#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MFN2	9927	genome.wustl.edu	37	1	12065962	12065962	+	Missense_Mutation	SNP	C	C	T	rs545454816		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:12065962C>T	ENST00000235329.5	+	15	2012	c.1690C>T	c.(1690-1692)Cgg>Tgg	p.R564W	MFN2_ENST00000444836.1_Missense_Mutation_p.R564W	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	564					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)	p.R564W(1)		endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		GAACAGCCGTCGGGCCTTGAT	0.547													C|||	1	0.000199681	0.0	0.0	5008	,	,		20692	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	1											100.0	96.0	97.0					1																	12065962		2203	4300	6503	11988549	SO:0001583	missense	9927			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.1690C>T	1.37:g.12065962C>T	ENSP00000235329:p.Arg564Trp		11988549	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	-	p.R564W	ENST00000235329.5	37	c.1690	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.967477	0.92855	.	.	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	T;T	0.69926	-0.44;-0.44	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.80465	0.4628	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.79042	-0.1965	10	0.37606	T	0.19	-31.8458	17.3618	0.87353	0.0:1.0:0.0:0.0	.	564	O95140	MFN2_HUMAN	W	564;564;262	ENSP00000416338:R564W;ENSP00000235329:R564W	ENSP00000235329:R564W	R	+	1	2	MFN2	11988549	0.996000	0.38824	1.000000	0.80357	0.998000	0.95712	3.424000	0.52764	2.656000	0.90262	0.561000	0.74099	CGG	-	NULL		0.547	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	protein_coding	OTTHUMT00000006859.2	C	NM_014874		11988549	1	no_errors	NM_014874	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
AMPD1	270	genome.wustl.edu	37	1	115218313	115218313	+	Splice_Site	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:115218313A>G	ENST00000520113.2	-	12	1631	c.1616T>C	c.(1615-1617)aTc>aCc	p.I539T	AMPD1_ENST00000369538.3_Splice_Site_p.I535T|AMPD1_ENST00000353928.6_Splice_Site_p.I506T			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	539					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)	p.I506T(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	AAAGCCAGTGATCTGTTAGGA	0.488																																																1	Substitution - Missense(1)	ovary(1)	1											125.0	119.0	121.0					1																	115218313		2203	4300	6503	115019836	SO:0001630	splice_region_variant	270			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1615-1T>C	1.37:g.115218313A>G			115019836	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	HMMPfam_A_deaminase;superfamily_Metallo-dependent hydrolases	p.I506T	ENST00000520113.2	37	c.1517	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.396414	0.83011	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.82344	-1.6;-1.6;-1.6	5.68	5.68	0.88126	Adenosine/AMP deaminase (1);	0.046888	0.85682	D	0.000000	D	0.86197	0.5875	M	0.79926	2.475	0.80722	D	1	P;P	0.48834	0.916;0.866	P;P	0.52066	0.622;0.689	D	0.88643	0.3177	10	0.87932	D	0	-22.7041	15.938	0.79729	1.0:0.0:0.0:0.0	.	535;506	Q5TF02;P23109	.;AMPD1_HUMAN	T	539;535;506	ENSP00000430075:I539T;ENSP00000358551:I535T;ENSP00000316520:I506T	ENSP00000316520:I506T	I	-	2	0	AMPD1	115019836	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.339000	0.96797	2.167000	0.68274	0.459000	0.35465	ATC	-	HMMPfam_A_deaminase		0.488	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	protein_coding	OTTHUMT00000032860.4	A		Missense_Mutation	115019836	-1	no_errors	NM_000036	genbank	human	reviewed	54_36p	missense	SNP	1	G
DCST2	127579	genome.wustl.edu	37	1	155002568	155002568	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:155002568A>C	ENST00000368424.3	-	7	1227	c.1169T>G	c.(1168-1170)aTc>aGc	p.I390S	DCST2_ENST00000295536.5_Missense_Mutation_p.I390S	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	390						integral component of membrane (GO:0016021)		p.I390S(1)		breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACCCGGTGGGATGTAGCGCCT	0.682																																																1	Substitution - Missense(1)	ovary(1)	1											60.0	61.0	61.0					1																	155002568		2203	4300	6503	153269192	SO:0001583	missense	127579			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.1169T>G	1.37:g.155002568A>C	ENSP00000357409:p.Ile390Ser		153269192	Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	-	p.I390S	ENST00000368424.3	37	c.1169	CCDS1082.2	1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.862223	0.51482	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.37235	1.21;1.21	4.68	4.68	0.58851	Dendritic cell-specific transmembrane protein-like (1);	0.154448	0.41712	D	0.000824	T	0.47116	0.1428	M	0.76328	2.33	0.37658	D	0.922655	D	0.62365	0.991	D	0.64877	0.93	T	0.54886	-0.8226	10	0.66056	D	0.02	-32.1833	11.751	0.51849	1.0:0.0:0.0:0.0	.	390	Q5T1A1	DCST2_HUMAN	S	390	ENSP00000357409:I390S;ENSP00000295536:I390S	ENSP00000295536:I390S	I	-	2	0	DCST2	153269192	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	5.171000	0.64996	1.964000	0.57103	0.533000	0.62120	ATC	-	NULL		0.682	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST2	protein_coding	OTTHUMT00000090953.3	A	NM_144622		153269192	-1	no_errors	NM_144622	genbank	human	validated	54_36p	missense	SNP	1	C
ARHGEF11	9826	genome.wustl.edu	37	1	156926338	156926338	+	Silent	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:156926338G>A	ENST00000361409.2	-	18	2167	c.1425C>T	c.(1423-1425)gcC>gcT	p.A475A	ARHGEF11_ENST00000368194.3_Silent_p.A515A	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	475	RGSL. {ECO:0000255|PROSITE- ProRule:PRU00171}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A515A(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGGTATTGAGGGCGAAGTCCA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	1											156.0	132.0	141.0					1																	156926338		2203	4300	6503	155192962	SO:0001819	synonymous_variant	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.1425C>T	1.37:g.156926338G>A			155192962	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	-	p.A515	ENST00000361409.2	37	c.1545	CCDS1162.1	1																																																																																			-	NULL		0.532	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	G	NM_198236		155192962	-1	no_errors	NM_198236	genbank	human	reviewed	54_36p	silent	SNP	1	A
FCRL1	115350	genome.wustl.edu	37	1	157771886	157771886	+	Silent	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:157771886A>G	ENST00000368176.3	-	5	772	c.705T>C	c.(703-705)tcT>tcC	p.S235S	FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000491942.1_Silent_p.S235S|FCRL1_ENST00000358292.3_Silent_p.S235S	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	235	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S235S(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGATCGGAGGAGAGCCTCTCA	0.612																																					GBM(54;482 1003 11223 30131 35730)											1	Substitution - coding silent(1)	ovary(1)	1											42.0	43.0	43.0					1																	157771886		2203	4300	6503	156038510	SO:0001819	synonymous_variant	115350			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.705T>C	1.37:g.157771886A>G			156038510	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Silent	SNP	-	p.S235	ENST00000368176.3	37	c.705	CCDS1170.1	1																																																																																			-	NULL		0.612	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	protein_coding	OTTHUMT00000051401.1	A	NM_052938		156038510	-1	no_errors	NM_052938	genbank	human	provisional	54_36p	silent	SNP	0.52	G
OR10X1	128367	genome.wustl.edu	37	1	158549529	158549529	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:158549529G>T	ENST00000368150.1	-	1	160	c.161C>A	c.(160-162)aCc>aAc	p.T54N		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T54N(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					ACCTGCAAGGGTGAGAAGGTA	0.453																																																1	Substitution - Missense(1)	ovary(1)	1											125.0	123.0	124.0					1																	158549529		2203	4300	6503	156816153	SO:0001583	missense	128367			BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.161C>A	1.37:g.158549529G>T	ENSP00000357132:p.Thr54Asn		156816153	Q6IFR8	Missense_Mutation	SNP	-	p.T54N	ENST00000368150.1	37	c.161	CCDS30900.1	1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844778	0.71603	.	.	ENSG00000186400	ENST00000368150	T	0.01438	4.89	5.13	4.2	0.49525	.	0.000000	0.50627	D	0.000119	T	0.02649	0.0080	M	0.78456	2.415	0.29912	N	0.823496	D	0.64830	0.994	P	0.58130	0.833	T	0.06679	-1.0813	10	0.72032	D	0.01	.	9.4854	0.38926	0.1642:0.0:0.8358:0.0	.	54	Q8NGY0	O10X1_HUMAN	N	54	ENSP00000357132:T54N	ENSP00000357132:T54N	T	-	2	0	OR10X1	156816153	0.979000	0.34478	0.978000	0.43139	0.972000	0.66771	1.738000	0.38207	2.648000	0.89879	0.650000	0.86243	ACC	-	NULL		0.453	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10X1	protein_coding	OTTHUMT00000051850.2	G	NM_001004477		156816153	-1	no_errors	NM_001004477	genbank	human	provisional	54_36p	missense	SNP	0.02	T
Unknown	0	genome.wustl.edu	37	1	160865559	160865559	+	IGR	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:160865559C>A								ITLN1 (10599 upstream) : RP11-312J18.6 (35969 downstream)																							AAGAGATACACCAAAGAAGGG	0.408																																																0			1																																								159132183	SO:0001628	intergenic_variant	646347																															1.37:g.160865559C>A			159132183		RNA	SNP	-	NULL		37	NULL		1																																																																																			-	-	0	0.408					LOC646347			C			159132183	1	pseudogene	XR_017680	genbank	human	model	54_36p	rna	SNP	0.94	A
HMCN1	83872	genome.wustl.edu	37	1	186151415	186151415	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:186151415C>T	ENST00000271588.4	+	105	16639	c.16410C>T	c.(16408-16410)tgC>tgT	p.C5470C	HMCN1_ENST00000367492.2_Silent_p.C5353C	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5470	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.C5470C(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAAAGACATGCCAAGGTGAGA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	1											106.0	99.0	101.0					1																	186151415		2203	4300	6503	184418038	SO:0001819	synonymous_variant	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16410C>T	1.37:g.186151415C>T			184418038	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	-	p.C5470	ENST00000271588.4	37	c.16410	CCDS30956.1	1																																																																																			-	NULL		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	C	NM_031935		184418038	1	no_errors	NM_031935	genbank	human	reviewed	54_36p	silent	SNP	1	T
ASPM	259266	genome.wustl.edu	37	1	197070656	197070656	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:197070656C>T	ENST00000367409.4	-	18	7981	c.7725G>A	c.(7723-7725)aaG>aaA	p.K2575K	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2575					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.K2575K(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CCCACTGAAGCTTTTGGTAGA	0.323																																																1	Substitution - coding silent(1)	ovary(1)	1											55.0	50.0	52.0					1																	197070656		2202	4297	6499	195337279	SO:0001819	synonymous_variant	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.7725G>A	1.37:g.197070656C>T			195337279	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	IQ;HMMPfam_IQ;CH;HMMPfam_CH;Calponin-homology domain CH-domain;superfamily_Calponin-homology domain CH-domain;ARM repeat;superfamily_ARM repeat;P-loop containing nucleoside triphosphate hydrolases;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.K2575	ENST00000367409.4	37	c.7725	CCDS1389.1	1																																																																																			-	NULL		0.323	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	protein_coding	OTTHUMT00000088256.1	C	NM_018136		195337279	-1	no_errors	NM_018136	genbank	human	validated	54_36p	silent	SNP		T
SYTL1	84958	genome.wustl.edu	37	1	27677362	27677362	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:27677362C>A	ENST00000543823.1	+	10	1545	c.1083C>A	c.(1081-1083)aaC>aaA	p.N361K	SYTL1_ENST00000318074.5_Missense_Mutation_p.N349K|SYTL1_ENST00000490170.1_3'UTR			Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1	361	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|melanosome (GO:0042470)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)	p.N349K(1)		NS(1)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	12		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TGGGTCGCAACATCTTTCTGG	0.667																																																1	Substitution - Missense(1)	ovary(1)	1											73.0	63.0	67.0					1																	27677362		2203	4300	6503	27549949	SO:0001583	missense	84958			AK027902	CCDS298.1, CCDS53286.1	1p35.3	2008-02-05			ENSG00000142765	ENSG00000142765			15584	protein-coding gene	gene with protein product		608042				12137562	Standard	NM_032872		Approved	SLP1, JFC1, FLJ14996, exophilin-7	uc001bnw.2	Q8IYJ3	OTTHUMG00000005770	ENST00000543823.1:c.1083C>A	1.37:g.27677362C>A	ENSP00000440704:p.Asn361Lys		27549949	Q5SSC9|Q96BB6|Q96GU6|Q96S89|Q96SI0	Missense_Mutation	SNP	-	p.N349K	ENST00000543823.1	37	c.1047	CCDS53286.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.8|24.8	4.571536|4.571536	0.86542|0.86542	.|.	.|.	ENSG00000142765|ENSG00000142765	ENST00000318074;ENST00000543823;ENST00000485269|ENST00000496001	T;T|.	0.09350|.	2.99;2.99|.	4.49|4.49	4.49|4.49	0.54785|0.54785	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70263|0.70263	0.3204|0.3204	L|L	0.60012|0.60012	1.86|1.86	0.58432|0.58432	D|D	0.999994|0.999994	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.993;0.999|.	T|T	0.69606|0.69606	-0.5100|-0.5100	10|5	0.87932|.	D|.	0|.	-31.6098|-31.6098	16.1755|16.1755	0.81847|0.81847	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	361;349|.	Q8IYJ3;Q8IYJ3-2|.	SYTL1_HUMAN;.|.	K|K	349;361;114|209	ENSP00000316464:N349K;ENSP00000440704:N361K|.	ENSP00000316464:N349K|.	N|T	+|+	3|2	2|0	SYTL1|SYTL1	27549949|27549949	0.963000|0.963000	0.33076|0.33076	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	2.283000|2.283000	0.43470|0.43470	2.337000|2.337000	0.79520|0.79520	0.456000|0.456000	0.33151|0.33151	AAC|ACA	-	NULL		0.667	SYTL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL1	protein_coding		C	NM_032872		27549949	1	no_errors	NM_032872	genbank	human	provisional	54_36p	missense	SNP	1	A
EYA3	2140	genome.wustl.edu	37	1	28362081	28362081	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:28362081G>T	ENST00000373871.3	-	6	575	c.335C>A	c.(334-336)aCc>aAc	p.T112N	EYA3_ENST00000373863.3_Missense_Mutation_p.T112N|EYA3_ENST00000545175.1_Missense_Mutation_p.T59N|EYA3_ENST00000540618.1_Missense_Mutation_p.T112N|EYA3_ENST00000436342.2_5'UTR|EYA3_ENST00000471498.1_5'UTR|EYA3_ENST00000373864.1_Intron	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3	112					anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.T112I(1)|p.T112N(1)		breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		ATACGTTTGGGTTGCCTGAGG	0.433																																																2	Substitution - Missense(2)	ovary(1)|skin(1)	1											273.0	263.0	266.0					1																	28362081		2203	4300	6503	28234668	SO:0001583	missense	2140			U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.335C>A	1.37:g.28362081G>T	ENSP00000362978:p.Thr112Asn		28234668	A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Missense_Mutation	SNP	-	p.T112N	ENST00000373871.3	37	c.335	CCDS316.1	1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.576701	0.45902	.	.	ENSG00000158161	ENST00000373871;ENST00000540618;ENST00000545175;ENST00000373863	D;D;D;D	0.92149	-2.98;-2.92;-2.94;-2.82	5.59	4.66	0.58398	.	0.264886	0.44285	D	0.000472	D	0.86356	0.5913	L	0.27053	0.805	0.80722	D	1	B;P;B	0.37276	0.253;0.589;0.216	B;B;B	0.33960	0.06;0.173;0.086	D	0.85046	0.0926	10	0.37606	T	0.19	-20.4441	16.3576	0.83241	0.0:0.1323:0.8677:0.0	.	112;112;112	B4DIR7;Q8IVX7;Q99504	.;.;EYA3_HUMAN	N	112;112;59;112	ENSP00000362978:T112N;ENSP00000442558:T112N;ENSP00000442280:T59N;ENSP00000362970:T112N	ENSP00000362970:T112N	T	-	2	0	EYA3	28234668	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	3.662000	0.54510	1.324000	0.45282	0.655000	0.94253	ACC	-	NULL		0.433	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EYA3	protein_coding	OTTHUMT00000011184.1	G	NM_001990		28234668	-1	no_errors	NM_001990	genbank	human	reviewed	54_36p	missense	SNP	1	T
SESN2	83667	genome.wustl.edu	37	1	28601440	28601440	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:28601440C>T	ENST00000253063.3	+	8	1446	c.1125C>T	c.(1123-1125)taC>taT	p.Y375Y		NM_031459.4	NP_113647.1	P58004	SESN2_HUMAN	sestrin 2	375					autophagy (GO:0006914)|fatty acid beta-oxidation (GO:0006635)|glucose import (GO:0046323)|mitochondrial DNA metabolic process (GO:0032042)|protein kinase B signaling (GO:0043491)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of response to reactive oxygen species (GO:1901031)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.Y375Y(1)		cervix(1)|endometrium(3)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	27		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;4.76e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;2.98e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|READ - Rectum adenocarcinoma(331;0.0649)		GCCTCACCTACAATACCATCG	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											116.0	94.0	101.0					1																	28601440		2203	4300	6503	28474027	SO:0001819	synonymous_variant	83667			AY123223	CCDS321.1	1p35.2	2008-02-05			ENSG00000130766	ENSG00000130766			20746	protein-coding gene	gene with protein product		607767				12607115, 12203114	Standard	NM_031459		Approved	SES2, DKFZp761M0212, HI95, SEST2	uc001bps.3	P58004	OTTHUMG00000003532	ENST00000253063.3:c.1125C>T	1.37:g.28601440C>T			28474027	Q5T7D0|Q96SI5	Silent	SNP	HMMPfam_PA26,superfamily_AhpD-like	p.Y375	ENST00000253063.3	37	c.1125	CCDS321.1	1																																																																																			-	HMMPfam_PA26		0.562	SESN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESN2	protein_coding	OTTHUMT00000009840.1	C			28474027	1	no_errors	NM_031459	genbank	human	reviewed	54_36p	silent	SNP	1	T
DNALI1	7802	genome.wustl.edu	37	1	38027251	38027251	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:38027251A>G	ENST00000296218.7	+	4	567	c.557A>G	c.(556-558)tAc>tGc	p.Y186C	DNALI1_ENST00000497858.1_3'UTR|DNALI1_ENST00000541606.1_Missense_Mutation_p.Y38C	NM_003462.3	NP_003453.2	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	164					cellular component movement (GO:0006928)|metabolic process (GO:0008152)|single fertilization (GO:0007338)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|filopodium (GO:0030175)	microtubule motor activity (GO:0003777)	p.Y186C(1)		breast(1)|kidney(1)|large_intestine(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ATCGCTGCCTACCAGACCCTG	0.592											OREG0013380	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	1											135.0	94.0	108.0					1																	38027251		2203	4300	6503	37799838	SO:0001583	missense	7802			AF006386	CCDS420.1	1p35.1	2008-07-18	2006-09-04		ENSG00000163879	ENSG00000163879		"""Axonemal dyneins"""	14353	protein-coding gene	gene with protein product	"""inner dynein arm, homolog of clamydomonas"", ""dJ423B22.5 (axonemal dynein light chain (hp28))"""	602135	"""dynein, axonemal, light intermediate polypeptide 1"""			9284741	Standard	NM_003462		Approved	P28, hp28, dJ423B22.5	uc001cbj.3	O14645	OTTHUMG00000004222	ENST00000296218.7:c.557A>G	1.37:g.38027251A>G	ENSP00000296218:p.Tyr186Cys	875	37799838	A8K387|B4DHN6|Q05BL9|Q5HYE2|Q5TGH0|Q7L0I5	Missense_Mutation	SNP	-	p.Y186C	ENST00000296218.7	37	c.557	CCDS420.1	1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522623	0.85600	.	.	ENSG00000163879	ENST00000296218;ENST00000541606	T	0.66280	-0.2	5.2	5.2	0.72013	.	0.054218	0.85682	D	0.000000	T	0.81837	0.4907	M	0.90082	3.085	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	D	0.85923	0.1447	10	0.66056	D	0.02	-6.8872	15.3682	0.74541	1.0:0.0:0.0:0.0	.	164	O14645	IDLC_HUMAN	C	186;38	ENSP00000296218:Y186C	ENSP00000296218:Y186C	Y	+	2	0	DNALI1	37799838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.251000	0.78297	2.082000	0.62665	0.533000	0.62120	TAC	-	NULL		0.592	DNALI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNALI1	protein_coding	OTTHUMT00000012159.1	A	NM_003462		37799838	1	no_errors	NM_003462	genbank	human	reviewed	54_36p	missense	SNP	1	G
BSND	7809	genome.wustl.edu	37	1	55472682	55472682	+	Silent	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:55472682G>A	ENST00000371265.4	+	3	539	c.285G>A	c.(283-285)caG>caA	p.Q95Q		NM_057176.2	NP_476517.1	Q8WZ55	BSND_HUMAN	barttin CLCNK-type chloride channel accessory beta subunit	95					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride channel activity (GO:0005254)|chloride channel regulator activity (GO:0017081)	p.Q95Q(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17						CCAGTCCCCAGCCGCCCTATG	0.582																																					Ovarian(191;1657 2078 22894 42033 48899)											1	Substitution - coding silent(1)	ovary(1)	1											26.0	28.0	27.0					1																	55472682		2201	4297	6498	55245270	SO:0001819	synonymous_variant	7809			AY034632	CCDS602.1	1p32.3	2014-06-17	2014-06-17		ENSG00000162399	ENSG00000162399			16512	protein-coding gene	gene with protein product		606412	"""deafness, autosomal recessive 73"", ""Bartter syndrome, infantile, with sensorineural deafness (Barttin)"""	DFNB73		11687798, 11734858, 19646679	Standard	NM_057176		Approved	BART	uc001cye.3	Q8WZ55	OTTHUMG00000008112	ENST00000371265.4:c.285G>A	1.37:g.55472682G>A			55245270	Q6NT28	Silent	SNP	-	p.Q95	ENST00000371265.4	37	c.285	CCDS602.1	1																																																																																			-	NULL		0.582	BSND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSND	protein_coding	OTTHUMT00000022213.4	G	NM_057176		55245270	1	no_errors	NM_057176	genbank	human	reviewed	54_36p	silent	SNP	0.97	A
FGGY	55277	genome.wustl.edu	37	1	60228249	60228249	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:60228249A>G	ENST00000303721.7	+	16	1823	c.1649A>G	c.(1648-1650)gAt>gGt	p.D550G	FGGY_ENST00000371212.1_Missense_Mutation_p.D462G|RP4-782L23.2_ENST00000443012.1_RNA|FGGY_ENST00000371210.1_Missense_Mutation_p.D251G|FGGY_ENST00000371218.4_Missense_Mutation_p.D574G	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	550					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.D438G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					ATCATGAATGATGACTGAACA	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											72.0	67.0	68.0					1																	60228249		2203	4300	6503	60000837	SO:0001583	missense	55277				CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.1649A>G	1.37:g.60228249A>G	ENSP00000305922:p.Asp550Gly		60000837	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Missense_Mutation	SNP	-	p.D438G	ENST00000303721.7	37	c.1313	CCDS611.2	1	.	.	.	.	.	.	.	.	.	.	A	8.635	0.894488	0.17613	.	.	ENSG00000172456	ENST00000371218;ENST00000303721;ENST00000371212;ENST00000371210	T;T;T;T	0.47869	2.78;2.82;1.8;0.83	5.16	-0.433	0.12287	.	0.769649	0.12381	N	0.473939	T	0.26195	0.0639	N	0.25286	0.73	0.20074	N	0.999934	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.0;0.002;0.0	T	0.16305	-1.0407	9	.	.	.	-0.8673	4.0206	0.09664	0.4325:0.1799:0.3876:0.0	.	574;462;550	Q96C11-3;B1AK94;Q96C11	.;.;FGGY_HUMAN	G	574;550;462;251	ENSP00000360262:D574G;ENSP00000305922:D550G;ENSP00000360256:D462G;ENSP00000360254:D251G	.	D	+	2	0	FGGY	60000837	0.018000	0.18449	0.130000	0.21974	0.020000	0.10135	-0.119000	0.10676	0.044000	0.15775	-0.479000	0.04858	GAT	-	NULL		0.403	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGGY	protein_coding	OTTHUMT00000023210.2	A	NM_001113411		60000837	1	no_errors	NM_018291	genbank	human	validated	54_36p	missense	SNP	0.02	G
PTGFR	5737	genome.wustl.edu	37	1	79002109	79002109	+	Nonsense_Mutation	SNP	G	G	T	rs267598731		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:79002109G>T	ENST00000370757.3	+	3	1054	c.817G>T	c.(817-819)Gga>Tga	p.G273*	PTGFR_ENST00000370758.1_Nonsense_Mutation_p.G273*|PTGFR_ENST00000370756.3_Missense_Mutation_p.L296F	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	273					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)	p.G273*(1)|p.L296F(1)		breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	GGCCAACATTGGAATAAATGG	0.343																																																2	Substitution - Missense(1)|Substitution - Nonsense(1)	ovary(2)	1											91.0	97.0	95.0					1																	79002109		2203	4300	6503	78774697	SO:0001587	stop_gained	5737			AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.817G>T	1.37:g.79002109G>T	ENSP00000359793:p.Gly273*		78774697	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Nonsense_Mutation	SNP	-	p.G273*	ENST00000370757.3	37	c.817	CCDS686.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	6.873334|6.873334	0.97901|0.97901	.|.	.|.	ENSG00000122420|ENSG00000122420	ENST00000370758;ENST00000370757|ENST00000370756	.|T	.|0.78481	.|-1.18	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.673359|.	0.15290|.	N|.	0.270216|.	.|T	.|0.75845	.|0.3905	.|.	.|.	.|.	0.30023|0.30023	N|N	0.814174|0.814174	.|P	.|0.50369	.|0.934	.|P	.|0.47864	.|0.559	.|T	.|0.75470	.|-0.3306	.|8	0.33141|0.87932	T|D	0.24|0	-7.725|-7.725	19.8452|19.8452	0.96705|0.96705	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|296	.|P43088-2	.|.	X|F	273|296	.|ENSP00000359792:L296F	ENSP00000359793:G273X|ENSP00000359792:L296F	G|L	+|+	1|3	0|2	PTGFR|PTGFR	78774697|78774697	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	5.306000|5.306000	0.65756|0.65756	2.771000|2.771000	0.95319|0.95319	0.561000|0.561000	0.74099|0.74099	GGA|TTG	-	NULL		0.343	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFR	protein_coding	OTTHUMT00000026582.1	G	NM_000959		78774697	1	no_errors	NM_000959	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
BCAR3	8412	genome.wustl.edu	37	1	94054874	94054874	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:94054874G>C	ENST00000370244.1	-	7	877	c.589C>G	c.(589-591)Cag>Gag	p.Q197E	BCAR3_ENST00000260502.6_Missense_Mutation_p.Q197E|RP5-1033H22.2_ENST00000427243.1_RNA|BCAR3_ENST00000370247.3_Missense_Mutation_p.Q106E|BCAR3_ENST00000370243.1_Missense_Mutation_p.Q197E|RP5-1033H22.2_ENST00000431770.1_RNA|RP5-1033H22.2_ENST00000417401.1_RNA	NM_001261408.1	NP_001248337.1	O75815	BCAR3_HUMAN	breast cancer anti-estrogen resistance 3	197	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				lens morphogenesis in camera-type eye (GO:0002089)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)	p.Q197E(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	25		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		TTGAAGTGCTGAGCGAGGTTC	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											51.0	52.0	52.0					1																	94054874		2203	4300	6503	93827462	SO:0001583	missense	8412			U92715	CCDS745.1, CCDS58010.1	1p22.1	2013-02-14			ENSG00000137936	ENSG00000137936		"""SH2 domain containing"""	973	protein-coding gene	gene with protein product		604704				9582273	Standard	NM_001261408		Approved	NSP2, SH2D3B	uc001dpz.4	O75815	OTTHUMG00000010301	ENST00000370244.1:c.589C>G	1.37:g.94054874G>C	ENSP00000359264:p.Gln197Glu		93827462	D3DT43|Q5TEW3|Q6UW40|Q9BR50	Missense_Mutation	SNP	-	p.Q197E	ENST00000370244.1	37	c.589	CCDS745.1	1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695257	0.68386	.	.	ENSG00000137936	ENST00000370247;ENST00000260502;ENST00000370244;ENST00000370243	D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38	4.96	4.96	0.65561	SH2 motif (4);	0.050365	0.85682	D	0.000000	D	0.83142	0.5190	L	0.41027	1.25	0.80722	D	1	P;P	0.42993	0.797;0.737	B;B	0.42462	0.388;0.338	D	0.85115	0.0965	10	0.49607	T	0.09	-0.0522	18.5655	0.91115	0.0:0.0:1.0:0.0	.	197;106	O75815;Q5TEW3	BCAR3_HUMAN;.	E	106;197;197;197	ENSP00000359267:Q106E;ENSP00000260502:Q197E;ENSP00000359264:Q197E;ENSP00000359263:Q197E	ENSP00000260502:Q197E	Q	-	1	0	BCAR3	93827462	1.000000	0.71417	0.994000	0.49952	0.806000	0.45545	9.354000	0.97083	2.468000	0.83385	0.561000	0.74099	CAG	-	NULL		0.557	BCAR3-003	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCAR3	protein_coding	OTTHUMT00000028420.1	G			93827462	-1	no_errors	NM_003567	genbank	human	reviewed	54_36p	missense	SNP	1	C
RYR2	6262	genome.wustl.edu	37	1	237863534	237863534	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	A	T	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr1:237863534T>A	ENST00000366574.2	+	65	9451	c.9134T>A	c.(9133-9135)gTg>gAg	p.V3045E	RYR2_ENST00000542537.1_Missense_Mutation_p.V3029E|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.V3043E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3045					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.V3043E(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCTAGGACAGTGATGAAGACT	0.418																																																1	Substitution - Missense(1)	ovary(1)	1											26.0	25.0	26.0					1																	237863534		1888	4104	5992	235930157	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9134T>A	1.37:g.237863534T>A	ENSP00000355533:p.Val3045Glu		235930157	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	HMMPfam_RYDR_ITPR;HMMPfam_efhand;HMMPfam_RyR;HMMPfam_MIR;HMMPfam_SPRY;HMMPfam_Ion_trans;HMMPfam_RR_TM4-6;HMMPfam_RIH_assoc;HMMPfam_Ins145_P3_rec;superfamily_EF-hand;superfamily_MIR domain (Pfam 02815)	p.V3045E	ENST00000366574.2	37	c.9134	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370127	0.82573	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000540213	T;D;T	0.97529	-0.51;-4.42;-0.59	5.19	5.19	0.71726	.	0.000000	0.52532	U	0.000078	D	0.96153	0.8746	L	0.43701	1.375	0.80722	D	1	P	0.48503	0.911	P	0.49226	0.603	D	0.96719	0.9531	10	0.87932	D	0	.	15.3474	0.74350	0.0:0.0:0.0:1.0	.	3045	Q92736	RYR2_HUMAN	E	3045;3043;3029;40	ENSP00000355533:V3045E;ENSP00000353174:V3043E;ENSP00000443798:V3029E	ENSP00000353174:V3043E	V	+	2	0	RYR2	235930157	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.997000	0.88414	2.074000	0.62210	0.460000	0.39030	GTG	-	NULL		0.418	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	T	NM_001035		235930157	1	no_errors	NM_001035	genbank	human	reviewed	54_36p	missense	SNP	1	A
CUBN	8029	genome.wustl.edu	37	10	16982056	16982056	+	Silent	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr10:16982056C>A	ENST00000377833.4	-	37	5588	c.5523G>T	c.(5521-5523)acG>acT	p.T1841T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1841	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.T1841T(2)		breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCTGGAAGCCCGTGCCGCTGC	0.403																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	10											140.0	154.0	149.0					10																	16982056		2203	4300	6503	17022062	SO:0001819	synonymous_variant	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5523G>T	10.37:g.16982056C>A			17022062	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_EGF;HMMPfam_EGF_CA;superfamily_EGF/Laminin	p.T1841	ENST00000377833.4	37	c.5523	CCDS7113.1	10																																																																																			-	HMMPfam_CUB		0.403	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	protein_coding	OTTHUMT00000047009.1	C	NM_001081		17022062	-1	no_errors	NM_001081	genbank	human	reviewed	54_36p	silent	SNP		A
CYP2C18	1562	genome.wustl.edu	37	10	96447594	96447594	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr10:96447594G>T	ENST00000285979.6	+	2	435	c.236G>T	c.(235-237)gGa>gTa	p.G79V	CYP2C18_ENST00000339022.5_Missense_Mutation_p.G79V	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	79					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.G79V(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GTGTTGCATGGATATGAAGCA	0.423																																																1	Substitution - Missense(1)	ovary(1)	10											266.0	254.0	258.0					10																	96447594		2203	4300	6503	96437584	SO:0001583	missense	1562			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.236G>T	10.37:g.96447594G>T	ENSP00000285979:p.Gly79Val		96437584	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.G79V	ENST00000285979.6	37	c.236	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	g	21.1	4.101807	0.76983	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	T;T	0.14144	2.53;2.53	4.63	4.63	0.57726	.	0.000000	0.85682	U	0.000000	T	0.52885	0.1762	H	0.97415	4	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.71682	-0.4519	10	0.87932	D	0	.	14.9723	0.71243	0.0:0.0:1.0:0.0	.	79;79	Q4VAT5;P33260	.;CP2CI_HUMAN	V	79	ENSP00000341293:G79V;ENSP00000285979:G79V	ENSP00000285979:G79V	G	+	2	0	CYP2C18	96437584	1.000000	0.71417	0.645000	0.29479	0.984000	0.73092	6.874000	0.75546	2.105000	0.64084	0.306000	0.20318	GGA	-	HMMPfam_p450		0.423	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	protein_coding	OTTHUMT00000049486.1	G	NM_000772		96437584	1	no_errors	NM_000772	genbank	human	reviewed	54_36p	missense	SNP	0.87	T
BLOC1S2	282991	genome.wustl.edu	37	10	102045938	102045938	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr10:102045938T>C	ENST00000370372.2	-	2	140	c.88A>G	c.(88-90)Aag>Gag	p.K30E	BLOC1S2_ENST00000361832.2_5'UTR|BLOC1S2_ENST00000441611.1_5'UTR	NM_173809.4	NP_776170.2	Q6QNY1	BL1S2_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 2	30					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|melanosome organization (GO:0032438)|microtubule nucleation (GO:0007020)|mitochondrial outer membrane permeabilization (GO:0097345)|neuron projection development (GO:0031175)|platelet dense granule organization (GO:0060155)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	BLOC-1 complex (GO:0031083)|centrosome (GO:0005813)|gamma-tubulin complex (GO:0000930)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	gamma-tubulin binding (GO:0043015)|protein C-terminus binding (GO:0008022)	p.K30E(1)		large_intestine(1)|lung(2)|ovary(1)	4		Colorectal(252;0.117)		Epithelial(162;2.44e-10)|all cancers(201;1.97e-08)		GCAGGCTCCTTTGCTTCCTCA	0.587																																																1	Substitution - Missense(1)	ovary(1)	10											89.0	77.0	81.0					10																	102045938		2203	4300	6503	102035928	SO:0001583	missense	282991			AK054697	CCDS7490.1, CCDS73179.1	10q24.31	2012-08-01	2008-08-11		ENSG00000196072	ENSG00000196072		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20984	protein-coding gene	gene with protein product	"""centrosome protein oncogene"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 2"", ""BLOC-1 subunit 2"""	609768				11483580, 15102850	Standard	NM_173809		Approved	MGC10120, FLJ30135, BLOS2	uc001kqw.2	Q6QNY1	OTTHUMG00000018908	ENST00000370372.2:c.88A>G	10.37:g.102045938T>C	ENSP00000359398:p.Lys30Glu		102035928	B4DQV2|Q5W040|Q8WUI8	Missense_Mutation	SNP	-	p.K30E	ENST00000370372.2	37	c.88	CCDS7490.1	10	.	.	.	.	.	.	.	.	.	.	-	10.65	1.409497	0.25378	.	.	ENSG00000196072	ENST00000358848	.	.	.	5.58	5.58	0.84498	.	0.347203	0.33670	N	0.004666	T	0.27798	0.0684	N	0.24115	0.695	0.24361	N	0.994875	B	0.19817	0.039	B	0.19391	0.025	T	0.13764	-1.0497	9	0.26408	T	0.33	-13.7078	9.4421	0.38675	0.0:0.079:0.0:0.921	.	30	Q6QNY1	BL1S2_HUMAN	E	30	.	ENSP00000351716:K30E	K	-	1	0	BLOC1S2	102035928	1.000000	0.71417	0.981000	0.43875	0.998000	0.95712	4.585000	0.60977	2.126000	0.65437	0.449000	0.29647	AAG	-	NULL		0.587	BLOC1S2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S2	protein_coding	OTTHUMT00000049861.2	T	NM_173809		102035928	-1	no_errors	NM_173809	genbank	human	validated	54_36p	missense	SNP	0.82	C
MMP7	4316	genome.wustl.edu	37	11	102401416	102401416	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:102401416G>T	ENST00000260227.4	-	1	68	c.16C>A	c.(16-18)Ctg>Atg	p.L6M		NM_002423.3	NP_002414.1	P09237	MMP7_HUMAN	matrix metallopeptidase 7 (matrilysin, uterine)	6					antibacterial peptide secretion (GO:0002779)|collagen catabolic process (GO:0030574)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L6M(1)		large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_cancers(8;2.04e-05)|all_epithelial(12;0.00053)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0105)|all cancers(10;0.0496)|Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0147)	Marimastat(DB00786)	ACAGCACACAGCACGGTGAGT	0.542																																																1	Substitution - Missense(1)	ovary(1)	11											70.0	60.0	64.0					11																	102401416		2203	4299	6502	101906626	SO:0001583	missense	4316			Z11887	CCDS8317.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000137673	ENSG00000137673	3.4.24.23		7174	protein-coding gene	gene with protein product		178990	"""matrix metalloproteinase 7 (matrilysin, uterine)"""	MPSL1		8978768	Standard	NM_002423		Approved	PUMP-1	uc001phb.3	P09237	OTTHUMG00000048193	ENST00000260227.4:c.16C>A	11.37:g.102401416G>T	ENSP00000260227:p.Leu6Met		101906626	Q9BTK9	Missense_Mutation	SNP	"HMMPfam_Peptidase_M10,HMMPfam_PG_binding_1,superfamily_PGBD-like,superfamily_Metalloproteases (""zincins"") catalytic domain"	p.L6M	ENST00000260227.4	37	c.16	CCDS8317.1	11	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086637	0.36855	.	.	ENSG00000137673	ENST00000260227	T	0.28069	1.63	4.98	3.05	0.35203	.	1.418690	0.05052	N	0.478388	T	0.52141	0.1716	M	0.66939	2.045	0.09310	N	1	P;D;P	0.71674	0.91;0.998;0.952	B;D;P	0.62955	0.294;0.909;0.753	T	0.21965	-1.0230	10	0.72032	D	0.01	-0.2883	8.9846	0.35986	0.1872:0.0:0.8128:0.0	.	6;6;6	B4DDW4;Q53GF1;P09237	.;.;MMP7_HUMAN	M	6	ENSP00000260227:L6M	ENSP00000260227:L6M	L	-	1	2	MMP7	101906626	0.631000	0.27164	0.018000	0.16275	0.026000	0.11368	1.442000	0.35046	1.211000	0.43351	0.655000	0.94253	CTG	-	NULL		0.542	MMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP7	protein_coding	OTTHUMT00000109633.2	G			101906626	-1	no_errors	NM_002423	genbank	human	reviewed	54_36p	missense	SNP	0.004	T
MMP8	4317	genome.wustl.edu	37	11	102593395	102593395	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:102593395C>T	ENST00000236826.3	-	2	210	c.112G>A	c.(112-114)Gaa>Aaa	p.E38K		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	38					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.E38K(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	TAGAACTTTTCCAGGTAGTCC	0.423																																																1	Substitution - Missense(1)	ovary(1)	11											85.0	83.0	84.0					11																	102593395		2203	4298	6501	102098605	SO:0001583	missense	4317			J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.112G>A	11.37:g.102593395C>T	ENSP00000236826:p.Glu38Lys		102098605	Q45F99	Missense_Mutation	SNP	"HMMPfam_Hemopexin;superfamily_Hemopexin-like domain;HMMPfam_Peptidase_M10;HMMPfam_PG_binding_1;superfamily_PGBD-like;superfamily_Metalloproteases (""zincins"") catalytic domain"	p.E38K	ENST00000236826.3	37	c.112	CCDS8320.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.405|8.405	0.842750|0.842750	0.16963|0.16963	.|.	.|.	ENSG00000118113|ENSG00000118113	ENST00000236826;ENST00000544383|ENST00000438475	T|.	0.33865|.	1.39|.	5.99|5.99	4.04|4.04	0.47022|0.47022	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);|.	0.547984|.	0.17776|.	N|.	0.162437|.	T|T	0.24928|0.24928	0.0605|0.0605	N|N	0.20574|0.20574	0.59|0.59	0.09310|0.09310	N|N	1|1	B;B|.	0.14438|.	0.01;0.01|.	B;B|.	0.27076|.	0.076;0.074|.	T|T	0.19128|0.19128	-1.0315|-1.0315	10|5	0.14656|.	T|.	0.56|.	.|.	8.3349|8.3349	0.32208|0.32208	0.0:0.481:0.3898:0.1292|0.0:0.481:0.3898:0.1292	.|.	38;38|.	A8K9E4;P22894|.	.;MMP8_HUMAN|.	K|E	38;15|13	ENSP00000236826:E38K|.	ENSP00000236826:E38K|.	E|G	-|-	1|2	0|0	MMP8|MMP8	102098605|102098605	0.000000|0.000000	0.05858|0.05858	0.067000|0.067000	0.19924|0.19924	0.987000|0.987000	0.75469|0.75469	-0.870000|-0.870000	0.04228|0.04228	0.787000|0.787000	0.33731|0.33731	0.655000|0.655000	0.94253|0.94253	GAA|GGA	-	HMMPfam_PG_binding_1		0.423	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP8	protein_coding	OTTHUMT00000395223.1	C	NM_002424		102098605	-1	no_errors	NM_002424	genbank	human	reviewed	54_36p	missense	SNP	0.34	T
VPS11	55823	genome.wustl.edu	37	11	118941061	118941061	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:118941061C>G	ENST00000300793.6	+	5	629	c.587C>G	c.(586-588)gCa>gGa	p.A196G	VPS11_ENST00000527798.1_3'UTR|RP11-110I1.13_ENST00000607709.1_RNA	NM_021729.4	NP_068375.3	Q9H270	VPS11_HUMAN	vacuolar protein sorting 11 homolog (S. cerevisiae)	197					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.A196G(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	29	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.88e-05)		TTTCGCCAAGCAGGAAAGACC	0.507																																																1	Substitution - Missense(1)	ovary(1)	11											67.0	68.0	68.0					11																	118941061		1948	4137	6085	118446271	SO:0001583	missense	55823			AB027508	CCDS73404.1	11q23	2008-02-05	2006-12-19			ENSG00000160695		"""RING-type (C3HC4) zinc fingers"""	14583	protein-coding gene	gene with protein product		608549	"""vacuolar protein sorting 11 (yeast homolog)"""				Standard	NM_021729		Approved	RNF108, PEP5	uc010ryx.2	Q9H270		ENST00000300793.6:c.587C>G	11.37:g.118941061C>G	ENSP00000475301:p.Ala196Gly		118446271	Q8WY89|Q96EP8|Q9H6D9|Q9HCS6	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_WD40 repeat-like;superfamily_ARM repeat;superfamily_Protein prenylyltransferase;superfamily_RING/U-box	p.A196G	ENST00000300793.6	37	c.587		11																																																																																			-	NULL		0.507	VPS11-201	KNOWN	basic|appris_principal	protein_coding	VPS11	protein_coding		C	NM_021729		118446271	1	no_errors	ENST00000300793	ensembl	human	known	54_36p	missense	SNP	0.99	G
NAP1L4	4676	genome.wustl.edu	37	11	2981001	2981001	+	Splice_Site	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:2981001C>T	ENST00000380542.4	-	9	885	c.745G>A	c.(745-747)Ggg>Agg	p.G249R	NAP1L4_ENST00000526115.1_Splice_Site_p.G249R	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	249					nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.G249R(1)		endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		TTTTCTTACCCGTCACAGTCC	0.363																																																1	Substitution - Missense(1)	ovary(1)	11											116.0	105.0	109.0					11																	2981001		1845	4090	5935	2937577	SO:0001630	splice_region_variant	4676			AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.746+1G>A	11.37:g.2981001C>T			2937577	B2R6J4|F5HFY4	Missense_Mutation	SNP	superfamily_ARM repeat;HMMPfam_NAP	p.G249R	ENST00000380542.4	37	c.745	CCDS41599.1	11	.	.	.	.	.	.	.	.	.	.	C	23.7	4.441724	0.83993	.	.	ENSG00000205531	ENST00000399624;ENST00000380542;ENST00000526115;ENST00000532325;ENST00000448187	T;T;T	0.29142	1.58;1.58;1.58	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.63581	0.2523	M	0.92507	3.315	0.80722	D	1	D;D	0.60160	0.967;0.987	P;D	0.63113	0.855;0.911	T	0.74179	-0.3749	10	0.62326	D	0.03	-9.7584	17.8896	0.88867	0.0:1.0:0.0:0.0	.	249;249	F5HFY4;Q99733	.;NP1L4_HUMAN	R	249;249;249;134;261	ENSP00000369915:G249R;ENSP00000436397:G249R;ENSP00000387783:G261R	ENSP00000369915:G249R	G	-	1	0	NAP1L4	2937577	1.000000	0.71417	0.998000	0.56505	0.604000	0.37047	7.162000	0.77515	2.456000	0.83038	0.557000	0.71058	GGG	-	HMMPfam_NAP		0.363	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L4	protein_coding	OTTHUMT00000030273.3	C	NM_005969	Missense_Mutation	2937577	-1	no_errors	NM_005969	genbank	human	reviewed	54_36p	missense	SNP	1	T
C11orf42	160298	genome.wustl.edu	37	11	6231819	6231819	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:6231819C>A	ENST00000316375.2	+	2	862	c.812C>A	c.(811-813)cCc>cAc	p.P271H	FAM160A2_ENST00000529360.1_5'Flank	NM_173525.2	NP_775796.2	Q8N5U0	CK042_HUMAN	chromosome 11 open reading frame 42	271	Pro-rich.							p.P271H(1)		endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|skin(1)|soft_tissue(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.95e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGGACAAACCCACCAGATTC	0.587																																																1	Substitution - Missense(1)	ovary(1)	11											34.0	38.0	37.0					11																	6231819		2200	4292	6492	6188395	SO:0001583	missense	160298			BC031612	CCDS7759.1	11p15.4	2012-08-09			ENSG00000180878	ENSG00000180878			28541	protein-coding gene	gene with protein product						12477932	Standard	NM_173525		Approved	MGC34805	uc001mcj.3	Q8N5U0	OTTHUMG00000133377	ENST00000316375.2:c.812C>A	11.37:g.6231819C>A	ENSP00000321021:p.Pro271His		6188395		Missense_Mutation	SNP	-	p.P271H	ENST00000316375.2	37	c.812	CCDS7759.1	11	.	.	.	.	.	.	.	.	.	.	C	8.511	0.866548	0.17250	.	.	ENSG00000180878	ENST00000316375	T	0.46063	0.88	5.05	3.06	0.35304	.	0.230963	0.31199	N	0.008068	T	0.31513	0.0799	N	0.19112	0.55	0.24690	N	0.993317	B	0.31351	0.32	B	0.40285	0.325	T	0.26780	-1.0093	10	0.66056	D	0.02	-1.154	7.306	0.26447	0.0:0.782:0.0:0.218	.	271	Q8N5U0	CK042_HUMAN	H	271	ENSP00000321021:P271H	ENSP00000321021:P271H	P	+	2	0	C11orf42	6188395	1.000000	0.71417	0.998000	0.56505	0.858000	0.48976	0.667000	0.25112	0.730000	0.32425	-0.224000	0.12420	CCC	-	NULL		0.587	C11orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf42	protein_coding	OTTHUMT00000257227.2	C	NM_173525		6188395	1	no_errors	NM_173525	genbank	human	predicted	54_36p	missense	SNP	0.99	A
DAGLA	747	genome.wustl.edu	37	11	61511228	61511228	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:61511228G>C	ENST00000257215.5	+	20	2512	c.2396G>C	c.(2395-2397)gGc>gCc	p.G799A	RP11-467L20.10_ENST00000536405.1_lincRNA	NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	799					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.G799A(1)		breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CGCTCCTCAGGCTTCCGCAGC	0.667																																																1	Substitution - Missense(1)	ovary(1)	11											54.0	61.0	59.0					11																	61511228		2022	4025	6047	61267804	SO:0001583	missense	747			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2396G>C	11.37:g.61511228G>C	ENSP00000257215:p.Gly799Ala		61267804	A7E233|Q6WQJ0	Missense_Mutation	SNP	HMMPfam_Lipase_3,superfamily_alpha/beta-Hydrolases	p.G799A	ENST00000257215.5	37	c.2396	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	G	8.828	0.939257	0.18281	.	.	ENSG00000134780	ENST00000257215	T	0.20738	2.05	3.11	3.11	0.35812	.	0.059396	0.64402	D	0.000003	T	0.11793	0.0287	N	0.12182	0.205	0.52099	D	0.999949	B	0.11235	0.004	B	0.12837	0.008	T	0.10177	-1.0641	10	0.13470	T	0.59	-37.9663	15.476	0.75481	0.0:0.0:1.0:0.0	.	799	Q9Y4D2	DGLA_HUMAN	A	799	ENSP00000257215:G799A	ENSP00000257215:G799A	G	+	2	0	DAGLA	61267804	1.000000	0.71417	0.994000	0.49952	0.643000	0.38383	6.619000	0.74219	2.062000	0.61559	0.491000	0.48974	GGC	-	NULL		0.667	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	protein_coding	OTTHUMT00000398516.1	G	NM_006133		61267804	1	no_errors	NM_006133	genbank	human	validated	54_36p	missense	SNP	1	C
HEPHL1	341208	genome.wustl.edu	37	11	93754554	93754554	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:93754554C>T	ENST00000315765.9	+	1	28	c.20C>T	c.(19-21)gCt>gTt	p.A7V		NM_001098672.1	NP_001092142.1	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1	7					copper ion transport (GO:0006825)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)	p.A7V(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	61		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				AAGCAGCCAGCTGGCTGCATC	0.537																																																1	Substitution - Missense(1)	ovary(1)	11											105.0	106.0	106.0					11																	93754554		1927	4124	6051	93394202	SO:0001583	missense	341208			BX641008	CCDS44710.1	11q21	2008-02-05			ENSG00000181333	ENSG00000181333			30477	protein-coding gene	gene with protein product							Standard	NM_001098672		Approved	DKFZp686F22190	uc001pep.2	Q6MZM0	OTTHUMG00000167751	ENST00000315765.9:c.20C>T	11.37:g.93754554C>T	ENSP00000313699:p.Ala7Val		93394202	Q3C1W7	Missense_Mutation	SNP	-	p.A7V	ENST00000315765.9	37	c.20	CCDS44710.1	11	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702667	0.48307	.	.	ENSG00000181333	ENST00000315765	D	0.99270	-5.66	5.87	3.95	0.45737	.	0.892845	0.09742	N	0.761788	D	0.97281	0.9111	N	0.22421	0.69	0.21861	N	0.999506	B	0.06786	0.001	B	0.04013	0.001	D	0.90941	0.4797	10	0.24483	T	0.36	.	15.8605	0.79017	0.0:0.5766:0.4234:0.0	.	7	Q6MZM0	HPHL1_HUMAN	V	7	ENSP00000313699:A7V	ENSP00000313699:A7V	A	+	2	0	HEPHL1	93394202	0.654000	0.27367	0.951000	0.38953	0.952000	0.60782	0.952000	0.29149	0.881000	0.35993	0.655000	0.94253	GCT	-	NULL		0.537	HEPHL1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HEPHL1	protein_coding	OTTHUMT00000396103.2	C	XM_291947		93394202	1	no_errors	NM_001098672	genbank	human	validated	54_36p	missense	SNP	0.51	T
SORL1	6653	genome.wustl.edu	37	11	121461798	121461798	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr11:121461798C>T	ENST00000260197.7	+	31	4431	c.4302C>T	c.(4300-4302)gaC>gaT	p.D1434D	SORL1_ENST00000525532.1_Silent_p.D378D|SORL1_ENST00000527934.1_Silent_p.D49D|SORL1_ENST00000534286.1_Silent_p.D344D|SORL1_ENST00000532694.1_Silent_p.D280D	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1434	LDL-receptor class A 9. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)	p.D1434D(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GCGTGATGGACACCTGGGTGT	0.572											OREG0021431	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	11											215.0	190.0	199.0					11																	121461798		2203	4299	6502	120967008	SO:0001819	synonymous_variant	6653			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.4302C>T	11.37:g.121461798C>T		1511	120967008	B2RNX7|Q92856	Silent	SNP	HMMPfam_Ldl_recept_b;HMMPfam_Ldl_recept_a;HMMPfam_BNR;HMMPfam_fn3;superfamily_Fibronectin type III;superfamily_Oligoxyloglucan reducing end-specific cellobiohydrolase;superfamily_EGF/Laminin;superfamily_LDL receptor-like module;superfamily_YWTD domain	p.D1434	ENST00000260197.7	37	c.4302	CCDS8436.1	11																																																																																			-	HMMPfam_Ldl_recept_a		0.572	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	protein_coding	OTTHUMT00000387626.2	C	NM_003105		120967008	1	no_errors	NM_003105	genbank	human	reviewed	54_36p	silent	SNP	1	T
DNAH10	196385	genome.wustl.edu	37	12	124272389	124272389	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:124272389C>A	ENST00000409039.3	+	10	1302	c.1277C>A	c.(1276-1278)gCc>gAc	p.A426D		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	426	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.A244D(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACCTTGGAAGCCAGGAACACC	0.597																																																1	Substitution - Missense(1)	ovary(1)	12											51.0	51.0	51.0					12																	124272389		2203	4300	6503	122838342	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1277C>A	12.37:g.124272389C>A	ENSP00000386770:p.Ala426Asp		122838342	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	-	p.A244D	ENST00000409039.3	37	c.731	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461922	0.63513	.	.	ENSG00000197653	ENST00000409039	T	0.57752	0.38	5.55	5.55	0.83447	Dynein heavy chain, domain-1 (1);	0.163324	0.38058	N	0.001821	T	0.75817	0.3901	M	0.88979	2.995	0.43841	D	0.99642	D	0.55800	0.973	P	0.61874	0.895	T	0.79825	-0.1640	10	0.59425	D	0.04	.	17.677	0.88233	0.0:1.0:0.0:0.0	.	426	Q8IVF4	DYH10_HUMAN	D	426	ENSP00000386770:A426D	ENSP00000386770:A426D	A	+	2	0	DNAH10	122838342	1.000000	0.71417	0.995000	0.50966	0.097000	0.18754	3.847000	0.55895	2.601000	0.87937	0.561000	0.74099	GCC	-	NULL		0.597	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	C			122838342	1	no_errors	NM_207437	genbank	human	validated	54_36p	missense	SNP	0.996	A
PZP	5858	genome.wustl.edu	37	12	9355269	9355269	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:9355269G>C	ENST00000261336.2	-	3	307	c.279C>G	c.(277-279)atC>atG	p.I93M	PZP_ENST00000381997.2_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	93					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.I93M(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						AAGAGGCTGAGATCCTTGGGA	0.453																																					Melanoma(125;1402 1695 4685 34487 38571)											1	Substitution - Missense(1)	ovary(1)	12											68.0	69.0	69.0					12																	9355269		2203	4300	6503	9246536	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.279C>G	12.37:g.9355269G>C	ENSP00000261336:p.Ile93Met		9246536	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	HMMPfam_A2M;HMMPfam_A2M_N;superfamily_Terpenoid cyclases/Protein prenyltransferases;superfamily_Invasin/intimin cell-adhesion fragments;HMMPfam_A2M_recep;superfamily_Alpha-macroglobulin receptor domain;HMMPfam_A2M_N_2;HMMPfam_A2M_comp	p.I93M	ENST00000261336.2	37	c.279	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	G	8.791	0.930602	0.18131	.	.	ENSG00000126838	ENST00000261336	T	0.41758	0.99	2.44	-0.622	0.11560	.	0.838929	0.09940	U	0.736100	T	0.27241	0.0668	L	0.36672	1.1	0.09310	N	1	B	0.15719	0.014	B	0.17098	0.017	T	0.24728	-1.0152	10	0.31617	T	0.26	.	3.0185	0.06067	0.2985:0.2355:0.466:0.0	.	93	P20742	PZP_HUMAN	M	93	ENSP00000261336:I93M	ENSP00000261336:I93M	I	-	3	3	PZP	9246536	0.000000	0.05858	0.001000	0.08648	0.746000	0.42486	-2.257000	0.01180	-0.137000	0.11455	0.460000	0.39030	ATC	-	HMMPfam_A2M_N		0.453	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	protein_coding	OTTHUMT00000337624.1	G	NM_002864		9246536	-1	no_errors	NM_002864	genbank	human	validated	54_36p	missense	SNP		C
PLEKHA5	54477	genome.wustl.edu	37	12	19522733	19522733	+	Splice_Site	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:19522733G>C	ENST00000299275.6	+	25	3368		c.e25+1		PLEKHA5_ENST00000359180.3_Splice_Site|PLEKHA5_ENST00000543806.1_Splice_Site|PLEKHA5_ENST00000355397.3_Splice_Site|PLEKHA5_ENST00000317589.4_Splice_Site|PLEKHA5_ENST00000538714.1_Splice_Site|PLEKHA5_ENST00000424268.1_Splice_Site|PLEKHA5_ENST00000539256.1_Splice_Site|PLEKHA5_ENST00000429027.2_Splice_Site	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5						reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)	p.?(1)		autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CTTAGAAGAAGTACGTCATTT	0.428																																					Pancreas(196;329 2193 11246 14234 19524)											1	Unknown(1)	ovary(1)	12											130.0	112.0	118.0					12																	19522733		2203	4300	6503	19414000	SO:0001630	splice_region_variant	54477			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.3348+1G>C	12.37:g.19522733G>C			19414000	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Splice_Site	SNP	-	e25+1	ENST00000299275.6	37	c.3351+1	CCDS8682.1	12																																																																																			-	-		0.428	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	protein_coding	OTTHUMT00000397013.1	G	NM_019012	Intron	19414000	1	no_errors	NM_019012	genbank	human	validated	54_36p	splice_site	SNP	1	C
SOX5	6660	genome.wustl.edu	37	12	23687162	23687162	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:23687162T>A	ENST00000451604.2	-	15	2384	c.2283A>T	c.(2281-2283)caA>caT	p.Q761H	SOX5_ENST00000396007.2_Missense_Mutation_p.Q375H|SOX5_ENST00000546136.1_Missense_Mutation_p.Q748H|SOX5_ENST00000545921.1_Missense_Mutation_p.Q751H|SOX5_ENST00000541536.1_Missense_Mutation_p.Q640H|SOX5_ENST00000309359.1_Missense_Mutation_p.Q748H|SOX5_ENST00000537393.1_Missense_Mutation_p.Q726H|SOX5_ENST00000381381.2_Missense_Mutation_p.Q640H			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	761					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.Q761H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						ATCAGTTGGCTTGTCCTGCAA	0.423																																																1	Substitution - Missense(1)	ovary(1)	12											204.0	179.0	188.0					12																	23687162		2203	4300	6503	23578429	SO:0001583	missense	6660			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.2283A>T	12.37:g.23687162T>A	ENSP00000398273:p.Gln761His		23578429	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	HMMPfam_HMG_box;superfamily_HMG-box	p.Q761H	ENST00000451604.2	37	c.2283	CCDS8699.1	12	.	.	.	.	.	.	.	.	.	.	T	15.67	2.903005	0.52227	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000537393;ENST00000541536;ENST00000396007;ENST00000545921	D;D;D;D;D;D;D;D	0.97138	-4.24;-4.24;-4.23;-4.24;-4.24;-4.23;-4.26;-4.24	5.96	5.96	0.96718	.	0.269957	0.38164	N	0.001785	D	0.95017	0.8387	N	0.22421	0.69	0.30329	N	0.786859	B;D;B	0.61080	0.289;0.989;0.264	B;P;B	0.50708	0.136;0.648;0.264	D	0.93379	0.6742	10	0.72032	D	0.01	.	12.2347	0.54508	0.0:0.0675:0.0:0.9325	.	640;761;375	P35711-4;P35711;P35711-3	.;SOX5_HUMAN;.	H	748;748;640;761;726;640;375;751	ENSP00000437487:Q748H;ENSP00000308927:Q748H;ENSP00000370788:Q640H;ENSP00000398273:Q761H;ENSP00000439832:Q726H;ENSP00000441973:Q640H;ENSP00000379328:Q375H;ENSP00000443520:Q751H	ENSP00000308927:Q748H	Q	-	3	2	SOX5	23578429	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.893000	0.56243	2.285000	0.76669	0.533000	0.62120	CAA	-	NULL		0.423	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	protein_coding	OTTHUMT00000402006.2	T	NM_006940		23578429	-1	no_errors	NM_006940	genbank	human	reviewed	54_36p	missense	SNP	1	A
SLC2A13	114134	genome.wustl.edu	37	12	40223985	40223985	+	Nonsense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:40223985G>T	ENST00000280871.4	-	7	1415	c.1365C>A	c.(1363-1365)taC>taA	p.Y455*		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	455					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)	p.Y436*(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				TGTTCATCTTGTAGCAGAAAC	0.418										HNSCC(50;0.14)																																						1	Substitution - Nonsense(1)	ovary(1)	12											119.0	113.0	115.0					12																	40223985		2203	4300	6503	38510252	SO:0001587	stop_gained	114134			AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1365C>A	12.37:g.40223985G>T	ENSP00000280871:p.Tyr455*		38510252	Q17S07	Nonsense_Mutation	SNP	HMMPfam_Sugar_tr;superfamily_MFS general substrate transporter;superfamily_Plexin repeat	p.Y436*	ENST00000280871.4	37	c.1308	CCDS8736.2	12	.	.	.	.	.	.	.	.	.	.	G	34	5.395630	0.96009	.	.	ENSG00000151229	ENST00000280871	.	.	.	5.72	2.41	0.29592	.	0.059670	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7173	9.0626	0.36444	0.3583:0.0:0.6417:0.0	.	.	.	.	X	455	.	ENSP00000280871:Y455X	Y	-	3	2	SLC2A13	38510252	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.902000	0.28459	0.744000	0.32741	0.591000	0.81541	TAC	-	HMMPfam_Sugar_tr		0.418	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A13	protein_coding	OTTHUMT00000132849.2	G			38510252	-1	no_errors	NM_052885	genbank	human	validated	54_36p	nonsense	SNP	1	T
ANP32D	23519	genome.wustl.edu	37	12	48866782	48866784	+	In_Frame_Del	DEL	TAG	TAG	-			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	TAG	TAG	TAG	-	TAG	TAG	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:48866782_48866784delTAG	ENST00000266594.1	+	1	335_337	c.335_337delTAG	c.(334-339)ttagaa>taa	p.112_113LE>*		NM_012404.2	NP_036536.2	O95626	AN32D_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member D	112						nuclear matrix (GO:0016363)		p.L112_E113>*(1)		central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	9						CTGAAAAAGTTAGAAAACCTCGA	0.409																																																1	Complex - deletion inframe(1)	ovary(1)	12																																								47153051	SO:0001651	inframe_deletion	23519			U71084	CCDS31788.1	12q13.12	2008-08-04			ENSG00000139223	ENSG00000139223		"""ANP32 acidic nuclear phosphoproteins"""	16676	protein-coding gene	gene with protein product	"""pp32 related 2"""	606878				10086381, 10400610	Standard	NM_012404		Approved	PP32R2	uc010slt.2	O95626	OTTHUMG00000162681	ENST00000266594.1:c.335_337delTAG	12.37:g.48866782_48866784delTAG	ENSP00000266594:p.Leu112_Glu113delins*		47153049	Q6NTC4	In_Frame_Del	DEL	superfamily_Outer arm dynein light chain 1	p.LENLE112in_frame_del*	ENST00000266594.1	37	c.335_337	CCDS31788.1	12																																																																																			(deletion:cds_exon[47152715,47153110])	NULL		0.409	ANP32D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32D	protein_coding	OTTHUMT00000370058.1	TAG	NM_012404		47153051	1	no_errors	NM_012404	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000	-
NEUROD4	58158	genome.wustl.edu	37	12	55421182	55421182	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:55421182G>T	ENST00000242994.3	+	2	1337	c.959G>T	c.(958-960)gGt>gTt	p.G320V		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	320					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.G320V(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						CCCCATCATGGTATTGGGACC	0.443																																																1	Substitution - Missense(1)	ovary(1)	12											369.0	368.0	368.0					12																	55421182		2203	4300	6503	53707449	SO:0001583	missense	58158			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.959G>T	12.37:g.55421182G>T	ENSP00000242994:p.Gly320Val		53707449	B2RAC9	Missense_Mutation	SNP	-	p.G320V	ENST00000242994.3	37	c.959	CCDS8886.1	12	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595309	0.28445	.	.	ENSG00000123307	ENST00000242994	D	0.95035	-3.59	5.56	5.56	0.83823	.	0.625803	0.16595	N	0.207561	D	0.89901	0.6849	N	0.19112	0.55	0.52099	D	0.999942	B	0.02656	0.0	B	0.01281	0.0	D	0.84175	0.0436	10	0.30854	T	0.27	-19.1777	17.405	0.87471	0.0:0.0:1.0:0.0	.	320	Q9HD90	NDF4_HUMAN	V	320	ENSP00000242994:G320V	ENSP00000242994:G320V	G	+	2	0	NEUROD4	53707449	0.674000	0.27549	0.861000	0.33841	0.927000	0.56198	1.927000	0.40094	2.790000	0.95986	0.655000	0.94253	GGT	-	NULL		0.443	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD4	protein_coding	OTTHUMT00000406104.1	G			53707449	1	no_errors	NM_021191	genbank	human	validated	54_36p	missense	SNP	0.05	T
RPSAP12	387867	genome.wustl.edu	37	12	68946875	68946875	+	IGR	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:68946875G>T								RP11-71J4.2 (203136 upstream) : RAP1B (57743 downstream)														p.P263H(1)									GTCTTCAGTAGGGAATTGCTG	0.542																																																1	Substitution - Missense(1)	ovary(1)	12																																								67233142	SO:0001628	intergenic_variant	387867																															12.37:g.68946875G>T			67233142		Missense_Mutation	SNP	-	p.P263H		37	c.788		12																																																																																			-	NULL	0	0.542					LOC387867			G			67233142	-1	pseudogene	XM_001726521	genbank	human	model	54_36p	missense	SNP	1	T
CRADD	8738	genome.wustl.edu	37	12	94072616	94072616	+	Silent	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:94072616G>T	ENST00000542893.2	+	2	384	c.66G>T	c.(64-66)gtG>gtT	p.V22V	CRADD_ENST00000332896.3_Silent_p.V22V|CRADD_ENST00000548483.1_Silent_p.V22V|CRADD_ENST00000552983.1_Silent_p.V22V|CRADD_ENST00000552033.1_Silent_p.V22V|CRADD_ENST00000541813.1_Silent_p.V22V			P78560	CRADD_HUMAN	CASP2 and RIPK1 domain containing adaptor with death domain	22	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|positive regulation of apoptotic signaling pathway (GO:2001235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	death domain binding (GO:0070513)|protease binding (GO:0002020)|protein binding, bridging (GO:0030674)	p.V22V(1)		endometrium(1)|large_intestine(5)|lung(1)|ovary(1)	8						AGGTATTGGTGGAGGGACTGG	0.488																																																1	Substitution - coding silent(1)	ovary(1)	12											78.0	73.0	75.0					12																	94072616		2203	4300	6503	92596747	SO:0001819	synonymous_variant	8738			U84388	CCDS9048.1	12q21.33-q23.1	2008-08-04				ENSG00000169372			2340	protein-coding gene	gene with protein product	"""RIP-associated ICH1/CED3-homologous protein with death domain"""	603454				8985253, 9044836	Standard	NM_003805		Approved	RAIDD	uc001tda.3	P78560		ENST00000542893.2:c.66G>T	12.37:g.94072616G>T			92596747	B7Z2Q5	Silent	SNP	-	p.V22	ENST00000542893.2	37	c.66	CCDS9048.1	12																																																																																			-	NULL		0.488	CRADD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CRADD	protein_coding	OTTHUMT00000408515.1	G	NM_003805		92596747	1	no_errors	NM_003805	genbank	human	reviewed	54_36p	silent	SNP	1	T
TMEM132D	121256	genome.wustl.edu	37	12	129558863	129558863	+	Nonsense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr12:129558863C>A	ENST00000422113.2	-	9	3183	c.2857G>T	c.(2857-2859)Gag>Tag	p.E953*	TMEM132D_ENST00000389441.4_Nonsense_Mutation_p.E491*	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	953					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.E953*(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCCTGCTCCTCGAAGGGAACC	0.458																																																1	Substitution - Nonsense(1)	ovary(1)	12											121.0	108.0	113.0					12																	129558863		2203	4300	6503	128124816	SO:0001587	stop_gained	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2857G>T	12.37:g.129558863C>A	ENSP00000408581:p.Glu953*		128124816	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Nonsense_Mutation	SNP	-	p.E953*	ENST00000422113.2	37	c.2857	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	C	43	9.955582	0.99304	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	.	.	.	4.14	4.14	0.48551	.	0.000000	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-30.3738	16.7565	0.85501	0.0:1.0:0.0:0.0	.	.	.	.	X	491;953	.	.	E	-	1	0	TMEM132D	128124816	0.324000	0.24652	0.009000	0.14445	0.945000	0.59286	1.066000	0.30604	2.002000	0.58637	0.411000	0.27672	GAG	-	NULL		0.458	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	protein_coding	OTTHUMT00000399592.1	C	NM_133448		128124816	-1	no_errors	NM_133448	genbank	human	validated	54_36p	nonsense	SNP	0.92	A
MTMR6	9107	genome.wustl.edu	37	13	25831942	25831942	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr13:25831942C>T	ENST00000381801.5	-	8	1662	c.901G>A	c.(901-903)Ggt>Agt	p.G301S	MTMR6_ENST00000540661.1_Missense_Mutation_p.G301S|MTMR6_ENST00000482345.1_5'Flank	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	301	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.G301S(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		CTCTCCAAACCGGAGTAGAAA	0.383																																																1	Substitution - Missense(1)	ovary(1)	13											73.0	78.0	76.0					13																	25831942		2203	4300	6503	24729942	SO:0001583	missense	9107			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.901G>A	13.37:g.25831942C>T	ENSP00000371221:p.Gly301Ser		24729942	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	HMMPfam_Myotub-related;superfamily_PH domain-like;superfamily_(Phosphotyrosine protein) phosphatases II	p.G301S	ENST00000381801.5	37	c.901	CCDS9313.1	13	.	.	.	.	.	.	.	.	.	.	C	27.1	4.803973	0.90623	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801	D;D	0.91894	-2.93;-2.93	5.49	5.49	0.81192	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.91747	0.7390	L	0.33339	1.005	0.80722	D	1	D;D	0.61080	0.989;0.982	P;P	0.53313	0.648;0.723	D	0.90740	0.4649	10	0.34782	T	0.22	.	19.3738	0.94501	0.0:1.0:0.0:0.0	.	301;301	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	S	301	ENSP00000443161:G301S;ENSP00000371221:G301S	ENSP00000371221:G301S	G	-	1	0	MTMR6	24729942	1.000000	0.71417	0.955000	0.39395	0.887000	0.51463	5.596000	0.67570	2.577000	0.86979	0.563000	0.77884	GGT	-	NULL		0.383	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR6	protein_coding	OTTHUMT00000044225.1	C	NM_004685		24729942	-1	no_errors	NM_004685	genbank	human	validated	54_36p	missense	SNP	1	T
TRIM13	10206	genome.wustl.edu	37	13	50586659	50586659	+	Nonsense_Mutation	SNP	C	C	T	rs374494187		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr13:50586659C>T	ENST00000378182.3	+	2	1321	c.583C>T	c.(583-585)Caa>Taa	p.Q195*	KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000356017.4_Nonsense_Mutation_p.Q198*|TRIM13_ENST00000457662.2_Nonsense_Mutation_p.Q195*|TRIM13_ENST00000420995.2_Nonsense_Mutation_p.Q195*|TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000312942.1_5'Flank|TRIM13_ENST00000298772.5_Nonsense_Mutation_p.Q198*	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	195					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q195*(1)		large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		CACACTGGATCAAAAGAAGAA	0.378																																																1	Substitution - Nonsense(1)	ovary(1)	13											52.0	50.0	50.0					13																	50586659		2203	4300	6503	49484660	SO:0001587	stop_gained	10206			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.583C>T	13.37:g.50586659C>T	ENSP00000367424:p.Gln195*		49484660	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Nonsense_Mutation	SNP	-	p.Q198*	ENST00000378182.3	37	c.592	CCDS9423.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.957336	0.97145	.	.	ENSG00000204977	ENST00000378183;ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	.	.	.	5.82	5.82	0.92795	.	0.169105	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.7537	20.088	0.97803	0.0:1.0:0.0:0.0	.	.	.	.	X	195;195;195;198;195;198	.	.	Q	+	1	0	TRIM13	49484660	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	5.667000	0.68067	2.739000	0.93911	0.655000	0.94253	CAA	-	NULL		0.378	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TRIM13	protein_coding	OTTHUMT00000354875.1	C	NM_001007278		49484660	1	no_errors	NM_001007278	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
NALCN	259232	genome.wustl.edu	37	13	101717867	101717867	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr13:101717867C>T	ENST00000251127.6	-	40	4574	c.4493G>A	c.(4492-4494)cGt>cAt	p.R1498H		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1498					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.R1498H(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAGCCTCCCACGCAGTAGCCG	0.572																																																1	Substitution - Missense(1)	ovary(1)	13											103.0	81.0	89.0					13																	101717867		2203	4300	6503	100515868	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4493G>A	13.37:g.101717867C>T	ENSP00000251127:p.Arg1498His		100515868	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	HMMPfam_Ion_trans;superfamily_Voltage-gated potassium channels	p.R1498H	ENST00000251127.6	37	c.4493	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	C	35	5.437212	0.96168	.	.	ENSG00000102452	ENST00000251127	D	0.97688	-4.49	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.97923	0.9317	L	0.39898	1.24	0.80722	D	1	D	0.89917	1.0	D	0.67382	0.951	D	0.98934	1.0788	10	0.66056	D	0.02	.	19.8625	0.96789	0.0:1.0:0.0:0.0	.	1498	Q8IZF0	NALCN_HUMAN	H	1498	ENSP00000251127:R1498H	ENSP00000251127:R1498H	R	-	2	0	NALCN	100515868	1.000000	0.71417	0.990000	0.47175	0.955000	0.61496	7.487000	0.81328	2.689000	0.91719	0.655000	0.94253	CGT	-	NULL		0.572	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	protein_coding	OTTHUMT00000045663.2	C	NM_052867		100515868	-1	no_errors	NM_052867	genbank	human	validated	54_36p	missense	SNP	1	T
CPNE6	9362	genome.wustl.edu	37	14	24546493	24546493	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr14:24546493C>G	ENST00000397016.2	+	16	1741	c.1430C>G	c.(1429-1431)tCt>tGt	p.S477C	CPNE6_ENST00000216775.2_Missense_Mutation_p.S477C|CPNE6_ENST00000537691.1_Missense_Mutation_p.S532C	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	477	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)	p.S477C(1)		endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GCTGACTTCTCTGACATGCGG	0.637																																																1	Substitution - Missense(1)	ovary(1)	14											111.0	96.0	101.0					14																	24546493		2203	4300	6503	23616333	SO:0001583	missense	9362			AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1430C>G	14.37:g.24546493C>G	ENSP00000380211:p.Ser477Cys		23616333	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	HMMPfam_C2;superfamily_C2 domain (Calcium/lipid-binding domain CaLB);HMMPfam_Copine;superfamily_vWA-like	p.S477C	ENST00000397016.2	37	c.1430	CCDS9607.1	14	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506743	0.85282	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.23950	1.88;1.88;1.88	5.06	5.06	0.68205	von Willebrand factor, type A (2);	0.000000	0.51477	D	0.000081	T	0.58061	0.2096	M	0.91920	3.255	0.47308	D	0.999386	D;D;D	0.76494	0.998;0.996;0.999	D;D;D	0.64687	0.927;0.91;0.928	T	0.69273	-0.5188	10	0.87932	D	0	-39.5868	15.9207	0.79570	0.0:1.0:0.0:0.0	.	532;302;477	F5GXN1;B3KWK1;O95741	.;.;CPNE6_HUMAN	C	532;477;477	ENSP00000440077:S532C;ENSP00000380211:S477C;ENSP00000216775:S477C	ENSP00000216775:S477C	S	+	2	0	CPNE6	23616333	1.000000	0.71417	0.948000	0.38648	0.846000	0.48090	3.268000	0.51585	2.347000	0.79759	0.467000	0.42956	TCT	-	NULL		0.637	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE6	protein_coding	OTTHUMT00000071869.5	C			23616333	1	no_errors	NM_006032	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
SEC23A	10484	genome.wustl.edu	37	14	39512066	39512066	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr14:39512066A>G	ENST00000307712.6	-	17	2427	c.1910T>C	c.(1909-1911)cTt>cCt	p.L637P	SEC23A_ENST00000536508.1_Missense_Mutation_p.L535P|SEC23A_ENST00000537403.1_Missense_Mutation_p.L435P|SEC23A_ENST00000545328.2_Missense_Mutation_p.L608P	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	637					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)	p.L637P(1)		kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		ACTGCTATCAAGAAGAACCGG	0.323																																																1	Substitution - Missense(1)	ovary(1)	14											95.0	100.0	98.0					14																	39512066		2203	4300	6503	38581817	SO:0001583	missense	10484			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1910T>C	14.37:g.39512066A>G	ENSP00000306881:p.Leu637Pro		38581817	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	HMMPfam_zf-Sec23_Sec24;HMMPfam_Sec23_trunk;HMMPfam_Sec23_helical;HMMPfam_Gelsolin;HMMPfam_Sec23_BS;superfamily_vWA-like;superfamily_Helical domain of Sec23/24;superfamily_beta-sandwich domain of Sec23/24;superfamily_C-terminal gelsolin-like domain of Sec23/24;superfamily_Zn-finger domain of Sec23/24	p.L637P	ENST00000307712.6	37	c.1910	CCDS9668.1	14	.	.	.	.	.	.	.	.	.	.	A	19.27	3.795264	0.70452	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	T;T;T;T	0.61040	0.14;0.14;0.14;0.14	5.55	4.41	0.53225	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.82171	0.4979	H	0.96239	3.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.86133	0.1576	10	0.87932	D	0	-11.5962	11.7074	0.51605	0.9305:0.0:0.0695:0.0	.	608;535;637	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	P	435;637;535;608	ENSP00000444193:L435P;ENSP00000306881:L637P;ENSP00000437715:L535P;ENSP00000445393:L608P	ENSP00000306881:L637P	L	-	2	0	SEC23A	38581817	1.000000	0.71417	0.988000	0.46212	0.797000	0.45037	9.268000	0.95675	1.038000	0.40049	0.533000	0.62120	CTT	-	HMMPfam_Gelsolin		0.323	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	protein_coding	OTTHUMT00000276728.2	A			38581817	-1	no_errors	NM_006364	genbank	human	reviewed	54_36p	missense	SNP	1	G
SEL1L	6400	genome.wustl.edu	37	14	81964820	81964820	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr14:81964820C>T	ENST00000336735.4	-	9	1026	c.910G>A	c.(910-912)Ggc>Agc	p.G304S		NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	304	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.G304S(1)		breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		ACGCCGATGCCAGCCCAGTAT	0.433																																																1	Substitution - Missense(1)	ovary(1)	14											101.0	92.0	95.0					14																	81964820		2203	4300	6503	81034573	SO:0001583	missense	6400				CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.910G>A	14.37:g.81964820C>T	ENSP00000337053:p.Gly304Ser		81034573	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	HMMPfam_fn2;HMMPfam_Sel1;superfamily_Kringle-like;superfamily_HCP-like	p.G304S	ENST00000336735.4	37	c.910	CCDS9876.1	14	.	.	.	.	.	.	.	.	.	.	C	35	5.512225	0.96402	.	.	ENSG00000071537	ENST00000336735	T	0.69561	-0.41	4.78	4.78	0.61160	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.87888	0.6291	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91702	0.5374	10	0.87932	D	0	-22.8627	18.3645	0.90386	0.0:1.0:0.0:0.0	.	304	Q9UBV2	SE1L1_HUMAN	S	304	ENSP00000337053:G304S	ENSP00000337053:G304S	G	-	1	0	SEL1L	81034573	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.085000	0.76875	2.644000	0.89710	0.655000	0.94253	GGC	-	HMMPfam_Sel1		0.433	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L	protein_coding	OTTHUMT00000413325.1	C	NM_005065		81034573	-1	no_errors	NM_005065	genbank	human	validated	54_36p	missense	SNP	1	T
Unknown	0	genome.wustl.edu	37	7	148334634	148334634	+	IGR	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:148334634C>T								C7orf33 (21682 upstream) : RP5-1136G13.2 (58924 downstream)																							AGGCGGCTTGCGGGAACACAT	0.473																																																0			7																																								147965567	SO:0001628	intergenic_variant	643438																															7.37:g.148334634C>T			147965567		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.473					LOC643438			C			147965567	1	no_errors	XR_015310	genbank	human	model	54_36p	rna	SNP	1	T
SPINT1	6692	genome.wustl.edu	37	15	41145746	41145746	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr15:41145746G>C	ENST00000344051.4	+	4	897	c.663G>C	c.(661-663)caG>caC	p.Q221H	SPINT1_ENST00000562057.1_Missense_Mutation_p.Q221H|SPINT1_ENST00000431806.1_Missense_Mutation_p.Q221H			O43278	SPIT1_HUMAN	serine peptidase inhibitor, Kunitz type 1	221					branching involved in labyrinthine layer morphogenesis (GO:0060670)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|placenta blood vessel development (GO:0060674)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.Q221H(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	16		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		ACCTGTTCCAGCTGACAGTGA	0.582																																																1	Substitution - Missense(1)	ovary(1)	15											74.0	59.0	64.0					15																	41145746		2203	4300	6503	38933038	SO:0001583	missense	6692				CCDS10067.1, CCDS45231.1	15q13.3	2008-02-05	2005-08-17		ENSG00000166145	ENSG00000166145			11246	protein-coding gene	gene with protein product		605123	"""serine protease inhibitor, Kunitz type 1"""				Standard	XM_006720657		Approved	HAI, MANSC2	uc001zna.3	O43278	OTTHUMG00000130068	ENST00000344051.4:c.663G>C	15.37:g.41145746G>C	ENSP00000342098:p.Gln221His		38933038	Q7Z7D2	Missense_Mutation	SNP	HMMPfam_Ldl_recept_a;HMMPfam_Kunitz_BPTI;superfamily_BPTI-like;HMMPfam_MANEC;superfamily_LDL receptor-like module	p.Q221H	ENST00000344051.4	37	c.663	CCDS10067.1	15	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434284	0.62955	.	.	ENSG00000166145	ENST00000344051;ENST00000536281;ENST00000431806	D;D	0.96716	-4.1;-4.09	5.34	4.41	0.53225	.	0.115715	0.64402	D	0.000009	D	0.98009	0.9344	M	0.85197	2.74	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.991;1.0	D;P;D	0.83275	0.996;0.844;0.993	D	0.98556	1.0639	10	0.87932	D	0	-22.2859	13.0897	0.59160	0.0793:0.0:0.9207:0.0	.	221;221;221	B2RBU9;O43278-2;O43278	.;.;SPIT1_HUMAN	H	221;188;221	ENSP00000342098:Q221H;ENSP00000409935:Q221H	ENSP00000342098:Q221H	Q	+	3	2	SPINT1	38933038	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	4.089000	0.57685	1.215000	0.43411	0.491000	0.48974	CAG	-	NULL		0.582	SPINT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPINT1	protein_coding	OTTHUMT00000252359.2	G	NM_003710		38933038	1	no_errors	NM_181642	genbank	human	reviewed	54_36p	missense	SNP	1	C
C15orf48	84419	genome.wustl.edu	37	15	45723253	45723253	+	Missense_Mutation	SNP	G	G	C	rs143173357		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr15:45723253G>C	ENST00000344300.3	+	2	281	c.91G>C	c.(91-93)Gct>Cct	p.A31P	RP11-519G16.5_ENST00000559553.1_RNA|C15orf48_ENST00000396650.2_Missense_Mutation_p.A31P|MIR147B_ENST00000390185.1_RNA	NM_032413.3	NP_115789.1	Q9C002	NMES1_HUMAN	chromosome 15 open reading frame 48	31						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.A31P(1)		large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)		CTCATCTTTCGCTGTGTATTC	0.413																																																1	Substitution - Missense(1)	ovary(1)	15											191.0	180.0	184.0					15																	45723253		2198	4298	6496	43510545	SO:0001583	missense	84419				CCDS10124.1	15q21.1	2014-05-29			ENSG00000166920	ENSG00000166920			29898	protein-coding gene	gene with protein product	"""normal mucosa of esophagus specific 1"""	608409				12209954	Standard	NM_032413		Approved	NMES1	uc001zvh.4	Q9C002	OTTHUMG00000131424	ENST00000344300.3:c.91G>C	15.37:g.45723253G>C	ENSP00000341610:p.Ala31Pro		43510545		Missense_Mutation	SNP	-	p.A31P	ENST00000344300.3	37	c.91	CCDS10124.1	15	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637111	0.67130	.	.	ENSG00000166920	ENST00000396650;ENST00000344300	T;T	0.77489	-1.1;-1.1	5.69	4.71	0.59529	.	0.360238	0.29473	N	0.012058	D	0.82384	0.5025	.	.	.	0.09310	N	1	D	0.59767	0.986	P	0.59761	0.863	T	0.74064	-0.3785	9	0.49607	T	0.09	-28.5648	10.4461	0.44495	0.0:0.0:0.7227:0.2773	.	31	Q9C002	NMES1_HUMAN	P	31	ENSP00000379887:A31P;ENSP00000341610:A31P	ENSP00000341610:A31P	A	+	1	0	C15orf48	43510545	0.101000	0.21875	0.167000	0.22817	0.090000	0.18270	1.741000	0.38238	2.702000	0.92279	0.591000	0.81541	GCT	-	NULL		0.413	C15orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf48	protein_coding	OTTHUMT00000254217.2	G	NM_032413		43510545	1	no_errors	NM_032413	genbank	human	validated	54_36p	missense	SNP	0.002	C
MYEF2	50804	genome.wustl.edu	37	15	48458162	48458162	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr15:48458162C>G	ENST00000324324.7	-	5	772	c.493G>C	c.(493-495)Gat>Cat	p.D165H	MYEF2_ENST00000267836.6_Missense_Mutation_p.D165H	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	165	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.D165N(1)|p.D165H(1)		endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		CCACTAAGATCATATTTGTTC	0.279																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	15											59.0	73.0	68.0					15																	48458162		2185	4251	6436	46245454	SO:0001583	missense	50804			AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.493G>C	15.37:g.48458162C>G	ENSP00000316950:p.Asp165His		46245454	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.D165H	ENST00000324324.7	37	c.493	CCDS32230.1	15	.	.	.	.	.	.	.	.	.	.	C	25.0	4.592347	0.86953	.	.	ENSG00000104177	ENST00000324324;ENST00000267836	T;T	0.16457	2.34;2.34	5.66	5.66	0.87406	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	M	0.63169	1.94	0.80722	D	1	D;D	0.69078	0.993;0.997	D;D	0.74674	0.964;0.984	T	0.16276	-1.0408	10	0.72032	D	0.01	-16.1444	19.7302	0.96179	0.0:1.0:0.0:0.0	.	165;165	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	H	165	ENSP00000316950:D165H;ENSP00000267836:D165H	ENSP00000267836:D165H	D	-	1	0	MYEF2	46245454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.726000	0.68515	2.669000	0.90835	0.585000	0.79938	GAT	-	HMMPfam_RRM_1		0.279	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYEF2	protein_coding	OTTHUMT00000416909.2	C	NM_016132		46245454	-1	no_errors	NM_016132	genbank	human	validated	54_36p	missense	SNP	1	G
CCPG1	9236	genome.wustl.edu	37	15	55652274	55652274	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr15:55652274A>G	ENST00000310958.6	-	8	1995	c.1697T>C	c.(1696-1698)tTt>tCt	p.F566S	CCPG1_ENST00000569205.1_Missense_Mutation_p.F566S|CCPG1_ENST00000425574.3_Intron|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000442196.3_Missense_Mutation_p.F566S	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	566					cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)		p.F566S(1)		autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		ATAGTCACTAAAAACTGTTCT	0.358																																																1	Substitution - Missense(1)	ovary(1)	15											138.0	126.0	130.0					15																	55652274		1805	4071	5876	53439566	SO:0001583	missense	9236			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.1697T>C	15.37:g.55652274A>G	ENSP00000311656:p.Phe566Ser		53439566	A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	-	p.F566S	ENST00000310958.6	37	c.1697	CCDS42039.1	15	.	.	.	.	.	.	.	.	.	.	A	11.52	1.664109	0.29604	.	.	ENSG00000256061	ENST00000310958;ENST00000442196	T;T	0.03524	3.9;3.9	5.45	3.01	0.34805	.	0.692705	0.15947	N	0.236910	T	0.03053	0.0090	N	0.22421	0.69	0.26696	N	0.97126	P;P;P;P	0.41265	0.744;0.744;0.744;0.744	B;B;B;B	0.41510	0.359;0.288;0.359;0.359	T	0.44112	-0.9349	10	0.29301	T	0.29	.	5.6595	0.17660	0.3116:0.1148:0.0:0.5735	.	566;566;566;422	A8K9T0;Q9ULG6-4;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	S	566	ENSP00000311656:F566S;ENSP00000403400:F566S	ENSP00000311656:F566S	F	-	2	0	DYX1C1	53439566	0.995000	0.38212	0.968000	0.41197	0.801000	0.45260	1.164000	0.31810	0.327000	0.23409	0.533000	0.62120	TTT	-	NULL		0.358	CCPG1-001	KNOWN	basic|CCDS	protein_coding	CCPG1	protein_coding	OTTHUMT00000419850.1	A	NM_004748		53439566	-1	no_errors	NM_004748	genbank	human	validated	54_36p	missense	SNP		G
BNIP2	663	genome.wustl.edu	37	15	59964835	59964835	+	Splice_Site	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr15:59964835C>A	ENST00000607373.1	-	6	778		c.e6+1		BNIP2_ENST00000267859.3_Splice_Site|AC092755.4_ENST00000441746.1_RNA|BNIP2_ENST00000415213.2_Splice_Site	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2						apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)	p.?(1)		NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						TATATACTTACTTAAAAAGAT	0.308																																					Ovarian(174;1936 1978 6671 8240 38212)											1	Unknown(1)	ovary(1)	15											59.0	63.0	62.0					15																	59964835		2190	4290	6480	57752127	SO:0001630	splice_region_variant	663			U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.575+1G>T	15.37:g.59964835C>A			57752127	B4DS94	Splice_Site	SNP	-	e5+1	ENST00000607373.1	37	c.575+1		15	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325652	0.81580	.	.	ENSG00000140299	ENST00000267859;ENST00000415213;ENST00000439052	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8208	0.96592	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BNIP2	57752127	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.438000	0.80431	2.680000	0.91292	0.591000	0.81541	.	-	-		0.308	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	BNIP2	protein_coding	OTTHUMT00000470740.1	C	NM_004330	Intron	57752127	-1	no_errors	NM_004330	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
UNC45A	55898	genome.wustl.edu	37	15	91489894	91489894	+	Missense_Mutation	SNP	C	C	T	rs199668693		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr15:91489894C>T	ENST00000418476.2	+	10	1290	c.1250C>T	c.(1249-1251)aCg>aTg	p.T417M	UNC45A_ENST00000394275.2_Missense_Mutation_p.T402M	NM_018671.3	NP_061141.2	Q9H3U1	UN45A_HUMAN	unc-45 homolog A (C. elegans)	417					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)		p.T417M(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			GCCATCCAGACGGTGTCCTGC	0.632													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18673	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15						C	MET/THR,MET/THR	1,4395	2.1+/-5.4	0,1,2197	43.0	40.0	41.0		1205,1250	5.2	1.0	15		41	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense	UNC45A	NM_001039675.1,NM_018671.3	81,81	0,2,6494	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	402/930,417/945	91489894	2,12990	2198	4298	6496	89290898	SO:0001583	missense	55898				CCDS10367.1, CCDS42082.1	15q26.1	2008-02-05			ENSG00000140553	ENSG00000140553			30594	protein-coding gene	gene with protein product	"""smooth muscle cell associated protein-1"""	611219				12356907	Standard	XM_005254963		Approved	SMAP-1, GC-UNC45	uc002bqg.3	Q9H3U1	OTTHUMG00000141261	ENST00000418476.2:c.1250C>T	15.37:g.91489894C>T	ENSP00000407487:p.Thr417Met		89290898	A8K6F7|Q7L3Y6|Q9H3U8|Q9NSE8|Q9NSE9	Missense_Mutation	SNP	HMMPfam_Arm;HMMPfam_TPR_1;HMMPfam_TPR_2;superfamily_ARM repeat;superfamily_TPR-like	p.T417M	ENST00000418476.2	37	c.1250	CCDS10367.1	15	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	28.8	4.947421	0.92593	2.27E-4	1.16E-4	ENSG00000140553	ENST00000394275;ENST00000418476	T;T	0.48201	0.82;0.82	5.23	5.23	0.72850	Armadillo-like helical (1);Armadillo-type fold (1);	0.046588	0.85682	D	0.000000	T	0.69043	0.3067	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.971	T	0.70547	-0.4842	10	0.56958	D	0.05	-21.8364	19.2173	0.93783	0.0:1.0:0.0:0.0	.	417;402	Q9H3U1;A8K6F7	UN45A_HUMAN;.	M	402;417	ENSP00000377816:T402M;ENSP00000407487:T417M	ENSP00000377816:T402M	T	+	2	0	UNC45A	89290898	0.994000	0.37717	1.000000	0.80357	0.991000	0.79684	3.207000	0.51106	2.627000	0.88993	0.456000	0.33151	ACG	-	NULL		0.632	UNC45A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45A	protein_coding	OTTHUMT00000280406.2	C	NM_018671		89290898	1	no_errors	NM_018671	genbank	human	validated	54_36p	missense	SNP	1	T
RNPS1	10921	genome.wustl.edu	37	16	2312306	2312306	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr16:2312306C>T	ENST00000565678.1	-	6	1194	c.649G>A	c.(649-651)Gag>Aag	p.E217K	RNPS1_ENST00000301730.8_Missense_Mutation_p.E217K|RNPS1_ENST00000569598.2_Missense_Mutation_p.E123K|RNPS1_ENST00000566397.1_Missense_Mutation_p.E40K|RNPS1_ENST00000561718.1_Missense_Mutation_p.E40K|RNPS1_ENST00000567147.1_Missense_Mutation_p.E194K|RNPS1_ENST00000320225.5_Missense_Mutation_p.E217K|RNPS1_ENST00000397086.2_Missense_Mutation_p.E217K|AC009065.1_ENST00000454671.1_Missense_Mutation_p.S167L|RNPS1_ENST00000568631.1_Missense_Mutation_p.E217K|RNPS1_ENST00000566458.1_Missense_Mutation_p.E194K			Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain	217	Interaction with SAP18 and ACIN1.|Necessary for interaction with PNN and exon-skipping.|Necessary for interaction with the cleaved p110 isoform of CDC2L1.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.E217K(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						AGCGCCTTCTCGGCTTCATCT	0.522																																																1	Substitution - Missense(1)	ovary(1)	16											108.0	100.0	103.0					16																	2312306		2198	4300	6498	2252307	SO:0001583	missense	10921			AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828	ENST00000565678.1:c.649G>A	16.37:g.2312306C>T	ENSP00000457723:p.Glu217Lys		2252307	A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	Missense_Mutation	SNP	HMMPfam_RRM_1;superfamily_RNA-binding domain RBD	p.E217K	ENST00000565678.1	37	c.649	CCDS10465.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.71|17.71	3.457613|3.457613	0.63401|0.63401	.|.	.|.	ENSG00000205937|ENSG00000167970	ENST00000320225;ENST00000397086;ENST00000301730|ENST00000454671	T;T;T|.	0.17528|.	2.27;2.27;2.27|.	5.12|5.12	5.12|5.12	0.69794|0.69794	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.	0.226096|.	0.45606|.	D|.	0.000360|.	T|T	0.51312|0.51312	0.1667|0.1667	N|N	0.11756|0.11756	0.17|0.17	0.58432|0.58432	D|D	0.999999|0.999999	P;P|.	0.51449|.	0.945;0.814|.	P;P|.	0.51974|.	0.686;0.564|.	T|T	0.59348|0.59348	-0.7471|-0.7471	10|6	0.49607|0.87932	T|D	0.09|0	.|.	16.1125|16.1125	0.81273|0.81273	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	194;217|.	Q15287-2;Q15287|.	.;RNPS1_HUMAN|.	K|L	217|167	ENSP00000315859:E217K;ENSP00000380275:E217K;ENSP00000301730:E217K|.	ENSP00000301730:E217K|ENSP00000402058:S167L	E|S	-|+	1|2	0|0	RNPS1|AC009065.1	2252307|2252307	0.998000|0.998000	0.40836|0.40836	0.967000|0.967000	0.41034|0.41034	0.689000|0.689000	0.40095|0.40095	3.613000|3.613000	0.54152|0.54152	2.680000|2.680000	0.91292|0.91292	0.446000|0.446000	0.29264|0.29264	GAG|TCG	-	HMMPfam_RRM_1		0.522	RNPS1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNPS1	protein_coding	OTTHUMT00000435415.1	C	NM_080594		2252307	-1	no_errors	NM_006711	genbank	human	reviewed	54_36p	missense	SNP	1	T
CES1	1066	genome.wustl.edu	37	16	55857572	55857572	+	Silent	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr16:55857572C>A	ENST00000361503.4	-	4	556	c.426G>T	c.(424-426)ggG>ggT	p.G142G	CES1_ENST00000566555.1_5'UTR|CES1_ENST00000360526.3_Silent_p.G143G|CES1_ENST00000422046.2_Silent_p.G142G			P23141	EST1_HUMAN	carboxylesterase 1	142					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)	p.G143G(1)							all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	CCATCAGCCCCCCTCCGTGGA	0.567																																					NSCLC(162;1801 2756 42904 52896)											1	Substitution - coding silent(1)	ovary(1)	16											78.0	71.0	73.0					16																	55857572		2196	4298	6494	54415073	SO:0001819	synonymous_variant	1066			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.426G>T	16.37:g.55857572C>A			54415073	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Silent	SNP	HMMPfam_COesterase;superfamily_alpha/beta-Hydrolases	p.G143	ENST00000361503.4	37	c.429	CCDS45488.1	16																																																																																			-	HMMPfam_COesterase		0.567	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES1	protein_coding	OTTHUMT00000433285.1	C	NM_001266		54415073	-1	no_errors	NM_001025195	genbank	human	reviewed	54_36p	silent	SNP	0.99	A
ZFP90	146198	genome.wustl.edu	37	16	68597502	68597502	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr16:68597502A>T	ENST00000570495.1	+	5	1104	c.812A>T	c.(811-813)gAg>gTg	p.E271V	ZFP90_ENST00000398253.2_Missense_Mutation_p.E271V|ZFP90_ENST00000563169.2_Missense_Mutation_p.E271V			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	271					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)	p.E271V(1)		breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		CAGCTTACTGAGCATCAGAGA	0.443																																																1	Substitution - Missense(1)	ovary(1)	16											91.0	101.0	97.0					16																	68597502		2185	4293	6478	67155003	SO:0001583	missense	146198			AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.812A>T	16.37:g.68597502A>T	ENSP00000460547:p.Glu271Val		67155003	B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	-	p.E271V	ENST00000570495.1	37	c.812	CCDS42183.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.47|11.47	1.648265|1.648265	0.29336|0.29336	.|.	.|.	ENSG00000184939|ENSG00000184939	ENST00000398253|ENST00000327567	T|.	0.08546|.	3.08|.	5.98|5.98	3.64|3.64	0.41730|0.41730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.20618|0.20618	0.0496|0.0496	N|N	0.13003|0.13003	0.285|0.285	0.09310|0.09310	N|N	1|1	B|.	0.25743|.	0.133|.	B|.	0.26969|.	0.075|.	T|T	0.08743|0.08743	-1.0707|-1.0707	9|6	0.21540|0.38643	T|T	0.41|0.18	-12.7693|-12.7693	3.1421|3.1421	0.06460|0.06460	0.6362:0.1453:0.0788:0.1397|0.6362:0.1453:0.0788:0.1397	.|.	271|.	Q8TF47|.	ZFP90_HUMAN|.	V|C	271|43	ENSP00000381304:E271V|.	ENSP00000381304:E271V|ENSP00000329859:S43C	E|S	+|+	2|1	0|0	ZFP90|ZFP90	67155003|67155003	0.000000|0.000000	0.05858|0.05858	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	-1.061000|-1.061000	0.03472|0.03472	2.295000|2.295000	0.77249|0.77249	0.524000|0.524000	0.50904|0.50904	GAG|AGC	-	NULL		0.443	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP90	protein_coding	OTTHUMT00000436217.3	A	XM_085375		67155003	1	no_errors	NM_133458	genbank	human	provisional	54_36p	missense	SNP	0.16	T
MYH8	4626	genome.wustl.edu	37	17	10304046	10304046	+	Silent	SNP	T	T	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:10304046T>A	ENST00000403437.2	-	27	3490	c.3396A>T	c.(3394-3396)cgA>cgT	p.R1132R	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1132					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)	p.R1132R(1)		NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CCGCTTTGGCTCGGGACGCCC	0.557									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																							1	Substitution - coding silent(1)	ovary(1)	17											49.0	55.0	53.0					17																	10304046		2202	4300	6502	10244771	SO:0001819	synonymous_variant	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3396A>T	17.37:g.10304046T>A			10244771	Q14910	Silent	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_t-snare proteins;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R1132	ENST00000403437.2	37	c.3396	CCDS11153.1	17																																																																																			-	HMMPfam_Myosin_tail_1		0.557	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	protein_coding	OTTHUMT00000252724.2	T	NM_002472		10244771	-1	no_errors	NM_002472	genbank	human	validated	54_36p	silent	SNP	1	A
MYH4	4622	genome.wustl.edu	37	17	10363304	10363304	+	Missense_Mutation	SNP	C	C	G	rs267604706		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:10363304C>G	ENST00000255381.2	-	14	1491	c.1381G>C	c.(1381-1383)Ggg>Cgg	p.G461R	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	461	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)	p.G461R(1)		NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TCCAAGACCCCGATGAAGTAC	0.493																																																1	Substitution - Missense(1)	ovary(1)	17											160.0	155.0	157.0					17																	10363304		2203	4298	6501	10304029	SO:0001583	missense	4622				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1381G>C	17.37:g.10363304C>G	ENSP00000255381:p.Gly461Arg		10304029		Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G461R	ENST00000255381.2	37	c.1381	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.189456	0.94923	.	.	ENSG00000141048	ENST00000255381	D	0.94000	-3.33	5.34	5.34	0.76211	Myosin head, motor domain (3);	0.000000	0.37906	U	0.001897	D	0.98779	0.9589	H	0.99976	5.16	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99041	1.0824	10	0.87932	D	0	.	19.3946	0.94601	0.0:1.0:0.0:0.0	.	461	Q9Y623	MYH4_HUMAN	R	461	ENSP00000255381:G461R	ENSP00000255381:G461R	G	-	1	0	MYH4	10304029	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.050000	0.71063	2.669000	0.90835	0.650000	0.86243	GGG	-	HMMPfam_Myosin_head		0.493	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	protein_coding	OTTHUMT00000252731.1	C	NM_017533		10304029	-1	no_errors	NM_017533	genbank	human	validated	54_36p	missense	SNP	1	G
KRT25	147183	genome.wustl.edu	37	17	38910189	38910189	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:38910189G>T	ENST00000312150.4	-	3	652	c.592C>A	c.(592-594)Ctg>Atg	p.L198M		NM_181534.3	NP_853512.1			keratin 25									p.L198M(1)		endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				GTTCTGCACAGGGTTATTTCA	0.408																																																1	Substitution - Missense(1)	ovary(1)	17											146.0	136.0	140.0					17																	38910189		2203	4300	6503	36163715	SO:0001583	missense	147183			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.592C>A	17.37:g.38910189G>T	ENSP00000310573:p.Leu198Met		36163715		Missense_Mutation	SNP	-	p.L198M	ENST00000312150.4	37	c.592	CCDS11373.1	17	.	.	.	.	.	.	.	.	.	.	G	16.07	3.018047	0.54576	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.92099	-2.97	5.92	2.91	0.33838	Filament (1);	0.000000	0.49916	D	0.000127	D	0.92074	0.7488	L	0.41961	1.31	0.36908	D	0.890754	D	0.55605	0.972	D	0.64144	0.922	D	0.90899	0.4767	10	0.54805	T	0.06	.	6.7439	0.23451	0.1997:0.0:0.6747:0.1256	.	198	Q7Z3Z0	K1C25_HUMAN	M	198	ENSP00000310573:L198M	ENSP00000310573:L198M	L	-	1	2	KRT25	36163715	0.043000	0.20138	0.998000	0.56505	0.978000	0.69477	0.303000	0.19210	0.423000	0.26033	-0.218000	0.12543	CTG	-	NULL		0.408	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT25	protein_coding	OTTHUMT00000257218.1	G	NM_181534		36163715	-1	no_errors	NM_181534	genbank	human	provisional	54_36p	missense	SNP	1	T
RP11-156P1.2	0	genome.wustl.edu	37	17	45096709	45096709	+	Intron	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:45096709C>T	ENST00000571841.1	+	8	736				GOSR2_ENST00000439730.2_Intron|RP11-156P1.3_ENST00000575173.1_RNA|LRRC37A17P_ENST00000570478.1_RNA																							CTCAAGCCACCGTTCAACCTC	0.537																																																0			17																																								42451708	SO:0001627	intron_variant	644397																														ENST00000571841.1:c.677-5337C>T	17.37:g.45096709C>T			42451708		RNA	SNP	-	NULL	ENST00000571841.1	37	NULL		17																																																																																			-	-		0.537	RP11-156P1.2-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	LOC644397	protein_coding	OTTHUMT00000440447.1	C			42451708	1	pseudogene	XR_042323	genbank	human	model	54_36p	rna	SNP		T
TP53	7157	genome.wustl.edu	37	17	7578204	7578204	+	Missense_Mutation	SNP	A	A	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	T	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:7578204A>T	ENST00000269305.4	-	6	834	c.645T>A	c.(643-645)agT>agA	p.S215R	TP53_ENST00000455263.2_Missense_Mutation_p.S215R|TP53_ENST00000359597.4_Missense_Mutation_p.S215R|TP53_ENST00000445888.2_Missense_Mutation_p.S215R|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.S215R|TP53_ENST00000420246.2_Missense_Mutation_p.S215R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	215	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in sporadic cancers; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> K (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|S -> N (in sporadic cancers; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S215R(17)|p.0?(8)|p.?(5)|p.S215S(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)|p.V216fs*6(1)|p.T211_S215delTFRHS(1)|p.S83R(1)|p.D208fs*1(1)|p.S215fs*32(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)|p.S122R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACCACCACACTATGTCGAA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Substitution - Missense(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(3)|Substitution - coding silent(2)|Insertion - In frame(1)|Complex - frameshift(1)	haematopoietic_and_lymphoid_tissue(9)|biliary_tract(5)|large_intestine(5)|bone(5)|breast(5)|stomach(4)|oesophagus(4)|ovary(4)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(2)|skin(2)|lung(2)|liver(1)|prostate(1)	17	GRCh37	CD941799	TP53	D							124.0	111.0	116.0					17																	7578204		2203	4300	6503	7518929	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.645T>A	17.37:g.7578204A>T	ENSP00000269305:p.Ser215Arg		7518929	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.S215R	ENST00000269305.4	37	c.645	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	20.9	4.061984	0.76187	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99855	-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2	5.28	-4.05	0.03998	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	M	0.90705	3.14	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98563	1.0642	10	0.87932	D	0	-18.3023	12.3136	0.54942	0.7185:0.0:0.2815:0.0	.	176;215;215;122;215;215;215	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	215;215;215;215;215;215;204;122;83;122;83	ENSP00000410739:S215R;ENSP00000352610:S215R;ENSP00000269305:S215R;ENSP00000398846:S215R;ENSP00000391127:S215R;ENSP00000391478:S215R;ENSP00000425104:S83R;ENSP00000423862:S122R	ENSP00000269305:S215R	S	-	3	2	TP53	7518929	0.000000	0.05858	0.557000	0.28306	0.964000	0.63967	-1.515000	0.02252	-0.649000	0.05430	-0.468000	0.05107	AGT	-	HMMPfam_P53		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7518929	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.99	T
DNAI2	64446	genome.wustl.edu	37	17	72285862	72285862	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:72285862C>T	ENST00000311014.6	+	5	664	c.597C>T	c.(595-597)taC>taT	p.Y199Y	DNAI2_ENST00000446837.2_Silent_p.Y199Y|DNAI2_ENST00000579490.1_Silent_p.Y256Y|DNAI2_ENST00000307504.5_Silent_p.Y56Y|DNAI2_ENST00000582036.1_Silent_p.Y199Y			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	199					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)	p.Y199Y(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GCGATTCATACATCTGGGACC	0.632									Kartagener syndrome																																							1	Substitution - coding silent(1)	ovary(1)	17											61.0	58.0	59.0					17																	72285862		2203	4300	6503	69797457	SO:0001819	synonymous_variant	64446	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.597C>T	17.37:g.72285862C>T			69797457	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Silent	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.Y199	ENST00000311014.6	37	c.597	CCDS11697.1	17																																																																																			-	NULL		0.632	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DNAI2	protein_coding	OTTHUMT00000442537.1	C	NM_023036		69797457	1	no_errors	NM_023036	genbank	human	validated	54_36p	silent	SNP	1	T
USP43	124739	genome.wustl.edu	37	17	9631299	9631299	+	Silent	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:9631299G>T	ENST00000285199.7	+	15	2460	c.2364G>T	c.(2362-2364)cgG>cgT	p.R788R	USP43_ENST00000570475.1_Silent_p.R783R|USP43_ENST00000570827.2_3'UTR	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	788					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.R789R(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						GTTTGGTACGGGGCGTGAAAG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	17											61.0	64.0	63.0					17																	9631299		2018	4171	6189	9572024	SO:0001819	synonymous_variant	124739			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.2364G>T	17.37:g.9631299G>T			9572024	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Silent	SNP	-	p.R788	ENST00000285199.7	37	c.2364	CCDS45610.1	17																																																																																			-	NULL		0.547	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP43	protein_coding	OTTHUMT00000439855.3	G	NM_153210		9572024	1	no_errors	NM_153210	genbank	human	validated	54_36p	silent	SNP	0.04	T
RNF213	57674	genome.wustl.edu	37	17	78317686	78317686	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr17:78317686C>G	ENST00000582970.1	+	28	6356	c.6213C>G	c.(6211-6213)ttC>ttG	p.F2071L	RNF213_ENST00000336301.6_Missense_Mutation_p.F144L|RNF213_ENST00000508628.2_Missense_Mutation_p.F2120L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	2071					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.F144L(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TGTTTCTTTTCAAGCTCCTCA	0.438																																																1	Substitution - Missense(1)	ovary(1)	17											179.0	160.0	166.0					17																	78317686		2203	4300	6503	75932281	SO:0001583	missense	57674			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.6213C>G	17.37:g.78317686C>G	ENSP00000464087:p.Phe2071Leu		75932281	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	HMMPfam_zf-C3HC4;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Nickel-iron hydrogenase small subunit;superfamily_RING/U-box	p.F144L	ENST00000582970.1	37	c.432	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748538	0.49257	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.59906	0.23	5.92	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.65811	0.2727	L	0.36672	1.1	0.34933	D	0.749546	D	0.89917	1.0	D	0.91635	0.999	T	0.75758	-0.3205	10	0.87932	D	0	.	11.2635	0.49097	0.0:0.8603:0.0:0.1397	.	144	Q63HN8	RN213_HUMAN	L	2071;2120;144	ENSP00000338218:F144L	ENSP00000338218:F144L	F	+	3	2	RNF213	75932281	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.432000	0.52824	1.510000	0.48803	0.561000	0.74099	TTC	-	NULL		0.438	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	C	NM_020914		75932281	1	no_errors	NM_020914	genbank	human	validated	54_36p	missense	SNP	1	G
RGL3	57139	genome.wustl.edu	37	19	11527320	11527320	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr19:11527320C>T	ENST00000380456.3	-	4	456	c.393G>A	c.(391-393)gcG>gcA	p.A131A	RGL3_ENST00000393423.3_Silent_p.A131A	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	131	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)	p.A131A(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						GATCTTGTACCGCTGTCTTCT	0.567																																					GBM(174;751 2067 17998 27979 33959)											1	Substitution - coding silent(1)	ovary(1)	19											115.0	105.0	108.0					19																	11527320		2203	4300	6503	11388320	SO:0001819	synonymous_variant	57139			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.393G>A	19.37:g.11527320C>T			11388320	B5ME84|B7ZL22|Q0P6G0	Silent	SNP	HMMPfam_RA;HMMPfam_RasGEF_N;HMMPfam_RasGEF;superfamily_Ras GEF;superfamily_Ubiquitin-like	p.A131	ENST00000380456.3	37	c.393	CCDS32910.1	19																																																																																			-	HMMPfam_RasGEF_N		0.567	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	protein_coding	OTTHUMT00000421208.3	C	XM_290867		11388320	-1	no_errors	NM_001035223	genbank	human	provisional	54_36p	silent	SNP		T
FKBP8	23770	genome.wustl.edu	37	19	18649133	18649133	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr19:18649133G>C	ENST00000596558.2	-	5	771	c.662C>G	c.(661-663)gCc>gGc	p.A221G	AC005387.2_ENST00000596596.1_RNA|FKBP8_ENST00000610101.1_Intron|FKBP8_ENST00000453489.2_Missense_Mutation_p.A250G|FKBP8_ENST00000222308.4_Missense_Mutation_p.A221G|FKBP8_ENST00000597960.3_Missense_Mutation_p.A222G|FKBP8_ENST00000608443.1_Missense_Mutation_p.A222G			Q14318	FKBP8_HUMAN	FK506 binding protein 8, 38kDa	221					apoptotic process (GO:0006915)|camera-type eye development (GO:0043010)|cell fate specification (GO:0001708)|chaperone-mediated protein folding (GO:0061077)|dorsal/ventral neural tube patterning (GO:0021904)|intracellular signal transduction (GO:0035556)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|positive regulation of BMP signaling pathway (GO:0030513)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of gene expression (GO:0010468)|smoothened signaling pathway (GO:0007224)|viral process (GO:0016032)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	FK506 binding (GO:0005528)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.A222G(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)	15						CTTCCGGTTGGCCAGGGCCAC	0.692																																																1	Substitution - Missense(1)	ovary(1)	19											40.0	38.0	38.0					19																	18649133		2202	4299	6501	18510133	SO:0001583	missense	23770			L37033	CCDS32961.1	19p12	2013-01-10	2002-08-29		ENSG00000105701	ENSG00000105701		"""Tetratricopeptide (TTC) repeat domain containing"""	3724	protein-coding gene	gene with protein product	"""FK506-binding protein 8 (38kD)"""	604840	"""FK506-binding protein 8 (38kD)"""			7543869	Standard	NM_012181		Approved	FKBP38, FKBPr38	uc002njj.1	Q14318		ENST00000596558.2:c.662C>G	19.37:g.18649133G>C	ENSP00000472302:p.Ala221Gly		18510133	C8C9T5|Q53GU3|Q7Z349|Q86YK6	Missense_Mutation	SNP	HMMPfam_FKBP_C;HMMPfam_TPR_1;superfamily_TPR-like;superfamily_FKBP-like	p.A222G	ENST00000596558.2	37	c.665		19	.	.	.	.	.	.	.	.	.	.	G	0.295	-0.977555	0.02197	.	.	ENSG00000105701	ENST00000222308;ENST00000453489	T;T	0.55588	0.51;0.51	3.79	2.75	0.32379	.	0.000000	0.85682	D	0.000000	T	0.35682	0.0940	N	0.20766	0.605	0.80722	D	1	B;B;P;P	0.36909	0.372;0.017;0.573;0.525	B;B;B;B	0.37601	0.089;0.022;0.254;0.084	T	0.11446	-1.0587	10	0.35671	T	0.21	-14.822	10.387	0.44145	0.0972:0.0:0.9028:0.0	.	250;165;221;222	B7Z6M0;B2R8G6;Q14318;Q14318-2	.;.;FKBP8_HUMAN;.	G	222;250	ENSP00000222308:A222G;ENSP00000388891:A250G	ENSP00000222308:A222G	A	-	2	0	FKBP8	18510133	1.000000	0.71417	0.997000	0.53966	0.105000	0.19272	7.010000	0.76353	0.812000	0.34326	-0.258000	0.10820	GCC	-	NULL		0.692	FKBP8-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate	protein_coding	FKBP8	protein_coding	OTTHUMT00000466374.3	G	NM_012181		18510133	-1	no_errors	NM_012181	genbank	human	reviewed	54_36p	missense	SNP	1	C
PHLDB3	653583	genome.wustl.edu	37	19	43990788	43990788	+	Silent	SNP	C	C	T	rs373252899		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr19:43990788C>T	ENST00000292140.5	-	12	1761	c.1401G>A	c.(1399-1401)gcG>gcA	p.A467A		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	467							enzyme binding (GO:0019899)	p.A467A(1)		breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				GCTCCCTCTCCGCCATGGCCT	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19						C		0,4038		0,0,2019	24.0	27.0	26.0		1401	-8.0	0.0	19		26	1,8337		0,1,4168	no	coding-synonymous	PHLDB3	NM_198850.3		0,1,6187	TT,TC,CC		0.012,0.0,0.0081		467/641	43990788	1,12375	2019	4169	6188	48682628	SO:0001819	synonymous_variant	653583				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1401G>A	19.37:g.43990788C>T			48682628	Q8N7Z4	Silent	SNP	-	p.A467	ENST00000292140.5	37	c.1401	CCDS12621.2	19																																																																																			-	NULL		0.652	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	protein_coding	OTTHUMT00000319643.2	C			48682628	-1	no_errors	NM_198850	genbank	human	validated	54_36p	silent	SNP	0.48	T
AURKC	6795	genome.wustl.edu	37	19	57746636	57746636	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr19:57746636T>G	ENST00000302804.7	+	7	967	c.781T>G	c.(781-783)Tca>Gca	p.S261A	AURKC_ENST00000415300.2_Missense_Mutation_p.S242A|AURKC_ENST00000448930.1_Missense_Mutation_p.S227A|AURKC_ENST00000599062.1_Missense_Mutation_p.S258A|AURKC_ENST00000598785.1_Missense_Mutation_p.S227A	NM_001015878.1	NP_001015878.1	Q9UQB9	AURKC_HUMAN	aurora kinase C	261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|cytokinesis (GO:0000910)|histone modification (GO:0016570)|meiotic nuclear division (GO:0007126)|positive regulation of cytokinesis (GO:0032467)|protein phosphorylation (GO:0006468)|spindle midzone assembly involved in mitosis (GO:0051256)	chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)	p.S227A(1)		breast(1)|endometrium(1)|large_intestine(9)|lung(9)|ovary(3)|prostate(1)|stomach(1)	25		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0122)		GTTTCCACTATCAATGCCTCT	0.512																																																1	Substitution - Missense(1)	ovary(1)	19											72.0	76.0	75.0					19																	57746636		2203	4300	6503	62438448	SO:0001583	missense	6795				CCDS33128.1, CCDS46205.1, CCDS46206.1	19q13.43	2013-09-19	2003-07-21	2003-07-23	ENSG00000105146	ENSG00000105146			11391	protein-coding gene	gene with protein product		603495	"""serine/threonine kinase 13 (aurora/IPL1-like)"""	STK13		9799611	Standard	XR_430209		Approved	AurC, ARK3	uc002qoe.3	Q9UQB9	OTTHUMG00000183106	ENST00000302804.7:c.781T>G	19.37:g.57746636T>G	ENSP00000302898:p.Ser261Ala		62438448	O60681|O75442|Q6AZY8|Q6DLZ0|Q9UPK5	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.S261A	ENST00000302804.7	37	c.781	CCDS33128.1	19	.	.	.	.	.	.	.	.	.	.	T	3.357	-0.131348	0.06753	.	.	ENSG00000105146	ENST00000415300;ENST00000448930;ENST00000302804	T;T;T	0.65178	-0.14;-0.14;-0.14	3.88	1.7	0.24286	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.656563	0.15500	N	0.259090	T	0.45538	0.1347	L	0.29908	0.895	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.16722	0.016;0.008;0.006	T	0.28332	-1.0047	10	0.29301	T	0.29	-2.4644	7.6119	0.28135	0.3702:0.0:0.0:0.6298	.	258;261;242	Q5Y191;Q9UQB9;Q9UQB9-3	.;AURKC_HUMAN;.	A	242;227;261	ENSP00000407162:S242A;ENSP00000406798:S227A;ENSP00000302898:S261A	ENSP00000302898:S261A	S	+	1	0	AURKC	62438448	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.055000	0.11807	0.279000	0.22186	-0.336000	0.08194	TCA	-	HMMPfam_Pkinase		0.512	AURKC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AURKC	protein_coding	OTTHUMT00000465089.1	T	NM_003160		62438448	1	no_errors	NM_001015878	genbank	human	reviewed	54_36p	missense	SNP		G
TBC1D8	11138	genome.wustl.edu	37	2	101654923	101654923	+	Splice_Site	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:101654923C>A	ENST00000376840.4	-	7	1229	c.1230G>T	c.(1228-1230)atG>atT	p.M410I	TBC1D8_ENST00000409318.1_Splice_Site_p.M425I			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	410					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.M425I(1)		breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						GGGACCATACCATGTCATCAT	0.597																																																1	Substitution - Missense(1)	ovary(1)	2											150.0	153.0	152.0					2																	101654923		2137	4246	6383	101021355	SO:0001630	splice_region_variant	11138			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1230+1G>T	2.37:g.101654923C>A			101021355	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	-	p.M410I	ENST00000376840.4	37	c.1230	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	C	6.466	0.454083	0.12283	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.02890	4.12;4.12	5.03	5.03	0.67393	.	0.929476	0.08962	N	0.868580	T	0.02156	0.0067	N	0.02916	-0.46	0.42923	D	0.994299	B;B	0.12630	0.006;0.0	B;B	0.11329	0.006;0.001	T	0.57997	-0.7714	9	.	.	.	-8.0325	18.3517	0.90340	0.0:1.0:0.0:0.0	.	425;410	B7Z6L4;O95759	.;TBCD8_HUMAN	I	410;425	ENSP00000366036:M410I;ENSP00000386856:M425I	.	M	-	3	0	TBC1D8	101021355	0.997000	0.39634	0.685000	0.30070	0.130000	0.20726	3.386000	0.52492	2.324000	0.78689	0.655000	0.94253	ATG	-	NULL		0.597	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	protein_coding	OTTHUMT00000376092.1	C	NM_007063	Missense_Mutation	101021355	-1	no_errors	NM_001102426	genbank	human	validated	54_36p	missense	SNP	0.98	A
IL37	27178	genome.wustl.edu	37	2	113675240	113675240	+	Silent	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:113675240G>A	ENST00000263326.3	+	4	336	c.294G>A	c.(292-294)ttG>ttA	p.L98L	IL37_ENST00000352179.3_Silent_p.L77L|IL37_ENST00000349806.3_Silent_p.L37L|IL37_ENST00000353225.3_Silent_p.L58L|IL37_ENST00000311328.2_Silent_p.L72L	NM_014439.3	NP_055254.2	Q9NZH6	IL37_HUMAN	interleukin 37	98					immune response (GO:0006955)|inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)	interleukin-1 receptor binding (GO:0005149)	p.L98L(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(7)|ovary(2)|skin(3)	19						CCTCATCCTTGAGCTCAGCCT	0.488																																																1	Substitution - coding silent(1)	ovary(1)	2											220.0	227.0	225.0					2																	113675240		2203	4300	6503	113391711	SO:0001819	synonymous_variant	27178			AF201832	CCDS2103.1, CCDS2104.1, CCDS2105.1, CCDS2106.1, CCDS2107.1	2q12-q14.1	2011-06-06	2011-06-06	2011-06-06	ENSG00000125571	ENSG00000125571		"""Interleukins and interleukin receptors"""	15563	protein-coding gene	gene with protein product	"""interleukin 1, zeta"", ""interleukin-1 homolog 4"", ""interleukin-1-related protein"""	605510	"""interleukin 1 family, member 7 (zeta)"""	IL1F7		10625660, 10512743, 12496389	Standard	NM_014439		Approved	FIL1, FIL1Z, FIL1(ZETA), IL-1H4, IL-1RP1, IL-1F7	uc002tij.3	Q9NZH6	OTTHUMG00000131345	ENST00000263326.3:c.294G>A	2.37:g.113675240G>A			113391711	B5BU97|Q56AP9|Q8TD04|Q8TD05|Q9HBF2|Q9HBF3|Q9UHA6	Silent	SNP	-	p.L98	ENST00000263326.3	37	c.294	CCDS2103.1	2																																																																																			-	NULL		0.488	IL37-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL1F7	protein_coding	OTTHUMT00000254126.1	G	NM_014439		113391711	1	no_errors	NM_014439	genbank	human	reviewed	54_36p	silent	SNP		A
TPO	7173	genome.wustl.edu	37	2	1491750	1491750	+	Missense_Mutation	SNP	C	C	A	rs368643878		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:1491750C>A	ENST00000345913.4	+	10	1846	c.1755C>A	c.(1753-1755)gaC>gaA	p.D585E	TPO_ENST00000346956.3_Missense_Mutation_p.D585E|TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Missense_Mutation_p.D412E|TPO_ENST00000382198.1_Missense_Mutation_p.D412E|TPO_ENST00000329066.4_Missense_Mutation_p.D585E|TPO_ENST00000382201.3_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.D585E	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	585					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)	p.D585E(1)		breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGGGCCGGGACCACGGGCTGC	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		16320	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	2						C	GLU/ASP,GLU/ASP,,,GLU/ASP,GLU/ASP	0,4406		0,0,2203	85.0	82.0	83.0		1755,1755,,,1755,1236	2.5	1.0	2		83	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron,intron,missense,missense	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	45,45,,,45,45	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,,,probably-damaging,probably-damaging	585/934,585/934,,,585/890,412/761	1491750	1,13005	2203	4300	6503	1470757	SO:0001583	missense	7173				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1755C>A	2.37:g.1491750C>A	ENSP00000318820:p.Asp585Glu		1470757	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_An_peroxidase;superfamily_Heme-dependent peroxidases;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_Complement control module/SCR domain	p.D585E	ENST00000345913.4	37	c.1755	CCDS1643.1	2	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450461	0.63290	0.0	1.16E-4	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	4.78	2.53	0.30540	.	0.000000	0.85682	D	0.000000	T	0.80093	0.4560	M	0.80746	2.51	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	0.999;0.992;1.0	T	0.78383	-0.2225	10	0.87932	D	0	-51.3254	3.7625	0.08609	0.1898:0.5171:0.0:0.2932	.	585;412;585	P07202-4;P07202-5;P07202	.;.;PERT_HUMAN	E	585;585;585;412;585;412;514	ENSP00000337263:D585E;ENSP00000318820:D585E;ENSP00000263886:D585E;ENSP00000332044:D412E;ENSP00000329869:D585E;ENSP00000371633:D412E;ENSP00000405788:D514E	ENSP00000329869:D585E	D	+	3	2	TPO	1470757	0.928000	0.31464	1.000000	0.80357	0.970000	0.65996	0.032000	0.13732	0.961000	0.38030	0.591000	0.81541	GAC	-	HMMPfam_An_peroxidase		0.577	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	protein_coding	OTTHUMT00000206594.2	C	NM_000547		1470757	1	no_errors	NM_000547	genbank	human	reviewed	54_36p	missense	SNP	1	A
LCT	3938	genome.wustl.edu	37	2	136567006	136567006	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:136567006C>A	ENST00000264162.2	-	8	2921	c.2911G>T	c.(2911-2913)Gtg>Ttg	p.V971L	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	971	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)	p.V971L(1)		breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TAGGCCTTCACCTTCAAAGCT	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											89.0	91.0	90.0					2																	136567006		2203	4300	6503	136283476	SO:0001583	missense	3938			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.2911G>T	2.37:g.136567006C>A	ENSP00000264162:p.Val971Leu		136283476	Q4ZG58	Missense_Mutation	SNP	HMMPfam_Glyco_hydro_1;superfamily_(Trans)glycosidases	p.V971L	ENST00000264162.2	37	c.2911	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	19.81	3.897276	0.72639	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.48836	0.8	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.101330	0.64402	D	0.000002	T	0.57417	0.2052	N	0.22421	0.69	0.80722	D	1	D	0.61697	0.99	D	0.71656	0.974	T	0.56565	-0.7958	10	0.44086	T	0.13	-21.7281	20.0139	0.97470	0.0:1.0:0.0:0.0	.	971	P09848	LPH_HUMAN	L	971;403	ENSP00000264162:V971L	ENSP00000264162:V971L	V	-	1	0	LCT	136283476	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	7.818000	0.86416	2.724000	0.93272	0.563000	0.77884	GTG	-	HMMPfam_Glyco_hydro_1		0.498	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	protein_coding	OTTHUMT00000254657.1	C	NM_002299		136283476	-1	no_errors	NM_002299	genbank	human	reviewed	54_36p	missense	SNP	1	A
Unknown	0	genome.wustl.edu	37	2	174350740	174350740	+	IGR	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:174350740G>C								CDCA7 (117015 upstream) : RP11-796E10.1 (325063 downstream)																							ACTCAGACTTGGCAGTGCAGA	0.478																																																0			2																																								174058986	SO:0001628	intergenic_variant	643997																															2.37:g.174350740G>C			174058986		Silent	SNP	-	p.A117		37	c.351		2																																																																																			-	NULL	0	0.478					LOC643997			G			174058986	-1	no_errors	XM_292963	genbank	human	model	54_36p	silent	SNP	1	C
PLEKHA3	65977	genome.wustl.edu	37	2	179350382	179350382	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:179350382T>A	ENST00000234453.5	+	2	457	c.55T>A	c.(55-57)Tgg>Agg	p.W19R	PLEKHA3_ENST00000461474.1_3'UTR	NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3	19	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)	p.W19R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			GCAGCCTCGTTGGTTTGTTTT	0.363																																																1	Substitution - Missense(1)	ovary(1)	2											111.0	110.0	110.0					2																	179350382		2203	4300	6503	179058628	SO:0001583	missense	65977			AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.55T>A	2.37:g.179350382T>A	ENSP00000234453:p.Trp19Arg		179058628	Q4ZG69|Q86TQ1|Q9NXT3	Missense_Mutation	SNP	-	p.W19R	ENST00000234453.5	37	c.55	CCDS33336.1	2	.	.	.	.	.	.	.	.	.	.	T	23.1	4.370971	0.82573	.	.	ENSG00000116095	ENST00000234453	T	0.76968	-1.06	5.15	5.15	0.70609	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.92198	0.7526	H	0.97240	3.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94848	0.8011	10	0.87932	D	0	-13.3514	14.9801	0.71306	0.0:0.0:0.0:1.0	.	19	Q9HB20	PKHA3_HUMAN	R	19	ENSP00000234453:W19R	ENSP00000234453:W19R	W	+	1	0	PLEKHA3	179058628	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.036000	0.88901	1.928000	0.55862	0.460000	0.39030	TGG	-	NULL		0.363	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA3	protein_coding	OTTHUMT00000335241.2	T	NM_019091		179058628	1	no_errors	NM_019091	genbank	human	validated	54_36p	missense	SNP	1	A
MPP4	58538	genome.wustl.edu	37	2	202550728	202550728	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:202550728G>C	ENST00000409474.3	-	6	613	c.406C>G	c.(406-408)Ccc>Gcc	p.P136A	MPP4_ENST00000359962.5_Missense_Mutation_p.P136A|MPP4_ENST00000409143.1_Missense_Mutation_p.P109A|MPP4_ENST00000396886.3_Intron|MPP4_ENST00000428900.2_Missense_Mutation_p.P136A|MPP4_ENST00000447335.2_Missense_Mutation_p.P136A|MPP4_ENST00000315506.7_Missense_Mutation_p.P136A	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	136	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)		p.P136A(1)		kidney(1)|lung(11)	12						GGGAGAAGGGGTTCAAAATCT	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											139.0	132.0	134.0					2																	202550728		1943	4150	6093	202258973	SO:0001583	missense	58538			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.406C>G	2.37:g.202550728G>C	ENSP00000387278:p.Pro136Ala		202258973	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	-	p.P136A	ENST00000409474.3	37	c.406	CCDS46491.1	2	.	.	.	.	.	.	.	.	.	.	G	25.2	4.616144	0.87359	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000359962;ENST00000428900;ENST00000409143;ENST00000447335	T;T;T;T;T;T	0.07216	3.25;3.21;3.25;3.24;3.32;3.25	5.4	5.4	0.78164	L27, C-terminal (1);PDZ/DHR/GLGF (1);L27 (2);	0.060948	0.64402	N	0.000002	T	0.31979	0.0814	M	0.75085	2.285	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.02574	-1.1139	10	0.87932	D	0	.	19.1748	0.93600	0.0:0.0:1.0:0.0	.	109;136;136;136;136;136	F6Q0Y6;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;Q96JB8	.;.;.;.;.;MPP4_HUMAN	A	136;136;136;136;109;136	ENSP00000387278:P136A;ENSP00000319363:P136A;ENSP00000353047:P136A;ENSP00000416781:P136A;ENSP00000387293:P109A;ENSP00000406160:P136A	ENSP00000319363:P136A	P	-	1	0	MPP4	202258973	1.000000	0.71417	0.899000	0.35326	0.944000	0.59088	9.402000	0.97298	2.542000	0.85734	0.655000	0.94253	CCC	-	NULL		0.488	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPP4	protein_coding	OTTHUMT00000335748.2	G			202258973	-1	no_errors	NM_033066	genbank	human	reviewed	54_36p	missense	SNP	1	C
CCDC88A	55704	genome.wustl.edu	37	2	55536106	55536106	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:55536106T>C	ENST00000436346.1	-	25	5067	c.4226A>G	c.(4225-4227)gAt>gGt	p.D1409G	CCDC88A_ENST00000422883.2_Missense_Mutation_p.D32G|CCDC88A_ENST00000263630.8_Missense_Mutation_p.D1409G|CCDC88A_ENST00000336838.6_Missense_Mutation_p.D1408G|CCDC88A_ENST00000413716.2_Missense_Mutation_p.D1408G|AC012358.8_ENST00000366287.4_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1409					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)	p.D1409G(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CCGATTAATATCTTTCTTAGA	0.353																																																1	Substitution - Missense(1)	ovary(1)	2											90.0	89.0	89.0					2																	55536106		2203	4300	6503	55389610	SO:0001583	missense	55704			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.4226A>G	2.37:g.55536106T>C	ENSP00000410608:p.Asp1409Gly		55389610	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	-	p.D1409G	ENST00000436346.1	37	c.4226		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.64|16.64	3.180626|3.180626	0.57800|0.57800	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000422883;ENST00000412148;ENST00000413716;ENST00000426576|ENST00000444458	T;T;T;T;T;T|.	0.45276|.	2.47;2.7;2.7;0.9;2.48;1.43|.	4.75|4.75	4.75|4.75	0.60458|0.60458	.|.	0.000000|.	0.49305|.	U|.	0.000143|.	T|T	0.55033|0.55033	0.1895|0.1895	L|L	0.44542|0.44542	1.39|1.39	0.34414|0.34414	D|D	0.696689|0.696689	B;P;B;P;B;P;P|.	0.48162|.	0.325;0.493;0.361;0.906;0.177;0.493;0.493|.	B;B;B;B;B;B;B|.	0.43386|.	0.275;0.234;0.118;0.418;0.141;0.234;0.234|.	T|T	0.64976|0.64976	-0.6280|-0.6280	10|5	0.66056|.	D|.	0.02|.	-12.3101|-12.3101	14.5506|14.5506	0.68065|0.68065	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1408;1409;1354;32;1409;1408;1408|.	B7ZM78;Q3V6T2-2;D6W5D1;B3KW94;Q3V6T2;Q3V6T2-3;Q3V6T2-4|.	.;.;.;.;GRDN_HUMAN;.;.|.	G|V	1408;1409;1409;32;454;1408;584|34	ENSP00000338728:D1408G;ENSP00000263630:D1409G;ENSP00000410608:D1409G;ENSP00000390012:D454G;ENSP00000404431:D1408G;ENSP00000405080:D584G|.	ENSP00000263630:D1409G|.	D|I	-|-	2|1	0|0	CCDC88A|CCDC88A	55389610|55389610	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.828000|5.828000	0.69307|0.69307	1.890000|1.890000	0.54733|0.54733	0.482000|0.482000	0.46254|0.46254	GAT|ATA	-	NULL		0.353	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	protein_coding		T	NM_017571		55389610	-1	no_errors	NM_018084	genbank	human	validated	54_36p	missense	SNP	1	C
CCT4	10575	genome.wustl.edu	37	2	62099658	62099658	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:62099658C>T	ENST00000394440.3	-	11	1487	c.1191G>A	c.(1189-1191)gtG>gtA	p.V397V	CCT4_ENST00000544185.1_Silent_p.V247V|CCT4_ENST00000461540.2_Intron|CCT4_ENST00000544079.1_Silent_p.V367V|CCT4_ENST00000538252.1_Silent_p.V341V|AC107081.5_ENST00000425779.1_RNA	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	397					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)	p.V397V(1)		breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			CTTCTTCAATCACCAGTTTGT	0.368																																																1	Substitution - coding silent(1)	ovary(1)	2											80.0	75.0	77.0					2																	62099658		2203	4300	6503	61953162	SO:0001819	synonymous_variant	10575				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.1191G>A	2.37:g.62099658C>T			61953162	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Silent	SNP	HMMPfam_Cpn60_TCP1;superfamily_GroEL equatorial domain-like;superfamily_GroEL apical domain-like;superfamily_GroEL-intermediate domain like	p.V397	ENST00000394440.3	37	c.1191	CCDS33206.1	2																																																																																			-	HMMPfam_Cpn60_TCP1		0.368	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT4	protein_coding	OTTHUMT00000325548.2	C			61953162	-1	no_errors	NM_006430	genbank	human	validated	54_36p	silent	SNP	1	T
REV1	51455	genome.wustl.edu	37	2	100055283	100055283	+	Silent	SNP	C	C	T	rs368812454		TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:100055283C>T	ENST00000258428.3	-	6	1221	c.993G>A	c.(991-993)acG>acA	p.T331T	REV1_ENST00000465835.1_5'UTR|REV1_ENST00000393445.3_Silent_p.T331T	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	331					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)	p.T331T(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCTTGCTAAACGTAGATACTG	0.413								Direct reversal of damage																																								1	Substitution - coding silent(1)	ovary(1)	2											189.0	177.0	181.0					2																	100055283		2203	4300	6503	99421715	SO:0001819	synonymous_variant	51455			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.993G>A	2.37:g.100055283C>T			99421715	O95941|Q53SI7|Q9C0J4|Q9NUP2	Silent	SNP	HMMPfam_IMS;HMMPfam_BRCT;superfamily_Lesion bypass DNA polymerase (Y-family) little finger domain;superfamily_BRCT domain;superfamily_DNA/RNA polymerases	p.T331	ENST00000258428.3	37	c.993	CCDS2045.1	2																																																																																			-	NULL		0.413	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	protein_coding	OTTHUMT00000253123.2	C	NM_016316		99421715	-1	no_errors	NM_016316	genbank	human	reviewed	54_36p	silent	SNP	0.05	T
ABCA12	26154	genome.wustl.edu	37	2	215840695	215840695	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr2:215840695A>G	ENST00000272895.7	-	34	5414	c.5195T>C	c.(5194-5196)aTa>aCa	p.I1732T	ABCA12_ENST00000389661.4_Missense_Mutation_p.I1414T	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1732					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.I1732T(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CTTGATGAGTATAGCCATGAT	0.483																																					Ovarian(66;664 1488 5121 34295)											1	Substitution - Missense(1)	ovary(1)	2											151.0	133.0	139.0					2																	215840695		2203	4300	6503	215548940	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5195T>C	2.37:g.215840695A>G	ENSP00000272895:p.Ile1732Thr		215548940	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	HMMPfam_ABC_tran;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.I1732T	ENST00000272895.7	37	c.5195	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	A	24.1	4.494154	0.85069	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.95588	-3.75;-3.75	5.87	5.87	0.94306	.	0.158435	0.44285	D	0.000468	D	0.93138	0.7815	N	0.24115	0.695	0.80722	D	1	P;P	0.52842	0.956;0.597	P;P	0.47528	0.478;0.549	D	0.94268	0.7508	10	0.87932	D	0	.	16.5764	0.84681	1.0:0.0:0.0:0.0	.	1732;1414	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	T	1732;1414	ENSP00000272895:I1732T;ENSP00000374312:I1414T	ENSP00000272895:I1732T	I	-	2	0	ABCA12	215548940	0.997000	0.39634	0.563000	0.28383	0.900000	0.52787	9.287000	0.95975	2.371000	0.80710	0.533000	0.62120	ATA	-	NULL		0.483	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	protein_coding	OTTHUMT00000337111.1	A	NM_173076		215548940	-1	no_errors	NM_173076	genbank	human	reviewed	54_36p	missense	SNP	0.96	G
BTBD3	22903	genome.wustl.edu	37	20	11903398	11903398	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr20:11903398C>G	ENST00000405977.1	+	5	1278	c.653C>G	c.(652-654)aCc>aGc	p.T218S	BTBD3_ENST00000488503.1_3'UTR|BTBD3_ENST00000378226.2_Missense_Mutation_p.T218S|BTBD3_ENST00000254977.3_Missense_Mutation_p.T157S|BTBD3_ENST00000399006.2_Missense_Mutation_p.T157S	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	218					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.T218S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						TTCCTGGAGACCAGCCTGAGT	0.547																																																1	Substitution - Missense(1)	ovary(1)	20											105.0	103.0	104.0					20																	11903398		2203	4300	6503	11851398	SO:0001583	missense	22903			AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.653C>G	20.37:g.11903398C>G	ENSP00000384545:p.Thr218Ser		11851398	D3DW19|Q5JY73	Missense_Mutation	SNP	-	p.T218S	ENST00000405977.1	37	c.653	CCDS13113.1	20	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322187	0.60634	.	.	ENSG00000132640	ENST00000254977;ENST00000399006;ENST00000405977;ENST00000378226;ENST00000455911	T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08	5.95	5.02	0.67125	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.20495	0.0493	L	0.35542	1.07	0.80722	D	1	P	0.42827	0.791	P	0.46208	0.507	T	0.02512	-1.1148	10	0.10636	T	0.68	.	14.1156	0.65151	0.0:0.9287:0.0:0.0713	.	218	Q9Y2F9	BTBD3_HUMAN	S	157;157;218;218;107	ENSP00000254977:T157S;ENSP00000381971:T157S;ENSP00000384545:T218S;ENSP00000367471:T218S;ENSP00000408817:T107S	ENSP00000254977:T157S	T	+	2	0	BTBD3	11851398	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	1.535000	0.49220	0.650000	0.86243	ACC	-	NULL		0.547	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD3	protein_coding	OTTHUMT00000078021.3	C			11851398	1	no_errors	NM_014962	genbank	human	validated	54_36p	missense	SNP	1	G
TPX2	22974	genome.wustl.edu	37	20	30358241	30358241	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr20:30358241T>C	ENST00000300403.6	+	6	980	c.452T>C	c.(451-453)aTc>aCc	p.I151T	TPX2_ENST00000340513.4_Missense_Mutation_p.I151T	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	151					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)	p.I151T(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			CCTGTAATCATCGATGAAATT	0.388																																																1	Substitution - Missense(1)	ovary(1)	20											102.0	104.0	103.0					20																	30358241		2203	4300	6503	29821902	SO:0001583	missense	22974			AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.452T>C	20.37:g.30358241T>C	ENSP00000300403:p.Ile151Thr		29821902	Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	HMMPfam_TPX2;HMMPfam_Aurora-A_bind	p.I151T	ENST00000300403.6	37	c.452	CCDS13190.1	20	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.827018	0.00584	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.29142	1.58	4.42	-0.89	0.10577	.	0.930262	0.09012	N	0.861392	T	0.12987	0.0315	N	0.14661	0.345	0.09310	N	1	B;B	0.34103	0.437;0.146	B;B	0.30401	0.115;0.038	T	0.26224	-1.0109	10	0.14252	T	0.57	1.6377	4.2809	0.10833	0.0:0.212:0.3884:0.3997	.	151;151	Q96RR5;Q9ULW0	.;TPX2_HUMAN	T	151	ENSP00000341145:I151T	ENSP00000300403:I151T	I	+	2	0	TPX2	29821902	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.025000	0.13577	-0.042000	0.13535	-1.219000	0.01604	ATC	-	NULL		0.388	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPX2	protein_coding	OTTHUMT00000078569.2	T			29821902	1	no_errors	NM_012112	genbank	human	validated	54_36p	missense	SNP		C
PAK7	57144	genome.wustl.edu	37	20	9546755	9546755	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr20:9546755G>C	ENST00000378429.3	-	6	1813	c.1267C>G	c.(1267-1269)Cag>Gag	p.Q423E	PAK7_ENST00000353224.5_Missense_Mutation_p.Q423E|PAK7_ENST00000378423.1_Missense_Mutation_p.Q423E	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	423	Linker.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q423K(1)|p.Q423E(1)		NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			CTGGAGGGCTGCTGGTCGGAG	0.622																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	20											56.0	58.0	57.0					20																	9546755		2203	4300	6503	9494755	SO:0001583	missense	57144			AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1267C>G	20.37:g.9546755G>C	ENSP00000367686:p.Gln423Glu		9494755	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	PBD;HMMPfam_PBD;Pkinase;HMMPfam_Pkinase	p.Q423E	ENST00000378429.3	37	c.1267	CCDS13107.1	20	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953083	0.34471	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423;ENST00000439520	T;T;T	0.72725	-0.68;-0.68;-0.68	5.66	5.66	0.87406	.	0.109437	0.64402	D	0.000004	T	0.60843	0.2300	L	0.28274	0.84	0.58432	D	0.999999	B;B	0.11235	0.004;0.004	B;B	0.12837	0.008;0.008	T	0.54193	-0.8330	9	.	.	.	.	19.7589	0.96306	0.0:0.0:1.0:0.0	.	423;423	B0AZM9;Q9P286	.;PAK7_HUMAN	E	423;423;423;371	ENSP00000367686:Q423E;ENSP00000322957:Q423E;ENSP00000367679:Q423E	.	Q	-	1	0	PAK7	9494755	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.373000	0.66162	2.654000	0.90174	0.585000	0.79938	CAG	-	NULL		0.622	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK7	protein_coding	OTTHUMT00000077962.1	G			9494755	-1	no_errors	NM_020341	genbank	human	reviewed	54_36p	missense	SNP	1	C
RNF114	55905	genome.wustl.edu	37	20	48558183	48558183	+	Nonsense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr20:48558183C>T	ENST00000244061.2	+	2	228	c.226C>T	c.(226-228)Cga>Tga	p.R76*	snoU13_ENST00000459122.1_RNA	NM_018683.3	NP_061153.1	Q9Y508	RN114_HUMAN	ring finger protein 114	76					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.R76*(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5						ACCTGGCGTCCGAGCCGTGGA	0.547																																																1	Substitution - Nonsense(1)	ovary(1)	20											113.0	110.0	111.0					20																	48558183		2203	4300	6503	47991590	SO:0001587	stop_gained	55905			AF265215	CCDS33482.1	20q13	2013-01-09	2008-06-16	2008-06-16	ENSG00000124226	ENSG00000124226		"""RING-type (C3HC4) zinc fingers"""	13094	protein-coding gene	gene with protein product		612451	"""zinc finger protein 313"""	ZNF313		18364390	Standard	NM_018683		Approved	PSORS12	uc002xux.3	Q9Y508	OTTHUMG00000032709	ENST00000244061.2:c.226C>T	20.37:g.48558183C>T	ENSP00000244061:p.Arg76*		47991590	B2RDQ9|B4DWY5|E1P627|Q6N0B0	Nonsense_Mutation	SNP	-	p.R76*	ENST00000244061.2	37	c.226	CCDS33482.1	20	.	.	.	.	.	.	.	.	.	.	C	35	5.531105	0.96446	.	.	ENSG00000124226	ENST00000449816;ENST00000244061	.	.	.	6.16	5.15	0.70609	.	0.230899	0.43579	D	0.000542	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	0.9536	13.6427	0.62260	0.1975:0.8025:0.0:0.0	.	.	.	.	X	76	.	ENSP00000244061:R76X	R	+	1	2	RNF114	47991590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.852000	0.48310	2.937000	0.99478	0.650000	0.86243	CGA	-	NULL		0.547	RNF114-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	RNF114	protein_coding	OTTHUMT00000079663.1	C	NM_018683		47991590	1	no_errors	NM_018683	genbank	human	validated	54_36p	nonsense	SNP	0.99	T
NCAM2	4685	genome.wustl.edu	37	21	22710714	22710714	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr21:22710714C>T	ENST00000400546.1	+	8	1153	c.904C>T	c.(904-906)Cct>Tct	p.P302S	NCAM2_ENST00000535285.1_Missense_Mutation_p.P327S|NCAM2_ENST00000284894.7_Missense_Mutation_p.P160S	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	302	Ig-like C2-type 4.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P302S(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TACAGTACAGCCTCACATAAT	0.358																																																1	Substitution - Missense(1)	ovary(1)	21											52.0	51.0	51.0					21																	22710714		1838	4079	5917	21632585	SO:0001583	missense	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.904C>T	21.37:g.22710714C>T	ENSP00000383392:p.Pro302Ser		21632585	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	HMMPfam_fn3;superfamily_Fibronectin type III;HMMPfam_I-set;HMMPfam_ig;superfamily_Immunoglobulin	p.P302S	ENST00000400546.1	37	c.904	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	C	26.0	4.699806	0.88924	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.78126	-1.15;-1.08;0.63	5.8	5.8	0.92144	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91788	0.7402	H	0.94771	3.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93456	0.6806	10	0.87932	D	0	-14.2816	18.6141	0.91296	0.0:1.0:0.0:0.0	.	327;160;302	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	S	302;160;327	ENSP00000383392:P302S;ENSP00000284894:P160S;ENSP00000441887:P327S	ENSP00000284894:P160S	P	+	1	0	NCAM2	21632585	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.312000	0.65792	2.736000	0.93811	0.591000	0.81541	CCT	-	NULL		0.358	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	protein_coding	OTTHUMT00000170915.1	C	NM_004540		21632585	1	no_errors	NM_004540	genbank	human	reviewed	54_36p	missense	SNP	1	T
APP	351	genome.wustl.edu	37	21	27484437	27484437	+	Silent	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr21:27484437C>A	ENST00000346798.3	-	2	117	c.84G>T	c.(82-84)ctG>ctT	p.L28L	APP_ENST00000448388.2_5'UTR|APP_ENST00000358918.3_Silent_p.L28L|APP_ENST00000439274.2_Intron|APP_ENST00000359726.3_Silent_p.L28L|APP_ENST00000440126.3_Silent_p.L23L|APP_ENST00000354192.3_Intron|APP_ENST00000348990.5_Silent_p.L28L|APP_ENST00000357903.3_Silent_p.L28L|APP_ENST00000474136.1_5'UTR	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	28					adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)	p.L28L(1)		endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				GTTCAGCCAGCAGGCCAGCAT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	21											121.0	107.0	112.0					21																	27484437		2203	4300	6503	26406308	SO:0001819	synonymous_variant	351			M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.84G>T	21.37:g.27484437C>A			26406308	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Silent	SNP	HMMPfam_Kunitz_BPTI;superfamily_BPTI-like;HMMPfam_A4_EXTRA;superfamily_Amyloid beta a4 protein copper binding domain (domain 2);HMMPfam_Beta-APP;superfamily_A heparin-binding domain;superfamily_CAPPD an extracellular domain of amyloid beta A4 protein	p.L28	ENST00000346798.3	37	c.84	CCDS13576.1	21																																																																																			-	HMMPfam_A4_EXTRA		0.483	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APP	protein_coding	OTTHUMT00000171340.1	C	NM_000484		26406308	-1	no_errors	NM_000484	genbank	human	reviewed	54_36p	silent	SNP	1	A
CLDN17	26285	genome.wustl.edu	37	21	31538792	31538792	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr21:31538792T>A	ENST00000286808.3	-	1	179	c.144A>T	c.(142-144)gaA>gaT	p.E48D		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	48					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)	p.E48D(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						TCCAGAGCCCTTCCCAGAGCC	0.547																																																1	Substitution - Missense(1)	ovary(1)	21											70.0	77.0	75.0					21																	31538792		2203	4300	6503	30460663	SO:0001583	missense	26285			AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.144A>T	21.37:g.31538792T>A	ENSP00000286808:p.Glu48Asp		30460663	Q3MJB5|Q6UY37	Missense_Mutation	SNP	-	p.E48D	ENST00000286808.3	37	c.144	CCDS13586.1	21	.	.	.	.	.	.	.	.	.	.	T	19.67	3.870970	0.72065	.	.	ENSG00000156282	ENST00000286808	D	0.89123	-2.47	5.22	4.07	0.47477	.	0.000000	0.85682	D	0.000000	D	0.93074	0.7795	M	0.77313	2.365	0.50171	D	0.999857	D	0.89917	1.0	D	0.85130	0.997	D	0.92100	0.5687	10	0.49607	T	0.09	.	9.0443	0.36336	0.0:0.1509:0.0:0.8491	.	48	P56750	CLD17_HUMAN	D	48	ENSP00000286808:E48D	ENSP00000286808:E48D	E	-	3	2	CLDN17	30460663	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.198000	0.32223	1.117000	0.41842	0.533000	0.62120	GAA	-	NULL		0.547	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN17	protein_coding	OTTHUMT00000182261.1	T	NM_012131		30460663	-1	no_errors	NM_012131	genbank	human	provisional	54_36p	missense	SNP	1	A
TBX1	6899	genome.wustl.edu	37	22	19751755	19751755	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr22:19751755C>T	ENST00000329705.7	+	5	719	c.590C>T	c.(589-591)cCg>cTg	p.P197L	TBX1_ENST00000332710.4_Missense_Mutation_p.P197L|TBX1_ENST00000359500.3_Missense_Mutation_p.P197L	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1	197					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)	p.P197L(1)		breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				CACTACCACCCGGACTCGCCT	0.662																																																1	Substitution - Missense(1)	ovary(1)	22											71.0	57.0	62.0					22																	19751755		2203	4300	6503	18131755	SO:0001583	missense	6899			AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.590C>T	22.37:g.19751755C>T	ENSP00000331176:p.Pro197Leu		18131755	C6G493|C6G494|O43436|Q96RJ2	Missense_Mutation	SNP	HMMPfam_T-box;superfamily_p53-like transcription factors	p.P197L	ENST00000329705.7	37	c.590	CCDS13766.1	22	.	.	.	.	.	.	.	.	.	.	C	33	5.249690	0.95305	.	.	ENSG00000184058	ENST00000332710;ENST00000329705;ENST00000359500	D;D;D	0.90620	-2.7;-2.7;-2.7	4.75	4.75	0.60458	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.96716	0.8928	H	0.94503	3.545	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	D	0.98063	1.0394	10	0.87932	D	0	.	17.418	0.87506	0.0:1.0:0.0:0.0	.	197;197;197	Q152R5;O43435;D9ZGG0	.;TBX1_HUMAN;.	L	197	ENSP00000331791:P197L;ENSP00000331176:P197L;ENSP00000352483:P197L	ENSP00000331176:P197L	P	+	2	0	TBX1	18131755	1.000000	0.71417	0.930000	0.37139	0.854000	0.48673	7.798000	0.85924	2.206000	0.71126	0.558000	0.71614	CCG	-	HMMPfam_T-box		0.662	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TBX1	protein_coding	OTTHUMT00000318033.1	C	NM_080647		18131755	1	no_errors	NM_080647	genbank	human	reviewed	54_36p	missense	SNP	1	T
GGT5	2687	genome.wustl.edu	37	22	24615945	24615945	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr22:24615945C>A	ENST00000327365.4	-	12	2170	c.1754G>T	c.(1753-1755)gGc>gTc	p.G585V	GGT5_ENST00000263112.7_Missense_Mutation_p.G553V|GGT5_ENST00000398292.3_Missense_Mutation_p.G586V|GGT5_ENST00000418439.2_Missense_Mutation_p.G509V	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	585					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)	p.G585V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						GTCTTAGTAGCCTGCGGCCTC	0.632																																																1	Substitution - Missense(1)	ovary(1)	22											56.0	50.0	52.0					22																	24615945		2203	4300	6503	22945945	SO:0001583	missense	2687			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.1754G>T	22.37:g.24615945C>A	ENSP00000330080:p.Gly585Val		22945945	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	-	p.G586V	ENST00000327365.4	37	c.1757	CCDS13825.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.351863|2.351863	0.41700|0.41700	.|.	.|.	ENSG00000099998|ENSG00000099998	ENST00000425408|ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	.|T;T;T;T	.|0.30981	.|1.51;1.51;1.51;1.51	4.65|4.65	3.6|3.6	0.41247|0.41247	.|.	.|0.056003	.|0.64402	.|D	.|0.000001	T|T	0.59059|0.59059	0.2166|0.2166	M|M	0.88181|0.88181	2.935|2.935	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.999;0.999;0.999;1.0	T|T	0.66337|0.66337	-0.5949|-0.5949	5|10	.|0.87932	.|D	.|0	-28.1867|-28.1867	11.2842|11.2842	0.49212|0.49212	0.0:0.814:0.186:0.0|0.0:0.814:0.186:0.0	.|.	.|509;553;586;585	.|E7EUG3;P36269-2;Q6GMP0;P36269	.|.;.;.;GGT5_HUMAN	S|V	219|585;553;500;586;509	.|ENSP00000330080:G585V;ENSP00000263112:G553V;ENSP00000381340:G586V;ENSP00000392146:G509V	.|ENSP00000263112:G553V	A|G	-|-	1|2	0|0	GGT5|GGT5	22945945|22945945	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.098000|0.098000	0.18820|0.18820	4.831000|4.831000	0.62752|0.62752	1.232000|1.232000	0.43678|0.43678	0.650000|0.650000	0.86243|0.86243	GCT|GGC	-	NULL		0.632	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GGT5	protein_coding	OTTHUMT00000320119.1	C	NM_004121		22945945	-1	no_errors	NM_001099781	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
IGSF10	285313	genome.wustl.edu	37	3	151164524	151164524	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr3:151164524G>C	ENST00000282466.3	-	4	3244	c.3245C>G	c.(3244-3246)cCa>cGa	p.P1082R		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1082					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.P1082R(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGCAGCACTTGGAAAAGACAA	0.488																																																1	Substitution - Missense(1)	ovary(1)	3											131.0	133.0	132.0					3																	151164524		2203	4300	6503	152647214	SO:0001583	missense	285313			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.3245C>G	3.37:g.151164524G>C	ENSP00000282466:p.Pro1082Arg		152647214	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	-	p.P1082R	ENST00000282466.3	37	c.3245	CCDS3160.1	3	.	.	.	.	.	.	.	.	.	.	G	14.58	2.576495	0.45902	.	.	ENSG00000152580	ENST00000282466	T	0.68025	-0.3	5.46	3.65	0.41850	.	0.169667	0.28151	N	0.016403	T	0.62073	0.2398	L	0.34521	1.04	0.09310	N	1	P	0.50272	0.933	P	0.49665	0.618	T	0.55451	-0.8139	10	0.59425	D	0.04	.	10.6076	0.45402	0.2168:0.0:0.7832:0.0	.	1082	Q6WRI0	IGS10_HUMAN	R	1082	ENSP00000282466:P1082R	ENSP00000282466:P1082R	P	-	2	0	IGSF10	152647214	0.563000	0.26594	0.001000	0.08648	0.017000	0.09413	1.719000	0.38011	0.663000	0.31027	0.591000	0.81541	CCA	-	NULL		0.488	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	protein_coding	OTTHUMT00000357782.1	G	NM_178822		152647214	-1	no_errors	NM_178822	genbank	human	provisional	54_36p	missense	SNP	0.02	C
OR5K2	402135	genome.wustl.edu	37	3	98217146	98217146	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr3:98217146G>A	ENST00000427338.1	+	1	699	c.622G>A	c.(622-624)Gtc>Atc	p.V208I	CLDND1_ENST00000502288.1_Intron	NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V208I(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TTCAGTTCAAGTCTTTACCAT	0.378																																																1	Substitution - Missense(1)	ovary(1)	3											188.0	184.0	185.0					3																	98217146		2203	4298	6501	99699836	SO:0001583	missense	402135			AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.622G>A	3.37:g.98217146G>A	ENSP00000393889:p.Val208Ile		99699836	B2RN70|Q6IF47	Missense_Mutation	SNP	-	p.V208I	ENST00000427338.1	37	c.622	CCDS33804.1	3	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.464119	0.00171	.	.	ENSG00000231861	ENST00000427338	T	0.37411	1.2	2.82	-0.209	0.13180	GPCR, rhodopsin-like superfamily (1);	0.190438	0.25391	N	0.031008	T	0.13457	0.0326	N	0.12422	0.21	0.18873	N	0.999989	B	0.06786	0.001	B	0.10450	0.005	T	0.32052	-0.9921	10	0.02654	T	1	-6.68	5.7165	0.17962	0.4053:0.0:0.5947:0.0	.	208	Q8NHB8	OR5K2_HUMAN	I	208	ENSP00000393889:V208I	ENSP00000393889:V208I	V	+	1	0	OR5K2	99699836	0.000000	0.05858	0.015000	0.15790	0.050000	0.14768	-0.611000	0.05622	-0.072000	0.12864	0.313000	0.20887	GTC	-	NULL		0.378	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K2	protein_coding	OTTHUMT00000359020.2	G			99699836	1	no_errors	NM_001004737	genbank	human	provisional	54_36p	missense	SNP		A
PHC3	80012	genome.wustl.edu	37	3	169847157	169847157	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr3:169847157T>G	ENST00000494943.1	-	8	1135	c.1067A>C	c.(1066-1068)cAg>cCg	p.Q356P	PHC3_ENST00000495893.2_Missense_Mutation_p.Q368P|PHC3_ENST00000467570.1_Missense_Mutation_p.Q315P			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	356	Gln-rich.|Pro-rich.				multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Q337P(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			GCCATGGTTCTGGAGTGGTAT	0.483																																																1	Substitution - Missense(1)	ovary(1)	3											203.0	204.0	204.0					3																	169847157		2050	4186	6236	171329851	SO:0001583	missense	80012				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.1067A>C	3.37:g.169847157T>G	ENSP00000420271:p.Gln356Pro		171329851	A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	-	p.Q368P	ENST00000494943.1	37	c.1103		3	.	.	.	.	.	.	.	.	.	.	T	3.840	-0.034045	0.07543	.	.	ENSG00000173889	ENST00000494943;ENST00000495893;ENST00000467570;ENST00000484931	T;T	0.32753	1.44;1.44	5.49	-2.28	0.06826	.	0.418236	0.22714	N	0.056530	T	0.18087	0.0434	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.09022	0.002;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.16988	-1.0384	10	0.13470	T	0.59	-0.7931	18.0781	0.89433	0.0:0.0:0.6744:0.3256	.	315;315;356;368	B4E2T1;E7EX82;Q8NDX5;Q8NDX5-7	.;.;PHC3_HUMAN;.	P	356;368;315;194	ENSP00000420271:Q356P;ENSP00000420294:Q368P	ENSP00000419089:Q315P	Q	-	2	0	PHC3	171329851	0.843000	0.29541	0.954000	0.39281	0.917000	0.54804	0.574000	0.23714	-0.229000	0.09854	-0.316000	0.08728	CAG	-	NULL		0.483	PHC3-004	KNOWN	basic	protein_coding	PHC3	protein_coding	OTTHUMT00000352182.3	T	NM_024947		171329851	-1	no_errors	NM_024947	genbank	human	validated	54_36p	missense	SNP	0.96	G
ADAM29	11086	genome.wustl.edu	37	4	175897680	175897680	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr4:175897680G>T	ENST00000359240.3	+	5	1674	c.1004G>T	c.(1003-1005)gGt>gTt	p.G335V	ADAM29_ENST00000404450.4_Missense_Mutation_p.G335V|ADAM29_ENST00000445694.1_Missense_Mutation_p.G335V|ADAM29_ENST00000514159.1_Missense_Mutation_p.G335V|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	335	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G335V(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CATCATCTAGGTCATAATTTG	0.393																																					Ovarian(140;1727 1835 21805 25838 41440)											1	Substitution - Missense(1)	ovary(1)	4											154.0	150.0	152.0					4																	175897680		2203	4300	6503	176134255	SO:0001583	missense	11086			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1004G>T	4.37:g.175897680G>T	ENSP00000352177:p.Gly335Val		176134255	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	HMMPfam_Reprolysin;HMMPfam_Disintegrin;HMMPfam_Pep_M12B_propep;HMMPfam_ADAM_CR	p.G335V	ENST00000359240.3	37	c.1004	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697400	0.30142	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	3.6	2.74	0.32292	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.32769	U	0.005665	T	0.71584	0.3357	H	0.95260	3.645	0.50171	D	0.999853	D	0.89917	1.0	D	0.97110	1.0	T	0.78795	-0.2064	9	.	.	.	.	11.2353	0.48936	0.0:0.1879:0.8121:0.0	.	335	Q9UKF5	ADA29_HUMAN	V	335	ENSP00000352177:G335V;ENSP00000414544:G335V;ENSP00000384229:G335V;ENSP00000423517:G335V	.	G	+	2	0	ADAM29	176134255	1.000000	0.71417	0.929000	0.37066	0.019000	0.09904	5.399000	0.66314	1.063000	0.40649	0.579000	0.79373	GGT	-	HMMPfam_Reprolysin		0.393	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	protein_coding		G			176134255	1	no_errors	NM_014269	genbank	human	reviewed	54_36p	missense	SNP	0.56	T
ADAM29	11086	genome.wustl.edu	37	4	175897769	175897769	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr4:175897769A>G	ENST00000359240.3	+	5	1763	c.1093A>G	c.(1093-1095)Aaa>Gaa	p.K365E	ADAM29_ENST00000404450.4_Missense_Mutation_p.K365E|ADAM29_ENST00000445694.1_Missense_Mutation_p.K365E|ADAM29_ENST00000514159.1_Missense_Mutation_p.K365E|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	365	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.K365E(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		ACCAATAACTAAATTTAGCAA	0.368																																					Ovarian(140;1727 1835 21805 25838 41440)											1	Substitution - Missense(1)	ovary(1)	4											119.0	118.0	119.0					4																	175897769		2203	4300	6503	176134344	SO:0001583	missense	11086			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1093A>G	4.37:g.175897769A>G	ENSP00000352177:p.Lys365Glu		176134344	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	HMMPfam_Reprolysin;HMMPfam_Disintegrin;HMMPfam_Pep_M12B_propep;HMMPfam_ADAM_CR	p.K365E	ENST00000359240.3	37	c.1093	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	A	14.86	2.661409	0.47572	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	3.6	-2.46	0.06461	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	2.177720	0.03186	U	0.172723	T	0.50360	0.1611	L	0.31371	0.925	0.09310	N	1	P	0.41978	0.767	B	0.42112	0.376	T	0.44772	-0.9306	9	.	.	.	.	6.7165	0.23306	0.4584:0.45:0.0916:0.0	.	365	Q9UKF5	ADA29_HUMAN	E	365	ENSP00000352177:K365E;ENSP00000414544:K365E;ENSP00000384229:K365E;ENSP00000423517:K365E	.	K	+	1	0	ADAM29	176134344	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.803000	0.04540	-0.375000	0.07955	0.472000	0.43445	AAA	-	HMMPfam_Reprolysin		0.368	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	protein_coding		A			176134344	1	no_errors	NM_014269	genbank	human	reviewed	54_36p	missense	SNP		G
ZNF595	152687	genome.wustl.edu	37	4	53601	53601	+	Intron	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr4:53601G>A	ENST00000509152.2	+	1	188				ZNF595_ENST00000339368.6_Intron|ZNF595_ENST00000526473.2_Intron			Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		CCGCAGCCCCGCACCTTCCCT	0.746																																																0			4																																								43601	SO:0001627	intron_variant	3166			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.3+216G>A	4.37:g.53601G>A			43601		Silent	SNP	-	p.C124	ENST00000509152.2	37	c.372		4																																																																																			-	NULL		0.746	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	HMX1	protein_coding	OTTHUMT00000357817.2	G	NM_182524		43601	-1	no_start_codon:pseudogene:no_stop_codon	NM_018942	genbank	human	validated	54_36p	silent	SNP	0	A
TLR1	7096	genome.wustl.edu	37	4	38799027	38799027	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr4:38799027C>T	ENST00000502213.2	-	3	1655	c.1426G>A	c.(1426-1428)Gct>Act	p.A476T	TLR1_ENST00000308979.2_Missense_Mutation_p.A476T|TLR1_ENST00000510552.1_5'Flank			Q15399	TLR1_HUMAN	toll-like receptor 1	476					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.A476T(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						GAATTGAAAGCAACATTGAGT	0.398																																					GBM(5;216 373 40795 46382)											1	Substitution - Missense(1)	ovary(1)	4											77.0	82.0	80.0					4																	38799027		2203	4298	6501	38475422	SO:0001583	missense	7096			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.1426G>A	4.37:g.38799027C>T	ENSP00000421259:p.Ala476Thr		38475422	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	-	p.A476T	ENST00000502213.2	37	c.1426	CCDS33973.1	4	.	.	.	.	.	.	.	.	.	.	C	18.47	3.631635	0.67015	.	.	ENSG00000174125	ENST00000308979;ENST00000502213	T;T	0.56941	0.43;0.43	4.61	4.61	0.57282	.	0.097855	0.44097	D	0.000482	T	0.54806	0.1881	N	0.16708	0.43	0.36856	D	0.888167	D	0.60575	0.988	D	0.67382	0.951	T	0.64947	-0.6287	10	0.87932	D	0	.	13.0242	0.58806	0.161:0.839:0.0:0.0	.	476	Q15399	TLR1_HUMAN	T	476	ENSP00000354932:A476T;ENSP00000421259:A476T	ENSP00000354932:A476T	A	-	1	0	TLR1	38475422	0.994000	0.37717	0.907000	0.35723	0.992000	0.81027	3.059000	0.49947	2.548000	0.85928	0.650000	0.86243	GCT	-	NULL		0.398	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	protein_coding	OTTHUMT00000360510.3	C			38475422	-1	no_errors	NM_003263	genbank	human	reviewed	54_36p	missense	SNP	0.96	T
CEP135	9662	genome.wustl.edu	37	4	56878120	56878120	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr4:56878120G>T	ENST00000257287.4	+	21	2895	c.2771G>T	c.(2770-2772)aGa>aTa	p.R924I		NM_025009.4	NP_079285.2	Q66GS9	CP135_HUMAN	centrosomal protein 135kDa	924					centriole replication (GO:0007099)|centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)	protein C-terminus binding (GO:0008022)	p.R924I(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(26)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	50	Glioma(25;0.08)|all_neural(26;0.101)					CTTCGAGAAAGAGTGGAGCTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	4											54.0	55.0	55.0					4																	56878120		2203	4300	6503	56572877	SO:0001583	missense	9662			AB014535	CCDS33986.1	4q12	2014-02-20	2005-12-02	2005-12-02	ENSG00000174799	ENSG00000174799			29086	protein-coding gene	gene with protein product		611423	"""KIAA0635"", ""centrosomal protein 4"""	KIAA0635, CEP4		9734811, 14654843	Standard	NM_025009		Approved	FLJ13621	uc003hbi.4	Q66GS9	OTTHUMG00000160748	ENST00000257287.4:c.2771G>T	4.37:g.56878120G>T	ENSP00000257287:p.Arg924Ile		56572877	B2RMY0|O75130|Q58F25|Q9H8H7	Missense_Mutation	SNP	-	p.R924I	ENST00000257287.4	37	c.2771	CCDS33986.1	4	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059103	0.76074	.	.	ENSG00000174799	ENST00000257287	T	0.14266	2.52	5.69	4.85	0.62838	.	0.083754	0.85682	D	0.000000	T	0.37156	0.0993	M	0.76574	2.34	0.58432	D	0.999999	D	0.71674	0.998	D	0.71184	0.972	T	0.21245	-1.0251	10	0.56958	D	0.05	.	15.1561	0.72743	0.0679:0.0:0.9321:0.0	.	924	Q66GS9	CP135_HUMAN	I	924	ENSP00000257287:R924I	ENSP00000257287:R924I	R	+	2	0	CEP135	56572877	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	4.464000	0.60134	1.542000	0.49330	-0.150000	0.13652	AGA	-	NULL		0.358	CEP135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP135	protein_coding	OTTHUMT00000362092.2	G	NM_025009		56572877	1	no_errors	NM_025009	genbank	human	validated	54_36p	missense	SNP	1	T
HPSE	10855	genome.wustl.edu	37	4	84231915	84231915	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr4:84231915C>T	ENST00000405413.2	-	6	938	c.802G>A	c.(802-804)Gtt>Att	p.V268I	HPSE_ENST00000513463.1_Missense_Mutation_p.V210I|HPSE_ENST00000311412.5_Missense_Mutation_p.V268I|HPSE_ENST00000512196.1_Missense_Mutation_p.V268I	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	268					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)	p.V268I(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	GGCTGACCAACATCAGGACCA	0.383																																																1	Substitution - Missense(1)	ovary(1)	4											209.0	201.0	204.0					4																	84231915		2203	4300	6503	84450939	SO:0001583	missense	10855			AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.802G>A	4.37:g.84231915C>T	ENSP00000384262:p.Val268Ile		84450939	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Missense_Mutation	SNP	-	p.V268I	ENST00000405413.2	37	c.802	CCDS3602.1	4	.	.	.	.	.	.	.	.	.	.	C	3.245	-0.154470	0.06544	.	.	ENSG00000173083	ENST00000311412;ENST00000405413;ENST00000512196;ENST00000513463	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.11	-4.78	0.03209	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.643383	0.16294	N	0.220767	T	0.12433	0.0302	N	0.05534	-0.03	0.24037	N	0.996098	B;B;B	0.25105	0.011;0.025;0.118	B;B;B	0.25140	0.013;0.05;0.058	T	0.26608	-1.0098	10	0.07030	T	0.85	-2.178	15.3376	0.74269	0.0:0.319:0.0:0.681	.	268;210;268	E9PCA9;E9PGR1;Q9Y251	.;.;HPSE_HUMAN	I	268;268;268;210	ENSP00000308107:V268I;ENSP00000384262:V268I;ENSP00000423265:V268I;ENSP00000421365:V210I	ENSP00000308107:V268I	V	-	1	0	HPSE	84450939	0.001000	0.12720	0.011000	0.14972	0.928000	0.56348	-0.754000	0.04787	-1.049000	0.03234	0.585000	0.79938	GTT	-	NULL		0.383	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HPSE	protein_coding	OTTHUMT00000252812.2	C	NM_006665		84450939	-1	no_errors	NM_001098540	genbank	human	validated	54_36p	missense	SNP	0.51	T
FAT1	2195	genome.wustl.edu	37	4	187630233	187630233	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr4:187630233G>A	ENST00000441802.2	-	2	958	c.749C>T	c.(748-750)gCc>gTc	p.A250V		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	250	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A250V(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ACATTCATTGGCCTGTTCGAT	0.522										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)											1	Substitution - Missense(1)	ovary(1)	4											156.0	156.0	156.0					4																	187630233		2181	4281	6462	187867227	SO:0001583	missense	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.749C>T	4.37:g.187630233G>A	ENSP00000406229:p.Ala250Val		187867227		Missense_Mutation	SNP	-	p.A250V	ENST00000441802.2	37	c.749	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	4.320	0.058742	0.08339	.	.	ENSG00000083857	ENST00000441802;ENST00000260147;ENST00000509647	T;T	0.58358	0.34;0.34	5.04	5.04	0.67666	Cadherin (3);	0.000000	0.85682	D	0.000000	T	0.46600	0.1401	N	0.02830	-0.485	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.42666	-0.9438	10	0.06099	T	0.92	.	18.5672	0.91120	0.0:0.0:1.0:0.0	.	250	Q14517	FAT1_HUMAN	V	250	ENSP00000406229:A250V;ENSP00000423736:A250V	ENSP00000260147:A250V	A	-	2	0	FAT1	187867227	1.000000	0.71417	0.991000	0.47740	0.101000	0.19017	7.674000	0.83992	2.613000	0.88420	0.591000	0.81541	GCC	-	NULL		0.522	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	protein_coding	OTTHUMT00000360209.3	G	NM_005245		187867227	-1	no_errors	NM_005245	genbank	human	reviewed	54_36p	missense	SNP	1	A
TSSK1B	83942	genome.wustl.edu	37	5	112769970	112769970	+	Silent	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:112769970G>A	ENST00000390666.3	-	1	758	c.567C>T	c.(565-567)ggC>ggT	p.G189G	CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|CTD-2201G3.1_ENST00000416046.2_RNA|MCC_ENST00000408903.3_Intron	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.G189G(1)		large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		GGTAGGGAATGCCCTGCAGCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	5											55.0	54.0	54.0					5																	112769970		2202	4300	6502	112797869	SO:0001819	synonymous_variant	83942			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.567C>T	5.37:g.112769970G>A			112797869	B2R8D9	Silent	SNP	HMMPfam_Pkinase,superfamily_Protein kinase-like (PK-like)	p.G189	ENST00000390666.3	37	c.567	CCDS4112.1	5																																																																																			-	HMMPfam_Pkinase		0.582	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK1B	protein_coding	OTTHUMT00000250774.2	G	NM_032028		112797869	-1	no_errors	NM_032028	genbank	human	provisional	54_36p	silent	SNP	0.738	A
DMXL1	1657	genome.wustl.edu	37	5	118485175	118485175	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:118485175C>G	ENST00000311085.8	+	18	3733	c.3653C>G	c.(3652-3654)tCt>tGt	p.S1218C	DMXL1_ENST00000539542.1_Missense_Mutation_p.S1218C	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	1218								p.S1218Y(1)|p.S1218C(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTTCCTGTTTCTTTATCGTGG	0.443																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	5											137.0	138.0	138.0					5																	118485175		2202	4300	6502	118513074	SO:0001583	missense	1657			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.3653C>G	5.37:g.118485175C>G	ENSP00000309690:p.Ser1218Cys		118513074		Missense_Mutation	SNP	-	p.S1218C	ENST00000311085.8	37	c.3653	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184634	0.57909	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.01505	4.82;4.82	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.10937	0.0267	M	0.76574	2.34	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.74348	0.983;0.948	T	0.00581	-1.1660	10	0.49607	T	0.09	-17.336	19.5134	0.95153	0.0:1.0:0.0:0.0	.	1218;1218	F5H269;Q9Y485	.;DMXL1_HUMAN	C	1218	ENSP00000309690:S1218C;ENSP00000439479:S1218C	ENSP00000309690:S1218C	S	+	2	0	DMXL1	118513074	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.696000	0.92011	0.655000	0.94253	TCT	-	NULL		0.443	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	protein_coding	OTTHUMT00000250862.1	C	NM_005509		118513074	1	no_errors	NM_005509	genbank	human	validated	54_36p	missense	SNP	1	G
CDH12	1010	genome.wustl.edu	37	5	21882834	21882834	+	Intron	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:21882834C>A	ENST00000382254.1	-	7	1613				CDH12_ENST00000521384.1_Intron|CDH12_ENST00000504376.2_Intron|CDH12_ENST00000522262.1_Intron	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TGTAGGTAGACCTTTTAGCCG	0.483										HNSCC(59;0.17)																																						0			5																																								21918591	SO:0001627	intron_variant	643300			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.527-27935G>T	5.37:g.21882834C>A			21918591	B2RBT1|B7Z2U6|Q86UD2	RNA	SNP	-	NULL	ENST00000382254.1	37	NULL	CCDS3890.1	5																																																																																			-	-		0.483	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC643300	protein_coding	OTTHUMT00000207139.1	C	NM_004061		21918591	1	pseudogene	XR_016534	genbank	human	model	54_36p	rna	SNP	1	A
DROSHA	29102	genome.wustl.edu	37	5	31449420	31449420	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:31449420C>G	ENST00000511367.2	-	21	3033	c.2789G>C	c.(2788-2790)aGa>aCa	p.R930T	DROSHA_ENST00000513349.1_Missense_Mutation_p.R893T|DROSHA_ENST00000442743.1_Missense_Mutation_p.R893T|DROSHA_ENST00000344624.3_Missense_Mutation_p.R930T	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	930	Necessary for interaction with DGCR8 and pri-miRNA processing activity.|RNase III 1.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.R930T(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						ATGAACTTTTCTGTCTCCGTA	0.373																																																1	Substitution - Missense(1)	ovary(1)	5											98.0	94.0	95.0					5																	31449420		1920	4126	6046	31485177	SO:0001583	missense	29102			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.2789G>C	5.37:g.31449420C>G	ENSP00000425979:p.Arg930Thr		31485177	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	HMMPfam_Ribonuclease_3;superfamily_RNase III catalytic domain-like (Pfam 00636);HMMPfam_dsrm;superfamily_dsRNA-binding domain-like	p.R930T	ENST00000511367.2	37	c.2789	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.321513	0.95682	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	T;T;T;T	0.52983	1.25;1.25;0.64;0.64	5.76	5.76	0.90799	Ribonuclease III (2);	0.000000	0.85682	D	0.000000	T	0.63283	0.2498	M	0.67953	2.075	0.80722	D	1	P;P	0.51351	0.944;0.804	P;P	0.53450	0.726;0.554	T	0.65421	-0.6172	10	0.87932	D	0	-21.8009	19.9788	0.97318	0.0:1.0:0.0:0.0	.	893;930	E7EMP9;Q9NRR4	.;RNC_HUMAN	T	930;930;893;893;855;886	ENSP00000425979:R930T;ENSP00000339845:R930T;ENSP00000409335:R893T;ENSP00000424161:R893T	ENSP00000265075:R855T	R	-	2	0	DROSHA	31485177	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.360000	0.79487	2.719000	0.93026	0.555000	0.69702	AGA	-	NULL		0.373	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEN	protein_coding	OTTHUMT00000366561.3	C	NM_013235		31485177	-1	no_errors	NM_013235	genbank	human	validated	54_36p	missense	SNP	1	G
GOLPH3	64083	genome.wustl.edu	37	5	32126330	32126330	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:32126330C>T	ENST00000265070.6	-	4	1200	c.885G>A	c.(883-885)gcG>gcA	p.A295A	GOLPH3_ENST00000512668.1_5'Flank	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	295					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)	p.A295A(1)		kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						ACTTGGTGAACGCCGCCACCA	0.478																																																1	Substitution - coding silent(1)	ovary(1)	5											106.0	106.0	106.0					5																	32126330		2203	4300	6503	32162087	SO:0001819	synonymous_variant	64083			AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.885G>A	5.37:g.32126330C>T			32162087	Q9UIW5	Silent	SNP	HMMPfam_GPP34	p.A295	ENST00000265070.6	37	c.885	CCDS3896.1	5																																																																																			-	HMMPfam_GPP34		0.478	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3	protein_coding	OTTHUMT00000207363.2	C	NM_022130		32162087	-1	no_errors	NM_022130	genbank	human	reviewed	54_36p	silent	SNP	0.02	T
CTD-2066L21.3	0	genome.wustl.edu	37	5	33162634	33162634	+	lincRNA	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:33162634C>A	ENST00000510327.1	-	0	346																											AGATGTCCCACTACGTGCTGC	0.468																																																0			5																																								33198391			728553																															5.37:g.33162634C>A			33198391		RNA	SNP	-	NULL	ENST00000510327.1	37	NULL		5																																																																																			-	-		0.468	CTD-2066L21.3-002	KNOWN	basic	lincRNA	LOC728553	lincRNA	OTTHUMT00000366718.1	C			33198391	1	pseudogene	XR_015414	genbank	human	model	54_36p	rna	SNP	1	A
SKP2	6502	genome.wustl.edu	37	5	36180378	36180378	+	Intron	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:36180378G>A	ENST00000274255.6	+	10	1257				SKP2_ENST00000508514.1_Intron|SKP2_ENST00000274254.5_Intron|SKP2_ENST00000546211.1_Intron	NM_005983.3	NP_005974.2	Q13309	SKP2_HUMAN	S-phase kinase-associated protein 2, E3 ubiquitin protein ligase						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|cellular response to cell-matrix adhesion (GO:0071460)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	identical protein binding (GO:0042802)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|ovary(1)	4	all_lung(31;5.63e-05)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGTTGGAGCTGGATTGCTGTC	0.368																																																0			5											165.0	158.0	160.0					5																	36180378		876	1991	2867	36216135	SO:0001627	intron_variant	6502			U33761	CCDS3915.1, CCDS3916.1, CCDS58944.1	5p13	2012-02-23	2012-02-23		ENSG00000145604	ENSG00000145604		"""F-boxes / Leucine-rich repeats"""	10901	protein-coding gene	gene with protein product		601436	"""S-phase kinase-associated protein 2 (p45)"""			8646875	Standard	NM_005983		Approved	FBXL1, FBL1, p45	uc003jkc.2	Q13309	OTTHUMG00000131106	ENST00000274255.6:c.1062-1542G>A	5.37:g.36180378G>A			36216135	A8K5E0|B4DJT4|Q8TDZ0|Q8TDZ1|Q9BV69	Missense_Mutation	SNP	HMMPfam_F-box;HMMPfam_LRR_2;superfamily_RNI-like;superfamily_F-box domain	p.G383R	ENST00000274255.6	37	c.1147	CCDS3916.1	5																																																																																			-	NULL		0.368	SKP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SKP2	protein_coding	OTTHUMT00000253769.2	G	NM_005983		36216135	1	no_errors	ENST00000308927	ensembl	human	known	54_36p	missense	SNP	0.01	A
MEGF10	84466	genome.wustl.edu	37	5	126732383	126732383	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr5:126732383G>C	ENST00000274473.6	+	7	839	c.572G>C	c.(571-573)tGt>tCt	p.C191S	MEGF10_ENST00000503335.2_Missense_Mutation_p.C191S|MEGF10_ENST00000508365.1_Missense_Mutation_p.C191S|MEGF10_ENST00000418761.2_Missense_Mutation_p.C191S	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	191	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)		p.C191S(1)		breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		GGTAACGACTGTCATCAGAGA	0.637																																																1	Substitution - Missense(1)	ovary(1)	5											52.0	54.0	53.0					5																	126732383		2203	4300	6503	126760282	SO:0001583	missense	84466			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.572G>C	5.37:g.126732383G>C	ENSP00000274473:p.Cys191Ser		126760282	Q68DE5|Q8WUL3	Missense_Mutation	SNP	-	p.C191S	ENST00000274473.6	37	c.572	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.154696	0.94686	.	.	ENSG00000145794	ENST00000503335;ENST00000508365;ENST00000418761;ENST00000274473	T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34	5.63	5.63	0.86233	EGF-like, laminin (2);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.89434	0.6714	H	0.98068	4.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92842	0.6289	10	0.72032	D	0.01	-12.0613	19.6772	0.95941	0.0:0.0:1.0:0.0	.	191;191	Q96KG7-2;Q96KG7	.;MEG10_HUMAN	S	191	ENSP00000423354:C191S;ENSP00000423195:C191S;ENSP00000416284:C191S;ENSP00000274473:C191S	ENSP00000274473:C191S	C	+	2	0	MEGF10	126760282	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.869000	0.99810	2.656000	0.90262	0.655000	0.94253	TGT	-	NULL		0.637	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	protein_coding	OTTHUMT00000250973.2	G	NM_032446		126760282	1	no_errors	NM_032446	genbank	human	validated	54_36p	missense	SNP	1	C
Unknown	0	genome.wustl.edu	37	6	10214321	10214321	+	IGR	SNP	T	T	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:10214321T>C								OFCC1 (153323 upstream) : RNU6ATAC21P (7947 downstream)																							ATGTGCTCAATACACACATTA	0.433																																																0			6																																								10322307	SO:0001628	intergenic_variant	442160																															6.37:g.10214321T>C			10322307		RNA	SNP	-	NULL		37	NULL		6																																																																																			-	-	0	0.433					LOC442160			T			10322307	-1	pseudogene	XR_042339	genbank	human	model	54_36p	rna	SNP	1	C
HS3ST5	222537	genome.wustl.edu	37	6	114379323	114379323	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:114379323G>T	ENST00000312719.5	-	5	1327	c.139C>A	c.(139-141)Ctg>Atg	p.L47M	RP3-399L15.3_ENST00000519270.1_RNA|RP3-399L15.3_ENST00000523087.1_RNA|RP3-399L15.3_ENST00000519104.1_RNA|HS3ST5_ENST00000411826.1_Missense_Mutation_p.L47M			Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 5	47					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|negative regulation of coagulation (GO:0050819)|protein sulfation (GO:0006477)|regulation of viral entry into host cell (GO:0046596)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.L47M(1)		breast(4)|endometrium(2)|kidney(1)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	41		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GCTCCACCCAGTCGACCTTCA	0.537																																																1	Substitution - Missense(1)	ovary(1)	6											23.0	23.0	23.0					6																	114379323		2203	4300	6503	114486016	SO:0001583	missense	222537			AF503292	CCDS34517.1	6q21	2011-11-16			ENSG00000249853	ENSG00000249853		"""Sulfotransferases, membrane-bound"""	19419	protein-coding gene	gene with protein product		609407				12138164	Standard	NM_153612		Approved	3-OST-5	uc003pwg.4	Q8IZT8	OTTHUMG00000015412	ENST00000312719.5:c.139C>A	6.37:g.114379323G>T	ENSP00000427888:p.Leu47Met		114486016	A8K1J2|Q52LI2|Q8N285	Missense_Mutation	SNP	HMMPfam_Sulfotransfer_1;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.L47M	ENST00000312719.5	37	c.139	CCDS34517.1	6	.	.	.	.	.	.	.	.	.	.	G	0.103	-1.149946	0.01714	.	.	ENSG00000249853	ENST00000312719;ENST00000411826	T;T	0.46451	0.87;0.87	5.77	0.831	0.18860	.	0.512641	0.20659	N	0.088051	T	0.09158	0.0226	N	0.14661	0.345	0.26592	N	0.973176	B	0.21309	0.054	B	0.18871	0.023	T	0.30534	-0.9975	10	0.35671	T	0.21	.	9.2304	0.37432	0.7233:0.0:0.2767:0.0	.	47	Q8IZT8	HS3S5_HUMAN	M	47	ENSP00000427888:L47M;ENSP00000440332:L47M	ENSP00000427888:L47M	L	-	1	2	HS3ST5	114486016	1.000000	0.71417	0.815000	0.32552	0.057000	0.15508	1.931000	0.40134	0.191000	0.20236	-0.793000	0.03317	CTG	-	NULL		0.537	HS3ST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST5	protein_coding	OTTHUMT00000041911.2	G	NM_153612		114486016	-1	no_errors	NM_153612	genbank	human	validated	54_36p	missense	SNP	1	T
EXOC2	55770	genome.wustl.edu	37	6	633067	633067	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:633067C>A	ENST00000230449.4	-	3	304	c.169G>T	c.(169-171)Gca>Tca	p.A57S	EXOC2_ENST00000448181.3_Intron	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	57	IPT/TIG.				cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A57S(1)		breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		ATTTTACTTGCAGACATCCAT	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											136.0	116.0	123.0					6																	633067		2203	4300	6503	578067	SO:0001583	missense	55770			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.169G>T	6.37:g.633067C>A	ENSP00000230449:p.Ala57Ser		578067	B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	-	p.A57S	ENST00000230449.4	37	c.169	CCDS34327.1	6	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369481	0.42003	.	.	ENSG00000112685	ENST00000230449;ENST00000443083	T;T	0.72725	-0.68;-0.68	5.55	4.68	0.58851	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.045983	0.85682	D	0.000000	T	0.23370	0.0565	N	0.02202	-0.64	0.80722	D	1	B	0.12013	0.005	B	0.18263	0.021	T	0.35251	-0.9796	10	0.02654	T	1	-23.1357	16.4418	0.83903	0.0:0.8683:0.1317:0.0	.	57	Q96KP1	EXOC2_HUMAN	S	57	ENSP00000230449:A57S;ENSP00000406400:A57S	ENSP00000230449:A57S	A	-	1	0	EXOC2	578067	1.000000	0.71417	0.927000	0.36925	0.997000	0.91878	4.677000	0.61634	1.328000	0.45358	0.655000	0.94253	GCA	-	NULL		0.408	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC2	protein_coding	OTTHUMT00000039627.1	C	NM_018303		578067	-1	no_errors	NM_018303	genbank	human	reviewed	54_36p	missense	SNP	1	A
HIST1H2BG	8339	genome.wustl.edu	37	6	26216823	26216823	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:26216823T>C	ENST00000244601.3	-	1	49	c.49A>G	c.(49-51)Aag>Gag	p.K17E	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	17					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.K17E(1)		endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				GTCACAGCCTTCTTGGAACCC	0.483																																																1	Substitution - Missense(1)	ovary(1)	6											147.0	132.0	137.0					6																	26216823		2203	4300	6503	26324802	SO:0001583	missense	8339			M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.49A>G	6.37:g.26216823T>C	ENSP00000244601:p.Lys17Glu		26324802	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	-	p.K17E	ENST00000244601.3	37	c.49	CCDS4594.1	6	.	.	.	.	.	.	.	.	.	.	.	15.50	2.851696	0.51270	.	.	ENSG00000187990	ENST00000244601	T	0.22945	1.93	4.0	4.0	0.46444	.	.	.	.	.	T	0.30572	0.0769	.	.	.	0.36882	D	0.88944	.	.	.	.	.	.	T	0.15954	-1.0419	6	0.87932	D	0	.	12.5323	0.56122	0.0:0.0:0.0:1.0	.	.	.	.	E	17	ENSP00000244601:K17E	ENSP00000244601:K17E	K	-	1	0	HIST1H2BG	26324802	1.000000	0.71417	0.990000	0.47175	0.593000	0.36681	7.564000	0.82326	1.802000	0.52723	0.533000	0.62120	AAG	-	NULL		0.483	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BG	protein_coding	OTTHUMT00000040109.2	T	NM_003518		26324802	-1	no_errors	NM_003518	genbank	human	reviewed	54_36p	missense	SNP	1	C
ZSCAN31	64288	genome.wustl.edu	37	6	28294364	28294364	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:28294364T>A	ENST00000414429.1	-	8	1703	c.800A>T	c.(799-801)tAt>tTt	p.Y267F	ZSCAN31_ENST00000344279.6_Missense_Mutation_p.Y267F|ZSCAN31_ENST00000446474.1_Missense_Mutation_p.Y108F|ZSCAN31_ENST00000481934.1_5'UTR|ZSCAN31_ENST00000439158.1_Missense_Mutation_p.Y267F|ZSCAN31_ENST00000396838.2_Missense_Mutation_p.Y267F			Q96LW9	ZSC31_HUMAN	zinc finger and SCAN domain containing 31	267					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Y267F(1)									TTCACATTCATATGGCTTCTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	6											127.0	121.0	123.0					6																	28294364		2203	4300	6503	28402343	SO:0001583	missense	64288				CCDS4649.1, CCDS59001.1	6p	2013-01-09	2013-01-08	2013-01-08	ENSG00000235109	ENSG00000235109		"""-"", ""Zinc fingers, C2H2-type"""	14097	protein-coding gene	gene with protein product		610794	"""zinc finger protein 310 pseudogene"", ""zinc finger protein 323"""	ZNF310P, ZNF323			Standard	NM_001135216		Approved		uc003nla.3	Q96LW9	OTTHUMG00000014518	ENST00000414429.1:c.800A>T	6.37:g.28294364T>A	ENSP00000390076:p.Tyr267Phe		28402343	Q6P178|Q8WWS5	Missense_Mutation	SNP	HMMPfam_SCAN;HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.Y267F	ENST00000414429.1	37	c.800	CCDS4649.1	6	.	.	.	.	.	.	.	.	.	.	T	15.29	2.790347	0.50102	.	.	ENSG00000235109	ENST00000396838;ENST00000439158;ENST00000414429;ENST00000446474;ENST00000344279;ENST00000435857	T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22	4.79	2.17	0.27698	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02970	0.0088	N	0.03891	-0.335	0.09310	N	1	B	0.34061	0.436	B	0.41236	0.351	T	0.35822	-0.9773	9	0.49607	T	0.09	.	4.836	0.13466	0.2789:0.0956:0.0:0.6256	.	267	Q96LW9	ZN323_HUMAN	F	267;267;267;108;267;108	ENSP00000380050:Y267F;ENSP00000413705:Y267F;ENSP00000390076:Y267F;ENSP00000402937:Y108F;ENSP00000345339:Y267F;ENSP00000391235:Y108F	ENSP00000345339:Y267F	Y	-	2	0	ZNF323	28402343	0.000000	0.05858	0.625000	0.29200	0.987000	0.75469	-0.512000	0.06313	0.763000	0.33175	0.477000	0.44152	TAT	-	HMMPfam_zf-C2H2		0.498	ZSCAN31-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF323	protein_coding	OTTHUMT00000346804.1	T	NM_030899		28402343	-1	no_errors	NM_145909	genbank	human	validated	54_36p	missense	SNP		A
NOTCH4	4855	genome.wustl.edu	37	6	32190345	32190345	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:32190345G>A	ENST00000375023.3	-	3	532	c.394C>T	c.(394-396)Cgc>Tgc	p.R132C		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	132	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)	p.R132C(1)		NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						ATGTGGCAGCGGCCCCTTTTG	0.632																																																1	Substitution - Missense(1)	ovary(1)	6											37.0	42.0	40.0					6																	32190345		2202	4299	6501	32298323	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.394C>T	6.37:g.32190345G>A	ENSP00000364163:p.Arg132Cys		32298323	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	HMMPfam_Notch;HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_EGF;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_NODP;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_Notch domain	p.R132C	ENST00000375023.3	37	c.394	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523078	0.64747	.	.	ENSG00000204301	ENST00000375023	T	0.09538	2.97	4.14	3.19	0.36642	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.499688	0.16946	N	0.193086	T	0.12008	0.0292	M	0.73319	2.225	0.80722	D	1	D;D	0.71674	0.998;0.992	P;P	0.53360	0.724;0.513	T	0.01966	-1.1238	10	0.72032	D	0.01	.	8.9746	0.35928	0.0:0.0:0.5083:0.4917	.	132;132	Q6P3V5;Q99466	.;NOTC4_HUMAN	C	132	ENSP00000364163:R132C	ENSP00000364163:R132C	R	-	1	0	NOTCH4	32298323	1.000000	0.71417	0.989000	0.46669	0.958000	0.62258	1.359000	0.34113	0.773000	0.33404	0.561000	0.74099	CGC	-	HMMPfam_EGF		0.632	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	G			32298323	-1	no_errors	NM_004557	genbank	human	reviewed	54_36p	missense	SNP	0.97	A
RING1	6015	genome.wustl.edu	37	6	33177781	33177781	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:33177781T>G	ENST00000374656.4	+	4	537	c.329T>G	c.(328-330)aTc>aGc	p.I110S	MIR219-1_ENST00000362166.1_RNA|RING1_ENST00000478431.1_3'UTR	NM_002931.3	NP_002922.2	Q06587	RING1_HUMAN	ring finger protein 1	110	Necessary for transcriptional repression. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|histone H2A monoubiquitination (GO:0035518)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.I110S(1)		endometrium(5)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|skin(4)	17						ATCTCTAAGATCTATCCTAGC	0.567																																																1	Substitution - Missense(1)	ovary(1)	6											70.0	63.0	66.0					6																	33177781		2203	4300	6503	33285759	SO:0001583	missense	6015				CCDS34424.1	6p21.3	2013-01-09			ENSG00000204227	ENSG00000204227		"""RING-type (C3HC4) zinc fingers"""	10018	protein-coding gene	gene with protein product		602045				1906426	Standard	NM_002931		Approved	RNF1	uc003odk.3	Q06587	OTTHUMG00000031278	ENST00000374656.4:c.329T>G	6.37:g.33177781T>G	ENSP00000363787:p.Ile110Ser		33285759	A8JZZ0|Q5JP96|Q5SQW2|Q86V19	Missense_Mutation	SNP	-	p.I110S	ENST00000374656.4	37	c.329	CCDS34424.1	6	.	.	.	.	.	.	.	.	.	.	T	19.25	3.791731	0.70452	.	.	ENSG00000204227	ENST00000374656	D	0.85702	-2.02	4.23	4.23	0.50019	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.64402	D	0.000001	D	0.89206	0.6649	M	0.73598	2.24	0.58432	D	0.999997	D	0.71674	0.998	D	0.83275	0.996	D	0.90554	0.4511	10	0.87932	D	0	-27.3229	11.3179	0.49403	0.0:0.0:0.0:1.0	.	110	Q06587	RING1_HUMAN	S	110	ENSP00000363787:I110S	ENSP00000363787:I110S	I	+	2	0	RING1	33285759	1.000000	0.71417	0.997000	0.53966	0.918000	0.54935	7.463000	0.80869	1.767000	0.52121	0.443000	0.29094	ATC	-	NULL		0.567	RING1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RING1	protein_coding	OTTHUMT00000076609.2	T			33285759	1	no_errors	NM_002931	genbank	human	reviewed	54_36p	missense	SNP	1	G
ROS1	6098	genome.wustl.edu	37	6	117710595	117710595	+	Silent	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr6:117710595G>T	ENST00000368508.3	-	12	1875	c.1677C>A	c.(1675-1677)ggC>ggA	p.G559G	ROS1_ENST00000368507.3_Silent_p.G568G|GOPC_ENST00000467125.1_Intron	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	559	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.G559G(1)	TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CCTGCGGGCGGCCTGGCAGAG	0.547			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	1	Substitution - coding silent(1)	ovary(1)	6											81.0	86.0	84.0					6																	117710595		2203	4300	6503	117817288	SO:0001819	synonymous_variant	6098			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.1677C>A	6.37:g.117710595G>T			117817288	Q15368|Q5TDB5	Silent	SNP	Pkinase_Tyr;HMMPfam_Pkinase_Tyr;fn3;HMMPfam_fn3;Fibronectin type III;superfamily_Fibronectin type III;Protein kinase-like (PK-like);superfamily_Protein kinase-like (PK-like);YWTD domain;superfamily_YWTD domain	p.G559	ENST00000368508.3	37	c.1677	CCDS5116.1	6																																																																																			-	HMMPfam_fn3		0.547	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	protein_coding	OTTHUMT00000043464.1	G			117817288	-1	no_errors	NM_002944	genbank	human	reviewed	54_36p	silent	SNP		T
ASZ1	136991	genome.wustl.edu	37	7	117021117	117021117	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:117021117C>G	ENST00000284629.2	-	9	955	c.893G>C	c.(892-894)aGg>aCg	p.R298T		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1									p.R298T(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			CGTTATATCCCTTTCCTGTAT	0.313																																																1	Substitution - Missense(1)	ovary(1)	7											132.0	138.0	136.0					7																	117021117		2202	4296	6498	116808353	SO:0001583	missense	136991			AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.893G>C	7.37:g.117021117C>G	ENSP00000284629:p.Arg298Thr		116808353		Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_SAM/Pointed domain;HMMPfam_SAM_2	p.R298T	ENST00000284629.2	37	c.893	CCDS5772.1	7	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744017	0.49151	.	.	ENSG00000154438	ENST00000284629	D	0.84370	-1.84	5.57	2.63	0.31362	Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.370050	0.33110	N	0.005277	D	0.82384	0.5025	L	0.51422	1.61	0.25645	N	0.986151	P;P	0.36837	0.571;0.571	B;B	0.43123	0.409;0.409	T	0.73636	-0.3920	10	0.54805	T	0.06	-16.0118	8.835	0.35107	0.0:0.7473:0.0:0.2527	.	298;298	B7ZM20;Q8WWH4	.;ASZ1_HUMAN	T	298	ENSP00000284629:R298T	ENSP00000284629:R298T	R	-	2	0	ASZ1	116808353	0.061000	0.20836	0.998000	0.56505	0.806000	0.45545	0.125000	0.15749	0.325000	0.23359	-0.345000	0.07892	AGG	-	HMMPfam_SAM_2		0.313	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASZ1	protein_coding	OTTHUMT00000138907.7	C	NM_130768		116808353	-1	no_errors	NM_130768	genbank	human	validated	54_36p	missense	SNP	0.98	G
BRAF	673	genome.wustl.edu	37	7	140449169	140449169	+	Nonsense_Mutation	SNP	G	G	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:140449169G>C	ENST00000288602.6	-	16	1970	c.1910C>G	c.(1909-1911)tCa>tGa	p.S637*		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	637	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S637*(1)	SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	ATATACATCTGACTGAAAGCT	0.343		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	1	Substitution - Nonsense(1)	ovary(1)	7											104.0	108.0	107.0					7																	140449169		2202	4300	6502	140095638	SO:0001587	stop_gained	673	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1910C>G	7.37:g.140449169G>C	ENSP00000288602:p.Ser637*		140095638	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Nonsense_Mutation	SNP	Pkinase;HMMPfam_Pkinase;C1_1;HMMPfam_C1_1;RBD;HMMPfam_RBD	p.S637*	ENST00000288602.6	37	c.1910	CCDS5863.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.156366|5.156366	0.94686|0.94686	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000496384|ENST00000288602	.|.	.|.	.|.	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.78572|.	0.4304|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81741|.	-0.0794|.	3|.	.|0.87932	.|D	.|0	.|.	18.7092|18.7092	0.91649|0.91649	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	245|637	.|.	.|ENSP00000288602:S637X	Q|S	-|-	1|2	0|0	BRAF|BRAF	140095638|140095638	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	9.813000|9.813000	0.99286|0.99286	2.502000|2.502000	0.84385|0.84385	0.462000|0.462000	0.41574|0.41574	CAG|TCA	-	HMMPfam_Pkinase		0.343	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAF	protein_coding	OTTHUMT00000348886.1	G	NM_004333		140095638	-1	no_errors	NM_004333	genbank	human	reviewed	54_36p	nonsense	SNP	1	C
ZNF398	57541	genome.wustl.edu	37	7	148851129	148851129	+	Silent	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:148851129A>G	ENST00000475153.1	+	2	384	c.117A>G	c.(115-117)gcA>gcG	p.A39A	ZNF398_ENST00000483892.1_5'UTR|ZNF398_ENST00000540950.1_Silent_p.A44A|ZNF398_ENST00000485111.1_3'UTR|ZNF398_ENST00000491174.1_5'UTR|ZNF398_ENST00000335901.4_5'UTR|ZNF398_ENST00000426851.2_5'UTR|ZNF398_ENST00000420008.2_5'UTR			Q8TD17	ZN398_HUMAN	zinc finger protein 398	39					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A39A(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			TGCAGACAGCAGCTATCTCTC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	7											69.0	69.0	69.0					7																	148851129		2203	4300	6503	148482062	SO:0001819	synonymous_variant	57541			AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.117A>G	7.37:g.148851129A>G			148482062	A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Silent	SNP	-	p.A39	ENST00000475153.1	37	c.117	CCDS5894.1	7																																																																																			-	NULL		0.592	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF398	protein_coding	OTTHUMT00000352722.2	A			148482062	1	no_errors	NM_170686	genbank	human	reviewed	54_36p	silent	SNP	0.9	G
KCNH2	3757	genome.wustl.edu	37	7	150649923	150649923	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:150649923C>T	ENST00000262186.5	-	6	1548	c.1147G>A	c.(1147-1149)Gac>Aac	p.D383N	KCNH2_ENST00000392968.2_Missense_Mutation_p.D287N|KCNH2_ENST00000330883.4_Missense_Mutation_p.D43N|KCNH2_ENST00000430723.3_Missense_Mutation_p.D383N	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	383					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)	p.D383N(1)		NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GGCAGCACGTCGGCGCCCAGG	0.677																																					GBM(137;110 1844 13671 20123 45161)											1	Substitution - Missense(1)	ovary(1)	7											68.0	58.0	62.0					7																	150649923		2203	4300	6503	150280856	SO:0001583	missense	3757			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.1147G>A	7.37:g.150649923C>T	ENSP00000262186:p.Asp383Asn		150280856	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	-	p.D383N	ENST00000262186.5	37	c.1147	CCDS5910.1	7	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846140	0.91277	.	.	ENSG00000055118	ENST00000330883;ENST00000392968;ENST00000262186;ENST00000350328;ENST00000430723	D;D;D;D	0.99143	-3.46;-5.48;-5.48;-5.48	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.99105	0.9692	M	0.74647	2.275	0.51482	D	0.999925	D;D;D;D;P	0.89917	1.0;1.0;0.999;1.0;0.956	D;D;D;D;P	0.77557	0.99;0.988;0.932;0.957;0.761	D	0.99379	1.0922	10	0.56958	D	0.05	.	15.1057	0.72319	0.0:1.0:0.0:0.0	.	287;383;43;383;43	C4PFH9;G5E9I0;Q708S9;Q12809;Q12809-2	.;.;.;KCNH2_HUMAN;.	N	43;287;383;43;383	ENSP00000328531:D43N;ENSP00000376695:D287N;ENSP00000262186:D383N;ENSP00000387657:D383N	ENSP00000262186:D383N	D	-	1	0	KCNH2	150280856	1.000000	0.71417	0.628000	0.29241	0.832000	0.47134	5.961000	0.70356	2.167000	0.68274	0.455000	0.32223	GAC	-	NULL		0.677	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	protein_coding	OTTHUMT00000350741.2	C	NM_000238		150280856	-1	no_errors	NM_000238	genbank	human	reviewed	54_36p	missense	SNP	0.993	T
GRM3	2913	genome.wustl.edu	37	7	86468316	86468316	+	Missense_Mutation	SNP	T	T	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:86468316T>A	ENST00000361669.2	+	4	2585	c.1486T>A	c.(1486-1488)Tct>Act	p.S496T	GRM3_ENST00000546348.1_Missense_Mutation_p.S88T|GRM3_ENST00000394720.2_Intron|GRM3_ENST00000536043.1_Missense_Mutation_p.S368T|GRM3_ENST00000439827.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	496					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.S496T(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AGATGTCAACTCTATCCACTG	0.493																																					GBM(52;969 1098 3139 52280)											1	Substitution - Missense(1)	ovary(1)	7											87.0	78.0	81.0					7																	86468316		2203	4300	6503	86306252	SO:0001583	missense	2913				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1486T>A	7.37:g.86468316T>A	ENSP00000355316:p.Ser496Thr		86306252	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	HMMPfam_ANF_receptor;HMMPfam_NCD3G;superfamily_Periplasmic binding protein-like I;superfamily_TNF receptor-like;HMMPfam_7tm_3	p.S496T	ENST00000361669.2	37	c.1486	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	T	1.633	-0.518515	0.04171	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	D;D;D	0.90069	-2.61;-2.61;-2.61	5.91	4.73	0.59995	.	0.206106	0.45867	D	0.000322	T	0.78355	0.4270	N	0.22421	0.69	0.27984	N	0.935933	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.62300	-0.6883	10	0.15066	T	0.55	.	7.7235	0.28746	0.1389:0.0:0.1455:0.7156	.	88;368;496	B7Z204;F5GYZ2;Q14832	.;.;GRM3_HUMAN	T	496;88;368	ENSP00000355316:S496T;ENSP00000444064:S88T;ENSP00000441407:S368T	ENSP00000355316:S496T	S	+	1	0	GRM3	86306252	0.014000	0.17966	0.944000	0.38274	0.357000	0.29423	0.040000	0.13905	1.023000	0.39654	0.533000	0.62120	TCT	-	NULL		0.493	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	protein_coding	OTTHUMT00000253362.2	T			86306252	1	no_errors	NM_000840	genbank	human	reviewed	54_36p	missense	SNP	0.64	A
PTPRN2	5799	genome.wustl.edu	37	7	157959782	157959782	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:157959782C>G	ENST00000389418.4	-	6	760	c.751G>C	c.(751-753)Gcc>Ccc	p.A251P	PTPRN2_ENST00000389416.4_Missense_Mutation_p.A234P|PTPRN2_ENST00000409483.1_Missense_Mutation_p.A213P|PTPRN2_ENST00000404321.2_Missense_Mutation_p.A274P|PTPRN2_ENST00000389413.3_Missense_Mutation_p.A251P	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	251					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A251P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GGCCTCTGGGCAGCATAGGCA	0.672																																																1	Substitution - Missense(1)	ovary(1)	7											21.0	19.0	19.0					7																	157959782		2203	4300	6503	157652543	SO:0001583	missense	5799			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.751G>C	7.37:g.157959782C>G	ENSP00000374069:p.Ala251Pro		157652543	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	HMMPfam_Y_phosphatase,superfamily_(Phosphotyrosine protein) phosphatases II	p.A251P	ENST00000389418.4	37	c.751	CCDS5947.1	7	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174018	0.57692	.	.	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	T;T;T;T;T	0.04156	3.74;3.69;3.73;3.75;3.73	4.8	3.9	0.45041	.	0.371554	0.19634	N	0.109612	T	0.06188	0.0160	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B	0.32101	0.356;0.243;0.356;0.243;0.243	B;B;B;B;B	0.40864	0.342;0.116;0.342;0.116;0.116	T	0.34576	-0.9823	10	0.36615	T	0.2	.	10.9426	0.47283	0.0:0.81:0.19:0.0	.	274;213;251;234;251	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	P	213;251;234;251;274	ENSP00000387114:A213P;ENSP00000374064:A251P;ENSP00000374067:A234P;ENSP00000374069:A251P;ENSP00000385464:A274P	ENSP00000374064:A251P	A	-	1	0	PTPRN2	157652543	0.434000	0.25570	0.013000	0.15412	0.017000	0.09413	3.450000	0.52957	0.981000	0.38548	0.555000	0.69702	GCC	-	NULL		0.672	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	protein_coding	OTTHUMT00000353214.1	C			157652543	-1	no_errors	NM_002847	genbank	human	reviewed	54_36p	missense	SNP	0.734	G
CSMD1	64478	genome.wustl.edu	37	8	3216715	3216715	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr8:3216715C>T	ENST00000520002.1	-	22	3821	c.3266G>A	c.(3265-3267)gGg>gAg	p.G1089E	CSMD1_ENST00000602723.1_Missense_Mutation_p.G1089E|CSMD1_ENST00000400186.3_Missense_Mutation_p.G1089E|CSMD1_ENST00000542608.1_Missense_Mutation_p.G1088E|CSMD1_ENST00000539096.1_Missense_Mutation_p.G1088E|CSMD1_ENST00000602557.1_Missense_Mutation_p.G1089E|CSMD1_ENST00000537824.1_Missense_Mutation_p.G1088E			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1089	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.G817E(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ACGGCGGCCCCCACCCAGGCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	8											68.0	73.0	72.0					8																	3216715		2203	4300	6503	3204122	SO:0001583	missense	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3266G>A	8.37:g.3216715C>T	ENSP00000430733:p.Gly1089Glu		3204122	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	-	p.W1089*	ENST00000520002.1	37	c.3267		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	32|32	5.145942|5.145942	0.94603|0.94603	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.23950|.	1.88;1.88;1.88;1.88;1.88|.	5.34|5.34	5.34|5.34	0.76211|0.76211	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.77003|.	0.4067|.	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|.	0.76599|.	-0.2900|.	10|.	0.52906|.	T|.	0.07|.	.|.	19.067|19.067	0.93116|0.93116	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1089;1089;1089|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	E|X	1089;1089;951;1088;1088;1088|568	ENSP00000383047:G1089E;ENSP00000430733:G1089E;ENSP00000441462:G1088E;ENSP00000446243:G1088E;ENSP00000441675:G1088E|.	ENSP00000320445:G951E|.	G|W	-|-	2|3	0|0	CSMD1|CSMD1	3204122|3204122	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.612000|7.612000	0.82975|0.82975	2.489000|2.489000	0.83994|0.83994	0.550000|0.550000	0.68814|0.68814	GGG|TGG	-	NULL		0.552	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	C	NM_033225		3204122	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	nonsense	SNP	1	T
GOT1L1	137362	genome.wustl.edu	37	8	37793234	37793234	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr8:37793234A>G	ENST00000307599.4	-	7	1016	c.917T>C	c.(916-918)cTg>cCg	p.L306P	GOT1L1_ENST00000518826.1_Missense_Mutation_p.L47P	NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	306					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)	p.L306P(1)		central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			TTCTCCCAGCAGAGCAGGGTT	0.617																																																1	Substitution - Missense(1)	ovary(1)	8											27.0	29.0	29.0					8																	37793234		2039	4184	6223	37912392	SO:0001583	missense	137362			BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.917T>C	8.37:g.37793234A>G	ENSP00000303077:p.Leu306Pro		37912392	A8MWL4	Missense_Mutation	SNP	-	p.L305P	ENST00000307599.4	37	c.914	CCDS47839.1	8	.	.	.	.	.	.	.	.	.	.	A	15.05	2.717813	0.48622	.	.	ENSG00000169154	ENST00000307599;ENST00000518826	D;D	0.97870	-4.58;-4.58	5.11	5.11	0.69529	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.231761	0.27881	N	0.017464	D	0.98779	0.9589	M	0.91872	3.25	0.58432	D	0.999999	D	0.69078	0.997	D	0.69479	0.964	D	0.99675	1.0997	10	0.87932	D	0	-7.6665	12.4795	0.55833	1.0:0.0:0.0:0.0	.	306	Q8NHS2	AATC2_HUMAN	P	306;47	ENSP00000303077:L306P;ENSP00000429558:L47P	ENSP00000303077:L306P	L	-	2	0	GOT1L1	37912392	0.808000	0.29022	0.675000	0.29917	0.235000	0.25334	4.881000	0.63114	1.953000	0.56701	0.529000	0.55759	CTG	-	NULL		0.617	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT1L1	protein_coding	OTTHUMT00000376823.1	A	NM_152413		37912392	-1	no_errors	ENST00000307599	ensembl	human	known	54_36p	missense	SNP	0.98	G
CHD7	55636	genome.wustl.edu	37	8	61743045	61743045	+	Silent	SNP	T	T	G			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr8:61743045T>G	ENST00000423902.2	+	15	4166	c.3687T>G	c.(3685-3687)ctT>ctG	p.L1229L	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1229					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.L1229L(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TCACATTTCTTTCCAAAGGCG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	8											115.0	110.0	112.0					8																	61743045		1882	4108	5990	61905599	SO:0001819	synonymous_variant	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.3687T>G	8.37:g.61743045T>G			61905599	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	HMMPfam_SNF2_N;HMMPfam_Chromo;HMMPfam_Helicase_C;HMMPfam_TCH;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Chromo domain-like	p.L1229	ENST00000423902.2	37	c.3687	CCDS47865.1	8																																																																																			-	HMMPfam_SNF2_N		0.403	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	protein_coding	OTTHUMT00000383468.2	T	XM_098762		61905599	1	no_errors	NM_017780	genbank	human	reviewed	54_36p	silent	SNP	1	G
PLEKHF2	79666	genome.wustl.edu	37	8	96166689	96166689	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr8:96166689G>T	ENST00000315367.3	+	2	658	c.417G>T	c.(415-417)aaG>aaT	p.K139N	PLEKHF2_ENST00000519516.1_Missense_Mutation_p.K139N	NM_024613.3	NP_078889.1	Q9H8W4	PKHF2_HUMAN	pleckstrin homology domain containing, family F (with FYVE domain) member 2	139					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)|transport vesicle (GO:0030133)	metal ion binding (GO:0046872)	p.K139N(1)		breast(1)|large_intestine(1)|lung(1)|ovary(2)	5	Breast(36;3.18e-05)					AAAGTGGGAAGACACCCAGTA	0.413																																																1	Substitution - Missense(1)	ovary(1)	8											98.0	105.0	103.0					8																	96166689		2203	4300	6503	96235865	SO:0001583	missense	79666			AF434819	CCDS6267.1	8q22.1	2013-01-10				ENSG00000175895		"""Zinc fingers, FYVE domain containing"", ""Pleckstrin homology (PH) domain containing"""	20757	protein-coding gene	gene with protein product		615208					Standard	NM_024613		Approved	ZFYVE18, PHAFIN2, FLJ13187	uc003yhn.2	Q9H8W4		ENST00000315367.3:c.417G>T	8.37:g.96166689G>T	ENSP00000322373:p.Lys139Asn		96235865		Missense_Mutation	SNP	-	p.K139N	ENST00000315367.3	37	c.417	CCDS6267.1	8	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966745	0.53507	.	.	ENSG00000175895	ENST00000315367;ENST00000519516	T;T	0.81247	-1.47;-1.47	6.06	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.81978	0.4937	L	0.43646	1.37	0.80722	D	1	D	0.54047	0.964	P	0.56088	0.791	T	0.78453	-0.2198	10	0.18276	T	0.48	-16.701	15.2522	0.73556	0.067:0.0:0.933:0.0	.	139	Q9H8W4	PKHF2_HUMAN	N	139	ENSP00000322373:K139N;ENSP00000427792:K139N	ENSP00000322373:K139N	K	+	3	2	PLEKHF2	96235865	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.663000	0.46774	1.564000	0.49628	0.650000	0.86243	AAG	-	NULL		0.413	PLEKHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHF2	protein_coding	OTTHUMT00000379666.1	G	NM_024613		96235865	1	no_errors	NM_024613	genbank	human	provisional	54_36p	missense	SNP	1	T
FREM1	158326	genome.wustl.edu	37	9	14848670	14848670	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr9:14848670C>A	ENST00000380880.3	-	7	2037	c.1254G>T	c.(1252-1254)tgG>tgT	p.W418C	RNU6-1260P_ENST00000362944.1_RNA|FREM1_ENST00000380881.4_Missense_Mutation_p.W419C|FREM1_ENST00000422223.2_Missense_Mutation_p.W418C			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	418					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.W419C(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TACCTGTATTCCAGGATACAC	0.423																																																1	Substitution - Missense(1)	ovary(1)	9											129.0	115.0	119.0					9																	14848670		1904	4128	6032	14838670	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1254G>T	9.37:g.14848670C>A	ENSP00000370262:p.Trp418Cys		14838670	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	-	p.W418C	ENST00000380880.3	37	c.1254	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166191	0.78339	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.11277	2.79;2.79;2.79	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.37348	0.1000	M	0.80028	2.48	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.03077	-1.1075	10	0.38643	T	0.18	-7.3065	19.8344	0.96650	0.0:1.0:0.0:0.0	.	418	Q5H8C1	FREM1_HUMAN	C	419;418;418	ENSP00000370263:W419C;ENSP00000412940:W418C;ENSP00000370262:W418C	ENSP00000370257:W421C	W	-	3	0	FREM1	14838670	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	7.487000	0.81328	2.692000	0.91855	0.655000	0.94253	TGG	-	NULL		0.423	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	protein_coding	OTTHUMT00000339474.2	C	NM_144966		14838670	-1	no_errors	NM_144966	genbank	human	validated	54_36p	missense	SNP	1	A
BAG1	573	genome.wustl.edu	37	9	33255264	33255264	+	Nonsense_Mutation	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr9:33255264G>A	ENST00000379704.2	-	7	1079	c.646C>T	c.(646-648)Cag>Tag	p.Q216*	BAG1_ENST00000467389.2_5'UTR|BAG1_ENST00000472232.3_Nonsense_Mutation_p.Q331*			Q99933	BAG1_HUMAN	BCL2-associated athanogene	331	Interaction with HSPA8.|Interaction with PPP1R15A.|Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|chaperone cofactor-dependent protein refolding (GO:0070389)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor signaling protein activity (GO:0005057)	p.Q331*(1)		endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00506)			TCAGTCTCCTGGCAGATGTTC	0.582																																					GBM(77;1066 1502 5858 12192)											1	Substitution - Nonsense(1)	ovary(1)	9											117.0	109.0	112.0					9																	33255264		2203	4300	6503	33245264	SO:0001587	stop_gained	573			AF022224	CCDS35004.1, CCDS55301.1	9p12	2010-12-09			ENSG00000107262	ENSG00000107262			937	protein-coding gene	gene with protein product		601497				7834747	Standard	NM_004323		Approved		uc003zsj.3	Q99933	OTTHUMG00000019766	ENST00000379704.2:c.646C>T	9.37:g.33255264G>A	ENSP00000369026:p.Gln216*		33245264	O75315|Q14414|Q53H32|Q5VZE8|Q5VZE9|Q5VZF0|Q96TG2|Q9Y2V4	Nonsense_Mutation	SNP	HMMPfam_ubiquitin;HMMPfam_BAG;superfamily_Ubiquitin-like;superfamily_BAG domain	p.Q331*	ENST00000379704.2	37	c.991	CCDS55301.1	9	.	.	.	.	.	.	.	.	.	.	G	38	7.016063	0.98006	.	.	ENSG00000107262	ENST00000472232;ENST00000379704	.	.	.	4.73	3.81	0.43845	.	0.107310	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-14.8696	12.8749	0.57984	0.0:0.165:0.835:0.0	.	.	.	.	X	331;216	.	ENSP00000369026:Q216X	Q	-	1	0	BAG1	33245264	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.840000	0.69402	1.317000	0.45149	0.655000	0.94253	CAG	-	NULL		0.582	BAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG1	protein_coding	OTTHUMT00000052042.3	G	NM_004323		33245264	-1	no_errors	NM_004323	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
ZBTB43	23099	genome.wustl.edu	37	9	129596150	129596150	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr9:129596150C>T	ENST00000373464.4	+	3	1626	c.1362C>T	c.(1360-1362)taC>taT	p.Y454Y	ZBTB43_ENST00000449886.1_Silent_p.Y454Y|ZBTB43_ENST00000373457.1_Silent_p.Y454Y	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	454					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Y454Y(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						CTAAGTCCTACGAAGCTGCAA	0.423																																																1	Substitution - coding silent(1)	ovary(1)	9											110.0	116.0	114.0					9																	129596150		2201	4291	6492	128635971	SO:0001819	synonymous_variant	23099			AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.1362C>T	9.37:g.129596150C>T			128635971	Q5JU96	Silent	SNP	HMMPfam_zf-C2H2;HMMPfam_BTB;superfamily_POZ domain;superfamily_C2H2 and C2HC zinc fingers	p.Y454	ENST00000373464.4	37	c.1362	CCDS6867.1	9																																																																																			-	NULL		0.423	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZBTB43	protein_coding	OTTHUMT00000054124.1	C	NM_001135776		128635971	1	no_errors	NM_014007	genbank	human	validated	54_36p	silent	SNP	1	T
CALCR	799	genome.wustl.edu	37	7	93113304	93113304	+	Intron	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chr7:93113304G>A	ENST00000394441.1	-	2	367				CALCR_ENST00000360249.4_Intron|CALCR_ENST00000359558.2_Intron|CALCR_ENST00000426151.1_Intron|CALCR_ENST00000421592.1_Intron|MIR489_ENST00000384923.1_RNA|MIR653_ENST00000385279.1_RNA	NM_001164738.1	NP_001158210.1	P30988	CALCR_HUMAN	calcitonin receptor						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|response to glucocorticoid (GO:0051384)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcitonin binding (GO:0032841)|calcitonin receptor activity (GO:0004948)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(3)	45	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Pramlintide(DB01278)|Salmon Calcitonin(DB00017)	AGTAAATGGCGTCACACATAC	0.413																																																0			7											115.0	111.0	112.0					7																	93113304		1568	3582	5150	92951240	SO:0001627	intron_variant	574442			L00587	CCDS5631.1, CCDS55125.1	7q21.3	2012-08-10			ENSG00000004948	ENSG00000004948		"""GPCR / Class B : Calcitonin receptors"""	1440	protein-coding gene	gene with protein product		114131				1331173	Standard	NM_001742		Approved	CTR	uc003umw.2	P30988	OTTHUMG00000023599	ENST00000394441.1:c.51+2938C>T	7.37:g.93113304G>A			92951240	A4D1G6|F5H605|O14585|Q13941|Q5ZGL8|Q659U6|Q6DJU8|Q6T712	RNA	SNP	-	NULL	ENST00000394441.1	37	NULL	CCDS5631.1	7																																																																																			-	-		0.413	CALCR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	MIRN489	protein_coding	OTTHUMT00000254661.2	G	NM_001742		92951240	-1	no_errors	ENST00000384923	ensembl	human	known	54_36p	rna	SNP	1	A
SLC38A5	92745	genome.wustl.edu	37	X	48324676	48324676	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chrX:48324676G>A	ENST00000376876.3	-	6	1196	c.353C>T	c.(352-354)gCa>gTa	p.A118V	SLC38A5_ENST00000376875.1_Missense_Mutation_p.A67V|SLC38A5_ENST00000317669.5_Missense_Mutation_p.A118V			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	118					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)	p.A118V(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						AGGCCCGAATGCCCTCTGTCC	0.647											OREG0019763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - Missense(1)	ovary(1)	X											35.0	29.0	31.0					X																	48324676		2203	4299	6502	48209620	SO:0001583	missense	92745			AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.353C>T	X.37:g.48324676G>A	ENSP00000366073:p.Ala118Val	953	48209620	B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Missense_Mutation	SNP	-	p.A118V	ENST00000376876.3	37	c.353	CCDS14293.1	X	.	.	.	.	.	.	.	.	.	.	g	26.6	4.749046	0.89753	.	.	ENSG00000017483	ENST00000376876;ENST00000376875;ENST00000317669;ENST00000440085;ENST00000441948;ENST00000413668;ENST00000416711;ENST00000429543	T;T;T;T;T;T;T;T	0.02258	4.37;4.37;4.37;4.37;4.37;4.37;4.37;4.37	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.10895	0.0266	M	0.81682	2.555	0.80722	D	1	P	0.51351	0.944	P	0.60415	0.874	T	0.01781	-1.1275	10	0.41790	T	0.15	.	14.1721	0.65517	0.0:0.0:1.0:0.0	.	118	Q8WUX1	S38A5_HUMAN	V	118;67;118;118;118;118;118;118	ENSP00000366073:A118V;ENSP00000366071:A67V;ENSP00000313740:A118V;ENSP00000402988:A118V;ENSP00000407258:A118V;ENSP00000403976:A118V;ENSP00000389644:A118V;ENSP00000416948:A118V	ENSP00000313740:A118V	A	-	2	0	SLC38A5	48209620	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	9.337000	0.96545	1.918000	0.55548	0.429000	0.28392	GCA	-	NULL		0.647	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A5	protein_coding	OTTHUMT00000060724.1	G	NM_033518		48209620	-1	no_errors	NM_033518	genbank	human	validated	54_36p	missense	SNP	1	A
CXorf67	340602	genome.wustl.edu	37	X	51151274	51151274	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chrX:51151274T>C	ENST00000342995.2	+	1	1508	c.1406T>C	c.(1405-1407)cTt>cCt	p.L469P				Q86X51	CX067_HUMAN	chromosome X open reading frame 67	469								p.L469P(1)		breast(1)|endometrium(4)|large_intestine(1)|lung(11)|ovary(3)|prostate(1)	21						CCTGAAAGCCTTAGGTATGCT	0.557																																																1	Substitution - Missense(1)	ovary(1)	X											75.0	60.0	65.0					X																	51151274		2203	4300	6503	51168014	SO:0001583	missense	340602			BC046248		Xp11.22	2014-04-30			ENSG00000187690	ENSG00000187690			33738	protein-coding gene	gene with protein product						23959973	Standard	XR_113306		Approved			Q86X51	OTTHUMG00000187481	ENST00000342995.2:c.1406T>C	X.37:g.51151274T>C	ENSP00000342680:p.Leu469Pro		51168014		Missense_Mutation	SNP	-	p.L469P	ENST00000342995.2	37	c.1406		X	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872509	0.33069	.	.	ENSG00000187690	ENST00000342995	T	0.61158	0.13	3.79	2.62	0.31277	.	0.298816	0.18415	N	0.141938	T	0.69360	0.3102	.	.	.	0.19775	N	0.999955	D	0.89917	1.0	D	0.71414	0.973	T	0.57888	-0.7733	9	0.87932	D	0	-19.1661	6.786	0.23673	0.0:0.119:0.0:0.881	.	469	Q86X51	CX067_HUMAN	P	469	ENSP00000342680:L469P	ENSP00000342680:L469P	L	+	2	0	CXorf67	51168014	0.033000	0.19621	0.001000	0.08648	0.003000	0.03518	1.651000	0.37302	0.638000	0.30545	-0.314000	0.08810	CTT	-	NULL		0.557	CXorf67-201	KNOWN	basic|appris_principal	protein_coding	LOC340602	protein_coding		T	NM_203407		51168014	1	no_errors	NM_203407	genbank	human	predicted	54_36p	missense	SNP		C
USP51	158880	genome.wustl.edu	37	X	55513444	55513444	+	Silent	SNP	C	C	T			TCGA-04-1347-01A-01W-0488-09	TCGA-04-1347-11A-01W-0489-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	21b50b8c-781a-4e15-a4ad-715f416f0fa2	2655367b-70ac-471d-bcfa-2fbf59e0d4f7	g.chrX:55513444C>T	ENST00000500968.3	-	2	2011	c.1929G>A	c.(1927-1929)gtG>gtA	p.V643V	USP51_ENST00000586165.1_5'UTR	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	643	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.V643V(1)		NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						TCTCATTGGGCACACAATCTG	0.448																																																1	Substitution - coding silent(1)	ovary(1)	X											109.0	96.0	100.0					X																	55513444		2203	4300	6503	55530169	SO:0001819	synonymous_variant	158880			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.1929G>A	X.37:g.55513444C>T			55530169	Q8IWJ8	Silent	SNP	HMMPfam_UCH,superfamily_Cysteine proteinases	p.V643	ENST00000500968.3	37	c.1929	CCDS14370.1	X																																																																																			-	HMMPfam_UCH		0.448	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP51	protein_coding	OTTHUMT00000056871.2	C	NM_201286		55530169	-1	no_errors	NM_201286	genbank	human	validated	54_36p	silent	SNP	0.002	T
