#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PTCHD2	57540	hgsc.bcm.edu	37	1	11596435	11596435	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr1:11596435G>C	ENST00000294484.6	+	21	4009	c.3871G>C	c.(3871-3873)Gtg>Ctg	p.V1291L	PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1291L|PTCHD2_ENST00000304391.6_Missense_Mutation_p.R177P	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1291					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GCACGTGGGCGTGGCCATCGT	0.667																																					p.V1291L		Atlas-SNP	.											.	PTCHD2	193	.	0			c.G3871C						.						80.0	83.0	82.0					1																	11596435		2197	4276	6473	SO:0001583	missense	57540	exon21			GTGGGCGTGGCCA	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3871G>C	1.37:g.11596435G>C	ENSP00000294484:p.Val1291Leu	29.0	0.0		47.0	25.0	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.40|18.40	3.615180|3.615180	0.66672|0.66672	.|.	.|.	ENSG00000204624|ENSG00000204624	ENST00000304391|ENST00000294484;ENST00000389575	.|D;D	.|0.91521	.|-2.86;-1.88	4.89|4.89	4.89|4.89	0.63831|0.63831	.|Membrane transport protein, MMPL type (1);	.|0.000000	.|0.64402	.|D	.|0.000005	D|D	0.91801|0.91801	0.7406|0.7406	L|L	0.38531|0.38531	1.155|1.155	0.58432|0.58432	D|D	0.999992|0.999992	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	D|D	0.88490|0.88490	0.3075|0.3075	6|10	0.87932|0.11182	D|T	0|0.66	-26.0944|-26.0944	17.0791|17.0791	0.86593|0.86593	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1291	.|Q9P2K9	.|PTHD2_HUMAN	P|L	177|1291	.|ENSP00000294484:V1291L;ENSP00000374226:V1291L	ENSP00000303400:R177P|ENSP00000294484:V1291L	R|V	+|+	2|1	0|0	PTCHD2|PTCHD2	11519022|11519022	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	6.270000|6.270000	0.72563|0.72563	2.256000|2.256000	0.74724|0.74724	0.655000|0.655000	0.94253|0.94253	CGT|GTG	.	.		0.667	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
TRMT13	54482	hgsc.bcm.edu	37	1	100605738	100605738	+	Splice_Site	SNP	G	G	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr1:100605738G>C	ENST00000370141.2	+	5	331	c.325G>C	c.(325-327)Gtt>Ctt	p.V109L	TRMT13_ENST00000370143.1_Intron|TRMT13_ENST00000370139.1_Splice_Site_p.V78L	NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	109					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										TTGTATATAGGTTCCAATTTC	0.333																																					p.V109L		Atlas-SNP	.											.	.	.	.	0			c.G325C						.						44.0	43.0	44.0					1																	100605738		2200	4298	6498	SO:0001630	splice_region_variant	54482	exon5			ATATAGGTTCCAA	BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.325-1G>C	1.37:g.100605738G>C		69.0	0.0		72.0	28.0	NM_019083	Q5VVL0|Q9NW65	Missense_Mutation	SNP	ENST00000370141.2	37	CCDS765.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711719	0.48517	.	.	ENSG00000122435	ENST00000370141;ENST00000370139	T;T	0.45276	0.97;0.9	5.66	5.66	0.87406	.	0.108658	0.64402	D	0.000006	T	0.25494	0.0620	M	0.61703	1.905	0.49483	D	0.999797	B;P	0.39391	0.1;0.671	B;B	0.32393	0.031;0.145	T	0.07809	-1.0753	9	.	.	.	-21.0263	14.3978	0.67022	0.0:0.0:0.853:0.147	.	109;109	B4DQS9;Q9NUP7	.;TRM13_HUMAN	L	109;78	ENSP00000359160:V109L;ENSP00000359158:V78L	.	V	+	1	0	CCDC76	100378326	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.302000	0.51849	2.672000	0.90937	0.650000	0.86243	GTT	.	.		0.333	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029919.1	NM_019083	Missense_Mutation
F5	2153	hgsc.bcm.edu	37	1	169521852	169521852	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr1:169521852C>A	ENST00000367797.3	-	8	1440	c.1239G>T	c.(1237-1239)atG>atT	p.M413I	F5_ENST00000367796.3_Missense_Mutation_p.M413I|F5_ENST00000546081.1_Missense_Mutation_p.M276I	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	413	F5/8 type A 2.|Plastocyanin-like 3.		M -> T (in dbSNP:rs6033). {ECO:0000269|PubMed:10391209, ECO:0000269|Ref.3}.		blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CATCTTCTTTCATATTGGGAT	0.358																																					p.M413I		Atlas-SNP	.											F5,larynx,carcinoma,-2,1	F5	301	1	0			c.G1239T						.						154.0	154.0	154.0					1																	169521852		2203	4300	6503	SO:0001583	missense	2153	exon8			TTCTTTCATATTG	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.1239G>T	1.37:g.169521852C>A	ENSP00000356771:p.Met413Ile	120.0	0.0		180.0	48.0	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	37	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	C	4.952	0.176775	0.09443	.	.	ENSG00000198734	ENST00000367797;ENST00000367796;ENST00000546081	D;D;D	0.98914	-5.23;-5.23;-5.23	5.95	-0.944	0.10392	Cupredoxin (2);	1.658480	0.02698	N	0.111473	D	0.90239	0.6948	N	0.17082	0.46	0.21740	N	0.99957	B	0.02656	0.0	B	0.01281	0.0	D	0.88693	0.3210	9	0.27785	T	0.31	0.7786	5.4661	0.16644	0.0598:0.2597:0.376:0.3044	.	413	P12259	FA5_HUMAN	I	413;413;276	ENSP00000356771:M413I;ENSP00000356770:M413I;ENSP00000439664:M276I	ENSP00000356770:M413I	M	-	3	0	F5	167788476	0.000000	0.05858	0.000000	0.03702	0.548000	0.35241	-0.226000	0.09139	-0.443000	0.07180	-0.165000	0.13383	ATG	.	.		0.358	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
ZBTB37	84614	hgsc.bcm.edu	37	1	173840092	173840092	+	Silent	SNP	A	A	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr1:173840092A>G	ENST00000367701.5	+	2	920	c.729A>G	c.(727-729)gtA>gtG	p.V243V	ZBTB37_ENST00000432989.1_Silent_p.V243V|ZBTB37_ENST00000427304.1_Silent_p.V243V|ZBTB37_ENST00000367702.1_Silent_p.V243V|ZBTB37_ENST00000367704.1_Silent_p.V243V			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						TTGGAGCAGTACACATCAAAA	0.517																																					p.V243V		Atlas-SNP	.											.	ZBTB37	38	.	0			c.A729G						.						93.0	95.0	94.0					1																	173840092		2203	4300	6503	SO:0001819	synonymous_variant	84614	exon3			AGCAGTACACATC	AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.729A>G	1.37:g.173840092A>G		146.0	0.0		172.0	54.0	NM_032522	Q5TC80|Q96M87|Q9BQ88	Silent	SNP	ENST00000367701.5	37	CCDS44278.1																																																																																			.	.		0.517	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090729.2	NM_032522	
C1orf106	55765	hgsc.bcm.edu	37	1	200870236	200870236	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr1:200870236C>T	ENST00000367342.4	+	5	924	c.724C>T	c.(724-726)Cgg>Tgg	p.R242W	C1orf106_ENST00000413687.2_Missense_Mutation_p.R157W	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	242										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						CCTGGTCGAGCGGCGGCGCAA	0.667																																					p.R256W		Atlas-SNP	.											.	C1orf106	59	.	0			c.C766T						.						6.0	8.0	7.0					1																	200870236		1819	3508	5327	SO:0001583	missense	55765	exon5			GTCGAGCGGCGGC	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.724C>T	1.37:g.200870236C>T	ENSP00000356311:p.Arg242Trp	57.0	0.0		75.0	27.0	NM_018265	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		.	.	.	.	.	.	.	.	.	.	C	14.98	2.697800	0.48307	.	.	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.45276	0.9;0.92	4.15	2.08	0.27032	.	0.601193	0.16332	N	0.219076	T	0.39145	0.1067	L	0.51422	1.61	0.09310	N	1	D	0.69078	0.997	P	0.50231	0.635	T	0.19516	-1.0303	9	.	.	.	-9.3204	3.3503	0.07150	0.205:0.5733:0.0:0.2217	.	242	Q3KP66	CA106_HUMAN	W	242;157	ENSP00000356311:R242W;ENSP00000392105:R157W	.	R	+	1	2	C1orf106	199136859	0.291000	0.24352	0.184000	0.23157	0.043000	0.13939	0.608000	0.24223	0.854000	0.35336	0.460000	0.39030	CGG	.	.		0.667	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
TSNAX	7257	hgsc.bcm.edu	37	1	231700450	231700450	+	Silent	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr1:231700450T>C	ENST00000366639.4	+	6	830	c.672T>C	c.(670-672)gtT>gtC	p.V224V	TSNAX-DISC1_ENST00000602962.1_Intron	NM_005999.2	NP_005990.1	Q99598	TSNAX_HUMAN	translin-associated factor X	224					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		all_cancers(173;0.0395)|Acute lymphoblastic leukemia(190;3.76e-06)|Prostate(94;0.116)				TACGTCAGGTTTATGATGGGT	0.428																																					p.V224V		Atlas-SNP	.											.	TSNAX	14	.	0			c.T672C						.						210.0	197.0	202.0					1																	231700450		2203	4300	6503	SO:0001819	synonymous_variant	7257	exon6			TCAGGTTTATGAT	X95073	CCDS1596.1	1q42.2	2008-02-05			ENSG00000116918	ENSG00000116918			12380	protein-coding gene	gene with protein product		602964				9013868	Standard	NM_005999		Approved	TRAX	uc001huw.3	Q99598	OTTHUMG00000039486	ENST00000366639.4:c.672T>C	1.37:g.231700450T>C		240.0	0.0		241.0	105.0	NM_005999	B1APC6	Silent	SNP	ENST00000366639.4	37	CCDS1596.1																																																																																			.	.		0.428	TSNAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095267.2	NM_005999	
SMYD3	64754	hgsc.bcm.edu	37	1	246498775	246498775	+	Splice_Site	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr1:246498775T>C	ENST00000388985.4	-	3	229	c.230A>G	c.(229-231)aAa>aGa	p.K77R	SMYD3_ENST00000403792.3_Splice_Site_p.K77R|SMYD3_ENST00000490107.1_Splice_Site_p.K18R|SMYD3_ENST00000541742.1_Splice_Site_p.K18R			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	77	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CCAAGCTTTTTTCTATTAAAA	0.378																																					p.K77R		Atlas-SNP	.											.	SMYD3	77	.	0			c.A230G						.						108.0	111.0	110.0					1																	246498775		2203	4300	6503	SO:0001630	splice_region_variant	64754	exon3			GCTTTTTTCTATT	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.229-1A>G	1.37:g.246498775T>C		62.0	0.0		87.0	45.0	NM_001167740	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Missense_Mutation	SNP	ENST00000388985.4	37	CCDS53486.1	.	.	.	.	.	.	.	.	.	.	T	8.661	0.900561	0.17686	.	.	ENSG00000185420	ENST00000541742;ENST00000490107;ENST00000388985;ENST00000453676;ENST00000403792;ENST00000455277	T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5	5.41	3.09	0.35607	SET domain (2);Zinc finger, MYND-type (3);	0.237642	0.34879	N	0.003611	T	0.06735	0.0172	N	0.10972	0.075	0.41608	D	0.988891	B	0.24882	0.113	B	0.24269	0.052	T	0.36768	-0.9734	10	0.28530	T	0.3	-4.4062	7.8345	0.29362	0.0:0.2301:0.0:0.7699	.	77	Q9H7B4	SMYD3_HUMAN	R	18;18;77;18;77;18	ENSP00000444184:K18R;ENSP00000419184:K18R;ENSP00000373637:K77R;ENSP00000408122:K18R;ENSP00000385380:K77R	ENSP00000373637:K77R	K	-	2	0	SMYD3	244565398	1.000000	0.71417	1.000000	0.80357	0.212000	0.24457	3.123000	0.50453	0.449000	0.26747	-0.256000	0.11100	AAA	.	.		0.378	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022743	Missense_Mutation
PXDN	7837	hgsc.bcm.edu	37	2	1653379	1653379	+	Missense_Mutation	SNP	C	C	T	rs374347969		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:1653379C>T	ENST00000252804.4	-	17	2223	c.2173G>A	c.(2173-2175)Gcc>Acc	p.A725T		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	725					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CGCCGGTGGGCGGTACAGCCC	0.592																																					p.A725T		Atlas-SNP	.											.	PXDN	255	.	0			c.G2173A						.	C	THR/ALA	0,4178		0,0,2089	76.0	82.0	80.0		2173	5.6	0.4	2		80	1,8431		0,1,4215	no	missense	PXDN	NM_012293.1	58	0,1,6304	TT,TC,CC		0.0119,0.0,0.0079	benign	725/1480	1653379	1,12609	2089	4216	6305	SO:0001583	missense	7837	exon17			GGTGGGCGGTACA	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2173G>A	2.37:g.1653379C>T	ENSP00000252804:p.Ala725Thr	172.0	0.0		169.0	70.0	NM_012293	A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	ENST00000252804.4	37	CCDS46221.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.729138	0.30684	0.0	1.19E-4	ENSG00000130508	ENST00000252804	T	0.61742	0.08	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.47746	0.1462	L	0.47078	1.49	0.53005	D	0.999962	B	0.33288	0.406	B	0.28709	0.093	T	0.41752	-0.9491	10	0.26408	T	0.33	-47.2078	12.9957	0.58646	0.0:0.9264:0.0:0.0736	.	725	Q92626	PXDN_HUMAN	T	725	ENSP00000252804:A725T	ENSP00000252804:A725T	A	-	1	0	PXDN	1632386	1.000000	0.71417	0.399000	0.26333	0.102000	0.19082	5.982000	0.70532	2.661000	0.90470	0.558000	0.71614	GCC	.	.		0.592	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322505.1	XM_056455	
PROM2	150696	hgsc.bcm.edu	37	2	95941842	95941842	+	Silent	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:95941842C>A	ENST00000317620.9	+	3	592	c.459C>A	c.(457-459)gcC>gcA	p.A153A	PROM2_ENST00000463580.1_Intron|PROM2_ENST00000317668.4_Silent_p.A153A|PROM2_ENST00000403131.2_Silent_p.A153A|PROM2_ENST00000542147.1_Silent_p.A153A	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	153					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						AGCGCGCGGCCCTCATGGTCT	0.697																																					p.A153A		Atlas-SNP	.											.	PROM2	78	.	0			c.C459A						.						43.0	54.0	51.0					2																	95941842		2203	4300	6503	SO:0001819	synonymous_variant	150696	exon3			CGCGGCCCTCATG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.459C>A	2.37:g.95941842C>A		108.0	0.0		84.0	38.0	NM_001165977	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Silent	SNP	ENST00000317620.9	37	CCDS2012.1																																																																																			.	.		0.697	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
GLI2	2736	hgsc.bcm.edu	37	2	121745822	121745822	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:121745822G>A	ENST00000452319.1	+	14	2392	c.2332G>A	c.(2332-2334)Ggg>Agg	p.G778R	GLI2_ENST00000314490.11_Missense_Mutation_p.G450R|GLI2_ENST00000361492.4_Missense_Mutation_p.G778R					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				Tgggggcggcgggcccgcggg	0.697																																					p.G778R		Atlas-SNP	.											.	GLI2	187	.	0			c.G2332A						.						8.0	10.0	9.0					2																	121745822		2147	4228	6375	SO:0001583	missense	2736	exon13			GGCGGCGGGCCCG		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.2332G>A	2.37:g.121745822G>A	ENSP00000390436:p.Gly778Arg	791.0	0.0		695.0	304.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312850	0.23908	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	D;D;D	0.93426	-3.22;-3.22;-3.22	4.17	3.2	0.36748	.	0.675275	0.15638	N	0.252034	D	0.94460	0.8217	M	0.75777	2.31	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;0.996;1.0	D;D;P;D	0.85130	0.994;0.997;0.766;0.934	D	0.85080	0.0945	10	0.13853	T	0.58	.	3.4888	0.07630	0.233:0.0:0.5561:0.211	.	778;433;433;450	P10070;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.	R	778;778;450	ENSP00000390436:G778R;ENSP00000354586:G778R;ENSP00000312694:G450R	ENSP00000312694:G450R	G	+	1	0	GLI2	121462292	0.992000	0.36948	0.032000	0.17829	0.059000	0.15707	2.119000	0.41958	0.959000	0.37980	0.561000	0.74099	GGG	.	.		0.697	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
LCT	3938	hgsc.bcm.edu	37	2	136570094	136570094	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:136570094T>A	ENST00000264162.2	-	7	2150	c.2140A>T	c.(2140-2142)Aac>Tac	p.N714Y	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	714	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CACACATGGTTCACGTGTTGG	0.537																																					p.N714Y		Atlas-SNP	.											.	LCT	309	.	0			c.A2140T						.						103.0	99.0	101.0					2																	136570094		2203	4300	6503	SO:0001583	missense	3938	exon7			CATGGTTCACGTG	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2140A>T	2.37:g.136570094T>A	ENSP00000264162:p.Asn714Tyr	203.0	0.0		264.0	83.0	NM_002299	Q4ZG58	Missense_Mutation	SNP	ENST00000264162.2	37	CCDS2178.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561772	0.65538	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.53206	0.63	5.66	3.86	0.44501	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.273821	0.40064	N	0.001181	T	0.45357	0.1338	L	0.28740	0.885	0.36344	D	0.859649	P	0.51791	0.948	P	0.51229	0.663	T	0.56220	-0.8015	10	0.87932	D	0	-27.613	11.5005	0.50435	0.0:0.8532:0.0:0.1468	.	714	P09848	LPH_HUMAN	Y	714;146	ENSP00000264162:N714Y	ENSP00000264162:N714Y	N	-	1	0	LCT	136286564	1.000000	0.71417	0.065000	0.19835	0.746000	0.42486	4.897000	0.63231	0.734000	0.32515	-0.242000	0.12053	AAC	.	.		0.537	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254657.1	NM_002299	
UBR3	130507	hgsc.bcm.edu	37	2	170936401	170936401	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:170936401G>C	ENST00000272793.5	+	37	5327	c.5277G>C	c.(5275-5277)caG>caC	p.Q1759H	UBR3_ENST00000392631.1_Missense_Mutation_p.Q580H|UBR3_ENST00000418381.1_Missense_Mutation_p.Q1759H			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1759					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						CCATTTTTCAGTACTACCACA	0.388																																					p.Q1759H		Atlas-SNP	.											.	UBR3	182	.	0			c.G5277C						.						118.0	109.0	112.0					2																	170936401		2203	4300	6503	SO:0001583	missense	130507	exon37			TTTTCAGTACTAC	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.5277G>C	2.37:g.170936401G>C	ENSP00000272793:p.Gln1759His	132.0	0.0		145.0	64.0	NM_172070	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.16|19.16	3.774315|3.774315	0.69992|0.69992	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681|ENST00000392632	T;T;T;T|.	0.49432|.	0.78;0.78;0.78;0.78|.	5.66|5.66	4.78|4.78	0.61160|0.61160	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62804|0.62804	0.2458|0.2458	L|L	0.60455|0.60455	1.87|1.87	0.40880|0.40880	D|D	0.983983|0.983983	D;D;D|.	0.76494|.	0.99;0.999;0.98|.	D;D;D|.	0.85130|.	0.979;0.997;0.965|.	T|T	0.61594|0.61594	-0.7031|-0.7031	10|5	0.46703|.	T|.	0.11|.	.|.	10.2773|10.2773	0.43519|0.43519	0.1471:0.0:0.8529:0.0|0.1471:0.0:0.8529:0.0	.|.	1759;580;1788|.	Q6ZT12;Q6ZT12-2;E7EVK3|.	UBR3_HUMAN;.;.|.	H|T	1759;1788;1759;580;459|821	ENSP00000272793:Q1759H;ENSP00000396068:Q1759H;ENSP00000376408:Q580H;ENSP00000389097:Q459H|.	ENSP00000272793:Q1759H|.	Q|S	+|+	3|2	2|0	UBR3|UBR3	170644647|170644647	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.503000|5.503000	0.66962|0.66962	2.653000|2.653000	0.90120|0.90120	0.650000|0.650000	0.86243|0.86243	CAG|AGT	.	.		0.388	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000255290.2	NM_172070	
AGPS	8540	hgsc.bcm.edu	37	2	178257523	178257523	+	Silent	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:178257523G>T	ENST00000264167.4	+	1	152	c.6G>T	c.(4-6)gcG>gcT	p.A2A	AGPS_ENST00000409888.1_Silent_p.A2A|NFE2L2_ENST00000464747.1_5'Flank|AC074286.1_ENST00000397057.2_RNA	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	2	Poly-Ala.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			TAGCCATGGCGGAGGCGGCGG	0.771																																					p.A2A		Atlas-SNP	.											.	AGPS	56	.	0			c.G6T						.						3.0	3.0	3.0					2																	178257523		1265	2959	4224	SO:0001819	synonymous_variant	8540	exon1			CATGGCGGAGGCG	Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.6G>T	2.37:g.178257523G>T		66.0	0.0		61.0	23.0	NM_003659	A5D8U9|Q2TU35	Silent	SNP	ENST00000264167.4	37	CCDS2275.1																																																																																			.	.		0.771	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255730.2		
OSBPL6	114880	hgsc.bcm.edu	37	2	179197657	179197657	+	Silent	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:179197657T>C	ENST00000190611.4	+	8	922	c.546T>C	c.(544-546)taT>taC	p.Y182Y	OSBPL6_ENST00000357080.4_Silent_p.Y182Y|OSBPL6_ENST00000409045.3_Silent_p.Y182Y|OSBPL6_ENST00000409631.1_Silent_p.Y182Y|OSBPL6_ENST00000392505.2_Silent_p.Y182Y|OSBPL6_ENST00000315022.2_Silent_p.Y161Y|OSBPL6_ENST00000359685.3_Silent_p.Y182Y	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	182					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			ATCGGTTGTATCGTCAGAATG	0.408																																					p.Y182Y		Atlas-SNP	.											.	OSBPL6	178	.	0			c.T546C						.						161.0	151.0	154.0					2																	179197657		2203	4300	6503	SO:0001819	synonymous_variant	114880	exon8			GTTGTATCGTCAG	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.546T>C	2.37:g.179197657T>C		167.0	0.0		200.0	79.0	NM_001201482	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Silent	SNP	ENST00000190611.4	37	CCDS2277.1																																																																																			.	.		0.408	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
TTN	7273	hgsc.bcm.edu	37	2	179479290	179479290	+	Silent	SNP	A	A	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:179479290A>T	ENST00000591111.1	-	211	44252	c.44028T>A	c.(44026-44028)acT>acA	p.T14676T	RP11-171I2.4_ENST00000605334.1_lincRNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Silent_p.T7377T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.T7252T|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Silent_p.T16317T|TTN_ENST00000342175.6_Silent_p.T7444T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Silent_p.T13749T			Q8WZ42	TITIN_HUMAN	titin	14676	Ig-like 96.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATCAACAATAGTCACTGTGG	0.418																																					p.T16317T		Atlas-SNP	.											.	TTN	18412	.	0			c.T48951A						.						113.0	106.0	108.0					2																	179479290		1931	4127	6058	SO:0001819	synonymous_variant	7273	exon261			AACAATAGTCACT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.44028T>A	2.37:g.179479290A>T		87.0	0.0		106.0	40.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	37																																																																																				.	.		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
BARD1	580	hgsc.bcm.edu	37	2	215674279	215674279	+	Silent	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:215674279C>A	ENST00000260947.4	-	1	149	c.15G>T	c.(13-15)cgG>cgT	p.R5R	AC072062.1_ENST00000607412.1_RNA|BARD1_ENST00000449967.2_5'UTR|BARD1_ENST00000471787.1_5'UTR	NM_000465.2|NM_001282543.1|NM_001282545.1|NM_001282548.1	NP_000456.2|NP_001269472.1|NP_001269474.1|NP_001269477.1	Q99728	BARD1_HUMAN	BRCA1 associated RING domain 1	5					cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA 3'-end processing (GO:0031441)|negative regulation of protein export from nucleus (GO:0046826)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein catabolic process (GO:0045732)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of phosphorylation (GO:0042325)|tissue homeostasis (GO:0001894)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	kinase binding (GO:0019900)|ligase activity (GO:0016874)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|prostate(4)|upper_aerodigestive_tract(1)	35		Renal(323;0.0243)		Epithelial(149;3.2e-06)|all cancers(144;0.000461)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCCTCGGCTGCCGATTATCCG	0.677									Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.R5R		Atlas-SNP	.											.	BARD1	138	.	0			c.G15T						.																																			SO:0001819	synonymous_variant	580	exon1	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CGGCTGCCGATTA		CCDS2397.1, CCDS74645.1, CCDS74646.1, CCDS74647.1, CCDS74648.1	2q34-q35	2013-01-10			ENSG00000138376	ENSG00000138376		"""Ankyrin repeat domain containing"""	952	protein-coding gene	gene with protein product		601593				8944023, 9425226, 15159397	Standard	NM_001282548		Approved		uc002veu.2	Q99728	OTTHUMG00000133016	ENST00000260947.4:c.15G>T	2.37:g.215674279C>A		93.0	0.0		123.0	46.0	NM_000465	F6MDH7|F6MDH8|F6MDH9|O43574|Q53SS5	Silent	SNP	ENST00000260947.4	37	CCDS2397.1																																																																																			.	.		0.677	BARD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256602.1	NM_000465	
ASIC4	55515	hgsc.bcm.edu	37	2	220396805	220396805	+	Silent	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr2:220396805G>A	ENST00000347842.3	+	3	1205	c.1191G>A	c.(1189-1191)ggG>ggA	p.G397G	ASIC4_ENST00000473709.1_3'UTR|ASIC4_ENST00000358078.4_Silent_p.G397G	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	397					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										TGGGGTTCGGGGTGTCCCCAG	0.622																																					p.G397G		Atlas-SNP	.											.	.	.	.	0			c.G1191A						.						67.0	73.0	71.0					2																	220396805		2203	4300	6503	SO:0001819	synonymous_variant	55515	exon3			GTTCGGGGTGTCC	AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.1191G>A	2.37:g.220396805G>A		173.0	0.0		144.0	25.0	NM_182847	Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Silent	SNP	ENST00000347842.3	37	CCDS2442.1																																																																																			.	.		0.622	ASIC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130263.1	NM_018674	
ITPR1	3708	hgsc.bcm.edu	37	3	4716014	4716014	+	Missense_Mutation	SNP	A	A	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr3:4716014A>T	ENST00000443694.2	+	19	2540	c.2540A>T	c.(2539-2541)aAg>aTg	p.K847M	ITPR1_ENST00000357086.4_Missense_Mutation_p.K862M|ITPR1_ENST00000423119.2_Missense_Mutation_p.K862M|ITPR1_ENST00000456211.2_Missense_Mutation_p.K847M|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000302640.8_Missense_Mutation_p.K847M|ITPR1_ENST00000354582.6_Missense_Mutation_p.K862M			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	862					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GAGAAGAATAAGCTTACGTTT	0.378																																					p.K862M		Atlas-SNP	.											.	ITPR1	659	.	0			c.A2585T						.						125.0	118.0	120.0					3																	4716014		1834	4085	5919	SO:0001583	missense	3708	exon22			AGAATAAGCTTAC	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2540A>T	3.37:g.4716014A>T	ENSP00000401671:p.Lys847Met	112.0	0.0		121.0	11.0	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445075	0.83993	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.92495	-3.04;-3.05;-3.04;-3.04;-3.04;-3.04	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.95887	0.8661	M	0.84082	2.675	0.80722	D	1	P;D;P	0.89917	0.956;1.0;0.94	P;D;B	0.74023	0.706;0.982;0.379	D	0.95141	0.8264	10	0.33940	T	0.23	.	15.7832	0.78281	1.0:0.0:0.0:0.0	.	847;862;862	E7EPX7;Q14643;G5E9P1	.;ITPR1_HUMAN;.	M	862;847;862;862;862;847;847	ENSP00000306253:K847M;ENSP00000346595:K862M;ENSP00000405934:K862M;ENSP00000349597:K862M;ENSP00000397885:K847M;ENSP00000401671:K847M	ENSP00000306253:K847M	K	+	2	0	ITPR1	4691014	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.676000	0.91199	2.302000	0.77476	0.533000	0.62120	AAG	.	.		0.378	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
SCN11A	11280	hgsc.bcm.edu	37	3	38962724	38962724	+	Silent	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr3:38962724G>T	ENST00000302328.3	-	6	933	c.735C>A	c.(733-735)gcC>gcA	p.A245A	SCN11A_ENST00000450244.1_Silent_p.A245A|SCN11A_ENST00000456224.3_Silent_p.A245A|SCN11A_ENST00000444237.2_Silent_p.A245A	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	245					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A245A(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGCGTAGCAAGGCCCCCACGA	0.542																																					p.A245A		Atlas-SNP	.											SCN11A,NS,carcinoma,0,1	SCN11A	296	1	1	Substitution - coding silent(1)	kidney(1)	c.C735A						.						102.0	99.0	100.0					3																	38962724		2203	4300	6503	SO:0001819	synonymous_variant	11280	exon6			TAGCAAGGCCCCC	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.735C>A	3.37:g.38962724G>T		161.0	1.0		206.0	78.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1																																																																																			.	.		0.542	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
XIRP1	165904	hgsc.bcm.edu	37	3	39228541	39228541	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr3:39228541T>A	ENST00000340369.3	-	2	2624	c.2396A>T	c.(2395-2397)gAg>gTg	p.E799V	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.E799V	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	799					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		AAGACAGAGCTCCCCTGGCCC	0.612																																					p.E799V		Atlas-SNP	.											.	XIRP1	173	.	0			c.A2396T						.						64.0	65.0	65.0					3																	39228541		2203	4300	6503	SO:0001583	missense	165904	exon2			CAGAGCTCCCCTG	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.2396A>T	3.37:g.39228541T>A	ENSP00000343140:p.Glu799Val	130.0	0.0		169.0	15.0	NM_001198621	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	T	16.43	3.120362	0.56613	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05513	3.43;3.82	4.11	2.85	0.33270	.	0.334304	0.29431	N	0.012178	T	0.08758	0.0217	L	0.51422	1.61	0.80722	D	1	P;P	0.50943	0.94;0.892	P;B	0.46144	0.505;0.406	T	0.06679	-1.0813	10	0.62326	D	0.03	.	8.9432	0.35742	0.0:0.0:0.1861:0.8139	.	799;799	Q702N8;Q702N8-2	XIRP1_HUMAN;.	V	799	ENSP00000379550:E799V;ENSP00000343140:E799V	ENSP00000343140:E799V	E	-	2	0	XIRP1	39203545	0.002000	0.14202	1.000000	0.80357	0.976000	0.68499	1.002000	0.29796	1.873000	0.54277	0.460000	0.39030	GAG	.	.		0.612	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
SCAP	22937	hgsc.bcm.edu	37	3	47459072	47459072	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr3:47459072G>A	ENST00000265565.5	-	17	3104	c.2692C>T	c.(2692-2694)Cgg>Tgg	p.R898W	SCAP_ENST00000441517.2_Missense_Mutation_p.R642W|SCAP_ENST00000545718.1_Missense_Mutation_p.R505W	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	898	Interaction with SREBF2. {ECO:0000250}.				aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CAGACCGCCCGGTGCCGGGGC	0.662																																					p.R898W	Pancreas(149;978 1908 29304 37806 46700)	Atlas-SNP	.											.	SCAP	88	.	0			c.C2692T						.						7.0	9.0	8.0					3																	47459072		2121	4188	6309	SO:0001583	missense	22937	exon17			CCGCCCGGTGCCG	BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.2692C>T	3.37:g.47459072G>A	ENSP00000265565:p.Arg898Trp	252.0	0.0		231.0	113.0	NM_012235	Q8N2E0|Q8WUA1	Missense_Mutation	SNP	ENST00000265565.5	37	CCDS2755.2	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194997	0.78902	.	.	ENSG00000114650	ENST00000360832;ENST00000265565;ENST00000441517;ENST00000545718	T;T;T	0.80994	-1.44;-1.4;0.73	4.85	4.85	0.62838	.	0.000000	0.64402	D	0.000017	D	0.84014	0.5379	L	0.29908	0.895	0.48135	D	0.999594	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.965	D	0.84074	0.0381	10	0.41790	T	0.15	-31.6416	17.7353	0.88391	0.0:0.0:1.0:0.0	.	642;898	F8W921;Q12770	.;SCAP_HUMAN	W	524;898;642;505	ENSP00000265565:R898W;ENSP00000416847:R642W;ENSP00000438956:R505W	ENSP00000265565:R898W	R	-	1	2	SCAP	47434076	0.976000	0.34144	0.998000	0.56505	0.538000	0.34931	0.923000	0.28757	2.513000	0.84729	0.561000	0.74099	CGG	.	.		0.662	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246872.2	NM_012235	
OR5H14	403273	hgsc.bcm.edu	37	3	97869095	97869095	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr3:97869095T>C	ENST00000437310.1	+	1	926	c.866T>C	c.(865-867)aTc>aCc	p.I289T	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						AATCCCATGATCTACAGCCTG	0.348																																					p.I289T		Atlas-SNP	.											.	OR5H14	56	.	0			c.T866C						.						45.0	44.0	44.0					3																	97869095		2202	4296	6498	SO:0001583	missense	403273	exon1			CCATGATCTACAG		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.866T>C	3.37:g.97869095T>C	ENSP00000401706:p.Ile289Thr	162.0	0.0		172.0	70.0	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	T	11.56	1.675075	0.29783	.	.	ENSG00000236032	ENST00000437310	T	0.57273	0.41	2.49	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000212	T	0.75635	0.3876	H	0.96720	3.87	0.26098	N	0.980854	D	0.62365	0.991	P	0.60949	0.881	T	0.68872	-0.5294	10	0.87932	D	0	.	8.4219	0.32705	0.0:0.0:0.0:1.0	.	289	A6NHG9	O5H14_HUMAN	T	289	ENSP00000401706:I289T	ENSP00000401706:I289T	I	+	2	0	OR5H14	99351785	1.000000	0.71417	0.996000	0.52242	0.133000	0.20885	6.893000	0.75649	1.132000	0.42129	0.164000	0.16699	ATC	.	.		0.348	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
MED12L	116931	hgsc.bcm.edu	37	3	150876484	150876484	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr3:150876484G>A	ENST00000474524.1	+	6	773	c.735G>A	c.(733-735)atG>atA	p.M245I	MED12L_ENST00000422248.2_Missense_Mutation_p.M245I|MED12L_ENST00000309237.4_Missense_Mutation_p.M245I|MED12L_ENST00000273432.4_Missense_Mutation_p.M245I	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	245						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGGAAGGAATGTTAGAAAAAC	0.308																																					p.M245I		Atlas-SNP	.											.	MED12L	271	.	0			c.G735A						.						72.0	69.0	70.0					3																	150876484		2203	4300	6503	SO:0001583	missense	116931	exon6			AGGAATGTTAGAA	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.735G>A	3.37:g.150876484G>A	ENSP00000417235:p.Met245Ile	135.0	0.0		190.0	109.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.543570	0.86022	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524;ENST00000273432	T;T;T;T	0.61274	0.45;0.43;0.31;0.12	5.07	5.07	0.68467	.	0.046152	0.85682	D	0.000000	T	0.69797	0.3151	L	0.58101	1.795	0.34666	D	0.723237	B;B;B;P	0.44281	0.073;0.131;0.206;0.831	B;B;B;P	0.54664	0.024;0.039;0.059;0.758	T	0.79112	-0.1937	10	0.87932	D	0	-18.1091	18.4436	0.90676	0.0:0.0:1.0:0.0	.	245;245;245;245	F8WAE6;Q86YW9;Q86YW9-2;Q86YW9-3	.;MD12L_HUMAN;.;.	I	245	ENSP00000403308:M245I;ENSP00000310760:M245I;ENSP00000417235:M245I;ENSP00000273432:M245I	ENSP00000273432:M245I	M	+	3	0	MED12L	152359174	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.194000	0.89721	2.519000	0.84933	0.467000	0.42956	ATG	.	.		0.308	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
UGT2B7	7364	hgsc.bcm.edu	37	4	69962260	69962260	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr4:69962260G>T	ENST00000508661.1	+	1	49	c.22G>T	c.(22-24)Gta>Tta	p.V8L	UGT2B7_ENST00000509763.1_Intron|UGT2B7_ENST00000305231.7_Missense_Mutation_p.V8L			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	8					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ATGGACTTCAGTAATTTTGCT	0.403																																					p.V8L		Atlas-SNP	.											.	UGT2B7	79	.	0			c.G22T						.						127.0	126.0	126.0					4																	69962260		2203	4300	6503	SO:0001583	missense	7364	exon1			ACTTCAGTAATTT	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.22G>T	4.37:g.69962260G>T	ENSP00000427659:p.Val8Leu	81.0	0.0		103.0	30.0	NM_001074	B2R810|Q6GTW0	Missense_Mutation	SNP	ENST00000508661.1	37		.	.	.	.	.	.	.	.	.	.	G	9.040	0.989448	0.18966	.	.	ENSG00000171234	ENST00000305231;ENST00000508661	T;T	0.59502	0.26;0.9	2.54	-5.08	0.02929	.	0.760929	0.10779	U	0.635043	T	0.36663	0.0975	N	0.17082	0.46	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.12837	0.003;0.008	T	0.23511	-1.0186	9	.	.	.	.	14.6506	0.68794	0.0:0.1845:0.8155:0.0	.	8;8	E9PBP8;P16662	.;UD2B7_HUMAN	L	8	ENSP00000304811:V8L;ENSP00000427659:V8L	.	V	+	1	0	UGT2B7	69996849	.	.	0.000000	0.03702	0.007000	0.05969	.	.	-1.053000	0.03218	0.313000	0.20887	GTA	.	.		0.403	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074	
AFP	174	hgsc.bcm.edu	37	4	74303922	74303922	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr4:74303922G>C	ENST00000395792.2	+	3	269	c.169G>C	c.(169-171)Gaa>Caa	p.E57Q	AFP_ENST00000226359.2_Missense_Mutation_p.E57Q	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	57	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GTTTGTTCAAGAAGCCACTTA	0.393									Alpha-Fetoprotein, Hereditary Persistence of																												p.E57Q		Atlas-SNP	.											.	AFP	60	.	0			c.G169C						.						127.0	126.0	126.0					4																	74303922		2203	4300	6503	SO:0001583	missense	174	exon3	Familial Cancer Database	HPAFP	GTTCAAGAAGCCA	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.169G>C	4.37:g.74303922G>C	ENSP00000379138:p.Glu57Gln	131.0	0.0		125.0	55.0	NM_001134	B2RBU3	Missense_Mutation	SNP	ENST00000395792.2	37	CCDS3556.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276271	0.40294	.	.	ENSG00000081051	ENST00000395792;ENST00000226359	T;T	0.39056	1.1;1.1	5.29	3.57	0.40892	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.637984	0.16311	N	0.219982	T	0.32675	0.0837	L	0.42245	1.32	0.24510	N	0.994213	P	0.41393	0.748	B	0.44315	0.446	T	0.16158	-1.0412	10	0.02654	T	1	-3.1533	7.615	0.28152	0.1883:0.0:0.8117:0.0	.	57	P02771	FETA_HUMAN	Q	57	ENSP00000379138:E57Q;ENSP00000226359:E57Q	ENSP00000226359:E57Q	E	+	1	0	AFP	74522786	0.071000	0.21146	0.301000	0.25044	0.317000	0.28152	0.970000	0.29383	0.807000	0.34208	0.655000	0.94253	GAA	.	.		0.393	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3		
CASP3	836	hgsc.bcm.edu	37	4	185550586	185550586	+	Missense_Mutation	SNP	T	T	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr4:185550586T>G	ENST00000308394.4	-	8	936	c.674A>C	c.(673-675)cAg>cCg	p.Q225P	CASP3_ENST00000393585.2_3'UTR|CASP3_ENST00000393588.4_3'UTR|CASP3_ENST00000517513.1_3'UTR|CASP3_ENST00000523916.1_Missense_Mutation_p.Q225P	NM_004346.3	NP_004337.2	P42574	CASP3_HUMAN	caspase 3, apoptosis-related cysteine peptidase	225					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell homeostasis (GO:0001782)|cell fate commitment (GO:0045165)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte differentiation (GO:0030218)|execution phase of apoptosis (GO:0097194)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|heart development (GO:0007507)|hippo signaling (GO:0035329)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|keratinocyte differentiation (GO:0030216)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|proteolysis (GO:0006508)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|release of cytochrome c from mitochondria (GO:0001836)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:0097200)|peptidase activity (GO:0008233)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.057)|all_hematologic(60;0.0592)		all cancers(43;2.05e-27)|Epithelial(43;4.27e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.04e-11)|Colorectal(24;2e-05)|STAD - Stomach adenocarcinoma(60;2.35e-05)|GBM - Glioblastoma multiforme(59;4.94e-05)|COAD - Colon adenocarcinoma(29;0.00017)|BRCA - Breast invasive adenocarcinoma(30;0.000218)|LUSC - Lung squamous cell carcinoma(40;0.00904)|READ - Rectum adenocarcinoma(43;0.161)	Minocycline(DB01017)	GTCGGCATACTGTTTCAGCAT	0.418																																					p.Q225P		Atlas-SNP	.											.	CASP3	27	.	0			c.A674C						.						86.0	80.0	82.0					4																	185550586		2203	4300	6503	SO:0001583	missense	836	exon8			GCATACTGTTTCA	BC016926	CCDS3836.1	4q34	2008-02-05	2005-08-17		ENSG00000164305	ENSG00000164305		"""Caspases"""	1504	protein-coding gene	gene with protein product		600636	"""caspase 3, apoptosis-related cysteine protease"""			8780721	Standard	NM_004346		Approved	CPP32, CPP32B, Yama, apopain	uc003iwi.3	P42574	OTTHUMG00000133681	ENST00000308394.4:c.674A>C	4.37:g.185550586T>G	ENSP00000311032:p.Gln225Pro	123.0	0.0		186.0	112.0	NM_004346	A8K5M2|D3DP53|Q96AN1|Q96KP2	Missense_Mutation	SNP	ENST00000308394.4	37	CCDS3836.1	.	.	.	.	.	.	.	.	.	.	T	8.731	0.916737	0.17907	.	.	ENSG00000164305	ENST00000308394;ENST00000523916	T;T	0.21361	2.01;2.01	5.69	-4.3	0.03710	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.941225	0.08994	N	0.864032	T	0.27765	0.0683	M	0.81802	2.56	0.09310	N	1	B	0.26577	0.153	B	0.33295	0.161	T	0.44498	-0.9324	10	0.54805	T	0.06	.	10.4944	0.44768	0.7169:0.0612:0.0:0.2219	.	225	P42574	CASP3_HUMAN	P	225	ENSP00000311032:Q225P;ENSP00000428929:Q225P	ENSP00000311032:Q225P	Q	-	2	0	CASP3	185787580	0.004000	0.15560	0.000000	0.03702	0.142000	0.21351	1.060000	0.30530	-0.998000	0.03446	-1.530000	0.00923	CAG	.	.		0.418	CASP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257885.2	NM_004346	
C1QTNF3	114899	hgsc.bcm.edu	37	5	34043130	34043130	+	Intron	SNP	T	T	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr5:34043130T>G	ENST00000231338.7	-	1	172				C1QTNF3_ENST00000382065.3_Missense_Mutation_p.N34T|RP11-1084J3.4_ENST00000382079.3_Intron	NM_030945.3	NP_112207.1	Q9BXJ4	C1QT3_HUMAN	C1q and tumor necrosis factor related protein 3						cellular triglyceride homeostasis (GO:0035356)|fat cell differentiation (GO:0045444)|negative regulation of gene expression (GO:0010629)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of adiponectin secretion (GO:0070165)|positive regulation of cytokine secretion (GO:0050715)|protein trimerization (GO:0070206)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|prostate(3)|stomach(1)|urinary_tract(1)	17	all_lung(31;0.0207)					CACCACTTTATTAGTTCTTCC	0.502																																					p.N34T		Atlas-SNP	.											.	C1QTNF3	31	.	0			c.A101C						.						174.0	174.0	174.0					5																	34043130		2203	4300	6503	SO:0001627	intron_variant	114899	exon1			ACTTTATTAGTTC	AF329837	CCDS3904.1, CCDS34141.1	5p13	2009-05-20			ENSG00000082196	ENSG00000082196			14326	protein-coding gene	gene with protein product	"""cartonectin"""	612045				18421280	Standard	NM_030945		Approved	CTRP3, Cors, Corcs, 2310005P21Rik, Cors-26	uc003jio.3	Q9BXJ4	OTTHUMG00000090735	ENST00000231338.7:c.84+16A>C	5.37:g.34043130T>G		86.0	0.0		57.0	29.0	NM_181435	Q0VAN4|Q542Y2|Q6MZN1|Q96KY1	Missense_Mutation	SNP	ENST00000231338.7	37	CCDS3904.1	.	.	.	.	.	.	.	.	.	.	T	14.50	2.555014	0.45487	.	.	ENSG00000082196	ENST00000382065	D	0.85171	-1.95	5.77	5.77	0.91146	.	.	.	.	.	T	0.80199	0.4579	.	.	.	0.80722	D	1	B	0.09022	0.002	B	0.12156	0.007	T	0.75797	-0.3191	8	0.51188	T	0.08	.	11.4399	0.50090	0.0:0.07:0.0:0.93	.	34	Q0VAN4	.	T	34	ENSP00000371497:N34T	ENSP00000371497:N34T	N	-	2	0	C1QTNF3	34078887	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.010000	0.64004	2.326000	0.78906	0.533000	0.62120	AAT	.	.		0.502	C1QTNF3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000207469.1	NM_030945	
NRG2	9542	hgsc.bcm.edu	37	5	139266992	139266992	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr5:139266992G>T	ENST00000361474.1	-	2	1029	c.805C>A	c.(805-807)Cgt>Agt	p.R269S	NRG2_ENST00000340391.3_Missense_Mutation_p.R66S|NRG2_ENST00000545385.1_Missense_Mutation_p.R269S|NRG2_ENST00000394770.1_Missense_Mutation_p.R269S|NRG2_ENST00000518130.1_5'UTR|NRG2_ENST00000541337.1_Missense_Mutation_p.R269S|NRG2_ENST00000289409.4_Missense_Mutation_p.R269S|NRG2_ENST00000358522.3_Missense_Mutation_p.R269S|NRG2_ENST00000289422.7_Missense_Mutation_p.R269S	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	269	Ig-like C2-type.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.R269C(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGAACCAACGGTAGGAAGGC	0.557																																					p.R269S		Atlas-SNP	.											NRG2,NS,carcinoma,0,1	NRG2	69	1	1	Substitution - Missense(1)	breast(1)	c.C805A						.						158.0	128.0	139.0					5																	139266992		2203	4300	6503	SO:0001583	missense	9542	exon2			ACCAACGGTAGGA		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.805C>A	5.37:g.139266992G>T	ENSP00000354910:p.Arg269Ser	128.0	0.0		129.0	66.0	NM_013982		Missense_Mutation	SNP	ENST00000361474.1	37	CCDS4217.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994199	0.74703	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000340391;ENST00000289409;ENST00000358522;ENST00000544729;ENST00000378238	T;T;T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.64	4.72	0.59763	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.215756	0.34291	N	0.004096	T	0.52386	0.1731	N	0.05280	-0.08	0.39275	D	0.964464	P;P;P;P	0.51240	0.881;0.579;0.943;0.583	P;B;P;B	0.55508	0.697;0.261;0.777;0.425	T	0.59284	-0.7483	10	0.49607	T	0.09	-24.2851	11.0045	0.47626	0.0:0.0:0.7288:0.2712	.	269;269;269;269	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	S	269;269;269;269;269;269;66;269;269;177;269	ENSP00000444235:R269S;ENSP00000289422:R269S;ENSP00000354910:R269S;ENSP00000438753:R269S;ENSP00000378251:R269S;ENSP00000342660:R66S;ENSP00000289409:R269S;ENSP00000351323:R269S;ENSP00000367483:R269S	ENSP00000289409:R269S	R	-	1	0	NRG2	139247176	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.612000	0.54142	2.654000	0.90174	0.563000	0.77884	CGT	.	.		0.557	NRG2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251340.1	NM_013982	
FBXO38	81545	hgsc.bcm.edu	37	5	147813252	147813252	+	Missense_Mutation	SNP	A	A	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr5:147813252A>T	ENST00000340253.5	+	17	2977	c.2809A>T	c.(2809-2811)Atc>Ttc	p.I937F	FBXO38_ENST00000296701.6_Missense_Mutation_p.I692F|FBXO38_ENST00000394370.3_Missense_Mutation_p.I862F|FBXO38_ENST00000513826.1_Missense_Mutation_p.I692F|CTD-2283N19.1_ENST00000520980.2_RNA			Q6PIJ6	FBX38_HUMAN	F-box protein 38	937					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAATTGTGGAATCACAGATCT	0.323																																					p.I862F		Atlas-SNP	.											.	FBXO38	115	.	0			c.A2584T						.						146.0	150.0	149.0					5																	147813252		2203	4300	6503	SO:0001583	missense	81545	exon17			TGTGGAATCACAG	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2809A>T	5.37:g.147813252A>T	ENSP00000342023:p.Ile937Phe	170.0	0.0		107.0	100.0	NM_030793	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		.	.	.	.	.	.	.	.	.	.	A	21.7	4.190941	0.78789	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.46819	0.86;0.94;0.91;0.94	5.16	5.16	0.70880	.	0.047356	0.85682	D	0.000000	T	0.57961	0.2089	L	0.32530	0.975	0.35264	D	0.779825	P;D;D	0.89917	0.899;0.999;1.0	B;D;D	0.83275	0.39;0.986;0.996	T	0.69285	-0.5185	10	0.66056	D	0.02	-12.7874	14.1172	0.65161	1.0:0.0:0.0:0.0	.	692;862;937	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	F	937;692;862;692	ENSP00000342023:I937F;ENSP00000296701:I692F;ENSP00000377895:I862F;ENSP00000426410:I692F	ENSP00000296701:I692F	I	+	1	0	FBXO38	147793445	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.142000	0.77339	2.069000	0.61940	0.460000	0.39030	ATC	.	.		0.323	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
CSF1R	1436	hgsc.bcm.edu	37	5	149435893	149435893	+	Silent	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr5:149435893C>T	ENST00000286301.3	-	18	2622	c.2331G>A	c.(2329-2331)cgG>cgA	p.R777R		NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	777	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Missing (in HDLS). {ECO:0000269|PubMed:22197934}.		cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	CTGCCACGTCCCGGTGGATGC	0.577																																					p.R777R		Atlas-SNP	.											.	CSF1R	250	.	0			c.G2331A						.						96.0	85.0	89.0					5																	149435893		2203	4300	6503	SO:0001819	synonymous_variant	1436	exon18			CACGTCCCGGTGG	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.2331G>A	5.37:g.149435893C>T		129.0	0.0		64.0	52.0	NM_005211	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Silent	SNP	ENST00000286301.3	37	CCDS4302.1																																																																																			.	.		0.577	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211	
GRIA1	2890	hgsc.bcm.edu	37	5	153054114	153054114	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr5:153054114G>A	ENST00000285900.5	+	6	1097	c.754G>A	c.(754-756)Ggt>Agt	p.G252S	GRIA1_ENST00000521843.2_Missense_Mutation_p.G183S|GRIA1_ENST00000448073.4_Missense_Mutation_p.G262S|GRIA1_ENST00000340592.5_Missense_Mutation_p.G252S|GRIA1_ENST00000518783.1_Missense_Mutation_p.G262S|GRIA1_ENST00000518142.1_Missense_Mutation_p.G172S	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	252					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	CAATGTGACAGGTTTCCAGCT	0.507																																					p.G262S		Atlas-SNP	.											.	GRIA1	321	.	0			c.G784A						.						200.0	197.0	198.0					5																	153054114		2203	4300	6503	SO:0001583	missense	2890	exon6			GTGACAGGTTTCC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.754G>A	5.37:g.153054114G>A	ENSP00000285900:p.Gly252Ser	309.0	0.0		330.0	135.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	20.0	3.930250	0.73327	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	D;D;D;D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97	5.56	4.69	0.59074	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90755	0.7098	M	0.66378	2.025	0.80722	D	1	P;P;P;P;P;D	0.61697	0.938;0.938;0.954;0.938;0.924;0.99	D;D;D;D;P;D	0.74674	0.921;0.921;0.963;0.921;0.872;0.984	D	0.91520	0.5234	10	0.87932	D	0	.	13.4661	0.61254	0.0752:0.0:0.9248:0.0	.	262;262;172;262;252;252	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	S	252;252;172;206;252;183;183;262;262	ENSP00000285900:G252S;ENSP00000427920:G172S;ENSP00000339343:G252S;ENSP00000427864:G183S;ENSP00000442108:G183S;ENSP00000428994:G262S;ENSP00000415569:G262S	ENSP00000285900:G252S	G	+	1	0	GRIA1	153034307	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	9.640000	0.98453	1.350000	0.45770	-0.136000	0.14681	GGT	.	.		0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
DOCK2	1794	hgsc.bcm.edu	37	5	169101345	169101345	+	Nonsense_Mutation	SNP	C	C	G	rs35393134	byFrequency	TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr5:169101345C>G	ENST00000256935.8	+	6	446	c.366C>G	c.(364-366)taC>taG	p.Y122*		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	122					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCATGATGTACGATCTGATGG	0.473																																					p.Y122X		Atlas-SNP	.											.	DOCK2	389	.	0			c.C366G						.						155.0	141.0	145.0					5																	169101345		2203	4300	6503	SO:0001587	stop_gained	1794	exon6			GATGTACGATCTG	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.366C>G	5.37:g.169101345C>G	ENSP00000256935:p.Tyr122*	124.0	0.0		110.0	59.0	NM_004946	Q2M3I0|Q96AK7	Nonsense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.336496	0.81801	.	.	ENSG00000134516	ENST00000256935	.	.	.	5.27	-3.53	0.04667	.	0.118746	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.597	0.61996	0.0:0.3685:0.0:0.6315	.	.	.	.	X	122	.	ENSP00000256935:Y122X	Y	+	3	2	DOCK2	169033923	0.001000	0.12720	0.971000	0.41717	0.925000	0.55904	-1.732000	0.01851	-0.653000	0.05401	-1.056000	0.02311	TAC	.	C|0.978;T|0.022		0.473	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
HRH2	3274	hgsc.bcm.edu	37	5	175112488	175112488	+	IGR	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr5:175112488G>A	ENST00000231683.2	+	0	3095				HRH2_ENST00000377291.2_Missense_Mutation_p.A385T	NM_022304.2	NP_071640.1	P25021	HRH2_HUMAN	histamine receptor H2						digestive tract development (GO:0048565)|epithelial cell morphogenesis (GO:0003382)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|gastrin-induced gastric acid secretion (GO:0001698)|gland development (GO:0048732)|histamine-induced gastric acid secretion (GO:0001697)|immune response (GO:0006955)|memory (GO:0007613)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(10)|ovary(1)	22	all_cancers(89;0.00805)|Renal(175;0.000269)|Lung NSC(126;0.00419)|all_lung(126;0.00711)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Colorectal(1;0.0154)|COAD - Colon adenocarcinoma(1;0.149)	Amitriptyline(DB00321)|Asenapine(DB06216)|Betazole(DB00272)|Cimetidine(DB00501)|Doxepin(DB01142)|Epinastine(DB00751)|Famotidine(DB00927)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Methantheline(DB00940)|Nizatidine(DB00585)|Olanzapine(DB00334)|Ranitidine(DB00863)|Roxatidine acetate(DB08806)|Tolazoline(DB00797)	tcattcattTGcaaacattca	0.398																																					p.A385T		Atlas-SNP	.											.	HRH2	108	.	0			c.G1153A						.						108.0	90.0	96.0					5																	175112488		692	1591	2283	SO:0001628	intergenic_variant	3274	exon3			TCATTTGCAAACA		CCDS4395.1, CCDS47344.1	5q35	2012-08-08			ENSG00000113749	ENSG00000113749		"""GPCR / Class A : Histamine receptors"""	5183	protein-coding gene	gene with protein product		142703				1714721	Standard	NM_022304		Approved		uc003mdc.4	P25021	OTTHUMG00000130660		5.37:g.175112488G>A		235.0	0.0		183.0	85.0	NM_001131055	B5BUP7|Q14464|Q7Z5R9	Missense_Mutation	SNP	ENST00000231683.2	37	CCDS4395.1	.	.	.	.	.	.	.	.	.	.	G	9.890	1.203903	0.22121	.	.	ENSG00000113749	ENST00000377291	T	0.64438	-0.1	2.53	0.676	0.17958	.	.	.	.	.	T	0.47395	0.1443	.	.	.	0.09310	N	0.999998	B	0.09022	0.002	B	0.08055	0.003	T	0.43048	-0.9415	8	0.87932	D	0	.	4.9524	0.14021	0.305:0.0:0.695:0.0	.	385	Q7Z5R9	.	T	385	ENSP00000366506:A385T	ENSP00000366506:A385T	A	+	1	0	HRH2	175045094	0.070000	0.21116	0.012000	0.15200	0.247000	0.25773	0.440000	0.21592	0.171000	0.19730	0.491000	0.48974	GCA	.	.		0.398	HRH2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253151.1		
PRRC2A	7916	hgsc.bcm.edu	37	6	31593819	31593819	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr6:31593819C>T	ENST00000376033.2	+	9	1096	c.862C>T	c.(862-864)Ccc>Tcc	p.P288S	PRRC2A_ENST00000469577.1_3'UTR|SNORA38_ENST00000363946.1_RNA|PRRC2A_ENST00000376007.4_Missense_Mutation_p.P288S	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	288	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TGTGGCGGGCCCCCGAGGCTC	0.502																																					p.P288S		Atlas-SNP	.											.	PRRC2A	152	.	0			c.C862T						.						54.0	61.0	58.0					6																	31593819		1508	2707	4215	SO:0001583	missense	7916	exon9			GCGGGCCCCCGAG	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.862C>T	6.37:g.31593819C>T	ENSP00000365201:p.Pro288Ser	112.0	0.0		169.0	61.0	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	37	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	C	6.017	0.371466	0.11409	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033	T;T	0.02103	4.45;4.45	4.96	4.09	0.47781	.	0.000000	0.49916	D	0.000131	T	0.01124	0.0037	L	0.34521	1.04	0.46774	D	0.999191	B	0.26483	0.15	B	0.23419	0.046	T	0.52480	-0.8570	10	0.87932	D	0	-4.446	13.6421	0.62257	0.1564:0.8436:0.0:0.0	.	288	P48634	PRC2A_HUMAN	S	288	ENSP00000365175:P288S;ENSP00000365201:P288S	ENSP00000365175:P288S	P	+	1	0	PRRC2A	31701798	1.000000	0.71417	0.970000	0.41538	0.181000	0.23173	2.954000	0.49113	1.310000	0.45006	-0.181000	0.13052	CCC	.	.		0.502	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
VARS	7407	hgsc.bcm.edu	37	6	31760169	31760169	+	Splice_Site	SNP	C	C	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr6:31760169C>G	ENST00000375663.3	-	5	1226	c.786G>C	c.(784-786)gaG>gaC	p.E262D	VARS_ENST00000444930.2_5'UTR	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	262					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	CTCGCCTCACCTCCCCTGGAG	0.537																																					p.E262D		Atlas-SNP	.											.	VARS	76	.	0			c.G786C						.						128.0	126.0	127.0					6																	31760169		2203	4300	6503	SO:0001630	splice_region_variant	7407	exon5			CCTCACCTCCCCT	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.786+1G>C	6.37:g.31760169C>G		87.0	0.0		235.0	44.0	NM_006295	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	37	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	C	13.49	2.254204	0.39896	.	.	ENSG00000204394	ENST00000375663	T	0.04809	3.55	4.72	4.72	0.59763	.	0.106857	0.41396	D	0.000894	T	0.03477	0.0100	L	0.55834	1.745	0.80722	D	1	P	0.46395	0.877	B	0.40741	0.339	T	0.52343	-0.8588	9	.	.	.	-9.7875	15.4962	0.75653	0.0:1.0:0.0:0.0	.	262	P26640	SYVC_HUMAN	D	262	ENSP00000364815:E262D	.	E	-	3	2	VARS	31868148	1.000000	0.71417	1.000000	0.80357	0.099000	0.18886	4.185000	0.58330	2.315000	0.78130	0.313000	0.20887	GAG	.	.		0.537	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	Missense_Mutation
TRERF1	55809	hgsc.bcm.edu	37	6	42214272	42214272	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr6:42214272C>G	ENST00000372922.4	-	14	3229	c.2667G>C	c.(2665-2667)aaG>aaC	p.K889N	TRERF1_ENST00000340840.2_Missense_Mutation_p.K806N|TRERF1_ENST00000354325.2_Missense_Mutation_p.K806N|TRERF1_ENST00000541110.1_Missense_Mutation_p.K909N|TRERF1_ENST00000372917.4_Missense_Mutation_p.K806N	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	889	Interacts with CREBBP.|SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGGAGGTCCACTTGTCCGAAC	0.373																																					p.K889N		Atlas-SNP	.											.	TRERF1	124	.	0			c.G2667C						.						104.0	103.0	103.0					6																	42214272		2203	4300	6503	SO:0001583	missense	55809	exon14			GGTCCACTTGTCC	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2667G>C	6.37:g.42214272C>G	ENSP00000362013:p.Lys889Asn	83.0	0.0		89.0	40.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.566756	0.45694	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.12569	2.82;2.67;2.85;2.67;2.67	5.17	2.4	0.29515	SANT domain, DNA binding (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.56097	D	0.000032	T	0.11879	0.0289	M	0.64170	1.965	0.49299	D	0.999774	B;B;B;B;P	0.37370	0.241;0.155;0.155;0.241;0.592	B;B;B;B;P	0.48598	0.177;0.086;0.086;0.177;0.583	T	0.02009	-1.1230	10	0.59425	D	0.04	-24.6629	7.6482	0.28334	0.0:0.6625:0.0:0.3375	.	806;909;889;645;645	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	N	909;806;889;806;806	ENSP00000439689:K909N;ENSP00000362008:K806N;ENSP00000362013:K889N;ENSP00000339438:K806N;ENSP00000346285:K806N	ENSP00000339438:K806N	K	-	3	2	TRERF1	42322250	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.472000	0.22116	0.697000	0.31718	-0.136000	0.14681	AAG	.	.		0.373	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
CUL9	23113	hgsc.bcm.edu	37	6	43192005	43192005	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr6:43192005G>T	ENST00000252050.4	+	41	7460	c.7376G>T	c.(7375-7377)gGg>gTg	p.G2459V	CUL9_ENST00000354495.3_Missense_Mutation_p.G2349V|RP3-330M21.5_ENST00000500590.1_RNA|CUL9_ENST00000372647.2_Missense_Mutation_p.G2431V	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	2459					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GCCTCCTCAGGGCCAGAGGCA	0.607																																					p.G2459V		Atlas-SNP	.											.	CUL9	248	.	0			c.G7376T						.						72.0	63.0	66.0					6																	43192005		2203	4300	6503	SO:0001583	missense	23113	exon41			CCTCAGGGCCAGA	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.7376G>T	6.37:g.43192005G>T	ENSP00000252050:p.Gly2459Val	105.0	0.0		128.0	25.0	NM_015089	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	G	2.295	-0.361602	0.05103	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.16457	2.34;2.34;2.34	5.69	1.36	0.22044	.	1.421260	0.04262	N	0.340529	T	0.03651	0.0104	N	0.24115	0.695	0.19575	N	0.999962	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.09377	0.004;0.002;0.002	T	0.41070	-0.9529	10	0.72032	D	0.01	-14.3347	2.0522	0.03573	0.2099:0.1552:0.4763:0.1586	.	2349;2431;2459	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	V	2459;2349;2431	ENSP00000252050:G2459V;ENSP00000346490:G2349V;ENSP00000361730:G2431V	ENSP00000252050:G2459V	G	+	2	0	CUL9	43299983	0.079000	0.21365	0.018000	0.16275	0.182000	0.23217	0.664000	0.25068	0.742000	0.32697	0.561000	0.74099	GGG	.	.		0.607	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
IRAK1BP1	134728	hgsc.bcm.edu	37	6	79577582	79577582	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr6:79577582C>T	ENST00000369940.2	+	1	394	c.289C>T	c.(289-291)Cag>Tag	p.Q97*		NM_001010844.2	NP_001010844.1	Q5VVH5	IKBP1_HUMAN	interleukin-1 receptor-associated kinase 1 binding protein 1	97					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(3)	12		all_cancers(76;0.0398)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)		BRCA - Breast invasive adenocarcinoma(397;0.21)		TTACATCACGCAGAGCCTCCA	0.637																																					p.Q97X		Atlas-SNP	.											.	IRAK1BP1	18	.	0			c.C289T						.						15.0	14.0	14.0					6																	79577582		2200	4294	6494	SO:0001587	stop_gained	134728	exon1			ATCACGCAGAGCC	AI478629	CCDS34488.1	6q14-q15	2006-04-12				ENSG00000146243			17368	protein-coding gene	gene with protein product		615375				11096118	Standard	XM_005248654		Approved	AIP70, SIMPL	uc003pim.4	Q5VVH5		ENST00000369940.2:c.289C>T	6.37:g.79577582C>T	ENSP00000358956:p.Gln97*	179.0	0.0		389.0	305.0	NM_001010844		Nonsense_Mutation	SNP	ENST00000369940.2	37	CCDS34488.1	.	.	.	.	.	.	.	.	.	.	C	37	6.505076	0.97620	.	.	ENSG00000146243	ENST00000369940	.	.	.	4.45	4.45	0.53987	.	0.070462	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.7051	14.6281	0.68638	0.0:1.0:0.0:0.0	.	.	.	.	X	97	.	.	Q	+	1	0	IRAK1BP1	79634301	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.345000	0.59360	2.282000	0.76494	0.561000	0.74099	CAG	.	.		0.637	IRAK1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041296.2	XM_059729	
CEP162	22832	hgsc.bcm.edu	37	6	84925113	84925113	+	Silent	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr6:84925113C>T	ENST00000403245.3	-	5	504	c.390G>A	c.(388-390)gaG>gaA	p.E130E	KIAA1009_ENST00000257766.4_Silent_p.E54E	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		ATTGTTCTTTCTCCTCTTGTT	0.348																																					p.E130E		Atlas-SNP	.											KIAA1009,NS,carcinoma,0,1	KIAA1009	119	1	0			c.G390A						.						114.0	105.0	108.0					6																	84925113		2203	4300	6503	SO:0001819	synonymous_variant	22832	exon5			TTCTTTCTCCTCT																												ENST00000403245.3:c.390G>A	6.37:g.84925113C>T		49.0	0.0		42.0	36.0	NM_014895		Silent	SNP	ENST00000403245.3	37	CCDS34494.2																																																																																			.	.		0.348	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
PCLO	27445	hgsc.bcm.edu	37	7	82583509	82583509	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr7:82583509C>T	ENST00000333891.9	-	5	7097	c.6760G>A	c.(6760-6762)Gat>Aat	p.D2254N	PCLO_ENST00000423517.2_Missense_Mutation_p.D2254N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.D2254N(2)|p.D2185N(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCTCTACCATCTGGTGGGGCA	0.388																																					p.D2254N		Atlas-SNP	.											Q9Y6V0-3,NS,carcinoma,0,3	PCLO	1506	3	3	Substitution - Missense(3)	cervix(3)	c.G6760A						.						73.0	71.0	71.0					7																	82583509		1867	4093	5960	SO:0001583	missense	27445	exon5			TACCATCTGGTGG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6760G>A	7.37:g.82583509C>T	ENSP00000334319:p.Asp2254Asn	60.0	0.0		64.0	35.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	7.938	0.742113	0.15642	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15952	2.38;2.38	5.7	4.8	0.61643	.	.	.	.	.	T	0.12347	0.0300	N	0.22421	0.69	0.09310	N	1	B;B	0.30973	0.302;0.302	B;B	0.33620	0.109;0.167	T	0.12604	-1.0541	9	0.87932	D	0	.	5.7004	0.17879	0.1293:0.6293:0.159:0.0824	.	2254;2254	Q9Y6V0-5;Q9Y6V0-6	.;.	N	2185;2254;2254	ENSP00000334319:D2254N;ENSP00000388393:D2254N	ENSP00000334319:D2254N	D	-	1	0	PCLO	82421445	0.000000	0.05858	0.534000	0.28014	0.449000	0.32228	0.323000	0.19593	2.690000	0.91761	0.603000	0.83216	GAT	.	.		0.388	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PHYHIP	9796	hgsc.bcm.edu	37	8	22085742	22085742	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr8:22085742C>G	ENST00000321613.3	-	3	585	c.129G>C	c.(127-129)aaG>aaC	p.K43N	PHYHIP_ENST00000454243.2_Missense_Mutation_p.K43N	NM_001099335.1	NP_001092805.1	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	43	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.									endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	10				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		TATTCTCCTTCTTGTTAAGGT	0.527																																					p.K43N		Atlas-SNP	.											.	PHYHIP	24	.	0			c.G129C						.						122.0	123.0	123.0					8																	22085742		1987	4168	6155	SO:0001583	missense	9796	exon2			CTCCTTCTTGTTA	D87463	CCDS43723.1	8p21.2	2010-02-17	2006-01-09		ENSG00000168490	ENSG00000168490			16865	protein-coding gene	gene with protein product		608511	"""phytanoyl-CoA hydroxylase interacting protein"", ""DYRK1A interacting protein 3"""	DYRK1AP3		9039502, 10686344	Standard	NM_014759		Approved	KIAA0273, PAHX-AP	uc003xbj.4	Q92561	OTTHUMG00000163776	ENST00000321613.3:c.129G>C	8.37:g.22085742C>G	ENSP00000320017:p.Lys43Asn	143.0	0.0		74.0	64.0	NM_014759	D3DSR1|Q8N4I9	Missense_Mutation	SNP	ENST00000321613.3	37	CCDS43723.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.690058	0.88735	.	.	ENSG00000168490	ENST00000321613;ENST00000454243;ENST00000456132	T;T	0.42513	0.97;0.97	5.67	4.79	0.61399	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.061993	0.64402	D	0.000007	T	0.52597	0.1744	L	0.42245	1.32	0.45318	D	0.998312	D	0.63880	0.993	P	0.61397	0.888	T	0.54344	-0.8308	10	0.59425	D	0.04	-29.4667	13.3462	0.60575	0.0:0.923:0.0:0.077	.	43	Q92561	PHYIP_HUMAN	N	43	ENSP00000320017:K43N;ENSP00000415491:K43N	ENSP00000320017:K43N	K	-	3	2	PHYHIP	22141687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.071000	0.57556	1.404000	0.46819	0.511000	0.50034	AAG	.	.		0.527	PHYHIP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000375388.1	NM_014759	
RNF19A	25897	hgsc.bcm.edu	37	8	101276968	101276968	+	Missense_Mutation	SNP	T	T	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr8:101276968T>G	ENST00000519449.1	-	7	1553	c.1237A>C	c.(1237-1239)Aat>Cat	p.N413H	RNF19A_ENST00000341084.2_Missense_Mutation_p.N413H|RNF19A_ENST00000523255.1_5'UTR	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	413					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			ATGGCCAAATTCCGTTTGTGC	0.378																																					p.N413H		Atlas-SNP	.											.	RNF19A	67	.	0			c.A1237C						.						240.0	212.0	222.0					8																	101276968		2203	4300	6503	SO:0001583	missense	25897	exon7			CCAAATTCCGTTT	AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1237A>C	8.37:g.101276968T>G	ENSP00000428968:p.Asn413His	97.0	0.0		128.0	55.0	NM_015435	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	ENST00000519449.1	37	CCDS6286.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.503574	0.85176	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.85171	-1.95;-1.95	5.17	5.17	0.71159	.	0.143656	0.64402	D	0.000009	D	0.90466	0.7014	M	0.61703	1.905	0.58432	D	0.999994	D	0.89917	1.0	D	0.68192	0.956	D	0.91056	0.4882	10	0.56958	D	0.05	.	15.0318	0.71713	0.0:0.0:0.0:1.0	.	413	Q9NV58	RN19A_HUMAN	H	413	ENSP00000428968:N413H;ENSP00000342667:N413H	ENSP00000342667:N413H	N	-	1	0	RNF19A	101346144	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.655000	0.83696	2.089000	0.63090	0.529000	0.55759	AAT	.	.		0.378	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380004.1	NM_015435	
NCALD	83988	hgsc.bcm.edu	37	8	102701577	102701577	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr8:102701577C>A	ENST00000311028.3	-	7	920	c.542G>T	c.(541-543)cGc>cTc	p.R181L	NCALD_ENST00000521599.1_Missense_Mutation_p.R181L|NCALD_ENST00000395923.1_Missense_Mutation_p.R181L|NCALD_ENST00000522951.1_Intron|KB-1107E3.1_ENST00000518749.1_RNA|NCALD_ENST00000220931.6_Missense_Mutation_p.R181L|NCALD_ENST00000519508.2_Missense_Mutation_p.R181L	NM_001040624.1|NM_001040626.1	NP_001035714.1|NP_001035716.1	P61601	NCALD_HUMAN	neurocalcin delta	181					calcium-mediated signaling (GO:0019722)|regulation of systemic arterial blood pressure (GO:0003073)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	clathrin coat of trans-Golgi network vesicle (GO:0030130)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)	8	all_cancers(14;8.94e-08)|all_epithelial(15;7.03e-10)|Lung NSC(17;1.36e-05)|all_lung(17;2.7e-05)		all cancers(13;1.09e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000699)			CTGCAGGAGGCGCACAATGGA	0.562																																					p.R181L		Atlas-SNP	.											NCALD,right_upper_lobe,carcinoma,0,1	NCALD	16	1	0			c.G542T						.						51.0	46.0	48.0					8																	102701577		2203	4300	6503	SO:0001583	missense	83988	exon6			AGGAGGCGCACAA	AF052142	CCDS6292.1	8q22.3	2014-08-12			ENSG00000104490	ENSG00000104490		"""EF-hand domain containing"""	7655	protein-coding gene	gene with protein product		606722				11267673	Standard	XM_006716672		Approved		uc003ykk.3	P61601	OTTHUMG00000164876	ENST00000311028.3:c.542G>T	8.37:g.102701577C>A	ENSP00000310587:p.Arg181Leu	154.0	0.0		133.0	51.0	NM_001040627	P29554|Q8IYC3|Q9H0W2	Missense_Mutation	SNP	ENST00000311028.3	37	CCDS6292.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547493	0.65311	.	.	ENSG00000104490	ENST00000395923;ENST00000311028;ENST00000220931;ENST00000521599;ENST00000519508	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	5.6	5.6	0.85130	EF-hand-like domain (1);	.	.	.	.	T	0.62696	0.2449	L	0.42686	1.345	0.80722	D	1	B	0.12630	0.006	B	0.12156	0.007	T	0.55471	-0.8136	9	0.36615	T	0.2	.	19.9733	0.97292	0.0:1.0:0.0:0.0	.	181	P61601	NCALD_HUMAN	L	181	ENSP00000379256:R181L;ENSP00000310587:R181L;ENSP00000220931:R181L;ENSP00000428105:R181L;ENSP00000430476:R181L	ENSP00000220931:R181L	R	-	2	0	NCALD	102770753	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.771000	0.85420	2.804000	0.96469	0.655000	0.94253	CGC	.	.		0.562	NCALD-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380732.2		
ZFPM2	23414	hgsc.bcm.edu	37	8	106331209	106331209	+	Splice_Site	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr8:106331209C>A	ENST00000407775.2	+	1	290	c.40C>A	c.(40-42)Cgg>Agg	p.R14R	ZFPM2_ENST00000520492.1_5'Flank	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	14					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GCAGATCAAACGTAAGTTTGC	0.711																																					p.R14R		Atlas-SNP	.											.	ZFPM2	219	.	0			c.C40A						.						5.0	7.0	6.0					8																	106331209		1557	3525	5082	SO:0001630	splice_region_variant	23414	exon1			ATCAAACGTAAGT	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.40+1C>A	8.37:g.106331209C>A		331.0	0.0		345.0	169.0	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Silent	SNP	ENST00000407775.2	37	CCDS47908.1																																																																																			.	.		0.711	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		Silent
NTRK2	4915	hgsc.bcm.edu	37	9	87635185	87635185	+	Missense_Mutation	SNP	T	T	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr9:87635185T>G	ENST00000323115.4	+	16	2542	c.2189T>G	c.(2188-2190)tTc>tGc	p.F730C	NTRK2_ENST00000376214.1_Missense_Mutation_p.F746C|NTRK2_ENST00000376213.1_Missense_Mutation_p.F730C|NTRK2_ENST00000277120.3_Missense_Mutation_p.F746C			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	730	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	TACAGGAAATTCACGACGGAA	0.552										TSP Lung(25;0.17)																											p.F746C		Atlas-SNP	.											.	NTRK2	331	.	0			c.T2237G						.						136.0	125.0	129.0					9																	87635185		2203	4300	6503	SO:0001583	missense	4915	exon20			GGAAATTCACGAC	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.2189T>G	9.37:g.87635185T>G	ENSP00000314586:p.Phe730Cys	176.0	0.0		136.0	71.0	NM_006180	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	37	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.853418	0.91355	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57	6.16	6.16	0.99307	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94896	0.8350	M	0.83852	2.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.95318	0.8418	10	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	730;746	Q16620;Q16620-4	NTRK2_HUMAN;.	C	746;730;746;730	ENSP00000365387:F746C;ENSP00000365386:F730C;ENSP00000277120:F746C;ENSP00000314586:F730C	ENSP00000277120:F746C	F	+	2	0	NTRK2	86825005	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	8.033000	0.88852	2.367000	0.80283	0.528000	0.53228	TTC	.	.		0.552	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
OR1K1	392392	hgsc.bcm.edu	37	9	125563246	125563246	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr9:125563246T>C	ENST00000277309.2	+	1	877	c.845T>C	c.(844-846)gTc>gCc	p.V282A		NM_080859.1	NP_543135.1	Q8NGR3	OR1K1_HUMAN	olfactory receptor, family 1, subfamily K, member 1	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(8)|lung(2)|ovary(1)|skin(4)|stomach(1)	17						TACACTGTAGTCACCCCCATG	0.577																																					p.V282A		Atlas-SNP	.											.	OR1K1	34	.	0			c.T845C						.						101.0	89.0	93.0					9																	125563246		2203	4300	6503	SO:0001583	missense	392392	exon1			CTGTAGTCACCCC	AL359512	CCDS35132.1	9q33	2013-09-20			ENSG00000165204	ENSG00000165204		"""GPCR / Class A : Olfactory receptors"""	8212	protein-coding gene	gene with protein product							Standard	NM_080859		Approved	hg99, MNAB	uc011lze.2	Q8NGR3	OTTHUMG00000020625	ENST00000277309.2:c.845T>C	9.37:g.125563246T>C	ENSP00000277309:p.Val282Ala	55.0	0.0		52.0	22.0	NM_080859	B9EH41|Q4VXB7|Q96R23	Missense_Mutation	SNP	ENST00000277309.2	37	CCDS35132.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.888832	0.52014	.	.	ENSG00000165204	ENST00000277309	T	0.00296	8.24	4.02	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.220885	0.22557	U	0.058513	T	0.00666	0.0022	M	0.91354	3.2	0.09310	N	0.999995	P	0.41673	0.759	P	0.53760	0.734	T	0.03807	-1.1002	10	0.72032	D	0.01	.	12.0785	0.53657	0.0:0.0:0.0:1.0	.	282	Q8NGR3	OR1K1_HUMAN	A	282	ENSP00000277309:V282A	ENSP00000277309:V282A	V	+	2	0	OR1K1	124603067	0.022000	0.18835	0.310000	0.25168	0.896000	0.52359	1.906000	0.39887	1.683000	0.51011	0.460000	0.39030	GTC	.	.		0.577	OR1K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053958.1		
RABGAP1	23637	hgsc.bcm.edu	37	9	125719407	125719407	+	Silent	SNP	A	A	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr9:125719407A>G	ENST00000373647.4	+	2	203	c.69A>G	c.(67-69)gaA>gaG	p.E23E		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	23					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						TTAATAGTGAAGATTTTGTCT	0.383																																					p.E23E		Atlas-SNP	.											.	RABGAP1	164	.	0			c.A69G						.						108.0	93.0	98.0					9																	125719407		1568	3582	5150	SO:0001819	synonymous_variant	23637	exon2			TAGTGAAGATTTT	AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.69A>G	9.37:g.125719407A>G		102.0	0.0		121.0	59.0	NM_012197	B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Silent	SNP	ENST00000373647.4	37	CCDS6848.2																																																																																			.	.		0.383	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053976.3	NM_012197	
FPGS	2356	hgsc.bcm.edu	37	9	130565239	130565239	+	Silent	SNP	A	A	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr9:130565239A>T	ENST00000373247.2	+	1	86	c.36A>T	c.(34-36)ctA>ctT	p.L12L	FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000393706.2_Silent_p.L12L|FPGS_ENST00000373245.1_Silent_p.L12L|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	12					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	GCGCCGCTCTATTCCTGGCAG	0.771																																					p.L12L		Atlas-SNP	.											.	FPGS	30	.	0			c.A36T						.						1.0	2.0	2.0					9																	130565239		1058	2288	3346	SO:0001819	synonymous_variant	2356	exon1			CGCTCTATTCCTG		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.36A>T	9.37:g.130565239A>T		44.0	0.0		47.0	29.0	NM_004957	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Silent	SNP	ENST00000373247.2	37	CCDS35148.1																																																																																			.	.		0.771	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
GDF2	2658	hgsc.bcm.edu	37	10	48416487	48416487	+	Silent	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr10:48416487G>A	ENST00000249598.1	-	1	366	c.207C>T	c.(205-207)agC>agT	p.S69S		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	69					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						TCAGGTTAAGGCTGCGCAGGA	0.572																																					p.S69S		Atlas-SNP	.											.	GDF2	77	.	0			c.C207T						.						83.0	77.0	79.0					10																	48416487		2203	4300	6503	SO:0001819	synonymous_variant	2658	exon1			GTTAAGGCTGCGC	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.207C>T	10.37:g.48416487G>A		145.0	0.0		124.0	63.0	NM_016204	Q5VSQ9|Q9Y571	Silent	SNP	ENST00000249598.1	37	CCDS7219.1																																																																																			.	.		0.572	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047891.1	NM_016204	
ATAD1	84896	hgsc.bcm.edu	37	10	89544307	89544307	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr10:89544307C>A	ENST00000308448.7	-	5	881	c.503G>T	c.(502-504)gGa>gTa	p.G168V	ATAD1_ENST00000495903.1_5'Flank|ATAD1_ENST00000328142.3_Missense_Mutation_p.G168V|ATAD1_ENST00000541004.1_Missense_Mutation_p.G168V|ATAD1_ENST00000400215.3_Missense_Mutation_p.G110V	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	168					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CTGAGATTCTCCATACCACTT	0.433																																					p.G168V		Atlas-SNP	.											.	ATAD1	32	.	0			c.G503T						.						145.0	134.0	138.0					10																	89544307		2203	4300	6503	SO:0001583	missense	84896	exon5			GATTCTCCATACC	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.503G>T	10.37:g.89544307C>A	ENSP00000339017:p.Gly168Val	89.0	0.0		106.0	45.0	NM_032810	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	ENST00000308448.7	37	CCDS7386.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381743	0.82792	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62	5.35	4.44	0.53790	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98635	0.9543	H	0.99454	4.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99651	1.0991	9	.	.	.	-20.4245	16.3117	0.82873	0.0:0.8674:0.1325:0.0	.	110;168	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	V	168;168;110;168	ENSP00000339017:G168V;ENSP00000339016:G168V;ENSP00000412968:G110V;ENSP00000445500:G168V	.	G	-	2	0	ATAD1	89534287	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	1.365000	0.46057	0.563000	0.77884	GGA	.	.		0.433	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049235.1	NM_032810	
PAX2	5076	hgsc.bcm.edu	37	10	102584454	102584454	+	Silent	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr10:102584454C>A	ENST00000428433.1	+	9	1588	c.1038C>A	c.(1036-1038)ccC>ccA	p.P346P	PAX2_ENST00000355243.3_Silent_p.P323P|PAX2_ENST00000556085.1_Silent_p.P322P|PAX2_ENST00000370296.2_Silent_p.P346P|PAX2_ENST00000361791.3_Silent_p.P323P	NM_003987.3|NM_003990.3	NP_003978|NP_003981.2	Q02962	PAX2_HUMAN	paired box 2	346					aging (GO:0007568)|axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cell fate determination (GO:0001709)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucose stimulus (GO:0071333)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|glial cell differentiation (GO:0010001)|inner ear morphogenesis (GO:0042472)|mesenchymal to epithelial transition (GO:0060231)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|mesonephric duct development (GO:0072177)|mesonephric tubule formation (GO:0072172)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric nephron tubule formation (GO:0072289)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytolysis (GO:0045918)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of programmed cell death (GO:0043069)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|neural tube closure (GO:0001843)|optic chiasma development (GO:0061360)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|optic nerve development (GO:0021554)|optic nerve morphogenesis (GO:0021631)|optic nerve structural organization (GO:0021633)|pancreas development (GO:0031016)|paramesonephric duct development (GO:0061205)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of optic nerve formation (GO:2000597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|protein kinase B signaling (GO:0043491)|reactive oxygen species metabolic process (GO:0072593)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of metanephros size (GO:0035566)|response to nutrient levels (GO:0031667)|retinal pigment epithelium development (GO:0003406)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|ureter development (GO:0072189)|ureter maturation (GO:0035799)|ureter morphogenesis (GO:0072197)|urogenital system development (GO:0001655)|vestibulocochlear nerve formation (GO:0021650)|visual perception (GO:0007601)	centriolar satellite (GO:0034451)|lysosome (GO:0005764)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|superoxide-generating NADPH oxidase activity (GO:0016175)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		CTCACGTGCCCCCCACTGGCC	0.607																																					p.P346P		Atlas-SNP	.											.	PAX2	83	.	0			c.C1038A						.						97.0	93.0	94.0					10																	102584454		2203	4300	6503	SO:0001819	synonymous_variant	5076	exon9			CGTGCCCCCCACT		CCDS7499.1, CCDS41561.1	10q24.31	2011-06-20	2007-07-12		ENSG00000075891	ENSG00000075891		"""Paired boxes"", ""Homeoboxes / PRD class"""	8616	protein-coding gene	gene with protein product		167409	"""paired box gene 2"""			8431641, 7981748	Standard	NM_003990		Approved		uc001krk.4	Q02962	OTTHUMG00000018913	ENST00000428433.1:c.1038C>A	10.37:g.102584454C>A		61.0	0.0		51.0	16.0	NM_003987	Q15105|Q15110|Q15837|Q5SZP2|Q5SZP3	Silent	SNP	ENST00000428433.1	37	CCDS53569.1																																																																																			.	.		0.607	PAX2-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
TNNI2	7136	hgsc.bcm.edu	37	11	1862321	1862321	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr11:1862321C>T	ENST00000381906.1	+	7	406	c.337C>T	c.(337-339)Cgg>Tgg	p.R113W	TNNI2_ENST00000252898.7_Missense_Mutation_p.R113W|TNNI2_ENST00000381905.3_Missense_Mutation_p.R113W|TNNI2_ENST00000381911.1_Missense_Mutation_p.R113W	NM_001145829.1	NP_001139301.1	P48788	TNNI2_HUMAN	troponin I type 2 (skeletal, fast)	113	Involved in binding TNC and actin.				muscle filament sliding (GO:0030049)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|nucleus (GO:0005634)|troponin complex (GO:0005861)	troponin T binding (GO:0031014)			lung(8)|prostate(1)|urinary_tract(1)	10		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCCCCACTGCGGAGGGTGCG	0.637																																					p.R113W		Atlas-SNP	.											TNNI2,NS,carcinoma,-1,1	TNNI2	24	1	0			c.C337T						.						33.0	33.0	33.0					11																	1862321		2201	4299	6500	SO:0001583	missense	7136	exon5			CCACTGCGGAGGG	L21715	CCDS31333.1, CCDS53594.1	11p15.5	2014-09-17	2005-09-12		ENSG00000130598	ENSG00000130598			11946	protein-coding gene	gene with protein product	"""troponin I, fast-twitch skeletal muscle isoform"", ""troponin I fast twitch 2"""	191043	"""troponin I, skeletal, fast"", ""arthrogryposis multiplex congenita, distal, type 2B"""	AMCD2B		9016781, 12592607	Standard	NM_001145829		Approved	FSSV, DA2B	uc010qxe.1	P48788	OTTHUMG00000012253	ENST00000381906.1:c.337C>T	11.37:g.1862321C>T	ENSP00000371331:p.Arg113Trp	102.0	0.0		86.0	39.0	NM_001145841	A6NIV8|A6NJU5	Missense_Mutation	SNP	ENST00000381906.1	37	CCDS31333.1	.	.	.	.	.	.	.	.	.	.	c	11.00	1.509196	0.27036	.	.	ENSG00000130598	ENST00000381911;ENST00000381906;ENST00000252898;ENST00000381905	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	2.92	0.872	0.19113	.	0.173313	0.47455	D	0.000221	D	0.96081	0.8723	M	0.70842	2.15	0.42989	D	0.994481	D;D	0.89917	1.0;1.0	P;D	0.81914	0.905;0.995	D	0.95126	0.8251	10	0.72032	D	0.01	-0.4131	11.8296	0.52288	0.4576:0.5424:0.0:0.0	.	113;113	A6NIV8;P48788	.;TNNI2_HUMAN	W	113	ENSP00000371336:R113W;ENSP00000371331:R113W;ENSP00000252898:R113W;ENSP00000371330:R113W	ENSP00000252898:R113W	R	+	1	2	TNNI2	1818897	1.000000	0.71417	0.024000	0.17045	0.035000	0.12851	1.116000	0.31221	0.223000	0.20920	0.313000	0.20887	CGG	.	.		0.637	TNNI2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034046.2	NM_003282	
KCNA4	3739	hgsc.bcm.edu	37	11	30033969	30033969	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr11:30033969C>T	ENST00000328224.6	-	2	1490	c.257G>A	c.(256-258)aGg>aAg	p.R86K	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	86				RRRRQ -> EEEAT (in Ref. 1; AAA60034). {ECO:0000305}.	potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCGCTGTCGCCTCCTCCTCCG	0.637																																					p.R86K		Atlas-SNP	.											.	KCNA4	158	.	0			c.G257A						.						43.0	45.0	45.0					11																	30033969		2056	4201	6257	SO:0001583	missense	3739	exon2			TGTCGCCTCCTCC	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.257G>A	11.37:g.30033969C>T	ENSP00000328511:p.Arg86Lys	54.0	0.0		46.0	18.0	NM_002233		Missense_Mutation	SNP	ENST00000328224.6	37	CCDS41629.1	.	.	.	.	.	.	.	.	.	.	C	7.643	0.681305	0.14907	.	.	ENSG00000182255	ENST00000328224	D	0.96396	-4.0	4.84	2.95	0.34219	.	7.853160	0.00710	U	0.000828	D	0.90645	0.7066	N	0.08118	0	0.30678	N	0.752597	B	0.02656	0.0	B	0.01281	0.0	T	0.83218	-0.0070	10	0.30078	T	0.28	.	5.8313	0.18582	0.0:0.6302:0.1569:0.2129	.	86	P22459	KCNA4_HUMAN	K	86	ENSP00000328511:R86K	ENSP00000328511:R86K	R	-	2	0	KCNA4	29990545	0.083000	0.21467	0.859000	0.33776	0.082000	0.17680	0.824000	0.27379	0.462000	0.27095	-0.254000	0.11334	AGG	.	.		0.637	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388074.2	NM_002233	
ELF5	2001	hgsc.bcm.edu	37	11	34527248	34527248	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr11:34527248A>G	ENST00000312319.2	-	2	308	c.79T>C	c.(79-81)Tgc>Cgc	p.C27R	ELF5_ENST00000532417.1_Missense_Mutation_p.C17R|ELF5_ENST00000429939.2_Missense_Mutation_p.C17R|ELF5_ENST00000528709.1_5'UTR|ELF5_ENST00000257832.2_Missense_Mutation_p.C17R	NM_001243081.1|NM_198381.1	NP_001230010.1|NP_938195.1	Q9UKW6	ELF5_HUMAN	E74-like factor 5 (ets domain transcription factor)	27					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|ectoderm development (GO:0007398)|mammary gland epithelial cell differentiation (GO:0060644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(4)|skin(1)	5		Acute lymphoblastic leukemia(5;0.0087)|all_hematologic(20;0.0384)				AGGGGATCGCAGAAGGATGCA	0.537																																					p.C27R	Melanoma(61;202 1660 4348 21594)	Atlas-SNP	.											ELF5,colon,carcinoma,+1,1	ELF5	21	1	0			c.T79C						.						191.0	141.0	158.0					11																	34527248		2202	4298	6500	SO:0001583	missense	2001	exon2			GATCGCAGAAGGA	AF049703	CCDS7892.1, CCDS7893.1, CCDS58129.1, CCDS73273.1	11p13-p12	2008-05-14			ENSG00000135374	ENSG00000135374			3320	protein-coding gene	gene with protein product		605169				9840936	Standard	NM_001422		Approved		uc001mvp.2	Q9UKW6	OTTHUMG00000166451	ENST00000312319.2:c.79T>C	11.37:g.34527248A>G	ENSP00000311010:p.Cys27Arg	134.0	0.0		116.0	48.0	NM_198381	A6XAE6|A8K452|O95175|Q8N2K9|Q96QY3|Q9UKW5	Missense_Mutation	SNP	ENST00000312319.2	37	CCDS7892.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.028165	0.35797	.	.	ENSG00000135374	ENST00000257832;ENST00000312319;ENST00000429939;ENST00000532417	T;T;T;T	0.33654	2.54;2.51;1.86;1.4	5.38	4.25	0.50352	Sterile alpha motif/pointed domain (1);	3.120010	0.01230	U	0.008336	T	0.46308	0.1386	N	0.19112	0.55	0.54753	D	0.999988	P;D;D	0.64830	0.486;0.994;0.989	B;D;P	0.77004	0.032;0.989;0.55	T	0.44390	-0.9331	10	0.17369	T	0.5	.	8.8694	0.35307	0.9144:0.0:0.0856:0.0	.	17;17;27	A6XAE6;Q9UKW6-3;Q9UKW6	.;.;ELF5_HUMAN	R	17;27;17;17	ENSP00000257832:C17R;ENSP00000311010:C27R;ENSP00000407589:C17R;ENSP00000436386:C17R	ENSP00000257832:C17R	C	-	1	0	ELF5	34483824	1.000000	0.71417	0.998000	0.56505	0.164000	0.22412	4.990000	0.63876	0.882000	0.36016	0.454000	0.30748	TGC	.	.		0.537	ELF5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389845.1	NM_198381	
OR8H2	390151	hgsc.bcm.edu	37	11	55872886	55872886	+	Missense_Mutation	SNP	A	A	T	rs570097222		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr11:55872886A>T	ENST00000313503.1	+	1	368	c.368A>T	c.(367-369)tAt>tTt	p.Y123F		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CATGATCGCTATGCAGCGATC	0.463										HNSCC(53;0.14)																											p.Y123F		Atlas-SNP	.											.	OR8H2	117	.	0			c.A368T						.						191.0	189.0	190.0					11																	55872886		2201	4296	6497	SO:0001583	missense	390151	exon1			ATCGCTATGCAGC	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.368A>T	11.37:g.55872886A>T	ENSP00000323982:p.Tyr123Phe	128.0	0.0		107.0	47.0	NM_001005200	Q6IFC1	Missense_Mutation	SNP	ENST00000313503.1	37	CCDS31518.1	.	.	.	.	.	.	.	.	.	.	a	11.60	1.687283	0.29962	.	.	ENSG00000181767	ENST00000313503	T	0.02050	4.48	3.35	0.598	0.17512	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000204	T	0.07728	0.0194	M	0.69523	2.12	0.26686	N	0.971448	D	0.89917	1.0	D	0.71414	0.973	T	0.04961	-1.0915	10	0.56958	D	0.05	.	6.2726	0.20963	0.6782:0.1639:0.0:0.1579	.	123	Q8N162	OR8H2_HUMAN	F	123	ENSP00000323982:Y123F	ENSP00000323982:Y123F	Y	+	2	0	OR8H2	55629462	0.166000	0.22962	0.835000	0.33067	0.012000	0.07955	0.884000	0.28214	0.440000	0.26502	-0.724000	0.03597	TAT	.	.		0.463	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391540.1	NM_001005200	
PIWIL4	143689	hgsc.bcm.edu	37	11	94308255	94308255	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr11:94308255G>C	ENST00000299001.6	+	3	468	c.257G>C	c.(256-258)tGt>tCt	p.C86S	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	86					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGAGTATCTGTACCAGAGAA	0.353																																					p.C86S		Atlas-SNP	.											.	PIWIL4	70	.	0			c.G257C						.						120.0	125.0	123.0					11																	94308255		2201	4298	6499	SO:0001583	missense	143689	exon3			GTATCTGTACCAG	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.257G>C	11.37:g.94308255G>C	ENSP00000299001:p.Cys86Ser	150.0	0.0		199.0	81.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	G	6.716	0.500749	0.12822	.	.	ENSG00000134627	ENST00000299001;ENST00000545603	T;T	0.12465	2.68;2.68	4.6	3.61	0.41365	.	0.501088	0.20304	N	0.094967	T	0.09291	0.0229	L	0.43152	1.355	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17107	-1.0380	10	0.13108	T	0.6	-17.7313	4.5016	0.11867	0.2839:0.0:0.7161:0.0	.	86	Q7Z3Z4	PIWL4_HUMAN	S	86;17	ENSP00000299001:C86S;ENSP00000440499:C17S	ENSP00000299001:C86S	C	+	2	0	PIWIL4	93947903	0.929000	0.31497	0.997000	0.53966	0.227000	0.25037	1.372000	0.34261	2.398000	0.81561	0.650000	0.86243	TGT	.	.		0.353	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
AMOTL1	154810	hgsc.bcm.edu	37	11	94602440	94602440	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr11:94602440T>C	ENST00000433060.2	+	12	2707	c.2566T>C	c.(2566-2568)Tcc>Ccc	p.S856P	AMOTL1_ENST00000317837.9_Missense_Mutation_p.S443P|AMOTL1_ENST00000317829.8_Missense_Mutation_p.S806P	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	856					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				AGCACTGTCCTCCATAGCCTC	0.607																																					p.S856P		Atlas-SNP	.											.	AMOTL1	95	.	0			c.T2566C						.						26.0	33.0	31.0					11																	94602440		2157	4265	6422	SO:0001583	missense	154810	exon12			CTGTCCTCCATAG	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.2566T>C	11.37:g.94602440T>C	ENSP00000387739:p.Ser856Pro	122.0	0.0		114.0	5.0	NM_130847	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	T	10.20	1.283514	0.23392	.	.	ENSG00000166025	ENST00000317829;ENST00000317837;ENST00000433060	T;T;T	0.38722	2.29;1.12;2.3	5.48	3.53	0.40419	.	0.351400	0.27797	N	0.017810	T	0.09379	0.0231	N	0.00237	-1.79	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36163	-0.9759	10	0.02654	T	1	-2.9307	8.6656	0.34118	0.0:0.7062:0.0:0.2938	.	806;856	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	P	806;443;856	ENSP00000320968:S806P;ENSP00000323474:S443P;ENSP00000387739:S856P	ENSP00000320968:S806P	S	+	1	0	AMOTL1	94242088	0.083000	0.21467	0.003000	0.11579	0.255000	0.26057	1.126000	0.31344	0.683000	0.31428	-0.337000	0.08149	TCC	.	.		0.607	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396474.3	NM_130847	
GLI1	2735	hgsc.bcm.edu	37	12	57865281	57865281	+	Missense_Mutation	SNP	G	G	A	rs368469814		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr12:57865281G>A	ENST00000228682.2	+	12	2849	c.2758G>A	c.(2758-2760)Gcc>Acc	p.A920T	GLI1_ENST00000546141.1_Missense_Mutation_p.A879T|GLI1_ENST00000543426.1_Missense_Mutation_p.A792T	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	920					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			AGATGCCCCCGCCCAGGAACC	0.562																																					p.A920T	Pancreas(157;841 1936 10503 41495 50368)	Atlas-SNP	.											.	GLI1	141	.	0			c.G2758A						.	G	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	34.0	38.0	36.0		2374,2635,2758	1.1	0.6	12		36	2,8598	1.2+/-3.3	0,2,4298	no	missense,missense,missense	GLI1	NM_001160045.1,NM_001167609.1,NM_005269.2	58,58,58	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign,benign,benign	792/979,879/1066,920/1107	57865281	2,13004	2203	4300	6503	SO:0001583	missense	2735	exon12			GCCCCCGCCCAGG		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.2758G>A	12.37:g.57865281G>A	ENSP00000228682:p.Ala920Thr	87.0	0.0		113.0	33.0	NM_005269	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	37	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	G	2.388	-0.340469	0.05243	0.0	2.33E-4	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.12465	2.79;2.68;2.75;2.75	4.53	1.09	0.20402	.	0.811582	0.10385	N	0.681045	T	0.04998	0.0134	N	0.08118	0	0.09310	N	1	B	0.24426	0.103	B	0.14023	0.01	T	0.43702	-0.9375	10	0.08599	T	0.76	.	4.156	0.10261	0.3576:0.1672:0.4752:0.0	.	920	P08151	GLI1_HUMAN	T	792;920;879;879;388	ENSP00000437607:A792T;ENSP00000228682:A920T;ENSP00000441006:A879T;ENSP00000434408:A879T	ENSP00000228682:A920T	A	+	1	0	GLI1	56151548	0.000000	0.05858	0.562000	0.28370	0.204000	0.24138	-0.167000	0.09940	0.096000	0.17463	-0.234000	0.12200	GCC	.	.		0.562	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
MYBPC1	4604	hgsc.bcm.edu	37	12	102045035	102045035	+	Silent	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr12:102045035C>T	ENST00000550270.1	+	14	1315	c.1315C>T	c.(1315-1317)Ctg>Ttg	p.L439L	MYBPC1_ENST00000553190.1_Silent_p.L439L|MYBPC1_ENST00000545503.2_Silent_p.L439L|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000536007.1_Silent_p.L420L|MYBPC1_ENST00000441232.1_Silent_p.L439L|MYBPC1_ENST00000360610.2_Silent_p.L439L|MYBPC1_ENST00000549145.1_Silent_p.L452L|MYBPC1_ENST00000361685.2_Silent_p.L464L|MYBPC1_ENST00000547509.1_Silent_p.L425L|MYBPC1_ENST00000547405.1_Silent_p.L413L|MYBPC1_ENST00000361466.2_Silent_p.L464L|MYBPC1_ENST00000392934.3_Silent_p.L426L|MYBPC1_ENST00000541119.1_Silent_p.L427L|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000452455.2_Silent_p.L439L|MYBPC1_ENST00000551300.1_Silent_p.L340L			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	439	Ig-like C2-type 4.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						TTTGACACCTCTGACTGATCA	0.413																																					p.L464L		Atlas-SNP	.											.	MYBPC1	235	.	0			c.C1390T						.						131.0	136.0	135.0					12																	102045035		2203	4300	6503	SO:0001819	synonymous_variant	4604	exon16			ACACCTCTGACTG		CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1315C>T	12.37:g.102045035C>T		150.0	0.0		133.0	53.0	NM_206819	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	ENST00000550270.1	37	CCDS9085.1																																																																																			.	.		0.413	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000408806.1		
COL4A1	1282	hgsc.bcm.edu	37	13	110807652	110807652	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr13:110807652C>T	ENST00000375820.4	-	50	4854	c.4733G>A	c.(4732-4734)tGg>tAg	p.W1578*		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1578	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GTAGCCGATCCACAGCGAGGA	0.612																																					p.W1578X		Atlas-SNP	.											COL4A1_ENST00000375815,NS,carcinoma,-1,2	COL4A1	372	2	0			c.G4733A						.						62.0	60.0	61.0					13																	110807652		2203	4300	6503	SO:0001587	stop_gained	1282	exon50			CCGATCCACAGCG	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4733G>A	13.37:g.110807652C>T	ENSP00000364979:p.Trp1578*	200.0	1.0		164.0	89.0	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Nonsense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	46	12.191043	0.99645	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0031	0.92841	0.0:1.0:0.0:0.0	.	.	.	.	X	1221;1578;1227	.	ENSP00000364973:W1221X	W	-	2	0	COL4A1	109605653	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.525000	0.81892	2.479000	0.83701	0.609000	0.83330	TGG	.	.		0.612	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
OR4M1	441670	hgsc.bcm.edu	37	14	20248678	20248678	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr14:20248678T>C	ENST00000315957.4	+	1	278	c.197T>C	c.(196-198)cTg>cCg	p.L66P		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTGGCTAATCTGGCCCTCCTT	0.418																																					p.L66P		Atlas-SNP	.											OR4M1,NS,carcinoma,-1,1	OR4M1	104	1	0			c.T197C						.						309.0	326.0	320.0					14																	20248678		2203	4300	6503	SO:0001583	missense	441670	exon1			CTAATCTGGCCCT		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.197T>C	14.37:g.20248678T>C	ENSP00000319654:p.Leu66Pro	147.0	0.0		144.0	59.0	NM_001005500	B9EH18|Q6IFA3	Missense_Mutation	SNP	ENST00000315957.4	37	CCDS32021.1	.	.	.	.	.	.	.	.	.	.	.	14.18	2.459442	0.43736	.	.	ENSG00000176299	ENST00000315957	T	0.00591	6.35	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36703	N	0.002460	T	0.05318	0.0141	H	0.97962	4.115	0.49687	D	0.999815	D	0.89917	1.0	D	0.75484	0.986	T	0.00367	-1.1785	10	0.87932	D	0	-6.2105	11.5315	0.50614	0.0:0.0:0.0:1.0	.	66	Q8NGD0	OR4M1_HUMAN	P	66	ENSP00000319654:L66P	ENSP00000319654:L66P	L	+	2	0	OR4M1	19318518	0.914000	0.31030	0.974000	0.42286	0.937000	0.57800	5.599000	0.67592	1.894000	0.54839	0.330000	0.21533	CTG	.	.		0.418	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409770.1		
RORA	6095	hgsc.bcm.edu	37	15	60824052	60824052	+	Splice_Site	SNP	T	T	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr15:60824052T>A	ENST00000335670.6	-	3	297		c.e3-2		CTD-2501E16.2_ENST00000560280.1_RNA|RP11-219B17.1_ENST00000559902.1_RNA|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000261523.5_Splice_Site|RP11-219B17.1_ENST00000559203.1_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000449337.2_Splice_Site|RP11-219B17.1_ENST00000558140.1_RNA|RORA_ENST00000309157.4_Splice_Site|RORA_ENST00000560004.1_Splice_Site	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A						angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						CAATTTGAGCTGCAACAGAAG	0.358																																					.		Atlas-SNP	.											.	RORA	114	.	0			c.272-2A>T						.						108.0	97.0	101.0					15																	60824052		2203	4300	6503	SO:0001630	splice_region_variant	6095	exon4			TTGAGCTGCAACA	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.197-2A>T	15.37:g.60824052T>A		165.0	0.0		185.0	84.0	NM_002943	P35397|P35399|P45445|Q495X4|Q96H83	Splice_Site	SNP	ENST00000335670.6	37	CCDS10177.1	.	.	.	.	.	.	.	.	.	.	T	19.78	3.891081	0.72524	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3317	0.74219	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RORA	58611344	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.206000	0.71126	0.528000	0.53228	.	.	.		0.358	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		Intron
HERC1	8925	hgsc.bcm.edu	37	15	63966786	63966786	+	Missense_Mutation	SNP	A	A	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr15:63966786A>T	ENST00000443617.2	-	38	7688	c.7601T>A	c.(7600-7602)aTa>aAa	p.I2534K	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2534					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AACTTTTGGTATCAGCAACAG	0.473																																					p.I2534K		Atlas-SNP	.											.	HERC1	624	.	0			c.T7601A						.						69.0	67.0	68.0					15																	63966786		1996	4175	6171	SO:0001583	missense	8925	exon38			TTTGGTATCAGCA	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.7601T>A	15.37:g.63966786A>T	ENSP00000390158:p.Ile2534Lys	182.0	0.0		173.0	85.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.560882	0.86335	.	.	ENSG00000103657	ENST00000443617	T	0.29917	1.55	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.32852	0.0843	N	0.24115	0.695	0.80722	D	1	D	0.54964	0.969	P	0.50352	0.638	T	0.11518	-1.0584	10	0.87932	D	0	.	16.2631	0.82557	1.0:0.0:0.0:0.0	.	2534	Q15751	HERC1_HUMAN	K	2534	ENSP00000390158:I2534K	ENSP00000390158:I2534K	I	-	2	0	HERC1	61753839	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	9.339000	0.96797	2.239000	0.73571	0.528000	0.53228	ATA	.	.		0.473	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
SEMA7A	8482	hgsc.bcm.edu	37	15	74706891	74706891	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr15:74706891T>C	ENST00000261918.4	-	10	1839	c.1291A>G	c.(1291-1293)Aca>Gca	p.T431A	SEMA7A_ENST00000543145.2_Missense_Mutation_p.T417A|SEMA7A_ENST00000542748.1_Missense_Mutation_p.T266A	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	431	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						CTCTCACCTGTAGTTAGGTAA	0.483																																					p.T431A		Atlas-SNP	.											.	SEMA7A	58	.	0			c.A1291G						.						111.0	117.0	115.0					15																	74706891		2197	4296	6493	SO:0001583	missense	8482	exon10			CACCTGTAGTTAG	AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.1291A>G	15.37:g.74706891T>C	ENSP00000261918:p.Thr431Ala	247.0	0.0		192.0	86.0	NM_003612	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Missense_Mutation	SNP	ENST00000261918.4	37	CCDS10262.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.089903	0.76756	.	.	ENSG00000138623	ENST00000261918;ENST00000543145;ENST00000542748	T;T;T	0.33216	1.42;1.42;1.42	5.46	5.46	0.80206	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	M	0.76727	2.345	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69654	0.941;0.965	T	0.59337	-0.7473	10	0.87932	D	0	.	14.0647	0.64821	0.0:0.0:0.0:1.0	.	417;431	F5H1S0;O75326	.;SEM7A_HUMAN	A	431;417;266	ENSP00000261918:T431A;ENSP00000438966:T417A;ENSP00000441493:T266A	ENSP00000261918:T431A	T	-	1	0	SEMA7A	72493944	1.000000	0.71417	1.000000	0.80357	0.676000	0.39594	5.083000	0.64456	2.211000	0.71520	0.454000	0.30748	ACA	.	.		0.483	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272904.3	NM_003612	
SEMA7A	8482	hgsc.bcm.edu	37	15	74706913	74706913	+	Silent	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr15:74706913G>T	ENST00000261918.4	-	10	1817	c.1269C>A	c.(1267-1269)acC>acA	p.T423T	SEMA7A_ENST00000543145.2_Silent_p.T409T|SEMA7A_ENST00000542748.1_Silent_p.T258T	NM_003612.3	NP_003603.1	O75326	SEM7A_HUMAN	semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group)	423	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|immune response (GO:0006955)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|olfactory lobe development (GO:0021988)|osteoblast differentiation (GO:0001649)|positive regulation of axon extension (GO:0045773)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of protein phosphorylation (GO:0001934)|regulation of inflammatory response (GO:0050727)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	30						GCACATGAAAGGTCTCCCCGT	0.517																																					p.T423T		Atlas-SNP	.											.	SEMA7A	58	.	0			c.C1269A						.						114.0	119.0	117.0					15																	74706913		2197	4296	6493	SO:0001819	synonymous_variant	8482	exon10			ATGAAAGGTCTCC	AF069493	CCDS10262.1, CCDS53958.1, CCDS53959.1	15q22.3-q23	2014-07-18	2006-02-23		ENSG00000138623	ENSG00000138623		"""Semaphorins"", ""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10741	protein-coding gene	gene with protein product	"""John Milton Hagen blood group"", ""H-Sema K1"""	607961	"""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A"", ""sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A (JMH blood group)"""	SEMAL		9721204	Standard	NM_003612		Approved	H-Sema-L, CD108	uc002axv.3	O75326	OTTHUMG00000139000	ENST00000261918.4:c.1269C>A	15.37:g.74706913G>T		261.0	0.0		202.0	91.0	NM_003612	B4DDP7|F5H1S0|Q1XE81|Q1XE82|Q1XE83|Q1XE84|Q3MIY5	Silent	SNP	ENST00000261918.4	37	CCDS10262.1																																																																																			.	.		0.517	SEMA7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272904.3	NM_003612	
CSK	1445	hgsc.bcm.edu	37	15	75094691	75094691	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr15:75094691C>A	ENST00000220003.9	+	13	1919	c.1190C>A	c.(1189-1191)cCt>cAt	p.P397H	CSK_ENST00000567571.1_Missense_Mutation_p.P397H|CSK_ENST00000439220.2_Missense_Mutation_p.P397H|CSK_ENST00000309470.9_Missense_Mutation_p.P397H	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	397	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						GACGTCGTCCCTCGGGTGGAG	0.662																																					p.P397H		Atlas-SNP	.											.	CSK	43	.	0			c.C1190A						.						50.0	58.0	55.0					15																	75094691		2197	4296	6493	SO:0001583	missense	1445	exon14			TCGTCCCTCGGGT		CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.1190C>A	15.37:g.75094691C>A	ENSP00000220003:p.Pro397His	48.0	0.0		50.0	25.0	NM_001127190	Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	37	CCDS10269.1	.	.	.	.	.	.	.	.	.	.	C	19.80	3.894076	0.72639	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	D;D;D	0.82255	-1.59;-1.59;-1.59	4.28	4.28	0.50868	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72558	0.3475	N	0.11064	0.09	0.80722	D	1	D	0.54397	0.966	P	0.47015	0.534	T	0.73344	-0.4012	10	0.26408	T	0.33	-8.9995	15.6577	0.77155	0.0:1.0:0.0:0.0	.	397	P41240	CSK_HUMAN	H	397;397;346;397	ENSP00000220003:P397H;ENSP00000414764:P397H;ENSP00000438808:P397H	ENSP00000220003:P397H	P	+	2	0	CSK	72881744	0.220000	0.23631	1.000000	0.80357	0.995000	0.86356	1.549000	0.36212	2.218000	0.71995	0.563000	0.77884	CCT	.	.		0.662	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2	NM_004383	
CES1	1066	hgsc.bcm.edu	37	16	55853489	55853489	+	Silent	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr16:55853489T>C	ENST00000361503.4	-	7	991	c.861A>G	c.(859-861)cgA>cgG	p.R287R	CES1_ENST00000566555.1_5'Flank|CES1_ENST00000360526.3_Silent_p.R288R|CES1_ENST00000422046.2_Silent_p.R287R			P23141	EST1_HUMAN	carboxylesterase 1	287					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	CCGTCTTCTGTCGCAGGCAGT	0.498																																					p.R288R	NSCLC(162;1801 2756 42904 52896)	Atlas-SNP	.											CES1_ENST00000360526,NS,adenoma,-1,1	CES1	78	1	0			c.A864G						.						141.0	140.0	140.0					16																	55853489		2198	4300	6498	SO:0001819	synonymous_variant	1066	exon7			CTTCTGTCGCAGG	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.861A>G	16.37:g.55853489T>C		71.0	2.0		88.0	7.0	NM_001025195	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Silent	SNP	ENST00000361503.4	37	CCDS45488.1																																																																																			.	.		0.498	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
MYH1	4619	hgsc.bcm.edu	37	17	10404770	10404770	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:10404770G>A	ENST00000226207.5	-	27	3489	c.3395C>T	c.(3394-3396)tCc>tTc	p.S1132F	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1132					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TTTGGCCCGGGAGGCCCGCTC	0.567																																					p.S1132F		Atlas-SNP	.											MYH1,NS,carcinoma,-1,1	MYH1	403	1	0			c.C3395T						.						39.0	44.0	42.0					17																	10404770		2203	4295	6498	SO:0001583	missense	4619	exon27			GCCCGGGAGGCCC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3395C>T	17.37:g.10404770G>A	ENSP00000226207:p.Ser1132Phe	98.0	0.0		62.0	49.0	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	37	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054564	0.75960	.	.	ENSG00000109061	ENST00000226207	T	0.78924	-1.22	5.3	5.3	0.74995	Myosin tail (1);	0.000000	0.42964	U	0.000628	T	0.73418	0.3584	L	0.37697	1.125	0.58432	D	0.999999	P	0.38535	0.635	B	0.38921	0.285	T	0.76822	-0.2817	10	0.72032	D	0.01	.	19.3291	0.94278	0.0:0.0:1.0:0.0	.	1132	P12882	MYH1_HUMAN	F	1132	ENSP00000226207:S1132F	ENSP00000226207:S1132F	S	-	2	0	MYH1	10345495	1.000000	0.71417	0.991000	0.47740	0.994000	0.84299	7.916000	0.87491	2.641000	0.89580	0.650000	0.86243	TCC	.	.		0.567	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MYH2	4620	hgsc.bcm.edu	37	17	10438678	10438678	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:10438678T>C	ENST00000245503.5	-	18	2363	c.1979A>G	c.(1978-1980)aAt>aGt	p.N660S	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Missense_Mutation_p.N660S|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	660	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTTGTTCAAATTCTCCTGTAA	0.388																																					p.N660S		Atlas-SNP	.											.	MYH2	390	.	0			c.A1979G						.						79.0	77.0	77.0					17																	10438678		2203	4300	6503	SO:0001583	missense	4620	exon18			TTCAAATTCTCCT		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.1979A>G	17.37:g.10438678T>C	ENSP00000245503:p.Asn660Ser	147.0	0.0		68.0	58.0	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	T	17.08	3.298973	0.60195	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.68624	-0.34;-0.34	4.97	4.97	0.65823	Myosin head, motor domain (2);	0.000000	0.41605	U	0.000841	T	0.45438	0.1342	N	0.02973	-0.45	0.54753	D	0.999985	B	0.20459	0.045	B	0.31101	0.124	T	0.41787	-0.9489	10	0.23302	T	0.38	.	14.8132	0.70010	0.0:0.0:0.0:1.0	.	660	Q9UKX2	MYH2_HUMAN	S	660	ENSP00000245503:N660S;ENSP00000380367:N660S	ENSP00000245503:N660S	N	-	2	0	MYH2	10379403	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.848000	0.86902	2.086000	0.62901	0.533000	0.62120	AAT	.	.		0.388	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
MYOCD	93649	hgsc.bcm.edu	37	17	12649346	12649346	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:12649346C>A	ENST00000343344.4	+	9	1082	c.1082C>A	c.(1081-1083)tCt>tAt	p.S361Y	AC005358.1_ENST00000609971.1_Missense_Mutation_p.S265Y|MYOCD_ENST00000425538.1_Missense_Mutation_p.S361Y|MYOCD_ENST00000395988.1_3'UTR			Q8IZQ8	MYCD_HUMAN	myocardin	361					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		GGTGTCTCTTCTTTCAAACCA	0.408																																					p.S361Y		Atlas-SNP	.											.	MYOCD	291	.	0			c.C1082A						.						127.0	122.0	124.0					17																	12649346		2203	4300	6503	SO:0001583	missense	93649	exon9			TCTCTTCTTTCAA	AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.1082C>A	17.37:g.12649346C>A	ENSP00000341835:p.Ser361Tyr	105.0	0.0		65.0	52.0	NM_001146312	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	ENST00000343344.4	37	CCDS11163.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.239249	0.79800	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000395988;ENST00000443061	T;T	0.50277	0.75;0.79	5.71	5.71	0.89125	.	0.224226	0.48767	D	0.000174	T	0.56906	0.2017	L	0.27053	0.805	0.54753	D	0.999988	D;D;D;D	0.76494	0.999;0.998;0.998;0.997	D;D;D;D	0.70487	0.962;0.969;0.969;0.931	T	0.59268	-0.7486	10	0.66056	D	0.02	-12.2496	16.78	0.85561	0.0:1.0:0.0:0.0	.	80;265;361;361	E9PEP9;Q8IZQ8-2;Q8IZQ8-3;Q8IZQ8	.;.;.;MYCD_HUMAN	Y	80;361;361;265;66	ENSP00000341835:S361Y;ENSP00000400148:S66Y	ENSP00000341835:S361Y	S	+	2	0	MYOCD	12590071	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.642000	0.54367	2.704000	0.92352	0.561000	0.74099	TCT	.	.		0.408	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129950.1	NM_153604	
LGALS9	3965	hgsc.bcm.edu	37	17	25975942	25975942	+	Missense_Mutation	SNP	G	G	T	rs373192382		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:25975942G>T	ENST00000395473.2	+	11	2470	c.1002G>T	c.(1000-1002)agG>agT	p.R334S	LGALS9_ENST00000413914.2_3'UTR|LGALS9_ENST00000310394.5_Missense_Mutation_p.R290S|LGALS9_ENST00000302228.5_Missense_Mutation_p.R302S|LGALS9_ENST00000313648.6_3'UTR	NM_009587.2	NP_033665.1	O00182	LEG9_HUMAN	lectin, galactoside-binding, soluble, 9	334	Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|galactose binding (GO:0005534)|signal transducer activity (GO:0004871)			endometrium(3)|large_intestine(2)|lung(12)|skin(1)	18	Lung NSC(42;0.0103)		BRCA - Breast invasive adenocarcinoma(3;0.0141)	UCEC - Uterine corpus endometrioid carcinoma (53;0.155)		ATCGCCTGAGGAACCTGCCCA	0.602																																					p.R334S	Melanoma(106;677 1527 28724 29571 46552)|Ovarian(193;263 2088 2118 29005 43023)	Atlas-SNP	.											.	LGALS9	29	.	0			c.G1002T						.						281.0	250.0	261.0					17																	25975942		2203	4300	6503	SO:0001583	missense	3965	exon11			CCTGAGGAACCTG	AB006782	CCDS11222.1, CCDS32592.1	17q11.2	2013-03-28	2008-07-25		ENSG00000168961	ENSG00000168961		"""Lectins, galactoside-binding"""	6570	protein-coding gene	gene with protein product	"""galectin 9"""	601879				9045665	Standard	NM_009587		Approved	LGALS9A	uc002gzp.3	O00182	OTTHUMG00000179831	ENST00000395473.2:c.1002G>T	17.37:g.25975942G>T	ENSP00000378856:p.Arg334Ser	1057.0	0.0		892.0	401.0	NM_009587	A7VJG6|O14532|O75028|Q3B8N1|Q53FQ0|Q9NQ58	Missense_Mutation	SNP	ENST00000395473.2	37	CCDS11222.1	.	.	.	.	.	.	.	.	.	.	G	7.798	0.713065	0.15306	.	.	ENSG00000168961	ENST00000395473;ENST00000302228;ENST00000310394	T;T;T	0.10477	2.87;2.87;2.87	4.73	-4.61	0.03380	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.752729	0.11972	N	0.511684	T	0.03434	0.0099	N	0.12443	0.215	0.09310	N	0.999992	B;B;B	0.17667	0.002;0.023;0.023	B;B;B	0.18561	0.004;0.022;0.022	T	0.43475	-0.9389	10	0.15066	T	0.55	.	0.1677	0.00110	0.325:0.2375:0.1964:0.2411	.	245;302;334	B4DJD7;Q3B8N1;O00182	.;.;LEG9_HUMAN	S	334;302;290	ENSP00000378856:R334S;ENSP00000306228:R302S;ENSP00000312259:R290S	ENSP00000306228:R302S	R	+	3	2	LGALS9	23000069	0.000000	0.05858	0.855000	0.33649	0.001000	0.01503	-0.383000	0.07398	-0.460000	0.07003	-1.136000	0.01936	AGG	.	.		0.602	LGALS9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255583.1	NM_009587	
NUFIP2	57532	hgsc.bcm.edu	37	17	27620945	27620945	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:27620945G>T	ENST00000225388.4	-	1	191	c.133C>A	c.(133-135)Cac>Aac	p.H45N	NUFIP2_ENST00000579665.1_Missense_Mutation_p.H45N	NM_020772.2	NP_065823.1	Q7Z417	NUFP2_HUMAN	nuclear fragile X mental retardation protein interacting protein 2	45	His-rich.					cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	24			BRCA - Breast invasive adenocarcinoma(11;0.000457)|Colorectal(6;0.0178)|COAD - Colon adenocarcinoma(6;0.0551)			tggtggtggtggttgtggctg	0.587																																					p.H45N		Atlas-SNP	.											NUFIP2,right_lower_lobe,carcinoma,0,1	NUFIP2	60	1	0			c.C133A						.						127.0	125.0	125.0					17																	27620945		2203	4300	6503	SO:0001583	missense	57532	exon1			GGTGGTGGTTGTG	AB037742	CCDS32600.1	17q11.1	2006-03-01				ENSG00000108256			17634	protein-coding gene	gene with protein product		609356				12837692, 16407062	Standard	NM_020772		Approved	KIAA1321, MGC117262, PIG1, 182-FIP, FIP-82, 82-FIP	uc002hdy.4	Q7Z417		ENST00000225388.4:c.133C>A	17.37:g.27620945G>T	ENSP00000225388:p.His45Asn	99.0	0.0		111.0	5.0	NM_020772	A1L3A6|Q9P2M5	Missense_Mutation	SNP	ENST00000225388.4	37	CCDS32600.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778902	0.49891	.	.	ENSG00000108256	ENST00000225388	.	.	.	5.41	5.41	0.78517	.	0.000000	0.46758	D	0.000266	T	0.24470	0.0593	N	0.08118	0	0.32353	N	0.558245	B;B	0.34226	0.238;0.443	B;B	0.30943	0.122;0.047	T	0.33777	-0.9855	9	0.45353	T	0.12	0.0249	14.6859	0.69049	0.0:0.0:1.0:0.0	.	45;45	Q7Z417;A1L3A6	NUFP2_HUMAN;.	N	45	.	ENSP00000225388:H45N	H	-	1	0	NUFIP2	24645071	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.321000	0.65846	2.539000	0.85634	0.467000	0.42956	CAC	.	.		0.587	NUFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447015.2	NM_020772	
FNDC8	54752	hgsc.bcm.edu	37	17	33448911	33448911	+	Missense_Mutation	SNP	A	A	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:33448911A>G	ENST00000158009.5	+	1	314	c.199A>G	c.(199-201)Atc>Gtc	p.I67V	RAD51D_ENST00000394589.4_5'Flank|RAD51D_ENST00000590016.1_5'Flank|RAD51D_ENST00000345365.6_5'Flank|RAD51L3-RFFL_ENST00000593039.1_5'Flank|RAD51D_ENST00000360276.3_5'Flank|RAD51D_ENST00000335858.7_5'Flank|RAD51D_ENST00000357906.3_5'Flank|RAD51D_ENST00000460118.2_5'Flank|RAD51D_ENST00000590380.1_5'Flank	NM_017559.2	NP_060029.1	Q8TC99	FNDC8_HUMAN	fibronectin type III domain containing 8	67						nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	11		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.022)		GGATGATACCATCAACCTACT	0.512																																					p.I67V		Atlas-SNP	.											FNDC8,NS,carcinoma,-1,1	FNDC8	28	1	0			c.A199G						.						100.0	92.0	95.0					17																	33448911		2203	4300	6503	SO:0001583	missense	54752	exon1			GATACCATCAACC	BC024002	CCDS11290.1	17q12	2013-02-11			ENSG00000073598	ENSG00000073598		"""Fibronectin type III domain containing"""	25286	protein-coding gene	gene with protein product						12477932	Standard	XM_005257993		Approved	DKFZp434H2215	uc002hix.3	Q8TC99	OTTHUMG00000132932	ENST00000158009.5:c.199A>G	17.37:g.33448911A>G	ENSP00000158009:p.Ile67Val	137.0	1.0		103.0	44.0	NM_017559	B2R9G6|Q9UFC2	Missense_Mutation	SNP	ENST00000158009.5	37	CCDS11290.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.460184	0.26248	.	.	ENSG00000073598	ENST00000158009	T	0.31510	1.49	4.68	2.28	0.28536	.	0.409342	0.21140	N	0.079492	T	0.16685	0.0401	N	0.24115	0.695	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.12142	-1.0559	10	0.46703	T	0.11	-9.6888	3.7095	0.08414	0.7087:0.0:0.1022:0.1891	.	67	Q8TC99	FNDC8_HUMAN	V	67	ENSP00000158009:I67V	ENSP00000158009:I67V	I	+	1	0	FNDC8	30473024	0.072000	0.21174	0.093000	0.20910	0.162000	0.22319	1.579000	0.36536	0.903000	0.36546	0.454000	0.30748	ATC	.	.		0.512	FNDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256459.2	NM_017559	
NBR1	4077	hgsc.bcm.edu	37	17	41346472	41346472	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:41346472G>A	ENST00000422280.1	+	13	2089	c.1630G>A	c.(1630-1632)Gag>Aag	p.E544K	NBR1_ENST00000589872.1_Missense_Mutation_p.E544K|NBR1_ENST00000542611.1_Missense_Mutation_p.E523K|NBR1_ENST00000389312.4_Missense_Mutation_p.E544K|NBR1_ENST00000341165.6_Missense_Mutation_p.E544K|NBR1_ENST00000590996.1_Missense_Mutation_p.E544K	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	544	ATG8 family protein-binding.				macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		TGTTGCCAGTGAGAGGGAGCT	0.507																																					p.E544K		Atlas-SNP	.											.	NBR1	55	.	0			c.G1630A						.						156.0	158.0	157.0					17																	41346472		1984	4148	6132	SO:0001583	missense	4077	exon13			GCCAGTGAGAGGG	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1630G>A	17.37:g.41346472G>A	ENSP00000411250:p.Glu544Lys	293.0	1.0		256.0	115.0	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	37	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.241125	0.39598	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.45668	1.49;0.89;1.49;1.49	5.91	3.94	0.45596	.	.	.	.	.	T	0.33059	0.0850	L	0.33485	1.01	0.44092	D	0.99685	B;B;B;B	0.14438	0.005;0.01;0.008;0.005	B;B;B;B	0.18871	0.006;0.014;0.023;0.006	T	0.09465	-1.0673	9	0.54805	T	0.06	-6.7715	11.6268	0.51151	0.1445:0.0:0.8555:0.0	.	544;523;544;544	A8K1U0;B7Z5R6;Q14596-2;Q14596	.;.;.;NBR1_HUMAN	K	544;523;544;544;544	ENSP00000411250:E544K;ENSP00000437545:E523K;ENSP00000343479:E544K;ENSP00000373963:E544K	ENSP00000343479:E544K	E	+	1	0	NBR1	38599998	1.000000	0.71417	0.779000	0.31741	0.468000	0.32798	4.110000	0.57831	0.862000	0.35528	-0.140000	0.14226	GAG	.	.		0.507	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
TOB1	10140	hgsc.bcm.edu	37	17	48940589	48940589	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:48940589T>A	ENST00000268957.3	-	3	1218	c.790A>T	c.(790-792)Acc>Tcc	p.T264S	TOB1_ENST00000499247.2_Missense_Mutation_p.T264S|TOB1_ENST00000509385.1_5'Flank	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	264					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AGAGCAGAGGTTTTctgctgt	0.537																																					p.T264S	NSCLC(144;643 1919 24513 29423 40686)	Atlas-SNP	.											.	TOB1	40	.	0			c.A790T						.						50.0	48.0	48.0					17																	48940589		2203	4300	6503	SO:0001583	missense	10140	exon2			CAGAGGTTTTCTG	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.790A>T	17.37:g.48940589T>A	ENSP00000268957:p.Thr264Ser	98.0	0.0		111.0	24.0	NM_005749	B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	ENST00000268957.3	37	CCDS11576.1	.	.	.	.	.	.	.	.	.	.	T	7.267	0.606423	0.14002	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.41758	0.99;0.99	6.06	5.0	0.66597	.	0.394592	0.29522	N	0.011913	T	0.19087	0.0458	N	0.08118	0	0.34169	D	0.669623	B	0.14012	0.009	B	0.10450	0.005	T	0.21484	-1.0244	10	0.07325	T	0.83	.	8.0231	0.30421	0.0:0.0679:0.1362:0.7958	.	264	P50616	TOB1_HUMAN	S	264	ENSP00000427695:T264S;ENSP00000268957:T264S	ENSP00000268957:T264S	T	-	1	0	TOB1	46295588	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.298000	0.33412	1.123000	0.41961	0.528000	0.53228	ACC	.	.		0.537	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1		
KIF19	124602	hgsc.bcm.edu	37	17	72349069	72349069	+	Missense_Mutation	SNP	C	C	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:72349069C>G	ENST00000389916.4	+	15	2228	c.2090C>G	c.(2089-2091)gCc>gGc	p.A697G	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	697					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CAGAACAGCGCCCTCCCTCCC	0.597																																					p.A697G		Atlas-SNP	.											.	KIF19	102	.	0			c.C2090G						.						64.0	71.0	69.0					17																	72349069		2014	4178	6192	SO:0001583	missense	124602	exon15			ACAGCGCCCTCCC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2090C>G	17.37:g.72349069C>G	ENSP00000374566:p.Ala697Gly	99.0	0.0		135.0	34.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	37	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136354	0.37728	.	.	ENSG00000196169	ENST00000389916	T	0.70516	-0.49	5.08	1.68	0.24146	.	.	.	.	.	T	0.44456	0.1294	N	0.08118	0	0.09310	N	1	B	0.17667	0.023	B	0.14023	0.01	T	0.24368	-1.0162	9	0.25106	T	0.35	.	4.183	0.10385	0.0:0.5076:0.2367:0.2556	.	697	Q2TAC6	KIF19_HUMAN	G	697	ENSP00000374566:A697G	ENSP00000374566:A697G	A	+	2	0	KIF19	69860664	0.000000	0.05858	0.128000	0.21923	0.069000	0.16628	0.483000	0.22292	0.471000	0.27319	0.456000	0.33151	GCC	.	.		0.597	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
EVPL	2125	hgsc.bcm.edu	37	17	74004527	74004527	+	Missense_Mutation	SNP	G	G	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr17:74004527G>C	ENST00000301607.3	-	22	5012	c.4759C>G	c.(4759-4761)Cag>Gag	p.Q1587E	EVPL_ENST00000586740.1_Missense_Mutation_p.Q1609E|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1587	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TGGTCGGCCTGGTCCCGGGCC	0.701																																					p.Q1587E		Atlas-SNP	.											.	EVPL	155	.	0			c.C4759G						.						6.0	7.0	7.0					17																	74004527		2151	4211	6362	SO:0001583	missense	2125	exon22			CGGCCTGGTCCCG	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.4759C>G	17.37:g.74004527G>C	ENSP00000301607:p.Gln1587Glu	65.0	0.0		183.0	82.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	G	4.116	0.019660	0.08006	.	.	ENSG00000167880	ENST00000301607	T	0.63255	-0.03	5.17	5.17	0.71159	.	0.758911	0.12398	N	0.472409	T	0.60327	0.2260	M	0.63428	1.95	0.09310	N	1	B;B	0.17465	0.022;0.01	B;B	0.10450	0.005;0.004	T	0.49051	-0.8979	10	0.20046	T	0.44	-32.1298	15.0738	0.72059	0.0:0.1422:0.8578:0.0	.	1609;1587	B7ZLH8;Q92817	.;EVPL_HUMAN	E	1587	ENSP00000301607:Q1587E	ENSP00000301607:Q1587E	Q	-	1	0	EVPL	71516122	1.000000	0.71417	0.814000	0.32528	0.848000	0.48234	3.515000	0.53429	2.413000	0.81919	0.561000	0.74099	CAG	.	.		0.701	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
EPG5	57724	hgsc.bcm.edu	37	18	43505857	43505857	+	Nonsense_Mutation	SNP	G	G	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr18:43505857G>C	ENST00000282041.5	-	14	2599	c.2565C>G	c.(2563-2565)taC>taG	p.Y855*		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	855					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						CTTTAAACAAGTATAGAGAAA	0.303																																					p.Y855X		Atlas-SNP	.											.	EPG5	199	.	0			c.C2565G						.						60.0	54.0	56.0					18																	43505857		1818	4075	5893	SO:0001587	stop_gained	57724	exon14			AAACAAGTATAGA	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.2565C>G	18.37:g.43505857G>C	ENSP00000282041:p.Tyr855*	187.0	0.0		229.0	155.0	NM_020964	A2BDF3|Q9H8C8	Nonsense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	G	40	8.299130	0.98750	.	.	ENSG00000152223	ENST00000282041	.	.	.	5.47	2.72	0.32119	.	1.157670	0.05983	N	0.644630	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.6092	7.4008	0.26962	0.3981:0.0:0.6019:0.0	.	.	.	.	X	855	.	ENSP00000282041:Y855X	Y	-	3	2	EPG5	41759855	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	3.046000	0.49846	0.384000	0.24942	0.650000	0.86243	TAC	.	.		0.303	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
ABCA7	10347	hgsc.bcm.edu	37	19	1062215	1062215	+	Missense_Mutation	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr19:1062215G>T	ENST00000263094.6	+	42	5846	c.5615G>T	c.(5614-5616)tGc>tTc	p.C1872F	ABCA7_ENST00000433129.1_Missense_Mutation_p.C1872F|ABCA7_ENST00000435683.2_Missense_Mutation_p.C1734F	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	1872	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGGGATACTGCCCTCAATCC	0.682																																					p.C1872F		Atlas-SNP	.											.	ABCA7	174	.	0			c.G5615T						.						107.0	115.0	112.0					19																	1062215		2203	4300	6503	SO:0001583	missense	10347	exon42			GATACTGCCCTCA	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.5615G>T	19.37:g.1062215G>T	ENSP00000263094:p.Cys1872Phe	106.0	0.0		67.0	30.0	NM_019112	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Missense_Mutation	SNP	ENST00000263094.6	37	CCDS12055.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120353	0.56613	.	.	ENSG00000064687	ENST00000263094;ENST00000433129	D;D	0.93488	-3.23;-3.23	3.61	3.61	0.41365	ATPase, AAA+ type, core (1);ABC transporter-like (2);	.	.	.	.	D	0.96297	0.8792	M	0.81942	2.565	0.58432	D	0.999991	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.986	D	0.96820	0.9603	9	0.87932	D	0	.	13.98	0.64299	0.0:0.0:1.0:0.0	.	997;1872	D6W5Y0;Q8IZY2	.;ABCA7_HUMAN	F	1872	ENSP00000263094:C1872F;ENSP00000414062:C1872F	ENSP00000263094:C1872F	C	+	2	0	ABCA7	1013215	1.000000	0.71417	1.000000	0.80357	0.238000	0.25445	9.186000	0.94906	1.859000	0.53934	0.555000	0.69702	TGC	.	.		0.682	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
GNA15	2769	hgsc.bcm.edu	37	19	3155884	3155884	+	Silent	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr19:3155884G>T	ENST00000262958.3	+	5	936	c.678G>T	c.(676-678)gtG>gtT	p.V226V	AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	226					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		TCGAGAACGTGATCGCCCTCA	0.592																																					p.V226V		Atlas-SNP	.											.	GNA15	40	.	0			c.G678T						.						192.0	150.0	164.0					19																	3155884		2203	4300	6503	SO:0001819	synonymous_variant	2769	exon5			GAACGTGATCGCC		CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.678G>T	19.37:g.3155884G>T		109.0	0.0		79.0	46.0	NM_002068	E9KL40|E9KL47|O75247|Q53XK2	Silent	SNP	ENST00000262958.3	37	CCDS12104.1																																																																																			.	.		0.592	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452320.2	NM_002068	
SLC27A1	376497	hgsc.bcm.edu	37	19	17597668	17597668	+	Missense_Mutation	SNP	C	C	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr19:17597668C>A	ENST00000252595.7	+	2	561	c.464C>A	c.(463-465)gCc>gAc	p.A155D	SLC27A1_ENST00000442725.1_Missense_Mutation_p.A155D|CTD-3131K8.2_ENST00000596643.1_lincRNA|SLC27A1_ENST00000598424.1_5'UTR	NM_198580.1	NP_940982.1	Q6PCB7	S27A1_HUMAN	solute carrier family 27 (fatty acid transporter), member 1	155					adiponectin-activated signaling pathway (GO:0033211)|cardiolipin biosynthetic process (GO:0032049)|cellular lipid metabolic process (GO:0044255)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|negative regulation of phospholipid biosynthetic process (GO:0071072)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phosphatidylglycerol biosynthetic process (GO:0006655)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylserine biosynthetic process (GO:0006659)|positive regulation of heat generation (GO:0031652)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|response to cold (GO:0009409)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						GGCATGGAGGCCGCGCTGCTC	0.706																																					p.A155D		Atlas-SNP	.											.	SLC27A1	97	.	0			c.C464A						.						15.0	18.0	17.0					19																	17597668		2185	4272	6457	SO:0001583	missense	376497	exon2			TGGAGGCCGCGCT	BC059399	CCDS32953.1	19p13.11	2013-07-15			ENSG00000130304	ENSG00000130304		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10995	protein-coding gene	gene with protein product		600691				10873384	Standard	NM_198580		Approved	FATP1, FATP, MGC71751, FLJ00336, ACSVL5	uc002ngu.1	Q6PCB7	OTTHUMG00000182878	ENST00000252595.7:c.464C>A	19.37:g.17597668C>A	ENSP00000252595:p.Ala155Asp	75.0	0.0		40.0	20.0	NM_198580	A6NIH2|B7Z662	Missense_Mutation	SNP	ENST00000252595.7	37	CCDS32953.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.116454	0.77323	.	.	ENSG00000130304	ENST00000442725;ENST00000252595;ENST00000300969	T;T	0.43294	0.95;0.95	4.92	4.92	0.64577	AMP-dependent synthetase/ligase (1);	0.055037	0.64402	D	0.000001	T	0.70613	0.3244	M	0.91872	3.25	0.80722	D	1	D	0.61080	0.989	D	0.71656	0.974	T	0.77451	-0.2583	10	0.54805	T	0.06	.	15.6336	0.76933	0.0:1.0:0.0:0.0	.	155	Q6PCB7	S27A1_HUMAN	D	155;155;17	ENSP00000413424:A155D;ENSP00000252595:A155D	ENSP00000252595:A155D	A	+	2	0	SLC27A1	17458668	1.000000	0.71417	0.998000	0.56505	0.475000	0.33008	7.288000	0.78691	2.287000	0.76781	0.561000	0.74099	GCC	.	.		0.706	SLC27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464145.1	NM_198580	
MEGF8	1954	hgsc.bcm.edu	37	19	42830443	42830443	+	Silent	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr19:42830443C>T	ENST00000251268.6	+	1	48	c.48C>T	c.(46-48)gcC>gcT	p.A16A	MEGF8_ENST00000334370.4_Silent_p.A16A	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	16					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TGGCCTTGGCCGTGCTGGGGT	0.697											OREG0025502	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A16A		Atlas-SNP	.											.	MEGF8	358	.	0			c.C48T						.						23.0	27.0	26.0					19																	42830443		1995	4141	6136	SO:0001819	synonymous_variant	1954	exon1			CTTGGCCGTGCTG	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.48C>T	19.37:g.42830443C>T		337.0	0.0	911	267.0	127.0	NM_001271938	A8KAY0|O75097	Silent	SNP	ENST00000251268.6	37																																																																																				.	.		0.697	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
CACNG8	59283	hgsc.bcm.edu	37	19	54485510	54485510	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr19:54485510G>T	ENST00000270458.2	+	4	788	c.685G>T	c.(685-687)Gag>Tag	p.E229*	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	229					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		CATCTACATCGAGCGCAGCCG	0.677																																					p.E229X		Atlas-SNP	.											.	CACNG8	29	.	0			c.G685T						.						36.0	27.0	30.0					19																	54485510		2200	4300	6500	SO:0001587	stop_gained	59283	exon4			TACATCGAGCGCA	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.685G>T	19.37:g.54485510G>T	ENSP00000270458:p.Glu229*	75.0	0.0		34.0	29.0	NM_031895	Q9BXT0|Q9BY23	Nonsense_Mutation	SNP	ENST00000270458.2	37	CCDS33104.1	.	.	.	.	.	.	.	.	.	.	.	37	6.371487	0.97511	.	.	ENSG00000142408	ENST00000270458	.	.	.	1.82	1.82	0.25136	.	0.085246	0.45867	U	0.000329	.	.	.	.	.	.	0.80722	D	1.000000	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	9.2411	0.37498	0.0:0.0:1.0:0.0	.	.	.	.	X	229	.	ENSP00000270458:E229X	E	+	1	0	CACNG8	59177322	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.630000	0.90987	0.998000	0.38996	0.281000	0.19383	GAG	.	.		0.677	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139361.3		
ZIM2	23619	hgsc.bcm.edu	37	19	57286539	57286539	+	Silent	SNP	G	G	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr19:57286539G>T	ENST00000391708.3	-	12	1643	c.1101C>A	c.(1099-1101)ctC>ctA	p.L367L	AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000599935.1_Silent_p.L367L|ZIM2_ENST00000221722.5_Silent_p.L367L|ZIM2_ENST00000593711.1_Silent_p.L367L|AC006115.3_ENST00000595954.1_RNA|ZIM2_ENST00000601070.1_Silent_p.L367L|AC006115.3_ENST00000594400.1_RNA	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.L367L(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		GGTGTGGCATGAGATAGAAGG	0.478																																					p.L367L		Atlas-SNP	.											ZIM2,bladder,carcinoma,0,2	ZIM2	511	2	1	Substitution - coding silent(1)	urinary_tract(1)	c.C1101A						.						128.0	111.0	117.0					19																	57286539		2203	4300	6503	SO:0001819	synonymous_variant	23619	exon11			TGGCATGAGATAG	AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.1101C>A	19.37:g.57286539G>T		90.0	0.0		70.0	59.0	NM_015363	Q2M3K1	Silent	SNP	ENST00000391708.3	37	CCDS33123.1																																																																																			.	.		0.478	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416094.2		
ASXL1	171023	hgsc.bcm.edu	37	20	31024023	31024023	+	Silent	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr20:31024023T>C	ENST00000375687.4	+	13	3932	c.3508T>C	c.(3508-3510)Tta>Cta	p.L1170L	ASXL1_ENST00000306058.5_Silent_p.L1165L	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1170					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CCCCAGTTCTTTAAGGGCTTT	0.517			"""F, N, Mis"""		"""MDS, CMML"""																																p.L1170L		Atlas-SNP	.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	1114	.	0			c.T3508C						.						64.0	67.0	66.0					20																	31024023		2203	4300	6503	SO:0001819	synonymous_variant	171023	exon12			AGTTCTTTAAGGG	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3508T>C	20.37:g.31024023T>C		118.0	0.0		79.0	37.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	ENST00000375687.4	37	CCDS13201.1																																																																																			.	.		0.517	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
BPIFB6	128859	hgsc.bcm.edu	37	20	31622067	31622067	+	Silent	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr20:31622067G>A	ENST00000349552.1	+	3	273	c.273G>A	c.(271-273)gtG>gtA	p.V91V		NM_174897.2	NP_777557.1	Q8NFQ5	BPIB6_HUMAN	BPI fold containing family B, member 6	91						extracellular region (GO:0005576)	lipid binding (GO:0008289)										TCCAATGTGTGTCCACAGGCA	0.562																																					p.V91V		Atlas-SNP	.											.	.	.	.	0			c.G273A						.						158.0	122.0	134.0					20																	31622067		2203	4300	6503	SO:0001819	synonymous_variant	128859	exon3			ATGTGTGTCCACA	AF465767	CCDS13211.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000167104	ENSG00000167104		"""BPI fold containing"""	16504	protein-coding gene	gene with protein product		614110	"""bactericidal/permeability-increasing protein-like 3"""	BPIL3		12185532, 21787333	Standard	NM_174897		Approved	LPLUNC6	uc010zuc.2	Q8NFQ5	OTTHUMG00000032238	ENST00000349552.1:c.273G>A	20.37:g.31622067G>A		81.0	0.0		46.0	20.0	NM_174897		Silent	SNP	ENST00000349552.1	37	CCDS13211.1																																																																																			.	.		0.562	BPIFB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078658.2	NM_174897	
CNBD2	140894	hgsc.bcm.edu	37	20	34568456	34568456	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr20:34568456G>A	ENST00000373973.3	+	4	492	c.319G>A	c.(319-321)Gtc>Atc	p.V107I	CNBD2_ENST00000349339.1_Missense_Mutation_p.V107I|CNBD2_ENST00000538900.1_Missense_Mutation_p.V107I			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	107																	GATCCAGGCCGTCTGTAACAT	0.542																																					p.V107I		Atlas-SNP	.											C20orf152,NS,carcinoma,-1,1	.	.	1	0			c.G319A						.						104.0	86.0	92.0					20																	34568456		2203	4300	6503	SO:0001583	missense	140894	exon4			CAGGCCGTCTGTA	AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.319G>A	20.37:g.34568456G>A	ENSP00000363084:p.Val107Ile	147.0	0.0		109.0	40.0	NM_080834	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Missense_Mutation	SNP	ENST00000373973.3	37		.	.	.	.	.	.	.	.	.	.	G	10.41	1.343799	0.24339	.	.	ENSG00000149646	ENST00000373973;ENST00000349339;ENST00000538900	D;D;D	0.83419	-1.72;-1.72;-1.72	5.15	4.21	0.49690	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.218004	0.31601	N	0.007375	T	0.67859	0.2938	N	0.22421	0.69	0.21220	N	0.999758	B;B	0.20164	0.019;0.042	B;B	0.11329	0.004;0.006	T	0.50180	-0.8858	10	0.13108	T	0.6	-15.3993	8.5119	0.33222	0.1669:0.6557:0.1774:0.0	.	107;107	Q96M20;Q96M20-2	CT152_HUMAN;.	I	107	ENSP00000363084:V107I;ENSP00000340954:V107I;ENSP00000442729:V107I	ENSP00000340954:V107I	V	+	1	0	C20orf152	34031870	0.308000	0.24509	0.187000	0.23214	0.003000	0.03518	0.809000	0.27168	1.163000	0.42636	-0.165000	0.13383	GTC	.	.		0.542	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2	NM_080834	
NFATC2	4773	hgsc.bcm.edu	37	20	50139710	50139710	+	Missense_Mutation	SNP	T	T	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr20:50139710T>G	ENST00000396009.3	-	2	1289	c.1070A>C	c.(1069-1071)cAg>cCg	p.Q357P	NFATC2_ENST00000371564.3_Missense_Mutation_p.Q357P|NFATC2_ENST00000610033.1_Missense_Mutation_p.Q138P|NFATC2_ENST00000609943.1_Missense_Mutation_p.Q337P|NFATC2_ENST00000609507.1_Missense_Mutation_p.Q138P|NFATC2_ENST00000414705.1_Missense_Mutation_p.Q337P	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	357					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					CCTCTCGCCCTGCTCGCAGGG	0.677																																					p.Q357P		Atlas-SNP	.											.	NFATC2	112	.	0			c.A1070C						.						57.0	69.0	65.0					20																	50139710		2203	4300	6503	SO:0001583	missense	4773	exon2			TCGCCCTGCTCGC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.1070A>C	20.37:g.50139710T>G	ENSP00000379330:p.Gln357Pro	133.0	0.0		95.0	51.0	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	T	16.10	3.027888	0.54790	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000371567;ENST00000414705	T;T;T	0.16597	2.33;2.33;2.35	5.8	5.8	0.92144	.	0.314770	0.31577	N	0.007403	T	0.32971	0.0847	L	0.41492	1.28	0.54753	D	0.999989	D;D;D;D	0.76494	0.999;0.997;0.999;0.999	D;P;D;D	0.65874	0.939;0.889;0.939;0.939	T	0.02471	-1.1154	10	0.66056	D	0.02	-18.6322	16.1448	0.81559	0.0:0.0:0.0:1.0	.	337;337;357;357	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	P	357;357;138;337	ENSP00000360619:Q357P;ENSP00000379330:Q357P;ENSP00000396471:Q337P	ENSP00000360619:Q357P	Q	-	2	0	NFATC2	49573117	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	3.308000	0.51896	2.214000	0.71695	0.374000	0.22700	CAG	.	.		0.677	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
NCAM2	4685	hgsc.bcm.edu	37	21	22782603	22782603	+	Missense_Mutation	SNP	A	A	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr21:22782603A>T	ENST00000400546.1	+	10	1454	c.1205A>T	c.(1204-1206)aAg>aTg	p.K402M	NCAM2_ENST00000284894.7_Missense_Mutation_p.K260M	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	402	Ig-like C2-type 5.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GATGCCCCCAAGTTTATATCA	0.284																																					p.K402M		Atlas-SNP	.											.	NCAM2	220	.	0			c.A1205T						.						30.0	28.0	29.0					21																	22782603		1792	4049	5841	SO:0001583	missense	4685	exon10			CCCCCAAGTTTAT		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1205A>T	21.37:g.22782603A>T	ENSP00000383392:p.Lys402Met	247.0	0.0		328.0	127.0	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	A	16.94	3.259852	0.59321	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.31769	1.48;1.48	4.77	4.77	0.60923	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.044865	0.85682	D	0.000000	T	0.46658	0.1404	M	0.81802	2.56	0.80722	D	1	P;P	0.41131	0.739;0.739	P;P	0.49637	0.617;0.518	T	0.51865	-0.8651	10	0.87932	D	0	-18.6622	10.2864	0.43570	0.8345:0.1654:0.0:0.0	.	260;402	B7Z5K2;O15394	.;NCAM2_HUMAN	M	402;260	ENSP00000383392:K402M;ENSP00000284894:K260M	ENSP00000284894:K260M	K	+	2	0	NCAM2	21704474	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	3.153000	0.50685	1.888000	0.54679	0.482000	0.46254	AAG	.	.		0.284	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
SYNJ1	8867	hgsc.bcm.edu	37	21	34018849	34018849	+	Missense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr21:34018849G>A	ENST00000322229.7	-	23	3100	c.3101C>T	c.(3100-3102)tCa>tTa	p.S1034L	SYNJ1_ENST00000433931.2_Missense_Mutation_p.S1073L|SYNJ1_ENST00000382491.3_Missense_Mutation_p.S1029L|SYNJ1_ENST00000382499.2_Missense_Mutation_p.S1073L|SYNJ1_ENST00000357345.3_Missense_Mutation_p.S1034L			O43426	SYNJ1_HUMAN	synaptojanin 1	1034	Poly-Ser.|Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GCCGGAACTTGAAGATGGCTG	0.498																																					p.S1073L		Atlas-SNP	.											.	SYNJ1	253	.	0			c.C3218T						.						133.0	126.0	128.0					21																	34018849		2203	4300	6503	SO:0001583	missense	8867	exon24			GAACTTGAAGATG	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.3101C>T	21.37:g.34018849G>A	ENSP00000322234:p.Ser1034Leu	169.0	0.0		145.0	60.0	NM_203446	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675994	0.47886	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229	D;D;D;D;D	0.93906	-2.42;-3.31;-3.31;-2.5;-2.47	5.42	5.42	0.78866	.	0.183657	0.48767	D	0.000168	D	0.88224	0.6379	L	0.27053	0.805	0.20074	N	0.999934	B;B;B;B;B	0.12013	0.0;0.001;0.001;0.005;0.001	B;B;B;B;B	0.09377	0.002;0.002;0.004;0.004;0.004	T	0.78836	-0.2047	10	0.45353	T	0.12	.	13.5147	0.61533	0.0748:0.0:0.9252:0.0	.	1029;1073;1034;1034;1034	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	L	1029;1034;1073;1073;1034	ENSP00000371931:S1029L;ENSP00000349903:S1034L;ENSP00000371939:S1073L;ENSP00000409667:S1073L;ENSP00000322234:S1034L	ENSP00000322234:S1034L	S	-	2	0	SYNJ1	32940720	0.613000	0.27009	0.626000	0.29213	0.995000	0.86356	3.760000	0.55235	2.529000	0.85273	0.655000	0.94253	TCA	.	.		0.498	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
KRTAP10-9	386676	hgsc.bcm.edu	37	21	46047778	46047778	+	Silent	SNP	T	T	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr21:46047778T>G	ENST00000397911.3	+	1	739	c.690T>G	c.(688-690)tcT>tcG	p.S230S	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	230	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCTCCTCCTCTGTGTCCCTCC	0.687																																					p.S230S		Atlas-SNP	.											.	KRTAP10-9	24	.	0			c.T690G						.						111.0	130.0	124.0					21																	46047778		2203	4300	6503	SO:0001819	synonymous_variant	386676	exon1			CTCCTCTGTGTCC	AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.690T>G	21.37:g.46047778T>G		63.0	0.0		64.0	29.0	NM_198690	A2RRG1|A6NIR9|Q70LJ1	Silent	SNP	ENST00000397911.3	37	CCDS42961.1																																																																																			.	.		0.687	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128040.1		
PRAME	23532	hgsc.bcm.edu	37	22	22890574	22890574	+	Missense_Mutation	SNP	A	A	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr22:22890574A>C	ENST00000398741.1	-	6	1751	c.1445T>G	c.(1444-1446)cTt>cGt	p.L482R	PRAME_ENST00000398743.2_Missense_Mutation_p.L482R|PRAME_ENST00000402697.1_Missense_Mutation_p.L482R|PRAME_ENST00000424204.2_Missense_Mutation_p.L466R|PRAME_ENST00000405655.3_Missense_Mutation_p.L482R|PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000543184.1_Missense_Mutation_p.L482R|PRAME_ENST00000539862.1_Missense_Mutation_p.L466R	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	482	Mediates interaction with RARA.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		GTTGGCACTAAGCCAGACCAT	0.587																																					p.L482R	Melanoma(73;1707 1838 15168 27201)	Atlas-SNP	.											.	PRAME	78	.	0			c.T1445G						.						118.0	111.0	113.0					22																	22890574		2203	4300	6503	SO:0001583	missense	23532	exon6			GCACTAAGCCAGA	U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.1445T>G	22.37:g.22890574A>C	ENSP00000381726:p.Leu482Arg	128.0	0.0		86.0	37.0	NM_206954	B2R6Y7|O43481|Q8IXN8	Missense_Mutation	SNP	ENST00000398741.1	37	CCDS13801.1	.	.	.	.	.	.	.	.	.	.	A	12.82	2.052525	0.36181	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204	T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7	3.68	3.68	0.42216	.	0.466193	0.21690	N	0.070584	T	0.56455	0.1986	L	0.43923	1.385	0.09310	N	1	D	0.76494	0.999	D	0.72625	0.978	T	0.42949	-0.9421	10	0.87932	D	0	.	9.0179	0.36182	1.0:0.0:0.0:0.0	.	482	P78395	PRAME_HUMAN	R	482;482;482;482;466;482;466	ENSP00000381728:L482R;ENSP00000445675:L482R;ENSP00000381726:L482R;ENSP00000384343:L482R;ENSP00000445097:L466R;ENSP00000385198:L482R;ENSP00000407342:L466R	ENSP00000381726:L482R	L	-	2	0	PRAME	21220574	1.000000	0.71417	0.137000	0.22149	0.004000	0.04260	1.168000	0.31859	1.902000	0.55061	0.523000	0.50628	CTT	.	.		0.587	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321644.1	NM_206953	
MAGEB1	4112	hgsc.bcm.edu	37	X	30269467	30269467	+	Missense_Mutation	SNP	T	T	C			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chrX:30269467T>C	ENST00000378981.3	+	4	1178	c.857T>C	c.(856-858)cTc>cCc	p.L286P	MAGEB1_ENST00000397548.2_Missense_Mutation_p.L286P|MAGEB1_ENST00000397550.1_Missense_Mutation_p.L286P	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	286	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						ATGAAAGTCCTCGAGTTTTTG	0.507																																					p.L286P		Atlas-SNP	.											.	MAGEB1	76	.	0			c.T857C						.						135.0	113.0	121.0					X																	30269467		2202	4300	6502	SO:0001583	missense	4112	exon3			AAGTCCTCGAGTT		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.857T>C	X.37:g.30269467T>C	ENSP00000368264:p.Leu286Pro	94.0	0.0		93.0	6.0	NM_177415	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	ENST00000378981.3	37	CCDS14222.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.261556	0.23051	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.11169	2.8;2.8;2.8	3.86	3.86	0.44501	.	0.000000	0.64402	D	0.000003	T	0.42787	0.1218	H	0.97186	3.955	0.21416	N	0.999699	D	0.89917	1.0	D	0.83275	0.996	T	0.47420	-0.9119	10	0.87932	D	0	.	8.1385	0.31069	0.0:0.0:0.0:1.0	.	286	P43366	MAGB1_HUMAN	P	286	ENSP00000368264:L286P;ENSP00000380683:L286P;ENSP00000380681:L286P	ENSP00000368264:L286P	L	+	2	0	MAGEB1	30179388	0.142000	0.22610	0.004000	0.12327	0.069000	0.16628	3.262000	0.51538	1.737000	0.51674	0.417000	0.27973	CTC	.	.		0.507	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056160.1	NM_002363	
FAM47B	170062	hgsc.bcm.edu	37	X	34962125	34962125	+	Missense_Mutation	SNP	C	C	T			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chrX:34962125C>T	ENST00000329357.5	+	1	1213	c.1177C>T	c.(1177-1179)Cgg>Tgg	p.R393W		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	393										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TTTTGAGAGTCGGATGCCCCA	0.587																																					p.R393W		Atlas-SNP	.											.	FAM47B	209	.	0			c.C1177T						.						54.0	49.0	51.0					X																	34962125		2202	4300	6502	SO:0001583	missense	170062	exon1			GAGAGTCGGATGC	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1177C>T	X.37:g.34962125C>T	ENSP00000328307:p.Arg393Trp	77.0	0.0		89.0	85.0	NM_152631	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	ENST00000329357.5	37	CCDS14236.1	.	.	.	.	.	.	.	.	.	.	C	5.961	0.361232	0.11296	.	.	ENSG00000189132	ENST00000329357	T	0.16196	2.36	0.703	-0.729	0.11158	.	.	.	.	.	T	0.16214	0.0390	M	0.65498	2.005	0.09310	N	1	B	0.22414	0.069	B	0.12156	0.007	T	0.27468	-1.0073	8	0.66056	D	0.02	.	.	.	.	.	393	Q8NA70	FA47B_HUMAN	W	393	ENSP00000328307:R393W	ENSP00000328307:R393W	R	+	1	2	FAM47B	34872046	0.410000	0.25376	0.000000	0.03702	0.005000	0.04900	1.109000	0.31135	-0.345000	0.08325	0.418000	0.28097	CGG	.	.		0.587	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
DRP2	1821	hgsc.bcm.edu	37	X	100496749	100496750	+	Missense_Mutation	DNP	CG	CG	TT	rs369730985|rs368516281		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chrX:100496749_100496750CG>TT	ENST00000395209.3	+	7	1179_1180	c.652_653CG>TT	c.(652-654)CGc>TTc	p.R218F	DRP2_ENST00000538510.1_Missense_Mutation_p.R218F|DRP2_ENST00000541709.1_Missense_Mutation_p.R140F|DRP2_ENST00000402866.1_Missense_Mutation_p.R218F	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	218					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GTTGACAGCCCGCTGTGTGGAC	0.559																																					p.R218C|p.R218L		Atlas-SNP	.											.	DRP2	98	.	0			c.C652T|c.G653T						.																																			SO:0001583	missense	1821	exon7			ACAGCCCGCTGTG|CAGCCCGCTGTGT	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	Exception_encountered	X.37:g.100496749_100496750delinsTT	ENSP00000378635:p.Arg218Phe	66.0	0.0		51.0	48.0	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	ENST00000395209.3	37	CCDS14480.2																																																																																			.	.		0.559	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
SERPINA7	6906	hgsc.bcm.edu	37	X	105279299	105279299	+	Nonsense_Mutation	SNP	G	G	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chrX:105279299G>A	ENST00000327674.4	-	2	1035	c.700C>T	c.(700-702)Caa>Taa	p.Q234*	SERPINA7_ENST00000487487.1_5'Flank|SERPINA7_ENST00000372563.1_Nonsense_Mutation_p.Q234*			P05543	THBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7	234					aging (GO:0007568)|negative regulation of endopeptidase activity (GO:0010951)|post-embryonic development (GO:0009791)|regulation of proteolysis (GO:0030162)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to peptide hormone (GO:0043434)|response to prostaglandin E (GO:0034695)|response to vitamin A (GO:0033189)|thyroid hormone transport (GO:0070327)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hormone binding (GO:0042562)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|skin(3)	24					Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ATGGGCACTTGAACAGTGGTG	0.433																																					p.Q234X		Atlas-SNP	.											.	SERPINA7	72	.	0			c.C700T						.						224.0	189.0	201.0					X																	105279299		2203	4300	6503	SO:0001587	stop_gained	6906	exon3			GCACTTGAACAGT	M14091	CCDS14518.1	Xq21-q22	2014-02-18	2005-08-18		ENSG00000123561	ENSG00000123561		"""Serine (or cysteine) peptidase inhibitors"""	11583	protein-coding gene	gene with protein product	"""thyroxin-binding globulin"", ""thyroxine-binding globulin"", ""alpha-1 antiproteinase, antitrypsin"""	314200	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7"""	TBG		24172014	Standard	NM_000354		Approved		uc004eme.2	P05543	OTTHUMG00000022144	ENST00000327674.4:c.700C>T	X.37:g.105279299G>A	ENSP00000329374:p.Gln234*	81.0	0.0		86.0	75.0	NM_000354	D3DUX1	Nonsense_Mutation	SNP	ENST00000327674.4	37	CCDS14518.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.530213	0.85706	.	.	ENSG00000123561	ENST00000327674;ENST00000372563	.	.	.	4.41	0.112	0.14623	.	0.663946	0.14010	N	0.347545	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5034	0.27530	0.0:0.1452:0.2693:0.5855	.	.	.	.	X	234	.	ENSP00000329374:Q234X	Q	-	1	0	SERPINA7	105165955	0.227000	0.23707	0.045000	0.18777	0.248000	0.25809	0.533000	0.23082	0.066000	0.16515	-0.209000	0.12711	CAA	.	.		0.433	SERPINA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057790.1	NM_000354	
ZDHHC9	51114	hgsc.bcm.edu	37	X	128957708	128957708	+	Missense_Mutation	SNP	T	T	A			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chrX:128957708T>A	ENST00000357166.6	-	5	825	c.434A>T	c.(433-435)aAg>aTg	p.K145M	AL359542.1_ENST00000582964.1_RNA|ZDHHC9_ENST00000371064.3_Missense_Mutation_p.K145M|ZDHHC9_ENST00000491039.1_5'UTR	NM_016032.3	NP_057116.2	Q9Y397	ZDHC9_HUMAN	zinc finger, DHHC-type containing 9	145					peptidyl-L-cysteine S-palmitoylation (GO:0018230)|protein palmitoylation (GO:0018345)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|palmitoyltransferase complex (GO:0002178)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|Ras palmitoyltransferase activity (GO:0043849)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	19						CCGGAAGATCTTGCATGTGTA	0.512																																					p.K145M		Atlas-SNP	.											.	ZDHHC9	41	.	0			c.A434T						.						143.0	133.0	136.0					X																	128957708		2203	4300	6503	SO:0001583	missense	51114	exon4			AAGATCTTGCATG	AF151847	CCDS35395.1	Xq26.1	2008-02-05			ENSG00000188706	ENSG00000188706		"""Zinc fingers, DHHC-type"""	18475	protein-coding gene	gene with protein product		300646	"""zinc finger, DHHC-type containing 10"", ""chromosome X open reading frame 11"""	ZDHHC10, CXorf11		10810093	Standard	NM_001008222		Approved	ZNF379, CGI-89, ZNF380	uc004euw.3	Q9Y397	OTTHUMG00000022375	ENST00000357166.6:c.434A>T	X.37:g.128957708T>A	ENSP00000349689:p.Lys145Met	54.0	0.0		50.0	45.0	NM_001008222	B4F6G2|D3DTF9|Q59EK4|Q5JSW5|Q8WWS7|Q9BPY4|Q9NSP0|Q9NVL0|Q9NVR6	Missense_Mutation	SNP	ENST00000357166.6	37	CCDS35395.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	21.0|21.0	4.084348|4.084348	0.76642|0.76642	.|.	.|.	ENSG00000188706|ENSG00000188706	ENST00000357166;ENST00000371064;ENST00000406492|ENST00000433917	T;T;T|.	0.26810|.	1.71;1.71;1.71|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Zinc finger, DHHC-type, palmitoyltransferase (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.73148|.	0.3550|.	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D|.	0.56035|.	0.974|.	D|.	0.65233|.	0.933|.	T|.	0.73464|.	-0.3974|.	10|.	0.25106|.	T|.	0.35|.	-15.1815|-15.1815	14.5407|14.5407	0.67990|0.67990	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	145|.	Q9Y397|.	ZDHC9_HUMAN|.	M|X	145|105	ENSP00000349689:K145M;ENSP00000360103:K145M;ENSP00000383991:K145M|.	ENSP00000349689:K145M|.	K|R	-|-	2|1	0|2	ZDHHC9|ZDHHC9	128785389|128785389	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	7.667000|7.667000	0.83888|0.83888	1.894000|1.894000	0.54839|0.54839	0.483000|0.483000	0.47432|0.47432	AAG|AGA	.	.		0.512	ZDHHC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058213.1	NM_016032	
SLC6A8	6535	hgsc.bcm.edu	37	X	152959837	152959837	+	Silent	SNP	G	G	C	rs1060453		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chrX:152959837G>C	ENST00000253122.5	+	10	1907	c.1431G>C	c.(1429-1431)tcG>tcC	p.S477S	SLC6A8_ENST00000430077.2_Silent_p.S362S|SLC6A8_ENST00000485324.1_3'UTR	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	477					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	ACTACTACTCGGCCAGCGGCA	0.652																																					p.S477S		Atlas-SNP	.											.	SLC6A8	34	.	0			c.G1431C						.						60.0	57.0	58.0					X																	152959837		2203	4300	6503	SO:0001819	synonymous_variant	6535	exon10			CTACTCGGCCAGC		CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.1431G>C	X.37:g.152959837G>C		81.0	0.0		81.0	78.0	NM_005629	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Silent	SNP	ENST00000253122.5	37	CCDS14726.1	.	.	.	.	.	.	.	.	.	.	g	4.576	0.106970	0.08780	.	.	ENSG00000130821	ENST00000442457	.	.	.	4.57	-9.13	0.00704	.	.	.	.	.	T	0.43765	0.1262	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51849	-0.8653	4	.	.	.	.	5.6539	0.17633	0.1448:0.346:0.4228:0.0865	.	.	.	.	P	162	.	.	R	+	2	0	SLC6A8	152613031	0.000000	0.05858	0.469000	0.27204	0.924000	0.55760	-4.544000	0.00218	-3.055000	0.00258	-1.177000	0.01723	CGG	.	.		0.652	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061003.1		
IGJ	3512	hgsc.bcm.edu	37	4	71522068	71522068	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr4:71522068delG	ENST00000254801.4	-	4	627	c.458delC	c.(457-459)ccafs	p.P153fs	IGJ_ENST00000543780.1_Frame_Shift_Del_p.P169fs|ENAM_ENST00000472903.1_Intron	NM_144646.3	NP_653247.1	P01591	IGJ_HUMAN	immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides	153					adaptive immune response (GO:0002250)|antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of respiratory burst (GO:0060267)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|dimeric IgA immunoglobulin complex (GO:0071750)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|pentameric IgM immunoglobulin complex (GO:0071756)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7			Lung(101;0.235)			GCAGGCATCTGGGGTTAAGGC	0.423																																					p.P153fs		Atlas-Indel	.											.	IGJ	13	.	0			c.459delA						.						131.0	112.0	118.0					4																	71522068		2203	4300	6503	SO:0001589	frameshift_variant	3512	exon4			.	M12759	CCDS3545.1	4q21	2012-10-02			ENSG00000132465	ENSG00000132465		"""Immunoglobulins / IGJ linker"""	5713	protein-coding gene	gene with protein product	"""immunoglobulin J chain"", ""IgJ chain"""	147790				3016707, 2984306	Standard	NM_144646		Approved	IGCJ, JCH	uc003hfn.4	P01591	OTTHUMG00000129909	ENST00000254801.4:c.458delC	4.37:g.71522068delG	ENSP00000254801:p.Pro153fs	196.0	0.0		211.0	97.0	NM_144646		Frame_Shift_Del	DEL	ENST00000254801.4	37	CCDS3545.1																																																																																			.	.		0.423	IGJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252160.1	NM_144646	
ALB	213	hgsc.bcm.edu	37	4	74274521	74274524	+	Splice_Site	DEL	AAGT	AAGT	-	rs17853494		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	AAGT	AAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr4:74274521_74274524delAAGT	ENST00000295897.4	+	4	570_571	c.481_482delAAGT	c.(481-483)aag>g	p.K161fs	ALB_ENST00000503124.1_Intron|ALB_ENST00000401494.3_Intron|ALB_ENST00000509063.1_Splice_Site_p.K161fs|ALB_ENST00000415165.2_Intron|ALB_ENST00000505649.1_3'UTR	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTTTTGAAAAAGTAAGTAATCAG	0.348																																					p.160_161del		Atlas-Indel	.											.	ALB	132	.	0			c.480_482del						.																																			SO:0001630	splice_region_variant	213	exon4			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.482+1AAGT>-	4.37:g.74274525_74274528delAAGT		87.0	0.0		77.0	28.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	In_Frame_Del	DEL	ENST00000295897.4	37	CCDS3555.1																																																																																			.	.		0.348	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252173.3	NM_000477	Frame_Shift_Del
GUCY1A3	2982	hgsc.bcm.edu	37	4	156618268	156618268	+	Frame_Shift_Del	DEL	C	C	-			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr4:156618268delC	ENST00000296518.7	+	3	458	c.249delC	c.(247-249)ttcfs	p.F83fs	GUCY1A3_ENST00000506455.1_Frame_Shift_Del_p.F83fs|GUCY1A3_ENST00000455639.2_Frame_Shift_Del_p.F83fs|GUCY1A3_ENST00000513574.1_Frame_Shift_Del_p.F83fs|GUCY1A3_ENST00000515602.1_3'UTR|GUCY1A3_ENST00000511507.1_Frame_Shift_Del_p.F83fs|GUCY1A3_ENST00000393832.3_5'UTR|GUCY1A3_ENST00000511108.1_Frame_Shift_Del_p.F83fs			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	83					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		AACTGATTTTCCCAGAGGTGA	0.368																																					p.F83fs		Atlas-Indel	.											.	GUCY1A3	133	.	0			c.248delT						.						112.0	114.0	113.0					4																	156618268		2203	4300	6503	SO:0001589	frameshift_variant	2982	exon3			.		CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.249delC	4.37:g.156618268delC	ENSP00000296518:p.Phe83fs	96.0	0.0		112.0	49.0	NM_001130682	D3DP19|D6RDW3|O43843|Q8TAH3	Frame_Shift_Del	DEL	ENST00000296518.7	37	CCDS34085.1																																																																																			.	.		0.368	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365786.2		
CASP3	836	hgsc.bcm.edu	37	4	185550584	185550584	+	Frame_Shift_Del	DEL	A	A	-	rs137982553		TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr4:185550584delA	ENST00000308394.4	-	8	938	c.676delT	c.(676-678)tatfs	p.Y226fs	CASP3_ENST00000393585.2_3'UTR|CASP3_ENST00000393588.4_3'UTR|CASP3_ENST00000517513.1_3'UTR|CASP3_ENST00000523916.1_Frame_Shift_Del_p.Y226fs	NM_004346.3	NP_004337.2	P42574	CASP3_HUMAN	caspase 3, apoptosis-related cysteine peptidase	226					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell homeostasis (GO:0001782)|cell fate commitment (GO:0045165)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte differentiation (GO:0030218)|execution phase of apoptosis (GO:0097194)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|heart development (GO:0007507)|hippo signaling (GO:0035329)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|keratinocyte differentiation (GO:0030216)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|proteolysis (GO:0006508)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|release of cytochrome c from mitochondria (GO:0001836)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:0097200)|peptidase activity (GO:0008233)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.057)|all_hematologic(60;0.0592)		all cancers(43;2.05e-27)|Epithelial(43;4.27e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.04e-11)|Colorectal(24;2e-05)|STAD - Stomach adenocarcinoma(60;2.35e-05)|GBM - Glioblastoma multiforme(59;4.94e-05)|COAD - Colon adenocarcinoma(29;0.00017)|BRCA - Breast invasive adenocarcinoma(30;0.000218)|LUSC - Lung squamous cell carcinoma(40;0.00904)|READ - Rectum adenocarcinoma(43;0.161)	Minocycline(DB01017)	TTGTCGGCATACTGTTTCAGC	0.413																																					p.Y226fs		Atlas-Indel	.											.	CASP3	27	.	0			c.677delA						.						88.0	82.0	84.0					4																	185550584		2203	4300	6503	SO:0001589	frameshift_variant	836	exon7			.	BC016926	CCDS3836.1	4q34	2008-02-05	2005-08-17		ENSG00000164305	ENSG00000164305		"""Caspases"""	1504	protein-coding gene	gene with protein product		600636	"""caspase 3, apoptosis-related cysteine protease"""			8780721	Standard	NM_004346		Approved	CPP32, CPP32B, Yama, apopain	uc003iwi.3	P42574	OTTHUMG00000133681	ENST00000308394.4:c.676delT	4.37:g.185550584delA	ENSP00000311032:p.Tyr226fs	125.0	0.0		186.0	110.0	NM_032991	A8K5M2|D3DP53|Q96AN1|Q96KP2	Frame_Shift_Del	DEL	ENST00000308394.4	37	CCDS3836.1																																																																																			.	.		0.413	CASP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257885.2	NM_004346	
GLDC	2731	hgsc.bcm.edu	37	9	6610207	6610208	+	Frame_Shift_Ins	INS	-	-	GT	rs142181803	byFrequency	TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr9:6610207_6610208insGT	ENST00000321612.6	-	4	769_770	c.619_620insAC	c.(619-621)ctgfs	p.L207fs		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	207					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	GCACAGCTGCAGTGCCTCTGCG	0.525																																					p.L207fs		Atlas-Indel	.											.	GLDC	118	.	0			c.620_621insAC						.																																			SO:0001589	frameshift_variant	2731	exon4			.	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.618_619dupAC	9.37:g.6610208_6610209dupGT	ENSP00000370737:p.Leu207fs	110.0	0.0		87.0	32.0	NM_000170	Q2M2F8	Frame_Shift_Ins	INS	ENST00000321612.6	37	CCDS34987.1																																																																																			.	.		0.525	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
C10orf12	26148	hgsc.bcm.edu	37	10	98743503	98743504	+	Frame_Shift_Ins	INS	-	-	G			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr10:98743503_98743504insG	ENST00000286067.2	+	1	2463_2464	c.2356_2357insG	c.(2356-2358)ccafs	p.P786fs		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	786										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AGATGAACAGCCAAAGTTTATG	0.49																																					p.P786fs		Atlas-Indel	.											.	C10orf12	94	.	0			c.2356_2357insG						.																																			SO:0001589	frameshift_variant	26148	exon1			.	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	Exception_encountered	10.37:g.98743503_98743504insG	ENSP00000286067:p.Pro786fs	199.0	0.0		193.0	16.0	NM_015652	Q9H945|Q9Y457	Frame_Shift_Ins	INS	ENST00000286067.2	37	CCDS7452.1																																																																																			.	.		0.490	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
SPRY2	10253	hgsc.bcm.edu	37	13	80911241	80911241	+	Frame_Shift_Del	DEL	G	G	-			TCGA-ZS-A9CF-01A-11D-A382-10	TCGA-ZS-A9CF-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	2b7e988c-761a-40aa-bbf0-23064aa3a82c	5feaeaff-2fb4-4cfd-a652-27e3146e3877	g.chr13:80911241delG	ENST00000377102.1	-	2	1577	c.600delC	c.(598-600)atcfs	p.I200fs	SPRY2_ENST00000540649.1_Frame_Shift_Del_p.I200fs|SPRY2_ENST00000377104.3_Frame_Shift_Del_p.I200fs			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	200	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		GCTTGTCGCAGATCCAGTCTG	0.512																																					p.C201fs		Atlas-Indel	.											SPRY2,NS,carcinoma,+2,1	SPRY2	28	1	0			c.601delT						.						111.0	95.0	100.0					13																	80911241		2203	4300	6503	SO:0001589	frameshift_variant	10253	exon2			.	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.600delC	13.37:g.80911241delG	ENSP00000366306:p.Ile200fs	152.0	0.0		123.0	51.0	NM_005842	B2R9J9|Q5T6Z7	Frame_Shift_Del	DEL	ENST00000377102.1	37	CCDS9463.1																																																																																			.	.		0.512	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		
