#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
GPR158	57512	genome.wustl.edu	37	10	25887877	25887877	+	Missense_Mutation	SNP	C	C	T	rs372238950		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr10:25887877C>T	ENST00000376351.3	+	11	3681	c.3322C>T	c.(3322-3324)Cgt>Tgt	p.R1108C	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1108					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R1108C(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AGGTCAGCCTCGTGCAGCCAA	0.502																																																1	Substitution - Missense(1)	ovary(1)	10											84.0	89.0	87.0					10																	25887877		2203	4300	6503	25927883	SO:0001583	missense	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3322C>T	10.37:g.25887877C>T	ENSP00000365529:p.Arg1108Cys		25927883	Q6QR81|Q9ULT3	Missense_Mutation	SNP	HMMPfam_7tm_3,superfamily_EGF/Laminin	p.R1108C	ENST00000376351.3	37	c.3322	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	C	1.905	-0.452118	0.04540	.	.	ENSG00000151025	ENST00000376351	T	0.60548	0.18	5.79	-6.54	0.01860	.	1.919920	0.02347	N	0.075465	T	0.28928	0.0718	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16719	-1.0393	10	0.49607	T	0.09	.	3.5595	0.07877	0.1622:0.2747:0.0808:0.4823	.	1108	Q5T848	GP158_HUMAN	C	1108	ENSP00000365529:R1108C	ENSP00000365529:R1108C	R	+	1	0	GPR158	25927883	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.312000	0.08113	-1.726000	0.01370	0.655000	0.94253	CGT	-	NULL		0.502	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	protein_coding	OTTHUMT00000047248.2	C	XM_166110		25927883	1	no_errors	NM_020752	genbank	human	validated	54_36p	missense	SNP	0	T
SLIT1	6585	genome.wustl.edu	37	10	98802721	98802721	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr10:98802721G>C	ENST00000266058.4	-	20	2346	c.2101C>G	c.(2101-2103)Cct>Gct	p.P701A	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.P701A	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	701	LRRCT 3.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)	p.P701A(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		AAAAAGTCAGGGTTCTGGCAT	0.627																																																1	Substitution - Missense(1)	ovary(1)	10											75.0	72.0	73.0					10																	98802721		2203	4300	6503	98792711	SO:0001583	missense	6585			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.2101C>G	10.37:g.98802721G>C	ENSP00000266058:p.Pro701Ala		98792711	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	HMMPfam_LRRNT,HMMPfam_LRRCT,HMMPfam_LRR_1,HMMPfam_EGF,superfamily_Concanavalin A-like lectins/glucanases,HMMPfam_Laminin_G_2,superfamily_L domain-like,superfamily_EGF/Laminin	p.P701A	ENST00000266058.4	37	c.2101	CCDS7453.1	10	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377068	0.82682	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;D	0.92965	-3.14;-3.14;-3.14	4.73	4.73	0.59995	Cysteine-rich flanking region, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.97356	0.9135	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.98645	1.0677	10	0.87932	D	0	.	17.8876	0.88862	0.0:0.0:1.0:0.0	.	711;701	E7EWQ8;O75093	.;SLIT1_HUMAN	A	701;711;701;694	ENSP00000266058:P701A;ENSP00000360109:P701A;ENSP00000315005:P694A	ENSP00000266058:P701A	P	-	1	0	SLIT1	98792711	1.000000	0.71417	0.996000	0.52242	0.766000	0.43426	9.263000	0.95617	2.442000	0.82660	0.561000	0.74099	CCT	-	HMMPfam_LRRCT		0.627	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT1	protein_coding	OTTHUMT00000049636.1	G	NM_003061		98792711	-1	no_errors	NM_003061	genbank	human	validated	54_36p	missense	SNP	1	C
CFAP43	80217	genome.wustl.edu	37	10	105927375	105927375	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr10:105927375G>C	ENST00000278064.2	-	22	2930	c.2605C>G	c.(2605-2607)Cta>Gta	p.L869V	WDR96_ENST00000428666.1_Intron|WDR96_ENST00000357060.3_Intron														p.?(1)		NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ATTTAAAATAGTACTTTAAGA	0.343																																																1	Unknown(1)	ovary(1)	10											80.0	84.0	83.0					10																	105927375		2203	4300	6503	105917365	SO:0001583	missense	80217																														ENST00000278064.2:c.2605C>G	10.37:g.105927375G>C	ENSP00000278064:p.Leu869Val		105917365		Missense_Mutation	SNP	-	p.L869V	ENST00000278064.2	37	c.2605		10	.	.	.	.	.	.	.	.	.	.	G	11.66	1.705873	0.30232	.	.	ENSG00000197748	ENST00000278064	T	0.14640	2.49	5.74	0.0339	0.14181	.	.	.	.	.	T	0.08846	0.0219	.	.	.	0.40326	D	0.978878	B	0.06786	0.001	B	0.04013	0.001	T	0.22347	-1.0219	8	0.87932	D	0	.	1.7872	0.03044	0.4608:0.1373:0.2611:0.1408	.	939	B4DHB6	.	V	869	ENSP00000278064:L869V	ENSP00000278064:L869V	L	-	1	2	WDR96	105917365	0.058000	0.20735	0.162000	0.22713	0.531000	0.34715	0.061000	0.14366	0.085000	0.17107	0.650000	0.86243	CTA	-	NULL		0.343	WDR96-003	KNOWN	basic	protein_coding	C10orf79	protein_coding	OTTHUMT00000050200.1	G			105917365	-1	no_errors	ENST00000278064	ensembl	human	known	54_36p	missense	SNP	0.05	C
OR51G1	79324	genome.wustl.edu	37	11	4944749	4944749	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr11:4944749A>G	ENST00000321961.2	-	1	888	c.821T>C	c.(820-822)gTa>gCa	p.V274A	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V274A(1)		NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAAGAGGTGTACAACGCGGGG	0.483																																																1	Substitution - Missense(1)	ovary(1)	11											204.0	170.0	182.0					11																	4944749		2201	4298	6499	4901325	SO:0001583	missense	79324			AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.821T>C	11.37:g.4944749A>G	ENSP00000322546:p.Val274Ala		4901325	B9EGW8|Q6IFH6	Missense_Mutation	SNP	-	p.V274A	ENST00000321961.2	37	c.821	CCDS31366.1	11	.	.	.	.	.	.	.	.	.	.	A	5.014	0.188240	0.09547	.	.	ENSG00000176879	ENST00000321961	T	0.00099	8.73	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.229218	0.21943	U	0.066856	T	0.00178	0.0005	L	0.37507	1.11	0.09310	N	1	B	0.23540	0.087	B	0.36092	0.217	T	0.26018	-1.0115	10	0.59425	D	0.04	.	7.6758	0.28484	0.9042:0.0:0.0958:0.0	.	274	Q8NGK1	O51G1_HUMAN	A	274	ENSP00000322546:V274A	ENSP00000322546:V274A	V	-	2	0	OR51G1	4901325	0.000000	0.05858	0.629000	0.29254	0.124000	0.20399	0.514000	0.22786	1.911000	0.55334	0.455000	0.32223	GTA	-	NULL		0.483	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	protein_coding	OTTHUMT00000142345.1	A	NM_001005237		4901325	-1	no_errors	NM_001005237	genbank	human	provisional	54_36p	missense	SNP		G
FSHB	2488	genome.wustl.edu	37	11	30255218	30255218	+	Silent	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr11:30255218T>C	ENST00000417547.1	+	3	300	c.261T>C	c.(259-261)caT>caC	p.H87H	FSHB_ENST00000533718.1_Silent_p.H87H|FSHB_ENST00000254122.3_Silent_p.H87H	NM_001018080.1	NP_001018090.1	P01225	FSHB_HUMAN	follicle stimulating hormone, beta polypeptide	87					cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|female pregnancy (GO:0007565)|follicle-stimulating hormone signaling pathway (GO:0042699)|peptide hormone processing (GO:0016486)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone biosynthetic process (GO:0006701)|regulation of osteoclast differentiation (GO:0045670)|Sertoli cell proliferation (GO:0060011)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	hormone activity (GO:0005179)	p.H87H(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	12						GTGCTCACCATGCAGATTCCT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	11											111.0	91.0	98.0					11																	30255218		2202	4299	6501	30211794	SO:0001819	synonymous_variant	2488				CCDS7868.1	11p13	2013-02-26				ENSG00000131808		"""Endogenous ligands"""	3964	protein-coding gene	gene with protein product	"""follitropin, beta chain"", ""follicle-stimulating hormone beta subunit"""	136530				2885163, 3151250	Standard	NM_000510		Approved		uc001msm.3	P01225		ENST00000417547.1:c.261T>C	11.37:g.30255218T>C			30211794	A2TF08|A5JVV3|Q14D61	Silent	SNP	HMMPfam_Cys_knot,superfamily_Cystine-knot cytokines	p.H87	ENST00000417547.1	37	c.261	CCDS7868.1	11																																																																																			-	HMMPfam_Cys_knot		0.532	FSHB-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FSHB	protein_coding	OTTHUMT00000389757.1	T	NM_000510		30211794	1	no_errors	NM_000510	genbank	human	reviewed	54_36p	silent	SNP	0.186	C
QSER1	79832	genome.wustl.edu	37	11	32997955	32997955	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr11:32997955T>C	ENST00000399302.2	+	13	5478	c.5143T>C	c.(5143-5145)Tgg>Cgg	p.W1715R	QSER1_ENST00000527788.1_Missense_Mutation_p.W1476R	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1715								p.W1715R(1)		breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AAATGTAAAATGGGTGGAGGA	0.323																																																1	Substitution - Missense(1)	ovary(1)	11											85.0	83.0	84.0					11																	32997955		1802	4063	5865	32954531	SO:0001583	missense	79832			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.5143T>C	11.37:g.32997955T>C	ENSP00000382241:p.Trp1715Arg		32954531	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	-	p.W1715R	ENST00000399302.2	37	c.5143	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	T	17.09	3.299198	0.60195	.	.	ENSG00000060749	ENST00000399302;ENST00000527788	T;T	0.73789	-0.55;-0.78	5.78	5.78	0.91487	.	0.000000	0.33199	U	0.005177	D	0.85004	0.5598	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.98	D	0.86567	0.1845	10	0.87932	D	0	.	16.1099	0.81255	0.0:0.0:0.0:1.0	.	1476;1715	Q2KHR3-2;Q2KHR3	.;QSER1_HUMAN	R	1715;1476	ENSP00000382241:W1715R;ENSP00000432766:W1476R	ENSP00000382241:W1715R	W	+	1	0	QSER1	32954531	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.979000	0.76154	2.215000	0.71742	0.460000	0.39030	TGG	-	NULL		0.323	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	protein_coding	OTTHUMT00000388448.1	T	NM_024774		32954531	1	no_errors	NM_001076786	genbank	human	provisional	54_36p	missense	SNP	1	C
CREB3L1	90993	genome.wustl.edu	37	11	46332692	46332692	+	Silent	SNP	G	G	A	rs545047399		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr11:46332692G>A	ENST00000529193.1	+	5	1156	c.705G>A	c.(703-705)gcG>gcA	p.A235A	CREB3L1_ENST00000288400.3_Silent_p.A235A			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	235					regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.A235A(1)	FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		GGCCCATGGCGCGCTCCTCCA	0.652			T	FUS	myxofibrosarcoma								G|||	1	0.000199681	0.0	0.0	5008	,	,		15061	0.0		0.0	False		,,,				2504	0.001				Pancreas(3;159 194 19597 26278 47995)		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	1	Substitution - coding silent(1)	ovary(1)	11											22.0	27.0	26.0					11																	46332692		1979	4153	6132	46289268	SO:0001819	synonymous_variant	90993				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.705G>A	11.37:g.46332692G>A			46289268	Q8N2D5|Q96CP0	Silent	SNP	superfamily_A DNA-binding domain in eukaryotic transcription factors,HMMPfam_bZIP_1	p.A235	ENST00000529193.1	37	c.705	CCDS53620.1	11																																																																																			-	NULL		0.652	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CREB3L1	protein_coding	OTTHUMT00000389702.1	G	NM_052854		46289268	1	no_errors	ENST00000288400	ensembl	human	known	54_36p	silent	SNP	0.666	A
DLG2	1740	genome.wustl.edu	37	11	83182725	83182725	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr11:83182725C>T	ENST00000532653.1	-	19	2323	c.2021G>A	c.(2020-2022)cGg>cAg	p.R674Q	DLG2_ENST00000524982.1_Missense_Mutation_p.R688Q|DLG2_ENST00000376106.3_Missense_Mutation_p.R156Q|DLG2_ENST00000418306.2_Missense_Mutation_p.R571Q|DLG2_ENST00000404783.3_Missense_Mutation_p.R170Q|DLG2_ENST00000280241.8_Missense_Mutation_p.R731Q|DLG2_ENST00000330014.6_Missense_Mutation_p.R613Q|DLG2_ENST00000426717.2_Missense_Mutation_p.R156Q|DLG2_ENST00000537455.1_Missense_Mutation_p.R442Q|DLG2_ENST00000543673.1_Missense_Mutation_p.R797Q|DLG2_ENST00000398309.2_Missense_Mutation_p.R692Q|DLG2_ENST00000376104.2_Missense_Mutation_p.R797Q|DLG2_ENST00000531015.1_Missense_Mutation_p.R659Q			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	389					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.R692Q(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GTCATTGATCCGATCCTTCAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	11											68.0	65.0	66.0					11																	83182725		1847	4093	5940	82860373	SO:0001583	missense	1740			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.2021G>A	11.37:g.83182725C>T	ENSP00000435849:p.Arg674Gln		82860373	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_Guanylate_kin;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R692Q	ENST00000532653.1	37	c.2075		11	.	.	.	.	.	.	.	.	.	.	C	34	5.394084	0.96009	.	.	ENSG00000150672	ENST00000398309;ENST00000426717;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000404783;ENST00000330014;ENST00000537455;ENST00000376106;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000457267;ENST00000420775	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.43294	2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28;0.95	5.08	5.08	0.68730	Src homology-3 domain (1);Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.64402	D	0.000018	T	0.72170	0.3427	M	0.89658	3.05	0.80722	D	1	D;D;P;D;D;D;D;D	0.89917	1.0;1.0;0.801;1.0;0.991;1.0;1.0;1.0	D;D;P;D;P;D;D;D	0.91635	0.999;0.999;0.459;0.989;0.611;0.988;0.97;0.976	T	0.78135	-0.2322	9	.	.	.	.	18.8341	0.92153	0.0:1.0:0.0:0.0	.	659;674;688;613;170;797;692;571	E9PIW2;B7Z2T4;E9PN83;B7Z264;B5MCC5;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	Q	692;156;797;571;797;731;170;613;442;156;688;674;797;659;44;174	ENSP00000381355:R692Q;ENSP00000393049:R156Q;ENSP00000365272:R797Q;ENSP00000402275:R571Q;ENSP00000441994:R797Q;ENSP00000280241:R731Q;ENSP00000385113:R170Q;ENSP00000381353:R613Q;ENSP00000443248:R442Q;ENSP00000365274:R156Q;ENSP00000432894:R688Q;ENSP00000435849:R674Q;ENSP00000433848:R659Q;ENSP00000409133:R44Q;ENSP00000391017:R174Q	.	R	-	2	0	DLG2	82860373	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.765000	0.85310	2.510000	0.84645	0.591000	0.81541	CGG	-	NULL		0.433	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	protein_coding	OTTHUMT00000259253.2	C	NM_001364		82860373	-1	no_errors	NM_001364	genbank	human	reviewed	54_36p	missense	SNP	1	T
CRTAM	56253	genome.wustl.edu	37	11	122726478	122726478	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr11:122726478G>T	ENST00000227348.4	+	5	613	c.566G>T	c.(565-567)gGc>gTc	p.G189V		NM_019604.2	NP_062550.2			cytotoxic and regulatory T cell molecule									p.G189V(1)		breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		CACACTTATGGCAAAAATTCA	0.418																																																1	Substitution - Missense(1)	ovary(1)	11											109.0	105.0	106.0					11																	122726478		2202	4299	6501	122231688	SO:0001583	missense	56253			AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000227348.4:c.566G>T	11.37:g.122726478G>T	ENSP00000227348:p.Gly189Val		122231688		Missense_Mutation	SNP	HMMPfam_V-set;HMMPfam_C2-set_2;superfamily_Immunoglobulin	p.G189V	ENST00000227348.4	37	c.566	CCDS8437.1	11	.	.	.	.	.	.	.	.	.	.	G	13.74	2.326397	0.41197	.	.	ENSG00000109943	ENST00000227348	T	0.14022	2.54	4.86	3.83	0.44106	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);	0.495810	0.22537	N	0.058774	T	0.26231	0.0640	M	0.69823	2.125	0.09310	N	1	D	0.54601	0.967	P	0.57720	0.826	T	0.08994	-1.0695	10	0.59425	D	0.04	.	5.4314	0.16456	0.1964:0.1619:0.6417:0.0	.	189	O95727	CRTAM_HUMAN	V	189	ENSP00000227348:G189V	ENSP00000227348:G189V	G	+	2	0	CRTAM	122231688	0.000000	0.05858	0.006000	0.13384	0.048000	0.14542	0.467000	0.22035	1.016000	0.39470	0.462000	0.41574	GGC	-	HMMPfam_C2-set_2		0.418	CRTAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRTAM	protein_coding	OTTHUMT00000387507.1	G	NM_019604		122231688	1	no_errors	NM_019604	genbank	human	validated	54_36p	missense	SNP	0.01	T
LRRIQ1	84125	genome.wustl.edu	37	12	85518019	85518019	+	Silent	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr12:85518019T>C	ENST00000393217.2	+	17	3790	c.3729T>C	c.(3727-3729)acT>acC	p.T1243T		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1243								p.T1243T(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		GTGACAGCACTCTGCAAAATG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	12											100.0	104.0	103.0					12																	85518019		2203	4300	6503	84042150	SO:0001819	synonymous_variant	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3729T>C	12.37:g.85518019T>C			84042150	Q567P4|Q9BS17|Q9HA36	Silent	SNP	-	p.T1243	ENST00000393217.2	37	c.3729	CCDS41816.1	12																																																																																			-	NULL		0.473	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	protein_coding	OTTHUMT00000388249.2	T	NM_032165		84042150	1	no_errors	NM_001079910	genbank	human	validated	54_36p	silent	SNP		C
HAL	3034	genome.wustl.edu	37	12	96370239	96370239	+	Missense_Mutation	SNP	C	C	G	rs377498665		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr12:96370239C>G	ENST00000261208.3	-	20	2169	c.1801G>C	c.(1801-1803)Gag>Cag	p.E601Q	HAL_ENST00000541929.1_Missense_Mutation_p.E393Q|HAL_ENST00000538703.1_Intron	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	601					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)	p.E601Q(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	TGGGCTGCCTCGATGTCCGGG	0.537																																					NSCLC(169;943 2815 23563 30031)											1	Substitution - Missense(1)	ovary(1)	12											62.0	69.0	67.0					12																	96370239		2203	4300	6503	94894370	SO:0001583	missense	3034				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.1801G>C	12.37:g.96370239C>G	ENSP00000261208:p.Glu601Gln		94894370	B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Missense_Mutation	SNP	HMMPfam_PAL;superfamily_L-aspartase-like	p.E601Q	ENST00000261208.3	37	c.1801	CCDS9058.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.423259|5.423259	0.96111|0.96111	.|.	.|.	ENSG00000084110|ENSG00000084110	ENST00000261208;ENST00000541929|ENST00000548808	T;T|.	0.78003|.	-1.14;-1.14|.	5.4|5.4	5.4|5.4	0.78164|0.78164	L-Aspartase-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76205|0.76205	0.3955|0.3955	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	D|.	0.54397|.	0.966|.	P|.	0.55011|.	0.766|.	T|T	0.75348|0.75348	-0.3349|-0.3349	10|5	0.59425|.	D|.	0.04|.	-21.4163|-21.4163	19.1606|19.1606	0.93529|0.93529	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	601|.	P42357|.	HUTH_HUMAN|.	Q|P	601;393|132	ENSP00000261208:E601Q;ENSP00000446364:E393Q|.	ENSP00000261208:E601Q|.	E|R	-|-	1|2	0|0	HAL|HAL	94894370|94894370	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.931000|0.931000	0.56810|0.56810	7.407000|7.407000	0.80029|0.80029	2.535000|2.535000	0.85469|0.85469	0.655000|0.655000	0.94253|0.94253	GAG|CGA	-	NULL		0.537	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	protein_coding	OTTHUMT00000408644.1	C			94894370	-1	no_errors	NM_002108	genbank	human	reviewed	54_36p	missense	SNP	1	G
MIR363	574031	genome.wustl.edu	37	X	133303864	133303864	+	RNA	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chrX:133303864T>C	ENST00000384840.1	-	0	0				MIR19B2_ENST00000385077.2_RNA|MIR106A_ENST00000384870.1_RNA|MIR18B_ENST00000454574.2_RNA|MIR92A2_ENST00000385299.1_RNA|MIR20B_ENST00000384977.1_RNA	NR_029852.1				microRNA 363																		CATACTACAGTAGAGTCATGC	0.418																																																0			X											214.0	174.0	186.0					X																	133303864		1568	3582	5150	133131530			574032					Xq26.2	2012-03-12		2008-12-18	ENSG00000207572	ENSG00000207572		"""ncRNAs / Micro RNAs"""	32023	non-coding RNA	RNA, micro				MIRN363			Standard	NR_029852		Approved	hsa-mir-363, MIR-363	uc022ceb.1				X.37:g.133303864T>C			133131530		RNA	SNP	-	NULL	ENST00000384840.1	37	NULL		X																																																																																			-	-		0.418	MIR363-201	KNOWN	basic	miRNA	MIRN20B	miRNA		T	NR_029852		133131530	-1	no_errors	ENST00000384977	ensembl	human	known	54_36p	rna	SNP	1	C
TRDC	28526	genome.wustl.edu	37	14	22932141	22932141	+	RNA	SNP	A	A	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr14:22932141A>C	ENST00000390477.2	+	0	218				AE000661.37_ENST00000514473.2_RNA|AE000661.37_ENST00000556777.1_RNA			B7Z8K6	TRDC_HUMAN	T cell receptor delta constant							integral component of membrane (GO:0016021)											TGACATGTTCAGTTCAACACG	0.413																																																0			14											75.0	74.0	74.0					14																	22932141		1871	4130	6001	22001981			6955			M22148		14q11.2	2012-02-07			ENSG00000211829	ENSG00000211829		"""T cell receptors / TRD locus"""	12253	other	T cell receptor gene		186810					Standard	NG_001332		Approved			B7Z8K6	OTTHUMG00000170905		14.37:g.22932141A>C			22001981		Missense_Mutation	SNP	-	p.Q73P	ENST00000390477.2	37	c.218		14																																																																																			-	NULL		0.413	TRDC-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	TR_C_gene	TRA@	TR_C_gene	OTTHUMT00000410936.1	A	NG_001332		22001981	1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000390477	ensembl	human	known	54_36p	missense	SNP	0.91	C
IGHV4-31	28396	genome.wustl.edu	37	14	106805439	106805439	+	RNA	SNP	T	T	C	rs557301882|rs142283571	byFrequency	TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr14:106805439T>C	ENST00000438142.2	-	0	195									immunoglobulin heavy variable 4-31																		CCAGAGACAGTACAGGTGAGG	0.592													N|||	298	0.0595048	0.093	0.0389	5008	,	,		8211	0.0278		0.0408	False		,,,				2504	0.0808															0			14											87.0	125.0	113.0					14																	106805439		1943	4141	6084	105876484			0			L10098		14q32.33	2012-02-08			ENSG00000231475	ENSG00000231475		"""Immunoglobulins / IGH locus"""	5649	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152097		14.37:g.106805439T>C			105876484		Missense_Mutation	SNP	-	p.T42A	ENST00000438142.2	37	c.124		14																																																																																			-	NULL		0.592	IGHV4-31-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	ENSG00000211954	IG_V_gene	OTTHUMT00000325194.1	T	NG_001019		105876484	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390614	ensembl	human	known	54_36p	missense	SNP	0	C
Unknown	0	genome.wustl.edu	37	18	15271461	15271461	+	IGR	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr18:15271461T>C								RP11-454P7.3 (73733 upstream) : AP005901.1 (42093 downstream)														p.H416H(1)									AGAGAATTCATACTGAAGAGA	0.378																																																1	Substitution - coding silent(1)	ovary(1)	18																																								15261461	SO:0001628	intergenic_variant	0																															18.37:g.15271461T>C			15261461		Silent	SNP	-	p.H416		37	c.1248		18																																																																																			-	NULL	0	0.378					ENSG00000184624			T			15261461	1	no_start_codon:no_stop_codon	ENST00000330020	ensembl	human	known	54_36p	silent	SNP	1	C
TMEM159	57146	genome.wustl.edu	37	16	21190856	21190856	+	Silent	SNP	C	C	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr16:21190856C>T	ENST00000233047.4	+	5	933	c.465C>T	c.(463-465)ttC>ttT	p.F155F	TMEM159_ENST00000451578.2_Silent_p.F179F|TMEM159_ENST00000261388.3_Silent_p.F155F|TMEM159_ENST00000572599.1_Silent_p.F155F|TMEM159_ENST00000572258.1_3'UTR			Q96B96	TM159_HUMAN	transmembrane protein 159	155						integral component of membrane (GO:0016021)		p.F155F(1)		large_intestine(3)|lung(2)|ovary(1)	6				GBM - Glioblastoma multiforme(48;0.0972)		CTGCAGAATTCGAGGGGCTTT	0.502																																																1	Substitution - coding silent(1)	ovary(1)	16											100.0	92.0	95.0					16																	21190856		2200	4300	6500	21098357	SO:0001819	synonymous_variant	57146			AF070596	CCDS10595.1	16p12.2	2008-02-05			ENSG00000011638	ENSG00000011638			30136	protein-coding gene	gene with protein product		611304				8619474, 9110174, 15589683	Standard	NM_020422		Approved	promethin	uc002dif.4	Q96B96	OTTHUMG00000131559	ENST00000233047.4:c.465C>T	16.37:g.21190856C>T			21098357	A6NMA9|B4DEC1|O00323	Silent	SNP	-	p.F155	ENST00000233047.4	37	c.465	CCDS10595.1	16																																																																																			-	NULL		0.502	TMEM159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM159	protein_coding	OTTHUMT00000254421.1	C	NM_020422		21098357	1	no_errors	NM_020422	genbank	human	validated	54_36p	silent	SNP		T
SPECC1	92521	genome.wustl.edu	37	17	20108296	20108296	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr17:20108296T>C	ENST00000261503.5	+	4	985	c.934T>C	c.(934-936)Tca>Cca	p.S312P	SPECC1_ENST00000584527.1_5'Flank|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000395530.2_Missense_Mutation_p.S231P|SPECC1_ENST00000395525.3_Missense_Mutation_p.S231P|SPECC1_ENST00000395527.4_Missense_Mutation_p.S312P|SPECC1_ENST00000395529.3_Missense_Mutation_p.S312P|SPECC1_ENST00000395522.2_Missense_Mutation_p.S231P|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000472876.1_Intron	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	312	Ser-rich.				cell adhesion (GO:0007155)	nucleus (GO:0005634)		p.S312P(1)		breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		ATTACGGACATCAGGCTCCTC	0.458																																																1	Substitution - Missense(1)	ovary(1)	17											104.0	109.0	107.0					17																	20108296		2203	4300	6503	20048888	SO:0001583	missense	92521			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.934T>C	17.37:g.20108296T>C	ENSP00000261503:p.Ser312Pro		20048888	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	HMMPfam_CH;superfamily_Spectrin repeat;superfamily_Calponin-homology domain CH-domain	p.S312P	ENST00000261503.5	37	c.934	CCDS32590.1	17	.	.	.	.	.	.	.	.	.	.	T	7.422	0.636993	0.14386	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.66099	-0.19;2.81;2.81;2.81	5.38	4.29	0.51040	.	0.053264	0.85682	D	0.000000	T	0.49677	0.1571	L	0.39147	1.195	0.80722	D	1	B;B;B;B;B	0.24043	0.009;0.096;0.096;0.096;0.044	B;B;B;B;B	0.24006	0.019;0.05;0.05;0.05;0.039	T	0.47005	-0.9150	10	0.33141	T	0.24	-13.9252	8.9918	0.36028	0.0:0.0873:0.0:0.9127	.	312;231;231;312;312	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	P	312;312;312;231;231;231	ENSP00000261503:S312P;ENSP00000378900:S312P;ENSP00000378893:S231P;ENSP00000378896:S231P	ENSP00000261503:S312P	S	+	1	0	SPECC1	20048888	1.000000	0.71417	0.086000	0.20670	0.203000	0.24098	4.622000	0.61240	2.179000	0.69175	0.533000	0.62120	TCA	-	NULL		0.458	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTSB	protein_coding	OTTHUMT00000441206.1	T	NM_152904		20048888	1	no_errors	NM_001033553	genbank	human	validated	54_36p	missense	SNP	0.54	C
TP53	7157	genome.wustl.edu	37	17	7578394	7578394	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr17:7578394T>C	ENST00000269305.4	-	5	725	c.536A>G	c.(535-537)cAt>cGt	p.H179R	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.H179R|TP53_ENST00000359597.4_Missense_Mutation_p.H179R|TP53_ENST00000420246.2_Missense_Mutation_p.H179R|TP53_ENST00000455263.2_Missense_Mutation_p.H179R|TP53_ENST00000445888.2_Missense_Mutation_p.H179R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179R(108)|p.H179L(43)|p.P177_C182delPHHERC(8)|p.0?(8)|p.H47L(4)|p.H86L(4)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H179P(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.H86R(2)|p.H47R(2)|p.R174fs*1(2)|p.H179fs*68(1)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.E171fs*1(1)|p.R174fs*3(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGCGCTCATGGTGGGGGCA	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	217	Substitution - Missense(166)|Deletion - In frame(24)|Deletion - Frameshift(18)|Whole gene deletion(8)|Complex - deletion inframe(1)	lung(35)|breast(32)|large_intestine(29)|upper_aerodigestive_tract(26)|oesophagus(21)|ovary(21)|central_nervous_system(16)|haematopoietic_and_lymphoid_tissue(8)|urinary_tract(6)|pancreas(6)|liver(5)|bone(4)|biliary_tract(3)|cervix(1)|stomach(1)|endometrium(1)|salivary_gland(1)|skin(1)	17											47.0	47.0	47.0					17																	7578394		2203	4300	6503	7519119	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.536A>G	17.37:g.7578394T>C	ENSP00000269305:p.His179Arg		7519119	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.H179R	ENST00000269305.4	37	c.536	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	26.0	4.694391	0.88830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87	5.47	5.47	0.80525	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	D	0.000000	D	0.99917	0.9961	M	0.92507	3.315	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.989;1.0;0.985;1.0;0.995;1.0;0.996	D;D;D;D;D;D;D	0.97110	0.929;0.996;0.912;1.0;0.985;0.995;0.937	D	0.95874	0.8893	10	0.87932	D	0	-15.4889	13.8032	0.63214	0.0:0.0:0.0:1.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179R;ENSP00000352610:H179R;ENSP00000269305:H179R;ENSP00000398846:H179R;ENSP00000391127:H179R;ENSP00000391478:H179R;ENSP00000425104:H47R;ENSP00000423862:H86R	ENSP00000269305:H179R	H	-	2	0	TP53	7519119	1.000000	0.71417	0.945000	0.38365	0.856000	0.48823	6.263000	0.72521	2.208000	0.71279	0.460000	0.39030	CAT	-	HMMPfam_P53		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546		7519119	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	C
KCNAB3	9196	genome.wustl.edu	37	17	7827515	7827515	+	Silent	SNP	C	C	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr17:7827515C>T	ENST00000303790.2	-	10	779	c.780G>A	c.(778-780)ctG>ctA	p.L260L		NM_004732.3	NP_004723.2	O43448	KCAB3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 3	260					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)	p.L260L(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	8		Prostate(122;0.157)				CCCTCTGAAACAGATGGTGCT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	17											124.0	110.0	115.0					17																	7827515		2203	4300	6503	7768240	SO:0001819	synonymous_variant	9196			AF016411	CCDS11124.1	17p13.1	2006-11-29			ENSG00000170049	ENSG00000170049		"""Potassium channels"", ""Aldo-keto reductases"""	6230	protein-coding gene	gene with protein product		604111				9857044	Standard	NM_004732		Approved	AKR6A9, KCNA3B	uc002gjm.2	O43448	OTTHUMG00000108170	ENST00000303790.2:c.780G>A	17.37:g.7827515C>T			7768240	Q4VAW0	Silent	SNP	-	p.L260	ENST00000303790.2	37	c.780	CCDS11124.1	17																																																																																			-	NULL		0.532	KCNAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNAB3	protein_coding	OTTHUMT00000226974.1	C	NM_004732		7768240	-1	no_errors	NM_004732	genbank	human	reviewed	54_36p	silent	SNP	1	T
GRB7	2886	genome.wustl.edu	37	17	37903121	37903121	+	Missense_Mutation	SNP	C	C	T	rs373351063		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr17:37903121C>T	ENST00000309156.4	+	15	1827	c.1570C>T	c.(1570-1572)Cgc>Tgc	p.R524C	GRB7_ENST00000445327.2_Missense_Mutation_p.R547C|GRB7_ENST00000309185.3_3'UTR|GRB7_ENST00000394209.2_Missense_Mutation_p.R524C|GRB7_ENST00000394204.1_3'UTR|GRB7_ENST00000394211.3_Missense_Mutation_p.R524C	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	524	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)	p.R524C(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			GTGCTTGCTGCGCCATTGCTG	0.662																																																1	Substitution - Missense(1)	ovary(1)	17						C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	72.0	55.0	61.0		1570,1639,1570,1570	4.9	1.0	17		61	0,8600		0,0,4300	no	missense,missense,missense,missense	GRB7	NM_001030002.2,NM_001242442.1,NM_001242443.1,NM_005310.3	180,180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	524/533,547/556,524/533,524/533	37903121	1,13005	2203	4300	6503	35156647	SO:0001583	missense	2886			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.1570C>T	17.37:g.37903121C>T	ENSP00000310771:p.Arg524Cys		35156647	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	RA,HMMPfam_RA,SH2,HMMPfam_SH2,PH,HMMPfam_PH,BPS,HMMPfam_BPS	p.R524C	ENST00000309156.4	37	c.1570	CCDS11345.1	17	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627785	0.87560	2.27E-4	0.0	ENSG00000141738	ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.89	4.89	0.63831	SH2 motif (2);	0.058919	0.64402	D	0.000003	T	0.53834	0.1821	M	0.67569	2.06	0.80722	D	1	D	0.67145	0.996	P	0.56434	0.798	T	0.57429	-0.7813	10	0.72032	D	0.01	-29.1217	10.5845	0.45275	0.3011:0.6989:0.0:0.0	.	524	Q14451	GRB7_HUMAN	C	524;524;524;547	ENSP00000310771:R524C;ENSP00000377761:R524C;ENSP00000377759:R524C;ENSP00000403459:R547C	ENSP00000310771:R524C	R	+	1	0	GRB7	35156647	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	4.255000	0.58804	2.541000	0.85698	0.655000	0.94253	CGC	-	NULL		0.662	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	protein_coding	OTTHUMT00000257024.2	C	NM_005310		35156647	1	no_errors	NM_001030002	genbank	human	reviewed	54_36p	missense	SNP	1	T
NPIPB1P	729602	genome.wustl.edu	37	18	11629696	11629696	+	RNA	SNP	C	C	T	rs539672817	byFrequency	TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr18:11629696C>T	ENST00000547442.1	-	0	273									nuclear pore complex interacting protein family, member B1, pseudogene																		TTCTCGGAAACGCAATAATGA	0.358													-|||	8	0.00159744	0.0008	0.0	5008	,	,		18736	0.002		0.0	False		,,,				2504	0.0051															0			18																																								11619696			729602					18p11.21	2013-06-11			ENSG00000257513	ENSG00000257513			37452	pseudogene	pseudogene							Standard	NG_023368		Approved				OTTHUMG00000170512		18.37:g.11629696C>T			11619696		Silent	SNP	-	p.A47	ENST00000547442.1	37	c.141		18																																																																																			-	NULL		0.358	NPIPB1P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	LOC729602	pseudogene	OTTHUMT00000409451.1	C	NG_023368		11619696	-1	no_errors	XM_001717235	genbank	human	model	54_36p	silent	SNP	0	T
C18orf8	29919	genome.wustl.edu	37	18	21100208	21100208	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr18:21100208G>A	ENST00000269221.3	+	10	1002	c.892G>A	c.(892-894)Ggc>Agc	p.G298S	C18orf8_ENST00000590868.1_Missense_Mutation_p.G250S	NM_013326.3	NP_037458.3	Q96DM3	MIC1_HUMAN	chromosome 18 open reading frame 8	298						lysosomal membrane (GO:0005765)		p.G298S(1)		endometrium(9)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	21	all_cancers(21;0.000122)|all_epithelial(16;8.08e-07)|Lung NSC(20;0.00206)|all_lung(20;0.00659)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGAGTTTGACGGCTCCGTTAC	0.517																																																1	Substitution - Missense(1)	ovary(1)	18											164.0	135.0	145.0					18																	21100208		2203	4300	6503	19354206	SO:0001583	missense	29919			AK057192	CCDS32803.1, CCDS74199.1	18q11.2	2013-12-13			ENSG00000141452	ENSG00000141452			24326	protein-coding gene	gene with protein product	"""colon cancer associated protein Mic1"", ""macrophage inhibitory cytokine 1"""					12477932	Standard	NM_013326		Approved	MIC1, MIC-1, HsT2591	uc021uie.2	Q96DM3		ENST00000269221.3:c.892G>A	18.37:g.21100208G>A	ENSP00000269221:p.Gly298Ser		19354206	Q9BU17|Q9Y5M0	Missense_Mutation	SNP	HMMPfam_Mic1;superfamily_WD40 repeat-like	p.G298S	ENST00000269221.3	37	c.892	CCDS32803.1	18	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415476	0.62511	.	.	ENSG00000141452	ENST00000269221;ENST00000544799;ENST00000540942;ENST00000542734	.	.	.	5.5	5.5	0.81552	.	0.052112	0.85682	D	0.000000	T	0.66406	0.2786	L	0.42245	1.32	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.59825	0.735;0.864	T	0.60209	-0.7308	9	0.24483	T	0.36	-2.0371	19.4067	0.94649	0.0:0.0:1.0:0.0	.	298;250	Q96DM3;F5H2W0	MIC1_HUMAN;.	S	298;141;250;141	.	ENSP00000269221:G298S	G	+	1	0	C18orf8	19354206	1.000000	0.71417	0.952000	0.39060	0.181000	0.23173	3.924000	0.56476	2.585000	0.87301	0.462000	0.41574	GGC	-	NULL		0.517	C18orf8-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C18orf8	protein_coding	OTTHUMT00000445386.1	G	NM_013326		19354206	1	no_errors	NM_013326	genbank	human	validated	54_36p	missense	SNP	1	A
MAST1	22983	genome.wustl.edu	37	19	12969432	12969432	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr19:12969432G>C	ENST00000251472.4	+	12	1284	c.1245G>C	c.(1243-1245)caG>caC	p.Q415H	MAST1_ENST00000591495.1_Missense_Mutation_p.Q411H	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1									p.Q415H(1)		NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						TCCGCAACCAGATCCAGCAGG	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											95.0	81.0	86.0					19																	12969432		2203	4300	6503	12830432	SO:0001583	missense	22983			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1245G>C	19.37:g.12969432G>C	ENSP00000251472:p.Gln415His		12830432		Missense_Mutation	SNP	Pkinase;HMMPfam_Pkinase;Pkinase_C;HMMPfam_Pkinase_C;PDZ;HMMPfam_PDZ;DUF1908;HMMPfam_DUF1908	p.Q415H	ENST00000251472.4	37	c.1245	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687878	0.68271	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.66815	-0.23	4.75	3.71	0.42584	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	L	0.58354	1.805	0.52099	D	0.999946	D;P	0.89917	1.0;0.746	D;P	0.97110	1.0;0.661	T	0.75662	-0.3240	10	0.87932	D	0	-32.4787	7.6981	0.28606	0.1941:0.0:0.8059:0.0	.	415;415	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	H	415	ENSP00000251472:Q415H	ENSP00000251472:Q415H	Q	+	3	2	MAST1	12830432	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.498000	0.53302	1.140000	0.42260	0.561000	0.74099	CAG	-	HMMPfam_Pkinase		0.592	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	protein_coding	OTTHUMT00000451733.2	G	NM_014975		12830432	1	no_errors	NM_014975	genbank	human	provisional	54_36p	missense	SNP	1	C
NOTCH3	4854	genome.wustl.edu	37	19	15298004	15298004	+	Silent	SNP	G	G	A	rs201207820		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr19:15298004G>A	ENST00000263388.2	-	11	1827	c.1752C>T	c.(1750-1752)gaC>gaT	p.D584D		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	584	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.D584D(1)		breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			TGCGGCATTCGTCCACCTGGC	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		15248	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19											42.0	40.0	40.0					19																	15298004		2203	4300	6503	15159004	SO:0001819	synonymous_variant	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1752C>T	19.37:g.15298004G>A			15159004	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	superfamily_Ankyrin repeat,superfamily_EGF/Laminin,superfamily_Notch domain,Notch,HMMPfam_Notch,Ank,HMMPfam_Ank,EGF,HMMPfam_EGF,NOD,HMMPfam_NOD,NODP,HMMPfam_NODP,EGF_CA,HMMPfam_EGF_CA,EGF_2,HMMPfam_EGF_2	p.D584	ENST00000263388.2	37	c.1752	CCDS12326.1	19																																																																																			-	NULL		0.657	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	protein_coding	OTTHUMT00000465714.1	G	NM_000435		15159004	-1	no_errors	NM_000435	genbank	human	reviewed	54_36p	silent	SNP	0.992	A
ZNF493	284443	genome.wustl.edu	37	19	21587960	21587960	+	Intron	SNP	A	A	G			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr19:21587960A>G	ENST00000355504.4	+	1	135				ZNF493_ENST00000596302.1_Missense_Mutation_p.I20M|ZNF493_ENST00000594390.1_Missense_Mutation_p.I20M|CTD-2561J22.3_ENST00000600810.1_5'Flank|ZNF493_ENST00000392288.2_Missense_Mutation_p.I20M|ZNF493_ENST00000339914.6_Missense_Mutation_p.I20M	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						ATGTGGCCATAGAATTCTCTC	0.443																																																0			19											86.0	91.0	89.0					19																	21587960		2203	4300	6503	21379800	SO:0001627	intron_variant	284443			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.-132+7891A>G	19.37:g.21587960A>G			21379800	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	-	p.I20M	ENST00000355504.4	37	c.60	CCDS12412.1	19	.	.	.	.	.	.	.	.	.	.	N	11.13	1.548570	0.27652	.	.	ENSG00000196268	ENST00000392288;ENST00000339914	T;T	0.01871	4.59;4.59	1.14	1.14	0.20703	.	.	.	.	.	T	0.08223	0.0205	M	0.72624	2.21	0.21325	N	0.999725	D;D	0.89917	0.966;1.0	P;D	0.70487	0.844;0.969	T	0.20739	-1.0266	9	0.87932	D	0	.	4.44	0.11570	1.0:0.0:0.0:0.0	.	20;20	Q6ZR52-2;G5E974	.;.	M	20	ENSP00000376110:I20M;ENSP00000340651:I20M	ENSP00000340651:I20M	I	+	3	3	ZNF493	21379800	0.537000	0.26386	0.999000	0.59377	0.454000	0.32378	-0.366000	0.07563	0.759000	0.33084	0.338000	0.21704	ATA	-	NULL		0.443	ZNF493-003	KNOWN	basic|CCDS	protein_coding	ZNF493	protein_coding	OTTHUMT00000280563.1	A	NM_175910		21379800	1	no_errors	NM_001076678	genbank	human	validated	54_36p	missense	SNP	0.99	G
TSHZ3	57616	genome.wustl.edu	37	19	31770078	31770078	+	Silent	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr19:31770078G>A	ENST00000240587.4	-	2	948	c.621C>T	c.(619-621)atC>atT	p.I207I		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	207					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I24I(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCCCCGTGAAGATGGAGCCAT	0.627																																																1	Substitution - coding silent(1)	ovary(1)	19											79.0	73.0	75.0					19																	31770078		2203	4300	6503	36461918	SO:0001819	synonymous_variant	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.621C>T	19.37:g.31770078G>A			36461918	Q9H0G6|Q9P254	Silent	SNP	-	p.I207	ENST00000240587.4	37	c.621	CCDS12421.2	19																																																																																			-	NULL		0.627	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	protein_coding	OTTHUMT00000316743.2	G	NM_020856		36461918	-1	no_errors	NM_020856	genbank	human	validated	54_36p	silent	SNP	1	A
APLP1	333	genome.wustl.edu	37	19	36370049	36370049	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr19:36370049T>A	ENST00000221891.4	+	16	1979	c.1787T>A	c.(1786-1788)cTc>cAc	p.L596H	APLP1_ENST00000586861.1_Missense_Mutation_p.L589H|RN7SL402P_ENST00000465059.1_RNA|APLP1_ENST00000537454.2_Missense_Mutation_p.L556H	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	595					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)	p.L596H(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGAGGCTCCCTCATCGTCCTC	0.657																																																1	Substitution - Missense(1)	ovary(1)	19											57.0	56.0	56.0					19																	36370049		2203	4300	6503	41061889	SO:0001583	missense	333			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1787T>A	19.37:g.36370049T>A	ENSP00000221891:p.Leu596His		41061889	O00113|Q96A92	Missense_Mutation	SNP	-	p.L596H	ENST00000221891.4	37	c.1787	CCDS32997.1	19	.	.	.	.	.	.	.	.	.	.	T	17.60	3.430907	0.62844	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.96011	-3.88;-3.88	4.86	3.8	0.43715	Beta-amyloid precursor protein C-terminal (1);	0.248415	0.20933	N	0.083061	D	0.93080	0.7797	N	0.08118	0	0.33941	D	0.643278	D;D;D;D	0.76494	0.992;0.998;0.999;0.999	P;P;D;D	0.66847	0.819;0.887;0.935;0.947	D	0.93545	0.6881	10	0.87932	D	0	-16.4964	8.2449	0.31682	0.0:0.0:0.2021:0.7979	.	589;556;596;595	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	H	556;596	ENSP00000441501:L556H;ENSP00000221891:L596H	ENSP00000221891:L596H	L	+	2	0	APLP1	41061889	1.000000	0.71417	0.030000	0.17652	0.828000	0.46876	5.048000	0.64238	0.823000	0.34589	0.533000	0.62120	CTC	-	NULL		0.657	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	protein_coding	OTTHUMT00000452564.1	T	NM_001024807		41061889	1	no_errors	NM_001024807	genbank	human	reviewed	54_36p	missense	SNP	0.95	A
TAF1B	9014	genome.wustl.edu	37	2	10073948	10073948	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr2:10073948T>A	ENST00000263663.5	+	15	1790	c.1602T>A	c.(1600-1602)aaT>aaA	p.N534K	TAF1B_ENST00000396242.3_Missense_Mutation_p.N279K|RP11-95D17.1_ENST00000602458.1_lincRNA	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	534					gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)	p.N534K(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAGAATCAAATTATTCTCTGA	0.348																																																1	Substitution - Missense(1)	ovary(1)	2											69.0	75.0	73.0					2																	10073948		2201	4295	6496	9991399	SO:0001583	missense	9014			L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1602T>A	2.37:g.10073948T>A	ENSP00000263663:p.Asn534Lys		9991399	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	-	p.N534K	ENST00000263663.5	37	c.1602	CCDS33143.1	2	.	.	.	.	.	.	.	.	.	.	T	14.80	2.643457	0.47258	.	.	ENSG00000115750	ENST00000263663;ENST00000396242	T;T	0.41758	0.99;0.99	5.64	1.98	0.26296	.	0.189479	0.53938	D	0.000047	T	0.44726	0.1307	M	0.67953	2.075	0.35159	D	0.770433	D	0.56521	0.976	P	0.49799	0.622	T	0.53781	-0.8390	9	.	.	.	-25.5956	7.2147	0.25953	0.0:0.2588:0.0:0.7412	.	534	Q53T94	TAF1B_HUMAN	K	534;279	ENSP00000263663:N534K;ENSP00000379542:N279K	.	N	+	3	2	TAF1B	9991399	0.999000	0.42202	0.977000	0.42913	0.589000	0.36550	0.205000	0.17356	0.103000	0.17682	-0.609000	0.04063	AAT	-	NULL		0.348	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1B	protein_coding	OTTHUMT00000323426.2	T	NM_005680		9991399	1	no_errors	NM_005680	genbank	human	reviewed	54_36p	missense	SNP	1	A
SNRNP200	23020	genome.wustl.edu	37	2	96952745	96952745	+	Splice_Site	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr2:96952745T>C	ENST00000323853.5	-	27	3715	c.3638A>G	c.(3637-3639)aAg>aGg	p.K1213R	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1213	SEC63 1.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)	p.K1213R(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						AAGCCTCACCTTTTCATCCCA	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											130.0	113.0	119.0					2																	96952745		2203	4300	6503	96316472	SO:0001630	splice_region_variant	23020			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.3639+1A>G	2.37:g.96952745T>C			96316472	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	-	p.K1213R	ENST00000323853.5	37	c.3638	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	T	12.16	1.854182	0.32791	.	.	ENSG00000144028	ENST00000323853	T	0.60424	0.19	5.04	5.04	0.67666	Sec63 domain (3);	0.000000	0.85682	D	0.000000	T	0.47710	0.1460	L	0.28649	0.875	0.80722	D	1	B	0.14805	0.011	B	0.24006	0.05	T	0.43376	-0.9395	10	0.45353	T	0.12	-21.3585	13.8909	0.63738	0.0:0.0:0.0:1.0	.	1213	O75643	U520_HUMAN	R	1213	ENSP00000317123:K1213R	ENSP00000317123:K1213R	K	-	2	0	SNRNP200	96316472	1.000000	0.71417	0.361000	0.25849	0.225000	0.24961	7.863000	0.87023	2.131000	0.65755	0.374000	0.22700	AAG	-	NULL		0.562	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	protein_coding	OTTHUMT00000252846.2	T	NM_014014	Missense_Mutation	96316472	-1	no_errors	NM_014014	genbank	human	validated	54_36p	missense	SNP	1	C
GLI2	2736	genome.wustl.edu	37	2	121684976	121684976	+	Missense_Mutation	SNP	C	C	T	rs147224778	byFrequency	TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr2:121684976C>T	ENST00000452319.1	+	3	248	c.188C>T	c.(187-189)cCg>cTg	p.P63L	GLI2_ENST00000361492.4_Missense_Mutation_p.P63L|GLI2_ENST00000314490.11_5'UTR|GLI2_ENST00000435313.2_3'UTR					GLI family zinc finger 2									p.P63L(1)		NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GCGCCCCTACCGATTGACATG	0.557													C|||	2	0.000399361	0.0015	0.0	5008	,	,		18735	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2						C	LEU/PRO	2,4404	4.2+/-10.8	0,2,2201	272.0	224.0	240.0		188	5.1	0.8	2	dbSNP_134	240	0,8600		0,0,4300	no	missense	GLI2	NM_005270.4	98	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	63/1587	121684976	2,13004	2203	4300	6503	121401446	SO:0001583	missense	2736				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.188C>T	2.37:g.121684976C>T	ENSP00000390436:p.Pro63Leu		121401446		Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_Kazal-type serine protease inhibitors;superfamily_C2H2 and C2HC zinc fingers	p.P63L	ENST00000452319.1	37	c.188	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587660	0.66105	4.54E-4	0.0	ENSG00000074047	ENST00000418323;ENST00000452319;ENST00000361492;ENST00000440937;ENST00000360874	T;T;T;T	0.76316	-1.01;-1.01;-1.01;-1.01	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.87838	0.6278	M	0.72118	2.19	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;0.998;1.0	D	0.89180	0.3543	10	0.87932	D	0	.	18.5372	0.91014	0.0:1.0:0.0:0.0	.	63;63;63;63	B4DT63;P10070;Q0VGA0;F5H4D9	.;GLI2_HUMAN;.;.	L	63;63;63;63;55	ENSP00000398992:P63L;ENSP00000390436:P63L;ENSP00000354586:P63L;ENSP00000441454:P55L	ENSP00000441454:P55L	P	+	2	0	GLI2	121401446	1.000000	0.71417	0.824000	0.32777	0.095000	0.18619	7.474000	0.81024	2.382000	0.81193	0.467000	0.42956	CCG	-	NULL		0.557	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	protein_coding	OTTHUMT00000332293.3	C	NM_005270		121401446	1	no_errors	NM_005270	genbank	human	reviewed	54_36p	missense	SNP	1	T
PTPRT	11122	genome.wustl.edu	37	20	40727184	40727184	+	Silent	SNP	C	C	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr20:40727184C>T	ENST00000373187.1	-	27	3722	c.3723G>A	c.(3721-3723)aaG>aaA	p.K1241K	PTPRT_ENST00000373190.1_Silent_p.K1240K|PTPRT_ENST00000356100.2_Silent_p.K1250K|PTPRT_ENST00000373198.4_Silent_p.K1260K|PTPRT_ENST00000373201.1_Silent_p.K1231K|PTPRT_ENST00000373193.3_Silent_p.K1244K|PTPRT_ENST00000373184.1_Silent_p.K1251K			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1241	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)	p.K1263K(1)		NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CGGCAGGCTGCTTGTGGCTCT	0.542																																																1	Substitution - coding silent(1)	ovary(1)	20											61.0	66.0	65.0					20																	40727184		2091	4242	6333	40160598	SO:0001819	synonymous_variant	11122			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3723G>A	20.37:g.40727184C>T			40160598	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	-	p.K1260	ENST00000373187.1	37	c.3780	CCDS42874.1	20																																																																																			-	NULL		0.542	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	protein_coding	OTTHUMT00000080315.1	C			40160598	-1	no_errors	NM_133170	genbank	human	reviewed	54_36p	silent	SNP	1	T
FERMT1	55612	genome.wustl.edu	37	20	6057909	6057909	+	Missense_Mutation	SNP	C	C	T	rs558908354		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr20:6057909C>T	ENST00000217289.4	-	15	2733	c.1945G>A	c.(1945-1947)Ggc>Agc	p.G649S	FERMT1_ENST00000478194.1_5'UTR|FERMT1_ENST00000536936.1_Missense_Mutation_p.G392S	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	649	FERM.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)		p.G649S(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						AAAATGTAGCCGCCAATGTAC	0.498											OREG0025763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0014	5008	,	,		20102	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	20											89.0	75.0	80.0					20																	6057909		2203	4300	6503	6005909	SO:0001583	missense	55612			AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.1945G>A	20.37:g.6057909C>T	ENSP00000217289:p.Gly649Ser	631	6005909	D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	-	p.G649S	ENST00000217289.4	37	c.1945	CCDS13098.1	20	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038161	0.93630	.	.	ENSG00000101311	ENST00000217289;ENST00000536936	T;T	0.47528	0.84;0.84	5.78	5.78	0.91487	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.75824	0.3902	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.70487	0.969	T	0.79808	-0.1647	10	0.66056	D	0.02	-20.041	20.0027	0.97425	0.0:1.0:0.0:0.0	.	649	Q9BQL6	FERM1_HUMAN	S	649;392	ENSP00000217289:G649S;ENSP00000441063:G392S	ENSP00000217289:G649S	G	-	1	0	FERMT1	6005909	1.000000	0.71417	0.965000	0.40720	0.492000	0.33523	7.711000	0.84669	2.733000	0.93635	0.655000	0.94253	GGC	-	NULL		0.498	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERMT1	protein_coding	OTTHUMT00000077908.2	C	NM_017671		6005909	-1	no_errors	NM_017671	genbank	human	validated	54_36p	missense	SNP	1	T
IFT52	51098	genome.wustl.edu	37	20	42271264	42271264	+	Splice_Site	SNP	G	G	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr20:42271264G>T	ENST00000373030.3	+	13	1396	c.1266G>T	c.(1264-1266)caG>caT	p.Q422H	IFT52_ENST00000373039.4_Splice_Site_p.Q422H|IFT52_ENST00000471199.1_3'UTR	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	422					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)	p.Q422H(1)		endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AATTGAACCAGGTACAGAGCC	0.468																																																1	Substitution - Missense(1)	ovary(1)	20											100.0	86.0	91.0					20																	42271264		2203	4300	6503	41704678	SO:0001630	splice_region_variant	51098			AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1266+1G>T	20.37:g.42271264G>T			41704678	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Missense_Mutation	SNP	-	p.Q422H	ENST00000373030.3	37	c.1266	CCDS33470.1	20	.	.	.	.	.	.	.	.	.	.	G	19.40	3.820725	0.71028	.	.	ENSG00000101052	ENST00000373030;ENST00000373039	.	.	.	4.74	4.74	0.60224	.	0.052764	0.85682	D	0.000000	T	0.72811	0.3507	M	0.64170	1.965	0.58432	D	0.999995	D	0.55800	0.973	P	0.56823	0.807	T	0.75266	-0.3378	9	0.52906	T	0.07	-16.0694	16.8652	0.86027	0.0:0.0:1.0:0.0	.	422	Q9Y366	IFT52_HUMAN	H	422	.	ENSP00000362121:Q422H	Q	+	3	2	IFT52	41704678	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.474000	0.81024	2.353000	0.79882	0.555000	0.69702	CAG	-	NULL		0.468	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	protein_coding	OTTHUMT00000079317.1	G	NM_016004	Missense_Mutation	41704678	1	no_errors	NM_016004	genbank	human	validated	54_36p	missense	SNP	1	T
LTN1	26046	genome.wustl.edu	37	21	30303491	30303491	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr21:30303491G>T	ENST00000361371.5	-	29	5303	c.5224C>A	c.(5224-5226)Cat>Aat	p.H1742N	LTN1_ENST00000389194.2_Missense_Mutation_p.H1788N			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1742					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.H1742N(1)		NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						CAGGCTGAATGGAATTTTTTC	0.358																																																1	Substitution - Missense(1)	ovary(1)	21											114.0	114.0	114.0					21																	30303491		2203	4300	6503	29225362	SO:0001583	missense	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.5224C>A	21.37:g.30303491G>T	ENSP00000354977:p.His1742Asn		29225362	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_ARM repeat;superfamily_RING/U-box	p.H1742N	ENST00000361371.5	37	c.5224		21	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585960	0.86748	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.65916	-0.18;-0.18	5.31	5.31	0.75309	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	D	0.87657	0.6232	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91872	0.5508	10	0.87932	D	0	.	19.1642	0.93548	0.0:0.0:1.0:0.0	.	1742	O94822	LTN1_HUMAN	N	1788;1742	ENSP00000373846:H1788N;ENSP00000354977:H1742N	ENSP00000354977:H1742N	H	-	1	0	LTN1	29225362	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.184000	0.94893	2.758000	0.94735	0.591000	0.81541	CAT	-	NULL		0.358	LTN1-008	NOVEL	basic|appris_principal	protein_coding	RNF160	protein_coding	OTTHUMT00000472108.1	G	NM_015565		29225362	-1	no_errors	NM_015565	genbank	human	validated	54_36p	missense	SNP	1	T
COL6A1	1291	genome.wustl.edu	37	21	47422537	47422537	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr21:47422537C>G	ENST00000361866.3	+	33	2461	c.2347C>G	c.(2347-2349)Cgg>Ggg	p.R783G	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	783	C-terminal globular domain.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)	p.R783G(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		ATCCCAGGGCCGGCCCGGCCT	0.587																																																1	Substitution - Missense(1)	ovary(1)	21											93.0	87.0	89.0					21																	47422537		2202	4300	6502	46246965	SO:0001583	missense	1291			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2347C>G	21.37:g.47422537C>G	ENSP00000355180:p.Arg783Gly		46246965	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	HMMPfam_Collagen;superfamily_vWA-like;HMMPfam_VWA	p.R783G	ENST00000361866.3	37	c.2347	CCDS13727.1	21	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325984	0.24080	.	.	ENSG00000142156	ENST00000361866	D	0.90844	-2.74	4.94	2.91	0.33838	von Willebrand factor, type A (2);	0.129206	0.51477	D	0.000091	D	0.84538	0.5494	L	0.40543	1.245	0.09310	N	0.999992	P	0.43169	0.8	P	0.45071	0.468	T	0.73385	-0.3999	10	0.23891	T	0.37	-27.2515	3.7596	0.08599	0.2971:0.4852:0.0:0.2176	.	783	P12109	CO6A1_HUMAN	G	783	ENSP00000355180:R783G	ENSP00000355180:R783G	R	+	1	2	COL6A1	46246965	0.507000	0.26146	0.221000	0.23827	0.026000	0.11368	1.006000	0.29847	1.084000	0.41184	0.455000	0.32223	CGG	-	HMMPfam_VWA		0.587	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	protein_coding	OTTHUMT00000206877.1	C	NM_001848		46246965	1	no_errors	NM_001848	genbank	human	reviewed	54_36p	missense	SNP	0.01	G
SIDT1	54847	genome.wustl.edu	37	3	113329877	113329877	+	Silent	SNP	C	C	T	rs145960933		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr3:113329877C>T	ENST00000264852.4	+	18	2469	c.1743C>T	c.(1741-1743)atC>atT	p.I581I	SIDT1_ENST00000393830.3_Silent_p.I581I|SIDT1_ENST00000463226.1_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	581					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)	p.I581I(1)		breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TGTACATGATCGCTGGCCTGT	0.498													C|||	1	0.000199681	0.0	0.0	5008	,	,		17579	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	3						C		1,4405	2.1+/-5.4	0,1,2202	169.0	157.0	161.0		1743	-3.2	0.5	3	dbSNP_134	161	17,8583	14.0+/-48.4	0,17,4283	no	coding-synonymous	SIDT1	NM_017699.2		0,18,6485	TT,TC,CC		0.1977,0.0227,0.1384		581/828	113329877	18,12988	2203	4300	6503	114812567	SO:0001819	synonymous_variant	54847			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1743C>T	3.37:g.113329877C>T			114812567	Q17RR4	Silent	SNP	-	p.I581	ENST00000264852.4	37	c.1743	CCDS2974.1	3																																																																																			-	NULL		0.498	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	protein_coding	OTTHUMT00000317564.1	C	NM_017699		114812567	1	no_errors	NM_017699	genbank	human	validated	54_36p	silent	SNP	1	T
ITIH3	3699	genome.wustl.edu	37	3	52833830	52833830	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr3:52833830T>C	ENST00000449956.2	+	9	974	c.968T>C	c.(967-969)aTc>aCc	p.I323T	ITIH3_ENST00000465243.2_3'UTR|ITIH3_ENST00000416872.2_Missense_Mutation_p.I323T	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	323	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.I323T(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CTGAATTTCATCCTGTTCAGT	0.522																																																1	Substitution - Missense(1)	ovary(1)	3											73.0	77.0	75.0					3																	52833830		1925	4136	6061	52808870	SO:0001583	missense	3699				CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.968T>C	3.37:g.52833830T>C	ENSP00000415769:p.Ile323Thr		52808870	Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	-	p.I323T	ENST00000449956.2	37	c.968	CCDS46845.1	3	.	.	.	.	.	.	.	.	.	.	T	22.7	4.324620	0.81580	.	.	ENSG00000162267	ENST00000398670;ENST00000536431;ENST00000273291;ENST00000416872;ENST00000449956	D;D	0.85171	-1.95;-1.95	5.33	5.33	0.75918	von Willebrand factor, type A (3);	0.195954	0.53938	D	0.000046	D	0.91593	0.7344	M	0.89030	3	0.42964	D	0.994418	D;P	0.64830	0.994;0.872	P;P	0.57620	0.824;0.673	D	0.93102	0.6509	10	0.72032	D	0.01	-28.8375	12.928	0.58270	0.0:0.0:0.0:1.0	.	323;323	E7ET33;Q06033	.;ITIH3_HUMAN	T	323;311;318;323;323	ENSP00000413922:I323T;ENSP00000415769:I323T	ENSP00000273291:I318T	I	+	2	0	ITIH3	52808870	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.857000	0.75455	2.240000	0.73641	0.533000	0.62120	ATC	-	NULL		0.522	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH3	protein_coding	OTTHUMT00000352668.2	T	NM_002217		52808870	1	no_errors	NM_002217	genbank	human	validated	54_36p	missense	SNP	1	C
MED12L	116931	genome.wustl.edu	37	3	151078293	151078293	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr3:151078293C>T	ENST00000474524.1	+	19	2790	c.2752C>T	c.(2752-2754)Ccc>Tcc	p.P918S	P2RY12_ENST00000302632.3_Intron|MED12L_ENST00000273432.4_Missense_Mutation_p.P778S	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	918						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P918S(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGTCGTAAACCCCTCAGAATG	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											281.0	268.0	272.0					3																	151078293		2203	4300	6503	152560983	SO:0001583	missense	116931			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.2752C>T	3.37:g.151078293C>T	ENSP00000417235:p.Pro918Ser		152560983	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	-	p.P918S	ENST00000474524.1	37	c.2752	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	31	5.087844	0.94100	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.77229	-1.08;-1.08	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.86648	0.5983	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.991	D;P;P	0.76071	0.987;0.844;0.831	D	0.84428	0.0575	10	0.35671	T	0.21	-23.5783	19.2898	0.94093	0.0:1.0:0.0:0.0	.	778;918;918	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	S	918;778	ENSP00000417235:P918S;ENSP00000273432:P778S	ENSP00000273432:P778S	P	+	1	0	MED12L	152560983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.166000	0.77553	2.723000	0.93209	0.655000	0.94253	CCC	-	NULL		0.398	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	protein_coding	OTTHUMT00000357707.2	C	NM_053002		152560983	1	no_errors	NM_053002	genbank	human	validated	54_36p	missense	SNP	1	T
PPBP	5473	genome.wustl.edu	37	4	74853703	74853703	+	Missense_Mutation	SNP	G	G	T	rs201450284		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr4:74853703G>T	ENST00000296028.3	-	1	211	c.118C>A	c.(118-120)Caa>Aaa	p.Q40K		NM_002704.3	NP_002695.1	P02775	CXCL7_HUMAN	pro-platelet basic protein (chemokine (C-X-C motif) ligand 7)	40					blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|defense response to bacterium (GO:0042742)|glucose transport (GO:0015758)|immune response (GO:0006955)|leukocyte migration involved in inflammatory response (GO:0002523)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell division (GO:0051781)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	glucose transmembrane transporter activity (GO:0005355)	p.Q40K(1)		breast(1)|central_nervous_system(1)|lung(1)|ovary(2)|skin(2)|stomach(1)|urinary_tract(2)	10	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)			CTCTTAGTTTGTCCTTTGGTG	0.522																																																1	Substitution - Missense(1)	ovary(1)	4											138.0	127.0	131.0					4																	74853703		2203	4300	6503	75072567	SO:0001583	missense	5473			M54995	CCDS3563.1	4q12-q13	2013-02-25	2002-08-22		ENSG00000163736	ENSG00000163736		"""Endogenous ligands"""	9240	protein-coding gene	gene with protein product	"""platelet basic protein"", ""beta-thromboglobulin"", ""connective tissue-activating peptide III"", ""neutrophil-activating peptide-2"""	121010		THBGB1		1826003	Standard	NM_002704		Approved	SCYB7, TGB, NAP-2-L1, LA-PF4, MDGF, LDGF, Beta-TG, CTAP3, CXCL7, PBP, b-TG1, TGB1, CTAPIII, NAP-2	uc003hhj.3	P02775	OTTHUMG00000130008	ENST00000296028.3:c.118C>A	4.37:g.74853703G>T	ENSP00000296028:p.Gln40Lys		75072567	B2R5F3|Q6IBJ8	Missense_Mutation	SNP	HMMPfam_IL8;superfamily_Interleukin 8-like chemokines	p.Q40K	ENST00000296028.3	37	c.118	CCDS3563.1	4	.	.	.	.	.	.	.	.	.	.	G	5.009	0.187309	0.09547	.	.	ENSG00000163736	ENST00000296028	T	0.39997	1.05	2.56	-3.17	0.05202	Chemokine interleukin-8-like domain (1);	.	.	.	.	T	0.16769	0.0403	N	0.19112	0.55	0.09310	N	1	B	0.30914	0.3	B	0.23275	0.045	T	0.27502	-1.0072	9	0.05833	T	0.94	.	4.5632	0.12170	0.0:0.2964:0.4118:0.2917	.	40	P02775	CXCL7_HUMAN	K	40	ENSP00000296028:Q40K	ENSP00000296028:Q40K	Q	-	1	0	PPBP	75072567	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-2.013000	0.01450	-0.787000	0.04510	-0.494000	0.04653	CAA	-	NULL		0.522	PPBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPBP	protein_coding	OTTHUMT00000252281.2	G	NM_002704		75072567	-1	no_errors	NM_002704	genbank	human	reviewed	54_36p	missense	SNP	0.01	T
GRID2	2895	genome.wustl.edu	37	4	94006418	94006418	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr4:94006418G>T	ENST00000282020.4	+	3	775	c.517G>T	c.(517-519)Gat>Tat	p.D173Y	GRID2_ENST00000510992.1_Intron|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	173					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.D173Y(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TATATTCTATGATAGTGAATA	0.353																																																2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|ovary(1)	4											89.0	92.0	91.0					4																	94006418		2203	4300	6503	94225441	SO:0001583	missense	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.517G>T	4.37:g.94006418G>T	ENSP00000282020:p.Asp173Tyr		94225441	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	HMMPfam_Lig_chan;HMMPfam_ANF_receptor;superfamily_Periplasmic binding protein-like I;superfamily_Periplasmic binding protein-like II	p.D173Y	ENST00000282020.4	37	c.517	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288196	0.80803	.	.	ENSG00000152208	ENST00000282020	D	0.90069	-2.61	5.23	5.23	0.72850	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.92877	0.7734	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.983	D	0.93443	0.6795	10	0.87932	D	0	.	19.1731	0.93588	0.0:0.0:1.0:0.0	.	173;114	O43424;B4DYB9	GRID2_HUMAN;.	Y	173	ENSP00000282020:D173Y	ENSP00000282020:D173Y	D	+	1	0	GRID2	94225441	1.000000	0.71417	0.953000	0.39169	0.909000	0.53808	9.804000	0.99143	2.613000	0.88420	0.655000	0.94253	GAT	-	HMMPfam_ANF_receptor		0.353	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	protein_coding	OTTHUMT00000253588.2	G			94225441	1	no_errors	NM_001510	genbank	human	validated	54_36p	missense	SNP	1	T
LPCAT1	79888	genome.wustl.edu	37	5	1479751	1479751	+	Silent	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr5:1479751G>A	ENST00000283415.3	-	8	933	c.801C>T	c.(799-801)aaC>aaT	p.N267N		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	267					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)	p.N267N(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		TTTCCACTTGGTTGTGAAACT	0.448											OREG0016481	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	5											176.0	130.0	146.0					5																	1479751		2203	4300	6503	1532751	SO:0001819	synonymous_variant	79888			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.801C>T	5.37:g.1479751G>A		596	1532751	Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Silent	SNP	-	p.N267	ENST00000283415.3	37	c.801	CCDS3864.1	5																																																																																			-	NULL		0.448	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	protein_coding	OTTHUMT00000304032.1	G	NM_024830		1532751	-1	no_errors	NM_024830	genbank	human	validated	54_36p	silent	SNP	0.7	A
PCDH1	5097	genome.wustl.edu	37	5	141244788	141244788	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr5:141244788G>A	ENST00000394536.3	-	3	1247	c.1108C>T	c.(1108-1110)Cgt>Tgt	p.R370C	PCDH1_ENST00000287008.3_Missense_Mutation_p.R370C|PCDH1_ENST00000503492.1_Intron|PCDH1_ENST00000536585.1_Missense_Mutation_p.R348C|PCDH1_ENST00000456271.1_Missense_Mutation_p.R358C|PCDH1_ENST00000511044.1_5'UTR	NM_001278613.1|NM_001278615.1	NP_001265542.1|NP_001265544.1	Q08174	PCDH1_HUMAN	protocadherin 1	370	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R370C(2)		breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(20)|ovary(5)|skin(3)|upper_aerodigestive_tract(1)	51		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		ACCTGGGCACGGGCACTCTTG	0.572																																					Ovarian(132;1609 1739 4190 14731 45037)											2	Substitution - Missense(2)	ovary(1)|lung(1)	5											130.0	121.0	124.0					5																	141244788		2203	4300	6503	141224972	SO:0001583	missense	5097			AK075233	CCDS4267.1, CCDS43375.1	5q31.3	2010-01-26	2007-02-12		ENSG00000156453	ENSG00000156453		"""Cadherins / Protocadherins : Non-clustered"""	8655	protein-coding gene	gene with protein product		603626	"""protocadherin 1 (cadherin-like 1)"""			8508762	Standard	NM_032420		Approved	pc42	uc003llp.3	Q08174	OTTHUMG00000129661	ENST00000394536.3:c.1108C>T	5.37:g.141244788G>A	ENSP00000378043:p.Arg370Cys		141224972	Q8IUP2	Missense_Mutation	SNP	-	p.R370C	ENST00000394536.3	37	c.1108	CCDS43375.1	5	.	.	.	.	.	.	.	.	.	.	g	23.6	4.438930	0.83885	.	.	ENSG00000156453	ENST00000287008;ENST00000394536;ENST00000456271;ENST00000357517;ENST00000536585	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.35	5.35	0.76521	Cadherin (4);Cadherin-like (1);	0.000000	0.49916	D	0.000129	T	0.67192	0.2867	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.969	T	0.69117	-0.5230	10	0.87932	D	0	.	16.645	0.85174	0.0:0.0:1.0:0.0	.	370;370	Q08174;Q08174-2	PCDH1_HUMAN;.	C	370;370;358;381;348	ENSP00000287008:R370C;ENSP00000378043:R370C;ENSP00000403497:R358C;ENSP00000350122:R381C;ENSP00000438825:R348C	ENSP00000287008:R370C	R	-	1	0	PCDH1	141224972	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.832000	0.55783	2.804000	0.96469	0.645000	0.84053	CGT	-	NULL		0.572	PCDH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH1	protein_coding	OTTHUMT00000251862.1	G	NM_032420		141224972	-1	no_errors	NM_032420	genbank	human	reviewed	54_36p	missense	SNP	1	A
HMGCR	3156	genome.wustl.edu	37	5	74646662	74646662	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr5:74646662C>G	ENST00000287936.4	+	9	985	c.829C>G	c.(829-831)Cct>Gct	p.P277A	HMGCR_ENST00000343975.5_Missense_Mutation_p.P277A|HMGCR_ENST00000511206.1_Missense_Mutation_p.P277A	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	277					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)	p.P277A(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	GATAGCTGATCCTTCTCCTCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	5											131.0	131.0	131.0					5																	74646662		2203	4300	6503	74682418	SO:0001583	missense	3156				CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.829C>G	5.37:g.74646662C>G	ENSP00000287936:p.Pro277Ala		74682418	B7Z3Y9|Q8N190	Missense_Mutation	SNP	HMMPfam_HMG-CoA_red;superfamily_NAD-binding domain of HMG-CoA reductase;superfamily_Substrate-binding domain of HMG-CoA reductase;superfamily_Multidrug efflux transporter AcrB transmembrane domain	p.P277A	ENST00000287936.4	37	c.829	CCDS4027.1	5	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356337	0.41700	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	T;T;T	0.42131	1.01;1.01;0.98	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.45518	0.1346	M	0.67953	2.075	0.58432	D	0.99999	B;B;B;B	0.09022	0.001;0.002;0.002;0.001	B;B;B;B	0.11329	0.002;0.003;0.006;0.003	T	0.36480	-0.9746	10	0.18276	T	0.48	-23.686	20.3248	0.98698	0.0:1.0:0.0:0.0	.	277;277;277;277	B2R649;A8KA27;P04035-2;P04035	.;.;.;HMDH_HUMAN	A	277;208;277;277	ENSP00000426745:P277A;ENSP00000287936:P277A;ENSP00000340816:P277A	ENSP00000287936:P277A	P	+	1	0	HMGCR	74682418	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.220000	0.51207	2.818000	0.97014	0.655000	0.94253	CCT	-	NULL		0.383	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCR	protein_coding	OTTHUMT00000219877.2	C			74682418	1	no_errors	NM_000859	genbank	human	reviewed	54_36p	missense	SNP	1	G
HK3	3101	genome.wustl.edu	37	5	176311063	176311063	+	Missense_Mutation	SNP	G	G	A	rs142919032		TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr5:176311063G>A	ENST00000292432.5	-	14	2021	c.1930C>T	c.(1930-1932)Cgg>Tgg	p.R644W		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	644	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)	p.R644W(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGGCTTCCCGCAACAGACTC	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19836	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	5						G	TRP/ARG	0,4406		0,0,2203	150.0	147.0	148.0		1930	4.9	1.0	5	dbSNP_134	148	1,8599	1.2+/-3.3	0,1,4299	no	missense	HK3	NM_002115.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	644/924	176311063	1,13005	2203	4300	6503	176243669	SO:0001583	missense	3101				CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.1930C>T	5.37:g.176311063G>A	ENSP00000292432:p.Arg644Trp		176243669	Q8N1E7	Missense_Mutation	SNP	HMMPfam_Hexokinase_1;HMMPfam_Hexokinase_2;superfamily_Actin-like ATPase domain	p.R644W	ENST00000292432.5	37	c.1930	CCDS4407.1	5	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	14.03	2.413888	0.42817	0.0	1.16E-4	ENSG00000160883	ENST00000292432;ENST00000514058	D;D	0.98419	-4.92;-4.92	5.8	4.92	0.64577	Hexokinase, N-terminal (1);	0.000000	0.47852	D	0.000213	D	0.99058	0.9677	M	0.90369	3.11	0.41404	D	0.98769	D	0.89917	1.0	D	0.97110	1.0	D	0.99734	1.1013	10	0.87932	D	0	.	14.5823	0.68300	0.0:0.0:0.7341:0.2659	.	644	P52790	HXK3_HUMAN	W	644;25	ENSP00000292432:R644W;ENSP00000424632:R25W	ENSP00000292432:R644W	R	-	1	2	HK3	176243669	1.000000	0.71417	0.998000	0.56505	0.068000	0.16541	3.353000	0.52247	1.436000	0.47453	0.462000	0.41574	CGG	-	HMMPfam_Hexokinase_1		0.587	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK3	protein_coding	OTTHUMT00000253428.1	G			176243669	-1	no_errors	NM_002115	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
LAMA2	3908	genome.wustl.edu	37	6	129802420	129802420	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr6:129802420G>A	ENST00000421865.2	+	55	7634	c.7585G>A	c.(7585-7587)Gtt>Att	p.V2529I	RP1-69D17.3_ENST00000442449.1_RNA	NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2529	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.V2529I(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TGTTTACACAGTTAGCTTTCC	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											128.0	120.0	122.0					6																	129802420		2203	4300	6503	129844113	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7585G>A	6.37:g.129802420G>A	ENSP00000400365:p.Val2529Ile		129844113	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	HMMPfam_Laminin_B;HMMPfam_Laminin_EGF;HMMPfam_Laminin_N;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Prefoldin;HMMPfam_Laminin_I;HMMPfam_Laminin_II;HMMPfam_Laminin_G_1;HMMPfam_Laminin_G_2;superfamily_ADP-ribosylation;superfamily_EGF/Laminin	p.V2529I	ENST00000421865.2	37	c.7585	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066908	0.76301	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.79653	-1.29	5.11	5.11	0.69529	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.85682	D	0.000000	D	0.84529	0.5492	L	0.50919	1.6	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.77557	0.99;0.99	T	0.82910	-0.0223	9	.	.	.	.	18.4873	0.90834	0.0:0.0:1.0:0.0	.	2530;2529	A6NF00;P24043	.;LAMA2_HUMAN	I	2529;2528;2529;547	ENSP00000400365:V2529I	.	V	+	1	0	LAMA2	129844113	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.113000	0.71553	2.540000	0.85666	0.563000	0.77884	GTT	-	NULL		0.408	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	protein_coding	OTTHUMT00000042180.1	G			129844113	1	no_errors	NM_000426	genbank	human	reviewed	54_36p	missense	SNP	1	A
LRRC16A	55604	genome.wustl.edu	37	6	25606436	25606436	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr6:25606436C>T	ENST00000329474.6	+	35	4150	c.3782C>T	c.(3781-3783)tCc>tTc	p.S1261F		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1261					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)	p.S1216F(1)		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CTCCTGCAGTCCCCCAAACCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	6											43.0	51.0	48.0					6																	25606436		1935	4145	6080	25714415	SO:0001583	missense	55604			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3782C>T	6.37:g.25606436C>T	ENSP00000331983:p.Ser1261Phe		25714415	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	-	p.S1216F	ENST00000329474.6	37	c.3647	CCDS54973.1	6	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715083	0.68844	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.18810	2.19	5.85	5.85	0.93711	.	0.454754	0.24745	N	0.035960	T	0.21550	0.0519	M	0.63428	1.95	0.80722	D	1	P;P;P	0.43662	0.712;0.814;0.776	B;B;B	0.42798	0.309;0.309;0.398	T	0.01639	-1.1306	10	0.56958	D	0.05	-3.0065	20.1649	0.98147	0.0:1.0:0.0:0.0	.	1261;1255;1216	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	F	1261;1216	ENSP00000331983:S1261F	ENSP00000331983:S1261F	S	+	2	0	LRRC16A	25714415	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.935000	0.63498	2.753000	0.94483	0.655000	0.94253	TCC	-	NULL		0.577	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	protein_coding	OTTHUMT00000040045.2	C	NM_017640		25714415	1	no_errors	NM_017640	genbank	human	validated	54_36p	missense	SNP	0.998	T
TOB2P1	222699	genome.wustl.edu	37	6	28186450	28186450	+	IGR	SNP	G	G	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr6:28186450G>T								ZNF192P1 (49078 upstream) : ZSCAN9 (6591 downstream)																							CAGGGGACGTGCACAGCCTTG	0.602																																																0			6																																								28294429	SO:0001628	intergenic_variant	387049																															6.37:g.28186450G>T			28294429		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.602					LOC222699			G			28294429	-1	pseudogene	NR_002936	genbank	human	validated	54_36p	rna	SNP	0.154	T
L3MBTL3	84456	genome.wustl.edu	37	6	130376384	130376384	+	Silent	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr6:130376384G>A	ENST00000529410.1	+	10	1130	c.651G>A	c.(649-651)tcG>tcA	p.S217S	L3MBTL3_ENST00000361794.2_Silent_p.S217S|L3MBTL3_ENST00000533560.1_Silent_p.S192S|L3MBTL3_ENST00000368136.2_Silent_p.S217S|L3MBTL3_ENST00000526019.1_Silent_p.S192S|L3MBTL3_ENST00000368139.2_Silent_p.S192S			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	217					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.S217S(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GAGGGGATTCGGCTGTACTAA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	6											108.0	114.0	112.0					6																	130376384		2203	4300	6503	130418077	SO:0001819	synonymous_variant	84456			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.651G>A	6.37:g.130376384G>A			130418077	Q4VXE1|Q5VUM9|Q6P9B5	Silent	SNP	-	p.S217	ENST00000529410.1	37	c.651	CCDS34537.1	6																																																																																			-	NULL		0.393	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	protein_coding	OTTHUMT00000042195.2	G	XM_027074		130418077	1	no_errors	NM_032438	genbank	human	validated	54_36p	silent	SNP		A
BBS9	27241	genome.wustl.edu	37	7	33397562	33397562	+	Missense_Mutation	SNP	A	A	G	rs150399299	byFrequency	TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr7:33397562A>G	ENST00000242067.6	+	16	2169	c.1648A>G	c.(1648-1650)Att>Gtt	p.I550V	BBS9_ENST00000355070.2_Missense_Mutation_p.I545V|BBS9_ENST00000354265.4_Missense_Mutation_p.I515V|BBS9_ENST00000350941.3_Missense_Mutation_p.I510V|BBS9_ENST00000396127.2_Missense_Mutation_p.I515V	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	550					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.I550V(1)	BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			CAAAATTACTATTGATACCAA	0.378									Bardet-Biedl syndrome				A|||	6	0.00119808	0.0045	0.0	5008	,	,		15632	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	7						A	VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE	23,4383	30.8+/-60.4	0,23,2180	102.0	103.0	103.0		1543,1633,1528,1648	5.8	1.0	7	dbSNP_134	103	0,8598		0,0,4299	yes	missense,missense,missense,missense	BBS9	NM_001033604.1,NM_001033605.1,NM_014451.3,NM_198428.2	29,29,29,29	0,23,6479	GG,GA,AA		0.0,0.522,0.1769	benign,benign,benign,benign	515/853,545/883,510/848,550/888	33397562	23,12981	2203	4299	6502	33364087	SO:0001583	missense	27241	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1648A>G	7.37:g.33397562A>G	ENSP00000242067:p.Ile550Val		33364087	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	-	p.I550V	ENST00000242067.6	37	c.1648	CCDS43566.1	7	4|4	0.0018315018315018315|0.0018315018315018315	4|4	0.008130081300813009|0.008130081300813009	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	A|A	13.60|13.60	2.286746|2.286746	0.40494|0.40494	0.00522|0.00522	0.0|0.0	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132|ENST00000434373	T;T;T;T;T|.	0.13089|.	2.62;2.62;2.62;2.62;2.62|.	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.117376|.	0.64402|.	D|.	0.000010|.	T|T	0.54029|0.54029	0.1833|0.1833	L|L	0.45228|0.45228	1.405|1.405	0.80722|0.80722	D|D	1|1	B;B;B;B;B|.	0.27656|.	0.184;0.184;0.184;0.184;0.086|.	B;B;B;B;B|.	0.31101|.	0.124;0.124;0.124;0.124;0.101|.	T|T	0.55823|0.55823	-0.8080|-0.8080	10|5	0.38643|.	T|.	0.18|.	-25.3837|-25.3837	15.8978|15.8978	0.79346|0.79346	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	550;510;545;515;550|.	Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;.;PTHB1_HUMAN|.	V|C	550;510;515;545;515;550|116	ENSP00000242067:I550V;ENSP00000313122:I510V;ENSP00000379433:I515V;ENSP00000347182:I545V;ENSP00000346214:I515V|.	ENSP00000242067:I550V|.	I|Y	+|+	1|2	0|0	BBS9|BBS9	33364087|33364087	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	5.041000|5.041000	0.64196|0.64196	2.240000|2.240000	0.73641|0.73641	0.523000|0.523000	0.50628|0.50628	ATT|TAT	-	NULL		0.378	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	protein_coding	OTTHUMT00000329064.1	A			33364087	1	no_errors	NM_198428	genbank	human	reviewed	54_36p	missense	SNP	1	G
ANLN	54443	genome.wustl.edu	37	7	36466558	36466558	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr7:36466558G>A	ENST00000265748.2	+	20	3025	c.2804G>A	c.(2803-2805)cGa>cAa	p.R935Q	ANLN_ENST00000396068.2_Missense_Mutation_p.R898Q	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	935	Localization to the cleavage furrow.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)	p.R935Q(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						AGTGCTGTGCGAACCAGCAAC	0.383																																																1	Substitution - Missense(1)	ovary(1)	7											99.0	96.0	97.0					7																	36466558		2203	4300	6503	36433083	SO:0001583	missense	54443			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.2804G>A	7.37:g.36466558G>A	ENSP00000265748:p.Arg935Gln		36433083	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	HMMPfam_PH;superfamily_PH domain-like	p.R935Q	ENST00000265748.2	37	c.2804	CCDS5447.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.4|25.4	4.631370|4.631370	0.87660|0.87660	.|.	.|.	ENSG00000011426|ENSG00000011426	ENST00000457743|ENST00000265748;ENST00000396068	.|T;T	.|0.48522	.|0.81;0.81	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71643|0.71643	0.3364|0.3364	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;1.0;1.0;1.0	T|T	0.73833|0.73833	-0.3858|-0.3858	5|10	.|0.87932	.|D	.|0	-10.8706|-10.8706	19.0792|19.0792	0.93175|0.93175	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|812;897;898;935	.|B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.|.;.;.;ANLN_HUMAN	K|Q	139|935;898	.|ENSP00000265748:R935Q;ENSP00000379380:R898Q	.|ENSP00000265748:R935Q	E|R	+|+	1|2	0|0	ANLN|ANLN	36433083|36433083	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.233000|0.233000	0.25261|0.25261	7.831000|7.831000	0.86748|0.86748	2.755000|2.755000	0.94549|0.94549	0.591000|0.591000	0.81541|0.81541	GAA|CGA	-	NULL		0.383	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	protein_coding	OTTHUMT00000218582.3	G	NM_018685		36433083	1	no_errors	NM_018685	genbank	human	validated	54_36p	missense	SNP	1	A
DLC1	10395	genome.wustl.edu	37	8	13251203	13251203	+	Splice_Site	SNP	C	C	T			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr8:13251203C>T	ENST00000276297.4	-	4	1583		c.e4-1		DLC1_ENST00000316609.5_Splice_Site|DLC1_ENST00000511869.1_Splice_Site	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.?(2)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						ATTCCAGATCCTATTAAAAAA	0.428																																																2	Unknown(2)	ovary(2)	8											111.0	105.0	107.0					8																	13251203		2203	4300	6503	13295574	SO:0001630	splice_region_variant	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1174-1G>A	8.37:g.13251203C>T			13295574	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Splice_Site	SNP	-	e3-1	ENST00000276297.4	37	c.1174-1	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	C	20.3	3.968801	0.74131	.	.	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9175	0.86155	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DLC1	13295574	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	4.843000	0.62838	2.740000	0.93945	0.650000	0.86243	.	-	-		0.428	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	protein_coding	OTTHUMT00000207632.2	C	NM_182643, NM_006094	Intron	13295574	-1	no_errors	NM_182643	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
DBH	1621	genome.wustl.edu	37	9	136507529	136507529	+	Silent	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chr9:136507529G>A	ENST00000393056.2	+	3	699	c.687G>A	c.(685-687)acG>acA	p.T229T		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	229					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)	p.T229T(1)		central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	AGGAGACCACGTACTGGTGCT	0.597																																																1	Substitution - coding silent(1)	ovary(1)	9											57.0	54.0	55.0					9																	136507529		2203	4300	6503	135497350	SO:0001819	synonymous_variant	1621			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.687G>A	9.37:g.136507529G>A			135497350	Q5T381|Q96AG2	Silent	SNP	-	p.T229	ENST00000393056.2	37	c.687	CCDS6977.2	9																																																																																			-	NULL		0.597	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	protein_coding	OTTHUMT00000054929.2	G	NM_000787		135497350	1	no_errors	NM_000787	genbank	human	reviewed	54_36p	silent	SNP	0.978	A
NR0B1	190	genome.wustl.edu	37	X	30326341	30326341	+	Silent	SNP	G	G	A			TCGA-04-1346-01A-01W-0488-09	TCGA-04-1346-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	9f494df7-f64f-4935-ae42-eeb0b94624dc	83363a24-76e6-4784-821e-829e8eee9ab6	g.chrX:30326341G>A	ENST00000378970.4	-	1	1374	c.1140C>T	c.(1138-1140)taC>taT	p.Y380Y	NR0B1_ENST00000453287.1_Silent_p.Y380Y|NR0B1_ENST00000378963.1_Silent_p.Y85Y	NM_000475.4	NP_000466.2	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	380	Ligand-binding. {ECO:0000250}.		Y -> D (in XL-AHC). {ECO:0000269|PubMed:11788621}.		adrenal gland development (GO:0030325)|gene expression (GO:0010467)|gonad development (GO:0008406)|hypothalamus development (GO:0021854)|intracellular receptor signaling pathway (GO:0030522)|Leydig cell differentiation (GO:0033327)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of cell differentiation (GO:0045596)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pituitary gland development (GO:0021983)|protein localization (GO:0008104)|response to immobilization stress (GO:0035902)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|steroid biosynthetic process (GO:0006694)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	AF-2 domain binding (GO:0050682)|DNA binding (GO:0003677)|DNA hairpin binding (GO:0032448)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|steroid hormone receptor binding (GO:0035258)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.Y380Y(1)		central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	24					Dexamethasone(DB01234)|Tretinoin(DB00755)	TCCCCTTGAGGTAGGCGTACT	0.582											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	X											84.0	76.0	79.0					X																	30326341		2202	4300	6502	30236262	SO:0001819	synonymous_variant	190			S74720	CCDS14223.1	Xp21.3	2014-06-28			ENSG00000169297	ENSG00000169297		"""Nuclear hormone receptors"""	7960	protein-coding gene	gene with protein product		300473	"""dosage-sensitive sex reversal"""	AHC, DSS		1301166, 10412368	Standard	NM_000475		Approved	DAX1, AHCH	uc004dcf.4	P51843	OTTHUMG00000021323	ENST00000378970.4:c.1140C>T	X.37:g.30326341G>A		816	30236262	Q96F69	Silent	SNP	HMMPfam_Hormone_recep;superfamily_Nuclear receptor ligand-binding domain	p.Y380	ENST00000378970.4	37	c.1140	CCDS14223.1	X																																																																																			-	HMMPfam_Hormone_recep		0.582	NR0B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR0B1	protein_coding	OTTHUMT00000056161.1	G	NM_000475		30236262	-1	no_errors	NM_000475	genbank	human	reviewed	54_36p	silent	SNP	1	A
