#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MYT1L	23040	genome.wustl.edu	37	2	1926914	1926914	+	Silent	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr2:1926914G>A	ENST00000399161.2	-	10	1374	c.627C>T	c.(625-627)ggC>ggT	p.G209G	MYT1L_ENST00000428368.2_Silent_p.G209G	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	209					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CAGCGATTTTGCCGAGGTTTA	0.423																																																0			2											111.0	104.0	106.0					2																	1926914		1950	4158	6108	1905921	SO:0001819	synonymous_variant	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.627C>T	2.37:g.1926914G>A			1905921	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	superfamily_SSF103637,HMMPfam_zf-C2HC,HMMPfam_MYT1,PatternScan_EF_HAND_1	p.G209	ENST00000399161.2	37	c.627		2																																																																																			-	NULL		0.423	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	protein_coding	OTTHUMT00000322493.1	G	NM_015025		1905921	-1	no_errors	NM_015025	genbank	human	validated	54_36p	silent	SNP	1.000	A
TSC2	7249	genome.wustl.edu	37	16	2107109	2107109	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr16:2107109A>G	ENST00000219476.3	+	9	1408	c.778A>G	c.(778-780)Atg>Gtg	p.M260V	TSC2_ENST00000382538.6_Missense_Mutation_p.M211V|TSC2_ENST00000353929.4_Missense_Mutation_p.M260V|TSC2_ENST00000568454.1_Missense_Mutation_p.M271V|TSC2_ENST00000350773.4_Missense_Mutation_p.M260V|TSC2_ENST00000439673.2_Missense_Mutation_p.M223V|TSC2_ENST00000401874.2_Missense_Mutation_p.M260V	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	260	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CTCGCAGCTGATGCGGAACCT	0.662			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																													yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0			16											38.0	27.0	31.0					16																	2107109		2077	4004	6081	2047110	SO:0001583	missense	7249	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.778A>G	16.37:g.2107109A>G	ENSP00000219476:p.Met260Val		2047110	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_Tuberin,superfamily_Rap/Ran-GAP (Pfam 02145),HMMPfam_Rap_GAP	p.M260V	ENST00000219476.3	37	c.778	CCDS10458.1	16	.	.	.	.	.	.	.	.	.	.	.	20.3	3.959048	0.74016	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	T;T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41;-1.41	4.65	4.65	0.58169	Armadillo-type fold (1);Tuberin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89100	0.6619	M	0.84082	2.675	0.80722	D	1	D;D;D;P;D;P	0.69078	0.957;0.979;0.997;0.904;0.979;0.771	D;D;D;D;D;P	0.75484	0.96;0.986;0.983;0.968;0.981;0.817	D	0.88159	0.2856	10	0.27785	T	0.31	-36.5501	14.3569	0.66742	1.0:0.0:0.0:0.0	.	211;223;260;260;260;260	B4DIL8;P49815-6;P49815-4;P49815-3;P49815-5;P49815	.;.;.;.;.;TSC2_HUMAN	V	260;260;260;223;211;260	ENSP00000219476:M260V;ENSP00000384468:M260V;ENSP00000248099:M260V;ENSP00000399232:M223V;ENSP00000371978:M211V;ENSP00000344383:M260V	ENSP00000219476:M260V	M	+	1	0	TSC2	2047110	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	7.098000	0.76974	1.857000	0.53885	0.459000	0.35465	ATG	-	superfamily_ARM repeat		0.662	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	protein_coding	OTTHUMT00000250657.2	A	NM_000548		2047110	+1	no_errors	NM_000548	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
CSMD1	64478	genome.wustl.edu	37	8	2820091	2820091	+	Silent	SNP	G	G	A	rs374609823		TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr8:2820091G>A	ENST00000520002.1	-	62	10083	c.9528C>T	c.(9526-9528)tcC>tcT	p.S3176S	CSMD1_ENST00000400186.3_Silent_p.S2999S|CSMD1_ENST00000537824.1_Silent_p.S3175S|CSMD1_ENST00000602723.1_Silent_p.S2999S|CSMD1_ENST00000542608.1_Silent_p.S2998S|CSMD1_ENST00000602557.1_Silent_p.S3176S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3176	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGAAGACTTCGGACTTATAGG	0.527																																																0			8						G		0,3806		0,0,1903	58.0	57.0	58.0		9525	-8.1	0.2	8		58	1,8239		0,1,4119	no	coding-synonymous	CSMD1	NM_033225.5		0,1,6022	AA,AG,GG		0.0121,0.0,0.0083		3175/3565	2820091	1,12045	1903	4120	6023	2807498	SO:0001819	synonymous_variant	64478					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9528C>T	8.37:g.2820091G>A			2807498	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	superfamily_Spermadhesin CUB domain,HMMPfam_CUB,HMMSmart_SM00042,superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.R3177*	ENST00000520002.1	37	c.9529		8	.	.	.	.	.	.	.	.	.	.	G	0.615	-0.823431	0.02755	0.0	1.21E-4	ENSG00000183117	ENST00000335551	.	.	.	5.6	-8.06	0.01102	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.0268	0.01529	0.2891:0.2176:0.3003:0.193	.	.	.	.	X	2593	.	.	R	-	1	2	CSMD1	2807498	0.003000	0.15002	0.154000	0.22540	0.101000	0.19017	-1.297000	0.02759	-1.781000	0.01277	-1.805000	0.00616	CGA	-	NULL		0.527	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	G	NM_033225		2807498	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_033225	genbank	human	validated	54_36p	nonsense	SNP	0.943	A
NUP98	4928	genome.wustl.edu	37	11	3781847	3781847	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr11:3781847C>T	ENST00000324932.7	-	10	1516	c.1096G>A	c.(1096-1098)Ggc>Agc	p.G366S	NUP98_ENST00000397007.4_Missense_Mutation_p.G366S|NUP98_ENST00000359171.4_Missense_Mutation_p.G366S|NUP98_ENST00000397004.4_Missense_Mutation_p.G366S|NUP98_ENST00000355260.3_Missense_Mutation_p.G366S	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	366	FG repeats 2.|Gly/Thr-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TTGTTATTGCCAAACAGGGTC	0.393			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	0			11											73.0	72.0	72.0					11																	3781847		2201	4298	6499	3738423	SO:0001583	missense	4928			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.1096G>A	11.37:g.3781847C>T	ENSP00000316032:p.Gly366Ser		3738423	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	superfamily_SSF88633,HMMPfam_Nucleoporin2,superfamily_Peptidase_S59	p.G366S	ENST00000324932.7	37	c.1096	CCDS7746.1	11	.	.	.	.	.	.	.	.	.	.	C	24.2	4.505100	0.85282	.	.	ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260;ENST00000397004;ENST00000397007	.	.	.	5.47	5.47	0.80525	.	0.113580	0.64402	D	0.000010	T	0.77883	0.4197	M	0.77313	2.365	0.58432	D	0.999994	D;D;D;D	0.67145	0.988;0.957;0.996;0.994	P;P;D;P	0.63793	0.709;0.503;0.918;0.867	T	0.78368	-0.2231	9	0.45353	T	0.12	.	16.4842	0.84180	0.0:1.0:0.0:0.0	.	366;366;366;366	P52948-3;P52948-4;P52948-2;P52948-5	.;.;.;.	S	366	.	ENSP00000316032:G366S	G	-	1	0	NUP98	3738423	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.177000	0.65032	2.566000	0.86566	0.563000	0.77884	GGC	-	NULL		0.393	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	protein_coding	OTTHUMT00000032766.3	C	NM_016320		3738423	-1	no_errors	NM_016320	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
MED11	400569	genome.wustl.edu	37	17	4638588	4638588	+	IGR	SNP	G	G	C	rs542989437		TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr17:4638588G>C	ENST00000293777.5	+	0	833				CXCL16_ENST00000574412.1_Missense_Mutation_p.H192D|CXCL16_ENST00000293778.6_Missense_Mutation_p.H192D|RP11-314A20.5_ENST00000570493.2_RNA|CXCL16_ENST00000576153.1_5'UTR	NM_001001683.2	NP_001001683.1	Q9P086	MED11_HUMAN	mediator complex subunit 11							mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			lung(2)|ovary(2)	4						CCCGCAGTGTGAATGGTGGTT	0.592																																																0			17											73.0	68.0	70.0					17																	4638588		2203	4300	6503	4585337	SO:0001628	intergenic_variant	58191			AF161414	CCDS32533.1	17p13.2	2007-07-30	2007-07-30			ENSG00000161920			32687	protein-coding gene	gene with protein product		612383	"""mediator of RNA polymerase II transcription, subunit 11 homolog (S. cerevisiae)"""			15175163, 12584197	Standard	NM_001001683		Approved	HSPC296, MGC88387	uc002fyp.3	Q9P086			17.37:g.4638588G>C			4585337	Q6NS89	Missense_Mutation	SNP	NULL	p.H192D	ENST00000293777.5	37	c.574	CCDS32533.1	17	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600963	0.28534	.	.	ENSG00000161921	ENST00000293778	T	0.29917	1.55	5.43	-2.7	0.06004	.	1.992470	0.02286	N	0.069825	T	0.15565	0.0375	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.20672	-1.0268	10	0.35671	T	0.21	-0.1028	5.8867	0.18886	0.5044:0.3328:0.1628:0.0	.	173	Q9H2A7	CXL16_HUMAN	D	192	ENSP00000293778:H192D	ENSP00000293778:H192D	H	-	1	0	CXCL16	4585337	0.000000	0.05858	0.000000	0.03702	0.172000	0.22775	-0.504000	0.06375	-0.078000	0.12730	0.561000	0.74099	CAC	-	NULL		0.592	MED11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL16	protein_coding	OTTHUMT00000439574.1	G	NM_001001683		4585337	-1	no_errors	NM_001100812	genbank	human	validated	54_36p	missense	SNP	0.001	C
LPCAT3	10162	genome.wustl.edu	37	12	7084952	7084952	+	IGR	SNP	A	A	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr12:7084952A>C	ENST00000261407.4	-	0	2268				EMG1_ENST00000546220.1_3'UTR|EMG1_ENST00000261406.6_Missense_Mutation_p.E238A|LPCAT3_ENST00000535021.1_5'Flank|U47924.30_ENST00000606112.1_lincRNA	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						GCCTTTGAGGAAGTATGGGGG	0.478																																																0			12											123.0	122.0	123.0					12																	7084952		1955	4140	6095	6955213	SO:0001628	intergenic_variant	10436			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970		12.37:g.7084952A>C			6955213	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	HMMPfam_EMG1	p.E238A	ENST00000261407.4	37	c.713	CCDS8572.1	12																																																																																			-	NULL		0.478	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMG1	protein_coding	OTTHUMT00000401812.1	A	NM_005768		6955213	+1	no_errors	ENST00000261406	ensembl	human	known	54_36p	missense	SNP	1.000	C
A2M	2	genome.wustl.edu	37	12	9254109	9254109	+	Silent	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr12:9254109G>A	ENST00000318602.7	-	12	1735	c.1428C>T	c.(1426-1428)gtC>gtT	p.V476V		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	476					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AATGTGCCTGGACTGTCTGAG	0.498																																																0			12											90.0	86.0	87.0					12																	9254109		1957	4138	6095	9145376	SO:0001819	synonymous_variant	2			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.1428C>T	12.37:g.9254109G>A			9145376	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Silent	SNP	PatternScan_TONB_DEPENDENT_REC_1,HMMPfam_A2M_N,HMMPfam_A2M_N_2,HMMPfam_A2M,superfamily_Terpenoid cyclases/Protein prenyltransferases,HMMPfam_Thiol-ester_cl,PatternScan_ALPHA_2_MACROGLOBULIN,HMMPfam_A2M_comp,superfamily_Alpha-macroglobulin receptor domain,HMMPfam_A2M_recep	p.V476	ENST00000318602.7	37	c.1428	CCDS44827.1	12																																																																																			-	HMMPfam_A2M_N_2		0.498	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	protein_coding	OTTHUMT00000317233.2	G	NM_000014		9145376	-1	no_errors	NM_000014	genbank	human	reviewed	54_36p	silent	SNP	0.087	A
P2RY11	5032	genome.wustl.edu	37	19	10224596	10224596	+	Missense_Mutation	SNP	C	C	T	rs200556743		TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr19:10224596C>T	ENST00000321826.4	+	2	491	c.307C>T	c.(307-309)Cgc>Tgc	p.R103C	PPAN_ENST00000556468.1_Missense_Mutation_p.R523C|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.R523C|PPAN-P2RY11_ENST00000428358.1_3'UTR	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	103					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			GGCCGCGTGCCGCCTGGAGCG	0.662											OREG0025230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				0			19											61.0	54.0	56.0					19																	10224596		2203	4300	6503	10085596	SO:0001583	missense	5032			AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.307C>T	19.37:g.10224596C>T	ENSP00000323872:p.Arg103Cys	663	10085596	B2R8X9|O43190|Q9BYU4|Q9H170	Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.R103C	ENST00000321826.4	37	c.307	CCDS12226.1	19	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889227	0.52014	.	.	ENSG00000243207;ENSG00000130810;ENSG00000244165	ENST00000393796;ENST00000556468;ENST00000321826	T;T;T	0.73363	-0.74;-0.74;-0.74	4.62	2.47	0.30058	GPCR, rhodopsin-like superfamily (1);	0.188637	0.33875	U	0.004474	T	0.81083	0.4749	M	0.78285	2.405	0.35971	D	0.835357	D	0.89917	1.0	D	0.68621	0.959	T	0.81154	-0.1062	10	0.87932	D	0	0.2089	2.878	0.05638	0.2934:0.4611:0.1536:0.0919	.	103	Q96G91	P2Y11_HUMAN	C	523;523;103	ENSP00000377385:R523C;ENSP00000450710:R523C;ENSP00000323872:R103C	ENSP00000323872:R103C	R	+	1	0	PPAN;P2RY11;PPAN-P2RY11	10085596	0.942000	0.31987	0.939000	0.37840	0.132000	0.20833	1.889000	0.39718	0.560000	0.29169	0.561000	0.74099	CGC	-	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1		0.662	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY11	protein_coding	OTTHUMT00000316664.2	C	NM_002566		10085596	+1	no_errors	NM_002566	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
EIF4G2	1982	genome.wustl.edu	37	11	10822101	10822101	+	Missense_Mutation	SNP	C	C	G			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr11:10822101C>G	ENST00000526148.1	-	17	2248	c.1738G>C	c.(1738-1740)Gag>Cag	p.E580Q	EIF4G2_ENST00000396525.2_Missense_Mutation_p.E542Q|SNORD97_ENST00000459187.1_RNA|RP11-685M7.5_ENST00000532365.1_RNA|EIF4G2_ENST00000339995.5_Missense_Mutation_p.E580Q|EIF4G2_ENST00000525681.1_Missense_Mutation_p.E580Q	NM_001172705.1	NP_001166176			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CTTAACATCTCAGGAAGAAAG	0.378																																																0			11											182.0	178.0	180.0					11																	10822101		2201	4294	6495	10778677	SO:0001583	missense	1982			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000526148.1:c.1738G>C	11.37:g.10822101C>G	ENSP00000433664:p.Glu580Gln		10778677		Missense_Mutation	SNP	superfamily_ARM repeat,HMMPfam_MIF4G,HMMSmart_SM00543,HMMPfam_MA3,HMMSmart_SM00544,HMMSmart_SM00515,HMMPfam_W2	p.E580Q	ENST00000526148.1	37	c.1738	CCDS31428.1	11	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869388	0.32977	.	.	ENSG00000110321	ENST00000526148;ENST00000525681;ENST00000339995;ENST00000396525;ENST00000429377;ENST00000531180	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.76	4.86	0.63082	Initiation factor eIF-4 gamma, MA3 (3);Armadillo-type fold (1);	0.090722	0.85682	D	0.000000	T	0.57961	0.2089	M	0.64997	1.995	0.48288	D	0.999626	D;D	0.71674	0.998;0.998	D;D	0.65573	0.936;0.936	T	0.60110	-0.7327	9	0.21540	T	0.41	-9.6063	15.1671	0.72837	0.0:0.9322:0.0:0.0678	.	580;653	P78344;B4DZF2	IF4G2_HUMAN;.	Q	580;580;580;542;653;85	ENSP00000433664:E580Q;ENSP00000433371:E580Q;ENSP00000340281:E580Q;ENSP00000379778:E542Q;ENSP00000433561:E85Q	ENSP00000340281:E580Q	E	-	1	0	EIF4G2	10778677	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	7.671000	0.83941	1.579000	0.49836	-0.145000	0.13849	GAG	-	HMMPfam_MA3,HMMSmart_SM00544		0.378	EIF4G2-006	KNOWN	alternative_5_UTR|non_ATG_start|basic|CCDS	protein_coding	EIF4G2	protein_coding	OTTHUMT00000386603.1	C	NM_001418		10778677	-1	no_start_codon	NM_001418	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
SNORD3B-1	26851	genome.wustl.edu	37	17	18965245	18965245	+	lincRNA	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr17:18965245C>T	ENST00000363359.1	+	0	21				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		tttcagggatcatttctatag	0.478																																																0			17											3.0	2.0	3.0					17																	18965245		327	338	665	18905970			0			AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965245C>T			18905970		RNA	SNP	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			-	-		0.478	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-1	lincRNA		C	NR_003271		18905970	+1	no_errors	ENST00000363359	ensembl	human	known	54_36p	rna	SNP	1.000	T
SNORD3C	780853	genome.wustl.edu	37	17	19091349	19091349	+	lincRNA	SNP	C	C	T	rs547269766	byFrequency	TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr17:19091349C>T	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		tttcagggatcatttctatag	0.473													c|||	8	0.00159744	0.0015	0.0029	5008	,	,		32956	0.001		0.001	False		,,,				2504	0.002															0			17											2.0	1.0	1.0					17																	19091349		249	159	408	19031942			0					17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091349C>T			19031942		RNA	SNP	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			-	-		0.473	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	lincRNA		C	NR_006881		19031942	+1	no_errors	ENST00000365494	ensembl	human	known	54_36p	rna	SNP	1.000	T
BMS1P16	727914	genome.wustl.edu	37	15	21366449	21366449	+	IGR	SNP	T	T	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr15:21366449T>A								RP11-854K16.3 (31025 upstream) : RP11-32B5.7 (574697 downstream)																							TTGAAGGAGATGTTTGATGTG	0.348																																																0			15																																								19631108	SO:0001628	intergenic_variant	727914																															15.37:g.21366449T>A			19631108		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.348					LOC727914			T			19631108	+1	pseudogene	XR_015142	genbank	human	model	54_36p	rna	SNP	1.000	A
DSG4	147409	genome.wustl.edu	37	18	28986206	28986206	+	Silent	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr18:28986206G>A	ENST00000308128.4	+	12	1938	c.1803G>A	c.(1801-1803)gcG>gcA	p.A601A	RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Silent_p.A601A|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	601					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTGGTGCCGCGGGCATCTACA	0.502																																																0			18											109.0	107.0	108.0					18																	28986206		2203	4300	6503	27240204	SO:0001819	synonymous_variant	147409			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1803G>A	18.37:g.28986206G>A			27240204	A2RUI1|Q6Y9L9|Q8IXV4	Silent	SNP	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1	p.A601	ENST00000308128.4	37	c.1803	CCDS11897.1	18																																																																																			-	NULL		0.502	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	protein_coding	OTTHUMT00000254941.1	G	NM_177986		27240204	+1	no_errors	NM_177986	genbank	human	validated	54_36p	silent	SNP	0.086	A
KIAA0556	23247	genome.wustl.edu	37	16	27761031	27761031	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr16:27761031C>T	ENST00000261588.4	+	16	2769	c.2750C>T	c.(2749-2751)aCg>aTg	p.T917M		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	917						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						ATCTCCAACACGGAGCTCCCG	0.647																																																0			16											51.0	49.0	50.0					16																	27761031		2197	4300	6497	27668532	SO:0001583	missense	23247			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.2750C>T	16.37:g.27761031C>T	ENSP00000261588:p.Thr917Met		27668532	A7E2C2	Missense_Mutation	SNP	superfamily_Galactose-binding domain-like,PatternScan_AKH	p.T917M	ENST00000261588.4	37	c.2750	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.882303	0.00532	.	.	ENSG00000047578	ENST00000261588	T	0.06449	3.3	4.7	1.14	0.20703	.	0.363040	0.30365	N	0.009800	T	0.01222	0.0040	N	0.00230	-1.795	0.25250	N	0.989688	B	0.16396	0.017	B	0.09377	0.004	T	0.47071	-0.9145	10	0.05959	T	0.93	-21.8493	8.5273	0.33313	0.0:0.2277:0.0:0.7723	.	917	O60303	K0556_HUMAN	M	917	ENSP00000261588:T917M	ENSP00000261588:T917M	T	+	2	0	KIAA0556	27668532	1.000000	0.71417	0.129000	0.21949	0.027000	0.11550	2.767000	0.47637	-0.017000	0.14103	-0.768000	0.03414	ACG	-	NULL		0.647	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	protein_coding	OTTHUMT00000433724.1	C	NM_015202		27668532	+1	no_errors	NM_015202	genbank	human	validated	54_36p	missense	SNP	1.000	T
KIF13B	23303	genome.wustl.edu	37	8	29005012	29005012	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr8:29005012G>A	ENST00000524189.1	-	17	1959	c.1921C>T	c.(1921-1923)Cgg>Tgg	p.R641W	KIF13B_ENST00000521515.1_Missense_Mutation_p.R641W	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	641					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		AGCCTTCTCCGGAGCTGCTCC	0.517																																																0			8											67.0	64.0	65.0					8																	29005012		1969	4157	6126	29060931	SO:0001583	missense	23303			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.1921C>T	8.37:g.29005012G>A	ENSP00000427900:p.Arg641Trp		29060931	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	HMMSmart_SM00129,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_Kinesin,PatternScan_KINESIN_MOTOR_DOMAIN1,superfamily_SMAD/FHA domain,HMMPfam_FHA,superfamily_Cap-Gly domain,HMMPfam_CAP_GLY,PatternScan_CAP_GLY_1	p.R641W	ENST00000524189.1	37	c.1921	CCDS55217.1	8	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521761	0.64747	.	.	ENSG00000197892	ENST00000524189;ENST00000521515	T;T	0.72615	-0.67;-0.67	5.68	3.67	0.42095	.	0.000000	0.85682	D	0.000000	D	0.83848	0.5343	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.988	D	0.86983	0.2105	10	0.87932	D	0	.	16.1541	0.81644	0.0:0.0:0.7455:0.2545	.	641;641	Q9NQT8;F8VPJ2	KI13B_HUMAN;.	W	641	ENSP00000427900:R641W;ENSP00000429201:R641W	ENSP00000429201:R641W	R	-	1	2	KIF13B	29060931	1.000000	0.71417	0.287000	0.24848	0.489000	0.33432	5.403000	0.66338	1.364000	0.46038	0.563000	0.77884	CGG	-	NULL		0.517	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	protein_coding	OTTHUMT00000376878.1	G			29060931	-1	no_errors	NM_015254	genbank	human	validated	54_36p	missense	SNP	0.896	A
SLC5A2	6524	genome.wustl.edu	37	16	31499366	31499366	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr16:31499366T>C	ENST00000330498.3	+	8	912	c.893T>C	c.(892-894)gTg>gCg	p.V298A	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	298					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	TAGGTCATCGTGCAGCGCTGC	0.687																																																0			16											69.0	66.0	67.0					16																	31499366		2197	4300	6497	31406867	SO:0001583	missense	6524				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.893T>C	16.37:g.31499366T>C	ENSP00000327943:p.Val298Ala		31406867	A2RRD2	Missense_Mutation	SNP	HMMPfam_SSF,PatternScan_NA_SOLUT_SYMP_1,PatternScan_NA_SOLUT_SYMP_2	p.V298A	ENST00000330498.3	37	c.893	CCDS10714.1	16	.	.	.	.	.	.	.	.	.	.	T	21.1	4.097790	0.76870	.	.	ENSG00000140675	ENST00000330498;ENST00000419665	D;D	0.89415	-2.51;-2.51	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.91730	0.7385	M	0.90145	3.09	0.80722	D	1	P	0.41710	0.76	P	0.45538	0.484	D	0.92839	0.6287	10	0.87932	D	0	.	11.1778	0.48610	0.0:0.0:0.0:1.0	.	298	P31639	SC5A2_HUMAN	A	298	ENSP00000327943:V298A;ENSP00000410601:V298A	ENSP00000327943:V298A	V	+	2	0	SLC5A2	31406867	1.000000	0.71417	0.962000	0.40283	0.575000	0.36095	7.785000	0.85724	1.739000	0.51704	0.379000	0.24179	GTG	-	HMMPfam_SSF		0.687	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A2	protein_coding	OTTHUMT00000255627.2	T			31406867	+1	no_errors	NM_003041	genbank	human	validated	54_36p	missense	SNP	1.000	C
KIAA1551	55196	genome.wustl.edu	37	12	32134393	32134393	+	Missense_Mutation	SNP	G	G	C	rs375507663		TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr12:32134393G>C	ENST00000312561.4	+	4	918	c.504G>C	c.(502-504)atG>atC	p.M168I	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	168																	AAATGCAGATGATCCCTTCTA	0.413																																																0			12											98.0	92.0	94.0					12																	32134393		2203	4300	6503	32025660	SO:0001583	missense	55196			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.504G>C	12.37:g.32134393G>C	ENSP00000310338:p.Met168Ile		32025660	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.M168I	ENST00000312561.4	37	c.504	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371914	0.42003	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.07444	3.19;3.19	5.42	3.35	0.38373	.	0.990505	0.08215	N	0.980019	T	0.07773	0.0195	L	0.36672	1.1	0.09310	N	1	P	0.38677	0.642	B	0.35278	0.199	T	0.38436	-0.9661	9	.	.	.	.	8.3033	0.32027	0.086:0.0:0.7647:0.1493	.	168	Q9HCM1	CL035_HUMAN	I	168	ENSP00000310338:M168I;ENSP00000370442:M168I	.	M	+	3	0	C12orf35	32025660	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	0.223000	0.17719	0.484000	0.27630	0.650000	0.86243	ATG	-	NULL		0.413	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf35	protein_coding	OTTHUMT00000250307.2	G	NM_018169		32025660	+1	no_errors	NM_018169	genbank	human	validated	54_36p	missense	SNP	0.001	C
NOTCH4	4855	genome.wustl.edu	37	6	32170085	32170085	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr6:32170085C>T	ENST00000375023.3	-	21	3661	c.3523G>A	c.(3523-3525)Gcc>Acc	p.A1175T		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1175					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CACCCCTTGGCTCCGGGTTTC	0.652																																																0			6											22.0	24.0	23.0					6																	32170085		1509	2707	4216	32278063	SO:0001583	missense	4855				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3523G>A	6.37:g.32170085C>T	ENSP00000364163:p.Ala1175Thr		32278063	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	HMMSmart_SM00181,HMMPfam_EGF,HMMSmart_SM00179,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_2,PatternScan_EGF_CA,HMMPfam_EGF_CA,PatternScan_ASX_HYDROXYL,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00004,HMMPfam_Notch,superfamily_Notch domain,HMMPfam_NODP,superfamily_Ankyrin repeat,HMMPfam_Ank,HMMSmart_SM00248	p.A1175T	ENST00000375023.3	37	c.3523	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	8.895	0.955028	0.18507	.	.	ENSG00000204301	ENST00000375023	D	0.92149	-2.98	4.77	3.9	0.45041	Notch domain (3);	0.153666	0.30383	N	0.009745	T	0.77948	0.4207	L	0.43152	1.355	0.09310	N	1	B	0.25809	0.135	B	0.33121	0.158	T	0.65084	-0.6254	10	0.13470	T	0.59	.	7.1342	0.25519	0.0:0.8014:0.0:0.1986	.	1175	Q99466	NOTC4_HUMAN	T	1175	ENSP00000364163:A1175T	ENSP00000364163:A1175T	A	-	1	0	NOTCH4	32278063	0.001000	0.12720	0.013000	0.15412	0.143000	0.21401	0.379000	0.20585	1.229000	0.43630	0.561000	0.74099	GCC	-	superfamily_EGF/Laminin,HMMSmart_SM00004,HMMPfam_Notch,superfamily_Notch domain		0.652	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	protein_coding	OTTHUMT00000076045.2	C			32278063	-1	no_errors	NM_004557	genbank	human	reviewed	54_36p	missense	SNP	0.003	T
TAF1L	138474	genome.wustl.edu	37	9	32634143	32634143	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr9:32634143C>T	ENST00000242310.4	-	1	1524	c.1435G>A	c.(1435-1437)Gat>Aat	p.D479N	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	479					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GGTTTGTCATCATCCAGAGTG	0.483																																																0			9											198.0	172.0	181.0					9																	32634143		2203	4300	6503	32624143	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.1435G>A	9.37:g.32634143C>T	ENSP00000418379:p.Asp479Asn		32624143	Q0VG57	Missense_Mutation	SNP	HMMPfam_TBP-binding,superfamily_TAF_II_230,superfamily_Bromodomain,HMMSmart_BROMO,HMMPfam_Bromodomain,PatternScan_BROMODOMAIN_1	p.D479N	ENST00000242310.4	37	c.1435	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315498	0.60524	.	.	ENSG00000122728	ENST00000242310	T	0.08102	3.13	0.479	0.479	0.16796	.	0.105883	0.64402	D	0.000004	T	0.05502	0.0145	L	0.36672	1.1	0.40218	D	0.977709	B	0.13145	0.007	B	0.12156	0.007	T	0.36648	-0.9739	10	0.16420	T	0.52	.	6.6915	0.23174	0.0:0.9998:0.0:2.0E-4	.	479	Q8IZX4	TAF1L_HUMAN	N	479	ENSP00000418379:D479N	ENSP00000418379:D479N	D	-	1	0	TAF1L	32624143	1.000000	0.71417	0.987000	0.45799	0.510000	0.34073	4.952000	0.63618	0.507000	0.28148	0.195000	0.17529	GAT	-	NULL		0.483	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	protein_coding	OTTHUMT00000052012.2	C			32624143	-1	no_errors	NM_153809	genbank	human	provisional	54_36p	missense	SNP	0.998	T
MGAT3	4248	genome.wustl.edu	37	22	39884180	39884180	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr22:39884180C>A	ENST00000341184.6	+	2	1043	c.828C>A	c.(826-828)caC>caA	p.H276Q		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	276					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					TCCTGGACCACTTCCCGCCCG	0.677																																																0			22											57.0	60.0	59.0					22																	39884180		2200	4296	6496	38214126	SO:0001583	missense	4248			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.828C>A	22.37:g.39884180C>A	ENSP00000345270:p.His276Gln		38214126	A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	HMMPfam_Glyco_transf_17	p.H276Q	ENST00000341184.6	37	c.828	CCDS13994.2	22	.	.	.	.	.	.	.	.	.	.	C	16.83	3.231061	0.58777	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.6	3.44	0.39384	.	0.000000	0.85682	D	0.000000	T	0.70107	0.3186	M	0.66939	2.045	0.38155	D	0.938873	D	0.76494	0.999	D	0.77557	0.99	T	0.72896	-0.4153	9	0.46703	T	0.11	.	10.1233	0.42634	0.0:0.7898:0.0:0.2102	.	276	Q09327	MGAT3_HUMAN	Q	276	.	ENSP00000345270:H276Q	H	+	3	2	MGAT3	38214126	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.456000	0.35201	1.350000	0.45770	0.561000	0.74099	CAC	-	HMMPfam_Glyco_transf_17		0.677	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	protein_coding	OTTHUMT00000075039.2	C	NM_002409		38214126	+1	no_errors	NM_001098270	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
SCN10A	6336	genome.wustl.edu	37	3	38835277	38835277	+	Silent	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr3:38835277G>A	ENST00000449082.2	-	1	224	c.225C>T	c.(223-225)atC>atT	p.I75I		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	75					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGGGCTCCCCGATCAGTTCTG	0.562																																																0			3											144.0	149.0	147.0					3																	38835277		2203	4300	6503	38810281	SO:0001819	synonymous_variant	6336			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.225C>T	3.37:g.38835277G>A			38810281	A6NDQ1	Silent	SNP	superfamily_SSF81324,HMMPfam_Ion_trans,HMMPfam_Na_trans_assoc	p.I75	ENST00000449082.2	37	c.225	CCDS33736.1	3																																																																																			-	NULL		0.562	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	protein_coding	OTTHUMT00000109745.3	G	NM_006514		38810281	-1	no_errors	NM_006514	genbank	human	validated	54_36p	silent	SNP	0.084	A
KLB	152831	genome.wustl.edu	37	4	39450111	39450111	+	Silent	SNP	A	A	G			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr4:39450111A>G	ENST00000257408.4	+	5	3037	c.2940A>G	c.(2938-2940)caA>caG	p.Q980Q		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	980					carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						GTCAGACCCAAGAAAATACAG	0.413																																																0			4											109.0	106.0	107.0					4																	39450111		2203	4300	6503	39126506	SO:0001819	synonymous_variant	152831			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2940A>G	4.37:g.39450111A>G			39126506	Q2M3K8	Silent	SNP	PatternScan_GLYCOSYL_HYDROL_F1_1,PatternScan_GLYCOSYL_HYDROL_F1_2,HMMPfam_Glyco_hydro_1,superfamily_Glyco_hydro_cat	p.Q980	ENST00000257408.4	37	c.2940	CCDS3451.1	4																																																																																			-	superfamily_Glyco_hydro_cat		0.413	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	protein_coding	OTTHUMT00000250429.1	A	NM_175737		39126506	+1	no_errors	NM_175737	genbank	human	validated	54_36p	silent	SNP	0.000	G
MACF1	23499	genome.wustl.edu	37	1	39893746	39893746	+	Intron	SNP	G	G	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr1:39893746G>C	ENST00000372915.3	+	61	16578				MACF1_ENST00000361689.2_Missense_Mutation_p.K3468N|MACF1_ENST00000289893.4_Missense_Mutation_p.K3970N|MACF1_ENST00000564288.1_Missense_Mutation_p.K5530N|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Missense_Mutation_p.K3468N|MACF1_ENST00000567887.1_Missense_Mutation_p.K5567N|MACF1_ENST00000545844.1_Missense_Mutation_p.K3468N			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTCAGAAAAGATAGACTCAT	0.507																																																0			1											108.0	97.0	101.0					1																	39893746		2203	4300	6503	39666333	SO:0001627	intron_variant	23499			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16491+460G>C	1.37:g.39893746G>C			39666333	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	superfamily_SSF75399,HMMSmart_PLEC,HMMPfam_Plectin,HMMPfam_Spectrin,superfamily_Spectrin,HMMSmart_SPEC,PatternScan_GLYCOSYL_HYDROL_F5,superfamily_SSF47473,HMMSmart_EFh,HMMPfam_efhand,PatternScan_EF_HAND_1,HMMPfam_GAS2,HMMSmart_GAS2	p.K3970N	ENST00000372915.3	37	c.11910		1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133094	0.56828	.	.	ENSG00000127603	ENST00000545844;ENST00000361689;ENST00000317713;ENST00000289893;ENST00000482035	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	5.84	2.96	0.34315	.	0.218896	0.30901	N	0.008653	T	0.63792	0.2541	L	0.58810	1.83	0.80722	D	1	D;D	0.69078	0.997;0.975	D;P	0.66979	0.948;0.848	T	0.64630	-0.6362	10	0.72032	D	0.01	.	9.6784	0.40054	0.3322:0.0:0.6678:0.0	.	3468;3412	F8W8Q1;Q9UPN3-3	.;.	N	3468;3468;3468;3970;284	ENSP00000439537:K3468N;ENSP00000354573:K3468N;ENSP00000313438:K3468N;ENSP00000289893:K3970N;ENSP00000433104:K284N	ENSP00000289893:K3970N	K	+	3	2	MACF1	39666333	0.996000	0.38824	1.000000	0.80357	0.986000	0.74619	0.364000	0.20325	0.828000	0.34709	-0.259000	0.10710	AAG	-	superfamily_Spectrin,HMMPfam_Spectrin,HMMSmart_SPEC		0.507	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	G	NM_033044		39666333	+1	no_errors	NM_033044	genbank	human	reviewed	54_36p	missense	SNP	0.995	C
ZSWIM1	90204	genome.wustl.edu	37	20	44511649	44511649	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr20:44511649G>C	ENST00000372523.1	+	2	513	c.418G>C	c.(418-420)Gag>Cag	p.E140Q	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.E140Q	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	140						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				TCCAGCATGGGAGAGAGTCTG	0.517																																																0			20											122.0	111.0	115.0					20																	44511649		2203	4300	6503	43945056	SO:0001583	missense	90204			AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.418G>C	20.37:g.44511649G>C	ENSP00000361601:p.Glu140Gln		43945056	Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	HMMPfam_SWIM	p.E140Q	ENST00000372523.1	37	c.418	CCDS13382.2	20	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402450	0.42613	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.24151	1.87;1.87	5.38	4.41	0.53225	.	0.507214	0.15750	U	0.246492	T	0.28433	0.0703	L	0.57536	1.79	0.25683	N	0.985775	P	0.48764	0.915	P	0.47603	0.551	T	0.10405	-1.0631	10	0.25751	T	0.34	-16.0353	7.4587	0.27283	0.135:0.0:0.7191:0.146	.	140	Q9BR11	ZSWM1_HUMAN	Q	140	ENSP00000361601:E140Q;ENSP00000361598:E140Q	ENSP00000361598:E140Q	E	+	1	0	ZSWIM1	43945056	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.636000	0.37144	2.793000	0.96121	0.655000	0.94253	GAG	-	NULL		0.517	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM1	protein_coding	OTTHUMT00000157064.2	G	NM_080603		43945056	+1	no_errors	NM_080603	genbank	human	provisional	54_36p	missense	SNP	0.941	C
PRKCE	5581	genome.wustl.edu	37	2	46207451	46207451	+	Silent	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr2:46207451C>T	ENST00000306156.3	+	5	951	c.624C>T	c.(622-624)gtC>gtT	p.V208V		NM_005400.2	NP_005391.1	Q02156	KPCE_HUMAN	protein kinase C, epsilon	208					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to ethanol (GO:0071361)|cellular response to hypoxia (GO:0071456)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|locomotory exploration behavior (GO:0035641)|macrophage activation involved in immune response (GO:0002281)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cellular glucuronidation (GO:2001031)|positive regulation of cytokinesis (GO:0032467)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of insulin secretion (GO:0032024)|positive regulation of lipid catabolic process (GO:0050996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|release of sequestered calcium ion into cytosol (GO:0051209)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|TRAM-dependent toll-like receptor 4 signaling pathway (GO:0035669)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|ethanol binding (GO:0035276)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|receptor activator activity (GO:0030546)|signal transducer activity (GO:0004871)		MBOAT2/PRKCE(2)	breast(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(13)|ovary(3)|upper_aerodigestive_tract(2)	34		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)		Tamoxifen(DB00675)	CCTGCGTGGTCCACAAGCGGT	0.532																																																0			2											73.0	70.0	71.0					2																	46207451		1822	3817	5639	46060955	SO:0001819	synonymous_variant	5581				CCDS1824.1	2p21	2009-07-10			ENSG00000171132	ENSG00000171132	2.7.11.1		9401	protein-coding gene	gene with protein product		176975				1382605, 7877991	Standard	NM_005400		Approved		uc002rut.3	Q02156	OTTHUMG00000128817	ENST00000306156.3:c.624C>T	2.37:g.46207451C>T			46060955	B0LPH7|Q32MQ3|Q53SL4|Q53SM5|Q9UE81	Silent	SNP	superfamily_C2 domain (Calcium/lipid-binding domain CaLB),HMMSmart_SM00239,HMMPfam_C2,superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1,superfamily_Protein kinase-like (PK-like),HMMSmart_SM00219,HMMSmart_SM00220,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ATP,PatternScan_PROTEIN_KINASE_ST,HMMSmart_SM00133,HMMPfam_Pkinase_C	p.V208	ENST00000306156.3	37	c.624	CCDS1824.1	2																																																																																			-	superfamily_Cysteine-rich domain,HMMSmart_SM00109,PatternScan_ZF_DAG_PE_1,HMMPfam_C1_1		0.532	PRKCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCE	protein_coding	OTTHUMT00000250751.2	C			46060955	+1	no_errors	NM_005400	genbank	human	reviewed	54_36p	silent	SNP	1.000	T
RB1	5925	genome.wustl.edu	37	13	48955568	48955568	+	Missense_Mutation	SNP	G	G	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr13:48955568G>C	ENST00000267163.4	+	17	1822	c.1684G>C	c.(1684-1686)Gca>Cca	p.A562P		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	562	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGAATCCCTTGCATGGCTCTC	0.343		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	13											69.0	65.0	66.0					13																	48955568		2203	4300	6503	47853569	SO:0001583	missense	5925	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1684G>C	13.37:g.48955568G>C	ENSP00000267163:p.Ala562Pro		47853569	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	HMMPfam_RB_A,superfamily_Cyclin-like,HMMPfam_RB_B,HMMSmart_SM00385,HMMPfam_Rb_C	p.A562P	ENST00000267163.4	37	c.1684	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878364	0.91740	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.93547	-3.24	5.34	5.34	0.76211	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.056609	0.64402	D	0.000001	D	0.97318	0.9123	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97974	1.0345	10	0.87932	D	0	.	19.0281	0.92941	0.0:0.0:1.0:0.0	.	562	P06400	RB_HUMAN	P	541;562	ENSP00000267163:A562P	ENSP00000267163:A562P	A	+	1	0	RB1	47853569	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.471000	0.97696	2.488000	0.83962	0.650000	0.86243	GCA	-	HMMPfam_RB_A,superfamily_Cyclin-like		0.343	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	G			47853569	+1	no_errors	NM_000321	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
CRISP2	7180	genome.wustl.edu	37	6	49666155	49666155	+	Missense_Mutation	SNP	T	T	G			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr6:49666155T>G	ENST00000339139.4	-	7	573	c.337A>C	c.(337-339)Agc>Cgc	p.S113R		NM_001142407.2|NM_001142408.2|NM_001142417.2|NM_001142435.2|NM_001261822.1|NM_003296.3	NP_001135879.1|NP_001135880.1|NP_001135889.1|NP_001135907.1|NP_001248751.1|NP_003287.1	P16562	CRIS2_HUMAN	cysteine-rich secretory protein 2	113	SCP.				single organismal cell-cell adhesion (GO:0016337)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	19	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			TCATACCAGCTTTGGATTGCA	0.413																																																0			6											155.0	141.0	146.0					6																	49666155		2203	4300	6503	49774114	SO:0001583	missense	7180			X95239	CCDS4928.1	6p12.3	2009-03-12	2003-09-03	2003-09-05	ENSG00000124490	ENSG00000124490			12024	protein-coding gene	gene with protein product	"""cancer/testis antigen 36"""	187430	"""testis specific protein 1 (probe H4-1 p3-1)"""	GAPDL5, TPX1		2613236, 8665901	Standard	NM_003296		Approved	CRISP-2, CT36	uc003ozo.3	P16562	OTTHUMG00000014822	ENST00000339139.4:c.337A>C	6.37:g.49666155T>G	ENSP00000339155:p.Ser113Arg		49774114	A8K8M0|Q53FF2|Q5U8Z9|Q7Z7B2	Missense_Mutation	SNP	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP,PatternScan_CRISP_1,PatternScan_CRISP_2,HMMPfam_Crisp	p.S113R	ENST00000339139.4	37	c.337	CCDS4928.1	6	.	.	.	.	.	.	.	.	.	.	T	11.06	1.528180	0.27299	.	.	ENSG00000124490	ENST00000339139;ENST00000211238	T	0.08370	3.1	5.39	4.21	0.49690	CAP domain (3);	0.729199	0.13855	N	0.358098	T	0.07863	0.0197	L	0.58101	1.795	0.39259	D	0.964178	B;B	0.33964	0.434;0.017	P;B	0.46585	0.521;0.081	T	0.14200	-1.0481	10	0.39692	T	0.17	.	7.1108	0.25388	0.0:0.17:0.0:0.83	.	113;113	Q7Z7B2;P16562	.;CRIS2_HUMAN	R	113	ENSP00000339155:S113R	ENSP00000211238:S113R	S	-	1	0	CRISP2	49774114	0.056000	0.20664	0.989000	0.46669	0.290000	0.27261	0.346000	0.19997	2.170000	0.68504	0.528000	0.53228	AGC	-	superfamily_PR-1-like,HMMSmart_SM00198,HMMPfam_SCP		0.413	CRISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISP2	protein_coding	OTTHUMT00000040870.2	T	NM_003296		49774114	-1	no_errors	NM_003296	genbank	human	validated	54_36p	missense	SNP	0.992	G
RSPH6A	81492	genome.wustl.edu	37	19	46307934	46307934	+	Missense_Mutation	SNP	G	G	A	rs186156470	byFrequency	TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr19:46307934G>A	ENST00000221538.3	-	3	1371	c.1229C>T	c.(1228-1230)cCg>cTg	p.P410L	RSPH6A_ENST00000597055.1_Missense_Mutation_p.P410L|RSPH6A_ENST00000600188.1_Missense_Mutation_p.P146L	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	410						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CACGGGCGGCGGCTTCCATAC	0.657													G|||	3	0.000599042	0.0	0.0043	5008	,	,		15854	0.0		0.0	False		,,,				2504	0.0															0			19											64.0	59.0	61.0					19																	46307934		2203	4300	6503	50999774	SO:0001583	missense	81492			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1229C>T	19.37:g.46307934G>A	ENSP00000221538:p.Pro410Leu		50999774	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	HMMPfam_Radial_spoke	p.P410L	ENST00000221538.3	37	c.1229	CCDS12675.1	19	3	0.0013736263736263737	0	0.0	3	0.008287292817679558	0	0.0	0	0.0	G	15.78	2.933719	0.52866	.	.	ENSG00000104941	ENST00000221538	T	0.19250	2.16	4.03	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	M	0.83953	2.67	0.52099	D	0.999948	D	0.76494	0.999	P	0.60173	0.87	T	0.41106	-0.9527	10	0.48119	T	0.1	-13.084	14.5144	0.67809	0.0:0.0:1.0:0.0	.	410	Q9H0K4	RSH6A_HUMAN	L	410	ENSP00000221538:P410L	ENSP00000221538:P410L	P	-	2	0	RSPH6A	50999774	1.000000	0.71417	1.000000	0.80357	0.169000	0.22640	4.951000	0.63610	2.544000	0.85801	0.456000	0.33151	CCG	-	HMMPfam_Radial_spoke		0.657	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSHL1	protein_coding	OTTHUMT00000461657.1	G			50999774	-1	no_errors	NM_030785	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
KRT6A	3853	genome.wustl.edu	37	12	52881700	52881700	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr12:52881700G>T	ENST00000330722.6	-	9	1567	c.1499C>A	c.(1498-1500)gCc>gAc	p.A500D		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	500	Tail.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		GACACCACTGGCACCGCCATA	0.602																																																0			12											57.0	62.0	60.0					12																	52881700		2203	4300	6503	51167967	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1499C>A	12.37:g.52881700G>T	ENSP00000369317:p.Ala500Asp		51167967	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	HMMPfam_Filament,PatternScan_IF	p.A500D	ENST00000330722.6	37	c.1499	CCDS41786.1	12	.	.	.	.	.	.	.	.	.	.	g	6.734	0.504203	0.12822	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.87966	-2.32	4.94	1.45	0.22620	.	0.847313	0.10085	N	0.717882	D	0.85444	0.5698	M	0.66939	2.045	0.09310	N	1	B	0.26635	0.155	B	0.26517	0.07	T	0.68330	-0.5437	10	0.12430	T	0.62	.	16.8847	0.86072	0.0:0.5604:0.4396:0.0	.	500	P02538	K2C6A_HUMAN	D	500;456	ENSP00000369317:A500D	ENSP00000369317:A500D	A	-	2	0	KRT6A	51167967	0.000000	0.05858	0.003000	0.11579	0.048000	0.14542	0.119000	0.15626	0.511000	0.28236	0.586000	0.80456	GCC	-	NULL		0.602	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6A	protein_coding	OTTHUMT00000404978.2	G	NM_005554		51167967	-1	no_errors	NM_005554	genbank	human	reviewed	54_36p	missense	SNP	0.149	T
PSME4	23198	genome.wustl.edu	37	2	54128637	54128637	+	Silent	SNP	A	A	G	rs150490966	byFrequency	TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr2:54128637A>G	ENST00000404125.1	-	28	3190	c.3135T>C	c.(3133-3135)gaT>gaC	p.D1045D	PSME4_ENST00000421748.2_Silent_p.D189D	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1045					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TACAGTCCCAATCATGAAGGT	0.418																																																0			2						A		2,4404	4.2+/-10.8	0,2,2201	137.0	133.0	134.0		3135	-4.3	1.0	2	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	PSME4	NM_014614.2		0,3,6500	GG,GA,AA		0.0116,0.0454,0.0231		1045/1844	54128637	3,13003	2203	4300	6503	53982141	SO:0001819	synonymous_variant	23198			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.3135T>C	2.37:g.54128637A>G			53982141	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	superfamily_ARM repeat,HMMPfam_HEAT	p.D931	ENST00000404125.1	37	c.2793	CCDS33197.2	2																																																																																			-	superfamily_ARM repeat		0.418	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	protein_coding	OTTHUMT00000324163.1	A	XM_040158		53982141	-1	no_errors	NM_014614	genbank	human	validated	54_36p	silent	SNP	0.996	G
PTOV1	53635	genome.wustl.edu	37	19	50363277	50363277	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr19:50363277G>T	ENST00000601675.1	+	11	1180	c.1076G>T	c.(1075-1077)tGt>tTt	p.C359F	AC018766.4_ENST00000596624.1_RNA|PTOV1_ENST00000601638.1_Missense_Mutation_p.C327F|PTOV1_ENST00000598325.1_3'UTR|PTOV1_ENST00000221557.9_Intron|PTOV1_ENST00000391842.1_Missense_Mutation_p.C359F|AC018766.5_ENST00000601893.1_RNA|AC018766.5_ENST00000593654.1_RNA|PTOV1_ENST00000600603.1_Intron|AC018766.5_ENST00000599259.1_RNA|PTOV1_ENST00000599732.1_Missense_Mutation_p.C359F			Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	359	Interaction with FLOT1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(5)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)	16		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		AAAGCATCGTGTGAGATCCGC	0.577																																																0			19											107.0	77.0	87.0					19																	50363277		2203	4300	6503	55055089	SO:0001583	missense	53635			AF238381	CCDS12782.1	19q13.33	2014-08-28	2008-09-12		ENSG00000104960	ENSG00000104960			9632	protein-coding gene	gene with protein product		610195				12598323, 15713644	Standard	XM_005258998		Approved		uc002pqf.1	Q86YD1	OTTHUMG00000183162	ENST00000601675.1:c.1076G>T	19.37:g.50363277G>T	ENSP00000472816:p.Cys359Phe		55055089	Q6UXX7|Q96BU3|Q9HBN4|Q9NYL1	Missense_Mutation	SNP	PatternScan_AA_TRNA_LIGASE_I	p.C359F	ENST00000601675.1	37	c.1076	CCDS12782.1	19	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854237	0.71719	.	.	ENSG00000104960	ENST00000391842	.	.	.	4.27	4.27	0.50696	Mediator complex, subunit Med25, PTOV activation and synapsin 2 (1);	0.000000	0.85682	D	0.000000	T	0.77824	0.4188	M	0.73217	2.22	0.53688	D	0.999979	D	0.76494	0.999	D	0.91635	0.999	T	0.80939	-0.1158	9	0.72032	D	0.01	-10.789	15.9638	0.79950	0.0:0.0:1.0:0.0	.	359	Q86YD1	PTOV1_HUMAN	F	359	.	ENSP00000375717:C359F	C	+	2	0	PTOV1	55055089	1.000000	0.71417	0.743000	0.31040	0.590000	0.36582	8.488000	0.90458	2.377000	0.81083	0.457000	0.33378	TGT	-	NULL		0.577	PTOV1-007	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|CCDS	protein_coding	PTOV1	protein_coding	OTTHUMT00000465347.1	G	NM_017432		55055089	+1	no_errors	NM_017432	genbank	human	provisional	54_36p	missense	SNP	0.997	T
OR8K5	219453	genome.wustl.edu	37	11	55926963	55926963	+	Missense_Mutation	SNP	A	A	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr11:55926963A>C	ENST00000313447.1	-	1	830	c.831T>G	c.(829-831)ttT>ttG	p.F277L		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	277						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CTAAAGTGTAAAACACAGAAG	0.383																																																0			11											103.0	89.0	93.0					11																	55926963		2201	4296	6497	55683539	SO:0001583	missense	219453			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.831T>G	11.37:g.55926963A>C	ENSP00000323853:p.Phe277Leu		55683539	Q6IFB5	Missense_Mutation	SNP	superfamily_SSF81321,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.F277L	ENST00000313447.1	37	c.831	CCDS31521.1	11	.	.	.	.	.	.	.	.	.	.	A	14.55	2.567674	0.45798	.	.	ENSG00000181752	ENST00000313447	T	0.00032	8.88	3.88	2.61	0.31194	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000018	T	0.00144	0.0004	L	0.45581	1.43	0.26564	N	0.973671	P	0.35628	0.513	B	0.39531	0.302	T	0.15983	-1.0418	10	0.66056	D	0.02	.	6.1634	0.20376	0.6457:0.0:0.0:0.3543	.	277	Q8NH50	OR8K5_HUMAN	L	277	ENSP00000323853:F277L	ENSP00000323853:F277L	F	-	3	2	OR8K5	55683539	0.000000	0.05858	1.000000	0.80357	0.865000	0.49528	-1.809000	0.01731	1.748000	0.51833	0.381000	0.24937	TTT	-	superfamily_SSF81321,HMMPfam_7tm_1		0.383	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K5	protein_coding	OTTHUMT00000391543.1	A	NM_001004058		55683539	-1	no_errors	NM_001004058	genbank	human	validated	54_36p	missense	SNP	0.003	C
SIGLEC14	100049587	genome.wustl.edu	37	19	52149592	52149592	+	Silent	SNP	C	C	T	rs541001381	byFrequency	TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr19:52149592C>T	ENST00000360844.6	-	2	380	c.339G>A	c.(337-339)acG>acA	p.T113T	SIGLEC5_ENST00000534261.2_5'Flank|SIGLEC5_ENST00000599649.1_Silent_p.T113T|SIGLEC5_ENST00000429354.3_Intron|SIGLEC5_ENST00000222107.4_Silent_p.T113T	NM_001098612.1	NP_001092082.1	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14	113	Ig-like V-type.				cell adhesion (GO:0007155)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)		AATAGCTTCCCGTGTCCTCCA	0.527													C|||	2	0.000399361	0.0015	0.0	5008	,	,		16759	0.0		0.0	False		,,,				2504	0.0															0			19											40.0	47.0	45.0					19																	52149592		1755	3885	5640	56841404	SO:0001819	synonymous_variant	0			AY854038	CCDS42604.1	19q13.41	2013-01-29			ENSG00000254415	ENSG00000254415		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	32926	protein-coding gene	gene with protein product						17012248	Standard	NM_001098612		Approved		uc002pxf.4	Q08ET2	OTTHUMG00000165511	ENST00000360844.6:c.339G>A	19.37:g.52149592C>T			56841404	Q6UXG0	Silent	SNP	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG,HMMPfam_ig,HMMSmart_IGc2,PatternScan_IG_MHC	p.T113	ENST00000360844.6	37	c.339	CCDS42604.1	19																																																																																			-	superfamily_SSF48726,HMMPfam_V-set,HMMSmart_IG		0.527	SIGLEC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC14	protein_coding	OTTHUMT00000466899.2	C	NM_001098612		56841404	-1	no_errors	NM_001098612	genbank	human	validated	54_36p	silent	SNP	0.000	T
LAMA5	3911	genome.wustl.edu	37	20	60884427	60884427	+	Missense_Mutation	SNP	C	C	T	rs138468519	byFrequency	TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr20:60884427C>T	ENST00000252999.3	-	80	11119	c.11053G>A	c.(11053-11055)Ggg>Agg	p.G3685R	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3685	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CCCACTGCCCCGTGGACCTCC	0.726													C|||	18	0.00359425	0.0008	0.0086	5008	,	,		7867	0.0		0.0099	False		,,,				2504	0.001															0			20							ARG/GLY	9,4123		0,9,2057	7.0	9.0	9.0		11053	5.4	0.5	20	dbSNP_134	9	73,8195		0,73,4061	yes	missense	LAMA5	NM_005560.3	125	0,82,6118	TT,TC,CC		0.8829,0.2178,0.6613	benign	3685/3696	60884427	82,12318	2066	4134	6200	60317822	SO:0001583	missense	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.11053G>A	20.37:g.60884427C>T	ENSP00000252999:p.Gly3685Arg		60317822	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	HMMSmart_SM00136,HMMPfam_Laminin_N,superfamily_Galactose-binding domain-like,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_1,PatternScan_EGF_LAM_1,HMMSmart_SM00181,PatternScan_EGF_2,HMMSmart_SM00281,HMMPfam_Laminin_B,PatternScan_TNFR_NGFR_1,HMMPfam_Laminin_I,HMMPfam_Laminin_II,superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.G3685R	ENST00000252999.3	37	c.11053	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	c	19.47	3.834528	0.71373	0.002178	0.008829	ENSG00000130702	ENST00000252999	D	0.81499	-1.5	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.85682	D	0.000000	D	0.88058	0.6335	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90205	0.4260	10	0.87932	D	0	.	18.7063	0.91640	0.0:1.0:0.0:0.0	.	3685	O15230	LAMA5_HUMAN	R	3685	ENSP00000252999:G3685R	ENSP00000252999:G3685R	G	-	1	0	LAMA5	60317822	0.997000	0.39634	0.543000	0.28128	0.015000	0.08874	6.207000	0.72159	2.520000	0.84964	0.556000	0.70494	GGG	-	superfamily_Concanavalin A-like lectins/glucanases		0.726	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	protein_coding	OTTHUMT00000080014.2	C	NM_005560		60317822	-1	no_errors	NM_005560	genbank	human	reviewed	54_36p	missense	SNP	0.989	T
TLN2	83660	genome.wustl.edu	37	15	63112807	63112807	+	Missense_Mutation	SNP	A	A	G			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr15:63112807A>G	ENST00000561311.1	+	53	7230	c.7000A>G	c.(7000-7002)Aaa>Gaa	p.K2334E	TLN2_ENST00000306829.6_Missense_Mutation_p.K2334E			Q9Y4G6	TLN2_HUMAN	talin 2	2334	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						AGCAAAACCAAAAGTAAGTGT	0.502																																																0			15											96.0	88.0	91.0					15																	63112807		2203	4300	6503	60899860	SO:0001583	missense	83660			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.7000A>G	15.37:g.63112807A>G	ENSP00000453508:p.Lys2334Glu		60899860	A6NLB8	Missense_Mutation	SNP	PatternScan_FERM_1,HMMSmart_B41,HMMPfam_FERM_N,superfamily_FERM_3-hlx,HMMPfam_FERM_M,PatternScan_FERM_2,superfamily_SSF50729,superfamily_Talin_cent,HMMPfam_Talin_middle,superfamily_SSF109885,HMMPfam_VBS,HMMSmart_ILWEQ,HMMPfam_I_LWEQ	p.K2334E	ENST00000561311.1	37	c.7000	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750480	0.69533	.	.	ENSG00000171914	ENST00000306829	T	0.30714	1.52	6.06	6.06	0.98353	I/LWEQ (2);	0.041485	0.85682	D	0.000000	T	0.29817	0.0745	L	0.41356	1.27	0.51233	D	0.999918	B	0.33238	0.403	B	0.35353	0.201	T	0.03403	-1.1040	10	0.29301	T	0.29	-21.4199	16.6093	0.84858	1.0:0.0:0.0:0.0	.	2334	Q9Y4G6	TLN2_HUMAN	E	2334	ENSP00000303476:K2334E	ENSP00000303476:K2334E	K	+	1	0	TLN2	60899860	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	9.287000	0.95975	2.324000	0.78689	0.533000	0.62120	AAA	-	superfamily_SSF109885		0.502	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	protein_coding	OTTHUMT00000257878.2	A			60899860	+1	no_errors	NM_015059	genbank	human	reviewed	54_36p	missense	SNP	1.000	G
HELZ2	85441	genome.wustl.edu	37	20	62197091	62197091	+	Silent	SNP	G	G	A	rs147465782	byFrequency	TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr20:62197091G>A	ENST00000467148.1	-	8	3153	c.3084C>T	c.(3082-3084)gaC>gaT	p.D1028D	HELZ2_ENST00000427522.2_Silent_p.D459D	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1028	Ala-rich.|Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CCTTCACTGCGTCTCCTGCTG	0.667													G|||	3	0.000599042	0.0015	0.0014	5008	,	,		17368	0.0		0.0	False		,,,				2504	0.0															0			20						G	,	11,4375	15.5+/-35.6	0,11,2182	37.0	30.0	32.0		3084,1377	-5.7	0.0	20	dbSNP_134	32	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	0,11,6478	AA,AG,GG		0.0,0.2508,0.0848	,	1028/2650,459/2081	62197091	11,12967	2193	4296	6489	61667535	SO:0001819	synonymous_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3084C>T	20.37:g.62197091G>A			61667535	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	PatternScan_ZINC_FINGER_C2H2_1,superfamily_P-loop containing nucleoside triphosphate hydrolases,HMMPfam_RNB,PatternScan_RIBONUCLEASE_II	p.D1028	ENST00000467148.1	37	c.3084	CCDS33508.1	20																																																																																			-	NULL		0.667	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIC285	protein_coding	OTTHUMT00000354127.1	G	NM_001037335		61667535	-1	no_errors	NM_001037335	genbank	human	reviewed	54_36p	silent	SNP	0.000	A
ASL	435	genome.wustl.edu	37	7	65557569	65557569	+	Missense_Mutation	SNP	C	C	G	rs201047656		TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr7:65557569C>G	ENST00000304874.9	+	16	1271	c.1169C>G	c.(1168-1170)gCc>gGc	p.A390G	AC068533.7_ENST00000450043.1_Silent_p.G158G|ASL_ENST00000380839.4_Missense_Mutation_p.A364G|ASL_ENST00000395332.3_Missense_Mutation_p.A390G|ASL_ENST00000395331.3_Missense_Mutation_p.A370G|ASL_ENST00000464970.1_3'UTR	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	390					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	GCCCACGAGGCCTCCGGGAAA	0.642																																																0			7											58.0	59.0	59.0					7																	65557569		2203	4300	6503	65195004	SO:0001583	missense	435				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.1169C>G	7.37:g.65557569C>G	ENSP00000307188:p.Ala390Gly		65195004	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Missense_Mutation	SNP	HMMPfam_Lyase_1,superfamily_L-Aspartase-like,PatternScan_FUMARATE_LYASES	p.A390G	ENST00000304874.9	37	c.1169	CCDS5531.1	7	.	.	.	.	.	.	.	.	.	.	c	22.8	4.331970	0.81801	.	.	ENSG00000126522	ENST00000304874;ENST00000380839;ENST00000395332;ENST00000395331	D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76	5.28	5.28	0.74379	L-Aspartase-like (1);	0.440908	0.25689	N	0.028950	D	0.89781	0.6814	M	0.81341	2.54	0.38388	D	0.945337	B;B;B	0.22983	0.078;0.028;0.015	B;B;B	0.22601	0.04;0.015;0.015	D	0.86875	0.2038	9	.	.	.	.	11.7137	0.51639	0.0:0.9187:0.0:0.0813	.	364;370;390	E9PE48;E7EMI0;P04424	.;.;ARLY_HUMAN	G	390;364;390;370	ENSP00000307188:A390G;ENSP00000370219:A364G;ENSP00000378741:A390G;ENSP00000378740:A370G	.	A	+	2	0	ASL	65195004	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	2.771000	0.47670	2.622000	0.88805	0.491000	0.48974	GCC	-	superfamily_L-Aspartase-like		0.642	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	protein_coding	OTTHUMT00000251695.2	C	NM_000048		65195004	+1	no_errors	NM_000048	genbank	human	reviewed	54_36p	missense	SNP	0.900	G
MAST4	375449	genome.wustl.edu	37	5	66456342	66456342	+	Missense_Mutation	SNP	G	G	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr5:66456342G>T	ENST00000403625.2	+	27	4002	c.3707G>T	c.(3706-3708)gGa>gTa	p.G1236V	MAST4_ENST00000403666.1_Missense_Mutation_p.G1047V|MAST4_ENST00000405643.1_Missense_Mutation_p.G1057V|MAST4_ENST00000261569.7_Missense_Mutation_p.G1042V|MAST4_ENST00000404260.3_Missense_Mutation_p.G1239V	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	1239						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		ATCAAAACTGGACCAGCCAGG	0.408																																																0			5											109.0	114.0	113.0					5																	66456342		1876	4121	5997	66492098	SO:0001583	missense	23227			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.3707G>T	5.37:g.66456342G>T	ENSP00000385727:p.Gly1236Val		66492098	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	HMMPfam_DUF1908,superfamily_Kinase_like,HMMSmart_S_TKc,HMMPfam_Pkinase,PatternScan_PROTEIN_KINASE_ST,HMMSmart_S_TK_X,HMMPfam_Pkinase_C,superfamily_PDZ,HMMSmart_PDZ,HMMPfam_PDZ	p.G1047V	ENST00000403625.2	37	c.3140	CCDS54861.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.114686|5.114686	0.94339|0.94339	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399|ENST00000443808	T;T;T;T;T|.	0.73258|.	-0.68;-0.69;-0.73;-0.73;-0.68|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85978|0.85978	0.5823|0.5823	M|M	0.90252|0.90252	3.1|3.1	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.87483|0.87483	0.2422|0.2422	10|5	0.87932|.	D|.	0|.	-19.7013|-19.7013	20.0784|20.0784	0.97758|0.97758	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1239;1047|.	O15021;O15021-3|.	MAST4_HUMAN;.|.	V|C	1239;1236;1047;1057;1057;1042;975|292	ENSP00000385048:G1239V;ENSP00000385727:G1236V;ENSP00000384313:G1047V;ENSP00000384099:G1057V;ENSP00000261569:G1042V|.	ENSP00000261569:G1042V|.	G|W	+|+	2|3	0|0	MAST4|MAST4	66492098|66492098	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.869000|9.869000	0.99810|0.99810	2.736000|2.736000	0.93811|0.93811	0.655000|0.655000	0.94253|0.94253	GGA|TGG	-	superfamily_PDZ		0.408	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	protein_coding	OTTHUMT00000326324.2	G			66492098	+1	no_errors	NM_015183	genbank	human	validated	54_36p	missense	SNP	1.000	T
COL19A1	1310	genome.wustl.edu	37	6	70854154	70854154	+	Splice_Site	SNP	A	A	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr6:70854154A>T	ENST00000322773.4	+	24	1781	c.1679A>T	c.(1678-1680)aAg>aTg	p.K560M	COL19A1_ENST00000393344.1_Splice_Site_p.K182M	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	560	Triple-helical region 3 (COL3).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AAAGGAGAAAAGGTATAGTTT	0.398																																																0			6											94.0	92.0	93.0					6																	70854154		2203	4300	6503	70910875	SO:0001630	splice_region_variant	1310				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1680+1A>T	6.37:g.70854154A>T			70910875	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	HMMSmart_TSPN,superfamily_ConA_like_lec_gl,HMMPfam_Collagen	p.K560M	ENST00000322773.4	37	c.1679	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	A	11.63	1.694653	0.30052	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.93488	-3.23;-3.23	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.94837	0.8332	M	0.64630	1.985	0.48830	D	0.999717	D	0.76494	0.999	D	0.81914	0.995	D	0.95082	0.8214	10	0.54805	T	0.06	.	13.7581	0.62948	1.0:0.0:0.0:0.0	.	560	Q14993	COJA1_HUMAN	M	560;182	ENSP00000316030:K560M;ENSP00000377013:K182M	ENSP00000316030:K560M	K	+	2	0	COL19A1	70910875	1.000000	0.71417	1.000000	0.80357	0.233000	0.25261	6.286000	0.72665	2.045000	0.60652	0.528000	0.53228	AAG	-	HMMPfam_Collagen		0.398	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	protein_coding	OTTHUMT00000041127.1	A		Missense_Mutation	70910875	+1	no_errors	NM_001858	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
ZNF516	9658	genome.wustl.edu	37	18	74091995	74091995	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr18:74091995T>C	ENST00000443185.2	-	4	2392	c.2075A>G	c.(2074-2076)gAg>gGg	p.E692G	ZNF516_ENST00000524431.2_5'UTR|RP11-504I13.3_ENST00000583287.1_RNA	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	692					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GGAAGGGAACTCCACACCATC	0.567																																																0			18											58.0	61.0	60.0					18																	74091995		1973	4175	6148	72220983	SO:0001583	missense	9658			D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.2075A>G	18.37:g.74091995T>C	ENSP00000394757:p.Glu692Gly		72220983		Missense_Mutation	SNP	superfamily_C2H2 and C2HC zinc fingers,HMMPfam_zf-C2H2,HMMSmart_SM00355,PatternScan_ZINC_FINGER_C2H2_1	p.E692G	ENST00000443185.2	37	c.2075		18	.	.	.	.	.	.	.	.	.	.	T	6.348	0.432349	0.12045	.	.	ENSG00000101493	ENST00000443185	T	0.10005	2.92	4.44	0.502	0.16932	.	0.401453	0.24070	N	0.041822	T	0.04770	0.0129	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41502	-0.9505	9	0.16896	T	0.51	-2.8289	4.2941	0.10892	0.0:0.2157:0.3334:0.4509	.	692	Q92618	ZN516_HUMAN	G	692	ENSP00000394757:E692G	ENSP00000394757:E692G	E	-	2	0	ZNF516	72220983	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	1.034000	0.30204	-0.039000	0.13602	0.533000	0.62120	GAG	-	NULL		0.567	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ZNF516	protein_coding		T	NM_014643		72220983	-1	no_errors	ENST00000217537	ensembl	human	known	54_36p	missense	SNP	0.000	C
ZFYVE1	53349	genome.wustl.edu	37	14	73440815	73440815	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr14:73440815C>T	ENST00000556143.1	-	11	2794	c.2074G>A	c.(2074-2076)Gtg>Atg	p.V692M	ZFYVE1_ENST00000555072.1_Missense_Mutation_p.V277M|ZFYVE1_ENST00000394207.2_Missense_Mutation_p.V277M|ZFYVE1_ENST00000318876.5_Missense_Mutation_p.V678M|ZFYVE1_ENST00000554145.1_5'Flank|ZFYVE1_ENST00000553891.1_Missense_Mutation_p.V692M	NM_001281735.1|NM_021260.2	NP_001268664.1|NP_067083.1	Q9HBF4	ZFYV1_HUMAN	zinc finger, FYVE domain containing 1	692					negative regulation of phosphatase activity (GO:0010923)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|ER-mitochondrion membrane contact site (GO:0044233)|Golgi stack (GO:0005795)|perinuclear region of cytoplasm (GO:0048471)|pre-autophagosomal structure (GO:0000407)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(17)|ovary(1)|prostate(2)|skin(1)	35		all_lung(585;1.33e-09)		OV - Ovarian serous cystadenocarcinoma(108;1.6e-46)|BRCA - Breast invasive adenocarcinoma(234;0.00349)		GCTGTCACCACGGCTCCCAGA	0.582																																																0			14											127.0	101.0	110.0					14																	73440815		2203	4300	6503	72510568	SO:0001583	missense	53349			AF251025	CCDS9811.1, CCDS41969.1, CCDS61498.1	14q24.2	2014-06-13	2003-02-28	2003-03-07		ENSG00000165861		"""Zinc fingers, FYVE domain containing"""	13180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 172"""	605471	"""zinc finger protein, subfamily 2A (FYVE domain containing), 1"""	ZNFN2A1		11024279, 11256955	Standard	NM_021260		Approved	DFCP1, KIAA1589, TAFF1, PPP1R172	uc001xnm.3	Q9HBF4		ENST00000556143.1:c.2074G>A	14.37:g.73440815C>T	ENSP00000450742:p.Val692Met		72510568	J3KNL9|Q8WYX7|Q96K57|Q9BXP9|Q9HCI3	Missense_Mutation	SNP	superfamily_P-loop containing nucleoside triphosphate hydrolases,superfamily_FYVE/PHD zinc finger,HMMSmart_SM00064,HMMPfam_FYVE	p.V692M	ENST00000556143.1	37	c.2074	CCDS9811.1	14	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029704	0.93518	.	.	ENSG00000165861	ENST00000553891;ENST00000318876;ENST00000556143;ENST00000394207;ENST00000555072	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.18;-0.18	5.54	5.54	0.83059	.	0.060246	0.64402	D	0.000003	T	0.79753	0.4500	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.999;0.985	P;P	0.59171	0.853;0.461	T	0.80863	-0.1192	10	0.72032	D	0.01	-19.3062	19.6787	0.95950	0.0:1.0:0.0:0.0	.	692;692	G3V5N8;Q9HBF4	.;ZFYV1_HUMAN	M	692;678;692;277;277	ENSP00000452442:V692M;ENSP00000326921:V678M;ENSP00000450742:V692M;ENSP00000377757:V277M;ENSP00000452232:V277M	ENSP00000326921:V692M	V	-	1	0	ZFYVE1	72510568	1.000000	0.71417	0.993000	0.49108	0.613000	0.37349	7.627000	0.83176	2.884000	0.98904	0.655000	0.94253	GTG	-	NULL		0.582	ZFYVE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE1	protein_coding	OTTHUMT00000413172.1	C	NM_021260		72510568	-1	no_errors	NM_021260	genbank	human	reviewed	54_36p	missense	SNP	0.994	T
PRKRIRP1	728748	genome.wustl.edu	37	X	73618823	73618823	+	IGR	SNP	T	T	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chrX:73618823T>C								RN7SL790P (8001 upstream) : SLC16A2 (22261 downstream)																							AAAGAGACCTTCTGGGATTTC	0.408																																																0			X																																								73535548	SO:0001628	intergenic_variant	728748																															X.37:g.73618823T>C			73535548		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.408					LOC728748			T			73535548	-1	pseudogene	XR_037583	genbank	human	model	54_36p	rna	SNP	0.637	C
LOXL3	84695	genome.wustl.edu	37	2	74762759	74762759	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr2:74762759C>T	ENST00000264094.3	-	8	1443	c.1372G>A	c.(1372-1374)Gcc>Acc	p.A458T	LOXL3_ENST00000409986.1_Missense_Mutation_p.A313T|LOXL3_ENST00000393937.2_Missense_Mutation_p.A313T|LOXL3_ENST00000409249.1_Intron|LOXL3_ENST00000409549.1_Intron	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	458	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						TGCCTACAGGCCACCATGGCC	0.637																																																0			2											85.0	97.0	93.0					2																	74762759		2203	4300	6503	74616267	SO:0001583	missense	84695			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.1372G>A	2.37:g.74762759C>T	ENSP00000264094:p.Ala458Thr		74616267	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	superfamily_Srcr_receptor,HMMSmart_SR,HMMPfam_SRCR,PatternScan_SRCR_1,HMMPfam_Lysyl_oxidase,PatternScan_LYSYL_OXIDASE	p.A458T	ENST00000264094.3	37	c.1372	CCDS1953.1	2	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038187	0.75617	.	.	ENSG00000115318	ENST00000264094;ENST00000393937;ENST00000409986	T;T;T	0.31247	1.5;1.5;1.5	5.02	5.02	0.67125	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.467869	0.24301	N	0.039723	T	0.42314	0.1197	M	0.64170	1.965	0.45690	D	0.9986	P;B;B	0.48834	0.916;0.107;0.052	P;B;B	0.49085	0.6;0.088;0.137	T	0.30736	-0.9968	10	0.54805	T	0.06	.	16.2052	0.82122	0.0:1.0:0.0:0.0	.	313;313;458	B9A025;Q6IPL7;P58215	.;.;LOXL3_HUMAN	T	458;313;313	ENSP00000264094:A458T;ENSP00000377512:A313T;ENSP00000386545:A313T	ENSP00000264094:A458T	A	-	1	0	LOXL3	74616267	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.769000	0.95229	0.563000	0.77884	GCC	-	superfamily_Srcr_receptor,HMMSmart_SR,HMMPfam_SRCR		0.637	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	protein_coding	OTTHUMT00000252215.1	C	NM_032603		74616267	-1	no_errors	NM_032603	genbank	human	reviewed	54_36p	missense	SNP	1.000	T
VAT1L	57687	genome.wustl.edu	37	16	78011560	78011560	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr16:78011560G>A	ENST00000302536.2	+	9	1381	c.1228G>A	c.(1228-1230)Gag>Aag	p.E410K		NM_020927.1	NP_065978.1	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport 1-like	410							oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(10)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24						GGGAGACAGCGAGAACAAGGA	0.512																																																0			16											173.0	130.0	145.0					16																	78011560		2198	4300	6498	76569061	SO:0001583	missense	57687			AB046796	CCDS32492.1	16q23.1	2014-09-09	2013-08-23		ENSG00000171724	ENSG00000171724			29315	protein-coding gene	gene with protein product			"""vesicle amine transport protein 1 homolog (T. californica)-like"""			10997877	Standard	NM_020927		Approved	KIAA1576	uc002ffg.1	Q9HCJ6	OTTHUMG00000176845	ENST00000302536.2:c.1228G>A	16.37:g.78011560G>A	ENSP00000303129:p.Glu410Lys		76569061	Q8IYW8	Missense_Mutation	SNP	superfamily_GroES_like,HMMPfam_ADH_N,superfamily_NAD(P)-bd,HMMPfam_ADH_zinc_N,PatternScan_QOR_ZETA_CRYSTAL	p.E410K	ENST00000302536.2	37	c.1228	CCDS32492.1	16	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633665	0.67130	.	.	ENSG00000171724	ENST00000302536	T	0.08896	3.04	4.97	4.97	0.65823	.	0.125201	0.56097	D	0.000027	T	0.03959	0.0111	N	0.08118	0	0.80722	D	1	P	0.44006	0.824	B	0.24701	0.055	T	0.54503	-0.8284	10	0.32370	T	0.25	-8.2833	17.8175	0.88639	0.0:0.0:1.0:0.0	.	410	Q9HCJ6	VAT1L_HUMAN	K	410	ENSP00000303129:E410K	ENSP00000303129:E410K	E	+	1	0	VAT1L	76569061	1.000000	0.71417	0.962000	0.40283	0.973000	0.67179	9.471000	0.97696	2.315000	0.78130	0.561000	0.74099	GAG	-	NULL		0.512	VAT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAT1L	protein_coding	OTTHUMT00000434010.1	G	NM_020927		76569061	+1	no_errors	NM_020927	genbank	human	provisional	54_36p	missense	SNP	1.000	A
FAM213A	84293	genome.wustl.edu	37	10	82187140	82187140	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr10:82187140G>A	ENST00000372181.1	+	4	934	c.464G>A	c.(463-465)cGt>cAt	p.R155H	FAM213A_ENST00000372188.1_Missense_Mutation_p.R155H|FAM213A_ENST00000372187.5_Missense_Mutation_p.R155H|FAM213A_ENST00000372185.1_Missense_Mutation_p.R144H	NM_001243778.1|NM_001243782.1	NP_001230707.1|NP_001230711.1	Q9BRX8	F213A_HUMAN	family with sequence similarity 213, member A	155					oxidation-reduction process (GO:0055114)|regulation of osteoclast differentiation (GO:0045670)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)										GGATTTATCCGTCTGGGAGTG	0.488																																																0			10											147.0	135.0	139.0					10																	82187140		2203	4300	6503	82177120	SO:0001583	missense	84293			AF086462	CCDS7368.1, CCDS58089.1	10q23.1	2011-12-08	2011-12-08	2011-12-08	ENSG00000122378	ENSG00000122378			28651	protein-coding gene	gene with protein product	"""peroxiredoxin-like 2 activated in M-CSF stimulated monocytes"""		"""chromosome 10 open reading frame 58"""	C10orf58		11483580, 19951071	Standard	NM_032333		Approved	MGC4248, PAMM	uc001kce.4	Q9BRX8	OTTHUMG00000018614	ENST00000372181.1:c.464G>A	10.37:g.82187140G>A	ENSP00000361254:p.Arg155His		82177120	B2RD81|Q6UW08|Q8N2K3|Q8NBK9|Q96JR0	Missense_Mutation	SNP	superfamily_Thiordxn-like_fd	p.R155H	ENST00000372181.1	37	c.464	CCDS7368.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.578563	0.96565	.	.	ENSG00000122378	ENST00000372188;ENST00000372187;ENST00000372185;ENST00000372181	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.71213	0.3313	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71303	-0.4633	10	0.33141	T	0.24	-10.4849	17.9177	0.88957	0.0:0.0:1.0:0.0	.	155	Q9BRX8	PAMM_HUMAN	H	155;155;144;155	ENSP00000361262:R155H;ENSP00000361261:R155H;ENSP00000361259:R144H;ENSP00000361254:R155H	ENSP00000361254:R155H	R	+	2	0	C10orf58	82177120	1.000000	0.71417	0.979000	0.43373	0.989000	0.77384	9.461000	0.97646	2.828000	0.97474	0.655000	0.94253	CGT	-	NULL		0.488	FAM213A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C10orf58	protein_coding	OTTHUMT00000049077.2	G			82177120	+1	no_errors	NM_032333	genbank	human	validated	54_36p	missense	SNP	0.992	A
SPATA31C2	645961	genome.wustl.edu	37	9	90747151	90747151	+	IGR	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr9:90747151C>T								U6 (133901 upstream) : U3 (242032 downstream)																							GGACAGAAGCCGCCAAATCCT	0.562																																																0			9											52.0	51.0	52.0					9																	90747151		692	1591	2283	89936971	SO:0001628	intergenic_variant	0																															9.37:g.90747151C>T			89936971		RNA	SNP	-	NULL		37	NULL		9																																																																																			-	-	0	0.562					LOC645961			C			89936971	-1	no_errors	XR_040572	genbank	human	model	54_36p	rna	SNP	0.052	T
TMEFF1	8577	genome.wustl.edu	37	9	103334907	103334907	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr9:103334907T>C	ENST00000374879.4	+	9	1439	c.1007T>C	c.(1006-1008)aTt>aCt	p.I336T	TMEFF1_ENST00000334943.6_Missense_Mutation_p.I297T|MSANTD3-TMEFF1_ENST00000502978.1_Silent_p.Y299Y	NM_003692.4	NP_003683.2	Q8IYR6	TEFF1_HUMAN	transmembrane protein with EGF-like and two follistatin-like domains 1	336					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(7)|lung(9)|stomach(1)	19		Acute lymphoblastic leukemia(62;0.0452)				GCAGCAATTATTGGAGCTGTA	0.383																																																0			9											127.0	114.0	118.0					9																	103334907		2203	4300	6503	102374728	SO:0001583	missense	8577			U19878	CCDS6750.1	9q31	2010-05-04			ENSG00000241697	ENSG00000241697			11866	protein-coding gene	gene with protein product	"""tomoregulin-1"", ""cancer/testis antigen family 120, member 1"""	603421		C9orf2		9730596	Standard	NM_003692		Approved	H7365, CT120.1		Q8IYR6	OTTHUMG00000020367	ENST00000374879.4:c.1007T>C	9.37:g.103334907T>C	ENSP00000364013:p.Ile336Thr		102374728	Q13086|Q8N3T8	Missense_Mutation	SNP	superfamily_Kazal-type serine protease inhibitors,HMMSmart_SM00280,HMMPfam_Kazal_1,superfamily_EGF/Laminin,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_2	p.I336T	ENST00000374879.4	37	c.1007	CCDS6750.1	9	.	.	.	.	.	.	.	.	.	.	T	21.2	4.120196	0.77323	.	.	ENSG00000241697	ENST00000334943;ENST00000374879	T;T	0.19938	2.11;2.11	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.34745	0.0908	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.11641	-1.0579	10	0.87932	D	0	-26.2375	12.7449	0.57276	0.0:0.0:0.0:1.0	.	336;297	Q8IYR6;Q8IYR6-2	TEFF1_HUMAN;.	T	297;336	ENSP00000334447:I297T;ENSP00000364013:I336T	ENSP00000334447:I297T	I	+	2	0	TMEFF1	102374728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.683000	0.84093	1.869000	0.54173	0.528000	0.53228	ATT	-	NULL		0.383	TMEFF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEFF1	protein_coding	OTTHUMT00000053418.1	T	NM_003692		102374728	+1	no_errors	NM_003692	genbank	human	validated	54_36p	missense	SNP	1.000	C
IRS4	8471	genome.wustl.edu	37	X	107977216	107977216	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chrX:107977216C>T	ENST00000372129.2	-	1	2435	c.2359G>A	c.(2359-2361)Ggt>Agt	p.G787S	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	787	CRK-binding.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GGAATTGCACCGGCTCCAGGA	0.478																																																0			X											130.0	138.0	135.0					X																	107977216		2203	4300	6503	107863872	SO:0001583	missense	8471			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2359G>A	X.37:g.107977216C>T	ENSP00000361202:p.Gly787Ser		107863872		Missense_Mutation	SNP	superfamily_SSF50729,HMMPfam_PH,HMMSmart_PH,HMMPfam_IRS,HMMSmart_PTBI	p.G787S	ENST00000372129.2	37	c.2359	CCDS14544.1	X	.	.	.	.	.	.	.	.	.	.	C	13.03	2.115667	0.37339	.	.	ENSG00000133124	ENST00000372129	T	0.21191	2.02	5.33	4.44	0.53790	.	0.405934	0.25377	N	0.031112	T	0.11879	0.0289	L	0.42245	1.32	0.21256	N	0.999748	P	0.44946	0.846	B	0.33339	0.162	T	0.22034	-1.0228	10	0.26408	T	0.33	-13.3152	4.1847	0.10392	0.0:0.5792:0.2556:0.1652	.	787	O14654	IRS4_HUMAN	S	787	ENSP00000361202:G787S	ENSP00000361202:G787S	G	-	1	0	IRS4	107863872	0.255000	0.24002	0.966000	0.40874	0.979000	0.70002	0.485000	0.22324	2.447000	0.82792	0.600000	0.82982	GGT	-	NULL		0.478	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	protein_coding	OTTHUMT00000057879.1	C	NM_003604		107863872	-1	no_errors	NM_003604	genbank	human	reviewed	54_36p	missense	SNP	0.992	T
RANBP2	5903	genome.wustl.edu	37	2	109368063	109368063	+	Missense_Mutation	SNP	C	C	T	rs377029115		TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr2:109368063C>T	ENST00000283195.6	+	11	1661	c.1535C>T	c.(1534-1536)cCg>cTg	p.P512L		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	512					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TCCTATCAGCCGTTATGCCTG	0.398													C|||	1	0.000199681	0.0	0.0	5008	,	,		17713	0.0		0.001	False		,,,				2504	0.0															0			2						C	LEU/PRO	0,2252		0,0,1126	27.0	33.0	31.0		1535	4.4	0.6	2		31	1,4413		0,1,2206	no	missense	RANBP2	NM_006267.4	98	0,1,3332	TT,TC,CC		0.0227,0.0,0.015	possibly-damaging	512/3225	109368063	1,6665	1126	2207	3333	108734495	SO:0001583	missense	5903			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.1535C>T	2.37:g.109368063C>T	ENSP00000283195:p.Pro512Leu		108734495	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	superfamily_SSF48452,HMMPfam_TPR_1,superfamily_SSF50729,HMMSmart_RanBD,HMMPfam_Ran_BP1,HMMPfam_zf-RanBP,HMMSmart_ZnF_RBZ,PatternScan_ZF_RANBP2_1,superfamily_CSA_PPIase,HMMPfam_Pro_isomerase,PatternScan_CSA_PPIASE_1	p.P512L	ENST00000283195.6	37	c.1535	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771785	0.49680	0.0	2.27E-4	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.54479	0.57	5.25	4.38	0.52667	.	.	.	.	.	T	0.48822	0.1521	M	0.69823	2.125	0.54753	D	0.999984	P	0.43938	0.822	B	0.33846	0.171	T	0.57130	-0.7864	9	0.54805	T	0.06	-16.5484	14.0025	0.64442	0.0:0.9265:0.0:0.0735	.	512	P49792	RBP2_HUMAN	L	512	ENSP00000283195:P512L	ENSP00000283195:P512L	P	+	2	0	RANBP2	108734495	1.000000	0.71417	0.611000	0.29010	0.024000	0.10985	5.218000	0.65257	1.343000	0.45638	0.650000	0.86243	CCG	-	NULL		0.398	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	protein_coding	OTTHUMT00000253594.1	C	NM_006267		108734495	+1	no_errors	NM_006267	genbank	human	reviewed	54_36p	missense	SNP	0.962	T
LOC101927640	101927640	genome.wustl.edu	37	6	112647361	112647361	+	RNA	SNP	G	G	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr6:112647361G>C	ENST00000587816.1	+	0	111				RP11-506B6.6_ENST00000585504.1_RNA|RP11-506B6.6_ENST00000590673.1_RNA|RP11-506B6.6_ENST00000585611.1_RNA																							AGGCCCTGGAGCTGCAACCTG	0.507																																																0			6																																								112754054			0																															6.37:g.112647361G>C			112754054		Missense_Mutation	SNP	HMMSmart_SM00443,HMMPfam_G-patch	p.A182G	ENST00000587816.1	37	c.545		6																																																																																			-	NULL		0.507	RP11-506B6.6-009	KNOWN	basic	antisense	LOC100128588	antisense	OTTHUMT00000459266.1	G			112754054	-1	no_errors	XM_001723020	genbank	human	model	54_36p	missense	SNP	0.001	C
ANK2	287	genome.wustl.edu	37	4	114254347	114254347	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr4:114254347T>C	ENST00000357077.4	+	29	3415	c.3362T>C	c.(3361-3363)cTt>cCt	p.L1121P	ANK2_ENST00000509550.1_Missense_Mutation_p.L297P|ANK2_ENST00000506722.1_Missense_Mutation_p.L1112P|ANK2_ENST00000264366.6_Missense_Mutation_p.L1088P|ANK2_ENST00000394537.3_Missense_Mutation_p.L1121P	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1121	Interaction with SPTBN1.|ZU5 1. {ECO:0000255|PROSITE- ProRule:PRU00485}.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		AATGAAATTCTTAACGGCATG	0.413																																																0			4											135.0	131.0	132.0					4																	114254347		2203	4300	6503	114473796	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.3362T>C	4.37:g.114254347T>C	ENSP00000349588:p.Leu1121Pro		114473796	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	superfamily_ANK,HMMSmart_ANK,HMMPfam_Ank,HMMPfam_ZU5,PatternScan_ALDEHYDE_DEHYDR_GLU,superfamily_DEATH_like,HMMSmart_DEATH,HMMPfam_Death	p.L1121P	ENST00000357077.4	37	c.3362	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	T	13.01	2.109927	0.37242	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550	T;T;T;T;T;T;T;T	0.81415	-1.12;-0.48;-0.73;-0.62;-0.73;-0.8;-0.75;-1.49	5.12	5.12	0.69794	.	0.000000	0.41712	D	0.000829	D	0.88760	0.6524	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.988	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.998;0.983	D	0.90149	0.4219	10	0.87932	D	0	.	15.2296	0.73378	0.0:0.0:0.0:1.0	.	297;1088;133;1121;1121;1112;1112	E9PCH6;Q01484;Q7Z344;Q01484-2;Q01484-4;Q01484-5;F8WEF9	.;ANK2_HUMAN;.;.;.;.;.	P	1100;1034;1112;167;1136;1121;1121;1088;1112;297	ENSP00000423799:L1100P;ENSP00000421011:L1034P;ENSP00000421067:L1112P;ENSP00000424722:L1136P;ENSP00000378044:L1121P;ENSP00000349588:L1121P;ENSP00000264366:L1088P;ENSP00000426944:L297P	ENSP00000264366:L1088P	L	+	2	0	ANK2	114473796	1.000000	0.71417	0.859000	0.33776	0.204000	0.24138	7.997000	0.88414	2.052000	0.61016	0.533000	0.62120	CTT	-	NULL		0.413	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	protein_coding	OTTHUMT00000256422.2	T	NM_001148		114473796	+1	no_errors	NM_001148	genbank	human	reviewed	54_36p	missense	SNP	1.000	C
PLEKHB2	55041	genome.wustl.edu	37	2	132060677	132060677	+	Intron	SNP	G	G	T	rs151134188	byFrequency	TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr2:132060677G>T	ENST00000404460.1	+	7	477				PLEKHB2_ENST00000303908.3_Intron			Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2							endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		AGGCAAAATGGGTAAGTACTT	0.368													.|||	62	0.0123802	0.0431	0.0058	5008	,	,		19143	0.001		0.0	False		,,,				2504	0.0															0			2																																								131777147	SO:0001627	intron_variant	150519				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000404460.1:c.424-49916G>T	2.37:g.132060677G>T			131777147	B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Nonsense_Mutation	SNP	NULL	p.G52*	ENST00000404460.1	37	c.154		2																																																																																			-	NULL		0.368	PLEKHB2-002	KNOWN	basic	protein_coding	FLJ30428	protein_coding	OTTHUMT00000318943.2	G	NM_017958		131777147	+1	no_errors	XM_001723916	genbank	human	model	54_36p	nonsense	SNP	0.999	T
TAAR9	134860	genome.wustl.edu	37	6	132860383	132860383	+	RNA	SNP	G	G	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr6:132860383G>C	ENST00000434551.1	+	0	955					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		CCAATGGTTTGGGAAGGCAAT	0.313																																					Colon(10;433 445 15992 45047 47213)											0			6											75.0	66.0	69.0					6																	132860383		1845	4101	5946	132902076			134860			AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132860383G>C			132902076		Missense_Mutation	SNP	superfamily_Family A G protein-coupled receptor-like,HMMPfam_7tm_1,PatternScan_G_PROTEIN_RECEP_F1_1	p.G319R	ENST00000434551.1	37	c.955		6																																																																																			-	superfamily_Family A G protein-coupled receptor-like		0.313	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	TAAR9	polymorphic_pseudogene	OTTHUMT00000042254.2	G	NM_175057		132902076	+1	pseudogene	NM_175057	genbank	human	reviewed	54_36p	missense	SNP	0.879	C
Unknown	0	genome.wustl.edu	37	10	135491041	135491041	+	IGR	SNP	C	C	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr10:135491041C>A								AL845259.1 (17862 upstream) : None (None downstream)																							TGGCAGGGCGCCCGCGCAGGC	0.731																																																0			10											30.0	39.0	36.0					10																	135491041		1128	2212	3340	135341031	SO:0001628	intergenic_variant	26584																															10.37:g.135491041C>A			135341031		Missense_Mutation	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox	p.P157T		37	c.469		10																																																																																			-	NULL	0	0.731					DUX1			C			135341031	+1	no_stop_codon	NM_012146	genbank	human	provisional	54_36p	missense	SNP	0.996	A
NOBOX	135935	genome.wustl.edu	37	7	144101697	144101697	+	Silent	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr7:144101697G>A	ENST00000467773.1	-	2	161	c.162C>T	c.(160-162)tcC>tcT	p.S54S	NOBOX_ENST00000223140.5_5'Flank|NOBOX_ENST00000483238.1_Silent_p.S54S	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	54					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TGATGAAGAAGGAGCTGAAAG	0.577																																																0			7											78.0	87.0	84.0					7																	144101697		2001	4169	6170	143732630	SO:0001819	synonymous_variant	135935					7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.162C>T	7.37:g.144101697G>A			143732630	A6NCD3|A8MZN5	Silent	SNP	superfamily_Homeodomain-like,HMMSmart_SM00389,HMMPfam_Homeobox	p.S54	ENST00000467773.1	37	c.162		7																																																																																			-	NULL		0.577	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	protein_coding	OTTHUMT00000350095.1	G	XM_001134420		143732630	-1	no_errors	NM_001080413	genbank	human	provisional	54_36p	silent	SNP	0.000	A
IQGAP3	128239	genome.wustl.edu	37	1	156503593	156503593	+	Silent	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr1:156503593C>T	ENST00000361170.2	-	31	3958	c.3948G>A	c.(3946-3948)ggG>ggA	p.G1316G		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1316					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGGGCAGCTCCCCAAGATCCT	0.607																																																0			1											62.0	50.0	54.0					1																	156503593		2203	4300	6503	154770217	SO:0001819	synonymous_variant	128239			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3948G>A	1.37:g.156503593C>T			154770217	Q5T3H8	Silent	SNP	superfamily_Calponin-homology,HMMPfam_CH,HMMSmart_CH,HMMSmart_IQ,superfamily_SSF52540,HMMPfam_IQ,superfamily_Rho_GAP,HMMSmart_RasGAP,HMMPfam_RasGAP,PatternScan_RAS_GTPASE_ACTIV_1,HMMPfam_RasGAP_C	p.G1316	ENST00000361170.2	37	c.3948	CCDS1144.1	1																																																																																			-	superfamily_Rho_GAP,HMMSmart_RasGAP		0.607	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	protein_coding	OTTHUMT00000080657.1	C	NM_178229		154770217	-1	no_errors	NM_178229	genbank	human	validated	54_36p	silent	SNP	0.991	T
SPTA1	6708	genome.wustl.edu	37	1	158632510	158632510	+	Missense_Mutation	SNP	C	C	T			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr1:158632510C>T	ENST00000368147.4	-	17	2626	c.2446G>A	c.(2446-2448)Gct>Act	p.A816T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	816					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTGGAAGTAGCTGAGGGTTCA	0.507																																																0			1											97.0	98.0	98.0					1																	158632510		1938	4131	6069	156899134	SO:0001583	missense	6708			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2446G>A	1.37:g.158632510C>T	ENSP00000357129:p.Ala816Thr		156899134	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150,superfamily_SH3-domain,HMMPfam_SH3_1,HMMSmart_SM00326,superfamily_EF-hand,HMMPfam_efhand_Ca_insen	p.A816T	ENST00000368147.4	37	c.2446	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.158532	0.57368	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.52754	0.65;0.65	4.28	4.28	0.50868	.	0.561865	0.13421	N	0.389151	T	0.66307	0.2776	M	0.91354	3.2	0.48696	D	0.999695	D	0.69078	0.997	D	0.68765	0.96	T	0.68066	-0.5507	10	0.33141	T	0.24	.	13.5817	0.61907	0.0:1.0:0.0:0.0	.	816	P02549	SPTA1_HUMAN	T	816	ENSP00000357130:A816T;ENSP00000357129:A816T	ENSP00000357129:A816T	A	-	1	0	SPTA1	156899134	1.000000	0.71417	0.158000	0.22627	0.591000	0.36615	6.804000	0.75186	2.200000	0.70718	0.563000	0.77884	GCT	-	superfamily_Spectrin repeat,HMMPfam_Spectrin,HMMSmart_SM00150		0.507	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	C	NM_003126		156899134	-1	no_errors	NM_003126	genbank	human	reviewed	54_36p	missense	SNP	0.976	T
USP13	8975	genome.wustl.edu	37	3	179371050	179371050	+	Missense_Mutation	SNP	G	G	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr3:179371050G>A	ENST00000263966.3	+	1	508	c.37G>A	c.(37-39)Ggc>Agc	p.G13S	USP13_ENST00000482333.1_3'UTR|USP13_ENST00000496897.1_5'Flank	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	13					autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CATGCCGGGCGGCAGCGGAGG	0.741																																																0			3											18.0	16.0	17.0					3																	179371050		2134	4209	6343	180853744	SO:0001583	missense	8975			U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.37G>A	3.37:g.179371050G>A	ENSP00000263966:p.Gly13Ser		180853744	A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	HMMSmart_ZnF_UBP,HMMPfam_zf-UBP,superfamily_SSF54001,HMMPfam_UCH,PatternScan_UCH_2_1,HMMPfam_UBA,HMMSmart_UBA,superfamily_UBA_like,PatternScan_UCH_2_2	p.G13S	ENST00000263966.3	37	c.37	CCDS3235.1	3	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329396	0.24167	.	.	ENSG00000058056	ENST00000263966	T	0.13657	2.57	3.29	3.29	0.37713	.	0.122386	0.32852	U	0.005566	T	0.05777	0.0151	N	0.08118	0	0.80722	D	1	B;B	0.24533	0.105;0.038	B;B	0.11329	0.006;0.006	T	0.35724	-0.9777	10	0.16420	T	0.52	-8.3241	8.6404	0.33974	0.1097:0.0:0.8903:0.0	.	13;13	Q92995;A8K2S3	UBP13_HUMAN;.	S	13	ENSP00000263966:G13S	ENSP00000263966:G13S	G	+	1	0	USP13	180853744	.	.	0.999000	0.59377	0.370000	0.29829	.	.	1.382000	0.46385	0.462000	0.41574	GGC	-	NULL		0.741	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	protein_coding	OTTHUMT00000349617.1	G			180853744	+1	no_errors	NM_003940	genbank	human	validated	54_36p	missense	SNP	1.000	A
HMCN1	83872	genome.wustl.edu	37	1	186039887	186039887	+	Missense_Mutation	SNP	C	C	A			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr1:186039887C>A	ENST00000271588.4	+	52	8366	c.8137C>A	c.(8137-8139)Cag>Aag	p.Q2713K	HMCN1_ENST00000367492.2_Missense_Mutation_p.Q2713K	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2713	Ig-like C2-type 25.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAAGGATGGACAGGCCAGTCA	0.383																																																0			1											114.0	107.0	110.0					1																	186039887		2203	4300	6503	184306510	SO:0001583	missense	83872			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8137C>A	1.37:g.186039887C>A	ENSP00000271588:p.Gln2713Lys		184306510	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	superfamily_vWA-like,superfamily_Immunoglobulin,HMMSmart_SM00409,HMMPfam_ig,HMMSmart_SM00408,HMMPfam_I-set,HMMSmart_SM00406,PatternScan_CECROPIN,superfamily_TSP-1 type 1 repeat,HMMSmart_SM00209,HMMPfam_TSP_1,HMMSmart_SM00682,HMMPfam_G2F,superfamily_GFP-like,PatternScan_EGF_CA,HMMSmart_SM00179,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMPfam_EGF,PatternScan_ASX_HYDROXYL,HMMPfam_EGF_CA,PatternScan_EGF_2	p.Q2713K	ENST00000271588.4	37	c.8137	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.983057	0.74474	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66638	-0.22;-0.22	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.158082	0.64402	D	0.000018	T	0.49643	0.1569	N	0.11724	0.165	0.80722	D	1	B	0.24317	0.101	B	0.26614	0.071	T	0.49143	-0.8970	10	0.06757	T	0.87	.	19.8579	0.96771	0.0:1.0:0.0:0.0	.	2713	Q96RW7	HMCN1_HUMAN	K	2713	ENSP00000271588:Q2713K;ENSP00000356462:Q2713K	ENSP00000271588:Q2713K	Q	+	1	0	HMCN1	184306510	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.676000	0.84012	2.687000	0.91594	0.655000	0.94253	CAG	-	superfamily_Immunoglobulin,HMMPfam_I-set,HMMSmart_SM00409,HMMSmart_SM00408,HMMSmart_SM00406		0.383	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	C	NM_031935		184306510	+1	no_errors	NM_031935	genbank	human	reviewed	54_36p	missense	SNP	1.000	A
CFH	3075	genome.wustl.edu	37	1	196654214	196654214	+	Missense_Mutation	SNP	T	T	C			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr1:196654214T>C	ENST00000359637.2	+	6	681	c.619T>C	c.(619-621)Tat>Cat	p.Y207H	CFH_ENST00000439155.2_Missense_Mutation_p.Y271H|CFH_ENST00000367429.4_Missense_Mutation_p.Y271H			P08603	CFAH_HUMAN	complement factor H	271	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TGATAATCCTTATATTCCAAA	0.318																																																0			1											70.0	69.0	69.0					1																	196654214		2203	4299	6502	194920837	SO:0001583	missense	3075			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.619T>C	1.37:g.196654214T>C	ENSP00000352658:p.Tyr207His		194920837	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032	p.Y271H	ENST00000359637.2	37	c.811		1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.590595	0.46214	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.63913	-0.07;-0.07;-0.07	5.11	-10.2	0.00374	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.62684	0.2448	L	0.45228	1.405	0.09310	N	1	D;B;B;B	0.71674	0.998;0.123;0.006;0.134	D;B;B;B	0.87578	0.998;0.062;0.006;0.063	T	0.65290	-0.6204	9	0.40728	T	0.16	.	7.4891	0.27452	0.2112:0.4877:0.0:0.3012	.	207;271;271;271	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	H	271;271;271;207	ENSP00000356399:Y271H;ENSP00000402656:Y271H;ENSP00000352658:Y207H	ENSP00000352658:Y207H	Y	+	1	0	CFH	194920837	0.000000	0.05858	0.153000	0.22517	0.280000	0.26924	-2.158000	0.01281	-2.130000	0.00816	-0.356000	0.07607	TAT	-	superfamily_Complement control module/SCR domain,HMMPfam_Sushi,HMMSmart_SM00032		0.318	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	CFH	protein_coding	OTTHUMT00000087502.1	T	NM_000186		194920837	+1	no_errors	NM_000186	genbank	human	reviewed	54_36p	missense	SNP	0.023	C
FAT3	120114	genome.wustl.edu	37	11	92534488	92534488	+	Frame_Shift_Del	DEL	G	G	-			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr11:92534488delG	ENST00000298047.6	+	9	8326	c.8309delG	c.(8308-8310)cgcfs	p.R2770fs	FAT3_ENST00000409404.2_Frame_Shift_Del_p.R2770fs|FAT3_ENST00000525166.1_Frame_Shift_Del_p.R2620fs			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2770	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CTTGACAAACGCCTTGACCGT	0.443										TCGA Ovarian(4;0.039)																																						0			11											77.0	74.0	75.0					11																	92534488		1918	4136	6054	92174136	SO:0001589	frameshift_variant	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8309delG	11.37:g.92534488delG	ENSP00000298047:p.Arg2770fs		92174136	B5MDB0|Q96AU6	Frame_Shift_Del	DEL	superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112,PatternScan_CADHERIN_1,superfamily_Concanavalin A-like lectins/glucanases,superfamily_EGF/Laminin,HMMSmart_SM00181,HMMSmart_SM00282,HMMPfam_Laminin_G_2,HMMSmart_SM00179,HMMPfam_EGF,PatternScan_EGF_1,PatternScan_EGF_CA,PatternScan_ASX_HYDROXYL,PatternScan_EGF_2	p.R2770fs	ENST00000298047.6	37	c.8309		11																																																																																			(deletion:cds_exon[92170650,92174723])	superfamily_Concanavalin A-like lectins/glucanases,superfamily_Cadherin-like,HMMPfam_Cadherin,HMMSmart_SM00112		0.443	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		G	NM_001008781		92174136	+1	no_errors	NM_001008781	genbank	human	validated	54_36p	frame_shift_del	DEL	0.993	-
USH2A	7399	genome.wustl.edu	37	1	215848434	215848435	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-04-1638-01A-01W-0639-09	TCGA-04-1638-11A-01W-0639-09	AT	AT					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	e987ddbb-58d8-4346-b91a-c733fdf8e585	489ca7cf-fb85-418d-8025-90afc71936d7	g.chr1:215848434_215848435delAT	ENST00000307340.3	-	63	13204_13205	c.12818_12819delAT	c.(12817-12819)tatfs	p.Y4273fs	USH2A_ENST00000366943.2_Frame_Shift_Del_p.Y4273fs	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4273	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		tcatagaaacataggatatcac	0.446										HNSCC(13;0.011)																																						0			1																																								213915058	SO:0001589	frameshift_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12818_12819delAT	1.37:g.215848434_215848435delAT	ENSP00000305941:p.Tyr4273fs		213915057	Q5VVM9|Q6S362|Q9NS27	Frame_Shift_Del	DEL	superfamily_Concanavalin A-like lectins/glucanases,HMMSmart_SM00560,HMMSmart_SM00136,HMMPfam_Laminin_N,HMMPfam_Laminin_EGF,HMMSmart_SM00180,superfamily_EGF/Laminin,PatternScan_EGF_LAM_1,PatternScan_EGF_1,superfamily_Fibronectin type III,HMMSmart_SM00060,HMMPfam_fn3,HMMSmart_SM00282,HMMPfam_Laminin_G_2	p.Y4273fs	ENST00000307340.3	37	c.12819_12818	CCDS31025.1	1																																																																																			(deletion:cds_exon[213914065,213915581])	superfamily_Fibronectin type III,HMMPfam_fn3,HMMSmart_SM00060		0.446	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	AT	NM_007123		213915058	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.000:0.002	-
