPH	41	.	0			c.C28T						.						60.0	70.0	67.0					1																	203144856		2203	4300	6503	SO:0001583	missense	4608	exon1			AGGCAGGGCCCTC	BC044226	CCDS30975.1	1q32.1	2013-02-11	2001-11-28		ENSG00000133055	ENSG00000133055		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7552	protein-coding gene	gene with protein product		160795	"""myosin-binding protein H"""			8486381	Standard	NM_004997		Approved		uc001gzh.1	Q13203	OTTHUMG00000042121	ENST00000255416.4:c.28C>T	chr1.hg19:g.203144856G>A	ENSP00000255416:p.Pro10Ser	62.0	0.0		109.0	14.0	NM_004997	Q16886|Q86YC5	Missense_Mutation	SNP	ENST00000255416.4	hg19	CCDS30975.1	.	.	.	.	.	.	.	.	.	.	G	4.088	0.014266	0.07959	.	.	ENSG00000133055	ENST00000255416	T	0.49720	0.77	5.02	-2.09	0.07232	.	0.998285	0.08105	N	0.997094	T	0.23410	0.0566	N	0.14661	0.345	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.19549	-1.0302	10	0.16420	T	0.52	.	3.672	0.08277	0.2589:0.0:0.3427:0.3985	.	10	Q13203	MYBPH_HUMAN	S	10	ENSP00000255416:P10S	ENSP00000255416:P10S	P	-	1	0	MYBPH	201411479	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-0.539000	0.06113	-0.417000	0.07461	0.462000	0.41574	CCT	.	.		0.627	MYBPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100264.1	NM_004997	
C1orf116	79098	hgsc.bcm.edu	37	1	207196069	207196069	+	Missense_Mutation	SNP	C	C	T	rs376328889		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:207196069C>T	ENST00000359470.5	-	4	1289	c.1040G>A	c.(1039-1041)cGt>cAt	p.R347H	C1orf116_ENST00000461135.2_Missense_Mutation_p.R101H	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	347						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					AGCTTCTTTACGTGCTTTTCT	0.567																																					p.R347H		Atlas-SNP	.											.	C1orf116	64	.	0			c.G1040A						.	C	HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	63.0	65.0	64.0		302,1040	5.6	0.7	1		64	0,8600		0,0,4300	no	missense,missense	C1orf116	NM_001083924.1,NM_023938.5	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	101/356,347/602	207196069	1,13005	2203	4300	6503	SO:0001583	missense	79098	exon4			TCTTTACGTGCTT		CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.1040G>A	chr1.hg19:g.207196069C>T	ENSP00000352447:p.Arg347His	47.0	0.0		104.0	28.0	NM_023938	C9JV41|Q658X3	Missense_Mutation	SNP	ENST00000359470.5	hg19	CCDS1475.1	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820390	0.71028	2.27E-4	0.0	ENSG00000182795	ENST00000359470;ENST00000461135	T;T	0.13196	2.61;2.61	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.38321	0.1036	M	0.66939	2.045	0.31573	N	0.656102	D	0.89917	1.0	D	0.91635	0.999	T	0.35871	-0.9771	10	0.87932	D	0	-21.9504	18.0883	0.89464	0.0:1.0:0.0:0.0	.	347	Q9BW04	SARG_HUMAN	H	347;101	ENSP00000352447:R347H;ENSP00000436862:R101H	ENSP00000352447:R347H	R	-	2	0	C1orf116	205262692	0.386000	0.25180	0.724000	0.30704	0.390000	0.30446	2.433000	0.44793	2.608000	0.88229	0.655000	0.94253	CGT	.	.		0.567	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088973.1	NM_024115	
ZP4	57829	hgsc.bcm.edu	37	1	238050802	238050802	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:238050802A>G	ENST00000366570.4	-	5	771	c.613T>C	c.(613-615)Tcg>Ccg	p.S205P	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	205	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			AGTGGTGGCGAGGTCACGTTC	0.527																																					p.S205P	NSCLC(166;160 2029 11600 18754 19936)	Atlas-SNP	.											.	ZP4	161	.	0			c.T613C						.						147.0	131.0	136.0					1																	238050802		2203	4300	6503	SO:0001583	missense	57829	exon5			GTGGCGAGGTCAC	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.613T>C	chr1.hg19:g.238050802A>G	ENSP00000355529:p.Ser205Pro	187.0	0.0		305.0	44.0	NM_021186	B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	hg19	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	A	3.188	-0.166527	0.06461	.	.	ENSG00000116996	ENST00000366570	D	0.82984	-1.67	4.86	-0.897	0.10553	Zona pellucida sperm-binding protein (3);	0.914034	0.09291	N	0.822324	T	0.80675	0.4668	M	0.80028	2.48	0.09310	N	1	B	0.21753	0.06	B	0.32211	0.142	T	0.66520	-0.5903	10	0.30854	T	0.27	-2.2422	2.5405	0.04724	0.3095:0.0:0.3073:0.3832	.	205	Q12836	ZP4_HUMAN	P	205	ENSP00000355529:S205P	ENSP00000355529:S205P	S	-	1	0	ZP4	236117425	0.017000	0.18338	0.000000	0.03702	0.022000	0.10575	0.485000	0.22324	-0.019000	0.14055	-0.327000	0.08410	TCG	.	.		0.527	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		
RGS7	6000	hgsc.bcm.edu	37	1	241094018	241094018	+	Splice_Site	SNP	A	A	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:241094018A>T	ENST00000407727.1	-	5	383	c.384T>A	c.(382-384)taT>taA	p.Y128*	RGS7_ENST00000366562.4_Splice_Site_p.Y128*|RGS7_ENST00000446183.2_Splice_Site_p.Y44*|RGS7_ENST00000401882.1_Intron|RGS7_ENST00000366563.1_Splice_Site_p.Y128*|RGS7_ENST00000331110.7_Splice_Site_p.Y102*|RGS7_ENST00000366565.1_Splice_Site_p.Y128*|RGS7_ENST00000348120.2_Intron|RGS7_ENST00000366564.1_Splice_Site_p.Y128*			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	128					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GGCACTGACCATAATCTGTGT	0.368																																					p.Y128X		Atlas-SNP	.											RGS7,NS,carcinoma,0,1	RGS7	308	.	0			c.T384A						.						133.0	148.0	143.0					1																	241094018		2203	4300	6503	SO:0001630	splice_region_variant	6000	exon6			CTGACCATAATCT	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.385+1T>A	chr1.hg19:g.241094018A>T		274.0	0.0		451.0	131.0	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Nonsense_Mutation	SNP	ENST00000407727.1	hg19		.	.	.	.	.	.	.	.	.	.	A	39	7.875008	0.98537	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000446183;ENST00000366562;ENST00000407727	.	.	.	5.83	-3.09	0.05331	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.5967	11.3762	0.49730	0.5851:0.0:0.4149:0.0	.	.	.	.	X	102;128;128;128;44;128;128	.	ENSP00000331485:Y102X	Y	-	3	2	RGS7	239160641	1.000000	0.71417	0.989000	0.46669	0.892000	0.51952	0.940000	0.28992	-0.509000	0.06532	-0.256000	0.11100	TAT	.	.		0.368	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	Nonsense_Mutation
OR2L3	391192	hgsc.bcm.edu	37	1	248224067	248224067	+	Silent	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:248224067C>T	ENST00000359959.3	+	1	84	c.84C>T	c.(82-84)atC>atT	p.I28I	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TCCTCTTCATCCTCATTGTTT	0.398																																					p.I28I		Atlas-SNP	.											.	OR2L3	97	.	0			c.C84T						.						238.0	236.0	237.0					1																	248224067		2203	4300	6503	SO:0001819	synonymous_variant	391192	exon1			CTTCATCCTCATT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.84C>T	chr1.hg19:g.248224067C>T		112.0	0.0		237.0	72.0	NM_001004687	B9EH44	Silent	SNP	ENST00000359959.3	hg19	CCDS31104.1																																																																																			.	.		0.398	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096852.1	NM_001004687	
OR2T2	401992	hgsc.bcm.edu	37	1	248616329	248616329	+	Silent	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:248616329C>T	ENST00000342927.3	+	1	253	c.231C>T	c.(229-231)atC>atT	p.I77I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACATCTGTATCACTGTCCCCA	0.522																																					p.I77I		Atlas-SNP	.											.	OR2T2	73	.	0			c.C231T						.						130.0	147.0	141.0					1																	248616329		2203	4297	6500	SO:0001819	synonymous_variant	401992	exon1			CTGTATCACTGTC	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.231C>T	chr1.hg19:g.248616329C>T		873.0	0.0		1360.0	94.0	NM_001004136	B2RNM1|B9EH01	Silent	SNP	ENST00000342927.3	hg19	CCDS31116.1																																																																																			.	.		0.522	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
NBAS	51594	hgsc.bcm.edu	37	2	15427254	15427254	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:15427254C>T	ENST00000281513.5	-	42	5106	c.5081G>A	c.(5080-5082)aGt>aAt	p.S1694N	NBAS_ENST00000441750.1_Missense_Mutation_p.S1574N	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1694					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GCGGGAGACACTGTAACGTTG	0.463																																					p.S1694N		Atlas-SNP	.											.	NBAS	246	.	0			c.G5081A						.						139.0	134.0	135.0					2																	15427254		2203	4300	6503	SO:0001583	missense	51594	exon42			GAGACACTGTAAC	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5081G>A	chr2.hg19:g.15427254C>T	ENSP00000281513:p.Ser1694Asn	113.0	0.0		149.0	75.0	NM_015909	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	ENST00000281513.5	hg19	CCDS1685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.350|0.350	-0.945593|-0.945593	0.02304|0.02304	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513|ENST00000442506	T;T|.	0.10192|.	2.9;3.08|.	5.55|5.55	-0.432|-0.432	0.12291|0.12291	.|.	0.502900|.	0.27996|.	N|.	0.017010|.	T|T	0.44286|0.44286	0.1286|0.1286	M|M	0.65975|0.65975	2.015|2.015	0.09310|0.09310	N|N	0.999994|0.999994	B;B|.	0.21753|.	0.06;0.001|.	B;B|.	0.22386|.	0.039;0.002|.	T|T	0.40327|0.40327	-0.9569|-0.9569	10|5	0.87932|.	D|.	0|.	.|.	7.1774|7.1774	0.25753|0.25753	0.0:0.4423:0.1133:0.4444|0.0:0.4423:0.1133:0.4444	.|.	1574;1694|.	A2RRP1-2;A2RRP1|.	.;NBAS_HUMAN|.	N|M	1574;1694|742	ENSP00000413201:S1574N;ENSP00000281513:S1694N|.	ENSP00000281513:S1694N|.	S|V	-|-	2|1	0|0	NBAS|NBAS	15344705|15344705	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.488000|0.488000	0.33401|0.33401	-0.084000|-0.084000	0.11268|0.11268	-0.034000|-0.034000	0.13713|0.13713	-0.137000|-0.137000	0.14449|0.14449	AGT|GTG	.	.		0.463	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241638.1	NM_015909	
PLB1	151056	hgsc.bcm.edu	37	2	28761188	28761188	+	Silent	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:28761188T>C	ENST00000327757.5	+	10	602	c.558T>C	c.(556-558)aaT>aaC	p.N186N	PLB1_ENST00000422425.2_Silent_p.N197N	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	186	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					TCTCACAGAATGGGCTTGCGG	0.657																																					p.N197N		Atlas-SNP	.											.	PLB1	255	.	0			c.T591C						.						49.0	46.0	47.0					2																	28761188		2203	4300	6503	SO:0001819	synonymous_variant	151056	exon10			ACAGAATGGGCTT		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.558T>C	chr2.hg19:g.28761188T>C		41.0	0.0		46.0	18.0	NM_001170585	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Silent	SNP	ENST00000327757.5	hg19	CCDS33168.1	.	.	.	.	.	.	.	.	.	.	T	0.598	-0.830236	0.02734	.	.	ENSG00000163803	ENST00000404858	.	.	.	5.0	-9.99	0.00435	.	.	.	.	.	T	0.16041	0.0386	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.08371	-1.0725	4	.	.	.	3.165	3.4752	0.07582	0.12:0.4363:0.2466:0.1971	.	.	.	.	T	196	.	.	M	+	2	0	PLB1	28614692	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.415000	0.01036	-3.088000	0.00248	-3.471000	0.00035	ATG	.	.		0.657	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
PLEKHH2	130271	hgsc.bcm.edu	37	2	43927267	43927267	+	Silent	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:43927267T>C	ENST00000282406.4	+	8	1280	c.1170T>C	c.(1168-1170)ttT>ttC	p.F390F		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	390					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ATAAAAAATTTCAATCCCAGA	0.403																																					p.F390F		Atlas-SNP	.											PLEKHH2,NS,carcinoma,0,1	PLEKHH2	156	.	0			c.T1170C						.						55.0	55.0	55.0					2																	43927267		2203	4300	6503	SO:0001819	synonymous_variant	130271	exon8			AAAATTTCAATCC	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.1170T>C	chr2.hg19:g.43927267T>C		136.0	0.0		176.0	78.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	ENST00000282406.4	hg19	CCDS1812.1																																																																																			.	.		0.403	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
PLEK	5341	hgsc.bcm.edu	37	2	68622843	68622843	+	Silent	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:68622843G>A	ENST00000234313.7	+	9	1127	c.948G>A	c.(946-948)gaG>gaA	p.E316E		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	316	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		ACCTTTTTGAGATCATCACAG	0.542																																					p.E316E		Atlas-SNP	.											.	PLEK	64	.	0			c.G948A						.						156.0	140.0	145.0					2																	68622843		2203	4300	6503	SO:0001819	synonymous_variant	5341	exon9			TTTTGAGATCATC	X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.948G>A	chr2.hg19:g.68622843G>A		172.0	0.0		242.0	50.0	NM_002664	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Silent	SNP	ENST00000234313.7	hg19	CCDS1887.1																																																																																			.	.		0.542	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251755.1	NM_002664	
ATP6V1B1	525	hgsc.bcm.edu	37	2	71190004	71190004	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:71190004A>C	ENST00000234396.4	+	9	956	c.883A>C	c.(883-885)Agt>Cgt	p.S295R	ATP6V1B1_ENST00000412314.1_Missense_Mutation_p.S295R|RN7SL160P_ENST00000468558.2_RNA|AC007040.11_ENST00000606025.1_Intron	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	295					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						GACGGACATGAGTTCCTATGC	0.592																																					p.S295R		Atlas-SNP	.											.	ATP6V1B1	66	.	0			c.A883C						.						135.0	120.0	125.0					2																	71190004		2203	4300	6503	SO:0001583	missense	525	exon9			GACATGAGTTCCT	AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.883A>C	chr2.hg19:g.71190004A>C	ENSP00000234396:p.Ser295Arg	45.0	0.0		63.0	28.0	NM_001692	Q53FY0|Q6P4H6	Missense_Mutation	SNP	ENST00000234396.4	hg19	CCDS1912.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.538771	0.85917	.	.	ENSG00000116039	ENST00000234396;ENST00000483246;ENST00000412314	D;D	0.82803	-1.65;-1.65	5.41	5.41	0.78517	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92938	0.7753	H	0.94964	3.605	0.80722	D	1	P;D;D	0.64830	0.89;0.994;0.99	D;D;D	0.69654	0.948;0.965;0.936	D	0.94567	0.7767	10	0.87932	D	0	-9.6708	13.3939	0.60838	1.0:0.0:0.0:0.0	.	270;295;295	B4DWH7;C9JL73;P15313	.;.;VATB1_HUMAN	R	295;270;295	ENSP00000234396:S295R;ENSP00000388353:S295R	ENSP00000234396:S295R	S	+	1	0	ATP6V1B1	71043512	1.000000	0.71417	0.998000	0.56505	0.937000	0.57800	9.332000	0.96446	2.066000	0.61787	0.528000	0.53228	AGT	.	.		0.592	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251920.2	NM_001692	
TTN	7273	hgsc.bcm.edu	37	2	179422457	179422457	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:179422457G>T	ENST00000591111.1	-	278	82925	c.82701C>A	c.(82699-82701)taC>taA	p.Y27567*	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.Y20335*|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.Y29208*|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.Y20268*|TTN_ENST00000460472.2_Nonsense_Mutation_p.Y20143*|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.Y26640*|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27567	Fibronectin type-III 100. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCGGAATTGGTATTCTTCTC	0.413																																					p.Y29208X		Atlas-SNP	.											.	TTN	18412	.	0			c.C87624A						.						340.0	335.0	336.0					2																	179422457		1956	4143	6099	SO:0001587	stop_gained	7273	exon328			GAATTGGTATTCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.82701C>A	chr2.hg19:g.179422457G>T	ENSP00000465570:p.Tyr27567*	116.0	0.0		67.0	49.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	G	66	91.457916	0.99996	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.96	0.939	0.19506	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.4651	0.21977	0.3623:0.0:0.5216:0.1161	.	.	.	.	X	26640;20143;20335;20268;20140	.	ENSP00000340554:Y20335X	Y	-	3	2	TTN	179130703	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.847000	0.27696	0.430000	0.26230	0.655000	0.94253	TAC	.	.		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
EPHA4	2043	hgsc.bcm.edu	37	2	222321452	222321452	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:222321452G>T	ENST00000281821.2	-	7	1525	c.1484C>A	c.(1483-1485)gCc>gAc	p.A495D	EPHA4_ENST00000409938.1_Missense_Mutation_p.A495D|EPHA4_ENST00000409854.1_Missense_Mutation_p.A495D|EPHA4_ENST00000392071.4_Missense_Mutation_p.A444D	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	495	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TGTGTTCCTGGCAGCTGTCCG	0.478																																					p.A495D		Atlas-SNP	.											.	EPHA4	263	.	0			c.C1484A						.						139.0	122.0	128.0					2																	222321452		2203	4300	6503	SO:0001583	missense	2043	exon7			TTCCTGGCAGCTG	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1484C>A	chr2.hg19:g.222321452G>T	ENSP00000281821:p.Ala495Asp	106.0	0.0		134.0	51.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408452	0.42715	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.91	5.02	0.67125	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.161120	0.56097	D	0.000023	T	0.39627	0.1085	N	0.10837	0.055	0.44611	D	0.997587	B	0.25235	0.121	B	0.30943	0.122	T	0.30679	-0.9970	10	0.52906	T	0.07	.	17.1291	0.86722	0.0:0.1265:0.8735:0.0	.	495	P54764	EPHA4_HUMAN	D	495;495;495;444	ENSP00000281821:A495D;ENSP00000386276:A495D;ENSP00000386829:A495D;ENSP00000375923:A444D	ENSP00000281821:A495D	A	-	2	0	EPHA4	222029696	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.429000	0.73387	1.481000	0.48307	-0.176000	0.13171	GCC	.	.		0.478	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
SNED1	25992	hgsc.bcm.edu	37	2	242007187	242007187	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:242007187C>T	ENST00000310397.8	+	22	3019	c.3019C>T	c.(3019-3021)Cct>Tct	p.P1007S	SNED1_ENST00000401884.1_Missense_Mutation_p.P1007S|SNED1_ENST00000405547.3_Missense_Mutation_p.P1007S|SNED1_ENST00000342631.6_Missense_Mutation_p.P1007S	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1007	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		AGGACCCCGCCCTGTGGAAGG	0.642																																					p.P1007S		Atlas-SNP	.											.	SNED1	76	.	0			c.C3019T						.						39.0	44.0	43.0					2																	242007187		2021	4154	6175	SO:0001583	missense	25992	exon22			CCCCGCCCTGTGG	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.3019C>T	chr2.hg19:g.242007187C>T	ENSP00000308893:p.Pro1007Ser	107.0	0.0		143.0	30.0	NM_001080437	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	hg19	CCDS46562.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697501	0.68386	.	.	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	4.92	4.92	0.64577	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.52532	D	0.000076	T	0.64735	0.2625	L	0.34521	1.04	0.41155	D	0.986051	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.977;0.999;0.986	T	0.59279	-0.7484	10	0.16896	T	0.51	.	16.2939	0.82762	0.0:1.0:0.0:0.0	.	1007;1007;1007	Q8TER0-5;B5MEF5;Q8TER0	.;.;SNED1_HUMAN	S	1007	ENSP00000384871:P1007S;ENSP00000386007:P1007S;ENSP00000308893:P1007S;ENSP00000342992:P1007S	ENSP00000308893:P1007S	P	+	1	0	SNED1	241655860	0.996000	0.38824	0.994000	0.49952	0.445000	0.32107	3.953000	0.56699	2.275000	0.75901	0.491000	0.48974	CCT	.	.		0.642	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
SEMA3F	6405	hgsc.bcm.edu	37	3	50197097	50197097	+	Silent	SNP	C	C	A	rs1046953	byFrequency	TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:50197097C>A	ENST00000002829.3	+	2	526	c.42C>A	c.(40-42)acC>acA	p.T14T	SEMA3F_ENST00000413852.1_Intron|SEMA3F_ENST00000434342.1_Silent_p.T14T	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	14					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		CCCTACTGACCGGGGCCTGGC	0.617																																					p.T14T		Atlas-SNP	.											.	SEMA3F	62	.	0			c.C42A						.						60.0	57.0	58.0					3																	50197097		2203	4300	6503	SO:0001819	synonymous_variant	6405	exon2			ACTGACCGGGGCC	U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.42C>A	chr3.hg19:g.50197097C>A		48.0	0.0		37.0	18.0	NM_004186	C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	ENST00000002829.3	hg19	CCDS2811.1																																																																																			.	C|0.626;T|0.374		0.617	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345929.1	NM_004186	
BBX	56987	hgsc.bcm.edu	37	3	107492029	107492029	+	Silent	SNP	A	A	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:107492029A>T	ENST00000325805.8	+	11	1748	c.1461A>T	c.(1459-1461)atA>atT	p.I487I	BBX_ENST00000402543.1_Silent_p.I487I|BBX_ENST00000416476.2_Intron|BBX_ENST00000415149.2_Silent_p.I487I|BBX_ENST00000406780.1_Silent_p.I487I			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	487	Lys-rich.				bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			AGAGCGTCATATATACCATTG	0.463																																					p.I487I		Atlas-SNP	.											.	BBX	156	.	0			c.A1461T						.						76.0	80.0	79.0					3																	107492029		2203	4300	6503	SO:0001819	synonymous_variant	56987	exon11			CGTCATATATACC	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.1461A>T	chr3.hg19:g.107492029A>T		382.0	0.0		374.0	87.0	NM_001142568	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Silent	SNP	ENST00000325805.8	hg19	CCDS46881.1																																																																																			.	.		0.463	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
MYH15	22989	hgsc.bcm.edu	37	3	108133217	108133217	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:108133217C>T	ENST00000273353.3	-	31	4123	c.4067G>A	c.(4066-4068)cGa>cAa	p.R1356Q		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1356						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ATACTGCTCTCGTAGAAGGTC	0.502																																					p.R1356Q		Atlas-SNP	.											.	MYH15	223	.	0			c.G4067A						.						116.0	109.0	111.0					3																	108133217		2048	4202	6250	SO:0001583	missense	22989	exon31			TGCTCTCGTAGAA	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4067G>A	chr3.hg19:g.108133217C>T	ENSP00000273353:p.Arg1356Gln	54.0	0.0		55.0	24.0	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	hg19	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.949644	0.73787	.	.	ENSG00000144821	ENST00000273353	D	0.82711	-1.64	5.58	-2.93	0.05598	Myosin tail (1);	.	.	.	.	T	0.78874	0.4352	M	0.64170	1.965	0.09310	N	1	P	0.41102	0.738	B	0.42282	0.382	T	0.70241	-0.4926	9	0.62326	D	0.03	.	7.3104	0.26471	0.1054:0.4429:0.0:0.4517	.	1356	Q9Y2K3	MYH15_HUMAN	Q	1356	ENSP00000273353:R1356Q	ENSP00000273353:R1356Q	R	-	2	0	MYH15	109615907	0.002000	0.14202	0.000000	0.03702	0.416000	0.31233	0.489000	0.22387	-0.398000	0.07679	0.655000	0.94253	CGA	.	.		0.502	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
HPS3	84343	hgsc.bcm.edu	37	3	148884845	148884845	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:148884845G>C	ENST00000296051.2	+	15	2754	c.2614G>C	c.(2614-2616)Gac>Cac	p.D872H	HPS3_ENST00000460120.1_Missense_Mutation_p.D707H	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	872					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TCCTTCATTTGACATAGCTTC	0.393									Hermansky-Pudlak syndrome																												p.D872H		Atlas-SNP	.											.	HPS3	104	.	0			c.G2614C						.						144.0	144.0	144.0					3																	148884845		2203	4300	6503	SO:0001583	missense	84343	exon15	Familial Cancer Database	HPS, HPS1-8	TCATTTGACATAG	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.2614G>C	chr3.hg19:g.148884845G>C	ENSP00000296051:p.Asp872His	80.0	0.0		49.0	16.0	NM_032383	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	ENST00000296051.2	hg19	CCDS3140.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.520603	0.64747	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.64991	-0.13;-0.13	5.82	5.82	0.92795	.	0.286046	0.44688	D	0.000428	T	0.72890	0.3517	L	0.53249	1.67	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.65773	0.938;0.922	T	0.74337	-0.3698	10	0.72032	D	0.01	-21.4224	12.8002	0.57582	0.1173:0.0:0.8827:0.0	.	707;872	G5E9V4;Q969F9	.;HPS3_HUMAN	H	872;707	ENSP00000296051:D872H;ENSP00000418230:D707H	ENSP00000296051:D872H	D	+	1	0	HPS3	150367535	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.076000	0.41548	2.762000	0.94881	0.650000	0.86243	GAC	.	.		0.393	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356151.1	NM_032383	
KCNAB1	7881	hgsc.bcm.edu	37	3	156170702	156170702	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:156170702T>C	ENST00000490337.1	+	3	398	c.334T>C	c.(334-336)Ttt>Ctt	p.F112L	KCNAB1_ENST00000389634.5_Missense_Mutation_p.F94L|KCNAB1_ENST00000389636.5_Missense_Mutation_p.F112L|KCNAB1_ENST00000302490.8_Missense_Mutation_p.F94L|KCNAB1_ENST00000471742.1_Missense_Mutation_p.F101L	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	112					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ATGGGTGACATTTGGAGGTCA	0.353																																					p.F112L		Atlas-SNP	.											.	KCNAB1	176	.	0			c.T334C						.						111.0	124.0	120.0					3																	156170702		2203	4300	6503	SO:0001583	missense	7881	exon3			GTGACATTTGGAG	U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.334T>C	chr3.hg19:g.156170702T>C	ENSP00000419952:p.Phe112Leu	117.0	0.0		102.0	59.0	NM_172160	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	ENST00000490337.1	hg19	CCDS3174.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.519012	0.85495	.	.	ENSG00000169282	ENST00000472028;ENST00000490337;ENST00000389636;ENST00000471742;ENST00000475456;ENST00000302490;ENST00000389634	T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.71	5.71	0.89125	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.49592	0.1566	M	0.83384	2.64	0.80722	D	1	B;P;D;P;P	0.56968	0.402;0.859;0.978;0.755;0.794	P;P;P;P;P	0.60117	0.539;0.654;0.869;0.579;0.704	T	0.54820	-0.8236	10	0.59425	D	0.04	-15.6506	12.396	0.55384	0.0:0.0:0.0:1.0	.	112;94;94;101;112	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	L	30;112;112;101;55;94;94	ENSP00000420755:F30L;ENSP00000419952:F112L;ENSP00000374287:F112L;ENSP00000418956:F101L;ENSP00000420221:F55L;ENSP00000305858:F94L;ENSP00000374285:F94L	ENSP00000305858:F94L	F	+	1	0	KCNAB1	157653396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.161000	0.71868	2.171000	0.68590	0.528000	0.53228	TTT	.	.		0.353	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351411.1	NM_003471	
MECOM	2122	hgsc.bcm.edu	37	3	169099207	169099207	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:169099207G>T	ENST00000494292.1	-	2	240	c.143C>A	c.(142-144)tCt>tAt	p.S48Y	MECOM_ENST00000485957.1_5'UTR	NM_004991.3	NP_004982.2	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	48					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						TGTGGCAGGAGAGCATGGCTC	0.483																																					p.S48Y		Atlas-SNP	.											.	MECOM	216	.	0			c.C143A						.						75.0	77.0	76.0					3																	169099207		1926	4129	6055	SO:0001583	missense	2122	exon2			GCAGGAGAGCATG	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000494292.1:c.143C>A	chr3.hg19:g.169099207G>T	ENSP00000417899:p.Ser48Tyr	76.0	0.0		88.0	47.0	NM_004991	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000494292.1	hg19		.	.	.	.	.	.	.	.	.	.	G	14.19	2.462122	0.43736	.	.	ENSG00000085276	ENST00000494292;ENST00000486748	T;T	0.57595	0.39;0.39	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000011	T	0.73024	0.3534	M	0.72894	2.215	0.80722	D	1	D;P	0.67145	0.996;0.642	D;B	0.66979	0.948;0.199	T	0.73968	-0.3815	10	0.87932	D	0	.	20.3343	0.98733	0.0:0.0:1.0:0.0	.	48;48	Q13465;Q03112-3	MDS1_HUMAN;.	Y	48;72	ENSP00000417899:S48Y;ENSP00000419537:S72Y	ENSP00000419537:S72Y	S	-	2	0	MECOM	170581901	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	8.072000	0.89496	2.822000	0.97130	0.650000	0.86243	TCT	.	.		0.483	MECOM-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000351517.3	NM_005241, NM_004991	
GPR160	26996	hgsc.bcm.edu	37	3	169802764	169802764	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:169802764T>C	ENST00000355897.5	+	4	1612	c.1004T>C	c.(1003-1005)aTa>aCa	p.I335T	RP11-379K17.12_ENST00000599781.1_RNA	NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	335						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			CCTATATCAATAATGATTTGT	0.289																																					p.I335T		Atlas-SNP	.											.	GPR160	26	.	0			c.T1004C						.						30.0	31.0	31.0					3																	169802764		2099	4250	6349	SO:0001583	missense	26996	exon4			TATCAATAATGAT	AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.1004T>C	chr3.hg19:g.169802764T>C	ENSP00000348161:p.Ile335Thr	197.0	0.0		216.0	61.0	NM_014373	D3DNQ2	Missense_Mutation	SNP	ENST00000355897.5	hg19	CCDS3211.1	.	.	.	.	.	.	.	.	.	.	T	5.062	0.197098	0.09599	.	.	ENSG00000173890	ENST00000355897	.	.	.	5.74	4.58	0.56647	.	0.689522	0.14402	N	0.321859	T	0.26774	0.0655	N	0.19112	0.55	0.09310	N	0.999994	B	0.23185	0.081	B	0.18561	0.022	T	0.16070	-1.0415	9	0.42905	T	0.14	.	7.2209	0.25985	0.1303:0.0704:0.0:0.7994	.	335	Q9UJ42	GP160_HUMAN	T	335	.	ENSP00000348161:I335T	I	+	2	0	GPR160	171285458	0.998000	0.40836	0.057000	0.19452	0.019000	0.09904	2.684000	0.46951	1.014000	0.39417	0.533000	0.62120	ATA	.	.		0.289	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352167.1	NM_014373	
PIK3CA	5290	hgsc.bcm.edu	37	3	178936092	178936092	+	Missense_Mutation	SNP	A	A	C	rs121913274		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:178936092A>C	ENST00000263967.3	+	10	1791	c.1634A>C	c.(1633-1635)gAg>gCg	p.E545A		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545A(96)|p.E545G(78)|p.E545V(4)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAATCACTGAGCAGGAGAAA	0.353	E545A(AGS_STOMACH)|E545G(KCL22_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545A	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,carcinoma,+1,211	PIK3CA	8460	.	178	Substitution - Missense(178)	breast(40)|large_intestine(39)|ovary(30)|endometrium(17)|skin(9)|urinary_tract(8)|upper_aerodigestive_tract(4)|central_nervous_system(4)|oesophagus(4)|stomach(4)|liver(4)|thyroid(3)|soft_tissue(3)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|NS(1)|eye(1)|pancreas(1)|prostate(1)|pituitary(1)	c.A1634C						.						61.0	61.0	61.0					3																	178936092		1813	4072	5885	SO:0001583	missense	5290	exon10			TCACTGAGCAGGA		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1634A>C	chr3.hg19:g.178936092A>C	ENSP00000263967:p.Glu545Ala	462.0	0.0		416.0	208.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.555316	0.86231	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71074	0.3297	L	0.43757	1.38	0.80722	D	1	D	0.67145	0.996	D	0.65140	0.932	T	0.69109	-0.5232	10	0.34782	T	0.22	-25.7963	16.1026	0.81194	1.0:0.0:0.0:0.0	.	545	P42336	PK3CA_HUMAN	A	545	ENSP00000263967:E545A	ENSP00000263967:E545A	E	+	2	0	PIK3CA	180418786	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	8.962000	0.93254	2.198000	0.70561	0.383000	0.25322	GAG	.	.		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
BOD1L1	259282	hgsc.bcm.edu	37	4	13589344	13589344	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr4:13589344G>A	ENST00000040738.5	-	16	8467	c.8332C>T	c.(8332-8334)Ctc>Ttc	p.L2778F		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2778						nucleus (GO:0005634)	DNA binding (GO:0003677)										TCTGAAGAGAGATAATGCTGC	0.303																																					p.L2778F		Atlas-SNP	.											.	.	.	.	0			c.C8332T						.						34.0	35.0	35.0					4																	13589344		2197	4288	6485	SO:0001583	missense	259282	exon16			AAGAGAGATAATG	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8332C>T	chr4.hg19:g.13589344G>A	ENSP00000040738:p.Leu2778Phe	440.0	1.0		365.0	103.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	ENST00000040738.5	hg19	CCDS3411.2	.	.	.	.	.	.	.	.	.	.	G	9.511	1.105790	0.20632	.	.	ENSG00000038219	ENST00000040738	T	0.07800	3.16	4.99	-0.115	0.13560	.	1.416370	0.04550	N	0.389728	T	0.05640	0.0148	N	0.24115	0.695	0.09310	N	1	P	0.34462	0.454	B	0.31614	0.133	T	0.33240	-0.9876	10	0.56958	D	0.05	1.5412	2.1752	0.03860	0.1739:0.28:0.4029:0.1432	.	2778	Q8NFC6	BOD1L_HUMAN	F	2778	ENSP00000040738:L2778F	ENSP00000040738:L2778F	L	-	1	0	BOD1L	13198442	0.330000	0.24705	0.007000	0.13788	0.962000	0.63368	0.870000	0.28010	-0.042000	0.13535	-0.165000	0.13383	CTC	.	.		0.303	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
FBXW7	55294	hgsc.bcm.edu	37	4	153245454	153245454	+	Silent	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr4:153245454C>T	ENST00000281708.4	-	11	2966	c.1737G>A	c.(1735-1737)ggG>ggA	p.G579G	FBXW7_ENST00000263981.5_Silent_p.G499G|FBXW7_ENST00000296555.5_Silent_p.G461G|FBXW7_ENST00000603841.1_Silent_p.G579G|FBXW7_ENST00000393956.3_Silent_p.G403G|FBXW7_ENST00000603548.1_Silent_p.G579G	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	579					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.G579_Q581>E(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ACGACTGGTGCCCTGTTAACG	0.413			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																p.G579G		Atlas-SNP	.		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	.	FBXW7	2157	.	2	Unknown(1)|Complex - deletion inframe(1)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	c.G1737A						.						150.0	124.0	133.0					4																	153245454		2203	4300	6503	SO:0001819	synonymous_variant	55294	exon11			CTGGTGCCCTGTT	AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1737G>A	chr4.hg19:g.153245454C>T		150.0	0.0		154.0	28.0	NM_033632	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Silent	SNP	ENST00000281708.4	hg19	CCDS3777.1																																																																																			.	.		0.413	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469956.1		
GPR98	84059	hgsc.bcm.edu	37	5	90074291	90074291	+	Silent	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:90074291G>A	ENST00000405460.2	+	63	12810	c.12714G>A	c.(12712-12714)caG>caA	p.Q4238Q	GPR98_ENST00000425867.2_5'Flank	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4238	Calx-beta 28. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATGAGTTTCAGCTCACTGCAG	0.463																																					p.Q4238Q		Atlas-SNP	.											.	GPR98	605	.	0			c.G12714A						.																																			SO:0001819	synonymous_variant	84059	exon63			GTTTCAGCTCACT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.12714G>A	chr5.hg19:g.90074291G>A		126.0	0.0		168.0	86.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	hg19	CCDS47246.1																																																																																			.	.		0.463	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
PAM	5066	hgsc.bcm.edu	37	5	102326066	102326066	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:102326066T>C	ENST00000438793.3	+	15	2044	c.1574T>C	c.(1573-1575)cTg>cCg	p.L525P	PAM_ENST00000304400.7_Missense_Mutation_p.L525P|PAM_ENST00000455264.2_Missense_Mutation_p.L525P|PAM_ENST00000274392.9_Missense_Mutation_p.L428P|PAM_ENST00000346918.2_Missense_Mutation_p.L525P|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000348126.2_Missense_Mutation_p.L418P	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	525	Peptidyl-alpha-hydroxyglycine alpha- amidating lyase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	AAGAATAACCTGGTGATTTTC	0.383																																					p.L525P		Atlas-SNP	.											.	PAM	180	.	0			c.T1574C						.						59.0	58.0	58.0					5																	102326066		2203	4300	6503	SO:0001583	missense	5066	exon15			ATAACCTGGTGAT	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.1574T>C	chr5.hg19:g.102326066T>C	ENSP00000396493:p.Leu525Pro	127.0	0.0		188.0	91.0	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	hg19	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189769	0.78789	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000274392;ENST00000455264	D;D;D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15;-3.15;-3.15	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.94381	0.8193	L	0.33093	0.98	0.80722	D	1	D;P;D;D;P;D;D	0.89917	1.0;0.702;1.0;1.0;0.85;1.0;1.0	D;P;D;D;P;D;D	0.97110	1.0;0.45;1.0;1.0;0.697;1.0;1.0	D	0.94606	0.7800	10	0.49607	T	0.09	-12.2412	15.1757	0.72910	0.0:0.0:0.0:1.0	.	428;98;525;525;525;525;418	F8WE90;Q13749;P19021;P19021-4;P19021-3;P19021-5;P19021-2	.;.;AMD_HUMAN;.;.;.;.	P	525;525;418;525;428;525	ENSP00000396493:L525P;ENSP00000282992:L525P;ENSP00000314638:L418P;ENSP00000306100:L525P;ENSP00000274392:L428P;ENSP00000403461:L525P	ENSP00000274392:L428P	L	+	2	0	PAM	102353965	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.669000	0.74462	2.075000	0.62263	0.454000	0.30748	CTG	.	.		0.383	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
FTMT	94033	hgsc.bcm.edu	37	5	121187669	121187669	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:121187669G>A	ENST00000321339.1	+	1	20	c.11G>A	c.(10-12)tGc>tAc	p.C4Y		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	4					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		ATGCTGTCCTGCTTCAGGCTC	0.697																																					p.C4Y		Atlas-SNP	.											.	FTMT	71	.	0			c.G11A						.						31.0	36.0	34.0					5																	121187669		2201	4297	6498	SO:0001583	missense	94033	exon1			TGTCCTGCTTCAG	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.11G>A	chr5.hg19:g.121187669G>A	ENSP00000313691:p.Cys4Tyr	37.0	0.0		35.0	15.0	NM_177478		Missense_Mutation	SNP	ENST00000321339.1	hg19	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	G	7.698	0.692553	0.15039	.	.	ENSG00000181867	ENST00000321339	T	0.64803	-0.12	3.1	1.28	0.21552	.	.	.	.	.	T	0.40247	0.1109	N	0.14661	0.345	0.19575	N	0.999967	B	0.06786	0.001	B	0.04013	0.001	T	0.26815	-1.0092	9	0.51188	T	0.08	.	4.8436	0.13503	0.2928:0.0:0.7072:0.0	.	4	Q8N4E7	FTMT_HUMAN	Y	4	ENSP00000313691:C4Y	ENSP00000313691:C4Y	C	+	2	0	FTMT	121215568	0.007000	0.16637	0.057000	0.19452	0.125000	0.20455	0.115000	0.15540	0.324000	0.23333	0.650000	0.86243	TGC	.	.		0.697	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
PCDHB14	56122	hgsc.bcm.edu	37	5	140604578	140604579	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:140604578_140604579GC>AA	ENST00000239449.4	+	1	1501_1502	c.1501_1502GC>AA	c.(1501-1503)GCc>AAc	p.A501N	PCDHB14_ENST00000515856.2_Missense_Mutation_p.A348N	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	501	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGCCCCTCGCCTCCTTGGTC	0.649																																					p.A501T|p.A501D	Ovarian(141;50 1831 27899 33809 37648)	Atlas-SNP	.											.	PCDHB14	132	.	0			c.G1501A|c.C1502A						.																																			SO:0001583	missense	56122	exon1			CCCCTCGCCTCCT|CCCTCGCCTCCTT	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	Exception_encountered	chr5.hg19:g.140604578_140604579delinsAA	ENSP00000239449:p.Ala501Asn	88.0|87.0	0.0		160.0|161.0	51.0|52.0	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	hg19	CCDS4256.1																																																																																			.	.		0.649	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
PCDHGB4	8641	hgsc.bcm.edu	37	5	140769171	140769171	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:140769171G>A	ENST00000519479.1	+	1	1720	c.1720G>A	c.(1720-1722)Gat>Aat	p.D574N	PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	574	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCGCTCTTCGATATGGTGCC	0.647																																					p.D574N		Atlas-SNP	.											.	PCDHGB4	125	.	0			c.G1720A						.						38.0	47.0	44.0					5																	140769171		2182	4278	6460	SO:0001583	missense	8641	exon1			CTCTTCGATATGG	AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1720G>A	chr5.hg19:g.140769171G>A	ENSP00000428288:p.Asp574Asn	61.0	0.0		108.0	33.0	NM_032098	O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	ENST00000519479.1	hg19	CCDS54928.1	.	.	.	.	.	.	.	.	.	.	.	25.5	4.645136	0.87859	.	.	ENSG00000253953	ENST00000519479	T	0.37584	1.19	5.05	4.18	0.49190	Cadherin-like (1);	.	.	.	.	T	0.62744	0.2453	M	0.82323	2.585	0.30511	N	0.769447	D;D	0.89917	1.0;0.999	D;D	0.71656	0.974;0.942	T	0.68096	-0.5499	9	0.87932	D	0	.	14.83	0.70139	0.0:0.0:0.8547:0.1453	.	574;574	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	N	574	ENSP00000428288:D574N	ENSP00000428288:D574N	D	+	1	0	PCDHGB4	140749355	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	3.828000	0.55753	1.242000	0.43836	0.563000	0.77884	GAT	.	.		0.647	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374745.1	NM_003736	
IL12B	3593	hgsc.bcm.edu	37	5	158750101	158750101	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:158750101C>T	ENST00000231228.2	-	3	780	c.325G>A	c.(325-327)Gat>Aat	p.D109N		NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	109					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)			cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAAATTCCATCTTCCTTTTTG	0.418																																					p.D109N		Atlas-SNP	.											.	IL12B	30	.	0			c.G325A						.						80.0	79.0	80.0					5																	158750101		2203	4300	6503	SO:0001583	missense	3593	exon3			TTCCATCTTCCTT	M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.325G>A	chr5.hg19:g.158750101C>T	ENSP00000231228:p.Asp109Asn	114.0	0.0		185.0	66.0	NM_002187		Missense_Mutation	SNP	ENST00000231228.2	hg19	CCDS4346.1	.	.	.	.	.	.	.	.	.	.	C	8.729	0.916122	0.17907	.	.	ENSG00000113302	ENST00000231228	T	0.17691	2.26	5.85	3.61	0.41365	.	0.368200	0.31450	N	0.007630	T	0.10078	0.0247	L	0.29908	0.895	0.32343	N	0.559463	B	0.02656	0.0	B	0.04013	0.001	T	0.15694	-1.0428	10	0.18276	T	0.48	-12.2537	5.4784	0.16708	0.1765:0.6917:0.0:0.1318	.	109	P29460	IL12B_HUMAN	N	109	ENSP00000231228:D109N	ENSP00000231228:D109N	D	-	1	0	IL12B	158682679	0.972000	0.33761	0.998000	0.56505	0.967000	0.64934	0.632000	0.24583	1.132000	0.42129	0.655000	0.94253	GAT	.	.		0.418	IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252652.2	NM_002187	
IL12B	3593	hgsc.bcm.edu	37	5	158750231	158750231	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:158750231G>C	ENST00000231228.2	-	3	650	c.195C>G	c.(193-195)agC>agG	p.S65R		NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	65	Ig-like C2-type.				cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)			cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGACCTCACTGCTCTGGTCCA	0.527																																					p.S65R		Atlas-SNP	.											.	IL12B	30	.	0			c.C195G						.						96.0	86.0	89.0					5																	158750231		2203	4300	6503	SO:0001583	missense	3593	exon3			CTCACTGCTCTGG	M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.195C>G	chr5.hg19:g.158750231G>C	ENSP00000231228:p.Ser65Arg	107.0	0.0		154.0	39.0	NM_002187		Missense_Mutation	SNP	ENST00000231228.2	hg19	CCDS4346.1	.	.	.	.	.	.	.	.	.	.	G	3.733	-0.055067	0.07362	.	.	ENSG00000113302	ENST00000231228	T	0.21361	2.01	5.96	-3.56	0.04626	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.576284	0.21928	N	0.067062	T	0.10594	0.0259	L	0.37561	1.115	0.09310	N	1	B	0.17038	0.02	B	0.11329	0.006	T	0.28106	-1.0054	10	0.17832	T	0.49	-8.388	4.5596	0.12154	0.3787:0.0:0.3263:0.295	.	65	P29460	IL12B_HUMAN	R	65	ENSP00000231228:S65R	ENSP00000231228:S65R	S	-	3	2	IL12B	158682809	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-1.286000	0.02788	-0.563000	0.06078	-0.122000	0.15005	AGC	.	.		0.527	IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252652.2	NM_002187	
PRELID1	27166	hgsc.bcm.edu	37	5	176732966	176732966	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:176732966G>C	ENST00000303204.4	+	3	625	c.413G>C	c.(412-414)gGt>gCt	p.G138A	MXD3_ENST00000427908.2_3'UTR|PRELID1_ENST00000503216.1_Missense_Mutation_p.G138A|RAB24_ENST00000303251.6_5'Flank|RAB24_ENST00000393611.2_5'Flank|RAB24_ENST00000303270.6_5'Flank			Q9Y255	PRLD1_HUMAN	PRELI domain containing 1	138	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				apoptotic process (GO:0006915)|immune response (GO:0006955)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of cellular respiration (GO:1901857)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of T cell apoptotic process (GO:0070234)|regulation of membrane lipid distribution (GO:0097035)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of T cell differentiation (GO:0045580)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(1)|kidney(2)|lung(2)|prostate(1)|stomach(1)	7	all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGCTTATTTGGTGTCTCCAGA	0.582																																					p.G138A		Atlas-SNP	.											.	PRELID1	10	.	0			c.G413C						.						61.0	58.0	59.0					5																	176732966		2203	4300	6503	SO:0001583	missense	27166	exon3			TATTTGGTGTCTC	BC013748	CCDS4415.1, CCDS64328.1	5q35.3	2010-01-18			ENSG00000169230	ENSG00000169230			30255	protein-coding gene	gene with protein product	"""protein of relevant evolutionary and lymphoid interest"", ""px19-like protein"""	605733				10784606, 14640972	Standard	NM_013237		Approved	CGI-106, PX19, PRELI	uc003mfx.4	Q9Y255	OTTHUMG00000130847	ENST00000303204.4:c.413G>C	chr5.hg19:g.176732966G>C	ENSP00000302114:p.Gly138Ala	51.0	0.0		89.0	27.0	NM_013237	B2R5F7|D6RD25|Q549N2|Q9UI13|Q9UJS9	Missense_Mutation	SNP	ENST00000303204.4	hg19	CCDS4415.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.0|28.0	4.879958|4.879958	0.91740|0.91740	.|.	.|.	ENSG00000169230|ENSG00000169230	ENST00000303204;ENST00000503216|ENST00000503853	T;T|.	0.19105|.	2.17;2.17|.	4.48|4.48	4.48|4.48	0.54585|0.54585	PRELI/MSF1 (2);|.	0.050772|.	0.85682|.	N|.	0.000000|.	T|T	0.78622|0.78622	0.4312|0.4312	M|M	0.83852|0.83852	2.665|2.665	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.997;0.999|.	D;D|.	0.79108|.	0.971;0.992|.	T|T	0.81378|0.81378	-0.0960|-0.0960	10|5	0.52906|.	T|.	0.07|.	-4.9142|-4.9142	17.3571|17.3571	0.87340|0.87340	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	138;138|.	D6RD25;Q9Y255|.	.;PRLD1_HUMAN|.	A|C	138|86	ENSP00000302114:G138A;ENSP00000427097:G138A|.	ENSP00000302114:G138A|.	G|W	+|+	2|3	0|0	PRELID1|PRELID1	176665572|176665572	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.988000|0.988000	0.76386|0.76386	7.184000|7.184000	0.77705|0.77705	2.332000|2.332000	0.79248|0.79248	0.561000|0.561000	0.74099|0.74099	GGT|TGG	.	.		0.582	PRELID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253414.1	NM_013237	
SCUBE3	222663	hgsc.bcm.edu	37	6	35196493	35196493	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr6:35196493C>T	ENST00000274938.7	+	3	311	c.311C>T	c.(310-312)gCa>gTa	p.A104V	SCUBE3_ENST00000394681.1_Missense_Mutation_p.A104V	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						TTCCACCTGGCACATGACGGA	0.498																																					p.A104V		Atlas-SNP	.											.	SCUBE3	99	.	0			c.C311T						.						222.0	162.0	182.0					6																	35196493		2203	4300	6503	SO:0001583	missense	222663	exon3			ACCTGGCACATGA	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.311C>T	chr6.hg19:g.35196493C>T	ENSP00000274938:p.Ala104Val	128.0	0.0		142.0	24.0	NM_152753		Missense_Mutation	SNP	ENST00000274938.7	hg19	CCDS4800.1	.	.	.	.	.	.	.	.	.	.	C	35	5.478243	0.96291	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.95035	-3.59;-3.59	5.31	5.31	0.75309	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.94666	0.8280	L	0.28608	0.87	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.80764	0.994;0.992	D	0.94280	0.7519	10	0.45353	T	0.12	.	19.1881	0.93653	0.0:1.0:0.0:0.0	.	104;104	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	V	104	ENSP00000378174:A104V;ENSP00000274938:A104V	ENSP00000274938:A104V	A	+	2	0	SCUBE3	35304471	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.614000	0.82996	2.758000	0.94735	0.655000	0.94253	GCA	.	.		0.498	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040275.1	NM_152753	
SYNE1	23345	hgsc.bcm.edu	37	6	152560752	152560752	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr6:152560752C>G	ENST00000367255.5	-	108	20584	c.19983G>C	c.(19981-19983)caG>caC	p.Q6661H	SYNE1_ENST00000448038.1_Missense_Mutation_p.Q6590H|SYNE1_ENST00000356820.4_Missense_Mutation_p.Q1185H|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q6273H|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q6661H|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q6590H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6661					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGTATGGAACTGGGTTTCCT	0.453										HNSCC(10;0.0054)																											p.Q6661H		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G19983C						.						127.0	108.0	114.0					6																	152560752		2203	4300	6503	SO:0001583	missense	23345	exon108			ATGGAACTGGGTT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19983G>C	chr6.hg19:g.152560752C>G	ENSP00000356224:p.Gln6661His	109.0	0.0		109.0	58.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	15.48	2.845628	0.51164	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28	5.7	-0.503	0.12000	.	0.103551	0.42682	D	0.000666	T	0.43523	0.1251	M	0.72894	2.215	0.42632	D	0.99338	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.48958	-0.8988	10	0.62326	D	0.03	.	12.3799	0.55301	0.0:0.4863:0.0:0.5137	.	6661;6661;6590	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	H	6661;6590;6661;6590;6273;1185	ENSP00000356224:Q6661H;ENSP00000396024:Q6590H;ENSP00000265368:Q6661H;ENSP00000390975:Q6590H;ENSP00000341887:Q6273H;ENSP00000349276:Q1185H	ENSP00000265368:Q6661H	Q	-	3	2	SYNE1	152602445	0.002000	0.14202	0.137000	0.22149	0.948000	0.59901	-0.142000	0.10311	-0.421000	0.07416	-0.880000	0.02959	CAG	.	.		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SLC22A3	6581	hgsc.bcm.edu	37	6	160819023	160819023	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr6:160819023T>A	ENST00000275300.2	+	2	594	c.442T>A	c.(442-444)Tgt>Agt	p.C148S	SLC22A3_ENST00000392145.1_Missense_Mutation_p.C148S	NM_021977.3	NP_068812.1	O75751	S22A3_HUMAN	solute carrier family 22 (organic cation transporter), member 3	148					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|histamine uptake (GO:0051615)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|regulation of appetite (GO:0032098)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine transmembrane transporter activity (GO:0005329)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|toxin transporter activity (GO:0019534)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)	Adefovir Dipivoxil(DB00718)|Amphetamine(DB00182)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Colchicine(DB01394)|Desipramine(DB01151)|Dopamine(DB00988)|Estradiol(DB00783)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imipramine(DB00458)|Irinotecan(DB00762)|Lamivudine(DB00709)|Melphalan(DB01042)|Metformin(DB00331)|Methamphetamine(DB01577)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Phenoxybenzamine(DB00925)|Prazosin(DB00457)|Procainamide(DB01035)|Progesterone(DB00396)|Testosterone(DB00624)|Vincristine(DB00541)	TGACCTTGTCTGTGTCAATGC	0.458																																					p.C148S		Atlas-SNP	.											SLC22A3,colon,carcinoma,0,1	SLC22A3	58	.	0			c.T442A						.						248.0	223.0	232.0					6																	160819023		2203	4300	6503	SO:0001583	missense	6581	exon2			CTTGTCTGTGTCA	AF078749	CCDS5277.1	6q25.3	2013-07-18	2013-07-18		ENSG00000146477	ENSG00000146477		"""Solute carriers"""	10967	protein-coding gene	gene with protein product		604842	"""solute carrier family 22 (extraneuronal monoamine transporter), member 3"""			9632645, 9933568	Standard	NM_021977		Approved	OCT3, EMT	uc003qti.4	O75751	OTTHUMG00000015953	ENST00000275300.2:c.442T>A	chr6.hg19:g.160819023T>A	ENSP00000275300:p.Cys148Ser	68.0	0.0		69.0	19.0	NM_021977	Q5SYN6|Q9UP02	Missense_Mutation	SNP	ENST00000275300.2	hg19	CCDS5277.1	.	.	.	.	.	.	.	.	.	.	T	18.97	3.736153	0.69189	.	.	ENSG00000146477	ENST00000275300;ENST00000392145	T;T	0.81078	-1.45;-1.45	5.31	5.31	0.75309	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.90208	0.6939	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.92606	0.6095	10	0.87932	D	0	.	13.8388	0.63426	0.0:0.0:0.0:1.0	.	148	O75751	S22A3_HUMAN	S	148	ENSP00000275300:C148S;ENSP00000375989:C148S	ENSP00000275300:C148S	C	+	1	0	SLC22A3	160739013	1.000000	0.71417	0.998000	0.56505	0.540000	0.34992	5.479000	0.66813	2.008000	0.58898	0.454000	0.30748	TGT	.	.		0.458	SLC22A3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042953.1	NM_021977	
GNA12	2768	hgsc.bcm.edu	37	7	2771229	2771229	+	Silent	SNP	C	C	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr7:2771229C>G	ENST00000275364.3	-	4	894	c.732G>C	c.(730-732)ggG>ggC	p.G244G	GNA12_ENST00000407653.1_Silent_p.G168G|GNA12_ENST00000491117.1_5'UTR|GNA12_ENST00000544127.1_Silent_p.G151G|AMZ1_ENST00000489665.1_Intron|GNA12_ENST00000407904.3_Silent_p.G185G|GNA12_ENST00000396960.3_Silent_p.G96G	NM_007353.2	NP_031379.2	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein) alpha 12	244					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic digit morphogenesis (GO:0042733)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|platelet activation (GO:0030168)|regulation of cell shape (GO:0008360)|regulation of fibroblast migration (GO:0010762)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)|response to drug (GO:0042493)|Rho protein signal transduction (GO:0007266)	brush border membrane (GO:0031526)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		TGGACGTGATCCCGTCGAAGC	0.567																																					p.G244G		Atlas-SNP	.											.	GNA12	35	.	0			c.G732C						.						122.0	109.0	113.0					7																	2771229		2203	4300	6503	SO:0001819	synonymous_variant	2768	exon4			CGTGATCCCGTCG	L01694	CCDS5335.1, CCDS64584.1, CCDS64583.1	7p22.3	2006-07-08			ENSG00000146535	ENSG00000146535			4380	protein-coding gene	gene with protein product		604394				8423800, 16247467	Standard	NM_007353		Approved	gep	uc003smu.3	Q03113	OTTHUMG00000023064	ENST00000275364.3:c.732G>C	chr7.hg19:g.2771229C>G		87.0	0.0		119.0	5.0	NM_007353	A4D204|B3KXS2|B7Z3F7|Q2T9L1|Q5PPR5|Q86UM8|Q8TD71|Q9UDU9	Silent	SNP	ENST00000275364.3	hg19	CCDS5335.1																																																																																			.	.		0.567	GNA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241608.1	NM_007353	
AUTS2	26053	hgsc.bcm.edu	37	7	70255042	70255042	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr7:70255042C>T	ENST00000342771.4	+	19	3161	c.2840C>T	c.(2839-2841)cCg>cTg	p.P947L	AUTS2_ENST00000406775.2_Missense_Mutation_p.P923L	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	947										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		GTGCGGACCCCGGTGGTGGAG	0.731																																					p.P947L		Atlas-SNP	.											.	AUTS2	173	.	0			c.C2840T						.						9.0	12.0	11.0					7																	70255042		2164	4256	6420	SO:0001583	missense	26053	exon19			GGACCCCGGTGGT	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2840C>T	chr7.hg19:g.70255042C>T	ENSP00000344087:p.Pro947Leu	161.0	0.0		178.0	111.0	NM_015570	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	hg19	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.627642	0.66901	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.29397	1.57;1.57	4.28	4.28	0.50868	.	0.369254	0.31438	N	0.007652	T	0.32823	0.0842	L	0.46157	1.445	0.80722	D	1	P;D;D	0.57257	0.89;0.979;0.979	B;P;P	0.45449	0.128;0.481;0.481	T	0.10847	-1.0612	9	.	.	.	-19.4334	16.9403	0.86216	0.0:1.0:0.0:0.0	.	399;923;947	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	L	923;947	ENSP00000385263:P923L;ENSP00000344087:P947L	.	P	+	2	0	AUTS2	69892978	0.994000	0.37717	0.739000	0.30968	0.985000	0.73830	3.221000	0.51215	2.223000	0.72356	0.655000	0.94253	CCG	.	.		0.731	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
ZNF394	84124	hgsc.bcm.edu	37	7	99091247	99091247	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr7:99091247C>T	ENST00000337673.6	-	3	1794	c.1591G>A	c.(1591-1593)Ggg>Agg	p.G531R	ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron|ZNF394_ENST00000426306.2_3'UTR|ZNF394_ENST00000394177.3_5'Flank	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	531					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AATCTTTCCCCACATTCAAGA	0.453																																					p.G531R	Ovarian(24;589 697 9939 12704 40742)	Atlas-SNP	.											.	ZNF394	48	.	0			c.G1591A						.						182.0	177.0	178.0					7																	99091247		2203	4300	6503	SO:0001583	missense	84124	exon3			TTTCCCCACATTC	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.1591G>A	chr7.hg19:g.99091247C>T	ENSP00000337363:p.Gly531Arg	170.0	0.0		224.0	73.0	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	ENST00000337673.6	hg19	CCDS5666.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.369226	0.82463	.	.	ENSG00000160908	ENST00000337673	T	0.07444	3.19	3.58	3.58	0.41010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48286	D	0.000191	T	0.21841	0.0526	L	0.50847	1.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00662	-1.1621	10	0.59425	D	0.04	.	13.493	0.61407	0.0:1.0:0.0:0.0	.	531	Q53GI3	ZN394_HUMAN	R	531	ENSP00000337363:G531R	ENSP00000337363:G531R	G	-	1	0	ZNF394	98929183	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	2.862000	0.48388	2.292000	0.77174	0.655000	0.94253	GGG	.	.		0.453	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
ACTL6B	51412	hgsc.bcm.edu	37	7	100247666	100247666	+	Silent	SNP	G	G	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr7:100247666G>C	ENST00000160382.5	-	5	568	c.462C>G	c.(460-462)ctC>ctG	p.L154L		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	154					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					GATACGCGGTGAGCACAGCCG	0.592																																					p.L154L		Atlas-SNP	.											.	ACTL6B	47	.	0			c.C462G						.						171.0	126.0	141.0					7																	100247666		2203	4300	6503	SO:0001819	synonymous_variant	51412	exon5			CGCGGTGAGCACA	AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.462C>G	chr7.hg19:g.100247666G>C		38.0	0.0		41.0	27.0	NM_016188	A4D2D0|O75421	Silent	SNP	ENST00000160382.5	hg19	CCDS5702.1																																																																																			.	.		0.592	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356745.1	NM_016188	
CTTNBP2	83992	hgsc.bcm.edu	37	7	117431601	117431602	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr7:117431601_117431602GG>TC	ENST00000160373.3	-	4	1739_1740	c.1648_1649CC>GA	c.(1648-1650)CCa>GAa	p.P550E	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	550	Pro-rich.				brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GGAGAGCCCTGGCTTTTTTGGA	0.515																																					p.P550Q|p.P550A		Atlas-SNP	.											.	CTTNBP2	200	.	0			c.C1649A|c.C1648G						.																																			SO:0001583	missense	83992	exon4			AGCCCTGGCTTTT|GCCCTGGCTTTTT		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1648_1649delinsTC	chr7.hg19:g.117431601_117431602delinsTC	ENSP00000160373:p.Pro550Glu	249.0|248.0	0.0		242.0|237.0	162.0|161.0	NM_033427	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	ENST00000160373.3	hg19	CCDS5774.1																																																																																			.	.		0.515	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
AGBL3	340351	hgsc.bcm.edu	37	7	134819954	134819954	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr7:134819954C>A	ENST00000436302.2	+	17	2957	c.2704C>A	c.(2704-2706)Cag>Aag	p.Q902K	AGBL3_ENST00000458078.1_Missense_Mutation_p.Q957K|C7orf49_ENST00000459937.1_Intron|AGBL3_ENST00000435976.2_Intron	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	983						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						TAAGGATGAGCAGGCCAATAA	0.383																																					p.Q902K		Atlas-SNP	.											.	AGBL3	45	.	0			c.C2704A						.						43.0	38.0	39.0					7																	134819954		692	1590	2282	SO:0001583	missense	340351	exon17			GATGAGCAGGCCA	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.2704C>A	chr7.hg19:g.134819954C>A	ENSP00000388275:p.Gln902Lys	107.0	0.0		133.0	14.0	NM_178563	B7Z827|Q9H965	Missense_Mutation	SNP	ENST00000436302.2	hg19	CCDS47718.1	.	.	.	.	.	.	.	.	.	.	C	8.694	0.908102	0.17833	.	.	ENSG00000146856	ENST00000436302;ENST00000458078	T;T	0.08634	3.13;3.07	4.8	2.77	0.32553	.	.	.	.	.	T	0.05777	0.0151	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39272	-0.9622	9	0.32370	T	0.25	-2.851	10.1344	0.42697	0.4663:0.5337:0.0:0.0	.	902	Q8NEM8-4	.	K	902;957	ENSP00000388275:Q902K;ENSP00000395969:Q957K	ENSP00000388275:Q902K	Q	+	1	0	AGBL3	134470494	0.035000	0.19736	0.002000	0.10522	0.006000	0.05464	0.446000	0.21694	0.546000	0.28920	-0.169000	0.13324	CAG	.	.		0.383	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
RP1	6101	hgsc.bcm.edu	37	8	55534746	55534746	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr8:55534746C>T	ENST00000220676.1	+	3	833	c.685C>T	c.(685-687)Cca>Tca	p.P229S		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	229	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCCATTTAAACCAGGAAATTA	0.483																																					p.P229S	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.C685T						.						81.0	80.0	80.0					8																	55534746		2203	4300	6503	SO:0001583	missense	6101	exon3			TTTAAACCAGGAA	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.685C>T	chr8.hg19:g.55534746C>T	ENSP00000220676:p.Pro229Ser	90.0	0.0		110.0	48.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	hg19	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974338	0.53720	.	.	ENSG00000104237	ENST00000427058;ENST00000220676	D	0.86956	-2.19	5.55	4.67	0.58626	Doublecortin domain (4);	0.000000	0.64402	D	0.000018	D	0.89815	0.6824	M	0.62209	1.925	0.31032	N	0.717321	P;D	0.69078	0.926;0.997	P;P	0.59643	0.454;0.861	D	0.88702	0.3216	10	0.66056	D	0.02	.	9.3112	0.37905	0.0:0.6506:0.2773:0.072	.	39;229	E7EVW9;P56715	.;RP1_HUMAN	S	39;229	ENSP00000220676:P229S	ENSP00000220676:P229S	P	+	1	0	RP1	55697299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.982000	0.29539	1.328000	0.45358	0.655000	0.94253	CCA	.	.		0.483	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
GDAP1	54332	hgsc.bcm.edu	37	8	75274160	75274160	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr8:75274160G>A	ENST00000220822.7	+	4	606	c.526G>A	c.(526-528)Gaa>Aaa	p.E176K	GDAP1_ENST00000434412.2_Missense_Mutation_p.E108K|GDAP1_ENST00000521096.1_3'UTR	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	176	GST C-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			GAAACTTGCTGAAGAAAACCC	0.373																																					p.E176K		Atlas-SNP	.											.	GDAP1	36	.	0			c.G526A						.						122.0	113.0	116.0					8																	75274160		2203	4300	6503	SO:0001583	missense	54332	exon4			CTTGCTGAAGAAA		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.526G>A	chr8.hg19:g.75274160G>A	ENSP00000220822:p.Glu176Lys	99.0	0.0		105.0	22.0	NM_018972	A8K957|E7FJF3|E7FJF4	Missense_Mutation	SNP	ENST00000220822.7	hg19	CCDS34911.1	.	.	.	.	.	.	.	.	.	.	G	14.99	2.699585	0.48307	.	.	ENSG00000104381	ENST00000220822;ENST00000434412	D;D	0.99032	-5.34;-5.35	5.27	4.36	0.52297	Glutathione S-transferase/chloride channel, C-terminal (1);	0.117788	0.56097	D	0.000029	D	0.96577	0.8883	N	0.20986	0.625	0.33581	D	0.599901	B	0.12630	0.006	B	0.25759	0.063	D	0.96035	0.9020	10	0.24483	T	0.36	-7.7737	15.9536	0.79861	0.0:0.2176:0.7824:0.0	.	176	Q8TB36	GDAP1_HUMAN	K	176;108	ENSP00000220822:E176K;ENSP00000417006:E108K	ENSP00000220822:E176K	E	+	1	0	GDAP1	75436715	0.993000	0.37304	1.000000	0.80357	0.998000	0.95712	2.481000	0.45215	2.758000	0.94735	0.561000	0.74099	GAA	.	.		0.373	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379061.1	NM_018972	
PKHD1L1	93035	hgsc.bcm.edu	37	8	110420351	110420351	+	Silent	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr8:110420351A>G	ENST00000378402.5	+	18	1991	c.1887A>G	c.(1885-1887)aaA>aaG	p.K629K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	629					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AACAAACCAAAGGAAAACCCA	0.408										HNSCC(38;0.096)																											p.K629K		Atlas-SNP	.											.	PKHD1L1	522	.	0			c.A1887G						.						119.0	118.0	118.0					8																	110420351		1912	4123	6035	SO:0001819	synonymous_variant	93035	exon18			AACCAAAGGAAAA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1887A>G	chr8.hg19:g.110420351A>G		119.0	0.0		108.0	21.0	NM_177531	Q567P2|Q9UF27	Silent	SNP	ENST00000378402.5	hg19	CCDS47911.1																																																																																			.	.		0.408	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
MELK	9833	hgsc.bcm.edu	37	9	36643018	36643018	+	Missense_Mutation	SNP	G	G	A	rs374744271		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr9:36643018G>A	ENST00000298048.2	+	11	1043	c.859G>A	c.(859-861)Gta>Ata	p.V287I	MELK_ENST00000536860.1_Missense_Mutation_p.V239I|MELK_ENST00000545008.1_Missense_Mutation_p.V216I|MELK_ENST00000538311.1_Missense_Mutation_p.V93I|MELK_ENST00000536329.1_Missense_Mutation_p.V216I|MELK_ENST00000541717.1_Missense_Mutation_p.V287I|MELK_ENST00000536987.1_Missense_Mutation_p.V156I|MELK_ENST00000543751.1_Missense_Mutation_p.V255I	NM_014791.3	NP_055606.1	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase	287	UBA-like.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|neural precursor cell proliferation (GO:0061351)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)	cell cortex (GO:0005938)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TGATGATTGCGTAACAGAACT	0.338																																					p.V287I	Ovarian(82;980 1317 7225 14391 18624)	Atlas-SNP	.											.	MELK	74	.	0			c.G859A						.						90.0	84.0	86.0					9																	36643018		2203	4300	6503	SO:0001583	missense	9833	exon11			GATTGCGTAACAG	D79997	CCDS6606.1, CCDS59123.1, CCDS59124.1, CCDS59125.1, CCDS59126.1, CCDS59127.1, CCDS59128.1	9p13.1	2008-02-05			ENSG00000165304	ENSG00000165304			16870	protein-coding gene	gene with protein product		607025				8724849, 9136115	Standard	NM_001256689		Approved	KIAA0175	uc003zzn.4	Q14680	OTTHUMG00000019906	ENST00000298048.2:c.859G>A	chr9.hg19:g.36643018G>A	ENSP00000298048:p.Val287Ile	390.0	0.0		444.0	180.0	NM_014791	A6P3A7|A6P3A8|B1AMQ6|B7Z1E6|B7Z5M5|B7Z6Q7|B7Z6R8|B7Z6Y0|B7Z7Q1|D3DRP8|F5H0Y0|F5H2R4|F5H689|Q7L3C3	Missense_Mutation	SNP	ENST00000298048.2	hg19	CCDS6606.1	.	.	.	.	.	.	.	.	.	.	G	8.088	0.773782	0.16051	.	.	ENSG00000165304	ENST00000298048;ENST00000538311;ENST00000536987;ENST00000545008;ENST00000536860;ENST00000536329;ENST00000541717;ENST00000543751	T;T;T;T;T;T;T;T	0.24908	1.85;2.08;1.83;1.85;1.85;1.85;1.85;1.85	5.46	-3.5	0.04710	Protein kinase-like domain (1);	0.482604	0.24274	N	0.039965	T	0.11707	0.0285	L	0.27053	0.805	0.27893	N	0.939243	B;B;B;B;B;B;B	0.12013	0.0;0.004;0.0;0.001;0.005;0.002;0.0	B;B;B;B;B;B;B	0.13407	0.002;0.009;0.002;0.003;0.005;0.002;0.001	T	0.37686	-0.9695	10	0.09843	T	0.71	-0.1289	7.6197	0.28179	0.5406:0.0:0.3482:0.1112	.	207;216;239;287;216;255;287	B7Z1G6;F5H2R4;F5H0Y0;F5H689;A6P3A8;A6P3A7;Q14680	.;.;.;.;.;.;MELK_HUMAN	I	287;93;156;216;239;216;287;255	ENSP00000298048:V287I;ENSP00000438226:V93I;ENSP00000439184:V156I;ENSP00000445452:V216I;ENSP00000439792:V239I;ENSP00000443550:V216I;ENSP00000437804:V287I;ENSP00000441596:V255I	ENSP00000298048:V287I	V	+	1	0	MELK	36633018	0.001000	0.12720	0.344000	0.25628	0.984000	0.73092	-0.551000	0.06027	-0.836000	0.04229	-0.133000	0.14855	GTA	.	.		0.338	MELK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052428.3	NM_014791	
SPTAN1	6709	hgsc.bcm.edu	37	9	131329101	131329101	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr9:131329101C>T	ENST00000372731.4	+	2	192	c.82C>T	c.(82-84)Cgc>Tgc	p.R28C	SPTAN1_ENST00000358161.5_Missense_Mutation_p.R28C|SPTAN1_ENST00000372739.3_Missense_Mutation_p.R28C	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	28					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CCGATACCACCGCTTCAAGGA	0.488																																					p.R28C	NSCLC(120;833 1744 2558 35612 37579)	Atlas-SNP	.											.	SPTAN1	266	.	0			c.C82T						.						106.0	105.0	105.0					9																	131329101		2203	4300	6503	SO:0001583	missense	6709	exon2			TACCACCGCTTCA	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.82C>T	chr9.hg19:g.131329101C>T	ENSP00000361816:p.Arg28Cys	153.0	0.0		177.0	76.0	NM_003127	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	ENST00000372731.4	hg19	CCDS6905.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.625175	0.87560	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.36520	1.25;1.25;1.25	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.59183	0.2175	M	0.72479	2.2	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.998;1.0;0.999	P;D;P;D;D	0.77004	0.898;0.989;0.88;0.978;0.922	T	0.60347	-0.7281	10	0.72032	D	0.01	.	14.5719	0.68218	0.1549:0.8451:0.0:0.0	.	28;28;28;28;28	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	C	28	ENSP00000350882:R28C;ENSP00000361816:R28C;ENSP00000361824:R28C	ENSP00000350882:R28C	R	+	1	0	SPTAN1	130368922	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.801000	0.69115	2.829000	0.97493	0.655000	0.94253	CGC	.	.		0.488	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
LARP4B	23185	hgsc.bcm.edu	37	10	860959	860959	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr10:860959C>T	ENST00000316157.3	-	15	1787	c.1747G>A	c.(1747-1749)Gag>Aag	p.E583K	LARP4B_ENST00000469487.1_5'UTR	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	583					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						ACCGAGGGCTCTCTGGAGACC	0.572																																					p.E583K		Atlas-SNP	.											.	LARP4B	110	.	0			c.G1747A						.						87.0	81.0	83.0					10																	860959		2203	4300	6503	SO:0001583	missense	23185	exon16			AGGGCTCTCTGGA	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1747G>A	chr10.hg19:g.860959C>T	ENSP00000326128:p.Glu583Lys	51.0	0.0		56.0	10.0	NM_015155	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	hg19	CCDS31131.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.986474|3.986474	0.74589|0.74589	.|.	.|.	ENSG00000107929|ENSG00000107929	ENST00000316157|ENST00000448368	T|T	0.32272|0.40225	1.46|1.04	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.100150|.	0.64402|.	D|.	0.000003|.	T|T	0.46347|0.46347	0.1388|0.1388	L|L	0.34521|0.34521	1.04|1.04	0.58432|0.58432	D|D	0.999998|0.999998	P|.	0.48294|.	0.908|.	B|.	0.43950|.	0.437|.	T|T	0.13202|0.13202	-1.0518|-1.0518	10|6	0.36615|.	T|.	0.2|.	-5.2101|-5.2101	17.945|17.945	0.89036|0.89036	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	583|.	Q92615|.	LAR4B_HUMAN|.	K|K	583|148	ENSP00000326128:E583K|ENSP00000394545:R148K	ENSP00000326128:E583K|.	E|R	-|-	1|2	0|0	LARP4B|LARP4B	850959|850959	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.112000|0.112000	0.19704|0.19704	4.867000|4.867000	0.63013|0.63013	2.773000|2.773000	0.95371|0.95371	0.609000|0.609000	0.83330|0.83330	GAG|AGA	.	.		0.572	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	
DDX50	79009	hgsc.bcm.edu	37	10	70706321	70706321	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr10:70706321G>T	ENST00000373585.3	+	15	2256	c.2149G>T	c.(2149-2151)Ggt>Tgt	p.G717C		NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	717	Arg-rich.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TCGACAAGATGGTAGAAGACG	0.522																																					p.G717C		Atlas-SNP	.											.	DDX50	65	.	0			c.G2149T						.						78.0	79.0	79.0					10																	70706321		2203	4300	6503	SO:0001583	missense	79009	exon15			CAAGATGGTAGAA	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.2149G>T	chr10.hg19:g.70706321G>T	ENSP00000362687:p.Gly717Cys	97.0	0.0		73.0	19.0	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	hg19	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523119	0.44866	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.21734	1.99	4.93	2.91	0.33838	.	0.758008	0.12998	N	0.421861	T	0.13586	0.0329	N	0.08118	0	0.43283	D	0.995258	D	0.59767	0.986	P	0.48368	0.575	T	0.06499	-1.0823	10	0.48119	T	0.1	-7.767	7.3991	0.26954	0.2091:0.0:0.7909:0.0	.	717	Q9BQ39	DDX50_HUMAN	C	717;691	ENSP00000362687:G717C	ENSP00000362687:G717C	G	+	1	0	DDX50	70376327	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.841000	0.48223	1.107000	0.41642	0.467000	0.42956	GGT	.	.		0.522	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
MRPS16	51021	hgsc.bcm.edu	37	10	75010634	75010634	+	Silent	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr10:75010634T>C	ENST00000372945.3	-	3	600	c.390A>G	c.(388-390)acA>acG	p.T130T	MRPS16_ENST00000416782.2_Intron|MRPS16_ENST00000479005.1_5'UTR|DNAJC9-AS1_ENST00000513954.1_RNA|MRPS16_ENST00000372940.3_Intron|RP11-152N13.5_ENST00000457758.1_RNA|TTC18_ENST00000493787.1_5'Flank|DNAJC9-AS1_ENST00000440197.2_RNA|RP11-152N13.5_ENST00000457147.1_RNA|RP11-152N13.5_ENST00000394864.2_RNA|DNAJC9_ENST00000372950.4_5'Flank	NM_016065.3	NP_057149.1	Q9Y3D3	RT16_HUMAN	mitochondrial ribosomal protein S16	130					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(2)	4	Prostate(51;0.0119)					CCTCTGTATCTGTAGCTTCTG	0.443																																					p.T130T		Atlas-SNP	.											.	MRPS16	12	.	0			c.A390G						.						209.0	188.0	195.0					10																	75010634		2203	4300	6503	SO:0001819	synonymous_variant	51021	exon3			TGTATCTGTAGCT	AB051351	CCDS7323.1	10q22.1	2012-09-13			ENSG00000182180	ENSG00000182180		"""Mitochondrial ribosomal proteins / small subunits"""	14048	protein-coding gene	gene with protein product		609204				10810093	Standard	NM_016065		Approved	CGI-132	uc001jts.1	Q9Y3D3	OTTHUMG00000018454	ENST00000372945.3:c.390A>G	chr10.hg19:g.75010634T>C		34.0	0.0		30.0	14.0	NM_016065	B4E032|Q96Q60	Silent	SNP	ENST00000372945.3	hg19	CCDS7323.1																																																																																			.	.		0.443	MRPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048616.1		
KIAA1549L	25758	hgsc.bcm.edu	37	11	33682552	33682552	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr11:33682552G>A	ENST00000321505.4	+	19	5440	c.5260G>A	c.(5260-5262)Gca>Aca	p.A1754T	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.A1760T			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1754						integral component of membrane (GO:0016021)											GAGCCAGTGGGCAGATTCGGT	0.483																																					p.A1754T		Atlas-SNP	.											.	.	.	.	0			c.G5260A						.						27.0	31.0	30.0					11																	33682552		1912	4125	6037	SO:0001583	missense	25758	exon19			CAGTGGGCAGATT	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.5260G>A	chr11.hg19:g.33682552G>A	ENSP00000315295:p.Ala1754Thr	56.0	0.0		86.0	16.0	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	hg19	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416191	0.83449	.	.	ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000536568	.	.	.	4.97	4.97	0.65823	.	0.000000	0.56097	D	0.000021	T	0.46814	0.1412	L	0.27053	0.805	0.43029	D	0.99459	D	0.62365	0.991	P	0.50192	0.634	T	0.47548	-0.9109	9	0.49607	T	0.09	-12.8074	10.9809	0.47494	0.0862:0.0:0.9138:0.0	.	1760	E9PAT2	.	T	1754;1760;1593	.	ENSP00000315295:A1754T	A	+	1	0	C11orf41	33639128	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	6.211000	0.72182	2.308000	0.77769	0.491000	0.48974	GCA	.	.		0.483	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
VWF	7450	hgsc.bcm.edu	37	12	6230347	6230347	+	Silent	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr12:6230347C>T	ENST00000261405.5	-	3	467	c.213G>A	c.(211-213)tcG>tcA	p.S71S	VWF_ENST00000572068.1_Silent_p.S108S|VWF_ENST00000545906.1_5'Flank	NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	71	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CACCAATAATCGAGAAGGAGC	0.567																																					p.S71S		Atlas-SNP	.											.	VWF	338	.	0			c.G213A						.						62.0	61.0	61.0					12																	6230347		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon3			AATAATCGAGAAG		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.213G>A	chr12.hg19:g.6230347C>T		72.0	0.0		95.0	35.0	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.		0.567	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
KRT6A	3853	hgsc.bcm.edu	37	12	52885513	52885513	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr12:52885513A>G	ENST00000330722.6	-	2	616	c.548T>C	c.(547-549)tTc>tCc	p.F183S		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	183	Coil 1A.|Rod.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTGCTCCAGGAACCGCACCTG	0.542																																					p.F183S		Atlas-SNP	.											.	KRT6A	89	.	0			c.T548C						.						52.0	52.0	52.0					12																	52885513		2203	4300	6503	SO:0001583	missense	3853	exon2			TCCAGGAACCGCA	BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.548T>C	chr12.hg19:g.52885513A>G	ENSP00000369317:p.Phe183Ser	88.0	0.0		128.0	23.0	NM_005554	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	hg19	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	a	27.4	4.824552	0.90955	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	T	0.70282	-0.47	5.26	5.26	0.73747	Filament (1);	0.000000	0.64402	D	0.000011	D	0.85401	0.5688	M	0.87827	2.91	0.58432	D	0.999994	D	0.71674	0.998	D	0.69479	0.964	D	0.88313	0.2957	10	0.87932	D	0	.	15.478	0.75501	1.0:0.0:0.0:0.0	.	183	P02538	K2C6A_HUMAN	S	183;139	ENSP00000369317:F183S	ENSP00000369317:F183S	F	-	2	0	KRT6A	51171780	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.139000	0.94554	2.116000	0.64780	0.459000	0.35465	TTC	.	.		0.542	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
OR6C65	403282	hgsc.bcm.edu	37	12	55794617	55794617	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr12:55794617T>C	ENST00000379665.2	+	1	404	c.305T>C	c.(304-306)tTa>tCa	p.L102S		NM_001005518.1	NP_001005518.1	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C, member 65	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(3)|lung(9)	15						GTATTTTTTTTAATTCTTTTG	0.363																																					p.L102S		Atlas-SNP	.											.	OR6C65	44	.	0			c.T305C						.						79.0	86.0	84.0					12																	55794617		2203	4300	6503	SO:0001583	missense	403282	exon1			TTTTTTTAATTCT		CCDS31821.1	12q13.2	2013-09-23			ENSG00000205328	ENSG00000205328		"""GPCR / Class A : Olfactory receptors"""	31295	protein-coding gene	gene with protein product							Standard	NM_001005518		Approved		uc010spl.2	A6NJZ3	OTTHUMG00000169955	ENST00000379665.2:c.305T>C	chr12.hg19:g.55794617T>C	ENSP00000368986:p.Leu102Ser	74.0	0.0		88.0	40.0	NM_001005518	B2RNH9	Missense_Mutation	SNP	ENST00000379665.2	hg19	CCDS31821.1	.	.	.	.	.	.	.	.	.	.	T	1.469	-0.560334	0.03939	.	.	ENSG00000205328	ENST00000379665	T	0.00498	6.97	3.56	0.865	0.19074	GPCR, rhodopsin-like superfamily (1);	0.578922	0.12857	U	0.433443	T	0.00328	0.0010	N	0.16368	0.405	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.40194	-0.9576	10	0.45353	T	0.12	.	8.2769	0.31877	0.1302:0.0:0.1326:0.7372	.	102	A6NJZ3	O6C65_HUMAN	S	102	ENSP00000368986:L102S	ENSP00000368986:L102S	L	+	2	0	OR6C65	54080884	0.000000	0.05858	0.103000	0.21229	0.275000	0.26752	0.111000	0.15458	0.097000	0.17492	-2.434000	0.00213	TTA	.	.		0.363	OR6C65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406674.1		
METAP2	10988	hgsc.bcm.edu	37	12	95867968	95867968	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr12:95867968G>A	ENST00000323666.5	+	1	242	c.13G>A	c.(13-15)Gag>Aag	p.E5K	METAP2_ENST00000546753.1_Missense_Mutation_p.E5K|METAP2_ENST00000261220.9_Missense_Mutation_p.E5K|METAP2_ENST00000551840.1_Missense_Mutation_p.E5K|METAP2_ENST00000550777.1_Missense_Mutation_p.E5K	NM_006838.3	NP_006829.1			methionyl aminopeptidase 2											endometrium(3)|large_intestine(2)|lung(7)|prostate(1)	13						GGCGGGTGTGGAGGAGGTAGC	0.642																																					p.E5K		Atlas-SNP	.											.	METAP2	28	.	0			c.G13A						.						33.0	41.0	38.0					12																	95867968		2203	4299	6502	SO:0001583	missense	10988	exon1			GGTGTGGAGGAGG	U13261	CCDS9052.1	12q22	2014-09-04			ENSG00000111142		3.4.11.18		16672	protein-coding gene	gene with protein product	"""Peptidase M"""	601870				7644482, 8858118	Standard	NM_006838		Approved	MNPEP, p67, MAP2	uc001tec.3	P50579	OTTHUMG00000170280	ENST00000323666.5:c.13G>A	chr12.hg19:g.95867968G>A	ENSP00000325312:p.Glu5Lys	186.0	0.0		196.0	80.0	NM_006838		Missense_Mutation	SNP	ENST00000323666.5	hg19	CCDS9052.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113422	0.77210	.	.	ENSG00000111142	ENST00000323666;ENST00000546753;ENST00000261220;ENST00000549502;ENST00000553151;ENST00000550777;ENST00000551840	.	.	.	5.19	5.19	0.71726	.	0.616940	0.15964	N	0.236096	T	0.52709	0.1751	N	0.08118	0	0.38205	D	0.940312	B;B;B;D;B	0.56035	0.005;0.149;0.116;0.974;0.079	B;B;B;D;B	0.67725	0.006;0.08;0.031;0.953;0.043	T	0.60052	-0.7338	9	0.46703	T	0.11	1.1894	14.6031	0.68456	0.0:0.0:1.0:0.0	.	5;5;5;5;5	B4DUX5;F8VRR3;G3XA91;F8VQZ7;P50579	.;.;.;.;AMPM2_HUMAN	K	5	.	ENSP00000261220:E5K	E	+	1	0	METAP2	94392099	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.102000	0.50291	2.583000	0.87209	0.561000	0.74099	GAG	.	.		0.642	METAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408296.1	NM_006838	
GRK1	6011	hgsc.bcm.edu	37	13	114322307	114322307	+	Silent	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr13:114322307G>A	ENST00000335678.6	+	1	838	c.606G>A	c.(604-606)ggG>ggA	p.G202G		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	202	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			GGGGCTTCGGGGAGGTGTCGG	0.597																																					p.G202G		Atlas-SNP	.											.	GRK1	41	.	0			c.G606A						.						19.0	21.0	20.0					13																	114322307		2004	4179	6183	SO:0001819	synonymous_variant	6011	exon1			CTTCGGGGAGGTG			13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.606G>A	chr13.hg19:g.114322307G>A		159.0	0.0		232.0	63.0	NM_002929	Q53X14	Silent	SNP	ENST00000335678.6	hg19																																																																																				.	.		0.597	GRK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470655.1	NM_002929	
FAM179B	23116	hgsc.bcm.edu	37	14	45475303	45475303	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr14:45475303G>T	ENST00000361577.3	+	5	2951	c.2737G>T	c.(2737-2739)Gtt>Ttt	p.V913F	KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000361462.2_Missense_Mutation_p.V913F|FAM179B_ENST00000382233.2_Missense_Mutation_p.V913F	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	913										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						GACAAAGCCTGTTCCTCCCAT	0.453																																					p.V913F		Atlas-SNP	.											.	FAM179B	115	.	0			c.G2737T						.						130.0	129.0	129.0					14																	45475303		2203	4300	6503	SO:0001583	missense	23116	exon5			AAGCCTGTTCCTC	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2737G>T	chr14.hg19:g.45475303G>T	ENSP00000355045:p.Val913Phe	116.0	0.0		146.0	28.0	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	hg19	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.276104	0.59649	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	T;T;T	0.42513	2.38;2.36;0.97	5.39	5.39	0.77823	Armadillo-type fold (1);	0.198337	0.32488	N	0.006035	T	0.37461	0.1004	L	0.29908	0.895	0.45883	D	0.998731	B;B;B	0.23249	0.01;0.01;0.082	B;B;B	0.25140	0.007;0.007;0.058	T	0.20405	-1.0276	10	0.66056	D	0.02	-9.8358	18.8028	0.92025	0.0:0.0:1.0:0.0	.	913;913;913	G3XAE9;Q9Y4F4;Q9Y4F4-2	.;F179B_HUMAN;.	F	913	ENSP00000355045:V913F;ENSP00000354917:V913F;ENSP00000371668:V913F	ENSP00000354917:V913F	V	+	1	0	FAM179B	44545053	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	5.052000	0.64263	2.538000	0.85594	0.558000	0.71614	GTT	.	.		0.453	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
FAM179B	23116	hgsc.bcm.edu	37	14	45475307	45475307	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr14:45475307C>T	ENST00000361577.3	+	5	2955	c.2741C>T	c.(2740-2742)cCt>cTt	p.P914L	KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000361462.2_Missense_Mutation_p.P914L|FAM179B_ENST00000382233.2_Missense_Mutation_p.P914L	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	914										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AAGCCTGTTCCTCCCATACCA	0.448																																					p.P914L		Atlas-SNP	.											.	FAM179B	115	.	0			c.C2741T						.						129.0	129.0	129.0					14																	45475307		2203	4300	6503	SO:0001583	missense	23116	exon5			CTGTTCCTCCCAT	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2741C>T	chr14.hg19:g.45475307C>T	ENSP00000355045:p.Pro914Leu	119.0	0.0		148.0	28.0	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	hg19	CCDS9681.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.4|26.4	4.737453|4.737453	0.89482|0.89482	.|.	.|.	ENSG00000198718|ENSG00000198718	ENST00000557250|ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	.|T;T;T	.|0.38077	.|2.32;2.29;1.16	5.39|5.39	5.39|5.39	0.77823|0.77823	.|Armadillo-type fold (1);	.|0.170595	.|0.40728	.|N	.|0.001040	T|T	0.50051|0.50051	0.1593|0.1593	L|L	0.27053|0.27053	0.805|0.805	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D	.|0.89917	.|0.974;0.974;1.0	.|P;P;D	.|0.91635	.|0.731;0.731;0.999	T|T	0.53968|0.53968	-0.8363|-0.8363	5|10	.|0.87932	.|D	.|0	-16.3962|-16.3962	18.8028|18.8028	0.92025|0.92025	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|914;914;914	.|G3XAE9;Q9Y4F4;Q9Y4F4-2	.|.;F179B_HUMAN;.	F|L	106|914	.|ENSP00000355045:P914L;ENSP00000354917:P914L;ENSP00000371668:P914L	.|ENSP00000354917:P914L	L|P	+|+	1|2	0|0	FAM179B|FAM179B	44545057|44545057	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.982000|0.982000	0.71751|0.71751	5.371000|5.371000	0.66150|0.66150	2.538000|2.538000	0.85594|0.85594	0.558000|0.558000	0.71614|0.71614	CTC|CCT	.	.		0.448	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
PNMA1	9240	hgsc.bcm.edu	37	14	74180325	74180325	+	Silent	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr14:74180325C>T	ENST00000316836.3	-	1	803	c.18G>A	c.(16-18)ttG>ttA	p.L6L		NM_006029.4	NP_006020.4	Q8ND90	PNMA1_HUMAN	paraneoplastic Ma antigen 1	6					inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleolus (GO:0005730)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|urinary_tract(2)	13				BRCA - Breast invasive adenocarcinoma(234;0.00331)|KIRC - Kidney renal clear cell carcinoma(182;0.0797)		accagtcttccaacagtgtca	0.522																																					p.L6L		Atlas-SNP	.											.	PNMA1	29	.	0			c.G18A						.						86.0	94.0	91.0					14																	74180325		2203	4300	6503	SO:0001819	synonymous_variant	9240	exon1			GTCTTCCAACAGT	AF037364	CCDS9818.1	14q24.3	2012-02-09	2012-02-09		ENSG00000176903	ENSG00000176903		"""Paraneoplastic Ma antigens"""	9158	protein-coding gene	gene with protein product		604010	"""paraneoplastic antigen MA1"""			10050892	Standard	NM_006029		Approved	MA1	uc001xor.1	Q8ND90	OTTHUMG00000169183	ENST00000316836.3:c.18G>A	chr14.hg19:g.74180325C>T		74.0	0.0		92.0	38.0	NM_006029	A8K4L5|O95144|Q8NG07	Silent	SNP	ENST00000316836.3	hg19	CCDS9818.1																																																																																			.	.		0.522	PNMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402774.1	NM_006029	
AHNAK2	113146	hgsc.bcm.edu	37	14	105413228	105413228	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr14:105413228C>G	ENST00000333244.5	-	7	8679	c.8560G>C	c.(8560-8562)Ggg>Cgg	p.G2854R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2854						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TTAAGATCCCCTTGCATGGAG	0.632																																					p.G2854R		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G8560C						.						133.0	152.0	146.0					14																	105413228		1970	4154	6124	SO:0001583	missense	113146	exon7			GATCCCCTTGCAT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8560G>C	chr14.hg19:g.105413228C>G	ENSP00000353114:p.Gly2854Arg	133.0	0.0		168.0	30.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	13.86	2.363340	0.41902	.	.	ENSG00000185567	ENST00000333244	T	0.03358	3.96	3.07	3.07	0.35406	.	.	.	.	.	T	0.09024	0.0223	M	0.93197	3.39	0.09310	N	1	P	0.41784	0.762	B	0.39379	0.298	T	0.25779	-1.0122	9	0.14252	T	0.57	.	8.136	0.31054	0.0:0.8829:0.0:0.1171	.	2854	Q8IVF2	AHNK2_HUMAN	R	2854	ENSP00000353114:G2854R	ENSP00000353114:G2854R	G	-	1	0	AHNAK2	104484273	.	.	0.001000	0.08648	0.010000	0.07245	.	.	1.569000	0.49696	0.306000	0.20318	GGG	.	.		0.632	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
TLN2	83660	hgsc.bcm.edu	37	15	62948248	62948248	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr15:62948248C>T	ENST00000561311.1	+	7	853	c.623C>T	c.(622-624)tCg>tTg	p.S208L	TLN2_ENST00000306829.6_Missense_Mutation_p.S208L			Q9Y4G6	TLN2_HUMAN	talin 2	208	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AATGTAGATTCGAGAGACCCC	0.458																																					p.S208L		Atlas-SNP	.											TLN2,NS,carcinoma,0,3	TLN2	253	.	0			c.C623T						.						115.0	98.0	104.0					15																	62948248		2203	4300	6503	SO:0001583	missense	83660	exon5			TAGATTCGAGAGA	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.623C>T	chr15.hg19:g.62948248C>T	ENSP00000453508:p.Ser208Leu	91.0	0.0		106.0	41.0	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	hg19	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	C	33	5.289973	0.95546	.	.	ENSG00000171914	ENST00000306829	T	0.75154	-0.91	5.47	5.47	0.80525	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.87233	0.6126	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87633	0.2517	10	0.56958	D	0.05	-9.4264	18.6826	0.91551	0.0:1.0:0.0:0.0	.	208	Q9Y4G6	TLN2_HUMAN	L	208	ENSP00000303476:S208L	ENSP00000303476:S208L	S	+	2	0	TLN2	60735540	1.000000	0.71417	0.876000	0.34364	0.913000	0.54294	7.768000	0.85345	2.723000	0.93209	0.655000	0.94253	TCG	.	.		0.458	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
HERC1	8925	hgsc.bcm.edu	37	15	64048942	64048942	+	Missense_Mutation	SNP	T	T	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr15:64048942T>G	ENST00000443617.2	-	5	1314	c.1227A>C	c.(1225-1227)gaA>gaC	p.E409D		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	409					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ACTGTCCAGCTTCAATCTATA	0.388																																					p.E409D		Atlas-SNP	.											.	HERC1	624	.	0			c.A1227C						.						16.0	15.0	15.0					15																	64048942		1822	4083	5905	SO:0001583	missense	8925	exon5			TCCAGCTTCAATC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.1227A>C	chr15.hg19:g.64048942T>G	ENSP00000390158:p.Glu409Asp	32.0	0.0		57.0	22.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185179	0.78677	.	.	ENSG00000103657	ENST00000443617	D	0.85013	-1.93	5.38	5.38	0.77491	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	U	0.000000	D	0.89339	0.6687	L	0.51422	1.61	0.58432	D	0.999999	D;D	0.76494	0.996;0.999	D;D	0.80764	0.99;0.994	D	0.86906	0.2057	10	0.22706	T	0.39	.	15.6888	0.77434	0.0:0.0:0.0:1.0	.	409;409	C9JUT5;Q15751	.;HERC1_HUMAN	D	409	ENSP00000390158:E409D	ENSP00000390158:E409D	E	-	3	2	HERC1	61835995	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.305000	0.51873	2.167000	0.68274	0.454000	0.30748	GAA	.	.		0.388	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
MAN2A2	4122	hgsc.bcm.edu	37	15	91448887	91448887	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr15:91448887G>T	ENST00000559717.1	+	4	928	c.469G>T	c.(469-471)Gac>Tac	p.D157Y	MAN2A2_ENST00000360468.3_Missense_Mutation_p.D157Y|MAN2A2_ENST00000431652.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	157					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CATCTCCTACGACCCGCACGA	0.597																																					p.D157Y		Atlas-SNP	.											.	MAN2A2	99	.	0			c.G469T						.						98.0	71.0	80.0					15																	91448887		2198	4298	6496	SO:0001583	missense	4122	exon3			TCCTACGACCCGC	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.469G>T	chr15.hg19:g.91448887G>T	ENSP00000452948:p.Asp157Tyr	110.0	0.0		106.0	22.0	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	hg19	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.495236	0.44352	.	.	ENSG00000196547	ENST00000360468	T	0.25414	1.8	4.71	0.573	0.17363	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (1);	0.504438	0.24379	N	0.039036	T	0.29061	0.0722	L	0.46157	1.445	0.80722	D	1	P;B	0.43392	0.805;0.273	P;P	0.49887	0.625;0.524	T	0.03566	-1.1024	10	0.72032	D	0.01	-8.4821	8.8564	0.35231	0.5095:0.0:0.4905:0.0	.	157;157	P49641-1;P49641	.;MA2A2_HUMAN	Y	157	ENSP00000353655:D157Y	ENSP00000353655:D157Y	D	+	1	0	MAN2A2	89249891	0.983000	0.35010	0.980000	0.43619	0.507000	0.33981	1.970000	0.40520	0.002000	0.14630	-0.330000	0.08379	GAC	.	.		0.597	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
PRR35	146325	hgsc.bcm.edu	37	16	613785	613785	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr16:613785C>T	ENST00000409413.3	+	2	770	c.491C>T	c.(490-492)cCg>cTg	p.P164L		NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		164	Pro-rich.									central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						TCGTGGAAGCCGGGGATGGGA	0.736																																					p.P164L		Atlas-SNP	.											.	C16orf11	27	.	0			c.C491T						.						4.0	6.0	5.0					16																	613785		1789	3951	5740	SO:0001583	missense	146325	exon2			GGAAGCCGGGGAT																												ENST00000409413.3:c.491C>T	chr16.hg19:g.613785C>T	ENSP00000386499:p.Pro164Leu	65.0	0.0		70.0	18.0	NM_145270	B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	ENST00000409413.3	hg19	CCDS45365.1	.	.	.	.	.	.	.	.	.	.	C	0.998	-0.691966	0.03303	.	.	ENSG00000161992	ENST00000409413	T	0.08546	3.08	4.96	-2.6	0.06190	.	0.467553	0.18396	N	0.142490	T	0.02380	0.0073	N	0.04959	-0.14	0.21020	N	0.999809	B	0.06786	0.001	B	0.04013	0.001	T	0.43147	-0.9409	10	0.02654	T	1	.	5.1659	0.15084	0.2177:0.3768:0.0:0.4055	.	164	P0CG20	CP011_HUMAN	L	164	ENSP00000386499:P164L	ENSP00000386499:P164L	P	+	2	0	C16orf11	553786	0.004000	0.15560	0.017000	0.16124	0.005000	0.04900	0.332000	0.19751	-0.364000	0.08088	-1.119000	0.02030	CCG	.	.		0.736	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333913.1		
TBX6	6911	hgsc.bcm.edu	37	16	30100136	30100136	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr16:30100136A>C	ENST00000395224.2	-	5	705	c.646T>G	c.(646-648)Tac>Gac	p.Y216D	TBX6_ENST00000279386.2_Missense_Mutation_p.Y216D|TBX6_ENST00000553607.1_Missense_Mutation_p.Y216D	NM_004608.3	NP_004599.2	O95947	TBX6_HUMAN	T-box 6	216					anatomical structure morphogenesis (GO:0009653)|cell fate specification (GO:0001708)|mesoderm development (GO:0007498)|mesoderm formation (GO:0001707)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	9						CGGGGTTGGTACTTGTGCATG	0.632																																					p.Y216D		Atlas-SNP	.											.	TBX6	29	.	0			c.T646G						.						91.0	99.0	96.0					16																	30100136		2197	4300	6497	SO:0001583	missense	6911	exon5			GTTGGTACTTGTG	AJ007989	CCDS10670.1	16p11.2	2008-02-05			ENSG00000149922	ENSG00000149922		"""T-boxes"""	11605	protein-coding gene	gene with protein product		602427				9888994, 9933572	Standard	NM_004608		Approved		uc010veh.2	O95947	OTTHUMG00000132115	ENST00000395224.2:c.646T>G	chr16.hg19:g.30100136A>C	ENSP00000378650:p.Tyr216Asp	97.0	0.0		151.0	62.0	NM_004608	Q8TAS4|Q9HA44	Missense_Mutation	SNP	ENST00000395224.2	hg19	CCDS10670.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.582649	0.86748	.	.	ENSG00000149922	ENST00000395224;ENST00000279386;ENST00000553607	D;D;D	0.96136	-3.92;-3.92;-3.92	6.04	6.04	0.98038	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.98507	0.9502	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99655	1.0992	10	0.87932	D	0	.	15.5711	0.76337	1.0:0.0:0.0:0.0	.	216;216	O95947;Q9HA44	TBX6_HUMAN;.	D	216	ENSP00000378650:Y216D;ENSP00000279386:Y216D;ENSP00000461223:Y216D	ENSP00000279386:Y216D	Y	-	1	0	TBX6	30007637	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.281000	0.95811	2.317000	0.78254	0.460000	0.39030	TAC	.	.		0.632	TBX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255157.2	NM_004608, NM_080758	
PHKB	5257	hgsc.bcm.edu	37	16	47699867	47699867	+	Intron	SNP	G	G	A	rs527426323		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr16:47699867G>A	ENST00000323584.5	+	25	2451				PHKB_ENST00000455779.1_Intron|PHKB_ENST00000299167.8_Missense_Mutation_p.R784H|PHKB_ENST00000566044.1_Missense_Mutation_p.R777H	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta						carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GTTGTACGCCGTGCAGCAAGT	0.458													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18021	0.0		0.0	False		,,,				2504	0.0				p.R777H		Atlas-SNP	.											.	PHKB	298	.	0			c.G2330A						.						91.0	90.0	90.0					16																	47699867		1895	4118	6013	SO:0001627	intron_variant	5257	exon26			TACGCCGTGCAGC		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.2427+981G>A	chr16.hg19:g.47699867G>A		88.0	0.0		102.0	13.0	NM_001031835	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	hg19	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794128	0.31777	.	.	ENSG00000102893	ENST00000299167	.	.	.	5.21	-2.05	0.07321	.	.	.	.	.	T	0.22627	0.0546	N	0.10874	0.06	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.13415	-1.0510	8	0.18710	T	0.47	.	1.4003	0.02269	0.3662:0.0968:0.3418:0.1953	.	25;777	B3KVX5;Q93100-4	.;.	H	777	.	ENSP00000299167:R777H	R	+	2	0	PHKB	46257368	0.998000	0.40836	0.993000	0.49108	0.996000	0.88848	0.554000	0.23407	-0.116000	0.11893	0.650000	0.86243	CGT	.	.		0.458	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000430413.1		
MMP2	4313	hgsc.bcm.edu	37	16	55522498	55522498	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr16:55522498G>T	ENST00000219070.4	+	6	1385	c.876G>T	c.(874-876)aaG>aaT	p.K292N	MMP2_ENST00000437642.2_Missense_Mutation_p.K242N|MMP2_ENST00000570308.1_Missense_Mutation_p.K216N|MMP2_ENST00000543485.1_Missense_Mutation_p.K216N	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	292	Collagen-binding.|Fibronectin type-II 2. {ECO:0000255|PROSITE-ProRule:PRU00479}.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	AGCCCTGCAAGTTTCCATTCC	0.612																																					p.K292N		Atlas-SNP	.											.	MMP2	119	.	0			c.G876T						.						81.0	66.0	71.0					16																	55522498		2198	4300	6498	SO:0001583	missense	4313	exon6			CTGCAAGTTTCCA		CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.876G>T	chr16.hg19:g.55522498G>T	ENSP00000219070:p.Lys292Asn	64.0	0.0		91.0	40.0	NM_004530	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Missense_Mutation	SNP	ENST00000219070.4	hg19	CCDS10752.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696211	0.30052	.	.	ENSG00000087245	ENST00000219070;ENST00000543485;ENST00000437642	T;T;T	0.51071	0.72;0.72;0.72	4.93	2.93	0.34026	Peptidase M10, metallopeptidase (1);Fibronectin, type II, collagen-binding (5);Kringle-like fold (1);Peptidase, metallopeptidase (1);	0.000000	0.85682	D	0.000000	T	0.56992	0.2023	L	0.53561	1.675	0.80722	D	1	D;D	0.89917	0.989;1.0	P;D	0.75484	0.907;0.986	T	0.52185	-0.8609	10	0.19147	T	0.46	.	9.8941	0.41306	0.2851:0.0:0.7149:0.0	.	242;292	E9PE45;P08253	.;MMP2_HUMAN	N	292;216;242	ENSP00000219070:K292N;ENSP00000444143:K216N;ENSP00000394237:K242N	ENSP00000219070:K292N	K	+	3	2	MMP2	54079999	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	2.205000	0.42770	1.204000	0.43247	-0.374000	0.07098	AAG	.	.		0.612	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256913.3		
SLC12A4	6560	hgsc.bcm.edu	37	16	67985897	67985897	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr16:67985897C>A	ENST00000316341.3	-	8	1101	c.961G>T	c.(961-963)Gac>Tac	p.D321Y	SLC12A4_ENST00000572037.1_Missense_Mutation_p.D273Y|SLC12A4_ENST00000537830.2_Missense_Mutation_p.D315Y|SLC12A4_ENST00000541864.2_Missense_Mutation_p.D290Y|SLC12A4_ENST00000422611.2_Missense_Mutation_p.D323Y|SLC12A4_ENST00000572010.1_5'Flank|SLC12A4_ENST00000576616.1_Missense_Mutation_p.D321Y|SLC12A4_ENST00000338335.3_Missense_Mutation_p.D321Y	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	321					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCACAGATGTCAAACTGGTCC	0.587																																					p.D323Y		Atlas-SNP	.											SLC12A4,bladder,carcinoma,0,1	SLC12A4	81	.	0			c.G967T						.						100.0	70.0	80.0					16																	67985897		2198	4300	6498	SO:0001583	missense	6560	exon7			AGATGTCAAACTG		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.961G>T	chr16.hg19:g.67985897C>A	ENSP00000318557:p.Asp321Tyr	89.0	0.0		113.0	46.0	NM_001145962	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	hg19	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.113518	0.77210	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28	5.0	5.0	0.66597	.	0.043142	0.85682	D	0.000000	D	0.83871	0.5348	M	0.86953	2.85	0.80722	D	1	D;P;D;P;B;B	0.63046	0.991;0.711;0.992;0.905;0.079;0.021	P;B;D;P;B;B	0.67548	0.847;0.287;0.952;0.583;0.094;0.015	D	0.86387	0.1733	10	0.59425	D	0.04	.	18.6574	0.91459	0.0:1.0:0.0:0.0	.	323;321;290;315;321;321	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	Y	323;290;315;321;321	ENSP00000395983:D323Y;ENSP00000438334:D290Y;ENSP00000445962:D315Y;ENSP00000343374:D321Y;ENSP00000318557:D321Y	ENSP00000318557:D321Y	D	-	1	0	SLC12A4	66543398	1.000000	0.71417	0.995000	0.50966	0.805000	0.45488	6.030000	0.70903	2.499000	0.84300	0.467000	0.42956	GAC	.	.		0.587	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
HAS3	3038	hgsc.bcm.edu	37	16	69143870	69143870	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr16:69143870G>A	ENST00000306560.1	+	2	728	c.572G>A	c.(571-573)gGa>gAa	p.G191E	HAS3_ENST00000569188.1_Missense_Mutation_p.G191E|HAS3_ENST00000219322.3_Missense_Mutation_p.G191E	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	191					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		CAGAAGTGGGGAGGCAAGCGC	0.647																																					p.G191E		Atlas-SNP	.											.	HAS3	61	.	0			c.G572A						.						79.0	63.0	68.0					16																	69143870		2198	4300	6498	SO:0001583	missense	3038	exon2			AGTGGGGAGGCAA	BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.572G>A	chr16.hg19:g.69143870G>A	ENSP00000304440:p.Gly191Glu	73.0	0.0		93.0	40.0	NM_138612	A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	ENST00000306560.1	hg19	CCDS10871.1	.	.	.	.	.	.	.	.	.	.	G	32	5.126065	0.94429	.	.	ENSG00000103044	ENST00000219322;ENST00000306560	D;T	0.85258	-1.96;0.22	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.94241	0.8151	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.983;1.0	D	0.95038	0.8175	10	0.72032	D	0.01	-8.2812	18.9466	0.92625	0.0:0.0:1.0:0.0	.	191;191	O00219;O00219-2	HAS3_HUMAN;.	E	191	ENSP00000219322:G191E;ENSP00000304440:G191E	ENSP00000219322:G191E	G	+	2	0	HAS3	67701371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.723000	0.98772	2.593000	0.87608	0.561000	0.74099	GGA	.	.		0.647	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268898.2	NM_138612	
ATAD5	79915	hgsc.bcm.edu	37	17	29187555	29187555	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr17:29187555G>T	ENST00000321990.4	+	10	3439	c.3061G>T	c.(3061-3063)Gag>Tag	p.E1021*	CTD-2349P21.11_ENST00000580873.1_RNA|RNU6-298P_ENST00000390888.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1021					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAAAAATCTGGAGAAGACCAA	0.348																																					p.E1021X		Atlas-SNP	.											.	ATAD5	150	.	0			c.G3061T						.						60.0	62.0	61.0					17																	29187555		2203	4299	6502	SO:0001587	stop_gained	79915	exon10			AATCTGGAGAAGA		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3061G>T	chr17.hg19:g.29187555G>T	ENSP00000313171:p.Glu1021*	439.0	0.0		614.0	240.0	NM_024857	Q05DH0|Q69YR6|Q9H9I1	Nonsense_Mutation	SNP	ENST00000321990.4	hg19	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	37	6.623947	0.97714	.	.	ENSG00000176208	ENST00000321990	.	.	.	4.37	-0.165	0.13355	.	1.095080	0.06861	N	0.799166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	5.0443	0.14475	0.321:0.1811:0.4979:0.0	.	.	.	.	X	1021	.	ENSP00000313171:E1021X	E	+	1	0	ATAD5	26211681	0.755000	0.28372	0.001000	0.08648	0.026000	0.11368	0.142000	0.16096	-0.014000	0.14175	0.585000	0.79938	GAG	.	.		0.348	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
COIL	8161	hgsc.bcm.edu	37	17	55027539	55027539	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr17:55027539G>A	ENST00000240316.4	-	2	1098	c.1064C>T	c.(1063-1065)cCa>cTa	p.P355L		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	355						Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					TGACAGCCCTGGGCCTGGACG	0.572																																					p.P355L		Atlas-SNP	.											.	COIL	49	.	0			c.C1064T						.						67.0	67.0	67.0					17																	55027539		2203	4300	6503	SO:0001583	missense	8161	exon2			AGCCCTGGGCCTG	U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.1064C>T	chr17.hg19:g.55027539G>A	ENSP00000240316:p.Pro355Leu	47.0	0.0		61.0	18.0	NM_004645	B2R931	Missense_Mutation	SNP	ENST00000240316.4	hg19	CCDS11592.1	.	.	.	.	.	.	.	.	.	.	G	1.678	-0.507165	0.04231	.	.	ENSG00000121058	ENST00000240316	.	.	.	5.8	2.74	0.32292	.	0.941871	0.09014	N	0.861077	T	0.41766	0.1173	L	0.60455	1.87	0.09310	N	0.999999	B	0.25390	0.125	B	0.23419	0.046	T	0.32981	-0.9886	9	0.21540	T	0.41	-2.1439	7.1941	0.25843	0.1406:0.0:0.7215:0.1379	.	355	P38432	COIL_HUMAN	L	355	.	ENSP00000240316:P355L	P	-	2	0	COIL	52382538	0.062000	0.20869	0.001000	0.08648	0.037000	0.13140	2.034000	0.41145	0.381000	0.24851	0.552000	0.68991	CCA	.	.		0.572	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440618.1		
TEX2	55852	hgsc.bcm.edu	37	17	62238222	62238222	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr17:62238222T>C	ENST00000583097.1	-	8	2915	c.2743A>G	c.(2743-2745)Acc>Gcc	p.T915A	TEX2_ENST00000258991.3_Missense_Mutation_p.T922A|TEX2_ENST00000584379.1_Missense_Mutation_p.T915A			Q8IWB9	TEX2_HUMAN	testis expressed 2	915					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CCTAGTTTGGTCAAATTCATT	0.413																																					p.T922A		Atlas-SNP	.											.	TEX2	89	.	0			c.A2764G						.						147.0	152.0	150.0					17																	62238222		2203	4300	6503	SO:0001583	missense	55852	exon8			GTTTGGTCAAATT	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2743A>G	chr17.hg19:g.62238222T>C	ENSP00000462665:p.Thr915Ala	117.0	0.0		115.0	41.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.35	1.910663	0.33721	.	.	ENSG00000136478	ENST00000258991	T	0.41400	1.0	5.84	5.84	0.93424	.	0.099080	0.64402	D	0.000001	T	0.33818	0.0876	L	0.33485	1.01	0.50313	D	0.999862	B;B	0.19706	0.038;0.023	B;B	0.26517	0.07;0.032	T	0.12400	-1.0549	10	0.35671	T	0.21	-19.7321	11.3176	0.49401	0.1357:0.0:0.0:0.8643	.	922;915	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	A	922	ENSP00000258991:T922A	ENSP00000258991:T922A	T	-	1	0	TEX2	59591954	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.025000	0.49681	2.234000	0.73211	0.459000	0.35465	ACC	.	.		0.413	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
HELZ	9931	hgsc.bcm.edu	37	17	65103749	65103749	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr17:65103749C>A	ENST00000358691.5	-	31	4943	c.4777G>T	c.(4777-4779)Gaa>Taa	p.E1593*	HELZ_ENST00000580168.1_Nonsense_Mutation_p.E1594*	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1593						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TCAGCTAGTTCCCGTGTTTCA	0.423																																					p.E1593X		Atlas-SNP	.											.	HELZ	160	.	0			c.G4777T						.						101.0	97.0	98.0					17																	65103749		1927	4128	6055	SO:0001587	stop_gained	9931	exon31			CTAGTTCCCGTGT	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.4777G>T	chr17.hg19:g.65103749C>A	ENSP00000351524:p.Glu1593*	163.0	0.0		187.0	84.0	NM_014877	I6L9H4	Nonsense_Mutation	SNP	ENST00000358691.5	hg19	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	C	45	11.662574	0.99588	.	.	ENSG00000198265	ENST00000358691	.	.	.	5.08	5.08	0.68730	.	0.161243	0.52532	D	0.000077	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-14.7503	18.4879	0.90836	0.0:1.0:0.0:0.0	.	.	.	.	X	1593	.	ENSP00000351524:E1593X	E	-	1	0	HELZ	62534211	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.784000	0.68990	2.368000	0.80403	0.478000	0.44815	GAA	.	.		0.423	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
JMJD6	23210	hgsc.bcm.edu	37	17	74721921	74721921	+	Missense_Mutation	SNP	G	G	A	rs367636744		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr17:74721921G>A	ENST00000397625.4	-	2	260	c.146C>T	c.(145-147)gCa>gTa	p.A49V	JMJD6_ENST00000445478.2_Missense_Mutation_p.A49V|METTL23_ENST00000590964.1_5'Flank|METTL23_ENST00000586752.1_5'Flank|METTL23_ENST00000588302.1_5'Flank|METTL23_ENST00000586738.1_5'Flank|METTL23_ENST00000341249.6_5'Flank|METTL23_ENST00000586200.1_5'Flank|METTL23_ENST00000588783.1_5'Flank|METTL23_ENST00000589977.1_5'Flank|METTL23_ENST00000591571.1_5'Flank|METTL23_ENST00000588822.1_5'Flank|JMJD6_ENST00000585429.1_Missense_Mutation_p.A49V	NM_015167.2	NP_055982.2	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6	49					cell surface receptor signaling pathway (GO:0007166)|erythrocyte development (GO:0048821)|heart development (GO:0007507)|histone H3-R2 demethylation (GO:0070078)|histone H4-R3 demethylation (GO:0070079)|kidney development (GO:0001822)|lung development (GO:0030324)|macrophage activation (GO:0042116)|mRNA processing (GO:0006397)|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine (GO:0018395)|recognition of apoptotic cell (GO:0043654)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|RNA splicing (GO:0008380)|sprouting angiogenesis (GO:0002040)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone demethylase activity (H3-R2 specific) (GO:0033746)|histone demethylase activity (H4-R3 specific) (GO:0033749)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)|peptidyl-lysine 5-dioxygenase activity (GO:0070815)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			endometrium(2)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|skin(2)	16						TAAAGCATCTGCCCTTTCCAC	0.468																																					p.A49V		Atlas-SNP	.											.	JMJD6	57	.	0			c.C146T						.						66.0	61.0	63.0					17																	74721921		1852	4096	5948	SO:0001583	missense	23210	exon2			GCATCTGCCCTTT	AB011157	CCDS42383.1, CCDS42384.1	17q25	2007-11-20	2007-02-16	2007-02-16	ENSG00000070495	ENSG00000070495			19355	protein-coding gene	gene with protein product		604914	"""phosphatidylserine receptor"""	PTDSR		11877474	Standard	NM_015167		Approved	PTDSR1, KIAA0585	uc002jsn.1	Q6NYC1	OTTHUMG00000169267	ENST00000397625.4:c.146C>T	chr17.hg19:g.74721921G>A	ENSP00000380750:p.Ala49Val	52.0	0.0		71.0	5.0	NM_001081461	B3KMN8|B4DGX1|Q86VY0|Q8IUM5|Q9Y4E2	Missense_Mutation	SNP	ENST00000397625.4	hg19	CCDS42384.1	.	.	.	.	.	.	.	.	.	.	G	1.946	-0.442318	0.04604	.	.	ENSG00000070495	ENST00000445478;ENST00000344991;ENST00000397625	T;T	0.68181	-0.31;-0.31	5.5	4.33	0.51752	.	0.162754	0.53938	D	0.000046	T	0.25195	0.0612	N	0.00237	-1.79	0.47994	D	0.999565	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.0;0.001;0.003	T	0.48234	-0.9053	10	0.02654	T	1	-16.5806	11.6802	0.51453	0.1518:0.0:0.8482:0.0	.	49;49;49	B2WTI3;Q6NYC1;Q6NYC1-3	.;JMJD6_HUMAN;.	V	49	ENSP00000394085:A49V;ENSP00000380750:A49V	ENSP00000302916:A49V	A	-	2	0	JMJD6	72233516	1.000000	0.71417	0.941000	0.38009	0.078000	0.17371	5.165000	0.64959	2.568000	0.86640	0.555000	0.69702	GCA	.	.		0.468	JMJD6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403211.1	NM_015167	
TNRC6C	57690	hgsc.bcm.edu	37	17	76087679	76087679	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr17:76087679A>G	ENST00000588061.1	+	16	4688	c.3961A>G	c.(3961-3963)Agc>Ggc	p.S1321G	TNRC6C_ENST00000544502.1_Missense_Mutation_p.S1318G|TNRC6C_ENST00000335749.4_Missense_Mutation_p.S1318G|TNRC6C_ENST00000301624.4_Missense_Mutation_p.S1321G|TNRC6C_ENST00000588847.1_Missense_Mutation_p.S1318G|TNRC6C_ENST00000541771.1_Missense_Mutation_p.S1321G			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	1321	Silencing domain; interaction with CNOT1 and PAN3.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GCAGAACCCTAGCAAGCATGG	0.552																																					p.S1321G		Atlas-SNP	.											.	TNRC6C	173	.	0			c.A3961G						.						30.0	32.0	31.0					17																	76087679		2007	4165	6172	SO:0001583	missense	57690	exon15			AACCCTAGCAAGC	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.3961A>G	chr17.hg19:g.76087679A>G	ENSP00000468647:p.Ser1321Gly	62.0	0.0		68.0	25.0	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	hg19	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.074641	0.36566	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.16324	2.35;2.35;2.35;2.35	5.97	2.48	0.30137	.	0.184288	0.64402	N	0.000013	T	0.09949	0.0244	N	0.24115	0.695	0.29309	N	0.868151	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.002	T	0.28870	-1.0030	10	0.20046	T	0.44	-8.5714	8.6295	0.33911	0.7047:0.0:0.2953:0.0	.	1318;1321	G3XAB8;Q9HCJ0	.;TNR6C_HUMAN	G	1321;1318;1318;1321;1321;1318	ENSP00000336783:S1318G;ENSP00000301624:S1321G;ENSP00000440310:S1321G;ENSP00000442421:S1318G	ENSP00000301624:S1321G	S	+	1	0	TNRC6C	73599274	0.822000	0.29219	0.851000	0.33527	0.928000	0.56348	1.431000	0.34925	0.139000	0.18822	-0.417000	0.06048	AGC	.	.		0.552	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
EMILIN2	84034	hgsc.bcm.edu	37	18	2891712	2891712	+	Silent	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr18:2891712G>A	ENST00000254528.3	+	4	1746	c.1587G>A	c.(1585-1587)ggG>ggA	p.G529G		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	529					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GAGTGTCAGGGTCAGGAGATG	0.532																																					p.G529G		Atlas-SNP	.											.	EMILIN2	97	.	0			c.G1587A						.						70.0	72.0	71.0					18																	2891712		2203	4300	6503	SO:0001819	synonymous_variant	84034	exon4			GTCAGGGTCAGGA	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.1587G>A	chr18.hg19:g.2891712G>A		82.0	0.0		96.0	26.0	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Silent	SNP	ENST00000254528.3	hg19	CCDS11828.1																																																																																			.	.		0.532	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
ANKRD12	23253	hgsc.bcm.edu	37	18	9258165	9258165	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr18:9258165G>C	ENST00000262126.4	+	9	5140	c.4900G>C	c.(4900-4902)Gaa>Caa	p.E1634Q	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Missense_Mutation_p.E1611Q|ANKRD12_ENST00000383440.2_Missense_Mutation_p.E1611Q	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1634						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						ACATGAAAAAGAAAACAAACT	0.353																																					p.E1634Q		Atlas-SNP	.											.	ANKRD12	167	.	0			c.G4900C						.						59.0	57.0	58.0					18																	9258165		2203	4300	6503	SO:0001583	missense	23253	exon9			GAAAAAGAAAACA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.4900G>C	chr18.hg19:g.9258165G>C	ENSP00000262126:p.Glu1634Gln	80.0	0.0		92.0	46.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	G	10.69	1.422350	0.25639	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.57107	0.42;0.42	5.29	5.29	0.74685	.	0.362158	0.27749	N	0.018011	T	0.41971	0.1182	L	0.29908	0.895	0.42281	D	0.992097	B;B	0.34103	0.437;0.31	B;B	0.34779	0.189;0.134	T	0.40905	-0.9538	10	0.48119	T	0.1	-10.7309	12.6308	0.56657	0.0762:0.0:0.9238:0.0	.	1611;1634	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	Q	1611;1634	ENSP00000372932:E1611Q;ENSP00000262126:E1634Q	ENSP00000262126:E1634Q	E	+	1	0	ANKRD12	9248165	1.000000	0.71417	0.989000	0.46669	0.460000	0.32559	5.503000	0.66962	2.619000	0.88677	0.655000	0.94253	GAA	.	.		0.353	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
FHOD3	80206	hgsc.bcm.edu	37	18	34326998	34326998	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr18:34326998G>T	ENST00000359247.4	+	20	3556	c.3556G>T	c.(3556-3558)Gaa>Taa	p.E1186*	FHOD3_ENST00000257209.4_Nonsense_Mutation_p.E1203*|FHOD3_ENST00000590592.1_Nonsense_Mutation_p.E1378*|FHOD3_ENST00000445677.1_Nonsense_Mutation_p.E1165*|FHOD3_ENST00000592128.1_Nonsense_Mutation_p.E182*|FHOD3_ENST00000591635.1_Nonsense_Mutation_p.E399*	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1186	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TGCAAAACATGAAATGAAACC	0.363																																					p.E1203X		Atlas-SNP	.											FHOD3,NS,carcinoma,0,1	FHOD3	210	.	0			c.G3607T						.						95.0	92.0	93.0					18																	34326998		2203	4300	6503	SO:0001587	stop_gained	80206	exon21			AAACATGAAATGA	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3556G>T	chr18.hg19:g.34326998G>T	ENSP00000352186:p.Glu1186*	217.0	0.0		190.0	40.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Nonsense_Mutation	SNP	ENST00000359247.4	hg19		.	.	.	.	.	.	.	.	.	.	G	42	9.676315	0.99236	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	.	.	.	5.67	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.1176	0.59309	0.0776:0.0:0.9224:0.0	.	.	.	.	X	1203;1186;1165	.	ENSP00000257209:E1203X	E	+	1	0	FHOD3	32580996	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	1.404000	0.46819	0.462000	0.41574	GAA	.	.		0.363	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
LOXHD1	125336	hgsc.bcm.edu	37	18	44140291	44140291	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr18:44140291T>C	ENST00000398722.4	-	12	1981	c.1982A>G	c.(1981-1983)aAg>aGg	p.K661R	LOXHD1_ENST00000441893.2_5'Flank|LOXHD1_ENST00000536736.1_Missense_Mutation_p.K939R|LOXHD1_ENST00000582408.1_5'Flank|LOXHD1_ENST00000300591.6_5'Flank|LOXHD1_ENST00000441551.2_Intron			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	661					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						cttcttcttcttcctcTGCAG	0.597																																					p.K939R		Atlas-SNP	.											.	LOXHD1	367	.	0			c.A2816G						.						76.0	75.0	75.0					18																	44140291		692	1591	2283	SO:0001583	missense	125336	exon19			TTCTTCTTCCTCT	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.1982A>G	chr18.hg19:g.44140291T>C	ENSP00000381707:p.Lys661Arg	283.0	0.0		272.0	15.0	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	hg19		.	.	.	.	.	.	.	.	.	.	T	11.78	1.742019	0.30865	.	.	ENSG00000167210	ENST00000398722;ENST00000536736;ENST00000335730	T;T	0.06218	3.33;3.34	4.89	4.89	0.63831	.	0.000000	0.52532	D	0.000063	T	0.04137	0.0115	N	0.22421	0.69	0.80722	D	1	B;B	0.27229	0.023;0.172	B;B	0.23716	0.01;0.048	T	0.48305	-0.9047	10	0.18276	T	0.48	.	7.3636	0.26760	0.0:0.0999:0.0:0.9001	.	939;661	F5GZB4;Q8IVV2-2	.;.	R	661;939;661	ENSP00000381707:K661R;ENSP00000444586:K939R	ENSP00000338222:K661R	K	-	2	0	LOXHD1	42394289	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	2.368000	0.44222	1.840000	0.53500	0.240000	0.17902	AAG	.	.		0.597	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
SERPINB4	6318	hgsc.bcm.edu	37	18	61305147	61305147	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr18:61305147T>A	ENST00000341074.5	-	8	1094	c.979A>T	c.(979-981)Aaa>Taa	p.K327*	SERPINB4_ENST00000356424.6_Nonsense_Mutation_p.K275*	NM_002974.2	NP_002965.1	P48594	SPB4_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 4	327					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	42						TGTAGGACTTTAGATACTGAG	0.502																																					p.K327X		Atlas-SNP	.											.	SERPINB4	89	.	0			c.A979T						.						130.0	120.0	123.0					18																	61305147		2203	4300	6503	SO:0001587	stop_gained	6318	exon8			GGACTTTAGATAC	X89015	CCDS11986.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206073	ENSG00000206073		"""Serine (or cysteine) peptidase inhibitors"""	10570	protein-coding gene	gene with protein product	"""squamous cell carcinoma antigen 2"""	600518	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4"""	SCCA2		7724531, 14630915, 24172014	Standard	NM_175041		Approved	PI11, LEUPIN, SCCA-2, SCCA1		P48594	OTTHUMG00000060405	ENST00000341074.5:c.979A>T	chr18.hg19:g.61305147T>A	ENSP00000343445:p.Lys327*	92.0	0.0		107.0	56.0	NM_002974	A8K847	Nonsense_Mutation	SNP	ENST00000341074.5	hg19	CCDS11986.1	.	.	.	.	.	.	.	.	.	.	t	17.04	3.288069	0.59976	.	.	ENSG00000206073	ENST00000341074;ENST00000356424	.	.	.	4.51	2.08	0.27032	.	0.333204	0.21587	N	0.072149	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4414	0.32818	0.0:0.2432:0.0:0.7568	.	.	.	.	X	327;275	.	ENSP00000343445:K327X	K	-	1	0	SERPINB4	59456127	0.000000	0.05858	0.001000	0.08648	0.024000	0.10985	-0.170000	0.09897	0.338000	0.23692	-0.308000	0.09152	AAA	.	.		0.502	SERPINB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133794.2	NM_175041	
REEP6	92840	hgsc.bcm.edu	37	19	1490287	1490287	+	5'Flank	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr19:1490287C>T	ENST00000233596.3	+	0	0				PCSK4_ENST00000587784.1_Intron|PCSK4_ENST00000300954.5_Missense_Mutation_p.R20H	NM_138393.1	NP_612402.1	Q96HR9	REEP6_HUMAN	receptor accessory protein 6						regulation of intracellular transport (GO:0032386)	apical part of cell (GO:0045177)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				lung(1)|ovary(1)	2		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCCGGGGGCGGACAAGGGC	0.741																																					p.R20H		Atlas-SNP	.											.	PCSK4	44	.	0			c.G59A						.						5.0	7.0	6.0					19																	1490287		2114	4156	6270	SO:0001631	upstream_gene_variant	54760	exon1			CGGGGGCGGACAA	BC008201	CCDS12070.1	19p13.3	2012-12-20	2006-02-08	2006-02-07	ENSG00000115255	ENSG00000115255		"""Receptor accessory proteins"""	30078	protein-coding gene	gene with protein product	"""polyposis locus protein 1-like 1"", ""deleted in polyposis 1-like 1"""	609346	"""chromosome 19 open reading frame 32"""	C19orf32		16271481, 15550249	Standard	NM_138393		Approved	DP1L1, FLJ25383	uc002ltc.3	Q96HR9	OTTHUMG00000180072		chr19.hg19:g.1490287C>T	Exception_encountered	48.0	0.0		34.0	14.0	NM_017573	B2RE01|D6W5Z0|Q96LM0	Missense_Mutation	SNP	ENST00000233596.3	hg19	CCDS12070.1	.	.	.	.	.	.	.	.	.	.	C	6.172	0.399835	0.11696	.	.	ENSG00000115257	ENST00000300954	T	0.69175	-0.38	3.31	0.995	0.19838	.	1.617810	0.04195	N	0.329028	T	0.37100	0.0991	N	0.08118	0	0.09310	N	1	P	0.46277	0.875	B	0.32211	0.142	T	0.30001	-0.9993	10	0.15499	T	0.54	.	4.8057	0.13319	0.2108:0.6684:0.0:0.1208	.	20	Q6UW60	PCSK4_HUMAN	H	20	ENSP00000300954:R20H	ENSP00000300954:R20H	R	-	2	0	PCSK4	1441287	0.067000	0.21026	0.088000	0.20740	0.016000	0.09150	0.437000	0.21543	0.053000	0.16036	0.313000	0.20887	CGC	.	.		0.741	REEP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449623.1	NM_138393	
GATAD2A	54815	hgsc.bcm.edu	37	19	19607000	19607000	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr19:19607000A>G	ENST00000360315.3	+	7	1208	c.896A>G	c.(895-897)aAc>aGc	p.N299S	GATAD2A_ENST00000252577.5_Missense_Mutation_p.N299S|GATAD2A_ENST00000429563.2_Missense_Mutation_p.N126S|GATAD2A_ENST00000537887.1_Intron|GATAD2A_ENST00000358713.3_Missense_Mutation_p.N299S|GATAD2A_ENST00000404158.1_Missense_Mutation_p.N299S	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	299					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						AATGTTCCCAACACCAGCCTG	0.652																																					p.N299S		Atlas-SNP	.											.	GATAD2A	81	.	0			c.A896G						.						113.0	89.0	97.0					19																	19607000		2203	4300	6503	SO:0001583	missense	54815	exon7			TTCCCAACACCAG	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.896A>G	chr19.hg19:g.19607000A>G	ENSP00000353463:p.Asn299Ser	54.0	0.0		56.0	19.0	NM_017660	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	hg19	CCDS12402.2	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360410	0.41801	.	.	ENSG00000167491	ENST00000360315;ENST00000252577;ENST00000404158;ENST00000358713;ENST00000429563	T;T;T;T	0.44083	1.5;1.54;1.5;0.93	5.65	2.48	0.30137	.	0.042391	0.85682	N	0.000000	T	0.30665	0.0772	L	0.43923	1.385	0.80722	D	1	B;B;B	0.20261	0.043;0.043;0.043	B;B;B	0.15870	0.014;0.014;0.014	T	0.06356	-1.0831	10	0.24483	T	0.36	-1.2984	8.4933	0.33112	0.7771:0.0:0.2229:0.0	.	126;318;299	B4DKZ7;B5MC40;Q86YP4	.;.;P66A_HUMAN	S	299;299;318;299;126	ENSP00000353463:N299S;ENSP00000252577:N299S;ENSP00000351552:N299S;ENSP00000388416:N126S	ENSP00000252577:N299S	N	+	2	0	GATAD2A	19468000	0.986000	0.35501	0.994000	0.49952	0.995000	0.86356	2.251000	0.43187	0.115000	0.18071	0.533000	0.62120	AAC	.	.		0.652	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326671.4	NM_017660	
ZNF99	7652	hgsc.bcm.edu	37	19	22941385	22941385	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr19:22941385T>A	ENST00000596209.1	-	4	1416	c.1326A>T	c.(1324-1326)aaA>aaT	p.K442N	ZNF99_ENST00000397104.3_Missense_Mutation_p.K351N	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTATCTTATGTTTTCTAAGGG	0.358																																					p.K442N		Atlas-SNP	.											.	ZNF99	273	.	0			c.A1326T						.						57.0	59.0	58.0					19																	22941385		2029	4215	6244	SO:0001583	missense	7652	exon4			CTTATGTTTTCTA	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1326A>T	chr19.hg19:g.22941385T>A	ENSP00000472969:p.Lys442Asn	58.0	0.0		73.0	32.0	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	N	1.143	-0.648896	0.03506	.	.	ENSG00000213973	ENST00000397104	T	0.20598	2.06	1.28	-2.55	0.06288	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11239	0.0274	N	0.25485	0.75	0.09310	N	1	B	0.17465	0.022	B	0.26517	0.07	T	0.39099	-0.9630	9	0.19590	T	0.45	.	2.6546	0.05008	0.4804:0.2932:0.0:0.2264	.	351	A8MXY4	ZNF99_HUMAN	N	351	ENSP00000380293:K351N	ENSP00000380293:K351N	K	-	3	2	ZNF99	22733225	0.000000	0.05858	0.002000	0.10522	0.036000	0.12997	-5.051000	0.00156	-1.146000	0.02854	-0.560000	0.04181	AAA	.	.		0.358	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
ZNF91	7644	hgsc.bcm.edu	37	19	23545201	23545201	+	Missense_Mutation	SNP	G	G	A	rs377229432		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr19:23545201G>A	ENST00000300619.7	-	4	785	c.580C>T	c.(580-582)Cgt>Tgt	p.R194C	ZNF91_ENST00000397082.2_Missense_Mutation_p.R162C|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	194					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTGTGTAAACGGATGCAAAAT	0.308																																					p.R194C		Atlas-SNP	.											.	ZNF91	349	.	0			c.C580T						.	G	CYS/ARG	2,4120		0,2,2059	74.0	76.0	75.0		580		0.1	19		75	1,8489		0,1,4244	no	missense	ZNF91	NM_003430.2	180	0,3,6303	AA,AG,GG		0.0118,0.0485,0.0238	possibly-damaging	194/1192	23545201	3,12609	2061	4245	6306	SO:0001583	missense	7644	exon4			GTAAACGGATGCA	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.580C>T	chr19.hg19:g.23545201G>A	ENSP00000300619:p.Arg194Cys	119.0	0.0		159.0	8.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	hg19	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	G	1.656	-0.512791	0.04200	4.85E-4	1.18E-4	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.16073	2.37;2.37	.	.	.	Zinc finger, C2H2 (1);	.	.	.	.	T	0.06826	0.0174	L	0.28014	0.82	0.09310	N	1	P;B	0.43578	0.811;0.319	B;B	0.14578	0.011;0.002	T	0.29971	-0.9994	8	0.52906	T	0.07	.	3.8088	0.08788	0.0:0.0:0.5804:0.4195	.	162;194	Q05481-2;Q05481	.;ZNF91_HUMAN	C	194;162	ENSP00000300619:R194C;ENSP00000380272:R162C	ENSP00000300619:R194C	R	-	1	0	ZNF91	23337041	0.000000	0.05858	0.078000	0.20375	0.020000	0.10135	-3.047000	0.00630	0.064000	0.16427	0.064000	0.15345	CGT	.	.		0.308	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
SSTR4	6754	hgsc.bcm.edu	37	20	23017238	23017238	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr20:23017238C>A	ENST00000255008.3	+	1	1182	c.1118C>A	c.(1117-1119)cCa>cAa	p.P373Q	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	373					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)	p.P373Q(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCCCTGCAACCAGAACCCGGC	0.667																																					p.P373Q	Esophageal Squamous(15;850 1104 16640)	Atlas-SNP	.											SSTR4,NS,carcinoma,0,1	SSTR4	83	.	1	Substitution - Missense(1)	lung(1)	c.C1118A						.						40.0	48.0	45.0					20																	23017238		2081	4203	6284	SO:0001583	missense	6754	exon1			TGCAACCAGAACC		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.1118C>A	chr20.hg19:g.23017238C>A	ENSP00000255008:p.Pro373Gln	61.0	0.0		66.0	13.0	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	hg19	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	C	3.375	-0.127528	0.06753	.	.	ENSG00000132671	ENST00000255008	T	0.65178	-0.14	3.92	1.89	0.25635	.	1.730700	0.03659	N	0.242347	T	0.49779	0.1577	N	0.22421	0.69	0.09310	N	0.999998	B	0.12630	0.006	B	0.12837	0.008	T	0.38607	-0.9653	10	0.51188	T	0.08	.	6.9321	0.24447	0.1725:0.7314:0.0:0.0962	.	373	P31391	SSR4_HUMAN	Q	373	ENSP00000255008:P373Q	ENSP00000255008:P373Q	P	+	2	0	SSTR4	22965238	0.049000	0.20398	0.067000	0.19924	0.002000	0.02628	1.327000	0.33746	0.284000	0.22305	-0.140000	0.14226	CCA	.	.		0.667	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
CABLES2	81928	hgsc.bcm.edu	37	20	60967986	60967986	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr20:60967986G>A	ENST00000279101.5	-	7	982	c.974C>T	c.(973-975)gCg>gTg	p.A325V		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	325					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CATGTACGACGCAAAGATGAG	0.647																																					p.A325V		Atlas-SNP	.											.	CABLES2	30	.	0			c.C974T						.						150.0	130.0	137.0					20																	60967986		2203	4300	6503	SO:0001583	missense	81928	exon7			TACGACGCAAAGA	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.974C>T	chr20.hg19:g.60967986G>A	ENSP00000279101:p.Ala325Val	52.0	0.0		73.0	4.0	NM_031215	Q5JWL0|Q9BYK0	Missense_Mutation	SNP	ENST00000279101.5	hg19	CCDS33503.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.20|19.20	3.781958|3.781958	0.70222|0.70222	.|.	.|.	ENSG00000149679|ENSG00000149679	ENST00000370560;ENST00000279101|ENST00000453274	T|.	0.18016|.	2.24|.	5.05|5.05	5.05|5.05	0.67936|0.67936	Cyclin-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75845|0.75845	0.3905|0.3905	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	D|.	0.56746|.	0.977|.	P|.	0.47075|.	0.536|.	T|T	0.75590|0.75590	-0.3265|-0.3265	10|5	0.27082|.	T|.	0.32|.	-23.5783|-23.5783	18.778|18.778	0.91920|0.91920	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	325|.	Q9BTV7|.	CABL2_HUMAN|.	V|C	113;325|119	ENSP00000279101:A325V|.	ENSP00000279101:A325V|.	A|R	-|-	2|1	0|0	CABLES2|CABLES2	60401381|60401381	1.000000|1.000000	0.71417|0.71417	0.695000|0.695000	0.30226|0.30226	0.121000|0.121000	0.20230|0.20230	9.633000|9.633000	0.98432|0.98432	2.522000|2.522000	0.85027|0.85027	0.655000|0.655000	0.94253|0.94253	GCG|CGT	.	.		0.647	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265	
SEC14L2	23541	hgsc.bcm.edu	37	22	30803523	30803523	+	Silent	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr22:30803523G>A	ENST00000312932.9	+	5	614	c.354G>A	c.(352-354)caG>caA	p.Q118Q	SEC14L2_ENST00000403484.1_Silent_p.Q44Q|SEC14L2_ENST00000402592.3_Intron|RP4-539M6.19_ENST00000439838.1_5'Flank|SEC14L2_ENST00000405717.3_Silent_p.Q118Q|SEC14L2_ENST00000459728.1_3'UTR	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	118	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	CCTCCAAACAGGACCTGCTGA	0.552																																					p.Q118Q		Atlas-SNP	.											.	SEC14L2	24	.	0			c.G354A						.						141.0	126.0	131.0					22																	30803523		2203	4300	6503	SO:0001819	synonymous_variant	23541	exon5			CAAACAGGACCTG	AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.354G>A	chr22.hg19:g.30803523G>A		58.0	0.0		90.0	33.0	NM_012429	B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Silent	SNP	ENST00000312932.9	hg19	CCDS13876.1																																																																																			.	.		0.552	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321018.4	NM_012429	
SLC5A4	6527	hgsc.bcm.edu	37	22	32627060	32627060	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr22:32627060T>C	ENST00000266086.4	-	10	1035	c.1024A>G	c.(1024-1026)Atg>Gtg	p.M342V	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	342					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CATGCTACCATATCTGGGGAA	0.453																																					p.M342V		Atlas-SNP	.											.	SLC5A4	82	.	0			c.A1024G						.						106.0	77.0	87.0					22																	32627060		2203	4300	6503	SO:0001583	missense	6527	exon10			CTACCATATCTGG	U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.1024A>G	chr22.hg19:g.32627060T>C	ENSP00000266086:p.Met342Val	82.0	0.0		102.0	17.0	NM_014227	O15279	Missense_Mutation	SNP	ENST00000266086.4	hg19	CCDS13903.1	.	.	.	.	.	.	.	.	.	.	.	3.782	-0.045464	0.07452	.	.	ENSG00000100191	ENST00000266086	D	0.87729	-2.29	4.86	1.53	0.23141	.	0.511737	0.22153	N	0.063885	T	0.68449	0.3002	N	0.05306	-0.075	0.22226	N	0.999274	B	0.02656	0.0	B	0.01281	0.0	T	0.58696	-0.7591	10	0.54805	T	0.06	.	3.5866	0.07973	0.0:0.2693:0.1918:0.5389	.	342	Q9NY91	SC5A4_HUMAN	V	342	ENSP00000266086:M342V	ENSP00000266086:M342V	M	-	1	0	SLC5A4	30957060	0.860000	0.29831	0.217000	0.23759	0.017000	0.09413	1.566000	0.36396	0.398000	0.25338	-0.280000	0.10049	ATG	.	.		0.453	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227	
SREBF2	6721	hgsc.bcm.edu	37	22	42266958	42266958	+	Silent	SNP	C	C	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr22:42266958C>T	ENST00000361204.4	+	4	952	c.786C>T	c.(784-786)ggC>ggT	p.G262G		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	262	Interaction with LMNA. {ECO:0000250}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						AGACAGATGGCAGCCCTGTTA	0.537																																					p.G262G		Atlas-SNP	.											.	SREBF2	99	.	0			c.C786T						.						168.0	156.0	160.0					22																	42266958		2203	4300	6503	SO:0001819	synonymous_variant	6721	exon4			AGATGGCAGCCCT	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.786C>T	chr22.hg19:g.42266958C>T		98.0	0.0		113.0	44.0	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Silent	SNP	ENST00000361204.4	hg19	CCDS14023.1																																																																																			.	.		0.537	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
USP9X	8239	hgsc.bcm.edu	37	X	41022048	41022048	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:41022048G>T	ENST00000324545.8	+	15	2536	c.1903G>T	c.(1903-1905)Gaa>Taa	p.E635*	USP9X_ENST00000378308.2_Nonsense_Mutation_p.E635*	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	635					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TGCAGACCATGAAGATTATGA	0.363																																					p.E635X	Ovarian(172;1807 2695 35459 49286)	Atlas-SNP	.											.	USP9X	385	.	0			c.G1903T						.						132.0	123.0	126.0					X																	41022048		2185	4293	6478	SO:0001587	stop_gained	8239	exon15			GACCATGAAGATT	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.1903G>T	chrX.hg19:g.41022048G>T	ENSP00000316357:p.Glu635*	210.0	0.0		237.0	111.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Nonsense_Mutation	SNP	ENST00000324545.8	hg19	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	G	40	8.171626	0.98688	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	.	.	.	5.32	5.32	0.75619	.	0.100122	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	18.3466	0.90324	0.0:0.0:1.0:0.0	.	.	.	.	X	635	.	ENSP00000316357:E635X	E	+	1	0	USP9X	40906992	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.069000	0.64370	2.360000	0.80028	0.422000	0.28245	GAA	.	.		0.363	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
CASK	8573	hgsc.bcm.edu	37	X	41394032	41394032	+	Silent	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:41394032A>G	ENST00000378163.1	-	24	2718	c.2244T>C	c.(2242-2244)caT>caC	p.H748H	CASK_ENST00000442742.2_Silent_p.H720H|CASK_ENST00000318588.9_Silent_p.H743H|CASK_ENST00000378166.4_Silent_p.H743H|CASK_ENST00000421587.2_Silent_p.H719H|CASK_ENST00000361962.4_Silent_p.H731H|CASK_ENST00000378158.1_Silent_p.H731H			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	748	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						TCCCAACACCATGTGCGCCTA	0.368																																					p.H743H	NSCLC(42;104 1086 3090 27189 35040)	Atlas-SNP	.											.	CASK	93	.	0			c.T2229C						.						266.0	207.0	227.0					X																	41394032		2203	4300	6503	SO:0001819	synonymous_variant	8573	exon24			AACACCATGTGCG	AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.2244T>C	chrX.hg19:g.41394032A>G		88.0	0.0		115.0	55.0	NM_003688	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Silent	SNP	ENST00000378163.1	hg19																																																																																				.	.		0.368	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000056285.1	NM_003688	
TSPYL2	64061	hgsc.bcm.edu	37	X	53115089	53115089	+	Silent	SNP	T	T	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:53115089T>A	ENST00000375442.4	+	6	1647	c.1515T>A	c.(1513-1515)acT>acA	p.T505T		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	505	Asn-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						acgaaaccactgacaacaatg	0.453																																					p.T505T		Atlas-SNP	.											.	TSPYL2	53	.	0			c.T1515A						.						241.0	173.0	196.0					X																	53115089		2203	4300	6503	SO:0001819	synonymous_variant	64061	exon6			AACCACTGACAAC	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1515T>A	chrX.hg19:g.53115089T>A		182.0	0.0		203.0	46.0	NM_022117	O94799|Q96DG7|Q9BZW6	Silent	SNP	ENST00000375442.4	hg19	CCDS14350.1																																																																																			.	.		0.453	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
TRO	7216	hgsc.bcm.edu	37	X	54955093	54955093	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:54955093G>A	ENST00000173898.7	+	12	2048	c.1936G>A	c.(1936-1938)Gaa>Aaa	p.E646K	TRO_ENST00000420798.2_Missense_Mutation_p.E177K|TRO_ENST00000375022.4_Missense_Mutation_p.E646K|TRO_ENST00000399736.1_Missense_Mutation_p.E249K|TRO_ENST00000319167.8_Missense_Mutation_p.E646K|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375041.2_Missense_Mutation_p.E249K	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	646					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						AGTGGAGATGGAAGTCCAAgc	0.547																																					p.E646K		Atlas-SNP	.											.	TRO	246	.	0			c.G1936A						.						43.0	49.0	47.0					X																	54955093		2136	4246	6382	SO:0001583	missense	7216	exon12			GAGATGGAAGTCC	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1936G>A	chrX.hg19:g.54955093G>A	ENSP00000173898:p.Glu646Lys	222.0	0.0		261.0	123.0	NM_016157	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	hg19	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261909	0.39995	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022;ENST00000399736;ENST00000319179;ENST00000420798;ENST00000375041	T;T;T;T;T;T	0.08984	3.68;3.43;3.43;3.26;3.03;3.37	2.99	1.16	0.20824	.	.	.	.	.	T	0.06781	0.0173	L	0.41492	1.28	0.25762	N	0.984937	B;B;B;B	0.28082	0.2;0.008;0.01;0.2	B;B;B;B	0.19391	0.025;0.004;0.006;0.025	T	0.31194	-0.9952	9	0.66056	D	0.02	.	5.4075	0.16330	0.1309:0.2047:0.6644:0.0	.	249;249;646;646	B1AKE9;B1AKF1;Q96SX2;Q12816	.;.;.;TROP_HUMAN	K	646;646;646;249;249;177;249	ENSP00000173898:E646K;ENSP00000318278:E646K;ENSP00000364162:E646K;ENSP00000382641:E249K;ENSP00000405126:E177K;ENSP00000364181:E249K	ENSP00000173898:E646K	E	+	1	0	TRO	54971818	1.000000	0.71417	0.998000	0.56505	0.834000	0.47266	1.455000	0.35190	0.179000	0.19938	0.544000	0.68410	GAA	.	.		0.547	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
ZXDB	158586	hgsc.bcm.edu	37	X	57618959	57618960	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:57618959_57618960GG>TT	ENST00000374888.1	+	1	691_692	c.478_479GG>TT	c.(478-480)GGc>TTc	p.G160F		NM_007157.3	NP_009088.1	P98169	ZXDB_HUMAN	zinc finger, X-linked, duplicated B	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(2)|skin(6)	27						ctccgcccccggccccgccgcg	0.738																																					p.G160C|p.G160V		Atlas-SNP	.											.	ZXDB	51	.	0			c.G478T|c.G479T						.																																			SO:0001583	missense	158586	exon1			GCCCCCGGCCCCG|CCCCCGGCCCCGC	L14788	CCDS35313.1	Xp11.1	2013-01-08			ENSG00000198455	ENSG00000198455		"""Zinc fingers, C2H2-type"""	13199	protein-coding gene	gene with protein product		300236				8268913	Standard	NM_007157		Approved	ZNF905	uc004dvd.3	P98169	OTTHUMG00000021685	Exception_encountered	chrX.hg19:g.57618959_57618960delinsTT	ENSP00000364023:p.Gly160Phe	107.0|108.0	0.0		172.0|176.0	67.0|64.0	NM_007157	A8K151|Q9UBB3	Missense_Mutation	SNP	ENST00000374888.1	hg19	CCDS35313.1																																																																																			.	.		0.738	ZXDB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056922.1	NM_007157	
HDX	139324	hgsc.bcm.edu	37	X	83723670	83723670	+	Missense_Mutation	SNP	A	A	G	rs138694491		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:83723670A>G	ENST00000297977.5	-	3	1172	c.1061T>C	c.(1060-1062)aTg>aCg	p.M354T	HDX_ENST00000373177.2_Missense_Mutation_p.M354T|HDX_ENST00000506585.2_Missense_Mutation_p.M296T	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	354						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						AATATTCACCATTTGTGAATT	0.403																																					p.M354T	Pancreas(53;231 1169 36156 43751 51139)	Atlas-SNP	.											.	HDX	124	.	0			c.T1061C						.						132.0	112.0	119.0					X																	83723670		2203	4300	6503	SO:0001583	missense	139324	exon3			TTCACCATTTGTG	BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1061T>C	chrX.hg19:g.83723670A>G	ENSP00000297977:p.Met354Thr	164.0	0.0		181.0	18.0	NM_144657	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	ENST00000297977.5	hg19	CCDS35342.1	.	.	.	.	.	.	.	.	.	.	A	7.336	0.619977	0.14193	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.32272	1.49;1.46;1.49	5.43	5.43	0.79202	.	0.285652	0.33854	N	0.004499	T	0.25005	0.0607	L	0.34521	1.04	0.45502	D	0.998464	B	0.30482	0.281	B	0.24006	0.05	T	0.04294	-1.0962	10	0.62326	D	0.03	-1.1798	14.5132	0.67802	1.0:0.0:0.0:0.0	.	354	Q7Z353	HDX_HUMAN	T	354;296;354	ENSP00000297977:M354T;ENSP00000362272:M296T;ENSP00000423670:M354T	ENSP00000297977:M354T	M	-	2	0	HDX	83610326	1.000000	0.71417	1.000000	0.80357	0.272000	0.26649	5.849000	0.69465	1.807000	0.52817	0.339000	0.21740	ATG	.	A|1.000;T|0.000		0.403	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057379.2	NM_144657	
LUZP4	51213	hgsc.bcm.edu	37	X	114524334	114524334	+	Silent	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:114524334G>A	ENST00000371920.3	+	1	16	c.9G>A	c.(7-9)tcG>tcA	p.S3S	LUZP4_ENST00000451986.2_5'UTR	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	3						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						AGATGGCTTCGTTTCGGAAGC	0.532																																					p.S3S		Atlas-SNP	.											.	LUZP4	51	.	0			c.G9A						.						108.0	85.0	93.0					X																	114524334		2203	4300	6503	SO:0001819	synonymous_variant	51213	exon1			GGCTTCGTTTCGG	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.9G>A	chrX.hg19:g.114524334G>A		108.0	0.0		141.0	56.0	NM_016383	B3KSD6	Silent	SNP	ENST00000371920.3	hg19	CCDS14567.1																																																																																			.	.		0.532	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383	
IL13RA1	3597	hgsc.bcm.edu	37	X	117895239	117895239	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:117895239A>G	ENST00000371666.3	+	6	882	c.815A>G	c.(814-816)cAt>cGt	p.H272R	IL13RA1_ENST00000481868.1_3'UTR|IL13RA1_ENST00000371642.1_Missense_Mutation_p.H272R	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	272	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						ACTGAGACACATAATGTTTTC	0.294																																					p.H272R		Atlas-SNP	.											.	IL13RA1	41	.	0			c.A815G						.						112.0	112.0	112.0					X																	117895239		2203	4299	6502	SO:0001583	missense	3597	exon6			AGACACATAATGT	U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.815A>G	chrX.hg19:g.117895239A>G	ENSP00000360730:p.His272Arg	158.0	0.0		188.0	45.0	NM_001560	O95646|Q5JSL4|Q99656|Q9UDY5	Missense_Mutation	SNP	ENST00000371666.3	hg19	CCDS14573.1	.	.	.	.	.	.	.	.	.	.	A	9.706	1.155782	0.21454	.	.	ENSG00000131724	ENST00000371666;ENST00000371642	D;D	0.85411	-1.98;-1.98	5.43	-3.62	0.04543	Fibronectin, type III (1);Immunoglobulin-like fold (1);	2.123750	0.01469	N	0.016214	T	0.75874	0.3909	L	0.38531	1.155	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.57159	-0.7859	10	0.21540	T	0.41	1.2789	5.311	0.15831	0.3829:0.2803:0.3369:0.0	.	272;272;272	Q5JSL4;P78552;Q9UDY5	.;I13R1_HUMAN;.	R	272	ENSP00000360730:H272R;ENSP00000360705:H272R	ENSP00000360705:H272R	H	+	2	0	IL13RA1	117779267	0.000000	0.05858	0.000000	0.03702	0.212000	0.24457	-0.143000	0.10296	-1.205000	0.02645	-0.467000	0.05162	CAT	.	.		0.294	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058009.1	NM_001560	
ZCCHC12	170261	hgsc.bcm.edu	37	X	117959257	117959257	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:117959257C>A	ENST00000310164.2	+	4	557	c.50C>A	c.(49-51)cCc>cAc	p.P17H		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	17					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						CTGAATGCACCCTTGCCGCCT	0.532																																					p.P17H		Atlas-SNP	.											.	ZCCHC12	60	.	0			c.C50A						.						75.0	66.0	69.0					X																	117959257		2203	4300	6503	SO:0001583	missense	170261	exon4			ATGCACCCTTGCC	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.50C>A	chrX.hg19:g.117959257C>A	ENSP00000308921:p.Pro17His	160.0	0.0		174.0	68.0	NM_173798	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	ENST00000310164.2	hg19	CCDS14574.1	.	.	.	.	.	.	.	.	.	.	C	6.239	0.412172	0.11812	.	.	ENSG00000174460	ENST00000310164	T	0.10099	2.91	3.05	0.0604	0.14336	.	0.480580	0.15659	N	0.250988	T	0.08758	0.0217	L	0.44542	1.39	0.19945	N	0.999942	B	0.10296	0.003	B	0.12156	0.007	T	0.26087	-1.0113	10	0.56958	D	0.05	-1.0646	5.7737	0.18267	0.208:0.3904:0.4016:0.0	.	17	Q6PEW1	ZCH12_HUMAN	H	17	ENSP00000308921:P17H	ENSP00000308921:P17H	P	+	2	0	ZCCHC12	117843285	0.156000	0.22821	0.176000	0.23000	0.732000	0.41865	0.553000	0.23391	-0.102000	0.12197	0.529000	0.55759	CCC	.	.		0.532	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798	
MAGEA1	4100	hgsc.bcm.edu	37	X	152482654	152482654	+	Silent	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrX:152482654G>A	ENST00000356661.5	-	3	575	c.357C>T	c.(355-357)gcC>gcT	p.A119A		NM_004988.4	NP_004979.3	P43355	MAGA1_HUMAN	melanoma antigen family A, 1 (directs expression of antigen MZ2-E)	119	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(7)|kidney(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGGCTCCCTGGCTCGATATT	0.488																																					p.A119A		Atlas-SNP	.											.	MAGEA1	57	.	0			c.C357T						.						123.0	123.0	123.0					X																	152482654		2203	4300	6503	SO:0001819	synonymous_variant	4100	exon3			CTCCCTGGCTCGA		CCDS76051.1	Xq28	2010-05-26			ENSG00000198681	ENSG00000198681			6796	protein-coding gene	gene with protein product	"""melanoma-associated antigen 1"", ""melanoma-associated antigen MZ2-E"", ""melanoma antigen MAGE-1"", ""melanoma antigen family A 1"", ""cancer/testis antigen family 1, member 1"""	300016		MAGE1		1840703	Standard	NM_004988		Approved	MGC9326, CT1.1	uc004fhf.2	P43355	OTTHUMG00000024192	ENST00000356661.5:c.357C>T	chrX.hg19:g.152482654G>A		302.0	0.0		363.0	153.0	NM_004988	B2RC81|O00346	Silent	SNP	ENST00000356661.5	hg19	CCDS14720.1																																																																																			.	.		0.488	MAGEA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060940.1	NM_004988	
MT-ND4L	4539	hgsc.bcm.edu	37	M	10724	10724	+	Silent	SNP	T	T	C			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrM:10724T>C	ENST00000361335.1	+	1	255	c.255T>C	c.(253-255)taT>taC	p.Y85Y	MT-TS2_ENST00000387449.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	85					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						TCCAACACATATGGCCTAGAC	0.448																																					p.Y85Y		Atlas-SNP	.											.	.	.	.	0			c.T255C						.																																			SO:0001819	synonymous_variant	0	exon1			CACATATGGCCTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.255T>C	chrM.hg19:g.10724T>C		21.0	0.0		22.0	7.0	ENST00000361335		Silent	SNP	ENST00000361335.1	hg19																																																																																				.	.		0.448	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024034	
MT-ND6	4541	hgsc.bcm.edu	37	M	14439	14439	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chrM:14439G>A	ENST00000361681.2	-	1	234	c.235C>T	c.(235-237)Cct>Tct	p.P79S	MT-TS2_ENST00000387449.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	79					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						CCATGCCTCAGGATACTCCTC	0.453																																					p.P79S		Atlas-SNP	.											.	.	.	.	0			c.C235T						.																																			SO:0001583	missense	0	exon1			CCTCAGGATACTC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.235C>T	chrM.hg19:g.14439G>A	ENSP00000354665:p.Pro79Ser	47.0	0.0		54.0	10.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.453	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
FUBP1	8880	hgsc.bcm.edu	37	1	78422295	78422295	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr1:78422295delG	ENST00000370768.2	-	17	1748	c.1667delC	c.(1666-1668)cctfs	p.P556fs	FUBP1_ENST00000370767.1_Frame_Shift_Del_p.P556fs|FUBP1_ENST00000436586.2_Frame_Shift_Del_p.P577fs	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	556	Pro-rich.				positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						TGCACCTGCAGGGGCTGCTGG	0.423			"""F, N"""		oligodendroglioma																																p.P556fs		Atlas-INDEL	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	112	.	0			c.1668delT						.						153.0	144.0	147.0					1																	78422295		2203	4300	6503	SO:0001589	frameshift_variant	8880	exon17			.	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1667delC	chr1.hg19:g.78422295delG	ENSP00000359804:p.Pro556fs	81.0	0.0		84.0	37.0	NM_003902	Q12828	Frame_Shift_Del	DEL	ENST00000370768.2	hg19	CCDS683.1																																																																																			.	.		0.423	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
JPH1	56704	hgsc.bcm.edu	37	8	75233276	75233276	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr8:75233276delG	ENST00000342232.4	-	1	287	c.247delC	c.(247-249)cggfs	p.R83fs		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	83	Gly-rich.				calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			CACTCCCCCCGGTACATCCAC	0.672																																					p.R83fs		Atlas-INDEL	.											.	JPH1	77	.	0			c.248delG						.						98.0	57.0	71.0					8																	75233276		2203	4300	6503	SO:0001589	frameshift_variant	56704	exon1			.	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.247delC	chr8.hg19:g.75233276delG	ENSP00000344488:p.Arg83fs	156.0	0.0		191.0	71.0	NM_020647	B2RTZ0	Frame_Shift_Del	DEL	ENST00000342232.4	hg19	CCDS6217.1																																																																																			.	.		0.672	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
CFAP58	159686	hgsc.bcm.edu	37	10	106153114	106153120	+	Frame_Shift_Del	DEL	TTAAAGA	TTAAAGA	-	rs371289437		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	TTAAAGA	TTAAAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr10:106153114_106153120delTTAAAGA	ENST00000369704.3	+	11	1689_1695	c.1555_1561delTTAAAGA	c.(1555-1563)ttaaagattfs	p.LKI519fs		NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		519						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GAAGAGAAAGTTAAAGATTATGATCCA	0.372																																					p.518_520del		Atlas-INDEL	.											.	CCDC147	137	.	0			c.1554_1560del						.																																			SO:0001589	frameshift_variant	159686	exon11			.																												ENST00000369704.3:c.1555_1561delTTAAAGA	chr10.hg19:g.106153114_106153120delTTAAAGA	ENSP00000358718:p.Leu519fs	198.0	0.0		174.0	29.0	NM_001008723	D3DRA6|Q8NA27	Frame_Shift_Del	DEL	ENST00000369704.3	hg19	CCDS31282.1																																																																																			.	.		0.372	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
SFMBT1	51460	hgsc.bcm.edu	37	3	52966136	52966137	+	Frame_Shift_Ins	INS	-	-	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr3:52966136_52966137insG	ENST00000394752.3	-	6	1023_1024	c.641_642insC	c.(640-642)ccafs	p.P214fs	SFMBT1_ENST00000394750.1_Frame_Shift_Ins_p.P214fs|SFMBT1_ENST00000358080.2_Frame_Shift_Ins_p.P214fs|SFMBT1_ENST00000296295.6_Frame_Shift_Ins_p.P214fs	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	214					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GATGAAGAAATGGATCCAAGTA	0.401																																					p.P214fs		Atlas-INDEL	.											.	SFMBT1	53	.	0			c.642_643insC						.																																			SO:0001589	frameshift_variant	51460	exon6			.	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.642dupC	chr3.hg19:g.52966138_52966138dupG	ENSP00000378235:p.Pro214fs	82.0	0.0		84.0	39.0	NM_016329	Q402F7|Q96C73|Q9Y4Q9	Frame_Shift_Ins	INS	ENST00000394752.3	hg19	CCDS2867.1																																																																																			.	.		0.401	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329	
RXFP3	51289	hgsc.bcm.edu	37	5	33937613	33937613	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr5:33937613delG	ENST00000330120.3	+	1	1123	c.768delG	c.(766-768)ctgfs	p.L256fs		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	256					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						ACAAGTTGCTGGGCCGCGACA	0.632																																					p.L256fs		Atlas-INDEL	.											.	RXFP3	114	.	0			c.767delT						.						46.0	37.0	40.0					5																	33937613		2201	4299	6500	SO:0001589	frameshift_variant	51289	exon1			.	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.768delG	chr5.hg19:g.33937613delG	ENSP00000328708:p.Leu256fs	109.0	0.0		117.0	50.0	NM_016568	Q14DA5	Frame_Shift_Del	DEL	ENST00000330120.3	hg19	CCDS3900.1																																																																																			.	.		0.632	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
ACVR2A	92	hgsc.bcm.edu	37	2	148684705	148684706	+	In_Frame_Ins	INS	-	-	AGGTTA			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr2:148684705_148684706insAGGTTA	ENST00000241416.7	+	11	2040_2041	c.1404_1405insAGGTTA	c.(1405-1407)agg>AGGTTAagg	p.469_469R>RLR	ACVR2A_ENST00000404590.1_In_Frame_Ins_p.469_469R>RLR|ACVR2A_ENST00000535787.1_In_Frame_Ins_p.361_361R>RLR|ACVR2A_ENST00000495775.1_3'UTR	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	469	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		ACGCAGAAGCCAGGTTATCAGC	0.421																																					p.A468delinsARL		Atlas-INDEL	.											.	ACVR2A	125	.	0			c.1404_1405insAGGTTA						.																																			SO:0001652	inframe_insertion	92	exon11			.		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1405_1410dupAGGTTA	chr2.hg19:g.148684706_148684711dupAGGTTA	Exception_encountered	142.0	0.0		67.0	26.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	In_Frame_Ins	INS	ENST00000241416.7	hg19	CCDS33301.1																																																																																			.	.		0.421	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
FAM175B	23172	hgsc.bcm.edu	37	10	126523308	126523319	+	In_Frame_Del	DEL	CTTCCAATTATG	CTTCCAATTATG	-	rs142891578		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	CTTCCAATTATG	CTTCCAATTATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr10:126523308_126523319delCTTCCAATTATG	ENST00000298492.5	+	9	1061_1072	c.1016_1027delCTTCCAATTATG	c.(1015-1029)tcttccaattatgct>tct	p.SNYA340del		NM_032182.3	NP_115558.3	Q15018	F175B_HUMAN	family with sequence similarity 175, member B	340					cellular response to freezing (GO:0071497)	BRISC complex (GO:0070552)|cytoplasm (GO:0005737)	polyubiquitin binding (GO:0031593)			NS(1)	1						GCTGTGGGCTCTTCCAATTATGCTTCCACCAG	0.514																																					p.339_342del		Atlas-INDEL	.											.	FAM175B	39	.	0			c.1015_1026del						.																																			SO:0001651	inframe_deletion	23172	exon9			.	D63877	CCDS31308.2	10q26.2	2013-01-24	2008-07-02	2008-07-02	ENSG00000165660	ENSG00000165660			28975	protein-coding gene	gene with protein product	"""Abraxas brother"""	611144	"""KIAA0157"""	KIAA0157		8590280	Standard	NM_032182		Approved	Em:AC068896.4, ABRO1	uc001lib.4	Q15018	OTTHUMG00000019218	ENST00000298492.5:c.1016_1027delCTTCCAATTATG	chr10.hg19:g.126523308_126523319delCTTCCAATTATG	ENSP00000298492:p.Ser340_Ala343del	115.0	0.0		125.0	30.0	NM_032182	B4DKR2|Q96H11	In_Frame_Del	DEL	ENST00000298492.5	hg19	CCDS31308.2																																																																																			.	.		0.514	FAM175B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050891.2	NM_032182	
KCNJ8	3764	hgsc.bcm.edu	37	12	21918723	21918740	+	In_Frame_Del	DEL	AGAATTGTTCCTTCGGAT	AGAATTGTTCCTTCGGAT	-	rs142014286		TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	AGAATTGTTCCTTCGGAT	AGAATTGTTCCTTCGGAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr12:21918723_21918740delAGAATTGTTCCTTCGGAT	ENST00000240662.2	-	3	1537_1554	c.1192_1209delATCCGAAGGAACAATTCT	c.(1192-1209)atccgaaggaacaattctdel	p.IRRNNS398del	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	398					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)	p.R399*(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	CCATGAGGGAAGAATTGTTCCTTCGGATAGAATTGTTC	0.413																																					p.398_404del		Atlas-INDEL	.											.	KCNJ8	59	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.1193_1210del						.																																			SO:0001651	inframe_deletion	3764	exon3			.	BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.1192_1209delATCCGAAGGAACAATTCT	chr12.hg19:g.21918723_21918740delAGAATTGTTCCTTCGGAT	ENSP00000240662:p.Ile398_Ser403del	105.0	0.0		115.0	21.0	NM_004982	O00657	In_Frame_Del	DEL	ENST00000240662.2	hg19	CCDS8692.1																																																																																			.	.		0.413	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402226.1	NM_004982	
IFITM3	10410	hgsc.bcm.edu	37	11	320637	320637	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr11:320637delG	ENST00000399808.4	-	1	413	c.177delC	c.(175-177)gtcfs	p.V59fs	RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA|RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000602735.1_Frame_Shift_Del_p.V38fs|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.11_ENST00000602429.1_RNA|IFITM3_ENST00000526811.1_Frame_Shift_Del_p.V38fs	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	59					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		ACAGGGACCAGACGACATGGT	0.632																																					p.W60fs		Atlas-INDEL	.											.	IFITM3	132	.	0			c.178delT						.						95.0	100.0	98.0					11																	320637		2087	4198	6285	SO:0001589	frameshift_variant	10410	exon1			.	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.177delC	chr11.hg19:g.320637delG	ENSP00000382707:p.Val59fs	53.0	0.0		78.0	28.0	NM_021034	Q53Y76|Q96HK8|Q96J15	Frame_Shift_Del	DEL	ENST00000399808.4	hg19	CCDS41585.1																																																																																			.	.		0.632	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384765.1	NM_021034	
C19orf48	84798	hgsc.bcm.edu	37	19	51301638	51301638	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr19:51301638delG	ENST00000598463.1	-	5	1166	c.68delC	c.(67-69)ccafs	p.P23fs	C19orf48_ENST00000595794.1_5'Flank|SNORD88B_ENST00000408454.1_RNA|C19orf48_ENST00000596655.1_Frame_Shift_Del_p.P23fs|C19orf48_ENST00000391812.1_Frame_Shift_Del_p.P23fs|SNORD88A_ENST00000408314.1_RNA|C19orf48_ENST00000345523.4_Frame_Shift_Del_p.P23fs			Q6RUI8	CS048_HUMAN	chromosome 19 open reading frame 48	23										endometrium(1)|kidney(1)|lung(1)|ovary(1)	4		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00531)|GBM - Glioblastoma multiforme(134;0.0145)		GGCGGGCCCTGGCACCATGGA	0.622																																					p.P23fs		Atlas-INDEL	.											.	C19orf48	11	.	0			c.69delA						.						85.0	83.0	84.0					19																	51301638		2203	4300	6503	SO:0001589	frameshift_variant	84798	exon5			.	BC037227	CCDS12803.1	19q13.33	2012-10-26			ENSG00000167747	ENSG00000167747			29667	protein-coding gene	gene with protein product	"""multidrug resistance-related protein"""					12452007	Standard	NM_001290154		Approved	MGC13170	uc002ptg.3	Q6RUI8		ENST00000598463.1:c.68delC	chr19.hg19:g.51301638delG	ENSP00000471463:p.Pro23fs	51.0	0.0		72.0	21.0	NM_199249		Frame_Shift_Del	DEL	ENST00000598463.1	hg19	CCDS12803.1																																																																																			.	.		0.622	C19orf48-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464107.1	NM_032712	
TNRC6A	27327	hgsc.bcm.edu	37	16	24788418	24788441	+	In_Frame_Del	DEL	CAGCAGCAGCCACAGCCGCAGCCG	CAGCAGCAGCCACAGCCGCAGCCG	-	rs201560222|rs71156436|rs10593507|rs60829899|rs11644562|rs71383714	byFrequency	TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	CAGCAGCAGCCACAGCCGCAGCCG	CAGCAGCAGCCACAGCCGCAGCCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr16:24788418_24788441delCAGCAGCAGCCACAGCCGCAGCCG	ENST00000395799.3	+	5	457_480	c.328_351delCAGCAGCAGCCACAGCCGCAGCCG	c.(328-351)cagcagcagccacagccgcagccgdel	p.QQQPQPQP110del	TNRC6A_ENST00000315183.7_In_Frame_Del_p.QQQPQPQP110del	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	110	Gln-rich.|Interaction with argonaute family proteins.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P117P(1)		breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		gcagcagccacagcagcagccacagccgcagccgcagcagcagc	0.58																																					p.109_117del		Atlas-INDEL	.											.	TNRC6A	171	.	1	Substitution - coding silent(1)	endometrium(1)	c.327_350del						.																																			SO:0001651	inframe_deletion	27327	exon5			.	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.328_351delCAGCAGCAGCCACAGCCGCAGCCG	chr16.hg19:g.24788418_24788441delCAGCAGCAGCCACAGCCGCAGCCG	ENSP00000379144:p.Gln110_Pro117del	62.0	0.0		88.0	33.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	In_Frame_Del	DEL	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	.		0.580	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
PLEKHH3	79990	hgsc.bcm.edu	37	17	40824222	40824223	+	Frame_Shift_Ins	INS	-	-	G			TCGA-ZS-A9CE-01A-11D-A36X-10	TCGA-ZS-A9CE-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c5e17d28-a154-47f9-a251-47f16437c16f	0e32e986-dd29-487a-85a2-5df371bbb9a4	g.chr17:40824222_40824223insG	ENST00000591022.1	-	7	1344_1345	c.957_958insC	c.(955-960)cccgggfs	p.G320fs	PLEKHH3_ENST00000412503.1_Frame_Shift_Ins_p.G320fs|PLEKHH3_ENST00000293349.6_Frame_Shift_Ins_p.G320fs|PLEKHH3_ENST00000456950.2_5'UTR	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	320	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GCCGGGAGCCCGGGGGGACCTG	0.678																																					p.G320fs		Atlas-INDEL	.											.	PLEKHH3	49	.	0			c.958_959insC						.																																			SO:0001589	frameshift_variant	79990	exon7			.	BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.958dupC	chr17.hg19:g.40824228_40824228dupG	ENSP00000468678:p.Gly320fs	65.0	0.0		74.0	29.0	NM_024927	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Frame_Shift_Ins	INS	ENST00000591022.1	hg19	CCDS11434.1																																																																																			.	.		0.678	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452332.1	NM_024927	
