#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
COL11A1	1301	genome.wustl.edu	37	1	103347309	103347309	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:103347309A>T	ENST00000370096.3	-	65	5296	c.4984T>A	c.(4984-4986)Tca>Aca	p.S1662T	COL11A1_ENST00000358392.2_Missense_Mutation_p.S1674T|COL11A1_ENST00000353414.4_Missense_Mutation_p.S1623T|COL11A1_ENST00000512756.1_Missense_Mutation_p.S1546T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1662	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.S1674T(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTGGCCATGATGAAATTCTT	0.318																																																1	Substitution - Missense(1)	ovary(1)	1											91.0	83.0	86.0					1																	103347309		2202	4300	6502	103119897	SO:0001583	missense	1301			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4984T>A	1.37:g.103347309A>T	ENSP00000359114:p.Ser1662Thr		103119897	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	HMMPfam_COLFI;HMMPfam_Collagen;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.S1674T	ENST00000370096.3	37	c.5020	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	A	15.16	2.749958	0.49257	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76	4.9	4.9	0.64082	Fibrillar collagen, C-terminal (3);	0.249017	0.34959	N	0.003543	T	0.69557	0.3124	L	0.38649	1.16	0.58432	D	0.999998	P;D;D;D;P	0.56287	0.884;0.969;0.969;0.975;0.859	P;P;P;P;P	0.55965	0.748;0.683;0.683;0.788;0.632	T	0.73990	-0.3808	10	0.54805	T	0.06	.	14.6652	0.68901	1.0:0.0:0.0:0.0	.	1546;1623;1674;1662;882	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	T	1662;1674;1623;882;1546	ENSP00000359114:S1662T;ENSP00000351163:S1674T;ENSP00000302551:S1623T;ENSP00000426533:S1546T	ENSP00000302551:S1623T	S	-	1	0	COL11A1	103119897	1.000000	0.71417	0.999000	0.59377	0.857000	0.48899	3.279000	0.51670	1.881000	0.54492	0.367000	0.22151	TCA	-	HMMPfam_COLFI		0.318	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	protein_coding	OTTHUMT00000029997.1	A	NM_080630		103119897	-1	no_errors	NM_080629	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZNF697	90874	genome.wustl.edu	37	1	120168565	120168565	+	Silent	SNP	C	C	T	rs374154556		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:120168565C>T	ENST00000421812.2	-	2	278	c.159G>A	c.(157-159)ccG>ccA	p.P53P		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	53					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P53P(1)		ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		TCTCCGGCTCCGGATGGCCTT	0.532																																																1	Substitution - coding silent(1)	ovary(1)	1						C		0,3888		0,0,1944	118.0	122.0	120.0		159	-5.0	0.0	1		120	2,8276		0,2,4137	no	coding-synonymous	ZNF697	NM_001080470.1		0,2,6081	TT,TC,CC		0.0242,0.0,0.0164		53/546	120168565	2,12164	1944	4139	6083	119970088	SO:0001819	synonymous_variant	90874			AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.159G>A	1.37:g.120168565C>T			119970088	Q96IT2	Silent	SNP	-	p.P53	ENST00000421812.2	37	c.159	CCDS44202.1	1																																																																																			-	NULL		0.532	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF697	protein_coding	OTTHUMT00000036349.3	C	XM_371286		119970088	-1	no_errors	NM_001080470	genbank	human	provisional	54_36p	silent	SNP		T
CGN	57530	genome.wustl.edu	37	1	151508330	151508330	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:151508330G>A	ENST00000271636.7	+	18	3286	c.3153G>A	c.(3151-3153)gaG>gaA	p.E1051E		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	1045					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)	p.E1051E(1)		NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTCAGCTTGAGTCCCAGAATC	0.562																																																1	Substitution - coding silent(1)	ovary(1)	1											50.0	52.0	52.0					1																	151508330		2203	4300	6503	149774954	SO:0001819	synonymous_variant	57530			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.3153G>A	1.37:g.151508330G>A			149774954	A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	-	p.E1051	ENST00000271636.7	37	c.3153	CCDS999.1	1																																																																																			-	NULL		0.562	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	protein_coding	OTTHUMT00000034900.3	G	NM_020770		149774954	1	no_errors	NM_020770	genbank	human	validated	54_36p	silent	SNP	0.97	A
CELA2B	51032	genome.wustl.edu	37	1	15807631	15807631	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:15807631C>G	ENST00000375910.3	+	3	193	c.168C>G	c.(166-168)caC>caG	p.H56Q	CELA2B_ENST00000494280.1_3'UTR	NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	56	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.H56Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						AGTGGTACCACACCTGCGGAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	1											129.0	112.0	118.0					1																	15807631		2203	4300	6503	15680218	SO:0001583	missense	51032				CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.168C>G	1.37:g.15807631C>G	ENSP00000365075:p.His56Gln		15680218	Q14D16|Q6ISM5|Q96QV5	Missense_Mutation	SNP	-	p.H56Q	ENST00000375910.3	37	c.168	CCDS30605.1	1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877539	0.51801	.	.	ENSG00000215704	ENST00000375910;ENST00000375909;ENST00000422901	D;D	0.93763	-3.28;-2.51	4.0	4.0	0.46444	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.64402	U	0.000018	D	0.95620	0.8576	M	0.76838	2.35	0.37795	D	0.927491	D	0.89917	1.0	D	0.97110	1.0	D	0.95870	0.8890	10	0.87932	D	0	.	7.7378	0.28825	0.0:0.886:0.0:0.114	.	56	P08218	CEL2B_HUMAN	Q	56;28;40	ENSP00000365075:H56Q;ENSP00000399811:H40Q	ENSP00000365074:H28Q	H	+	3	2	CELA2B	15680218	1.000000	0.71417	0.993000	0.49108	0.579000	0.36224	3.542000	0.53625	2.222000	0.72286	0.603000	0.83216	CAC	-	NULL		0.617	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELA2B	protein_coding	OTTHUMT00000006448.1	C	NM_015849		15680218	1	no_errors	NM_015849	genbank	human	reviewed	54_36p	missense	SNP	1	G
LCE3E	353145	genome.wustl.edu	37	1	152538458	152538458	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:152538458C>T	ENST00000368789.1	-	2	282	c.227G>A	c.(226-228)gGt>gAt	p.G76D		NM_178435.2	NP_848522.1	Q5T5B0	LCE3E_HUMAN	late cornified envelope 3E	76					keratinization (GO:0031424)			p.G76D(1)		lung(6)|ovary(1)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)		GCCTTGCTGACCACTGCCCCT	0.637																																																1	Substitution - Missense(1)	ovary(1)	1											59.0	70.0	66.0					1																	152538458		2203	4300	6503	150805082	SO:0001583	missense	353145				CCDS1013.1	1q21.3	2008-02-05			ENSG00000185966	ENSG00000185966		"""Late cornified envelopes"""	29463	protein-coding gene	gene with protein product		612617				11698679	Standard	NM_178435		Approved	LEP17	uc001faa.4	Q5T5B0	OTTHUMG00000012393	ENST00000368789.1:c.227G>A	1.37:g.152538458C>T	ENSP00000357778:p.Gly76Asp		150805082	A2RRM6	Missense_Mutation	SNP	-	p.G76D	ENST00000368789.1	37	c.227	CCDS1013.1	1	.	.	.	.	.	.	.	.	.	.	C	4.990	0.183771	0.09495	.	.	ENSG00000185966	ENST00000368789	T	0.09255	3.0	3.55	2.58	0.30949	.	.	.	.	.	T	0.14356	0.0347	.	.	.	0.31618	N	0.650603	D	0.71674	0.998	D	0.64776	0.929	T	0.02391	-1.1166	8	0.87932	D	0	.	8.6141	0.33820	0.0:0.7626:0.2374:0.0	.	76	Q5T5B0	LCE3E_HUMAN	D	76	ENSP00000357778:G76D	ENSP00000357778:G76D	G	-	2	0	LCE3E	150805082	0.017000	0.18338	0.848000	0.33437	0.189000	0.23516	-0.102000	0.10956	0.760000	0.33108	0.557000	0.71058	GGT	-	NULL		0.637	LCE3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE3E	protein_coding	OTTHUMT00000034513.1	C	NM_178435		150805082	-1	no_errors	NM_178435	genbank	human	validated	54_36p	missense	SNP	0.43	T
FCRL6	343413	genome.wustl.edu	37	1	159785238	159785238	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:159785238G>C	ENST00000368106.3	+	9	1169	c.1168G>C	c.(1168-1170)Gtg>Ctg	p.V390L	FCRL6_ENST00000339348.5_Intron|FCRL6_ENST00000321935.6_Missense_Mutation_p.V397L|FCRL6_ENST00000392235.3_Missense_Mutation_p.V295L	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	390						external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.V390L(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					TGAGTTCACCGTGGGGAGAAA	0.547																																																1	Substitution - Missense(1)	ovary(1)	1											116.0	99.0	105.0					1																	159785238		2203	4300	6503	158051862	SO:0001583	missense	343413			AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.1168G>C	1.37:g.159785238G>C	ENSP00000357086:p.Val390Leu		158051862	A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Missense_Mutation	SNP	-	p.V390L	ENST00000368106.3	37	c.1168	CCDS30912.1	1	.	.	.	.	.	.	.	.	.	.	G	6.940	0.543160	0.13250	.	.	ENSG00000181036	ENST00000321935;ENST00000392235;ENST00000368106	T;T;T	0.01145	5.27;5.57;5.55	3.15	-0.638	0.11500	.	.	.	.	.	T	0.00241	0.0007	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.28004	-1.0057	9	0.23302	T	0.38	.	4.1214	0.10108	0.0:0.1481:0.4747:0.3772	.	295;390;397	Q6DN72-4;Q6DN72;Q6DN72-2	.;FCRL6_HUMAN;.	L	397;295;390	ENSP00000320625:V397L;ENSP00000376068:V295L;ENSP00000357086:V390L	ENSP00000320625:V397L	V	+	1	0	FCRL6	158051862	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.406000	0.07187	-0.128000	0.11641	0.313000	0.20887	GTG	-	NULL		0.547	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL6	protein_coding	OTTHUMT00000276853.1	G	NM_001004310		158051862	1	no_errors	NM_001004310	genbank	human	validated	54_36p	missense	SNP		C
F5	2153	genome.wustl.edu	37	1	169484764	169484764	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:169484764T>C	ENST00000367797.3	-	24	6647	c.6446A>G	c.(6445-6447)tAt>tGt	p.Y2149C	F5_ENST00000367796.3_Missense_Mutation_p.Y2154C	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	2149	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)	p.Y2149C(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GCTCTTTACATACATTTCAGA	0.448																																																1	Substitution - Missense(1)	ovary(1)	1											185.0	173.0	177.0					1																	169484764		2203	4300	6503	167751388	SO:0001583	missense	2153			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.6446A>G	1.37:g.169484764T>C	ENSP00000356771:p.Tyr2149Cys		167751388	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	-	p.Y2149C	ENST00000367797.3	37	c.6446	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	T	16.00	2.997956	0.54147	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.84589	-1.87;-1.87	5.61	3.21	0.36854	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.211231	0.42682	D	0.000673	D	0.88969	0.6582	M	0.81614	2.55	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89086	0.3479	10	0.87932	D	0	-10.3756	10.3646	0.44015	0.4005:0.0:0.0:0.5995	.	2149	P12259	FA5_HUMAN	C	2149;2154	ENSP00000356771:Y2149C;ENSP00000356770:Y2154C	ENSP00000356770:Y2154C	Y	-	2	0	F5	167751388	0.959000	0.32827	0.984000	0.44739	0.930000	0.56654	0.566000	0.23593	0.357000	0.24183	0.383000	0.25322	TAT	-	NULL		0.448	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	protein_coding	OTTHUMT00000083712.1	T	NM_000130		167751388	-1	no_errors	NM_000130	genbank	human	reviewed	54_36p	missense	SNP	1	C
BRINP2	57795	genome.wustl.edu	37	1	177250578	177250578	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:177250578G>A	ENST00000361539.4	+	8	2578	c.2266G>A	c.(2266-2268)Gtg>Atg	p.V756M	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	756					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)		p.V756M(1)									CAACAATGAGGTGGGCAGGAT	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											74.0	73.0	73.0					1																	177250578		2203	4300	6503	175517201	SO:0001583	missense	57795				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.2266G>A	1.37:g.177250578G>A	ENSP00000354481:p.Val756Met		175517201	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	HMMPfam_MACPF	p.V756M	ENST00000361539.4	37	c.2266	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812749	0.70912	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.21734	1.99	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	L	0.52759	1.655	0.80722	D	1	D;D	0.89917	1.0;0.97	D;P	0.91635	0.999;0.754	T	0.23048	-1.0199	10	0.56958	D	0.05	-15.4833	18.4543	0.90714	0.0:0.0:1.0:0.0	.	651;756	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	M	509;756	ENSP00000354481:V756M	ENSP00000354481:V756M	V	+	1	0	FAM5B	175517201	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.731000	0.98807	2.457000	0.83068	0.313000	0.20887	GTG	-	NULL		0.557	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM5B	protein_coding	OTTHUMT00000084599.1	G	NM_021165		175517201	1	no_errors	NM_021165	genbank	human	provisional	54_36p	missense	SNP	1	A
KCNH1	3756	genome.wustl.edu	37	1	211192125	211192125	+	Splice_Site	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:211192125C>A	ENST00000271751.4	-	6	1059	c.1032G>T	c.(1030-1032)caG>caT	p.Q344H	KCNH1_ENST00000367007.4_Intron			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	344					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)	p.Q344H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		AGGGATGTACCTGACTCTCTC	0.438																																																1	Substitution - Missense(1)	ovary(1)	1											125.0	115.0	119.0					1																	211192125		2203	4300	6503	209258748	SO:0001630	splice_region_variant	3756			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1032+1G>T	1.37:g.211192125C>A			209258748	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	-	p.Q344H	ENST00000271751.4	37	c.1032	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	c	11.38	1.622300	0.28889	.	.	ENSG00000143473	ENST00000271751	D	0.98512	-4.97	4.23	4.23	0.50019	Ion transport (1);	0.367279	0.20812	N	0.085222	D	0.96112	0.8733	L	0.56124	1.755	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	D	0.93957	0.7237	9	.	.	.	.	12.2901	0.54812	0.0:1.0:0.0:0.0	.	344	O95259	KCNH1_HUMAN	H	344	ENSP00000271751:Q344H	.	Q	-	3	2	KCNH1	209258748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.407000	0.44565	2.349000	0.79799	0.558000	0.71614	CAG	-	NULL		0.438	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	protein_coding	OTTHUMT00000088332.1	C	NM_002238	Missense_Mutation	209258748	-1	no_errors	NM_172362	genbank	human	reviewed	54_36p	missense	SNP	1	A
USH2A	7399	genome.wustl.edu	37	1	216144095	216144095	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:216144095A>G	ENST00000307340.3	-	36	7215	c.6829T>C	c.(6829-6831)Tat>Cat	p.Y2277H	USH2A_ENST00000366943.2_Missense_Mutation_p.Y2277H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2277	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.Y2277H(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCATCTAGATATAATCCATAA	0.393										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											101.0	98.0	99.0					1																	216144095		2203	4300	6503	214210718	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6829T>C	1.37:g.216144095A>G	ENSP00000305941:p.Tyr2277His		214210718	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	-	p.Y2277H	ENST00000307340.3	37	c.6829	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	A	18.89	3.719959	0.68844	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55588	0.51;0.51	5.72	5.72	0.89469	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.40144	N	0.001177	T	0.72382	0.3453	M	0.77313	2.365	0.37687	D	0.923704	D	0.89917	1.0	D	0.85130	0.997	T	0.74532	-0.3634	10	0.29301	T	0.29	.	15.9989	0.80275	1.0:0.0:0.0:0.0	.	2277	O75445	USH2A_HUMAN	H	2277	ENSP00000305941:Y2277H;ENSP00000355910:Y2277H	ENSP00000305941:Y2277H	Y	-	1	0	USH2A	214210718	1.000000	0.71417	0.985000	0.45067	0.706000	0.40770	5.677000	0.68142	2.179000	0.69175	0.482000	0.46254	TAT	-	NULL		0.393	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	A	NM_007123		214210718	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	missense	SNP	1	G
TMEM63A	9725	genome.wustl.edu	37	1	226034785	226034785	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:226034785G>A	ENST00000366835.3	-	24	2650	c.2380C>T	c.(2380-2382)Cag>Tag	p.Q794*	RP11-285F7.2_ENST00000424332.1_RNA	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	794					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)	p.Q794*(2)		breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					GTGGCGCTCTGCGCCAAGCAC	0.667																																																2	Substitution - Nonsense(2)	ovary(1)|large_intestine(1)	1											63.0	63.0	63.0					1																	226034785		2203	4300	6503	224101408	SO:0001587	stop_gained	9725				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.2380C>T	1.37:g.226034785G>A	ENSP00000355800:p.Gln794*		224101408	Q53GI7|Q5TE96|Q8N2U2	Nonsense_Mutation	SNP	-	p.Q794*	ENST00000366835.3	37	c.2380	CCDS31042.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.237780	0.97403	.	.	ENSG00000196187	ENST00000366835	.	.	.	3.46	3.46	0.39613	.	0.710219	0.13253	N	0.401902	.	.	.	.	.	.	0.32765	N	0.504565	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-7.7796	10.6255	0.45506	0.0:0.0:1.0:0.0	.	.	.	.	X	794	.	ENSP00000355800:Q794X	Q	-	1	0	TMEM63A	224101408	0.002000	0.14202	0.005000	0.12908	0.002000	0.02628	1.216000	0.32443	1.954000	0.56735	0.448000	0.29417	CAG	-	NULL		0.667	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	protein_coding	OTTHUMT00000091154.2	G	NM_014698		224101408	-1	no_errors	NM_014698	genbank	human	provisional	54_36p	nonsense	SNP	0.02	A
NOC2L	26155	genome.wustl.edu	37	1	881892	881892	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:881892T>G	ENST00000327044.6	-	15	1742	c.1693A>C	c.(1693-1695)Aac>Cac	p.N565H		NM_015658.3	NP_056473	Q9Y3T9	NOC2L_HUMAN	nucleolar complex associated 2 homolog (S. cerevisiae)	565					apoptotic process (GO:0006915)|cellular response to UV (GO:0034644)|chromatin assembly (GO:0031497)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of histone acetylation (GO:0035067)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleolus to nucleoplasm transport (GO:0032066)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosome binding (GO:0031491)|poly(A) RNA binding (GO:0044822)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)	p.N565H(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	16	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00459)|Epithelial(90;1.86e-38)|OV - Ovarian serous cystadenocarcinoma(86;6.08e-23)|Colorectal(212;0.000161)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(365;0.000475)|Kidney(185;0.00231)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)		CGGCAGTAGTTGGCCACCTTG	0.632																																																1	Substitution - Missense(1)	ovary(1)	1											37.0	39.0	39.0					1																	881892		2203	4300	6503	871755	SO:0001583	missense	26155			AL050019	CCDS3.1	1p36.33	2014-06-12			ENSG00000188976	ENSG00000188976			24517	protein-coding gene	gene with protein product	"""novel INHAT repressor"", ""protein phosphatase 1, regulatory subunit 12"""	610770					Standard	NM_015658		Approved	DKFZP564C186, NET7, NET15, NIR, PPP1R112	uc001abz.4	Q9Y3T9	OTTHUMG00000040720	ENST00000327044.6:c.1693A>C	1.37:g.881892T>G	ENSP00000317992:p.Asn565His		871755	Q5SVA3|Q9BTN6	Missense_Mutation	SNP	-	p.N565H	ENST00000327044.6	37	c.1693	CCDS3.1	1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.794229	0.90453	.	.	ENSG00000188976	ENST00000327044	T	0.44482	0.92	5.16	5.16	0.70880	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62011	0.2393	M	0.67569	2.06	0.80722	D	1	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.74674	0.983;0.983;0.984	T	0.66260	-0.5968	10	0.87932	D	0	-55.8124	14.1658	0.65475	0.0:0.0:0.0:1.0	.	565;565;332	B3KNC3;Q9Y3T9;Q9H9J5	.;NOC2L_HUMAN;.	H	565	ENSP00000317992:N565H	ENSP00000317992:N565H	N	-	1	0	NOC2L	871755	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.820000	0.69250	1.937000	0.56155	0.374000	0.22700	AAC	-	NULL		0.632	NOC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC2L	protein_coding	OTTHUMT00000097869.1	T	NM_015658		871755	-1	no_errors	NM_015658	genbank	human	validated	54_36p	missense	SNP	1	G
SEPN1	57190	genome.wustl.edu	37	1	26135163	26135163	+	Silent	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:26135163T>A	ENST00000374315.1	+	4	566	c.528T>A	c.(526-528)ctT>ctA	p.L176L	SEPN1_ENST00000361547.2_Silent_p.L210L|SEPN1_ENST00000354177.4_Silent_p.L176L	NM_206926.1	NP_996809.1	Q9NZV5	SELN_HUMAN	selenoprotein N, 1	210						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.L210L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		AGCCCTTCCTTCCCCCGCCAG	0.657																																																1	Substitution - coding silent(1)	ovary(1)	1											69.0	81.0	77.0					1																	26135163		2057	4190	6247	26007750	SO:0001819	synonymous_variant	57190			AF166125	CCDS41282.1, CCDS41283.1	1p36.13	2014-09-17	2004-02-13		ENSG00000162430	ENSG00000162430		"""EF-hand domain containing"""	15999	protein-coding gene	gene with protein product		606210	"""rigid spine muscular dystrophy 1"""	RSMD1, MDRS1		10608886	Standard	NM_020451		Approved	selN, RSS	uc021ojl.1	Q9NZV5	OTTHUMG00000007375	ENST00000374315.1:c.528T>A	1.37:g.26135163T>A			26007750	A6NJG8|A8MQ64|Q6PI70|Q969F6|Q9NUI6	Silent	SNP	-	p.L176	ENST00000374315.1	37	c.528	CCDS41283.1	1																																																																																			-	NULL		0.657	SEPN1-002	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	SEPN1	protein_coding	OTTHUMT00000019315.2	T	NM_020451		26007750	1	no_errors	ENST00000354177	ensembl	human	known	54_36p	silent	SNP	0.69	A
ARID1A	8289	genome.wustl.edu	37	1	27102196	27102196	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:27102196C>T	ENST00000324856.7	+	19	5493	c.5122C>T	c.(5122-5124)Cag>Tag	p.Q1708*	ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q1491*|ARID1A_ENST00000540690.1_Nonsense_Mutation_p.Q36*|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q1325*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1708					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q1708*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAACCTCAGTCAGGTGAGTAT	0.473			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Substitution - Nonsense(1)	ovary(1)	1											136.0	112.0	120.0					1																	27102196		2203	4300	6503	26974783	SO:0001587	stop_gained	8289			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5122C>T	1.37:g.27102196C>T	ENSP00000320485:p.Gln1708*		26974783	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	-	p.Q1708*	ENST00000324856.7	37	c.5122	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	10.423085|10.423085	0.99402|0.99402	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	.|T	.|0.03831	.|3.79	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	0.114465|.	0.64402|.	D|.	0.000010|.	.|T	.|0.19725	.|0.0474	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.00066	.|-1.2146	.|6	0.72032|0.87932	D|D	0.01|0	-5.9144|-5.9144	18.9294|18.9294	0.92558|0.92558	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	1708;1491;1325;36|604	.|ENSP00000390317:S604L	ENSP00000320485:Q1708X|ENSP00000390317:S604L	Q|S	+|+	1|2	0|0	ARID1A|ARID1A	26974783|26974783	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	5.945000|5.945000	0.70226|0.70226	2.711000|2.711000	0.92665|0.92665	0.655000|0.655000	0.94253|0.94253	CAG|TCA	-	NULL		0.473	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	protein_coding	OTTHUMT00000011437.2	C	NM_139135		26974783	1	no_errors	NM_006015	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
PCSK9	255738	genome.wustl.edu	37	1	55523739	55523739	+	Missense_Mutation	SNP	C	C	A	rs140072072		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:55523739C>A	ENST00000302118.5	+	8	1501	c.1211C>A	c.(1210-1212)cCg>cAg	p.P404Q	PCSK9_ENST00000543384.1_Missense_Mutation_p.P204Q|PCSK9_ENST00000490692.1_3'UTR	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	404	Peptidase S8.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.P404Q(1)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						TCTGCCGAGCCGGAGCTCACC	0.612																																					Pancreas(137;1454 1827 5886 22361 42375)											1	Substitution - Missense(1)	ovary(1)	1											71.0	65.0	67.0					1																	55523739		2203	4300	6503	55296327	SO:0001583	missense	255738			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.1211C>A	1.37:g.55523739C>A	ENSP00000303208:p.Pro404Gln		55296327	A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Missense_Mutation	SNP	-	p.P404Q	ENST00000302118.5	37	c.1211	CCDS603.1	1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.304092	0.60305	.	.	ENSG00000169174	ENST00000302118;ENST00000543384	T;T	0.81163	-1.46;-1.46	4.39	3.48	0.39840	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.067800	0.64402	D	0.000020	D	0.84279	0.5437	M	0.81239	2.535	0.36382	D	0.861954	D	0.59357	0.985	P	0.49799	0.622	D	0.88829	0.3304	10	0.87932	D	0	-11.5511	12.6057	0.56523	0.0:0.9181:0.0:0.0819	.	404	Q8NBP7	PCSK9_HUMAN	Q	404;204	ENSP00000303208:P404Q;ENSP00000441859:P204Q	ENSP00000303208:P404Q	P	+	2	0	PCSK9	55296327	0.916000	0.31088	0.013000	0.15412	0.412000	0.31113	2.014000	0.40951	0.955000	0.37878	0.563000	0.77884	CCG	-	NULL		0.612	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK9	protein_coding	OTTHUMT00000022280.1	C	NM_174936		55296327	1	no_errors	NM_174936	genbank	human	reviewed	54_36p	missense	SNP	0.51	A
CCDC18	343099	genome.wustl.edu	37	1	93677660	93677660	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:93677660T>G	ENST00000343253.7	+	11	1839	c.1337T>G	c.(1336-1338)aTt>aGt	p.I446S	CCDC18_ENST00000338949.4_Missense_Mutation_p.I245S|CCDC18_ENST00000401026.3_Missense_Mutation_p.I446S|CCDC18_ENST00000557479.1_Missense_Mutation_p.I564S|CCDC18_ENST00000334652.5_De_novo_Start_InFrame			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	446								p.I564S(1)		breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TGTGCCAGAATTAAGCTTGCA	0.299																																																1	Substitution - Missense(1)	ovary(1)	1											91.0	88.0	89.0					1																	93677660		1794	4059	5853	93450248	SO:0001583	missense	343099					1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.1337T>G	1.37:g.93677660T>G	ENSP00000343377:p.Ile446Ser		93450248	Q6ZU17	Missense_Mutation	SNP	-	p.I564S	ENST00000343253.7	37	c.1691		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.23|14.23	2.473454|2.473454	0.43942|0.43942	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000455267|ENST00000370276	T;T;T;T;T|.	0.22539|.	1.95;1.95;1.95;1.95;1.95|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.555566|.	0.18035|.	N|.	0.153806|.	T|T	0.50463|0.50463	0.1617|0.1617	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	P;D|.	0.56035|.	0.902;0.974|.	P;P|.	0.56343|.	0.602;0.796|.	T|T	0.53823|0.53823	-0.8384|-0.8384	10|5	0.10377|.	T|.	0.69|.	.|.	10.4251|10.4251	0.44373|0.44373	0.0:0.0725:0.0:0.9274|0.0:0.0725:0.0:0.9274	.|.	446;564|.	Q5T9S5;G3V388|.	CCD18_HUMAN;.|.	S|V	446;446;564;245;166|500	ENSP00000343377:I446S;ENSP00000383808:I446S;ENSP00000451099:I564S;ENSP00000344380:I245S;ENSP00000391151:I166S|.	ENSP00000344380:I245S|.	I|L	+|+	2|1	0|2	CCDC18|CCDC18	93450248|93450248	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	1.931000|1.931000	0.40134|0.40134	2.192000|2.192000	0.70111|0.70111	0.460000|0.460000	0.39030|0.39030	ATT|TTA	-	NULL		0.299	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	protein_coding	OTTHUMT00000382327.1	T	NM_206886		93450248	1	no_errors	NM_206886	genbank	human	validated	54_36p	missense	SNP	1	G
WNT9A	7483	genome.wustl.edu	37	1	228111898	228111898	+	Missense_Mutation	SNP	G	G	A	rs149009608	byFrequency	TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr1:228111898G>A	ENST00000272164.5	-	3	566	c.556C>T	c.(556-558)Cgg>Tgg	p.R186W		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	186					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.R186W(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				TTGCTTGACCGTCTGCCCAGG	0.622													G|||	7	0.00139776	0.0023	0.0029	5008	,	,		10787	0.0		0.0	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	1						G	TRP/ARG	3,4403	6.2+/-15.9	0,3,2200	107.0	99.0	102.0		556	1.0	0.6	1	dbSNP_134	102	0,8600		0,0,4300	yes	missense	WNT9A	NM_003395.2	101	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	probably-damaging	186/366	228111898	3,13003	2203	4300	6503	226178521	SO:0001583	missense	7483			AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.556C>T	1.37:g.228111898G>A	ENSP00000272164:p.Arg186Trp		226178521	A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Missense_Mutation	SNP	HMMPfam_wnt	p.R186W	ENST00000272164.5	37	c.556	CCDS31045.1	1	2	9.157509157509158E-4	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	0	0.0	G	16.44	3.122813	0.56613	6.81E-4	0.0	ENSG00000143816	ENST00000272164	T	0.77750	-1.12	4.78	1.02	0.19986	.	0.121334	0.51477	D	0.000086	T	0.74703	0.3751	L	0.47716	1.5	0.47994	D	0.999565	D	0.56746	0.977	P	0.51453	0.67	T	0.72033	-0.4412	10	0.87932	D	0	.	8.0885	0.30786	0.0945:0.0:0.2172:0.6882	.	186	O14904	WNT9A_HUMAN	W	186	ENSP00000272164:R186W	ENSP00000272164:R186W	R	-	1	2	WNT9A	226178521	1.000000	0.71417	0.599000	0.28851	0.522000	0.34438	2.155000	0.42301	-0.055000	0.13244	0.491000	0.48974	CGG	-	HMMPfam_wnt		0.622	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT9A	protein_coding	OTTHUMT00000091646.1	G	NM_003395		226178521	-1	no_errors	NM_003395	genbank	human	validated	54_36p	missense	SNP	1	A
CFAP58	159686	genome.wustl.edu	37	10	106118153	106118153	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:106118153G>C	ENST00000369704.3	+	2	198	c.64G>C	c.(64-66)Gat>Cat	p.D22H	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		22						extracellular space (GO:0005615)		p.D22H(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AATGGAAAGAGATTTTCAGGG	0.383																																																1	Substitution - Missense(1)	ovary(1)	10											47.0	49.0	49.0					10																	106118153		2203	4300	6503	106108143	SO:0001583	missense	159686																														ENST00000369704.3:c.64G>C	10.37:g.106118153G>C	ENSP00000358718:p.Asp22His		106108143	D3DRA6|Q8NA27	Missense_Mutation	SNP	-	p.D22H	ENST00000369704.3	37	c.64	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808881	0.50421	.	.	ENSG00000120051	ENST00000369704	T	0.36157	1.27	5.31	5.31	0.75309	.	0.194253	0.53938	D	0.000054	T	0.61949	0.2388	M	0.74467	2.265	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.61623	-0.7025	10	0.46703	T	0.11	-25.8739	19.3406	0.94339	0.0:0.0:1.0:0.0	.	22	Q5T655	CC147_HUMAN	H	22	ENSP00000358718:D22H	ENSP00000358718:D22H	D	+	1	0	CCDC147	106108143	1.000000	0.71417	1.000000	0.80357	0.126000	0.20510	6.552000	0.73914	2.636000	0.89361	0.655000	0.94253	GAT	-	NULL		0.383	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	protein_coding	OTTHUMT00000050216.1	G			106108143	1	no_errors	NM_001008723	genbank	human	validated	54_36p	missense	SNP	1	C
TCF7L2	6934	genome.wustl.edu	37	10	114849161	114849161	+	Intron	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:114849161C>G	ENST00000355995.4	+	5	1059				TCF7L2_ENST00000536810.1_Intron|TCF7L2_ENST00000349937.2_Intron|TCF7L2_ENST00000545257.1_Intron|TCF7L2_ENST00000355717.4_Missense_Mutation_p.S162R|TCF7L2_ENST00000369395.1_Missense_Mutation_p.S163R|TCF7L2_ENST00000538897.1_Intron|TCF7L2_ENST00000543371.1_Intron|TCF7L2_ENST00000534894.1_Intron|TCF7L2_ENST00000542695.1_Intron|TCF7L2_ENST00000369397.4_Intron|TCF7L2_ENST00000352065.5_Intron			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)						blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.L164fs*29(1)	VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GGCAGCAGAGCCCCCTCCCTT	0.587			T	VTI1A	colorectal																																		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	1	Deletion - Frameshift(1)	large_intestine(1)	10											42.0	38.0	40.0					10																	114849161		1568	3582	5150	114839151	SO:0001627	intron_variant	6934			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.552+49276C>G	10.37:g.114849161C>G			114839151	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	HMMPfam_HMG_box;superfamily_HMG-box;HMMPfam_CTNNB1_binding	p.S163R	ENST00000355995.4	37	c.489		10	.	.	.	.	.	.	.	.	.	.	C	12.50	1.955167	0.34471	.	.	ENSG00000148737	ENST00000355717;ENST00000369395;ENST00000346198	D	0.99527	-6.09	4.4	1.57	0.23409	.	0.387194	0.22518	N	0.059014	D	0.96309	0.8796	N	0.08118	0	0.80722	D	1	B;B;B	0.31752	0.338;0.044;0.255	B;B;B	0.35114	0.196;0.09;0.126	D	0.92986	0.6410	10	0.49607	T	0.09	.	6.2504	0.20842	0.0:0.6902:0.0:0.3098	.	32;57;162	B4DWD5;C6ZRJ6;F8W7T5	.;.;.	R	162;163;132	ENSP00000347949:S162R	ENSP00000345640:S132R	S	+	3	2	TCF7L2	114839151	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.566000	0.23593	0.371000	0.24564	0.655000	0.94253	AGC	-	HMMPfam_CTNNB1_binding		0.587	TCF7L2-203	KNOWN	basic	protein_coding	TCF7L2	protein_coding		C	NM_030756		114839151	1	no_errors	ENST00000352065	ensembl	human	known	54_36p	missense	SNP	1	G
PTER	9317	genome.wustl.edu	37	10	16526424	16526424	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:16526424T>C	ENST00000378000.1	+	3	287	c.41T>C	c.(40-42)cTt>cCt	p.L14P	PTER_ENST00000423462.2_Missense_Mutation_p.L14P|PTER_ENST00000298942.3_Missense_Mutation_p.L14P|PTER_ENST00000535784.2_Missense_Mutation_p.L14P	NM_001001484.2|NM_001261838.1|NM_030664.4	NP_001001484.1|NP_001248767.1|NP_109589.2	Q96BW5	PTER_HUMAN	phosphotriesterase related	14					catabolic process (GO:0009056)|epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)	p.L14P(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)	15						GTTTTGGGCCTTGTAGAGCCA	0.463																																					Ovarian(2;46 150 15648 38137 47908)											1	Substitution - Missense(1)	ovary(1)	10											93.0	88.0	90.0					10																	16526424		2203	4300	6503	16566430	SO:0001583	missense	9317			BC015092	CCDS7111.1, CCDS58070.1, CCDS73070.1	10p12	2003-11-05			ENSG00000165983	ENSG00000165983			9590	protein-coding gene	gene with protein product		604446				9925913	Standard	NM_001001484		Approved		uc001ioi.2	Q96BW5	OTTHUMG00000017737	ENST00000378000.1:c.41T>C	10.37:g.16526424T>C	ENSP00000367239:p.Leu14Pro		16566430	B0YJ77|B3KTF5|D3DRU0|Q9BY46	Missense_Mutation	SNP	-	p.L14P	ENST00000378000.1	37	c.41	CCDS7111.1	10	.	.	.	.	.	.	.	.	.	.	T	4.317	0.058116	0.08339	.	.	ENSG00000165983	ENST00000343656;ENST00000535784;ENST00000423462;ENST00000378000;ENST00000298942	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	6.08	1.19	0.21007	.	0.563001	0.21139	N	0.079520	T	0.10852	0.0265	N	0.01631	-0.79	0.52099	D	0.999949	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.36237	-0.9756	10	0.02654	T	1	-6.2455	10.5475	0.45068	0.0:0.391:0.0:0.609	.	14;14	Q96BW5-2;Q96BW5	.;PTER_HUMAN	P	14	ENSP00000439485:L14P;ENSP00000389535:L14P;ENSP00000367239:L14P;ENSP00000298942:L14P	ENSP00000298942:L14P	L	+	2	0	PTER	16566430	0.000000	0.05858	0.190000	0.23270	0.373000	0.29922	-0.214000	0.09292	0.171000	0.19730	0.533000	0.62120	CTT	-	NULL		0.463	PTER-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTER	protein_coding	OTTHUMT00000047001.2	T	NM_030664		16566430	1	no_errors	NM_001001484	genbank	human	validated	54_36p	missense	SNP	0.01	C
ARHGAP21	57584	genome.wustl.edu	37	10	24908437	24908437	+	Missense_Mutation	SNP	G	G	T	rs138158463		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:24908437G>T	ENST00000396432.2	-	9	2873	c.2387C>A	c.(2386-2388)cCg>cAg	p.P796Q	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.P583Q	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	795					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)	p.P795Q(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						ATCGCCAGGCGGACTGGTACT	0.458																																																1	Substitution - Missense(1)	ovary(1)	10											83.0	86.0	85.0					10																	24908437		2203	4300	6503	24948443	SO:0001583	missense	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.2387C>A	10.37:g.24908437G>T	ENSP00000379709:p.Pro796Gln		24948443	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	HMMPfam_RhoGAP;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_PH;superfamily_GTPase activation domain GAP;superfamily_PH domain-like	p.P795Q	ENST00000396432.2	37	c.2384	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026995	0.54683	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.50813	0.73;0.73;0.73;0.73	5.25	5.25	0.73442	.	0.294778	0.39544	N	0.001328	T	0.59115	0.2170	L	0.40543	1.245	0.33453	D	0.583922	D;D	0.67145	0.996;0.993	P;P	0.62382	0.901;0.798	T	0.64960	-0.6284	10	0.40728	T	0.16	.	19.2213	0.93797	0.0:0.0:1.0:0.0	.	786;795	F8W9U9;Q5T5U3	.;RHG21_HUMAN	Q	796;583;786;796;631	ENSP00000379709:P796Q;ENSP00000365604:P583Q;ENSP00000365592:P786Q;ENSP00000405018:P796Q	ENSP00000365604:P583Q	P	-	2	0	ARHGAP21	24948443	1.000000	0.71417	0.123000	0.21794	0.808000	0.45660	6.880000	0.75578	2.590000	0.87494	0.655000	0.94253	CCG	-	NULL		0.458	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	protein_coding	OTTHUMT00000047229.4	G	NM_020824		24948443	-1	no_errors	NM_020824	genbank	human	validated	54_36p	missense	SNP	0.89	T
PTCHD3	374308	genome.wustl.edu	37	10	27687651	27687651	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:27687651C>G	ENST00000438700.3	-	4	1993	c.1876G>C	c.(1876-1878)Ggt>Cgt	p.G626R		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	626					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)	p.G626R(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						AGGTCTAAACCTTCCTGCACA	0.388																																																1	Substitution - Missense(1)	ovary(1)	10											80.0	79.0	79.0					10																	27687651		2203	4300	6503	27727657	SO:0001583	missense	374308			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.1876G>C	10.37:g.27687651C>G	ENSP00000417658:p.Gly626Arg		27727657	I3L499|Q6ZU28	Missense_Mutation	SNP	-	p.G626R	ENST00000438700.3	37	c.1876	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	C	19.50	3.840196	0.71488	.	.	ENSG00000182077	ENST00000438700	D	0.86164	-2.08	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	D	0.93533	0.7936	M	0.84683	2.71	0.53005	D	0.999969	D	0.55172	0.97	D	0.67382	0.951	D	0.94612	0.7805	10	0.66056	D	0.02	-15.8192	16.3031	0.82832	0.0:1.0:0.0:0.0	.	626	Q3KNS1	PTHD3_HUMAN	R	626	ENSP00000417658:G626R	ENSP00000417658:G626R	G	-	1	0	PTCHD3	27727657	1.000000	0.71417	0.973000	0.42090	0.970000	0.65996	4.580000	0.60942	2.173000	0.68751	0.484000	0.47621	GGT	-	NULL		0.388	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	protein_coding	OTTHUMT00000047325.3	C	XM_370541		27727657	-1	no_errors	NM_001034842	genbank	human	validated	54_36p	missense	SNP	0.99	G
ZNF488	118738	genome.wustl.edu	37	10	48371106	48371106	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:48371106C>A	ENST00000395702.2	+	2	801	c.574C>A	c.(574-576)Ctg>Atg	p.L192M	ZNF488_ENST00000586537.1_Missense_Mutation_p.L85M|ZNF488_ENST00000494156.1_3'UTR			Q96MN9	ZN488_HUMAN	zinc finger protein 488	192					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L192M(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						CCTGGGGGAGCTGTCTGGACT	0.537																																																1	Substitution - Missense(1)	ovary(1)	10											102.0	98.0	99.0					10																	48371106		2203	4300	6503	47991112	SO:0001583	missense	118738			AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.574C>A	10.37:g.48371106C>A	ENSP00000379054:p.Leu192Met		47991112	Q05CE0	Missense_Mutation	SNP	-	p.L192M	ENST00000395702.2	37	c.574	CCDS7217.1	10	.	.	.	.	.	.	.	.	.	.	C	14.22	2.469075	0.43839	.	.	ENSG00000165388	ENST00000395702	T	0.26518	1.73	5.55	4.51	0.55191	.	0.096997	0.44902	D	0.000401	T	0.41119	0.1145	M	0.63843	1.955	0.23043	N	0.998385	D	0.67145	0.996	P	0.62435	0.902	T	0.24297	-1.0164	10	0.56958	D	0.05	.	8.2082	0.31467	0.0:0.7941:0.0:0.2059	.	192	Q96MN9	ZN488_HUMAN	M	192	ENSP00000379054:L192M	ENSP00000379054:L192M	L	+	1	2	ZNF488	47991112	0.737000	0.28175	0.015000	0.15790	0.588000	0.36517	0.592000	0.23984	1.093000	0.41377	0.561000	0.74099	CTG	-	NULL		0.537	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF488	protein_coding	OTTHUMT00000314632.1	C	NM_153034		47991112	1	no_errors	NM_153034	genbank	human	provisional	54_36p	missense	SNP	0.92	A
CYP2C19	1557	genome.wustl.edu	37	10	96612532	96612532	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:96612532T>A	ENST00000371321.3	+	9	1416	c.1334T>A	c.(1333-1335)cTg>cAg	p.L445Q	CYP2C19_ENST00000464755.1_3'UTR	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	445					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)	p.L445Q(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	CGCATGGAGCTGTTTTTATTC	0.428																																																1	Substitution - Missense(1)	ovary(1)	10											143.0	134.0	137.0					10																	96612532		2203	4300	6503	96602522	SO:0001583	missense	1557			M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.1334T>A	10.37:g.96612532T>A	ENSP00000360372:p.Leu445Gln		96602522	P33259|Q8WZB1|Q8WZB2|Q9UCD4	Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.L445Q	ENST00000371321.3	37	c.1334	CCDS7436.1	10	.	.	.	.	.	.	.	.	.	.	T	18.63	3.664379	0.67700	.	.	ENSG00000165841	ENST00000371321	T	0.73047	-0.71	3.2	3.2	0.36748	.	0.343652	0.22291	U	0.061987	D	0.88134	0.6355	H	0.97587	4.035	0.33748	D	0.620244	D	0.89917	1.0	D	0.91635	0.999	D	0.91794	0.5446	10	0.87932	D	0	.	9.787	0.40681	0.0:0.0:0.0:1.0	.	445	P33261	CP2CJ_HUMAN	Q	445	ENSP00000360372:L445Q	ENSP00000360372:L445Q	L	+	2	0	CYP2C19	96602522	1.000000	0.71417	0.987000	0.45799	0.860000	0.49131	6.876000	0.75556	1.228000	0.43614	0.491000	0.48974	CTG	-	HMMPfam_p450		0.428	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C19	protein_coding	OTTHUMT00000049490.1	T	NM_000769		96602522	1	no_errors	NM_000769	genbank	human	reviewed	54_36p	missense	SNP	1	A
BAG3	9531	genome.wustl.edu	37	10	121432113	121432113	+	Missense_Mutation	SNP	C	C	T	rs375650805		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:121432113C>T	ENST00000369085.3	+	3	1160	c.854C>T	c.(853-855)aCg>aTg	p.T285M		NM_004281.3	NP_004272.2	O95817	BAG3_HUMAN	BCL2-associated athanogene 3	285					brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of apoptotic process (GO:0043066)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|Z disc (GO:0030018)		p.T285M(1)		endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(5)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	20		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00187)|BRCA - Breast invasive adenocarcinoma(275;0.148)		AGGAGCAGCACGCCACTCCAC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		17941	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	10						C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	44.0	51.0	49.0		854	5.8	1.0	10		49	0,8600		0,0,4300	no	missense	BAG3	NM_004281.3	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	285/576	121432113	1,13005	2203	4300	6503	121422103	SO:0001583	missense	9531			AF095193	CCDS7615.1	10q25.2-q26.2	2014-09-17			ENSG00000151929	ENSG00000151929			939	protein-coding gene	gene with protein product		603883				9873016, 18094623	Standard	XM_005270287		Approved		uc001lem.3	O95817	OTTHUMG00000019155	ENST00000369085.3:c.854C>T	10.37:g.121432113C>T	ENSP00000358081:p.Thr285Met		121422103	A8K5L8|Q3B763|Q9NT20|Q9P120	Missense_Mutation	SNP	HMMPfam_WW;superfamily_WW domain;HMMPfam_BAG;superfamily_BAG domain	p.T285M	ENST00000369085.3	37	c.854	CCDS7615.1	10	.	.	.	.	.	.	.	.	.	.	C	14.01	2.407613	0.42715	2.27E-4	0.0	ENSG00000151929	ENST00000369085;ENST00000450186	T;T	0.74947	-0.79;-0.89	5.81	5.81	0.92471	.	0.301525	0.36665	N	0.002478	T	0.55924	0.1951	L	0.27053	0.805	0.09310	N	0.999999	P;P	0.36733	0.567;0.567	B;B	0.19666	0.026;0.026	T	0.56475	-0.7973	10	0.42905	T	0.14	-6.1024	11.2192	0.48844	0.1411:0.7226:0.1363:0.0	.	285;285	O95817;Q53GY1	BAG3_HUMAN;.	M	285;227	ENSP00000358081:T285M;ENSP00000410036:T227M	ENSP00000358081:T285M	T	+	2	0	BAG3	121422103	0.785000	0.28726	0.964000	0.40570	0.061000	0.15899	2.865000	0.48412	2.752000	0.94435	0.467000	0.42956	ACG	-	NULL		0.657	BAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG3	protein_coding	OTTHUMT00000050662.1	C	NM_004281		121422103	1	no_errors	NM_004281	genbank	human	reviewed	54_36p	missense	SNP	0.75	T
ZNF202	7753	genome.wustl.edu	37	11	123597493	123597493	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	C	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:123597493T>C	ENST00000529691.1	-	7	1378	c.1159A>G	c.(1159-1161)Aca>Gca	p.T387A	ZNF202_ENST00000530393.1_Missense_Mutation_p.T387A|ZNF202_ENST00000336139.4_Missense_Mutation_p.T387A			O95125	ZN202_HUMAN	zinc finger protein 202	387					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T387A(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TGGACGGGTGTAGTTTCCCGA	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											89.0	93.0	92.0					11																	123597493		2202	4299	6501	123102703	SO:0001583	missense	7753			AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.1159A>G	11.37:g.123597493T>C	ENSP00000433881:p.Thr387Ala		123102703	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_SCAN;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.T387A	ENST00000529691.1	37	c.1159	CCDS8443.1	11	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.498482	0.00157	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.06142	3.34;3.34;3.34	4.41	-1.12	0.09808	.	0.513863	0.18630	N	0.135608	T	0.02418	0.0074	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.45920	-0.9228	10	0.17369	T	0.5	-0.0948	5.007	0.14293	0.0:0.1769:0.2903:0.5327	.	387	O95125	ZN202_HUMAN	A	387	ENSP00000337724:T387A;ENSP00000432504:T387A;ENSP00000433881:T387A	ENSP00000337724:T387A	T	-	1	0	ZNF202	123102703	0.000000	0.05858	0.014000	0.15608	0.038000	0.13279	-2.289000	0.01149	0.006000	0.14734	0.533000	0.62120	ACA	-	NULL		0.438	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF202	protein_coding	OTTHUMT00000387419.1	T	NM_003455		123102703	-1	no_errors	NM_003455	genbank	human	validated	54_36p	missense	SNP	0.16	C
VSIG2	23584	genome.wustl.edu	37	11	124618354	124618354	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:124618354G>A	ENST00000326621.5	-	6	883	c.783C>T	c.(781-783)ttC>ttT	p.F261F	RP11-677M14.2_ENST00000531241.1_RNA|VSIG2_ENST00000403470.1_Silent_p.F261F	NM_014312.3	NP_055127.2	Q96IQ7	VSIG2_HUMAN	V-set and immunoglobulin domain containing 2	261						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.F261F(1)		central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(5)	19	all_hematologic(175;0.215)	Breast(109;0.00663)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0215)		TGACCAGGCAGAACGCAGCAA	0.607																																																1	Substitution - coding silent(1)	ovary(1)	11											108.0	96.0	100.0					11																	124618354		2201	4299	6500	124123564	SO:0001819	synonymous_variant	23584			AF061022	CCDS8452.1	11q24	2013-01-11			ENSG00000019102	ENSG00000019102		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	17149	protein-coding gene	gene with protein product		606011				9862345	Standard	NM_014312		Approved	CTXL, CTH	uc001qas.3	Q96IQ7	OTTHUMG00000150357	ENST00000326621.5:c.783C>T	11.37:g.124618354G>A			124123564	O95791|Q9NX42	Silent	SNP	-	p.F261	ENST00000326621.5	37	c.783	CCDS8452.1	11																																																																																			-	NULL		0.607	VSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG2	protein_coding	OTTHUMT00000317785.1	G	NM_014312		124123564	-1	no_errors	NM_014312	genbank	human	provisional	54_36p	silent	SNP	0.98	A
PAMR1	25891	genome.wustl.edu	37	11	35454023	35454023	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:35454023G>A	ENST00000378880.2	-	11	2489	c.2044C>T	c.(2044-2046)Cgc>Tgc	p.R682C	PAMR1_ENST00000278360.3_Missense_Mutation_p.R699C|PAMR1_ENST00000532848.1_Missense_Mutation_p.R642C|PAMR1_ENST00000378878.3_Missense_Mutation_p.R571C	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	682	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R699C(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						AGATGCCAGCGTGGCTCAGGA	0.572																																																1	Substitution - Missense(1)	ovary(1)	11											81.0	77.0	78.0					11																	35454023		2202	4298	6500	35410599	SO:0001583	missense	25891				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.2044C>T	11.37:g.35454023G>A	ENSP00000368158:p.Arg682Cys		35410599	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_Trypsin;HMMPfam_EGF;superfamily_Trypsin-like serine proteases;superfamily_EGF/Laminin;superfamily_Complement control module/SCR domain	p.R699C	ENST00000378880.2	37	c.2095	CCDS31460.1	11	.	.	.	.	.	.	.	.	.	.	G	13.19	2.161825	0.38217	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	D;D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33	5.34	3.35	0.38373	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.239569	0.41001	D	0.000971	D	0.94598	0.8259	M	0.83223	2.63	0.21878	N	0.999497	D;P;D	0.69078	0.997;0.895;0.963	P;B;B	0.50490	0.642;0.438;0.431	D	0.89524	0.3780	10	0.87932	D	0	.	13.3905	0.60821	0.0:0.0:0.5602:0.4398	.	571;682;699	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	C	699;682;571;642;659	ENSP00000278360:R699C;ENSP00000368158:R682C;ENSP00000368156:R571C;ENSP00000433868:R642C;ENSP00000432591:R659C	ENSP00000278360:R699C	R	-	1	0	PAMR1	35410599	0.270000	0.24152	0.190000	0.23270	0.379000	0.30106	2.232000	0.43018	1.374000	0.46228	0.561000	0.74099	CGC	-	HMMPfam_Trypsin		0.572	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKFZP586H2123	protein_coding	OTTHUMT00000389177.1	G	NM_015430		35410599	-1	no_errors	NM_015430	genbank	human	validated	54_36p	missense	SNP	0.08	A
TTC17	55761	genome.wustl.edu	37	11	43465707	43465707	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:43465707C>G	ENST00000039989.4	+	18	2627	c.2613C>G	c.(2611-2613)taC>taG	p.Y871*	TTC17_ENST00000299240.6_Nonsense_Mutation_p.Y928*|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	871					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.Y871*(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						GACATCGTTACCAAGCAAACC	0.403																																																1	Substitution - Nonsense(1)	ovary(1)	11											82.0	81.0	81.0					11																	43465707		2203	4300	6503	43422283	SO:0001587	stop_gained	55761			AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.2613C>G	11.37:g.43465707C>G	ENSP00000039989:p.Tyr871*		43422283	G3XAB3|Q8NEC0	Nonsense_Mutation	SNP	-	p.Y871*	ENST00000039989.4	37	c.2613	CCDS31466.1	11	.	.	.	.	.	.	.	.	.	.	C	38	6.675900	0.97755	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	.	.	.	5.9	4.81	0.61882	.	0.620040	0.18259	N	0.146704	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5234	14.2126	0.65773	0.0:0.9195:0.0:0.0805	.	.	.	.	X	928;871	.	ENSP00000039989:Y871X	Y	+	3	2	TTC17	43422283	0.994000	0.37717	0.991000	0.47740	0.977000	0.68977	1.936000	0.40183	2.798000	0.96311	0.650000	0.86243	TAC	-	NULL		0.403	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC17	protein_coding	OTTHUMT00000389577.2	C	NM_018259		43422283	1	no_errors	NM_018259	genbank	human	provisional	54_36p	nonsense	SNP	0.95	G
PSMC3	5702	genome.wustl.edu	37	11	47445638	47445638	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:47445638G>A	ENST00000298852.3	-	6	707	c.550C>T	c.(550-552)Caa>Taa	p.Q184*	PSMC3_ENST00000602866.1_Nonsense_Mutation_p.Q168*|PSMC3_ENST00000530912.1_Nonsense_Mutation_p.Q142*	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	184					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.Q184*(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TCACTGTATTGCTCCGTGGGC	0.562																																																1	Substitution - Nonsense(1)	ovary(1)	11											242.0	188.0	207.0					11																	47445638		2201	4298	6499	47402214	SO:0001587	stop_gained	5702			M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.550C>T	11.37:g.47445638G>A	ENSP00000298852:p.Gln184*		47402214	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Nonsense_Mutation	SNP	-	p.Q184*	ENST00000298852.3	37	c.550	CCDS7935.1	11	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702820	0.88924	.	.	ENSG00000165916	ENST00000298852;ENST00000530912;ENST00000531051;ENST00000530887;ENST00000530651;ENST00000527906	.	.	.	5.42	5.42	0.78866	.	0.110501	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-14.7155	19.2234	0.93808	0.0:0.0:1.0:0.0	.	.	.	.	X	184;142;128;149;149;149	.	ENSP00000298852:Q184X	Q	-	1	0	PSMC3	47402214	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.869000	0.99810	2.534000	0.85438	0.655000	0.94253	CAA	-	NULL		0.562	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMC3	protein_coding	OTTHUMT00000395660.2	G	NM_002804		47402214	-1	no_errors	NM_002804	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
Unknown	0	genome.wustl.edu	37	11	49007376	49007376	+	IGR	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:49007376A>G								OR4A47 (496044 upstream) : TRIM49B (43127 downstream)																							CCTGGAGTAAACGGGTTCTCA	0.423																																																0			11																																								48963952	SO:0001628	intergenic_variant	340970																															11.37:g.49007376A>G			48963952		RNA	SNP	-	NULL		37	NULL		11																																																																																			-	-	0	0.423					LOC340970			A			48963952	-1	pseudogene	XR_042351	genbank	human	model	54_36p	rna	SNP		G
OR5D18	219438	genome.wustl.edu	37	11	55587291	55587291	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:55587291T>G	ENST00000333976.4	+	1	206	c.186T>G	c.(184-186)ttT>ttG	p.F62L		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.F62L(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				CCATGTACTTTTTCCTCAGCC	0.423																																																1	Substitution - Missense(1)	ovary(1)	11											257.0	237.0	244.0					11																	55587291		2200	4296	6496	55343867	SO:0001583	missense	219438			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.186T>G	11.37:g.55587291T>G	ENSP00000335025:p.Phe62Leu		55343867	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	-	p.F62L	ENST00000333976.4	37	c.186	CCDS31510.1	11	.	.	.	.	.	.	.	.	.	.	.	14.79	2.641444	0.47153	.	.	ENSG00000186119	ENST00000333976	T	0.00551	6.65	4.94	1.28	0.21552	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40302	N	0.001140	T	0.00724	0.0024	M	0.74467	2.265	0.31498	N	0.665149	P	0.35872	0.525	B	0.36418	0.224	T	0.25187	-1.0139	10	0.62326	D	0.03	-37.1952	8.539	0.33382	0.0:0.441:0.0:0.559	.	62	Q8NGL1	OR5DI_HUMAN	L	62	ENSP00000335025:F62L	ENSP00000335025:F62L	F	+	3	2	OR5D18	55343867	0.159000	0.22864	0.999000	0.59377	0.998000	0.95712	-0.329000	0.07935	0.048000	0.15891	0.514000	0.50259	TTT	-	NULL		0.423	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D18	protein_coding	OTTHUMT00000391515.1	T	NM_001001952		55343867	1	no_errors	NM_001001952	genbank	human	provisional	54_36p	missense	SNP	0.96	G
MS4A4E	643680	genome.wustl.edu	37	11	59997397	59997397	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:59997397G>A	ENST00000528394.1	-	1	131	c.132C>T	c.(130-132)ccC>ccT	p.P44P	MS4A4E_ENST00000427611.2_Missense_Mutation_p.P20L|MS4A4E_ENST00000526086.1_Silent_p.P44P|MS4A4E_ENST00000398986.2_Silent_p.P44P|MS4A4E_ENST00000398984.2_Silent_p.P44P|MS4A4E_ENST00000425663.1_Silent_p.P44P			Q96PG1	M4A4E_HUMAN	membrane-spanning 4-domains, subfamily A, member 4E	44						integral component of membrane (GO:0016021)		p.P20L(1)		ovary(1)	1						CAAGGACTTTGGGTTTCCTCT	0.458																																																1	Substitution - Missense(1)	ovary(1)	11																																								59753973	SO:0001819	synonymous_variant	643680			AF354936		11q12.2	2012-04-20			ENSG00000214787	ENSG00000214787			14284	protein-coding gene	gene with protein product		608401				11486273	Standard	XM_005275707		Approved		uc001noy.2	Q96PG1	OTTHUMG00000167354	ENST00000528394.1:c.132C>T	11.37:g.59997397G>A			59753973	Q3C1W1|Q3C1W3|Q3C1W4	Missense_Mutation	SNP	-	p.P20L	ENST00000528394.1	37	c.59		11	.	.	.	.	.	.	.	.	.	.	g	6.458	0.452565	0.12283	.	.	ENSG00000214787	ENST00000427611	.	.	.	2.89	-0.306	0.12780	.	0.133303	0.50627	U	0.000110	T	0.41903	0.1179	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.12760	-1.0535	5	.	.	.	.	2.4422	0.04497	0.2834:0.0:0.4813:0.2353	.	.	.	.	L	20	.	.	P	-	2	0	MS4A4E	59753973	0.195000	0.23338	0.985000	0.45067	0.118000	0.20060	-0.622000	0.05553	-0.054000	0.13266	0.205000	0.17691	CCA	-	NULL		0.458	MS4A4E-003	NOVEL	basic|appris_candidate	protein_coding	LOC643680	protein_coding	OTTHUMT00000394290.1	G	XM_003119183		59753973	-1	no_errors	XM_931901	genbank	human	model	54_36p	missense	SNP	0.47	A
STIP1	10963	genome.wustl.edu	37	11	63961672	63961672	+	Silent	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:63961672A>G	ENST00000305218.4	+	3	378	c.231A>G	c.(229-231)cgA>cgG	p.R77R	STIP1_ENST00000543847.1_Silent_p.R77R|STIP1_ENST00000538945.1_Intron|STIP1_ENST00000358794.5_Silent_p.R124R|STIP1_ENST00000540501.1_3'UTR	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	77					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R77R(1)		endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						GCTATTCACGAAAAGCAGCAG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	11											121.0	125.0	124.0					11																	63961672		2201	4297	6498	63718248	SO:0001819	synonymous_variant	10963			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.231A>G	11.37:g.63961672A>G			63718248	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Silent	SNP	-	p.R77	ENST00000305218.4	37	c.231	CCDS8058.1	11																																																																																			-	NULL		0.413	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIP1	protein_coding	OTTHUMT00000396289.2	A	NM_006819		63718248	1	no_errors	NM_006819	genbank	human	validated	54_36p	silent	SNP	0.77	G
RELA	5970	genome.wustl.edu	37	11	65427643	65427643	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:65427643C>G	ENST00000406246.3	-	5	640	c.379G>C	c.(379-381)Gag>Cag	p.E127Q	RELA_ENST00000308639.9_Missense_Mutation_p.E127Q|RELA_ENST00000525693.1_Missense_Mutation_p.E127Q	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	127	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.E127Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						ATAGCCTGCTCCAGGTCCCGC	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											187.0	166.0	173.0					11																	65427643		2201	4297	6498	65184219	SO:0001583	missense	5970			Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.379G>C	11.37:g.65427643C>G	ENSP00000384273:p.Glu127Gln		65184219	Q6GTV1|Q6SLK1	Missense_Mutation	SNP	TIG;HMMPfam_TIG;RHD;HMMPfam_RHD	p.E127Q	ENST00000406246.3	37	c.379	CCDS31609.1	11	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447560	0.63178	.	.	ENSG00000173039	ENST00000406246;ENST00000525693;ENST00000308639;ENST00000426617;ENST00000545816;ENST00000532999;ENST00000534558;ENST00000527749;ENST00000532879	T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83	4.86	4.86	0.63082	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.307559	0.33712	N	0.004625	T	0.56217	0.1970	M	0.77103	2.36	0.42940	D	0.994349	P;P;P;P;P;P	0.48589	0.904;0.912;0.858;0.834;0.871;0.623	B;B;B;P;P;B	0.46685	0.379;0.314;0.157;0.448;0.524;0.338	T	0.61987	-0.6949	10	0.41790	T	0.15	-15.2576	15.4734	0.75458	0.0:1.0:0.0:0.0	.	127;114;127;127;138;127	Q04206-3;Q04206-2;Q04206-4;Q04206;B4E082;Q2TAM5	.;.;.;TF65_HUMAN;.;.	Q	127;127;127;127;138;138;118;96;127	ENSP00000384273:E127Q;ENSP00000432537:E127Q;ENSP00000311508:E127Q;ENSP00000433526:E138Q;ENSP00000434372:E118Q;ENSP00000436545:E96Q;ENSP00000431153:E127Q	ENSP00000311508:E127Q	E	-	1	0	RELA	65184219	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	2.792000	0.47837	2.245000	0.73994	0.455000	0.32223	GAG	-	HMMPfam_RHD		0.612	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELA	protein_coding	OTTHUMT00000390457.2	C	NM_021975		65184219	-1	no_errors	NM_021975	genbank	human	validated	54_36p	missense	SNP	1	G
RBM4	5936	genome.wustl.edu	37	11	66411583	66411583	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:66411583G>A	ENST00000409406.1	+	2	1852	c.1075G>A	c.(1075-1077)Gcg>Acg	p.A359T	RBM4_ENST00000310092.7_Missense_Mutation_p.A359T|RBM14-RBM4_ENST00000500635.2_Intron|RBM4_ENST00000514361.3_Missense_Mutation_p.A334T|RBM4_ENST00000506523.2_Intron|RBM4_ENST00000515838.2_3'UTR|RBM14-RBM4_ENST00000412278.2_Missense_Mutation_p.A334T|RBM4_ENST00000396053.4_Intron|RBM4_ENST00000530235.1_Intron|RBM4_ENST00000503028.2_Missense_Mutation_p.A359T|RBM4_ENST00000408993.2_Missense_Mutation_p.A359T|RBM4_ENST00000398692.4_Intron|RBM4_ENST00000578778.1_Intron			Q9BWF3	RBM4_HUMAN	RNA binding motif protein 4	359	Interaction with TNPO3.				cap-independent translational initiation (GO:0002190)|cell differentiation (GO:0030154)|circadian regulation of translation (GO:0097167)|entrainment of circadian clock by photoperiod (GO:0043153)|IRES-dependent translational initiation (GO:0002192)|mRNA processing (GO:0006397)|negative regulation of translation (GO:0017148)|negative regulation of translation in response to stress (GO:0032055)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of nucleocytoplasmic transport (GO:0046822)|response to arsenic-containing substance (GO:0046685)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|stress-activated MAPK cascade (GO:0051403)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	miRNA binding (GO:0035198)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|pre-mRNA intronic pyrimidine-rich binding (GO:0097158)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.A359T(1)		endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				Lung(977;0.0112)|LUSC - Lung squamous cell carcinoma(976;0.0266)		TGCCGATCGGGCGCGGTACTC	0.577																																																1	Substitution - Missense(1)	ovary(1)	11											48.0	52.0	51.0					11																	66411583		2047	4224	6271	66168159	SO:0001583	missense	5936			U89505	CCDS41676.1, CCDS55776.1, CCDS55777.1	11q13	2013-02-12			ENSG00000173933	ENSG00000173933		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	9901	protein-coding gene	gene with protein product		602571				9169144, 16260624	Standard	NM_002896		Approved	LARK, RBM4A, ZCRB3A, ZCCHC21		Q9BWF3	OTTHUMG00000154171	ENST00000409406.1:c.1075G>A	11.37:g.66411583G>A	ENSP00000386894:p.Ala359Thr		66168159	B3KUN0|B4E1U0|E7EQS3|O02916|Q4VC48|Q6P1P2|Q8WU85	Missense_Mutation	SNP	-	p.A359T	ENST00000409406.1	37	c.1075	CCDS41676.1	11	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442559	0.63067	.	.	ENSG00000248643;ENSG00000248643;ENSG00000248643;ENSG00000173933;ENSG00000173933;ENSG00000173933	ENST00000412278;ENST00000503028;ENST00000514361;ENST00000310092;ENST00000408993;ENST00000409406	T;T;T;T;T	0.51325	0.71;1.52;1.52;1.52;1.52	6.17	6.17	0.99709	.	0.224065	0.35838	U	0.002945	T	0.43188	0.1236	L	0.45581	1.43	0.32811	D	0.501438	B;B	0.26081	0.141;0.001	B;B	0.20955	0.032;0.001	T	0.49707	-0.8911	10	0.34782	T	0.22	-5.5939	16.3795	0.83443	0.0:0.0:1.0:0.0	.	334;359	B0LM41;Q9BWF3	.;RBM4_HUMAN	T	334;359;359;359;359;359	ENSP00000388552:A334T;ENSP00000425760:A359T;ENSP00000309166:A359T;ENSP00000386561:A359T;ENSP00000386894:A359T	ENSP00000388552:A334T	A	+	1	0	RBM4;RBM14-RBM4	66168159	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.720000	0.61944	2.941000	0.99782	0.655000	0.94253	GCG	-	NULL		0.577	RBM4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBM4	protein_coding	OTTHUMT00000334212.1	G	NM_002896		66168159	1	no_errors	NM_002896	genbank	human	validated	54_36p	missense	SNP	1	A
KDM2A	22992	genome.wustl.edu	37	11	67022386	67022386	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:67022386C>T	ENST00000529006.2	+	21	3795	c.3349C>T	c.(3349-3351)Cgc>Tgc	p.R1117C	KDM2A_ENST00000530342.1_Missense_Mutation_p.R678C|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_Missense_Mutation_p.R575C|KDM2A_ENST00000398645.2_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	1117					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.R1117C(1)		NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CTACCTACGGCGCATTGCCAA	0.493																																																1	Substitution - Missense(1)	ovary(1)	11											98.0	93.0	95.0					11																	67022386		2033	4202	6235	66778962	SO:0001583	missense	22992			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.3349C>T	11.37:g.67022386C>T	ENSP00000432786:p.Arg1117Cys		66778962	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	HMMPfam_LRR_1;HMMPfam_F-box;HMMPfam_zf-CXXC;superfamily_FYVE/PHD zinc finger;HMMPfam_JmjC;superfamily_Clavaminate synthase-like;superfamily_RNI-like	p.R1117C	ENST00000529006.2	37	c.3349	CCDS44657.1	11	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287384	0.80803	.	.	ENSG00000173120	ENST00000529006;ENST00000530342;ENST00000308783	T;T;T	0.47869	0.83;0.83;0.83	5.32	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.71634	0.3363	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.99	T	0.78319	-0.2250	10	0.87932	D	0	-15.4951	15.6786	0.77349	0.1375:0.8625:0.0:0.0	.	678;1117	E9PIL6;Q9Y2K7	.;KDM2A_HUMAN	C	1117;678;575	ENSP00000432786:R1117C;ENSP00000435776:R678C;ENSP00000309302:R575C	ENSP00000309302:R575C	R	+	1	0	KDM2A	66778962	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.864000	0.69575	1.445000	0.47624	0.655000	0.94253	CGC	-	NULL		0.493	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL11	protein_coding	OTTHUMT00000393140.2	C	NM_012308		66778962	1	no_errors	NM_012308	genbank	human	reviewed	54_36p	missense	SNP	1	T
SUV420H1	51111	genome.wustl.edu	37	11	67925530	67925530	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:67925530C>A	ENST00000304363.4	-	11	2636	c.2283G>T	c.(2281-2283)aaG>aaT	p.K761N		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	761					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)	p.K761N(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						CATTATTAAGCTTTGCTACAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	11											185.0	194.0	191.0					11																	67925530		2200	4294	6494	67682106	SO:0001583	missense	51111			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.2283G>T	11.37:g.67925530C>A	ENSP00000305899:p.Lys761Asn		67682106	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	HMMPfam_SET;superfamily_SET domain	p.K761N	ENST00000304363.4	37	c.2283	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996338	0.54147	.	.	ENSG00000110066	ENST00000304363	T	0.62105	0.05	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75566	-0.3273	10	0.87932	D	0	-29.0322	19.0025	0.92839	0.0:1.0:0.0:0.0	.	761	Q4FZB7	SV421_HUMAN	N	761	ENSP00000305899:K761N	ENSP00000305899:K761N	K	-	3	2	SUV420H1	67682106	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	3.678000	0.54627	2.507000	0.84556	0.313000	0.20887	AAG	-	NULL		0.368	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	protein_coding	OTTHUMT00000318319.1	C	NM_017635		67682106	-1	no_errors	NM_017635	genbank	human	reviewed	54_36p	missense	SNP	1	A
CREBZF	58487	genome.wustl.edu	37	11	85375255	85375255	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:85375255C>A	ENST00000527447.1	-	1	891	c.665G>T	c.(664-666)cGa>cTa	p.R222L	CREBZF_ENST00000534224.1_Intron|CREBZF_ENST00000398294.2_Missense_Mutation_p.R140L|CREBZF_ENST00000531515.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	222	Basic motif. {ECO:0000250}.|bZIP.				negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R222L(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				CTTCTTCAGTCGATTAAGGCG	0.667											OREG0021274	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(172;674 2044 9050 18334 41735)											1	Substitution - Missense(1)	ovary(1)	11											42.0	47.0	46.0					11																	85375255		1869	4070	5939	85052903	SO:0001583	missense	58487			AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.665G>T	11.37:g.85375255C>A	ENSP00000433459:p.Arg222Leu	1236	85052903	B2R8Q9|Q0P5U9|Q52LT3	Missense_Mutation	SNP	-	p.R222L	ENST00000527447.1	37	c.665	CCDS41697.1	11	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307408	0.81247	.	.	ENSG00000137504	ENST00000398294;ENST00000527447	D;D	0.94232	-3.38;-3.38	4.89	4.89	0.63831	Basic-leucine zipper (bZIP) transcription factor (1);bZIP transcription factor, bZIP-1 (1);	0.106439	0.35903	N	0.002915	D	0.96097	0.8728	M	0.67700	2.07	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.95563	0.8631	9	.	.	.	-27.8054	17.8796	0.88837	0.0:1.0:0.0:0.0	.	222	Q9NS37	ZHANG_HUMAN	L	140;222	ENSP00000381342:R140L;ENSP00000433459:R222L	.	R	-	2	0	CREBZF	85052903	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.111000	0.64628	2.542000	0.85734	0.655000	0.94253	CGA	-	NULL		0.667	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBZF	protein_coding	OTTHUMT00000390191.2	C	NM_001039618		85052903	-1	no_errors	NM_001039618	genbank	human	validated	54_36p	missense	SNP	1	A
GPR83	10888	genome.wustl.edu	37	11	94113378	94113378	+	Silent	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:94113378G>T	ENST00000243673.2	-	4	1380	c.1209C>A	c.(1207-1209)acC>acA	p.T403T	GPR83_ENST00000539203.2_Silent_p.T361T	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	403					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)	p.T403T(1)		NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GGAGTTGGGAGGTGGGCAGGA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	11											67.0	70.0	69.0					11																	94113378		2201	4298	6499	93753026	SO:0001819	synonymous_variant	10888			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.1209C>A	11.37:g.94113378G>T			93753026	B0M0K5|Q6NWR4|Q9P1Y8	Silent	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.T403	ENST00000243673.2	37	c.1209	CCDS8297.1	11																																																																																			-	NULL		0.577	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	protein_coding	OTTHUMT00000396232.1	G	NM_016540		93753026	-1	no_errors	NM_016540	genbank	human	validated	54_36p	silent	SNP	0.93	T
ST14	6768	genome.wustl.edu	37	11	130070005	130070005	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr11:130070005A>C	ENST00000278742.5	+	16	2385	c.1967A>C	c.(1966-1968)cAc>cCc	p.H656P		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	656	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.H656P(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	TCTGCCGCACACTGCTACATC	0.612																																																1	Substitution - Missense(1)	ovary(1)	11											58.0	46.0	50.0					11																	130070005		2201	4297	6498	129575215	SO:0001583	missense	6768			AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.1967A>C	11.37:g.130070005A>C	ENSP00000278742:p.His656Pro		129575215	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	HMMPfam_SEA;HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_Trypsin;HMMPfam_Ldl_recept_a;superfamily_Trypsin-like serine proteases;superfamily_LDL receptor-like module;superfamily_SEA domain	p.H656P	ENST00000278742.5	37	c.1967	CCDS8487.1	11	.	.	.	.	.	.	.	.	.	.	A	16.24	3.066265	0.55539	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	D	0.95724	-3.79	5.52	5.52	0.82312	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.39615	N	0.001318	D	0.98767	0.9585	H	0.98738	4.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99552	1.0966	10	0.87932	D	0	.	15.3011	0.73952	1.0:0.0:0.0:0.0	.	656	Q9Y5Y6	ST14_HUMAN	P	656;558	ENSP00000278742:H656P	ENSP00000278742:H656P	H	+	2	0	ST14	129575215	1.000000	0.71417	0.991000	0.47740	0.027000	0.11550	9.290000	0.96065	2.101000	0.63845	0.533000	0.62120	CAC	-	HMMPfam_Trypsin		0.612	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST14	protein_coding	OTTHUMT00000386119.1	A			129575215	1	no_errors	NM_021978	genbank	human	reviewed	54_36p	missense	SNP	1	C
SSH1	54434	genome.wustl.edu	37	12	109192923	109192923	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:109192923G>A	ENST00000326495.5	-	13	1295	c.1202C>T	c.(1201-1203)gCc>gTc	p.A401V	SSH1_ENST00000360239.3_Missense_Mutation_p.A89V|SSH1_ENST00000326470.5_Missense_Mutation_p.A412V|SSH1_ENST00000551165.1_Missense_Mutation_p.A401V	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	401	Tyrosine-protein phosphatase.				actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A401V(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GACTGTGGAGGCCGAGCGACT	0.557																																																1	Substitution - Missense(1)	ovary(1)	12											58.0	54.0	55.0					12																	109192923		2203	4300	6503	107717052	SO:0001583	missense	54434			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1202C>T	12.37:g.109192923G>A	ENSP00000315713:p.Ala401Val		107717052	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	-	p.A401V	ENST00000326495.5	37	c.1202	CCDS9121.1	12	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685092	0.68157	.	.	ENSG00000084112	ENST00000360239;ENST00000326495;ENST00000551165;ENST00000326470	T;T;T;T	0.64991	1.38;-0.13;-0.13;-0.13	5.27	5.27	0.74061	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.77363	0.4119	L	0.60012	1.86	0.58432	D	0.999999	D;D;D;D	0.89917	0.996;1.0;1.0;1.0	D;D;D;D	0.97110	0.946;1.0;0.982;0.996	T	0.77059	-0.2728	10	0.51188	T	0.08	-20.0765	19.2929	0.94110	0.0:0.0:1.0:0.0	.	412;401;401;89	Q8WYL5-5;Q8WYL5-2;Q8WYL5;Q8WYL5-4	.;.;SSH1_HUMAN;.	V	89;401;401;412	ENSP00000353374:A89V;ENSP00000315713:A401V;ENSP00000448824:A401V;ENSP00000326107:A412V	ENSP00000326107:A412V	A	-	2	0	SSH1	107717052	1.000000	0.71417	0.206000	0.23566	0.047000	0.14425	8.004000	0.88535	2.636000	0.89361	0.655000	0.94253	GCC	-	NULL		0.557	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	protein_coding	OTTHUMT00000403724.1	G	NM_018984		107717052	-1	no_errors	NM_018984	genbank	human	provisional	54_36p	missense	SNP	0.98	A
NOS1	4842	genome.wustl.edu	37	12	117693815	117693815	+	Silent	SNP	G	G	T	rs78210735	byFrequency	TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:117693815G>T	ENST00000338101.4	-	16	2563	c.2559C>A	c.(2557-2559)ccC>ccA	p.P853P	NOS1_ENST00000317775.6_Intron|NOS1_ENST00000344089.3_Intron			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GCCCTTTACGGGGAAAGAAAC	0.597													G|||	12	0.00239617	0.0	0.0	5008	,	,		18542	0.0119		0.0	False		,,,				2504	0.0				Esophageal Squamous(162;1748 2599 51982 52956)											0			12											153.0	139.0	143.0					12																	117693815		876	1991	2867	116178198	SO:0001819	synonymous_variant	4842				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2559C>A	12.37:g.117693815G>T			116178198		Silent	SNP	-	p.P853	ENST00000338101.4	37	c.2559	CCDS55890.1	12																																																																																			-	NULL		0.597	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	protein_coding	OTTHUMT00000268053.1	G			116178198	-1	no_errors	ENST00000338101	ensembl	human	known	54_36p	silent	SNP	1	T
CCDC64	92558	genome.wustl.edu	37	12	120518690	120518690	+	Splice_Site	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:120518690G>C	ENST00000397558.2	+	7	1308		c.e7-1		CCDC64_ENST00000257583.4_Splice_Site|CCDC64_ENST00000446727.2_Splice_Site	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64						Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)	p.?(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCTCCTGTTAGGTGACACTGC	0.517																																																1	Unknown(1)	ovary(1)	12											59.0	60.0	60.0					12																	120518690		2003	4179	6182	119003073	SO:0001630	splice_region_variant	92558			U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1309-1G>C	12.37:g.120518690G>C			119003073	A8MUC8|B4DWL0|B5MDJ0|O95000	Splice_Site	SNP	-	e7-1	ENST00000397558.2	37	c.1309-1	CCDS41845.1	12	.	.	.	.	.	.	.	.	.	.	G	16.40	3.111738	0.56398	.	.	ENSG00000135127	ENST00000397558;ENST00000446727;ENST00000548673;ENST00000257583	.	.	.	5.45	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1713	0.65512	0.0719:0.0:0.9281:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC64	119003073	1.000000	0.71417	0.987000	0.45799	0.866000	0.49608	9.338000	0.96553	1.312000	0.45043	-0.136000	0.14681	.	-	-		0.517	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	CCDC64	protein_coding	OTTHUMT00000403390.2	G	NM_207311	Intron	119003073	1	no_errors	NM_207311	genbank	human	validated	54_36p	splice_site	SNP	1	C
CCDC62	84660	genome.wustl.edu	37	12	123290717	123290717	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:123290717G>A	ENST00000253079.6	+	10	2070	c.1726G>A	c.(1726-1728)Gat>Aat	p.D576N	CCDC62_ENST00000392441.4_Missense_Mutation_p.D576N|CCDC62_ENST00000392440.2_Missense_Mutation_p.D337N|CCDC62_ENST00000537566.1_Missense_Mutation_p.D337N	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	576					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)	p.D576N(1)		breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		TGCCATCCAAGATTCCCACTC	0.343																																																1	Substitution - Missense(1)	ovary(1)	12											85.0	86.0	86.0					12																	123290717		2203	4300	6503	121856670	SO:0001583	missense	84660				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.1726G>A	12.37:g.123290717G>A	ENSP00000253079:p.Asp576Asn		121856670	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	-	p.D576N	ENST00000253079.6	37	c.1726	CCDS9238.1	12	.	.	.	.	.	.	.	.	.	.	G	8.149	0.786962	0.16189	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	4.31	3.41	0.39046	.	0.469283	0.17987	N	0.155350	T	0.39436	0.1078	N	0.14661	0.345	0.19300	N	0.999973	B;B;B	0.27732	0.003;0.187;0.058	B;B;B	0.28011	0.001;0.085;0.025	T	0.20306	-1.0279	10	0.07644	T	0.81	-4.1605	10.1583	0.42836	0.0:0.7834:0.2166:0.0	.	576;337;576	Q6P9F0-2;Q6P9F0-3;Q6P9F0	.;.;CCD62_HUMAN	N	576;576;337;337	ENSP00000253079:D576N;ENSP00000376236:D576N;ENSP00000445045:D337N;ENSP00000376235:D337N	ENSP00000253079:D576N	D	+	1	0	CCDC62	121856670	0.211000	0.23529	0.521000	0.27850	0.874000	0.50279	1.736000	0.38187	1.157000	0.42530	-0.344000	0.07964	GAT	-	NULL		0.343	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC62	protein_coding	OTTHUMT00000400930.1	G	NM_032573		121856670	1	no_errors	NM_201435	genbank	human	validated	54_36p	missense	SNP		A
DNAH10	196385	genome.wustl.edu	37	12	124289498	124289498	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:124289498C>A	ENST00000409039.3	+	17	2569	c.2544C>A	c.(2542-2544)caC>caA	p.H848Q		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	848	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.H666Q(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGGTCGTCCACACCAACACAG	0.517																																																1	Substitution - Missense(1)	ovary(1)	12											96.0	93.0	94.0					12																	124289498		2203	4300	6503	122855451	SO:0001583	missense	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.2544C>A	12.37:g.124289498C>A	ENSP00000386770:p.His848Gln		122855451	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	-	p.H666Q	ENST00000409039.3	37	c.1998	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	14.09	2.431871	0.43122	.	.	ENSG00000197653	ENST00000409039	T	0.20332	2.08	5.42	2.51	0.30379	.	0.235114	0.26069	N	0.026537	T	0.16727	0.0402	M	0.65975	2.015	0.31774	N	0.63179	B;B;B	0.26672	0.156;0.097;0.016	B;B;B	0.27500	0.08;0.037;0.017	T	0.09885	-1.0654	10	0.10902	T	0.67	.	3.6225	0.08101	0.0:0.4998:0.217:0.2832	.	848;723;848	Q8IVF4-2;C4IXU6;Q8IVF4	.;.;DYH10_HUMAN	Q	848	ENSP00000386770:H848Q	ENSP00000386770:H848Q	H	+	3	2	DNAH10	122855451	0.015000	0.18098	1.000000	0.80357	0.953000	0.61014	-0.436000	0.06922	1.247000	0.43917	0.549000	0.68633	CAC	-	NULL		0.517	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	C			122855451	1	no_errors	NM_207437	genbank	human	validated	54_36p	missense	SNP	0.98	A
WNK1	65125	genome.wustl.edu	37	12	988974	988974	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:988974C>T	ENST00000315939.6	+	11	3252	c.2609C>T	c.(2608-2610)aCt>aTt	p.T870I	WNK1_ENST00000530271.2_Missense_Mutation_p.T1368I|WNK1_ENST00000537687.1_Intron|WNK1_ENST00000535572.1_Intron|WNK1_ENST00000340908.4_Missense_Mutation_p.T463I	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	870					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.T870I(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GCTGGCATTACTCAGCCTCTG	0.532																																					Colon(19;451 567 6672 12618 28860)											1	Substitution - Missense(1)	ovary(1)	12											164.0	136.0	145.0					12																	988974		2203	4300	6503	859235	SO:0001583	missense	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.2609C>T	12.37:g.988974C>T	ENSP00000313059:p.Thr870Ile		859235	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.T870I	ENST00000315939.6	37	c.2609	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	C	9.224	1.034152	0.19590	.	.	ENSG00000060237	ENST00000315939;ENST00000530271;ENST00000340908;ENST00000535698	T;T;T;T	0.16597	2.33;2.33;2.33;2.33	5.75	0.691	0.18045	.	0.377586	0.25114	N	0.033031	T	0.06462	0.0166	N	0.08118	0	0.22819	N	0.998694	B	0.09022	0.002	B	0.04013	0.001	T	0.38112	-0.9676	10	0.18276	T	0.48	-3.875	5.4671	0.16650	0.5332:0.2662:0.2006:0.0	.	870	Q9H4A3	WNK1_HUMAN	I	870;1368;463;140	ENSP00000313059:T870I;ENSP00000433548:T1368I;ENSP00000341292:T463I;ENSP00000439552:T140I	ENSP00000313059:T870I	T	+	2	0	WNK1	859235	0.974000	0.33945	0.973000	0.42090	0.888000	0.51559	0.337000	0.19841	-0.114000	0.11936	-0.474000	0.04947	ACT	-	NULL		0.532	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	C	NM_018979		859235	1	no_errors	NM_018979	genbank	human	validated	54_36p	missense	SNP	0.99	T
ERC1	23085	genome.wustl.edu	37	12	1553751	1553751	+	Silent	SNP	T	T	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:1553751T>G	ENST00000397203.2	+	18	3454	c.3048T>G	c.(3046-3048)ctT>ctG	p.L1016L	ERC1_ENST00000589028.1_Silent_p.L1016L|ERC1_ENST00000546231.2_Silent_p.L1020L|ERC1_ENST00000360905.4_Silent_p.L1016L|ERC1_ENST00000543086.3_Silent_p.L988L|ERC1_ENST00000355446.5_Silent_p.L1016L			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	1016					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)	p.L1016L(1)		NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TCTTAGAACTTGACCAAAATA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	12											65.0	74.0	71.0					12																	1553751		2203	4300	6503	1424012	SO:0001819	synonymous_variant	23085			AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.3048T>G	12.37:g.1553751T>G			1424012	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Silent	SNP	superfamily_Prefoldin;superfamily_lambda repressor-like DNA-binding domains	p.L1016	ENST00000397203.2	37	c.3048	CCDS8508.1	12																																																																																			-	NULL		0.398	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC1	protein_coding	OTTHUMT00000398380.2	T	NM_015064		1424012	1	no_errors	NM_178040	genbank	human	reviewed	54_36p	silent	SNP	1	G
CACNA1C	775	genome.wustl.edu	37	12	2224552	2224552	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:2224552C>A	ENST00000347598.4	+	2	212	c.212C>A	c.(211-213)gCg>gAg	p.A71E	CACNA1C_ENST00000399591.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000406454.3_Missense_Mutation_p.A71E|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000480911.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A71E|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000335762.5_Missense_Mutation_p.A71E|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399655.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A71E|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A71E|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A71E|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A71E	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	71					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.A101E(1)		NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTGGCAATGCGACCATCTCC	0.692																																																1	Substitution - Missense(1)	ovary(1)	12																																								2094813	SO:0001583	missense	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.212C>A	12.37:g.2224552C>A	ENSP00000266376:p.Ala71Glu		2094813	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	HMMPfam_Ion_trans;HMMPfam_Ca_chan_IQ;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.A71E	ENST00000347598.4	37	c.212	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	C	18.49	3.636334	0.67130	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96200	-3.88;-3.87;-3.9;-3.87;-3.87;-3.87;-3.89;-3.78;-3.83;-3.88;-3.78;-3.78;-3.88;-3.92;-3.79;-3.72;-3.94;-3.89;-3.87;-3.91;-3.81;-3.91;-3.94	5.58	5.58	0.84498	.	0.305040	0.25433	N	0.030703	D	0.95063	0.8401	L	0.29908	0.895	0.48452	D	0.999653	P;P;B;B;B;P;P;B;P;D;P;P;B;D;B;B;D;B;P;P	0.63046	0.667;0.667;0.003;0.364;0.212;0.667;0.553;0.16;0.853;0.992;0.667;0.553;0.113;0.992;0.003;0.212;0.992;0.212;0.667;0.667	P;B;B;B;B;B;B;B;P;P;B;B;B;P;B;B;P;B;B;B	0.56216	0.452;0.231;0.012;0.333;0.285;0.231;0.357;0.278;0.586;0.794;0.231;0.378;0.123;0.794;0.028;0.127;0.794;0.285;0.231;0.231	D	0.94028	0.7298	9	.	.	.	.	19.5768	0.95447	0.0:1.0:0.0:0.0	.	71;71;71;71;71;71;71;71;71;71;71;71;71;71;71;71;71;71;71;71	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-11;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	E	71	ENSP00000336982:A71E;ENSP00000382563:A71E;ENSP00000437936:A71E;ENSP00000382552:A71E;ENSP00000382547:A71E;ENSP00000382506:A71E;ENSP00000382530:A71E;ENSP00000382546:A71E;ENSP00000382500:A71E;ENSP00000382549:A71E;ENSP00000266376:A71E;ENSP00000382515:A71E;ENSP00000382510:A71E;ENSP00000341092:A71E;ENSP00000382537:A71E;ENSP00000329877:A71E;ENSP00000382557:A71E;ENSP00000385724:A71E;ENSP00000382512:A71E;ENSP00000382542:A71E;ENSP00000382526:A71E;ENSP00000385896:A71E;ENSP00000382504:A71E	.	A	+	2	0	CACNA1C	2094813	0.999000	0.42202	0.027000	0.17364	0.115000	0.19883	6.089000	0.71384	2.627000	0.88993	0.555000	0.69702	GCG	-	NULL		0.692	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	protein_coding	OTTHUMT00000317035.1	C	NM_000719		2094813	1	no_errors	NM_000719	genbank	human	reviewed	54_36p	missense	SNP	0.96	A
CLEC4D	338339	genome.wustl.edu	37	12	8672897	8672898	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	TG	TG	TG	GT	TG	TG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:8672897_8672898TG>GT	ENST00000299665.2	+	5	653_654	c.460_461TG>GT	c.(460-462)TGg>GTg	p.W154V		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	154	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					CAAAGGTCAGTGGCGTTGGGTG	0.396																																																0			12																																								8564165	SO:0001583	missense	338339			AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		Exception_encountered	12.37:g.8672897_8672898delinsGT	ENSP00000299665:p.Trp154Val		8564164	Q8N5J5	Missense_Mutation	DNP	HMMPfam_Lectin_C;superfamily_C-type lectin-like	p.W154V	ENST00000299665.2	37	c.460_461	CCDS8593.1	12																																																																																			-	HMMPfam_Lectin_C		0.396	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4D	protein_coding	OTTHUMT00000400565.1	TG	NM_080387		8564165	1	no_errors	NM_080387	genbank	human	reviewed	54_36p	missense	DNP	0.853:0.839	GT
MGP	4256	genome.wustl.edu	37	12	15035113	15035113	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:15035113G>A	ENST00000539261.1	-	4	406	c.272C>T	c.(271-273)gCc>gTc	p.A91V	MGP_ENST00000228938.5_Missense_Mutation_p.A116V|C12orf60_ENST00000527783.1_Intron	NM_000900.3	NP_000891.2	P08493	MGP_HUMAN	matrix Gla protein	91	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|ossification (GO:0001503)|regulation of bone mineralization (GO:0030500)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|structural constituent of bone (GO:0008147)	p.A91V(1)		large_intestine(1)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	7						GCGATTATAGGCAGCATTGTA	0.478																																																1	Substitution - Missense(1)	ovary(1)	12											141.0	138.0	139.0					12																	15035113		2203	4300	6503	14926380	SO:0001583	missense	4256			M58549	CCDS8669.1, CCDS53752.1	12p12.3	2006-12-15			ENSG00000111341	ENSG00000111341			7060	protein-coding gene	gene with protein product		154870				2394711	Standard	NM_000900		Approved		uc021qvr.1	P08493	OTTHUMG00000168740	ENST00000539261.1:c.272C>T	12.37:g.15035113G>A	ENSP00000445907:p.Ala91Val		14926380	A0M8W5|B2R519|J3KMX7|Q2TU41|Q567P9|Q6ICN5	Missense_Mutation	SNP	HMMPfam_Gla;superfamily_GLA-domain	p.A91V	ENST00000539261.1	37	c.272	CCDS8669.1	12	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401200	0.83120	.	.	ENSG00000111341	ENST00000539261;ENST00000228938	D;D	0.99557	-6.16;-6.16	5.13	5.13	0.70059	Gamma-carboxyglutamic acid-rich (GLA) domain (5);	0.000000	0.85682	D	0.000000	D	0.99569	0.9845	M	0.83384	2.64	0.53688	D	0.999975	D	0.76494	0.999	D	0.87578	0.998	D	0.97898	1.0301	10	0.87932	D	0	-9.5041	14.2721	0.66157	0.0:0.0:1.0:0.0	.	91	P08493	MGP_HUMAN	V	91;116	ENSP00000445907:A91V;ENSP00000228938:A116V	ENSP00000228938:A116V	A	-	2	0	MGP	14926380	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	5.201000	0.65163	2.826000	0.97356	0.655000	0.94253	GCC	-	HMMPfam_Gla		0.478	MGP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGP	protein_coding	OTTHUMT00000400864.1	G	NM_000900		14926380	-1	no_errors	NM_000900	genbank	human	validated	54_36p	missense	SNP	1	A
LRRK2	120892	genome.wustl.edu	37	12	40745425	40745425	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:40745425G>T	ENST00000298910.7	+	44	6524	c.6466G>T	c.(6466-6468)Gtt>Ttt	p.V2156F		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2156					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.V2156F(1)|p.V2163F(1)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGAATGCATGGTTGCTACACA	0.408																																																2	Substitution - Missense(2)	ovary(2)	12											89.0	89.0	89.0					12																	40745425		2203	4300	6503	39031692	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6466G>T	12.37:g.40745425G>T	ENSP00000298910:p.Val2156Phe		39031692	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Ankyrin repeat;superfamily_Protein kinase-like (PK-like);superfamily_WD40 repeat-like;superfamily_ARM repeat;superfamily_L domain-like;superfamily_P-loop containing nucleoside triphosphate hydrolases;Pkinase;LRR_1;HMMPfam_LRR_1;LRR_2;HMMPfam_LRR_2;Miro;HMMPfam_Miro	p.V2156F	ENST00000298910.7	37	c.6466	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196305	0.38806	.	.	ENSG00000188906	ENST00000298910	T	0.72725	-0.68	6.06	4.24	0.50183	.	0.469985	0.25200	N	0.032398	T	0.70307	0.3209	L	0.53249	1.67	0.47511	D	0.999444	P;P	0.39717	0.684;0.684	B;P	0.44561	0.352;0.453	T	0.73839	-0.3856	10	0.72032	D	0.01	.	12.1366	0.53974	0.1364:0.0:0.8636:0.0	.	2156;2156	Q17RV3;Q5S007	.;LRRK2_HUMAN	F	2156	ENSP00000298910:V2156F	ENSP00000298910:V2156F	V	+	1	0	LRRK2	39031692	1.000000	0.71417	0.998000	0.56505	0.033000	0.12548	4.889000	0.63171	1.579000	0.49836	0.655000	0.94253	GTT	-	NULL		0.408	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	G	XM_058513		39031692	1	no_errors	NM_198578	genbank	human	reviewed	54_36p	missense	SNP	1	T
LIMA1	51474	genome.wustl.edu	37	12	50642510	50642510	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:50642510G>A	ENST00000341247.4	-	2	174	c.25C>T	c.(25-27)Cgg>Tgg	p.R9W	LIMA1_ENST00000394943.3_Missense_Mutation_p.R9W	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	9					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)	p.R9W(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						GTCCATTGCCGTCTATTAAAT	0.383																																																1	Substitution - Missense(1)	ovary(1)	12											169.0	150.0	157.0					12																	50642510		2203	4300	6503	48928777	SO:0001583	missense	51474			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.25C>T	12.37:g.50642510G>A	ENSP00000340184:p.Arg9Trp		48928777	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	-	p.R9W	ENST00000341247.4	37	c.25	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665585	0.67700	.	.	ENSG00000050405	ENST00000394943;ENST00000341247;ENST00000551691;ENST00000550592	D;T	0.86164	-2.08;-1.34	4.7	4.7	0.59300	.	0.276630	0.33670	N	0.004665	D	0.88731	0.6516	L	0.56769	1.78	0.80722	D	1	D;D	0.76494	0.998;0.999	P;P	0.54889	0.549;0.763	D	0.89081	0.3476	10	0.66056	D	0.02	-6.9825	11.1139	0.48249	0.0:0.0:0.815:0.185	.	18;9	Q59FE8;Q9UHB6	.;LIMA1_HUMAN	W	9	ENSP00000378400:R9W;ENSP00000340184:R9W	ENSP00000340184:R9W	R	-	1	2	LIMA1	48928777	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.491000	0.53252	2.547000	0.85894	0.655000	0.94253	CGG	-	NULL		0.383	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	protein_coding	OTTHUMT00000406235.2	G	NM_016357		48928777	-1	no_errors	NM_016357	genbank	human	validated	54_36p	missense	SNP	1	A
KRT74	121391	genome.wustl.edu	37	12	52962018	52962018	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:52962018G>A	ENST00000305620.2	-	7	1337	c.1290C>T	c.(1288-1290)agC>agT	p.S430S	KRT74_ENST00000549343.1_Silent_p.S444S	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	430	Coil 2.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)	p.S430S(1)		kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		CCAGTTTCAGGCTCATGAGCT	0.637																																																1	Substitution - coding silent(1)	ovary(1)	12											98.0	89.0	92.0					12																	52962018		2203	4300	6503	51248285	SO:0001819	synonymous_variant	121391			BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.1290C>T	12.37:g.52962018G>A			51248285	B5MD61|Q86Y45	Silent	SNP	HMMPfam_Filament;superfamily_Ferritin-like	p.S430	ENST00000305620.2	37	c.1290	CCDS8832.1	12																																																																																			-	HMMPfam_Filament		0.637	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT74	protein_coding	OTTHUMT00000405324.1	G	NM_175053		51248285	-1	no_errors	NM_175053	genbank	human	validated	54_36p	silent	SNP	0.84	A
STAT2	6773	genome.wustl.edu	37	12	56745160	56745160	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:56745160A>G	ENST00000314128.4	-	9	880	c.857T>C	c.(856-858)gTt>gCt	p.V286A	STAT2_ENST00000557235.1_Missense_Mutation_p.V282A|STAT2_ENST00000418572.2_Missense_Mutation_p.V282A|RNU7-40P_ENST00000516397.1_RNA|STAT2_ENST00000556539.1_5'Flank			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	286					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.V286A(1)		NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						CTGATAGCTAACCAGGCAACT	0.547																																																1	Substitution - Missense(1)	ovary(1)	12											232.0	204.0	213.0					12																	56745160		2203	4300	6503	55031427	SO:0001583	missense	6773			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.857T>C	12.37:g.56745160A>G	ENSP00000315768:p.Val286Ala		55031427	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_Transcription factor STAT-4 N-domain;superfamily_STAT;superfamily_SH2 domain;HMMPfam_STAT_bind;SH2;HMMPfam_SH2;STAT_int;HMMPfam_STAT_int;STAT_alpha;HMMPfam_STAT_alpha;STAT_bind	p.V286A	ENST00000314128.4	37	c.857	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	A	19.13	3.768676	0.69878	.	.	ENSG00000170581	ENST00000314128;ENST00000557235;ENST00000418572	T;T;T	0.60672	0.17;0.17;0.17	4.39	4.39	0.52855	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.308881	0.31577	N	0.007402	T	0.62514	0.2434	M	0.69823	2.125	0.09310	N	0.999998	P;B;P	0.48834	0.916;0.08;0.78	P;B;B	0.48334	0.574;0.096;0.415	T	0.61262	-0.7098	10	0.87932	D	0	-6.4869	11.5275	0.50588	1.0:0.0:0.0:0.0	.	282;282;286	B4DLC8;G3V2M6;P52630	.;.;STAT2_HUMAN	A	286;282;282	ENSP00000315768:V286A;ENSP00000450751:V282A;ENSP00000387354:V282A	ENSP00000315768:V286A	V	-	2	0	STAT2	55031427	0.304000	0.24472	0.038000	0.18304	0.078000	0.17371	5.211000	0.65219	1.991000	0.58162	0.377000	0.23210	GTT	-	HMMPfam_STAT_alpha		0.547	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	protein_coding	OTTHUMT00000410277.1	A	NM_005419		55031427	-1	no_errors	NM_005419	genbank	human	reviewed	54_36p	missense	SNP	0.04	G
LRP1	4035	genome.wustl.edu	37	12	57571280	57571280	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:57571280C>T	ENST00000243077.3	+	26	4733	c.4267C>T	c.(4267-4269)Cgc>Tgc	p.R1423C		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1423					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)	p.R1423C(1)		NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGGGGCTGGGCGCCGCACCGT	0.667																																																1	Substitution - Missense(1)	ovary(1)	12											35.0	36.0	36.0					12																	57571280		2203	4299	6502	55857547	SO:0001583	missense	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.4267C>T	12.37:g.57571280C>T	ENSP00000243077:p.Arg1423Cys		55857547	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	HMMPfam_Ldl_recept_b,HMMPfam_Ldl_recept_a,HMMPfam_EGF,HMMPfam_EGF_CA,superfamily_EGF/Laminin,superfamily_LDL receptor-like module,superfamily_YWTD domain	p.R1423C	ENST00000243077.3	37	c.4267	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	16.92	3.254792	0.59212	.	.	ENSG00000123384	ENST00000243077	D	0.97665	-4.48	5.14	5.14	0.70334	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000002	D	0.98985	0.9654	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.99379	1.0922	10	0.87932	D	0	.	17.5443	0.87857	0.0:1.0:0.0:0.0	.	1423	Q07954	LRP1_HUMAN	C	1423	ENSP00000243077:R1423C	ENSP00000243077:R1423C	R	+	1	0	LRP1	55857547	0.989000	0.36119	0.997000	0.53966	0.918000	0.54935	2.482000	0.45224	2.689000	0.91719	0.462000	0.41574	CGC	-	HMMPfam_Ldl_recept_b		0.667	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	C	NM_002332		55857547	1	no_errors	NM_002332	genbank	human	validated	54_36p	missense	SNP	0.615	T
RAB3IP	117177	genome.wustl.edu	37	12	70133640	70133640	+	Missense_Mutation	SNP	A	A	C	rs554097102	byFrequency	TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:70133640A>C	ENST00000550536.1	+	1	471	c.14A>C	c.(13-15)aAg>aCg	p.K5T	RP11-588G21.2_ENST00000501300.1_RNA|RAB3IP_ENST00000325555.9_Intron|RAB3IP_ENST00000483530.2_Intron|RAB3IP_ENST00000362025.5_Missense_Mutation_p.K5T|RAB3IP_ENST00000247833.7_Intron|RP11-588G21.2_ENST00000501387.1_RNA|RAB3IP_ENST00000378815.6_Intron	NM_001278402.1|NM_175623.2	NP_001265331.1|NP_783322.1			RAB3A interacting protein									p.K5T(1)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22	Esophageal squamous(21;0.187)		Lung(24;0.000381)|OV - Ovarian serous cystadenocarcinoma(12;0.00168)|STAD - Stomach adenocarcinoma(21;0.00694)			GGATTAAAAAAGATGAAAGGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	12											151.0	140.0	144.0					12																	70133640		2202	4300	6502	68419907	SO:0001583	missense	117177				CCDS8993.1, CCDS8995.1, CCDS8996.1, CCDS41811.1, CCDS44942.1	12q15	2013-01-22	2013-01-22		ENSG00000127328	ENSG00000127328			16508	protein-coding gene	gene with protein product	"""rabin3"""	608686					Standard	NM_175623		Approved	RABIN3	uc001svm.3	Q96QF0	OTTHUMG00000169437	ENST00000550536.1:c.14A>C	12.37:g.70133640A>C	ENSP00000447300:p.Lys5Thr		68419907		Missense_Mutation	SNP	-	p.K5T	ENST00000550536.1	37	c.14	CCDS8993.1	12	.	.	.	.	.	.	.	.	.	.	A	7.754	0.704038	0.15172	.	.	ENSG00000127328	ENST00000550536;ENST00000362025	T	0.44083	0.93	3.43	-3.75	0.04372	.	1.933090	0.02427	N	0.083212	T	0.20170	0.0485	N	0.03608	-0.345	0.22156	N	0.999324	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26258	-1.0108	10	0.66056	D	0.02	.	5.6056	0.17377	0.2348:0.4791:0.0:0.286	.	5;5	Q96QF0-4;Q96QF0	.;RAB3I_HUMAN	T	5	ENSP00000447300:K5T	ENSP00000355381:K5T	K	+	2	0	RAB3IP	68419907	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.150000	0.16263	-0.761000	0.04670	-0.338000	0.08134	AAG	-	NULL		0.488	RAB3IP-001	KNOWN	basic|CCDS	protein_coding	RAB3IP	protein_coding	OTTHUMT00000280669.2	A	NM_022456		68419907	1	no_errors	NM_175623	genbank	human	validated	54_36p	missense	SNP	0	C
DNAH10	196385	genome.wustl.edu	37	12	124297818	124297818	+	Silent	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr12:124297818T>A	ENST00000409039.3	+	19	2923	c.2898T>A	c.(2896-2898)ccT>ccA	p.P966P		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	966	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.P784P(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTCTGAACCCTCAGATAATTG	0.408																																																1	Substitution - coding silent(1)	ovary(1)	12											95.0	96.0	95.0					12																	124297818		2203	4300	6503	122863771	SO:0001819	synonymous_variant	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.2898T>A	12.37:g.124297818T>A			122863771	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	-	p.P784	ENST00000409039.3	37	c.2352	CCDS9255.2	12																																																																																			-	NULL		0.408	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	T			122863771	1	no_errors	NM_207437	genbank	human	validated	54_36p	silent	SNP	0.99	A
VWA8	23078	genome.wustl.edu	37	13	42249411	42249411	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr13:42249411G>C	ENST00000379310.3	-	36	4417	c.4349C>G	c.(4348-4350)tCt>tGt	p.S1450C		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1450						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S1450C(1)									TATATAACCAGATGTTTGTGG	0.353																																																1	Substitution - Missense(1)	ovary(1)	13											122.0	113.0	116.0					13																	42249411		1834	4098	5932	41147411	SO:0001583	missense	23078			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.4349C>G	13.37:g.42249411G>C	ENSP00000368612:p.Ser1450Cys		41147411	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	-	p.S1450C	ENST00000379310.3	37	c.4349	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174481	0.57692	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.10960	2.82	5.51	4.65	0.58169	.	0.251205	0.38436	N	0.001690	T	0.14917	0.0360	L	0.48642	1.525	0.80722	D	1	P	0.37955	0.612	B	0.40101	0.319	T	0.01839	-1.1263	10	0.66056	D	0.02	.	16.6366	0.85060	0.0:0.13:0.87:0.0	.	1450	A3KMH1	K0564_HUMAN	C	1354;1450	ENSP00000368612:S1450C	ENSP00000251030:S1354C	S	-	2	0	KIAA0564	41147411	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	8.138000	0.89613	1.452000	0.47756	0.655000	0.94253	TCT	-	NULL		0.353	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0564	protein_coding	OTTHUMT00000354828.2	G	NM_015058		41147411	-1	no_errors	NM_015058	genbank	human	validated	54_36p	missense	SNP	1	C
PCDH17	27253	genome.wustl.edu	37	13	58208787	58208787	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr13:58208787G>A	ENST00000377918.3	+	1	2133	c.2107G>A	c.(2107-2109)Gac>Aac	p.D703N		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	703					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D703N(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GCACCACTGGGACATGTCGCT	0.607																																					Melanoma(72;952 1291 1619 12849 33676)											1	Substitution - Missense(1)	ovary(1)	13											72.0	70.0	71.0					13																	58208787		2203	4300	6503	57106788	SO:0001583	missense	27253			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2107G>A	13.37:g.58208787G>A	ENSP00000367151:p.Asp703Asn		57106788	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	-	p.D703N	ENST00000377918.3	37	c.2107	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548813	0.45383	.	.	ENSG00000118946	ENST00000377918	T	0.54479	0.57	5.46	5.46	0.80206	.	0.088254	0.85682	D	0.000000	T	0.35038	0.0918	N	0.10733	0.035	0.80722	D	1	B;B	0.29988	0.264;0.172	B;B	0.29663	0.105;0.049	T	0.17198	-1.0377	9	.	.	.	.	19.3157	0.94213	0.0:0.0:1.0:0.0	.	703;703	O14917-2;O14917	.;PCD17_HUMAN	N	703	ENSP00000367151:D703N	.	D	+	1	0	PCDH17	57106788	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.853000	0.99521	2.551000	0.86045	0.655000	0.94253	GAC	-	NULL		0.607	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	protein_coding	OTTHUMT00000045139.1	G	NM_001040429		57106788	1	no_errors	NM_001040429	genbank	human	reviewed	54_36p	missense	SNP	1	A
SLITRK6	84189	genome.wustl.edu	37	13	86370361	86370361	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr13:86370361G>T	ENST00000400286.2	-	2	881	c.283C>A	c.(283-285)Ctt>Att	p.L95I		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	95					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)		p.L95I(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TTAAATCCAAGGTGTATTGAA	0.368																																																1	Substitution - Missense(1)	ovary(1)	13											173.0	161.0	164.0					13																	86370361		1870	4101	5971	85268362	SO:0001583	missense	84189			AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.283C>A	13.37:g.86370361G>T	ENSP00000383143:p.Leu95Ile		85268362	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Missense_Mutation	SNP	superfamily_L domain-like;HMMPfam_LRRCT;HMMPfam_LRR_1	p.L95I	ENST00000400286.2	37	c.283	CCDS41903.1	13	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877183	0.51801	.	.	ENSG00000184564	ENST00000400286	T	0.68624	-0.34	6.17	6.17	0.99709	.	0.133516	0.51477	D	0.000083	T	0.71779	0.3380	M	0.85710	2.77	0.46678	D	0.999154	P	0.42409	0.779	B	0.36766	0.232	T	0.76602	-0.2899	10	0.56958	D	0.05	-17.224	19.4432	0.94831	0.0:0.0:1.0:0.0	.	95	Q9H5Y7	SLIK6_HUMAN	I	95	ENSP00000383143:L95I	ENSP00000383143:L95I	L	-	1	0	SLITRK6	85268362	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.443000	0.59994	2.941000	0.99782	0.655000	0.94253	CTT	-	HMMPfam_LRR_1		0.368	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK6	protein_coding	OTTHUMT00000045404.2	G	NM_032229		85268362	-1	no_errors	NM_032229	genbank	human	validated	54_36p	missense	SNP	1	T
CHD8	57680	genome.wustl.edu	37	14	21873400	21873400	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr14:21873400C>T	ENST00000557364.1	-	16	3538	c.3275G>A	c.(3274-3276)cGc>cAc	p.R1092H	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.R813H|CHD8_ENST00000399982.2_Missense_Mutation_p.R1092H			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1092					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.R1092H(2)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GCAGCACTTGCGCAACTCCAT	0.428																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	14											83.0	78.0	80.0					14																	21873400		1936	4143	6079	20943240	SO:0001583	missense	57680			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.3275G>A	14.37:g.21873400C>T	ENSP00000451601:p.Arg1092His		20943240	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	HMMPfam_SNF2_N;HMMPfam_Chromo;HMMPfam_Helicase_C;HMMPfam_TCH;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Chromo domain-like	p.R813H	ENST00000557364.1	37	c.2438	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	C	29.2	4.987929	0.93106	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	T;T;T	0.80480	-1.38;-1.38;-1.38	4.78	4.78	0.61160	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.92993	0.7770	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94963	0.8110	10	0.87932	D	0	-12.3316	17.0978	0.86641	0.0:1.0:0.0:0.0	.	1092;813	Q9HCK8;Q9HCK8-2	CHD8_HUMAN;.	H	813;1092;812;1092	ENSP00000406288:R813H;ENSP00000382863:R1092H;ENSP00000451601:R1092H	ENSP00000262707:R812H	R	-	2	0	CHD8	20943240	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.646000	0.89796	0.561000	0.74099	CGC	-	HMMPfam_SNF2_N		0.428	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	protein_coding	OTTHUMT00000410436.1	C	NM_020920		20943240	-1	no_errors	NM_020920	genbank	human	validated	54_36p	missense	SNP	1	T
SIPA1L1	26037	genome.wustl.edu	37	14	72085486	72085486	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	G	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr14:72085486A>G	ENST00000555818.1	+	3	1859	c.1511A>G	c.(1510-1512)tAt>tGt	p.Y504C	SIPA1L1_ENST00000537413.1_5'UTR|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.Y504C|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.Y504C	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	504					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)	p.Y504C(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CACTGGAACTATTTTGGGGCT	0.368																																																1	Substitution - Missense(1)	ovary(1)	14											98.0	98.0	98.0					14																	72085486		2203	4300	6503	71155239	SO:0001583	missense	26037			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1511A>G	14.37:g.72085486A>G	ENSP00000450832:p.Tyr504Cys		71155239	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	HMMPfam_Rap_GAP;HMMPfam_PDZ;superfamily_PDZ domain-like;superfamily_Rap/Ran-GAP (Pfam 02145)	p.Y504C	ENST00000555818.1	37	c.1511	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	A	24.2	4.502747	0.85176	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000555066	D;D;D;D	0.94613	-1.9;-1.9;-1.9;-3.47	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.97250	0.9101	M	0.82323	2.585	0.80722	D	1	D;D;D	0.76494	0.999;0.959;0.999	D;P;D	0.80764	0.987;0.816;0.994	D	0.97976	1.0346	10	0.87932	D	0	-14.6724	15.6441	0.77033	1.0:0.0:0.0:0.0	.	504;504;504	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	C	504;504;504;5	ENSP00000370630:Y504C;ENSP00000450832:Y504C;ENSP00000351352:Y504C;ENSP00000452450:Y5C	ENSP00000351352:Y504C	Y	+	2	0	SIPA1L1	71155239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.104000	0.64026	0.533000	0.62120	TAT	-	NULL		0.368	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	protein_coding	OTTHUMT00000412806.1	A	NM_015556		71155239	1	no_errors	NM_015556	genbank	human	provisional	54_36p	missense	SNP	1	G
ELMSAN1	91748	genome.wustl.edu	37	14	74205387	74205387	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr14:74205387C>G	ENST00000286523.5	-	2	2107	c.1325G>C	c.(1324-1326)tGt>tCt	p.C442S	ELMSAN1_ENST00000394071.2_Missense_Mutation_p.C442S|ELMSAN1_ENST00000486739.1_5'Flank	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.C442S(1)									CACCTGCCCACAGTCCCCTGT	0.667																																																1	Substitution - Missense(1)	ovary(1)	14											44.0	42.0	42.0					14																	74205387		2203	4300	6503	73275140	SO:0001583	missense	91748			BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.1325G>C	14.37:g.74205387C>G	ENSP00000286523:p.Cys442Ser		73275140	Q6PK13|Q6PK59|Q6ZS23	Missense_Mutation	SNP	-	p.C442S	ENST00000286523.5	37	c.1325	CCDS9819.1	14	.	.	.	.	.	.	.	.	.	.	C	3.580	-0.085836	0.07097	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	4.69	2.68	0.31781	.	0.257513	0.34291	N	0.004097	T	0.05364	0.0142	N	0.14661	0.345	0.27379	N	0.95548	B;B	0.33379	0.151;0.41	B;B	0.25614	0.039;0.062	T	0.33828	-0.9853	10	0.08599	T	0.76	-7.128	8.4137	0.32659	0.2411:0.6386:0.1202:0.0	.	442;442	A0PJD3;Q6PJG2	.;CN043_HUMAN	S	442	ENSP00000377634:C442S;ENSP00000286523:C442S;ENSP00000407767:C442S;ENSP00000402380:C442S	ENSP00000286523:C442S	C	-	2	0	C14orf43	73275140	0.335000	0.24748	1.000000	0.80357	0.961000	0.63080	1.269000	0.33074	2.163000	0.67991	0.491000	0.48974	TGT	-	NULL		0.667	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf43	protein_coding	OTTHUMT00000317793.1	C	NM_194278		73275140	-1	no_errors	NM_001043318	genbank	human	validated	54_36p	missense	SNP	0.94	G
TTLL5	23093	genome.wustl.edu	37	14	76249663	76249663	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr14:76249663C>T	ENST00000298832.9	+	26	2981	c.2776C>T	c.(2776-2778)Ccc>Tcc	p.P926S	TTLL5_ENST00000555422.1_3'UTR|TTLL5_ENST00000557636.1_Missense_Mutation_p.P940S|TTLL5_ENST00000556893.1_Missense_Mutation_p.P477S|TTLL5_ENST00000554510.1_Missense_Mutation_p.P435S	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	926					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)	p.P926S(1)		NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		TTCAGCTATCCCCAGCATGCC	0.507																																																1	Substitution - Missense(1)	ovary(1)	14											144.0	127.0	133.0					14																	76249663		2203	4300	6503	75319416	SO:0001583	missense	23093			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.2776C>T	14.37:g.76249663C>T	ENSP00000298832:p.Pro926Ser		75319416	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	HMMPfam_TTL;superfamily_Glutathione synthetase ATP-binding domain-like	p.P926S	ENST00000298832.9	37	c.2776	CCDS32124.1	14	.	.	.	.	.	.	.	.	.	.	C	11.31	1.599580	0.28534	.	.	ENSG00000119685	ENST00000418433;ENST00000557636;ENST00000298832;ENST00000393826;ENST00000556893;ENST00000554510	T;T;T;T	0.21543	4.1;4.19;2.0;2.0	5.72	3.64	0.41730	.	1.175900	0.06353	U	0.710209	T	0.12944	0.0314	N	0.14661	0.345	0.24298	N	0.995135	B;B;B	0.21147	0.006;0.052;0.017	B;B;B	0.16289	0.007;0.015;0.007	T	0.06481	-1.0824	10	0.30854	T	0.27	.	7.2175	0.25967	0.0:0.6998:0.163:0.1372	.	940;477;926	G3V2J9;Q6EMB2-2;Q6EMB2	.;.;TTLL5_HUMAN	S	613;940;926;477;477;435	ENSP00000450713:P940S;ENSP00000298832:P926S;ENSP00000452524:P477S;ENSP00000451946:P435S	ENSP00000298832:P926S	P	+	1	0	TTLL5	75319416	0.253000	0.23982	0.992000	0.48379	0.408000	0.30992	0.357000	0.20199	2.704000	0.92352	0.557000	0.71058	CCC	-	NULL		0.507	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	protein_coding	OTTHUMT00000414453.1	C	NM_015072		75319416	1	no_errors	NM_015072	genbank	human	validated	54_36p	missense	SNP	0.36	T
NRDE2	55051	genome.wustl.edu	37	14	90784449	90784449	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr14:90784449A>C	ENST00000354366.3	-	2	305	c.73T>G	c.(73-75)Tgg>Ggg	p.W25G	NRDE2_ENST00000557106.1_5'UTR|NRDE2_ENST00000357904.3_Intron	NM_017970.3	NP_060440.2	Q9H7Z3	NRDE2_HUMAN	NRDE-2, necessary for RNA interference, domain containing	25								p.W25G(1)									TTGCTCAGCCAGTCTAACTCT	0.438																																																1	Substitution - Missense(1)	ovary(1)	14											127.0	120.0	123.0					14																	90784449		2203	4300	6503	89854202	SO:0001583	missense	55051			AK000870	CCDS9890.1	14q32.11	2012-12-14	2012-09-25	2012-09-25	ENSG00000119720	ENSG00000119720			20186	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 102"""	C14orf102			Standard	NM_017970		Approved	FLJ14051	uc001xyi.2	Q9H7Z3	OTTHUMG00000171020	ENST00000354366.3:c.73T>G	14.37:g.90784449A>C	ENSP00000346335:p.Trp25Gly		89854202	B4DH71|Q4G0A7|Q9NWH6	Missense_Mutation	SNP	HMMPfam_DUF1740;superfamily_Polynucleotide phosphorylase/guanosine pentaphosphate synthase (PNPase/GPSI) domain 3;superfamily_Protein prenylyltransferase;superfamily_TPR-like	p.W25G	ENST00000354366.3	37	c.73	CCDS9890.1	14	.	.	.	.	.	.	.	.	.	.	A	18.54	3.646561	0.67358	.	.	ENSG00000119720	ENST00000354366	T	0.51817	0.69	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000002	T	0.66867	0.2833	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.70938	-0.4736	10	0.87932	D	0	-13.985	13.472	0.61287	1.0:0.0:0.0:0.0	.	25	Q9H7Z3	CN102_HUMAN	G	25	ENSP00000346335:W25G	ENSP00000346335:W25G	W	-	1	0	C14orf102	89854202	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.120000	0.71596	2.011000	0.59026	0.455000	0.32223	TGG	-	NULL		0.438	NRDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf102	protein_coding	OTTHUMT00000411264.1	A	NM_017970		89854202	-1	no_errors	NM_017970	genbank	human	validated	54_36p	missense	SNP	1	C
SERPINA10	51156	genome.wustl.edu	37	14	94750327	94750327	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr14:94750327C>A	ENST00000393096.1	-	5	1775	c.1310G>T	c.(1309-1311)aGg>aTg	p.R437M	SERPINA10_ENST00000261994.4_Missense_Mutation_p.R437M|SERPINA10_ENST00000554723.1_Missense_Mutation_p.R477M|SERPINA10_ENST00000554173.1_Missense_Mutation_p.R437M	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	437					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.R437M(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		ATTCACCACCCTGCCCAGAAA	0.453																																																1	Substitution - Missense(1)	ovary(1)	14											100.0	96.0	98.0					14																	94750327		2203	4300	6503	93820080	SO:0001583	missense	51156			AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.1310G>T	14.37:g.94750327C>A	ENSP00000376809:p.Arg437Met		93820080	A5Z2A5|Q6UWX9|Q86U20	Missense_Mutation	SNP	-	p.R437M	ENST00000393096.1	37	c.1310	CCDS9923.1	14	.	.	.	.	.	.	.	.	.	.	C	16.47	3.133298	0.56828	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.57	5.57	0.84162	Serpin domain (3);	0.000000	0.64402	D	0.000009	D	0.95207	0.8446	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95774	0.8811	10	0.87932	D	0	.	19.5537	0.95331	0.0:1.0:0.0:0.0	.	437	Q9UK55	ZPI_HUMAN	M	477;437;437;437	ENSP00000450896:R477M;ENSP00000376809:R437M;ENSP00000261994:R437M;ENSP00000450971:R437M	ENSP00000261994:R437M	R	-	2	0	SERPINA10	93820080	1.000000	0.71417	1.000000	0.80357	0.035000	0.12851	4.311000	0.59147	2.614000	0.88457	0.557000	0.71058	AGG	-	NULL		0.453	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA10	protein_coding	OTTHUMT00000413061.1	C	NM_016186		93820080	-1	no_errors	NM_001100607	genbank	human	validated	54_36p	missense	SNP	1	A
GPR132	29933	genome.wustl.edu	37	14	105518039	105518039	+	Silent	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr14:105518039C>T	ENST00000329797.3	-	4	1346	c.435G>A	c.(433-435)gtG>gtA	p.V145V	GPR132_ENST00000546679.1_5'UTR|GPR132_ENST00000539291.2_Silent_p.V145V|GPR132_ENST00000392585.2_Silent_p.V136V	NM_001278694.1|NM_001278696.1|NM_013345.2	NP_001265623.1|NP_001265625.1|NP_037477.1	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	145					G1/S transition of mitotic cell cycle (GO:0000082)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V145V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	18		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		CCAGCGCGTACACCACGGCCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	14											92.0	83.0	86.0					14																	105518039		2203	4300	6503	104589084	SO:0001819	synonymous_variant	29933			AF083955	CCDS9997.1, CCDS61567.1	14q32.3	2012-08-21			ENSG00000183484	ENSG00000183484		"""GPCR / Class A : Orphans"""	17482	protein-coding gene	gene with protein product	"""G2 accumulation"""	606167				12086852	Standard	NM_013345		Approved	G2A	uc001yqd.3	Q9UNW8	OTTHUMG00000140173	ENST00000329797.3:c.435G>A	14.37:g.105518039C>T			104589084	A8K7X7|B4E144|Q9BSU2	Silent	SNP	-	p.V145	ENST00000329797.3	37	c.435	CCDS9997.1	14																																																																																			-	NULL		0.627	GPR132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR132	protein_coding	OTTHUMT00000409278.1	C	NM_013345		104589084	-1	no_errors	NM_013345	genbank	human	reviewed	54_36p	silent	SNP	0.57	T
RYR3	6263	genome.wustl.edu	37	15	34049746	34049746	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	A	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr15:34049746C>A	ENST00000389232.4	+	60	8724	c.8654C>A	c.(8653-8655)cCc>cAc	p.P2885H	RYR3_ENST00000415757.3_Missense_Mutation_p.P2885H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2885					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)	p.P2885H(1)		NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCTCTGAAGCCCCTTAGCAGC	0.498																																																1	Substitution - Missense(1)	ovary(1)	15											85.0	78.0	80.0					15																	34049746		1928	4146	6074	31837038	SO:0001583	missense	6263				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8654C>A	15.37:g.34049746C>A	ENSP00000373884:p.Pro2885His		31837038	O15175|Q15412	Missense_Mutation	SNP	HMMPfam_RYDR_ITPR;HMMPfam_efhand;HMMPfam_RyR;HMMPfam_MIR;HMMPfam_SPRY;HMMPfam_Ion_trans;HMMPfam_RR_TM4-6;HMMPfam_RIH_assoc;HMMPfam_Ins145_P3_rec;superfamily_EF-hand;superfamily_ARM repeat;superfamily_MIR domain (Pfam 02815)	p.P2885H	ENST00000389232.4	37	c.8654	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	15.92	2.973933	0.53720	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96554	-4.05;-4.05	5.41	5.41	0.78517	.	0.134929	0.49305	D	0.000148	D	0.94581	0.8254	L	0.43152	1.355	0.28357	N	0.920647	P;P	0.45715	0.643;0.865	B;P	0.45712	0.136;0.491	D	0.91585	0.5282	10	0.66056	D	0.02	.	12.6636	0.56828	0.0:0.9255:0.0:0.0745	.	2885;2885	Q15413-2;Q15413	.;RYR3_HUMAN	H	2885	ENSP00000373884:P2885H;ENSP00000399610:P2885H	ENSP00000354735:P2885H	P	+	2	0	RYR3	31837038	0.967000	0.33354	1.000000	0.80357	0.985000	0.73830	2.547000	0.45786	2.826000	0.97356	0.655000	0.94253	CCC	-	NULL		0.498	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	protein_coding	OTTHUMT00000417514.1	C			31837038	1	no_errors	NM_001036	genbank	human	validated	54_36p	missense	SNP	1	A
PLCB2	5330	genome.wustl.edu	37	15	40595508	40595508	+	Missense_Mutation	SNP	T	T	G	rs537249891		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr15:40595508T>G	ENST00000260402.3	-	3	461	c.212A>C	c.(211-213)aAg>aCg	p.K71T	PLCB2_ENST00000543785.2_Missense_Mutation_p.K71T|PLCB2_ENST00000456256.2_Missense_Mutation_p.K71T|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000557821.1_Missense_Mutation_p.K71T	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	71					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)	p.K71T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		CTTGGCAAACTTCCCAAAGCG	0.597																																																1	Substitution - Missense(1)	ovary(1)	15											98.0	96.0	97.0					15																	40595508		1989	4166	6155	38382800	SO:0001583	missense	5330				CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.212A>C	15.37:g.40595508T>G	ENSP00000260402:p.Lys71Thr		38382800	A8K6J2|B9EGH5	Missense_Mutation	SNP	-	p.K71T	ENST00000260402.3	37	c.212	CCDS42020.1	15	.	.	.	.	.	.	.	.	.	.	T	15.94	2.980948	0.53827	.	.	ENSG00000137841	ENST00000260402;ENST00000456256;ENST00000543785	T;T;T	0.49139	0.79;0.79;0.79	4.53	4.53	0.55603	.	0.057552	0.64402	D	0.000003	T	0.58595	0.2133	M	0.79693	2.465	0.46654	D	0.999147	B;B;B;B	0.31968	0.349;0.256;0.321;0.003	B;P;B;B	0.44772	0.224;0.46;0.146;0.011	T	0.63910	-0.6530	10	0.66056	D	0.02	.	9.2522	0.37562	0.0:0.0936:0.0:0.9064	.	71;71;71;71	B9EGH5;Q00722-2;Q9BVT6;Q00722	.;.;.;PLCB2_HUMAN	T	71	ENSP00000260402:K71T;ENSP00000411991:K71T;ENSP00000444652:K71T	ENSP00000260402:K71T	K	-	2	0	PLCB2	38382800	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.256000	0.51492	2.021000	0.59480	0.533000	0.62120	AAG	-	NULL		0.597	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	protein_coding	OTTHUMT00000418430.1	T			38382800	-1	no_errors	NM_004573	genbank	human	validated	54_36p	missense	SNP	1	G
FAM81A	145773	genome.wustl.edu	37	15	59752196	59752196	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr15:59752196C>G	ENST00000288228.5	+	3	272	c.85C>G	c.(85-87)Ctc>Gtc	p.L29V		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	29								p.L26V(1)		endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						ATCTGTAAGCCTCGTGGAGCA	0.532																																																1	Substitution - Missense(1)	ovary(1)	15											34.0	37.0	36.0					15																	59752196		1972	4176	6148	57539488	SO:0001583	missense	145773				CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.85C>G	15.37:g.59752196C>G	ENSP00000288228:p.Leu29Val		57539488		Missense_Mutation	SNP	-	p.L29V	ENST00000288228.5	37	c.85	CCDS45269.1	15	.	.	.	.	.	.	.	.	.	.	C	10.92	1.486793	0.26686	.	.	ENSG00000157470	ENST00000288228	T	0.29655	1.56	5.57	4.66	0.58398	.	0.000000	0.53938	D	0.000051	T	0.45617	0.1351	L	0.44542	1.39	0.36831	D	0.886887	D;D	0.76494	0.999;0.996	D;D	0.80764	0.994;0.986	T	0.52465	-0.8572	10	0.51188	T	0.08	-12.8752	12.0151	0.53309	0.0:0.9198:0.0:0.0802	.	26;29	B4DRE4;Q8TBF8	.;FA81A_HUMAN	V	29	ENSP00000288228:L29V	ENSP00000288228:L29V	L	+	1	0	FAM81A	57539488	0.997000	0.39634	0.767000	0.31495	0.220000	0.24768	2.518000	0.45537	1.353000	0.45828	-0.291000	0.09656	CTC	-	NULL		0.532	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81A	protein_coding	OTTHUMT00000415876.1	C	NM_152450		57539488	1	no_errors	NM_152450	genbank	human	validated	54_36p	missense	SNP	0.98	G
HERC1	8925	genome.wustl.edu	37	15	63940273	63940273	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr15:63940273G>A	ENST00000443617.2	-	55	10960	c.10873C>T	c.(10873-10875)Cat>Tat	p.H3625Y		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3625					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.H3625Y(1)		NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TTTACCTTATGTGCATCAATT	0.343																																																1	Substitution - Missense(1)	ovary(1)	15											83.0	69.0	74.0					15																	63940273		1848	4072	5920	61727326	SO:0001583	missense	8925			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.10873C>T	15.37:g.63940273G>A	ENSP00000390158:p.His3625Tyr		61727326	Q8IW65	Missense_Mutation	SNP	HMMPfam_RCC1;HMMPfam_HECT;HMMPfam_WD40;HMMPfam_SPRY;superfamily_RCC1/BLIP-II;superfamily_WD40 repeat-like;superfamily_Hect E3 ligase catalytic domain	p.H3625Y	ENST00000443617.2	37	c.10873	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	16.81	3.226856	0.58668	.	.	ENSG00000103657	ENST00000443617	T	0.81415	-1.49	5.67	4.74	0.60224	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.066712	0.64402	U	0.000019	D	0.86070	0.5845	M	0.93283	3.4	0.58432	D	0.999996	B	0.06786	0.001	B	0.10450	0.005	D	0.84989	0.0893	10	0.66056	D	0.02	.	16.5168	0.84303	0.0:0.1311:0.8689:0.0	.	3625	Q15751	HERC1_HUMAN	Y	3625	ENSP00000390158:H3625Y	ENSP00000390158:H3625Y	H	-	1	0	HERC1	61727326	1.000000	0.71417	1.000000	0.80357	0.412000	0.31113	7.561000	0.82288	1.370000	0.46153	0.313000	0.20887	CAT	-	HMMPfam_WD40		0.343	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	protein_coding	OTTHUMT00000418523.1	G	NM_003922		61727326	-1	no_errors	NM_003922	genbank	human	reviewed	54_36p	missense	SNP	1	A
RP11-167H9.4	0	genome.wustl.edu	37	3	149795573	149795573	+	RNA	SNP	C	C	T	rs373982244		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:149795573C>T	ENST00000487840.1	+	0	46				snoU13_ENST00000459123.1_lincRNA																							acatctcacacgtaagtgtga	0.428																																																0			3																																								151278263			0																															3.37:g.149795573C>T			151278263		RNA	SNP	-	NULL	ENST00000487840.1	37	NULL		3																																																																																			-	-		0.428	RP11-167H9.4-003	KNOWN	basic	antisense	ENSG00000208756	antisense	OTTHUMT00000357120.1	C			151278263	-1	pseudogene	ENST00000386021	ensembl	human	known	54_36p	rna	SNP		T
MLST8	64223	genome.wustl.edu	37	16	2258832	2258832	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:2258832A>G	ENST00000569417.1	+	9	1289	c.935A>G	c.(934-936)cAg>cGg	p.Q312R	MLST8_ENST00000382450.4_Missense_Mutation_p.Q311R|MLST8_ENST00000301724.10_3'UTR|MLST8_ENST00000301725.7_3'UTR|MLST8_ENST00000564088.1_Missense_Mutation_p.Q312R|MLST8_ENST00000565250.1_Missense_Mutation_p.Q312R|MLST8_ENST00000397124.1_Missense_Mutation_p.Q312R	NM_022372.4	NP_071767.3	Q9BVC4	LST8_HUMAN	MTOR associated protein, LST8 homolog (S. cerevisiae)	312					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of TOR signaling (GO:0032008)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Rac GTPase activity (GO:0032314)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.Q312R(1)		large_intestine(3)|lung(2)|skin(1)	6						GGCGGCCACCAGAAGGCTGTT	0.617																																																1	Substitution - Missense(1)	ovary(1)	16											102.0	122.0	115.0					16																	2258832		2088	4219	6307	2198833	SO:0001583	missense	64223				CCDS10462.2, CCDS58409.1	16p13.3	2013-01-09			ENSG00000167965	ENSG00000167965		"""WD repeat domain containing"""	24825	protein-coding gene	gene with protein product	"""G protein beta subunit like"""	612190				12477932	Standard	NM_022372		Approved	Lst8, Pop3, GBL, GbetaL	uc002cpc.3	Q9BVC4	OTTHUMG00000128827	ENST00000569417.1:c.935A>G	16.37:g.2258832A>G	ENSP00000456405:p.Gln312Arg		2198833	B3KMM4|B4DY00|D3DU88|Q5M800|Q86Y18|Q8WUI5|Q9HA66|Q9UJV6	Missense_Mutation	SNP	WD40;HMMPfam_WD40	p.Q312R	ENST00000569417.1	37	c.935	CCDS10462.2	16	.	.	.	.	.	.	.	.	.	.	A	24.2	4.509907	0.85282	.	.	ENSG00000167965	ENST00000382450;ENST00000397124	T	0.39997	1.05	4.98	4.98	0.66077	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.	.	.	.	T	0.43897	0.1268	L	0.31120	0.905	0.80722	D	1	D;P	0.67145	0.996;0.788	P;B	0.56398	0.797;0.242	T	0.19877	-1.0292	9	0.22706	T	0.39	.	13.5077	0.61493	1.0:0.0:0.0:0.0	.	246;312	Q9BVC4-3;Q9BVC4	.;LST8_HUMAN	R	312	ENSP00000380313:Q312R	ENSP00000371888:Q312R	Q	+	2	0	MLST8	2198833	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.224000	0.72265	1.873000	0.54277	0.379000	0.24179	CAG	-	NULL		0.617	MLST8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GBL	protein_coding	OTTHUMT00000250763.2	A	NM_022372		2198833	1	no_errors	NM_022372	genbank	human	validated	54_36p	missense	SNP	1	G
RPL15P20	646672	genome.wustl.edu	37	16	16025570	16025570	+	IGR	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:16025570A>G								FOPNL (43088 upstream) : ABCC1 (17863 downstream)																							GTAACAGTGGAGATTGAGAGT	0.428																																																0			16																																								15933071	SO:0001628	intergenic_variant	0																															16.37:g.16025570A>G			15933071		Missense_Mutation	SNP	-	p.L185P		37	c.554		16																																																																																			-	NULL	0	0.428					ENSG00000215003			A			15933071	-1	no_errors	ENST00000399416	ensembl	human	known	54_36p	missense	SNP	1	G
RHBDF1	64285	genome.wustl.edu	37	16	109279	109279	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:109279G>A	ENST00000262316.6	-	16	2104	c.1962C>T	c.(1960-1962)taC>taT	p.Y654Y		NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	654					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)		p.Y654Y(1)		breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GCCACAGGCGGTAGAACTGGT	0.622																																																1	Substitution - coding silent(1)	ovary(1)	16											66.0	67.0	66.0					16																	109279		2203	4300	6503	49279	SO:0001819	synonymous_variant	64285			BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1962C>T	16.37:g.109279G>A			49279	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Silent	SNP	-	p.Y654	ENST00000262316.6	37	c.1962	CCDS32344.1	16																																																																																			-	NULL		0.622	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDF1	protein_coding	OTTHUMT00000134178.2	G	NM_022450		49279	-1	no_errors	NM_022450	genbank	human	validated	54_36p	silent	SNP	1	A
CLUAP1	23059	genome.wustl.edu	37	16	3573215	3573215	+	Silent	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:3573215C>T	ENST00000576634.1	+	8	915	c.771C>T	c.(769-771)gaC>gaT	p.D257D	CLUAP1_ENST00000571025.1_Silent_p.D257D|CLUAP1_ENST00000417763.2_Silent_p.D91D|CLUAP1_ENST00000341633.5_Silent_p.D257D|CLUAP1_ENST00000572600.1_Silent_p.D91D|CLUAP1_ENST00000445795.2_Silent_p.D16D	NM_015041.2	NP_055856.1	Q96AJ1	CLUA1_HUMAN	clusterin associated protein 1	257					cilium assembly (GO:0042384)	centrosome (GO:0005813)|cilium (GO:0005929)|intracellular membrane-bounded organelle (GO:0043231)|intraciliary transport particle B (GO:0030992)|nucleus (GO:0005634)		p.D257D(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(2)	16						AGCAGTATGACACTTATCTGG	0.373																																																1	Substitution - coding silent(1)	ovary(1)	16											118.0	111.0	113.0					16																	3573215		2197	4300	6497	3513216	SO:0001819	synonymous_variant	23059			BC017070	CCDS32381.1, CCDS45398.1	16p13.3	2014-07-18				ENSG00000103351		"""Intraflagellar transport homologs"""	19009	protein-coding gene	gene with protein product	"""flagellar associated protein 22, qilin-like protein, homolog (Chlamydomonas)"", ""cilia and flagella associated protein 22"""					15480429, 9734811, 19253336	Standard	NM_015041		Approved	FLJ13297, KIAA0643, FAP22, CFAP22	uc002cvk.2	Q96AJ1		ENST00000576634.1:c.771C>T	16.37:g.3573215C>T			3513216	O75138|Q65ZA3|Q9H8R4|Q9H8T1	Silent	SNP	-	p.D257	ENST00000576634.1	37	c.771	CCDS32381.1	16																																																																																			-	NULL		0.373	CLUAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLUAP1	protein_coding	OTTHUMT00000437883.2	C	NM_024793		3513216	1	no_errors	NM_015041	genbank	human	provisional	54_36p	silent	SNP	0.13	T
ZNF785	146540	genome.wustl.edu	37	16	30594263	30594263	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:30594263G>A	ENST00000395216.2	-	3	995	c.836C>T	c.(835-837)aCg>aTg	p.T279M	AC002310.7_ENST00000486926.1_RNA|ZNF785_ENST00000470110.1_Missense_Mutation_p.T264M|AC002310.7_ENST00000492040.1_RNA|RP11-146F11.5_ENST00000563540.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	279					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T279M(1)		endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						CTTCTCGCCCGTGTGCTTGCG	0.637																																																1	Substitution - Missense(1)	ovary(1)	16											54.0	50.0	51.0					16																	30594263		2197	4300	6497	30501764	SO:0001583	missense	146540			BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.836C>T	16.37:g.30594263G>A	ENSP00000378642:p.Thr279Met		30501764	O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	-	p.T279M	ENST00000395216.2	37	c.836	CCDS10685.1	16	.	.	.	.	.	.	.	.	.	.	g	25.6	4.653161	0.88056	.	.	ENSG00000197162	ENST00000470110;ENST00000395222;ENST00000395216	T;T	0.26373	1.74;1.74	4.25	1.1	0.20463	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46151	0.1378	M	0.80616	2.505	0.25220	N	0.989913	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.967;0.994;0.945	T	0.25882	-1.0119	9	0.87932	D	0	.	4.2917	0.10881	0.0902:0.1553:0.5942:0.1603	.	244;279;264	B4DQL1;A8K8V0;A8K8V0-2	.;ZN785_HUMAN;.	M	264;244;279	ENSP00000420340:T264M;ENSP00000378642:T279M	ENSP00000378642:T279M	T	-	2	0	ZNF785	30501764	1.000000	0.71417	0.141000	0.22245	0.803000	0.45373	3.212000	0.51145	0.099000	0.17552	-0.196000	0.12772	ACG	-	NULL		0.637	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF785	protein_coding	OTTHUMT00000255529.2	G	NM_152458		30501764	-1	no_errors	NM_152458	genbank	human	provisional	54_36p	missense	SNP	0.83	A
CNOT1	23019	genome.wustl.edu	37	16	58590888	58590888	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:58590888A>G	ENST00000317147.5	-	19	2674	c.2342T>C	c.(2341-2343)cTt>cCt	p.L781P	CNOT1_ENST00000569732.1_5'UTR|SNORA50_ENST00000384225.2_RNA|CNOT1_ENST00000569240.1_Missense_Mutation_p.L781P|CNOT1_ENST00000441024.2_Missense_Mutation_p.L781P	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	781					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)	p.L781P(1)		breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GCCTGTGCCAAGACCACCTAC	0.433																																																1	Substitution - Missense(1)	ovary(1)	16											57.0	52.0	54.0					16																	58590888		2198	4300	6498	57148389	SO:0001583	missense	23019			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2342T>C	16.37:g.58590888A>G	ENSP00000320949:p.Leu781Pro		57148389	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	HMMPfam_Not1;superfamily_ARM repeat	p.L781P	ENST00000317147.5	37	c.2342	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	A	14.03	2.412799	0.42817	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.48522	0.85;0.81	5.48	5.48	0.80851	.	0.182425	0.48767	D	0.000164	T	0.41581	0.1165	N	0.12182	0.205	0.80722	D	1	P;B;B	0.51537	0.946;0.003;0.002	P;B;B	0.50896	0.653;0.002;0.002	T	0.42932	-0.9422	10	0.45353	T	0.12	-24.7495	15.5775	0.76404	1.0:0.0:0.0:0.0	.	781;781;781	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	P	781;210;781;781	ENSP00000320949:L781P;ENSP00000413113:L781P	ENSP00000320949:L781P	L	-	2	0	CNOT1	57148389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.438000	0.90305	2.076000	0.62316	0.533000	0.62120	CTT	-	NULL		0.433	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	protein_coding	OTTHUMT00000257385.3	A	NM_016284		57148389	-1	no_errors	NM_016284	genbank	human	validated	54_36p	missense	SNP	1	G
CMTM2	146225	genome.wustl.edu	37	16	66620925	66620925	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:66620925G>C	ENST00000268595.2	+	3	621	c.470G>C	c.(469-471)tGt>tCt	p.C157S	CMTM2_ENST00000379486.2_Missense_Mutation_p.C104S	NM_144673.2	NP_653274.1	Q8TAZ6	CKLF2_HUMAN	CKLF-like MARVEL transmembrane domain containing 2	157	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.C157S(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.068)|Epithelial(162;0.212)		CTGATTGCTTGTGCGTTCCTT	0.537																																																1	Substitution - Missense(1)	ovary(1)	16											236.0	179.0	199.0					16																	66620925		2201	4300	6501	65178426	SO:0001583	missense	146225			BC025354	CCDS10814.1, CCDS56001.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000140932	ENSG00000140932			19173	protein-coding gene	gene with protein product		607885	"""chemokine-like factor super family 2"", ""chemokine-like factor superfamily 2"""	CKLFSF2			Standard	NM_001199317		Approved	MGC39436, FLJ25732	uc002ept.3	Q8TAZ6	OTTHUMG00000137501	ENST00000268595.2:c.470G>C	16.37:g.66620925G>C	ENSP00000268595:p.Cys157Ser		65178426	Q5I2A4|Q8N7E5	Missense_Mutation	SNP	-	p.C157S	ENST00000268595.2	37	c.470	CCDS10814.1	16	.	.	.	.	.	.	.	.	.	.	G	2.053	-0.417349	0.04766	.	.	ENSG00000140932	ENST00000379486;ENST00000268595	T;T	0.44881	0.91;1.53	4.05	-8.1	0.01086	Marvel (1);	1.835410	0.02593	N	0.100128	T	0.30324	0.0761	L	0.29908	0.895	0.09310	N	1	B;B	0.18013	0.025;0.025	B;B	0.19666	0.026;0.015	T	0.14420	-1.0473	10	0.30854	T	0.27	24.9965	12.3652	0.55224	0.0:0.1745:0.7098:0.1157	.	104;157	Q5I2A4;Q8TAZ6	.;CKLF2_HUMAN	S	104;157	ENSP00000368800:C104S;ENSP00000268595:C157S	ENSP00000268595:C157S	C	+	2	0	CMTM2	65178426	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.709000	0.01890	-2.223000	0.00726	-0.410000	0.06199	TGT	-	NULL		0.537	CMTM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CMTM2	protein_coding	OTTHUMT00000268808.1	G			65178426	1	no_errors	NM_144673	genbank	human	reviewed	54_36p	missense	SNP		C
CMIP	80790	genome.wustl.edu	37	16	81510059	81510059	+	Intron	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:81510059G>A	ENST00000537098.3	+	1	372					NM_198390.2	NP_938204.2	Q8IY22	CMIP_HUMAN	c-Maf inducing protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(5)|kidney(1)|lung(7)	13						CAAACAGCTCGAAGGAGATGC	0.527																																																0			16																																								80067560	SO:0001627	intron_variant	729313			AB051481	CCDS54044.1, CCDS54045.1	16q23	2011-08-04			ENSG00000153815	ENSG00000153815			24319	protein-coding gene	gene with protein product		610112				11214970, 12939343	Standard	NM_030629		Approved		uc002fgp.3	Q8IY22		ENST00000537098.3:c.300+30913G>A	16.37:g.81510059G>A			80067560	Q9C0G9	RNA	SNP	-	NULL	ENST00000537098.3	37	NULL	CCDS54044.1	16																																																																																			-	-		0.527	CMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729313	protein_coding	OTTHUMT00000432399.2	G	NM_030629		80067560	-1	pseudogene	XR_015971	genbank	human	model	54_36p	rna	SNP	0.99	A
DNAAF1	123872	genome.wustl.edu	37	16	84203520	84203520	+	Silent	SNP	G	G	A	rs199746574		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:84203520G>A	ENST00000378553.5	+	8	1210	c.1086G>A	c.(1084-1086)aaG>aaA	p.K362K	DNAAF1_ENST00000563818.1_3'UTR|DNAAF1_ENST00000334315.5_Silent_p.K362K	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	362					axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)	p.K362K(1)		NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						CGGAAGGCAAGGAGGAGCCTC	0.532													G|||	1	0.000199681	0.0	0.0	5008	,	,		19590	0.001		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	16											71.0	74.0	73.0					16																	84203520		2200	4300	6500	82761021	SO:0001819	synonymous_variant	123872			BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1086G>A	16.37:g.84203520G>A			82761021	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Silent	SNP	HMMPfam_LRR_1;superfamily_Outer arm dynein light chain 1	p.K362	ENST00000378553.5	37	c.1086	CCDS10943.2	16																																																																																			-	NULL		0.532	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC50	protein_coding	OTTHUMT00000250328.3	G	NM_178452		82761021	1	no_errors	NM_178452	genbank	human	validated	54_36p	silent	SNP	0.01	A
SPG7	6687	genome.wustl.edu	37	16	89603290	89603290	+	Intron	SNP	C	C	T	rs371077773		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr16:89603290C>T	ENST00000268704.2	+	9	1339				SPG7_ENST00000341316.2_Missense_Mutation_p.S481L	NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)						anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.S481L(1)		autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		GAGGGTCATTCGCTCTGCTGG	0.552																																																1	Substitution - Missense(1)	lung(1)	16						C	,LEU/SER	1,4395	2.1+/-5.4	0,1,2197	196.0	172.0	180.0		,1442	1.2	0.0	16		180	0,8600		0,0,4300	no	intron,missense	SPG7	NM_003119.2,NM_199367.1	,145	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	,	,481/490	89603290	1,12995	2198	4300	6498	88130791	SO:0001627	intron_variant	6687			Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1324+4246C>T	16.37:g.89603290C>T			88130791	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	-	p.S481L	ENST00000268704.2	37	c.1442	CCDS10977.1	16	.	.	.	.	.	.	.	.	.	.	C	4.518	0.096201	0.08681	2.27E-4	0.0	ENSG00000197912	ENST00000341316	D	0.93659	-3.26	1.18	1.18	0.20946	.	.	.	.	.	D	0.87362	0.6158	.	.	.	0.09310	N	1	B	0.22683	0.073	B	0.08055	0.003	T	0.79683	-0.1701	8	0.87932	D	0	.	5.7574	0.18180	0.0:1.0:0.0:0.0	.	481	Q9UQ90-2	.	L	481	ENSP00000341157:S481L	ENSP00000341157:S481L	S	+	2	0	SPG7	88130791	0.008000	0.16893	0.003000	0.11579	0.001000	0.01503	0.557000	0.23454	0.993000	0.38866	0.462000	0.41574	TCG	-	NULL		0.552	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG7	protein_coding	OTTHUMT00000269921.2	C	NM_003119		88130791	1	no_errors	NM_199367	genbank	human	reviewed	54_36p	missense	SNP		T
ZZEF1	23140	genome.wustl.edu	37	17	3920845	3920845	+	Silent	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr17:3920845G>C	ENST00000381638.2	-	48	7945	c.7821C>G	c.(7819-7821)ctC>ctG	p.L2607L		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2607							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.L2607L(1)		central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TCACTCGGAAGAGGTAGTCCC	0.627																																																1	Substitution - coding silent(1)	ovary(1)	17											74.0	63.0	67.0					17																	3920845		2203	4300	6503	3867594	SO:0001819	synonymous_variant	23140			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.7821C>G	17.37:g.3920845G>C			3867594	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	HMMPfam_ZZ;superfamily_Spermadhesin CUB domain;HMMPfam_efhand;HMMPfam_APC10;superfamily_Galactose-binding domain-like;superfamily_EF-hand;superfamily_Cysteine-rich domain	p.L2607	ENST00000381638.2	37	c.7821	CCDS11043.1	17																																																																																			-	NULL		0.627	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	protein_coding	OTTHUMT00000207480.1	G	NM_015113		3867594	-1	no_errors	NM_015113	genbank	human	validated	54_36p	silent	SNP	1	C
PSMB6	5694	genome.wustl.edu	37	17	4700982	4700982	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr17:4700982A>G	ENST00000270586.3	+	4	359	c.308A>G	c.(307-309)gAa>gGa	p.E103G		NM_001270481.1|NM_002798.2	NP_001257410.1|NP_002789.1	P28072	PSB6_HUMAN	proteasome (prosome, macropain) subunit, beta type, 6	103					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	endopeptidase activity (GO:0004175)|threonine-type endopeptidase activity (GO:0004298)	p.E103G(1)		endometrium(3)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11						TCTAGCATTGAACTGAATGAG	0.512																																																1	Substitution - Missense(1)	ovary(1)	17											115.0	115.0	115.0					17																	4700982		2203	4300	6503	4647940	SO:0001583	missense	5694			BC000835	CCDS11056.1, CCDS73944.1	17p13	2004-02-18			ENSG00000142507	ENSG00000142507		"""Proteasome (prosome, macropain) subunits"""	9543	protein-coding gene	gene with protein product		600307				8066462, 1888762	Standard	NM_002798		Approved	Y, DELTA	uc002fzb.4	P28072	OTTHUMG00000090777	ENST00000270586.3:c.308A>G	17.37:g.4700982A>G	ENSP00000270586:p.Glu103Gly		4647940	Q96J55	Missense_Mutation	SNP	HMMPfam_Proteasome;superfamily_N-terminal nucleophile aminohydrolases (Ntn hydrolases)	p.E103G	ENST00000270586.3	37	c.308	CCDS11056.1	17	.	.	.	.	.	.	.	.	.	.	A	19.32	3.804143	0.70682	.	.	ENSG00000142507	ENST00000270586	T	0.23348	1.91	5.99	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.54549	0.1865	M	0.91459	3.21	0.46478	D	0.999064	D	0.65815	0.995	D	0.64237	0.923	T	0.61931	-0.6961	10	0.66056	D	0.02	-22.1123	10.2756	0.43507	0.8339:0.1661:0.0:0.0	.	103	P28072	PSB6_HUMAN	G	103	ENSP00000270586:E103G	ENSP00000270586:E103G	E	+	2	0	PSMB6	4647940	1.000000	0.71417	0.982000	0.44146	0.964000	0.63967	8.417000	0.90247	1.068000	0.40764	-0.313000	0.08912	GAA	-	HMMPfam_Proteasome		0.512	PSMB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB6	protein_coding	OTTHUMT00000207559.2	A	NM_002798		4647940	1	no_errors	NM_002798	genbank	human	reviewed	54_36p	missense	SNP	1	G
TP53	7157	genome.wustl.edu	37	17	7577144	7577144	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA		dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr17:7577144A>G	ENST00000269305.4	-	8	983	c.794T>C	c.(793-795)cTg>cCg	p.L265P	TP53_ENST00000445888.2_Missense_Mutation_p.L265P|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.L265P|TP53_ENST00000359597.4_Missense_Mutation_p.L265P|TP53_ENST00000420246.2_Missense_Mutation_p.L265P|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	265	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		L -> M (in sporadic cancers; somatic mutation).|L -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L265P(15)|p.0?(8)|p.L265R(5)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G262_S269delGNLLGRNS(2)|p.N263fs*5(1)|p.L265del(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.L265_R267delLGR(1)|p.L265Q(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTCCGTCCCAGTAGATTACC	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	42	Substitution - Missense(21)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(3)|Deletion - Frameshift(3)	large_intestine(6)|lung(5)|oesophagus(5)|breast(4)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|upper_aerodigestive_tract(2)|stomach(2)|urinary_tract(2)|small_intestine(1)|skin(1)|eye(1)	17	GRCh37	CD004355|CM971505	TP53	D|M							46.0	41.0	43.0					17																	7577144		2203	4300	6503	7517869	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.794T>C	17.37:g.7577144A>G	ENSP00000269305:p.Leu265Pro		7517869	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.L265P	ENST00000269305.4	37	c.794	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	18.92	3.724991	0.68959	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99878	-7.42;-7.42;-7.42;-7.42;-7.42;-7.42	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.64402	D	0.000001	D	0.99849	0.9930	M	0.87827	2.91	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.96469	0.9347	10	0.87932	D	0	-15.8832	12.9367	0.58319	1.0:0.0:0.0:0.0	.	265;265;265;265	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	P	265;265;265;265;265;254;133	ENSP00000352610:L265P;ENSP00000269305:L265P;ENSP00000398846:L265P;ENSP00000391127:L265P;ENSP00000391478:L265P;ENSP00000425104:L133P	ENSP00000269305:L265P	L	-	2	0	TP53	7517869	1.000000	0.71417	0.999000	0.59377	0.528000	0.34623	9.060000	0.93907	2.154000	0.67381	0.379000	0.24179	CTG	-	HMMPfam_P53		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546		7517869	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
NLK	51701	genome.wustl.edu	37	17	26488244	26488244	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr17:26488244C>A	ENST00000407008.3	+	4	1421	c.703C>A	c.(703-705)Cca>Aca	p.P235T		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	235	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Required for interaction with TAB2. {ECO:0000250}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.P223T(1)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CTCTCCTCAACCACTCAGCTC	0.368																																																1	Substitution - Missense(1)	ovary(1)	17											119.0	113.0	115.0					17																	26488244		2203	4300	6503	23512371	SO:0001583	missense	51701			AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.703C>A	17.37:g.26488244C>A	ENSP00000384625:p.Pro235Thr		23512371	B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	-	p.P235T	ENST00000407008.3	37	c.703	CCDS11224.2	17	.	.	.	.	.	.	.	.	.	.	C	15.98	2.993892	0.54041	.	.	ENSG00000087095	ENST00000407008	T	0.64991	-0.13	6.17	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	N	0.11154	0.105	0.80722	D	1	B	0.30526	0.283	B	0.34242	0.178	T	0.48603	-0.9021	10	0.41790	T	0.15	-0.9486	16.0876	0.81068	0.1348:0.8652:0.0:0.0	.	235	Q9UBE8	NLK_HUMAN	T	235	ENSP00000384625:P235T	ENSP00000384625:P235T	P	+	1	0	NLK	23512371	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	1.606000	0.50161	-0.182000	0.12963	CCA	-	NULL		0.368	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLK	protein_coding	OTTHUMT00000255607.3	C	NM_016231		23512371	1	no_errors	NM_016231	genbank	human	validated	54_36p	missense	SNP	1	A
HEXDC	284004	genome.wustl.edu	37	17	80391633	80391633	+	Missense_Mutation	SNP	G	G	C	rs566441417		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr17:80391633G>C	ENST00000327949.9	+	4	393	c.382G>C	c.(382-384)Gcc>Ccc	p.A128P	HEXDC_ENST00000577944.1_Missense_Mutation_p.A128P|HEXDC_ENST00000337014.6_Missense_Mutation_p.A128P			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	128					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)	p.A128P(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			GCTGGTGGGCGCCATGATTGA	0.657																																																1	Substitution - Missense(1)	ovary(1)	17											37.0	41.0	40.0					17																	80391633		1938	4130	6068	77984922	SO:0001583	missense	284004			AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.382G>C	17.37:g.80391633G>C	ENSP00000332634:p.Ala128Pro		77984922	B7UUP6|Q8IYN4|Q8TE81	Missense_Mutation	SNP	-	p.A128P	ENST00000327949.9	37	c.382		17	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469210	0.43839	.	.	ENSG00000169660	ENST00000337014;ENST00000327949	D;D	0.90385	-2.66;-2.66	5.3	3.1	0.35709	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycoside hydrolase, family 20, catalytic core (1);	0.229494	0.44285	D	0.000478	D	0.85852	0.5793	L	0.50333	1.59	0.42438	D	0.992703	B;B	0.23442	0.014;0.085	B;B	0.23150	0.044;0.029	T	0.81560	-0.0877	10	0.33940	T	0.23	-22.4983	9.7463	0.40448	0.223:0.0:0.777:0.0	.	128;128	Q8WVB3;Q8WVB3-2	HEXDC_HUMAN;.	P	128	ENSP00000337854:A128P;ENSP00000332634:A128P	ENSP00000332634:A128P	A	+	1	0	HEXDC	77984922	0.964000	0.33143	0.973000	0.42090	0.966000	0.64601	1.761000	0.38440	1.225000	0.43566	0.563000	0.77884	GCC	-	NULL		0.657	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	HEXDC	protein_coding	OTTHUMT00000443513.1	G	NM_173620		77984922	1	no_errors	NM_173620	genbank	human	validated	54_36p	missense	SNP	0.71	C
TMED1	11018	genome.wustl.edu	37	19	10945964	10945964	+	Silent	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:10945964G>T	ENST00000214869.2	-	2	347	c.249C>A	c.(247-249)gtC>gtA	p.V83V	TMED1_ENST00000588289.1_5'UTR|TMED1_ENST00000591695.1_Silent_p.V83V|C19orf38_ENST00000592854.1_5'Flank	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	83	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.V83V(1)		breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						GGGACTCGCTGACCAACAGCA	0.632																																																1	Substitution - coding silent(1)	ovary(1)	19											146.0	115.0	126.0					19																	10945964		2203	4300	6503	10806964	SO:0001819	synonymous_variant	11018			U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.249C>A	19.37:g.10945964G>T			10806964		Silent	SNP	HMMPfam_EMP24_GP25L;superfamily_Supernatant protein factor (SPF) C-terminal domain	p.V83	ENST00000214869.2	37	c.249	CCDS12249.1	19																																																																																			-	HMMPfam_EMP24_GP25L		0.632	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED1	protein_coding	OTTHUMT00000452614.1	G	NM_006858		10806964	-1	no_errors	NM_006858	genbank	human	reviewed	54_36p	silent	SNP	1	T
HOOK2	29911	genome.wustl.edu	37	19	12881827	12881827	+	Missense_Mutation	SNP	G	G	A	rs144845831	byFrequency	TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:12881827G>A	ENST00000397668.3	-	10	894	c.821C>T	c.(820-822)gCg>gTg	p.A274V	HOOK2_ENST00000264827.5_Missense_Mutation_p.A274V|HOOK2_ENST00000589965.1_Intron	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	274	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)	p.A274V(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						CTGCAGCTCCGCAACCTCCCT	0.657													g|||	5	0.000998403	0.0038	0.0	5008	,	,		13960	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	19							VAL/ALA,VAL/ALA	14,4120		0,14,2053	28.0	34.0	32.0		821,821	1.5	0.0	19	dbSNP_134	32	0,8382		0,0,4191	yes	missense,missense	HOOK2	NM_001100176.1,NM_013312.2	64,64	0,14,6244	AA,AG,GG		0.0,0.3387,0.1119	benign,benign	274/718,274/720	12881827	14,12502	2067	4191	6258	12742827	SO:0001583	missense	29911			AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.821C>T	19.37:g.12881827G>A	ENSP00000380785:p.Ala274Val		12742827	O60562	Missense_Mutation	SNP	HMMPfam_HOOK;superfamily_UBA-like	p.A274V	ENST00000397668.3	37	c.821	CCDS42508.1	19	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	g	0.104	-1.147602	0.01714	0.003387	0.0	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.17213	2.29;2.29	4.8	1.52	0.23074	.	1.326580	0.04765	N	0.426993	T	0.06645	0.0170	N	0.25647	0.755	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.27468	-1.0073	10	0.02654	T	1	2.4459	3.1019	0.06329	0.2816:0.0:0.4249:0.2935	.	274;274	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	V	274	ENSP00000380785:A274V;ENSP00000264827:A274V	ENSP00000264827:A274V	A	-	2	0	HOOK2	12742827	0.000000	0.05858	0.000000	0.03702	0.613000	0.37349	-0.051000	0.11885	0.463000	0.27118	-0.394000	0.06481	GCG	-	HMMPfam_HOOK		0.657	HOOK2-002	KNOWN	basic|CCDS	protein_coding	HOOK2	protein_coding	OTTHUMT00000451008.1	G	NM_013312		12742827	-1	no_errors	NM_013312	genbank	human	validated	54_36p	missense	SNP		A
CACNA1A	773	genome.wustl.edu	37	19	13397396	13397396	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:13397396C>G	ENST00000360228.5	-	20	3473	c.3474G>C	c.(3472-3474)aaG>aaC	p.K1158N	CACNA1A_ENST00000573710.2_Missense_Mutation_p.K1159N	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1159					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.K1159N(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCTGGCAGTCTTAGCTGAAT	0.622																																																1	Substitution - Missense(1)	ovary(1)	19											51.0	52.0	52.0					19																	13397396		1979	4139	6118	13258396	SO:0001583	missense	773			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3474G>C	19.37:g.13397396C>G	ENSP00000353362:p.Lys1158Asn		13258396	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	HMMPfam_Ion_trans;HMMPfam_Ca_chan_IQ;superfamily_Voltage-gated potassium channels	p.K1159N	ENST00000360228.5	37	c.3477	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829472	0.50845	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	T	0.37235	1.21	5.3	5.3	0.74995	.	1.335510	0.04843	N	0.440888	T	0.29158	0.0725	N	0.01048	-1.04	0.35814	D	0.824071	D;D;B	0.57257	0.968;0.979;0.421	P;P;B	0.56434	0.482;0.798;0.154	T	0.40534	-0.9558	10	0.42905	T	0.14	.	11.9305	0.52843	0.0:0.9154:0.0:0.0846	.	1159;1162;1158	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	N	1158;1162;1159;1159	ENSP00000353362:K1158N	ENSP00000317661:K1159N	K	-	3	2	CACNA1A	13258396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.364000	0.44187	2.485000	0.83878	0.555000	0.69702	AAG	-	NULL		0.622	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	C	NM_000068		13258396	-1	no_errors	ENST00000325084	ensembl	human	known	54_36p	missense	SNP	1	G
THOP1	7064	genome.wustl.edu	37	19	2799744	2799744	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:2799744C>A	ENST00000307741.6	+	5	747	c.544C>A	c.(544-546)Ctg>Atg	p.L182M	THOP1_ENST00000586677.1_Missense_Mutation_p.L61M	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	182					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)	p.L182M(1)		NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAACAAGAACCTGAACGAGGA	0.612																																																1	Substitution - Missense(1)	ovary(1)	19											158.0	114.0	129.0					19																	2799744		2203	4300	6503	2750744	SO:0001583	missense	7064				CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.544C>A	19.37:g.2799744C>A	ENSP00000304467:p.Leu182Met		2750744	B3KSE2|Q9UCB3	Missense_Mutation	SNP	"HMMPfam_Peptidase_M3;superfamily_Metalloproteases (""zincins"") catalytic domain"	p.L182M	ENST00000307741.6	37	c.544	CCDS12095.1	19	.	.	.	.	.	.	.	.	.	.	C	17.20	3.329720	0.60743	.	.	ENSG00000172009	ENST00000307741	T	0.10960	2.82	4.62	2.47	0.30058	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.077013	0.53938	D	0.000056	T	0.27349	0.0671	M	0.79011	2.435	0.80722	D	1	D;D	0.67145	0.996;0.979	D;D	0.67382	0.951;0.919	T	0.00860	-1.1537	10	0.72032	D	0.01	-29.1118	7.251	0.26150	0.0:0.7184:0.0:0.2815	.	61;182	B4DU96;P52888	.;THOP1_HUMAN	M	182	ENSP00000304467:L182M	ENSP00000304467:L182M	L	+	1	2	THOP1	2750744	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.286000	0.43496	0.385000	0.24970	0.555000	0.69702	CTG	-	NULL		0.612	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOP1	protein_coding	OTTHUMT00000451587.2	C			2750744	1	no_errors	NM_003249	genbank	human	provisional	54_36p	missense	SNP	1	A
UPF1	5976	genome.wustl.edu	37	19	18963027	18963027	+	Silent	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:18963027C>T	ENST00000599848.1	+	6	1103	c.894C>T	c.(892-894)gaC>gaT	p.D298D	UPF1_ENST00000262803.5_Silent_p.D298D|UPF1_ENST00000600310.1_3'UTR			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	298	Sufficient for interaction with RENT2.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.D298D(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GGTACGAGGACGCCTACCAGT	0.597																																																2	Substitution - coding silent(2)	ovary(1)|large_intestine(1)	19											96.0	84.0	88.0					19																	18963027		2203	4300	6503	18824027	SO:0001819	synonymous_variant	5976			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.894C>T	19.37:g.18963027C>T			18824027	O00239|O43343|Q86Z25|Q92842	Silent	SNP	HMMPfam_ResIII;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D298	ENST00000599848.1	37	c.894		19																																																																																			-	NULL		0.597	UPF1-002	KNOWN	basic	protein_coding	UPF1	protein_coding	OTTHUMT00000464684.1	C	NM_002911		18824027	1	no_errors	NM_002911	genbank	human	reviewed	54_36p	silent	SNP	1	T
ZNF536	9745	genome.wustl.edu	37	19	30934635	30934635	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:30934635C>G	ENST00000355537.3	+	2	313	c.166C>G	c.(166-168)Ccc>Gcc	p.P56A		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	56					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.P56A(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCGGCCCAACCCCGAGGAGAA	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											50.0	53.0	52.0					19																	30934635		2203	4300	6503	35626475	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.166C>G	19.37:g.30934635C>G	ENSP00000347730:p.Pro56Ala		35626475	A2RU18	Missense_Mutation	SNP	-	p.P56A	ENST00000355537.3	37	c.166	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	7.719	0.696807	0.15106	.	.	ENSG00000198597	ENST00000355537	T	0.10477	2.87	5.37	0.686	0.18015	.	0.165377	0.56097	D	0.000040	T	0.06234	0.0161	L	0.27053	0.805	0.40082	D	0.976146	B;B	0.11235	0.001;0.004	B;B	0.10450	0.001;0.005	T	0.32508	-0.9904	10	0.32370	T	0.25	-7.8124	5.076	0.14632	0.2374:0.4648:0.2309:0.0669	.	56;56	A7E228;O15090	.;ZN536_HUMAN	A	56	ENSP00000347730:P56A	ENSP00000347730:P56A	P	+	1	0	ZNF536	35626475	0.989000	0.36119	0.137000	0.22149	0.894000	0.52154	0.881000	0.28173	0.321000	0.23259	0.462000	0.41574	CCC	-	NULL		0.672	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717		35626475	1	no_errors	NM_014717	genbank	human	provisional	54_36p	missense	SNP	1	G
FFAR3	2865	genome.wustl.edu	37	19	35849888	35849888	+	Silent	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:35849888C>T	ENST00000327809.4	+	2	297	c.96C>T	c.(94-96)aaC>aaT	p.N32N	FFAR3_ENST00000594310.1_Silent_p.N32N	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	32					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)	p.N32N(1)		endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TCCCCCTCAACCTGCTGGCCC	0.647																																					Esophageal Squamous(185;1742 2042 21963 24215 27871)											1	Substitution - coding silent(1)	ovary(1)	19											101.0	94.0	96.0					19																	35849888		2199	4294	6493	40541728	SO:0001819	synonymous_variant	2865			AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.96C>T	19.37:g.35849888C>T			40541728	B2RWM8|Q14CM7	Silent	SNP	-	p.N32	ENST00000327809.4	37	c.96	CCDS12459.1	19																																																																																			-	NULL		0.647	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FFAR3	protein_coding	OTTHUMT00000418873.2	C	NM_005304		40541728	1	no_errors	NM_005304	genbank	human	validated	54_36p	silent	SNP	1	T
ZNF568	374900	genome.wustl.edu	37	19	37440552	37440552	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:37440552C>A	ENST00000333987.7	+	7	1003	c.497C>A	c.(496-498)tCa>tAa	p.S166*	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000415168.1_Nonsense_Mutation_p.S102*	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S166*(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTCTGAGTTCAGACATTGTT	0.343																																																1	Substitution - Nonsense(1)	ovary(1)	19											89.0	82.0	84.0					19																	37440552		1839	4084	5923	42132392	SO:0001587	stop_gained	374900			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.497C>A	19.37:g.37440552C>A	ENSP00000334685:p.Ser166*		42132392	B4DS92|E7ER33|Q6N060|Q8NA64	Nonsense_Mutation	SNP	-	p.S166*	ENST00000333987.7	37	c.497	CCDS42558.1	19	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712055	0.89112	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	.	.	.	4.39	2.2	0.27929	.	0.000000	0.30890	N	0.008675	.	.	.	.	.	.	0.20196	N	0.999922	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.0015	0.36085	0.0:0.8198:0.0:0.1802	.	.	.	.	X	166;102	.	ENSP00000334685:S166X	S	+	2	0	ZNF568	42132392	0.024000	0.19004	0.033000	0.17914	0.744000	0.42396	2.547000	0.45786	0.561000	0.29186	0.655000	0.94253	TCA	-	NULL		0.343	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	protein_coding	OTTHUMT00000109572.2	C	NM_198539		42132392	1	no_errors	NM_198539	genbank	human	validated	54_36p	nonsense	SNP		A
MAP4K1	11184	genome.wustl.edu	37	19	39109960	39109960	+	5'Flank	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:39109960A>G	ENST00000591517.1	-	0	0				EIF3K_ENST00000538434.1_Intron|EIF3K_ENST00000248342.4_Missense_Mutation_p.I18V|EIF3K_ENST00000593062.1_3'UTR|MAP4K1_ENST00000396857.2_5'Flank|EIF3K_ENST00000593149.1_Intron|EIF3K_ENST00000545173.2_Missense_Mutation_p.I18V|MAP4K1_ENST00000589130.1_5'Flank|MAP4K1_ENST00000586296.1_5'Flank|EIF3K_ENST00000588934.1_Missense_Mutation_p.I18V|EIF3K_ENST00000592558.1_Missense_Mutation_p.I18V	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1						activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.I18V(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCTCAAGGGTATCGACAGGTC	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											121.0	90.0	100.0					19																	39109960		2203	4300	6503	43801800	SO:0001631	upstream_gene_variant	27335			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918			19.37:g.39109960A>G	Exception_encountered		43801800		Missense_Mutation	SNP	-	p.I18V	ENST00000591517.1	37	c.52	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	A	19.66	3.869461	0.72065	.	.	ENSG00000178982	ENST00000248342;ENST00000545173	.	.	.	5.64	5.64	0.86602	Translation initiation factor 3, subunit 12, N-terminal, eukaryotic (1);Armadillo-type fold (1);	0.049034	0.85682	D	0.000000	T	0.52885	0.1762	L	0.28649	0.875	0.80722	D	1	B;B	0.12013	0.005;0.005	B;B	0.16722	0.009;0.016	T	0.52071	-0.8624	9	0.87932	D	0	-22.2251	14.8184	0.70052	1.0:0.0:0.0:0.0	.	18;18	B7ZAM9;Q9UBQ5	.;EIF3K_HUMAN	V	18	.	ENSP00000248342:I18V	I	+	1	0	EIF3K	43801800	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.383000	0.90157	2.137000	0.66172	0.460000	0.39030	ATC	-	NULL		0.607	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	EIF3K	protein_coding	OTTHUMT00000453390.1	A	NM_001042600		43801800	1	no_errors	NM_013234	genbank	human	validated	54_36p	missense	SNP	1	G
PAK4	10298	genome.wustl.edu	37	19	39669141	39669141	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:39669141G>A	ENST00000593690.1	+	11	2125	c.1698G>A	c.(1696-1698)ctG>ctA	p.L566L	PAK4_ENST00000360442.3_Silent_p.L566L|PAK4_ENST00000599470.1_Silent_p.L413L|PAK4_ENST00000321944.4_Silent_p.L476L|PAK4_ENST00000358301.3_Silent_p.L566L|PAK4_ENST00000435673.2_Silent_p.L566L|PAK4_ENST00000599386.1_Silent_p.L413L	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	566	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.L566L(1)		central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			CAGCCGAGCTGCTGAAGCACC	0.687																																																1	Substitution - coding silent(1)	ovary(1)	19											19.0	20.0	19.0					19																	39669141		2184	4274	6458	44360981	SO:0001819	synonymous_variant	10298			AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.1698G>A	19.37:g.39669141G>A			44360981	B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Silent	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like);PBD;HMMPfam_PBD;Pkinase	p.L566	ENST00000593690.1	37	c.1698	CCDS12528.1	19																																																																																			-	HMMPfam_Pkinase		0.687	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK4	protein_coding	OTTHUMT00000463823.1	G			44360981	1	no_errors	NM_001014831	genbank	human	reviewed	54_36p	silent	SNP	1	A
CGB5	93659	genome.wustl.edu	37	19	49548354	49548354	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:49548354T>C	ENST00000301408.6	+	3	627	c.301T>C	c.(301-303)Tcc>Ccc	p.S101P	CGB1_ENST00000391869.3_Intron	NM_033043.1	NP_149032.1	P01233	CGHB_HUMAN	chorionic gonadotropin, beta polypeptide 5	101					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|female gamete generation (GO:0007292)|peptide hormone processing (GO:0016486)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)	p.S101P(1)		ovary(1)|pancreas(1)	2		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		CCCCGTGGTCTCCTACGCCGT	0.682																																																1	Substitution - Missense(1)	ovary(1)	19											1.0	1.0	1.0					19																	49548354		489	1384	1873	54240166	SO:0001583	missense	93659			X00265	CCDS12752.1	19q13.32	2008-02-05				ENSG00000189052			16452	protein-coding gene	gene with protein product		608825				6194155	Standard	NM_033043		Approved	HCG	uc002ply.3	P01233		ENST00000301408.6:c.301T>C	19.37:g.49548354T>C	ENSP00000301408:p.Ser101Pro		54240166	A1A5E0|B9ZVP5|Q13991|Q14000|Q3KPI3|Q3SY41|Q8WTT5|Q8WXL1|Q8WXL2|Q8WXL3|Q8WXL4	Missense_Mutation	SNP	-	p.S101P	ENST00000301408.6	37	c.301	CCDS12752.1	19	.	.	.	.	.	.	.	.	.	.	t	11.17	1.559914	0.27827	.	.	ENSG00000189052	ENST00000428927;ENST00000301408	D	0.91464	-2.85	1.83	1.83	0.25207	.	0.334108	0.29838	N	0.011077	D	0.88303	0.6400	.	.	.	0.30968	N	0.722915	.	.	.	.	.	.	D	0.85763	0.1350	7	0.87932	D	0	-23.6987	4.0398	0.09746	0.318:0.0:0.0:0.682	.	.	.	.	P	104;101	ENSP00000301408:S101P	ENSP00000301408:S101P	S	+	1	0	CGB5	54240166	1.000000	0.71417	0.995000	0.50966	0.011000	0.07611	1.269000	0.33074	1.083000	0.41159	0.164000	0.16699	TCC	-	NULL		0.682	CGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGB5	protein_coding	OTTHUMT00000466251.1	T	NM_033043		54240166	1	no_errors	NM_033043	genbank	human	reviewed	54_36p	missense	SNP	1	C
KIR3DL3	115653	genome.wustl.edu	37	19	55239325	55239325	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:55239325T>A	ENST00000291860.1	+	4	622	c.604T>A	c.(604-606)Tta>Ata	p.L202I	KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L202I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		TGTCACTCACTTACCCTATGA	0.552																																																1	Substitution - Missense(1)	ovary(1)	19											19.0	17.0	18.0					19																	55239325		1937	3250	5187	59931137	SO:0001583	missense	115653			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.604T>A	19.37:g.55239325T>A	ENSP00000291860:p.Leu202Ile		59931137	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	HMMPfam_ig,superfamily_Immunoglobulin	p.L202I	ENST00000291860.1	37	c.604	CCDS12903.1	19	.	.	.	.	.	.	.	.	.	.	N	8.293	0.818200	0.16607	.	.	ENSG00000242019	ENST00000291860	T	0.00737	5.76	1.38	0.111	0.14619	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	3.715540	0.01875	U	0.037471	T	0.00580	0.0019	N	0.03154	-0.405	0.09310	N	1	B	0.24186	0.099	B	0.28139	0.086	T	0.45190	-0.9278	10	0.72032	D	0.01	.	3.1684	0.06544	0.3813:0.0:0.0:0.6187	.	202	Q8N743	KI3L3_HUMAN	I	202	ENSP00000291860:L202I	ENSP00000291860:L202I	L	+	1	2	KIR3DL3	59931137	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.065000	0.14466	-0.025000	0.13918	0.172000	0.16884	TTA	-	NULL		0.552	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIR3DL3	protein_coding	OTTHUMT00000141147.1	T	NM_153443		59931137	1	no_errors	NM_153443	genbank	human	reviewed	54_36p	missense	SNP	0	A
NAT14	57106	genome.wustl.edu	37	19	55998176	55998176	+	Missense_Mutation	SNP	G	G	T	rs530693711	byFrequency	TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:55998176G>T	ENST00000205194.4	+	3	777	c.474G>T	c.(472-474)atG>atT	p.M158I	SSC5D_ENST00000587166.1_5'Flank|SSC5D_ENST00000389623.6_5'Flank|NAT14_ENST00000592719.1_Intron|NAT14_ENST00000587400.1_Intron	NM_020378.3	NP_065111.1	Q8WUY8	NAT14_HUMAN	N-acetyltransferase 14 (GCN5-related, putative)	158	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of transcription, DNA-templated (GO:0045893)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|N-acetyltransferase activity (GO:0008080)	p.M158I(1)		central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0527)		CTGGGGGCATGGGGGAGCCCC	0.781													g|||	2	0.000399361	0.0	0.0	5008	,	,		8646	0.0		0.0	False		,,,				2504	0.002															1	Substitution - Missense(1)	ovary(1)	19											2.0	2.0	2.0					19																	55998176		1255	2867	4122	60689988	SO:0001583	missense	57106			AB055059	CCDS12926.1	19q13.42	2011-11-25	2008-09-24		ENSG00000090971	ENSG00000090971			28918	protein-coding gene	gene with protein product	"""K562 cells-derived leucine zipper-like protein 1"""		"""N-acetyltransferase 14"""			10873651	Standard	NM_020378		Approved	KLP1	uc002qle.2	Q8WUY8		ENST00000205194.4:c.474G>T	19.37:g.55998176G>T	ENSP00000205194:p.Met158Ile		60689988	Q8TDY7|Q9NS72	Missense_Mutation	SNP	-	p.M158I	ENST00000205194.4	37	c.474	CCDS12926.1	19	.	.	.	.	.	.	.	.	.	.	.	8.796	0.931823	0.18131	.	.	ENSG00000090971	ENST00000205194	.	.	.	3.81	-2.89	0.05665	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (1);	0.924705	0.08992	N	0.864213	T	0.13500	0.0327	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21280	-1.0250	9	0.32370	T	0.25	-40.4463	0.3278	0.00314	0.2218:0.1697:0.2635:0.345	.	158	Q8WUY8	NAT14_HUMAN	I	158	.	ENSP00000205194:M158I	M	+	3	0	NAT14	60689988	0.682000	0.27624	0.274000	0.24659	0.958000	0.62258	0.752000	0.26362	-0.261000	0.09405	0.313000	0.20887	ATG	-	NULL		0.781	NAT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT14	protein_coding	OTTHUMT00000453339.1	G	NM_020378		60689988	1	no_errors	NM_020378	genbank	human	provisional	54_36p	missense	SNP	0.02	T
FBN3	84467	genome.wustl.edu	37	19	8201405	8201405	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:8201405G>A	ENST00000600128.1	-	11	1626	c.1212C>T	c.(1210-1212)acC>acT	p.T404T	FBN3_ENST00000601739.1_Silent_p.T404T|FBN3_ENST00000270509.2_Silent_p.T404T			Q75N90	FBN3_HUMAN	fibrillin 3	404						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T404T(1)		NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TCTGGTTCAGGGTAGCAGTGC	0.637																																																1	Substitution - coding silent(1)	ovary(1)	19											111.0	94.0	100.0					19																	8201405		2203	4300	6503	8107405	SO:0001819	synonymous_variant	84467				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.1212C>T	19.37:g.8201405G>A			8107405	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	HMMPfam_TB;HMMPfam_EGF;superfamily_Growth factor receptor domain;HMMPfam_EGF_CA;superfamily_EGF/Laminin;superfamily_TB module/8-cys domain	p.T404	ENST00000600128.1	37	c.1212	CCDS12196.1	19																																																																																			-	NULL		0.637	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	protein_coding	OTTHUMT00000461428.2	G	NM_032447		8107405	-1	no_errors	NM_032447	genbank	human	reviewed	54_36p	silent	SNP	0.12	A
ZNF470	388566	genome.wustl.edu	37	19	57088459	57088459	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr19:57088459A>G	ENST00000330619.8	+	6	1348	c.662A>G	c.(661-663)gAc>gGc	p.D221G	ZNF470_ENST00000391709.3_Missense_Mutation_p.D221G|ZNF470_ENST00000601902.1_Intron	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D221G(1)		endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		CACAAGCAAGACCGTGGAGAA	0.303																																																1	Substitution - Missense(1)	ovary(1)	19											38.0	40.0	39.0					19																	57088459		2203	4297	6500	61780271	SO:0001583	missense	388566			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.662A>G	19.37:g.57088459A>G	ENSP00000333223:p.Asp221Gly		61780271	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.D221G	ENST00000330619.8	37	c.662	CCDS33122.1	19	.	.	.	.	.	.	.	.	.	.	A	0.611	-0.824914	0.02755	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.06528	3.29;3.29	3.8	0.445	0.16597	.	.	.	.	.	T	0.03136	0.0092	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.42515	-0.9447	9	0.62326	D	0.03	.	3.8524	0.08960	0.1643:0.1933:0.0:0.6424	.	221	Q6ECI4	ZN470_HUMAN	G	221	ENSP00000375590:D221G;ENSP00000333223:D221G	ENSP00000333223:D221G	D	+	2	0	ZNF470	61780271	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.524000	0.06222	-0.184000	0.10567	-0.710000	0.03640	GAC	-	NULL		0.303	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF470	protein_coding	OTTHUMT00000459707.2	A	NM_001001668		61780271	1	no_errors	NM_001001668	genbank	human	validated	54_36p	missense	SNP		G
AC002472.1	0	genome.wustl.edu	37	22	21363539	21363539	+	5'Flank	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr22:21363539C>T	ENST00000547793.2	-	0	0				TUBA3FP_ENST00000422086.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000436079.1_RNA																							GTTCCAGGGTCGTGTAGGTGG	0.547																																																0			22																																								19693539	SO:0001631	upstream_gene_variant	0																															22.37:g.21363539C>T	Exception_encountered		19693539		Silent	SNP	HMMPfam_Tubulin;superfamily_RNI-like;superfamily_Tubulin nucleotide-binding domain-like	p.T107	ENST00000547793.2	37	c.321		22																																																																																			-	NULL		0.547	AC002472.1-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000161149	protein_coding		C			19693539	-1	no_errors	ENST00000292748	ensembl	human	known	54_36p	silent	SNP	1	T
NR4A2	4929	genome.wustl.edu	37	2	157183361	157183361	+	Silent	SNP	C	C	A	rs139491338		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:157183361C>A	ENST00000339562.4	-	6	1592	c.1230G>T	c.(1228-1230)ctG>ctT	p.L410L	NR4A2_ENST00000409108.2_Silent_p.L410L|NR4A2_ENST00000426264.1_Silent_p.L347L|NR4A2_ENST00000539077.1_Silent_p.L421L|NR4A2_ENST00000409572.1_Silent_p.L410L|NR4A2_ENST00000429376.1_Silent_p.L347L	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	410	Ligand-binding. {ECO:0000255}.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.L410L(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						TGGAGCCAGTCAGGAGATCAT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	2											109.0	117.0	114.0					2																	157183361		2203	4300	6503	156891607	SO:0001819	synonymous_variant	4929			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.1230G>T	2.37:g.157183361C>A			156891607	Q16311|Q53RZ2|Q6NXU0	Silent	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.L410	ENST00000339562.4	37	c.1230	CCDS2201.1	2																																																																																			-	NULL		0.483	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A2	protein_coding	OTTHUMT00000254909.2	C			156891607	-1	no_errors	NM_006186	genbank	human	reviewed	54_36p	silent	SNP	1	A
TTN	7273	genome.wustl.edu	37	2	179485027	179485027	+	Silent	SNP	G	G	A	rs370808856		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:179485027G>A	ENST00000591111.1	-	198	41522	c.41298C>T	c.(41296-41298)gaC>gaT	p.D13766D	TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Silent_p.D6467D|TTN_ENST00000460472.2_Silent_p.D6342D|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Silent_p.D6534D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Silent_p.D15407D|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342992.6_Silent_p.D12839D|TTN-AS1_ENST00000604956.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13766	Ig-like 94.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D12839D(1)|p.D6342D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGAAGACAGCGTCATCGAACT	0.433																																																2	Substitution - coding silent(2)	ovary(2)	2						G	,,,	1,3743		0,1,1871	110.0	107.0	108.0		19026,38517,19401,19602	-0.6	1.0	2		108	1,8215		0,1,4107	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,2,5978	AA,AG,GG		0.0122,0.0267,0.0167	,,,	6342/26927,12839/33424,6467/27052,6534/27119	179485027	2,11958	1872	4108	5980	179193272	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41298C>T	2.37:g.179485027G>A			179193272	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	-	p.D12839	ENST00000591111.1	37	c.38517		2																																																																																			-	NULL		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179193272	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	silent	SNP	1	A
TTN	7273	genome.wustl.edu	37	2	179498582	179498582	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:179498582A>T	ENST00000591111.1	-	181	37945	c.37721T>A	c.(37720-37722)gTc>gAc	p.V12574D	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V5275D|TTN_ENST00000460472.2_Missense_Mutation_p.V5150D|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V5342D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V14215D|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V11647D			Q8WZ42	TITIN_HUMAN	titin	12574	Ig-like 83.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.V11647D(1)|p.V5150D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCTCCTTGACTTGAGCTTT	0.413																																																2	Substitution - Missense(2)	ovary(2)	2											223.0	211.0	215.0					2																	179498582		1892	4115	6007	179206827	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37721T>A	2.37:g.179498582A>T	ENSP00000465570:p.Val12574Asp		179206827	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.V11647D	ENST00000591111.1	37	c.34940		2	.	.	.	.	.	.	.	.	.	.	A	11.75	1.732547	0.30684	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.93	5.93	0.95920	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.83036	0.5167	M	0.77103	2.36	0.80722	D	1	D;D;D;D	0.64830	0.994;0.994;0.994;0.994	P;P;P;P	0.61658	0.892;0.892;0.892;0.892	D	0.85336	0.1093	9	0.87932	D	0	.	16.3756	0.83387	1.0:0.0:0.0:0.0	.	5150;5275;5342;12574	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	11647;5150;5342;5275;5150	ENSP00000343764:V11647D;ENSP00000434586:V5150D;ENSP00000340554:V5342D;ENSP00000352154:V5275D	ENSP00000340554:V5342D	V	-	2	0	TTN	179206827	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	7.082000	0.76851	2.270000	0.75569	0.460000	0.39030	GTC	-	NULL		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179206827	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	1	T
TTN	7273	genome.wustl.edu	37	2	179613555	179613555	+	Intron	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:179613555A>G	ENST00000591111.1	-	45	10585				TTN_ENST00000360870.5_Silent_p.D4524D|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.D4524D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTAGATGAATCTGATTCAG	0.323																																																1	Substitution - coding silent(1)	ovary(1)	2											106.0	104.0	105.0					2																	179613555		2203	4297	6500	179321800	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4295T>C	2.37:g.179613555A>G			179321800	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	HMMPfam_I-set,HMMPfam_ig,HMMPfam_Titin_Z,superfamily_Immunoglobulin,superfamily_beta-sandwich domain of Sec23/24	p.D4524	ENST00000591111.1	37	c.13572		2																																																																																			-	NULL		0.323	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179321800	-1	no_errors	NM_133379	genbank	human	reviewed	54_36p	silent	SNP	0	G
SPEG	10290	genome.wustl.edu	37	2	220315878	220315910	+	In_Frame_Del	DEL	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	-	rs375953839|rs368756743		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	-	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:220315878_220315910delGTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	ENST00000312358.7	+	5	2266_2298	c.2134_2166delGTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	c.(2134-2166)gtgtccgctggagaagagcccctagaggcccctdel	p.VSAGEEPLEAP712del	SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396698.1_In_Frame_Del_p.VSAGEEPLEAP608del|SPEG_ENST00000396695.2_5'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	712					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G715V(1)|p.V712_P722del(1)|p.S713P(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		TGACTCCTACGTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCTGTGTTTGAGA	0.609																																																3	Substitution - Missense(2)|Deletion - In frame(1)	ovary(1)|lung(1)|large_intestine(1)	2																																								220024154	SO:0001651	inframe_deletion	10290			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2134_2166delGTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	2.37:g.220315878_220315910delGTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	ENSP00000311684:p.Val712_Pro722del		220024122	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	In_Frame_Del	DEL	-	p.SAGEEPLEAPV713in_frame_del	ENST00000312358.7	37	c.2134_2166	CCDS42824.1	2																																																																																			(deletion:cds_exon[220024102;220024245])	NULL		0.609	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	protein_coding	OTTHUMT00000130252.2	GTGTCCGCTGGAGAAGAGCCCCTAGAGGCCCCT	NM_005876		220024154	1	no_errors	NM_005876	genbank	human	validated	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:0.997:0.463:0.956:0.951:0.626:0.998:0.999:0.997:1.000:1.000:0.993:1.000:1.000:1.000:1.000:1.000:0.885:0.893:0.939:0.950:1.000:1.000:1.000:1.000:1.000:0.961:0.995:0.991:0.073	-
SNX17	9784	genome.wustl.edu	37	2	27598394	27598394	+	Silent	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:27598394C>T	ENST00000233575.2	+	10	1018	c.796C>T	c.(796-798)Ctg>Ttg	p.L266L	SNX17_ENST00000543024.1_Silent_p.L52L|ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000537606.1_Silent_p.L241L|SNX17_ENST00000542478.1_Silent_p.L52L	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	266	FERM-like.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)	p.L266L(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCCCAGACGCTGCGGCACTA	0.577																																																1	Substitution - coding silent(1)	ovary(1)	2											77.0	70.0	72.0					2																	27598394		2203	4300	6503	27451898	SO:0001819	synonymous_variant	9784			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.796C>T	2.37:g.27598394C>T			27451898	B4DQM7|Q53HN7|Q6IAS3	Silent	SNP	HMMPfam_PX;superfamily_PX domain	p.L266	ENST00000233575.2	37	c.796	CCDS1750.1	2																																																																																			-	NULL		0.577	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	protein_coding	OTTHUMT00000215024.1	C	NM_014748		27451898	1	no_errors	NM_014748	genbank	human	reviewed	54_36p	silent	SNP	0.9	T
FAM98A	25940	genome.wustl.edu	37	2	33817254	33817254	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:33817254A>T	ENST00000238823.8	-	3	370	c.230T>A	c.(229-231)cTt>cAt	p.L77H	FAM98A_ENST00000403368.1_Missense_Mutation_p.L77H|FAM98A_ENST00000498340.1_5'UTR|FAM98A_ENST00000441530.2_De_novo_Start_InFrame			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	77							poly(A) RNA binding (GO:0044822)	p.L77H(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					ACTCACCTCAAGCTGGAATTC	0.388																																																1	Substitution - Missense(1)	ovary(1)	2											146.0	143.0	144.0					2																	33817254		2203	4300	6503	33670758	SO:0001583	missense	25940				CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.230T>A	2.37:g.33817254A>T	ENSP00000238823:p.Leu77His		33670758	B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	-	p.L77H	ENST00000238823.8	37	c.230	CCDS33179.1	2	.	.	.	.	.	.	.	.	.	.	A	31	5.065070	0.93898	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000403368	T;T	0.52983	0.64;0.64	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.72748	0.3499	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75869	-0.3165	10	0.52906	T	0.07	-6.6931	16.6406	0.85098	1.0:0.0:0.0:0.0	.	77	Q8NCA5-2	.	H	77	ENSP00000238823:L77H;ENSP00000384711:L77H	ENSP00000238823:L77H	L	-	2	0	FAM98A	33670758	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.291000	0.96070	2.326000	0.78906	0.533000	0.62120	CTT	-	NULL		0.388	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM98A	protein_coding	OTTHUMT00000325457.2	A	NM_015475		33670758	-1	no_errors	NM_015475	genbank	human	validated	54_36p	missense	SNP	1	T
CLEC4F	165530	genome.wustl.edu	37	2	71044234	71044234	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:71044234G>T	ENST00000272367.2	-	4	355	c.279C>A	c.(277-279)caC>caA	p.H93Q	CLEC4F_ENST00000426626.1_Missense_Mutation_p.H93Q	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	93					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.H93Q(1)		endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CCCTGCCAAAGTGGTGATGAT	0.478																																					Colon(107;10 2157 6841 26035)											1	Substitution - Missense(1)	ovary(1)	2											45.0	41.0	43.0					2																	71044234		2203	4300	6503	70897742	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.279C>A	2.37:g.71044234G>T	ENSP00000272367:p.His93Gln		70897742	A4QPA5	Missense_Mutation	SNP	-	p.H93Q	ENST00000272367.2	37	c.279	CCDS1910.1	2	.	.	.	.	.	.	.	.	.	.	G	8.686	0.906195	0.17760	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.01572	4.81;4.76	5.04	-3.39	0.04868	.	1.240920	0.05926	N	0.634280	T	0.01489	0.0048	L	0.32530	0.975	0.09310	N	1	B;B	0.19331	0.012;0.035	B;B	0.14578	0.006;0.011	T	0.48736	-0.9009	10	0.41790	T	0.15	.	1.7544	0.02979	0.3985:0.1272:0.3385:0.1359	.	93;93	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	Q	93	ENSP00000272367:H93Q;ENSP00000390581:H93Q	ENSP00000272367:H93Q	H	-	3	2	CLEC4F	70897742	0.000000	0.05858	0.000000	0.03702	0.374000	0.29953	-0.739000	0.04866	-0.338000	0.08413	0.467000	0.42956	CAC	-	NULL		0.478	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	protein_coding	OTTHUMT00000251922.1	G	NM_173535		70897742	-1	no_errors	NM_173535	genbank	human	validated	54_36p	missense	SNP		T
DQX1	165545	genome.wustl.edu	37	2	74751165	74751165	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:74751165G>A	ENST00000404568.3	-	4	920	c.701C>T	c.(700-702)cCc>cTc	p.P234L	DQX1_ENST00000495597.1_5'UTR|DQX1_ENST00000393951.2_Missense_Mutation_p.P234L	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	234						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.P116L(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						CCAGTAGATGGGGGAAGGTCT	0.547																																																1	Substitution - Missense(1)	ovary(1)	2											72.0	71.0	71.0					2																	74751165		2203	4300	6503	74604673	SO:0001583	missense	165545			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.701C>T	2.37:g.74751165G>A	ENSP00000384621:p.Pro234Leu		74604673	Q6B017|Q8NAM8	Missense_Mutation	SNP	-	p.P116L	ENST00000404568.3	37	c.347	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	G	2.287	-0.363371	0.05103	.	.	ENSG00000144045	ENST00000393951;ENST00000404568;ENST00000451518	T;T;T	0.21191	3.2;3.2;2.02	5.38	1.22	0.21188	DEAD-like helicase (1);	0.695877	0.13971	N	0.350163	T	0.13072	0.0317	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25152	-1.0140	10	0.87932	D	0	-20.0491	3.6203	0.08093	0.4228:0.0:0.4066:0.1706	.	234	Q8TE96	DQX1_HUMAN	L	234;234;116	ENSP00000377523:P234L;ENSP00000384621:P234L;ENSP00000392969:P116L	ENSP00000377523:P234L	P	-	2	0	DQX1	74604673	0.004000	0.15560	0.003000	0.11579	0.020000	0.10135	1.354000	0.34056	0.160000	0.19432	0.609000	0.83330	CCC	-	NULL		0.547	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	protein_coding	OTTHUMT00000252230.3	G	NM_133637		74604673	-1	no_errors	NM_133637	genbank	human	validated	54_36p	missense	SNP		A
RMND5A	64795	genome.wustl.edu	37	2	86992174	86992174	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:86992174G>C	ENST00000283632.4	+	5	1041	c.546G>C	c.(544-546)atG>atC	p.M182I		NM_022780.3	NP_073617.1	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog A (S. cerevisiae)	182	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.							p.M182I(1)		kidney(1)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	17						ACCGGGAAATGCTTATAGCTC	0.373																																																1	Substitution - Missense(1)	ovary(1)	2											139.0	134.0	136.0					2																	86992174		2203	4300	6503	86845685	SO:0001583	missense	64795			BC012165	CCDS1991.1	2p11.2	2012-07-20			ENSG00000153561	ENSG00000153561			25850	protein-coding gene	gene with protein product	"""GID complex subunit 2 homolog A"""					12477932	Standard	NM_022780		Approved	FLJ13910, RMD5, GID2, GID2A	uc002srs.4	Q9H871	OTTHUMG00000130262	ENST00000283632.4:c.546G>C	2.37:g.86992174G>C	ENSP00000283632:p.Met182Ile		86845685	D6W5M6|Q6NTF0|Q9H6W5|Q9H9H2	Missense_Mutation	SNP	-	p.M182I	ENST00000283632.4	37	c.546	CCDS1991.1	2	.	.	.	.	.	.	.	.	.	.	G	16.56	3.156530	0.57259	.	.	ENSG00000153561	ENST00000283632	.	.	.	5.52	5.52	0.82312	CTLH, C-terminal LisH motif (2);	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	N	0.14661	0.345	0.51233	D	0.999913	B	0.22211	0.066	B	0.17433	0.018	T	0.40979	-0.9534	9	0.42905	T	0.14	-6.3239	19.434	0.94783	0.0:0.0:1.0:0.0	.	182	Q9H871	RMD5A_HUMAN	I	182	.	ENSP00000283632:M182I	M	+	3	0	RMND5A	86845685	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.168000	0.58216	2.590000	0.87494	0.563000	0.77884	ATG	-	NULL		0.373	RMND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND5A	protein_coding	OTTHUMT00000252591.2	G	NM_022780		86845685	1	no_errors	NM_022780	genbank	human	validated	54_36p	missense	SNP	1	C
RPIA	22934	genome.wustl.edu	37	2	89028821	89028821	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:89028821G>A	ENST00000283646.4	+	4	483	c.428G>A	c.(427-429)gGc>gAc	p.G143D		NM_144563.2	NP_653164.2	P49247	RPIA_HUMAN	ribose 5-phosphate isomerase A	143					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|ribose phosphate metabolic process (GO:0019693)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	monosaccharide binding (GO:0048029)|ribose-5-phosphate isomerase activity (GO:0004751)	p.G143D(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18		Acute lymphoblastic leukemia(2;0.000456)|all_hematologic(2;0.00287)				CTGCAGTATGGCTTGACCCTC	0.498																																																1	Substitution - Missense(1)	ovary(1)	2											73.0	81.0	78.0					2																	89028821		2001	4163	6164	88809936	SO:0001583	missense	22934			L35035	CCDS2004.2	2p11.2	2008-07-31	2008-07-31		ENSG00000153574	ENSG00000153574	5.3.1.6		10297	protein-coding gene	gene with protein product	"""ribose 5-phosphate epimerase"""	180430				7758956	Standard	NM_144563		Approved		uc002ste.3	P49247	OTTHUMG00000130333	ENST00000283646.4:c.428G>A	2.37:g.89028821G>A	ENSP00000283646:p.Gly143Asp		88809936	Q541P9|Q96BJ6	Missense_Mutation	SNP	HMMPfam_Rib_5-P_isom_A;superfamily_NagB/RpiA/CoA transferase-like;superfamily_D-ribose-5-phosphate isomerase (RpiA) lid domain	p.G143D	ENST00000283646.4	37	c.428	CCDS2004.2	2	.	.	.	.	.	.	.	.	.	.	G	31	5.088632	0.94100	.	.	ENSG00000153574	ENST00000283646;ENST00000543560	D	0.81908	-1.55	5.71	5.71	0.89125	.	0.044796	0.85682	D	0.000000	D	0.92456	0.7605	M	0.88181	2.935	0.80722	D	1	D	0.63880	0.993	D	0.66196	0.942	D	0.93085	0.6495	10	0.66056	D	0.02	-17.9864	19.4332	0.94779	0.0:0.0:1.0:0.0	.	143	P49247	RPIA_HUMAN	D	143;9	ENSP00000283646:G143D	ENSP00000283646:G143D	G	+	2	0	RPIA	88809936	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	6.023000	0.70848	2.690000	0.91761	0.655000	0.94253	GGC	-	HMMPfam_Rib_5-P_isom_A		0.498	RPIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPIA	protein_coding	OTTHUMT00000252683.2	G			88809936	1	no_errors	NM_144563	genbank	human	validated	54_36p	missense	SNP	1	A
SP110	3431	genome.wustl.edu	37	2	231077539	231077539	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr2:231077539G>C	ENST00000358662.4	-	4	598	c.520C>G	c.(520-522)Ccc>Gcc	p.P174A	SP110_ENST00000338556.3_5'UTR|SP110_ENST00000258382.5_Missense_Mutation_p.P174A|SP110_ENST00000486146.2_5'UTR|SP110_ENST00000540870.1_Missense_Mutation_p.P180A|SP110_ENST00000258381.6_Missense_Mutation_p.P174A|SP110_ENST00000392048.3_Missense_Mutation_p.P174A	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	174					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)	p.P174A(1)		breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		GATGGGCTGGGCGACTCACTC	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											168.0	163.0	165.0					2																	231077539		2203	4300	6503	230785783	SO:0001583	missense	3431			L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.520C>G	2.37:g.231077539G>C	ENSP00000351488:p.Pro174Ala		230785783	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	HMMPfam_SAND;HMMPfam_Bromodomain;HMMPfam_PHD;HMMPfam_Sp100;superfamily_SAND domain-like;superfamily_FYVE/PHD zinc finger;superfamily_Bromodomain	p.P174A	ENST00000358662.4	37	c.520	CCDS2474.1	2	.	.	.	.	.	.	.	.	.	.	G	10.69	1.420042	0.25552	.	.	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870;ENST00000409815;ENST00000455674	T;T;T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08;3.08;3.08	3.78	-0.304	0.12788	.	0.441505	0.16846	N	0.197160	T	0.07773	0.0195	L	0.58101	1.795	0.09310	N	0.999998	B;B;P;P	0.48834	0.192;0.192;0.916;0.838	B;B;B;P	0.45099	0.065;0.065;0.312;0.469	T	0.26849	-1.0091	10	0.11182	T	0.66	.	3.6929	0.08353	0.3437:0.1872:0.469:0.0	.	174;180;174;174	G5E9C0;F5H1M1;Q9HB58;Q9HB58-6	.;.;SP110_HUMAN;.	A	174;174;174;174;180;174;128	ENSP00000258381:P174A;ENSP00000351488:P174A;ENSP00000375902:P174A;ENSP00000258382:P174A;ENSP00000439558:P180A;ENSP00000387172:P174A;ENSP00000393992:P128A	ENSP00000258381:P174A	P	-	1	0	SP110	230785783	0.027000	0.19231	0.001000	0.08648	0.054000	0.15201	0.356000	0.20181	-0.081000	0.12662	0.650000	0.86243	CCC	-	NULL		0.562	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP110	protein_coding	OTTHUMT00000332414.1	G	NM_080424		230785783	-1	no_errors	NM_080424	genbank	human	reviewed	54_36p	missense	SNP	0.01	C
KIF3B	9371	genome.wustl.edu	37	20	30904343	30904343	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr20:30904343G>C	ENST00000375712.3	+	4	1687	c.1520G>C	c.(1519-1521)aGa>aCa	p.R507T	KIF3B_ENST00000418717.2_Missense_Mutation_p.R133T	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	507					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)	p.R507T(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CGTCGAGAAAGAGAAATCCAG	0.458																																																1	Substitution - Missense(1)	ovary(1)	20											61.0	57.0	59.0					20																	30904343		2203	4300	6503	30368004	SO:0001583	missense	9371			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1520G>C	20.37:g.30904343G>C	ENSP00000364864:p.Arg507Thr		30368004	B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	Kinesin;HMMPfam_Kinesin;P-loop containing nucleoside triphosphate hydrolases;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R507T	ENST00000375712.3	37	c.1520	CCDS13200.1	20	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710738	0.48517	.	.	ENSG00000101350	ENST00000375712;ENST00000418717	T;T	0.74947	-0.89;0.44	4.42	4.42	0.53409	.	0.059695	0.64402	D	0.000003	T	0.79435	0.4445	M	0.77616	2.38	0.80722	D	1	P;P	0.47253	0.892;0.884	P;B	0.48189	0.57;0.298	T	0.78196	-0.2298	10	0.23302	T	0.38	.	17.5708	0.87933	0.0:0.0:1.0:0.0	.	133;507	B4DSR5;O15066	.;KIF3B_HUMAN	T	507;133	ENSP00000364864:R507T;ENSP00000406287:R133T	ENSP00000364864:R507T	R	+	2	0	KIF3B	30368004	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.571000	0.98176	2.447000	0.82792	0.542000	0.68232	AGA	-	NULL		0.458	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	protein_coding	OTTHUMT00000078619.1	G	NM_004798		30368004	1	no_errors	NM_004798	genbank	human	reviewed	54_36p	missense	SNP	1	C
BPI	671	genome.wustl.edu	37	20	36952363	36952363	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr20:36952363T>C	ENST00000262865.4	+	8	949	c.860T>C	c.(859-861)cTg>cCg	p.L287P	BPI_ENST00000489102.1_3'UTR|CTD-2308N23.2_ENST00000437016.1_RNA	NM_001725.2	NP_001716.2	P17213	BPI_HUMAN	bactericidal/permeability-increasing protein	287					defense response to bacterium (GO:0042742)|immune response (GO:0006955)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of macrophage activation (GO:0043031)|negative regulation of tumor necrosis factor production (GO:0032720)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	lipopolysaccharide binding (GO:0001530)	p.L287P(1)		kidney(1)|large_intestine(6)|lung(15)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)				ATGGTATACCTGGGCCTCTCA	0.547																																																1	Substitution - Missense(1)	ovary(1)	20											110.0	93.0	99.0					20																	36952363		2203	4300	6503	36385777	SO:0001583	missense	671			J04739	CCDS13303.1	20q11.23	2011-08-16			ENSG00000101425	ENSG00000101425		"""BPI fold containing"""	1095	protein-coding gene	gene with protein product	"""BPI fold containing family D, member 1"""	109195				8432532	Standard	NM_001725		Approved	BPIFD1	uc002xia.2	P17213	OTTHUMG00000032441	ENST00000262865.4:c.860T>C	20.37:g.36952363T>C	ENSP00000262865:p.Leu287Pro		36385777	B2RCY2|Q1ZZU8|Q5JRW0|Q8IW58|Q9BYZ9|Q9H1L2|Q9H1M8|Q9H203|Q9UCT4|Q9UD65	Missense_Mutation	SNP	-	p.L287P	ENST00000262865.4	37	c.860	CCDS13303.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.49|19.49	3.837042|3.837042	0.71373|0.71373	.|.	.|.	ENSG00000101425|ENSG00000101425	ENST00000262865|ENST00000417318	T|.	0.13778|.	2.56|.	4.5|4.5	4.5|4.5	0.54988|0.54988	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);|.	0.320195|.	0.25768|.	N|.	0.028433|.	T|T	0.71986|0.71986	0.3405|0.3405	M|M	0.73962|0.73962	2.25|2.25	0.38883|0.38883	D|D	0.95695|0.95695	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.74861|0.74861	-0.3520|-0.3520	10|5	0.72032|.	D|.	0.01|.	-10.5829|-10.5829	12.1087|12.1087	0.53827|0.53827	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	287|.	P17213|.	BPI_HUMAN|.	P|R	287|113	ENSP00000262865:L287P|.	ENSP00000262865:L287P|.	L|W	+|+	2|1	0|0	BPI|BPI	36385777|36385777	1.000000|1.000000	0.71417|0.71417	0.191000|0.191000	0.23289|0.23289	0.468000|0.468000	0.32798|0.32798	3.434000|3.434000	0.52841|0.52841	2.020000|2.020000	0.59435|0.59435	0.533000|0.533000	0.62120|0.62120	CTG|TGG	-	NULL		0.547	BPI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BPI	protein_coding	OTTHUMT00000079157.2	T	NM_001725		36385777	1	no_errors	NM_001725	genbank	human	reviewed	54_36p	missense	SNP	0.82	C
CDH26	60437	genome.wustl.edu	37	20	58570969	58570969	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr20:58570969G>A	ENST00000244047.5	+	12	2059	c.1748G>A	c.(1747-1749)gGa>gAa	p.G583E	CDH26_ENST00000244049.3_5'Flank|CDH26_ENST00000350849.6_5'Flank|CDH26_ENST00000348616.4_Missense_Mutation_p.G583E|CDH26_ENST00000497614.1_3'UTR			Q8IXH8	CAD26_HUMAN	cadherin 26	583					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G583E(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GACAAACAGGGACTTTCCCAG	0.498																																																1	Substitution - Missense(1)	ovary(1)	20											128.0	115.0	120.0					20																	58570969		2203	4300	6503	58004364	SO:0001583	missense	60437			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1748G>A	20.37:g.58570969G>A	ENSP00000244047:p.Gly583Glu		58004364	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	-	p.G583E	ENST00000244047.5	37	c.1748		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.38|16.38	3.106356|3.106356	0.56291|0.56291	.|.	.|.	ENSG00000124215|ENSG00000124215	ENST00000370991|ENST00000244047;ENST00000348616	.|T;T	.|0.62364	.|0.03;0.03	4.56|4.56	4.56|4.56	0.56223|0.56223	.|Cadherin-like (1);	.|0.276491	.|0.36703	.|N	.|0.002442	T|T	0.78868|0.78868	0.4351|0.4351	M|M	0.73598|0.73598	2.24|2.24	0.42896|0.42896	D|D	0.994211|0.994211	.|P;D	.|0.89917	.|0.609;1.0	.|P;D	.|0.91635	.|0.453;0.999	T|T	0.82392|0.82392	-0.0480|-0.0480	5|10	.|0.72032	.|D	.|0.01	.|.	16.4509|16.4509	0.83990|0.83990	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|583;583	.|Q8IXH8;Q8IXH8-4	.|CAD26_HUMAN;.	N|E	175|583	.|ENSP00000244047:G583E;ENSP00000339390:G583E	.|ENSP00000244047:G583E	D|G	+|+	1|2	0|0	CDH26|CDH26	58004364|58004364	1.000000|1.000000	0.71417|0.71417	0.196000|0.196000	0.23383|0.23383	0.455000|0.455000	0.32408|0.32408	5.605000|5.605000	0.67634|0.67634	2.239000|2.239000	0.73571|0.73571	0.655000|0.655000	0.94253|0.94253	GAC|GGA	-	NULL		0.498	CDH26-201	KNOWN	basic	protein_coding	CDH26	protein_coding		G	NM_177980		58004364	1	no_errors	NM_177980	genbank	human	reviewed	54_36p	missense	SNP	0.95	A
IGLV10-54	28772	genome.wustl.edu	37	22	22569407	22569407	+	RNA	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr22:22569407G>T	ENST00000390287.2	+	0	112									immunoglobulin lambda variable 10-54																		CCAAGGGCTTGAGACAGACCG	0.592																																																0			22											31.0	35.0	34.0					22																	22569407		2153	4263	6416	20899407			28772			Z73676		22q11.2	2012-02-08			ENSG00000211642	ENSG00000211642		"""Immunoglobulins / IGL locus"""	5884	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000150993		22.37:g.22569407G>T			20899407		Missense_Mutation	SNP	-	p.L33F	ENST00000390287.2	37	c.99		22																																																																																			-	NULL		0.592	IGLV10-54-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV10-54	IG_V_gene	OTTHUMT00000320858.1	G	NG_000002		20899407	1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390287	ensembl	human	known	54_36p	missense	SNP	0.01	T
SLC5A3	6526	genome.wustl.edu	37	21	35468095	35468095	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr21:35468095A>G	ENST00000381151.3	+	2	1110	c.598A>G	c.(598-600)Atg>Gtg	p.M200V	SLC5A3_ENST00000608209.1_Missense_Mutation_p.M200V|MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	200					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)	p.M200V(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						ACTTACACTTATGATTATTAG	0.468																																																1	Substitution - Missense(1)	ovary(1)	21											83.0	76.0	79.0					21																	35468095		2203	4300	6503	34389965	SO:0001583	missense	6526				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.598A>G	21.37:g.35468095A>G	ENSP00000370543:p.Met200Val		34389965	O43489	Missense_Mutation	SNP	HMMPfam_SSF	p.M200V	ENST00000381151.3	37	c.598	CCDS33549.1	21	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312630	0.40895	.	.	ENSG00000198743	ENST00000381151	D	0.87966	-2.32	5.72	5.72	0.89469	.	0.148560	0.64402	D	0.000015	D	0.82829	0.5122	L	0.41632	1.29	0.40723	D	0.982671	P	0.41345	0.746	B	0.37550	0.253	D	0.85741	0.1337	10	0.87932	D	0	.	15.6743	0.77303	1.0:0.0:0.0:0.0	.	200	P53794	SC5A3_HUMAN	V	200	ENSP00000370543:M200V	ENSP00000370543:M200V	M	+	1	0	SLC5A3	34389965	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	9.339000	0.96797	2.180000	0.69256	0.496000	0.49642	ATG	-	HMMPfam_SSF		0.468	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	SLC5A3	protein_coding	OTTHUMT00000141037.1	A			34389965	1	no_errors	NM_006933	genbank	human	validated	54_36p	missense	SNP	1	G
CHAF1B	8208	genome.wustl.edu	37	21	37758546	37758546	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr21:37758546G>T	ENST00000314103.5	+	2	263	c.112G>T	c.(112-114)Gac>Tac	p.D38Y	CHAF1B_ENST00000480486.1_3'UTR	NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	38					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)	p.D38Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						TGCCGGCGTGGACACCAATGT	0.537																																																1	Substitution - Missense(1)	ovary(1)	21											66.0	71.0	69.0					21																	37758546		2203	4300	6503	36680416	SO:0001583	missense	8208			U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.112G>T	21.37:g.37758546G>T	ENSP00000315700:p.Asp38Tyr		36680416	Q99548	Missense_Mutation	SNP	HMMPfam_WD40,superfamily_WD40 repeat-like	p.D38Y	ENST00000314103.5	37	c.112	CCDS13644.1	21	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148325	0.78001	.	.	ENSG00000159259	ENST00000314103	T	0.75050	-0.9	4.61	4.61	0.57282	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.89494	0.6731	M	0.94021	3.485	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	D	0.92697	0.6171	9	.	.	.	-23.9711	17.0666	0.86561	0.0:0.0:1.0:0.0	.	38	Q13112	CAF1B_HUMAN	Y	38	ENSP00000315700:D38Y	.	D	+	1	0	CHAF1B	36680416	1.000000	0.71417	0.995000	0.50966	0.424000	0.31475	9.156000	0.94705	2.093000	0.63338	0.561000	0.74099	GAC	-	HMMPfam_WD40		0.537	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1B	protein_coding	OTTHUMT00000194616.2	G	NM_005441		36680416	1	no_errors	NM_005441	genbank	human	reviewed	54_36p	missense	SNP	1	T
C2CD2	25966	genome.wustl.edu	37	21	43327785	43327785	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr21:43327785C>G	ENST00000380486.3	-	9	1368	c.1127G>C	c.(1126-1128)gGc>gCc	p.G376A	C2CD2_ENST00000329623.7_Missense_Mutation_p.G221A	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	376						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)		p.G376A(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						CGTGACCGAGCCCAGCACCGA	0.637																																																1	Substitution - Missense(1)	ovary(1)	21											22.0	25.0	24.0					21																	43327785		2203	4300	6503	42200854	SO:0001583	missense	25966			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.1127G>C	21.37:g.43327785C>G	ENSP00000369853:p.Gly376Ala		42200854	Q5R2V7|Q6AHX8|Q9NSE6	Missense_Mutation	SNP	-	p.G376A	ENST00000380486.3	37	c.1127	CCDS42933.1	21	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413120	0.42817	.	.	ENSG00000157617	ENST00000329623;ENST00000380486	T;T	0.78481	-1.18;-1.18	5.51	5.51	0.81932	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.82870	0.5131	L	0.38175	1.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78265	-0.2271	10	0.19590	T	0.45	-28.0822	19.0649	0.93106	0.0:1.0:0.0:0.0	.	221;376	Q6P6D1;Q9Y426	.;CU025_HUMAN	A	221;376	ENSP00000329302:G221A;ENSP00000369853:G376A	ENSP00000329302:G221A	G	-	2	0	C2CD2	42200854	1.000000	0.71417	0.984000	0.44739	0.116000	0.19942	5.295000	0.65692	2.590000	0.87494	0.650000	0.86243	GGC	-	NULL		0.637	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD2	protein_coding	OTTHUMT00000195228.2	C	NM_015500		42200854	-1	no_errors	NM_015500	genbank	human	validated	54_36p	missense	SNP	0.997	G
TMPRSS3	64699	genome.wustl.edu	37	21	43796684	43796684	+	Missense_Mutation	SNP	G	G	T	rs201172277		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr21:43796684G>T	ENST00000291532.3	-	11	2115	c.1160C>A	c.(1159-1161)gCg>gAg	p.A387E	TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000380399.1_Missense_Mutation_p.A471E|TMPRSS3_ENST00000433957.2_Missense_Mutation_p.A386E|TMPRSS3_ENST00000398405.1_Missense_Mutation_p.A384E	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	387	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			ICNHRDVYGGIISPSMLCAGYLTGGVD -> DLQPQGRVRW HHLPLHALRGLPDGWRWN (in Ref. 1; AAG37012). {ECO:0000305}.	cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)	p.A387E(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						CAGGTAGCCCGCGCAGAGCAT	0.662																																																1	Substitution - Missense(1)	ovary(1)	21											115.0	100.0	105.0					21																	43796684		2203	4300	6503	42669753	SO:0001583	missense	64699			AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.1160C>A	21.37:g.43796684G>T	ENSP00000291532:p.Ala387Glu		42669753	D3DSJ6|Q5USC7|Q6ZMC3	Missense_Mutation	SNP	HMMPfam_SRCR;superfamily_SRCR-like;HMMPfam_Trypsin;superfamily_Trypsin-like serine proteases;superfamily_LDL receptor-like module	p.A387E	ENST00000291532.3	37	c.1160	CCDS13686.1	21	.	.	.	.	.	.	.	.	.	.	G	27.5	4.832807	0.91036	.	.	ENSG00000160183	ENST00000291532;ENST00000433957;ENST00000398405;ENST00000380399	D;D;D;D	0.91521	-2.86;-2.06;-2.06;-2.86	4.94	4.94	0.65067	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.97025	0.9028	H	0.95884	3.735	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.996	D	0.98516	1.0621	9	.	.	.	.	18.1681	0.89734	0.0:0.0:1.0:0.0	.	386;387;384	P57727-5;P57727;B7WPR2	.;TMPS3_HUMAN;.	E	387;386;384;471	ENSP00000291532:A387E;ENSP00000411013:A386E;ENSP00000381442:A384E;ENSP00000369762:A471E	.	A	-	2	0	TMPRSS3	42669753	1.000000	0.71417	0.491000	0.27477	0.822000	0.46500	9.048000	0.93830	2.269000	0.75478	0.591000	0.81541	GCG	-	HMMPfam_Trypsin		0.662	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS3	protein_coding	OTTHUMT00000195347.1	G			42669753	-1	no_errors	NM_024022	genbank	human	reviewed	54_36p	missense	SNP	1	T
PTTG1IP	754	genome.wustl.edu	37	21	46276241	46276241	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr21:46276241C>G	ENST00000330938.3	-	4	536	c.316G>C	c.(316-318)Ggg>Cgg	p.G106R	PTTG1IP_ENST00000494690.1_5'UTR|PTTG1IP_ENST00000397887.3_Intron|PTTG1IP_ENST00000397886.3_Missense_Mutation_p.G85R|PTTG1IP_ENST00000445724.2_Intron	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	106					multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)	p.G106R(1)		ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		AGGGTTCCCCCGACTACCGAC	0.607																																																1	Substitution - Missense(1)	ovary(1)	21											101.0	85.0	90.0					21																	46276241		2203	4300	6503	45100669	SO:0001583	missense	754			AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.316G>C	21.37:g.46276241C>G	ENSP00000328325:p.Gly106Arg		45100669	B2RDP7|D3DSL9|Q9NS09	Missense_Mutation	SNP	-	p.G106R	ENST00000330938.3	37	c.316	CCDS13715.1	21	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608734	0.46527	.	.	ENSG00000183255	ENST00000330938;ENST00000397886	T;T	0.58210	0.35;0.35	5.02	4.13	0.48395	.	0.309727	0.34362	N	0.004033	T	0.72382	0.3453	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75986	-0.3124	10	0.72032	D	0.01	-12.0936	11.4386	0.50083	0.0:0.9098:0.0:0.0902	.	106	P53801	PTTG_HUMAN	R	106;85	ENSP00000328325:G106R;ENSP00000380983:G85R	ENSP00000328325:G106R	G	-	1	0	PTTG1IP	45100669	0.967000	0.33354	0.078000	0.20375	0.004000	0.04260	5.952000	0.70282	1.215000	0.43411	0.579000	0.79373	GGG	-	NULL		0.607	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG1IP	protein_coding	OTTHUMT00000206553.1	C			45100669	-1	no_errors	NM_004339	genbank	human	reviewed	54_36p	missense	SNP	0.87	G
TEF	7008	genome.wustl.edu	37	22	41783493	41783498	+	In_Frame_Del	DEL	TGGACC	TGGACC	-			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	TGGACC	TGGACC	TGGACC	-	TGGACC	TGGACC	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr22:41783493_41783498delTGGACC	ENST00000266304.4	+	2	412_417	c.296_301delTGGACC	c.(295-303)atggacctg>atg	p.DL100del	TEF_ENST00000406644.3_In_Frame_Del_p.DL70del	NM_003216.3	NP_003207.1	Q10587	TEF_HUMAN	thyrotrophic embryonic factor	100					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L101_D102del(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						CTGGAGTACATGGACCTGGATGAGTT	0.607																																																1	Deletion - In frame(1)	ovary(1)	22																																								40113444	SO:0001651	inframe_deletion	7008				CCDS14014.1, CCDS46716.1	22q13.2	2013-01-10			ENSG00000167074	ENSG00000167074		"""basic leucine zipper proteins"""	11722	protein-coding gene	gene with protein product		188595				7835883, 15665112	Standard	NM_001145398		Approved	KIAA1655	uc003azy.4	Q10587	OTTHUMG00000150968	ENST00000266304.4:c.296_301delTGGACC	22.37:g.41783493_41783498delTGGACC	ENSP00000266304:p.Asp100_Leu101del		40113439	B0QYS8|B2RC22|Q15729|Q7Z3J7|Q8IU94|Q96TG4	In_Frame_Del	DEL	-	p.LD101in_frame_del	ENST00000266304.4	37	c.296_301	CCDS14014.1	22																																																																																			(deletion:cds_exon[40113301;40113618])	NULL		0.607	TEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEF	protein_coding	OTTHUMT00000320692.1	TGGACC	NM_003216		40113444	1	no_errors	NM_003216	genbank	human	reviewed	54_36p	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000	-
GOLGB1	2804	genome.wustl.edu	37	3	121415560	121415560	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:121415560T>A	ENST00000340645.5	-	13	3920	c.3795A>T	c.(3793-3795)gaA>gaT	p.E1265D	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E1270D	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1265					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.E1265D(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TGAATAAAGGTTCTTCTAAAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											169.0	155.0	160.0					3																	121415560		2203	4300	6503	122898250	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.3795A>T	3.37:g.121415560T>A	ENSP00000341848:p.Glu1265Asp		122898250	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	-	p.E1265D	ENST00000340645.5	37	c.3795	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	T	5.045	0.194065	0.09599	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517	T;T;T	0.26373	2.34;2.34;1.74	5.46	-3.72	0.04411	.	0.733181	0.12618	N	0.453255	T	0.15955	0.0384	L	0.57536	1.79	0.09310	N	1	B;B;B;B;B	0.10296	0.003;0.001;0.001;0.001;0.001	B;B;B;B;B	0.09377	0.004;0.003;0.003;0.003;0.003	T	0.35325	-0.9793	10	0.14252	T	0.57	.	1.9448	0.03354	0.1308:0.1537:0.3525:0.3629	.	1190;1229;1270;1270;1265	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	D	1265;1270;1229	ENSP00000341848:E1265D;ENSP00000377275:E1270D;ENSP00000418231:E1229D	ENSP00000341848:E1265D	E	-	3	2	GOLGB1	122898250	0.000000	0.05858	0.085000	0.20634	0.438000	0.31896	-0.839000	0.04368	-0.223000	0.09943	0.533000	0.62120	GAA	-	NULL		0.473	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	protein_coding	OTTHUMT00000355159.1	T	NM_004487		122898250	-1	no_errors	NM_004487	genbank	human	validated	54_36p	missense	SNP		A
FAM162A	26355	genome.wustl.edu	37	3	122123190	122123190	+	Silent	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:122123190T>C	ENST00000477892.1	+	3	327	c.243T>C	c.(241-243)gaT>gaC	p.D81D	FAM162A_ENST00000232125.5_Silent_p.D71D|FAM162A_ENST00000469967.1_Silent_p.D81D	NM_014367.3	NP_055182.3	Q96A26	F162A_HUMAN	family with sequence similarity 162, member A	81	Required for proapoptotic activity.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to hypoxia (GO:0071456)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|transformed cell apoptotic process (GO:0006927)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.D81D(2)		breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6						AAAAGGAAGATGAAATCCCAG	0.418																																																2	Substitution - coding silent(2)	ovary(2)	3											85.0	83.0	84.0					3																	122123190		1902	4120	6022	123605880	SO:0001819	synonymous_variant	26355			AF191020	CCDS43139.1	3q21.1	2008-06-05	2008-06-05	2008-06-05	ENSG00000114023	ENSG00000114023			17865	protein-coding gene	gene with protein product		608017	"""chromosome 3 open reading frame 28"""	C3orf28		11085516	Standard	NM_014367		Approved	E2IG5	uc003eez.3	Q96A26	OTTHUMG00000159494	ENST00000477892.1:c.243T>C	3.37:g.122123190T>C			123605880	Q9NRN6|Q9UJX8	Silent	SNP	-	p.D81	ENST00000477892.1	37	c.243	CCDS43139.1	3																																																																																			-	NULL		0.418	FAM162A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM162A	protein_coding	OTTHUMT00000355766.1	T	NM_014367		123605880	1	no_errors	NM_014367	genbank	human	validated	54_36p	silent	SNP	0.93	C
SEMA5B	54437	genome.wustl.edu	37	3	122679987	122679987	+	Splice_Site	SNP	C	C	A	rs148102705	byFrequency	TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:122679987C>A	ENST00000357599.3	-	2	510	c.124G>T	c.(124-126)Ggt>Tgt	p.G42C	SEMA5B_ENST00000195173.4_Splice_Site_p.G42C|SEMA5B_ENST00000465147.1_Intron|SEMA5B_ENST00000451055.2_Splice_Site_p.G96C	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	42			G -> S (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.G42C(1)|p.G42S(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCACACTTACCCCTGACCAGT	0.627																																																2	Substitution - Missense(2)	ovary(1)|breast(1)	3											64.0	53.0	57.0					3																	122679987		2203	4300	6503	124162677	SO:0001630	splice_region_variant	54437			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.124+1G>T	3.37:g.122679987C>A			124162677	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	HMMPfam_TSP_1;HMMPfam_Sema;superfamily_Sema domain;HMMPfam_PSI;superfamily_Plexin repeat;superfamily_TSP-1 type 1 repeat	p.G42C	ENST00000357599.3	37	c.124	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651085	0.29336	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000451055;ENST00000393583;ENST00000421053;ENST00000449546	T;T;T;T	0.38401	1.22;1.14;1.19;1.32	4.38	2.58	0.30949	.	.	.	.	.	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	P	0.50710	0.938	P	0.44518	0.452	T	0.05517	-1.0880	8	.	.	.	.	6.952	0.24550	0.0:0.7893:0.0:0.2107	.	42	Q9P283	SEM5B_HUMAN	C	42;42;96;42;42;42	ENSP00000350215:G42C;ENSP00000195173:G42C;ENSP00000389588:G96C;ENSP00000377208:G42C	.	G	-	1	0	SEMA5B	124162677	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	0.201000	0.17276	0.482000	0.27582	0.655000	0.94253	GGT	-	NULL		0.627	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	protein_coding	OTTHUMT00000277165.1	C	NM_001031702	Missense_Mutation	124162677	-1	no_errors	NM_001031702	genbank	human	validated	54_36p	missense	SNP	0.1	A
PIK3R4	30849	genome.wustl.edu	37	3	130405249	130405249	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:130405249T>G	ENST00000356763.3	-	15	3838	c.3281A>C	c.(3280-3282)gAg>gCg	p.E1094A	PIK3R4_ENST00000512677.1_5'UTR	NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	1094					innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E1094A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						ACAACCGTCCTCCTTCTGATC	0.443																																																1	Substitution - Missense(1)	ovary(1)	3											119.0	107.0	112.0					3																	130405249		2203	4300	6503	131887939	SO:0001583	missense	30849			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.3281A>C	3.37:g.130405249T>G	ENSP00000349205:p.Glu1094Ala		131887939	Q2TBF4	Missense_Mutation	SNP	HMMPfam_HEAT;HMMPfam_Pkinase;HMMPfam_WD40;superfamily_Protein kinase-like (PK-like);superfamily_WD40 repeat-like;superfamily_ARM repeat	p.E1094A	ENST00000356763.3	37	c.3281	CCDS3067.1	3	.	.	.	.	.	.	.	.	.	.	T	16.55	3.155066	0.57259	.	.	ENSG00000196455	ENST00000356763	T	0.01295	5.04	5.13	5.13	0.70059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.316182	0.36703	N	0.002455	T	0.02193	0.0068	M	0.61703	1.905	0.58432	D	0.99999	P	0.40066	0.701	B	0.35770	0.21	T	0.64236	-0.6455	10	0.14252	T	0.57	-8.5947	15.2302	0.73381	0.0:0.0:0.0:1.0	.	1094	Q99570	PI3R4_HUMAN	A	1094	ENSP00000349205:E1094A	ENSP00000349205:E1094A	E	-	2	0	PIK3R4	131887939	1.000000	0.71417	0.998000	0.56505	0.804000	0.45430	7.545000	0.82128	2.078000	0.62432	0.459000	0.35465	GAG	-	NULL		0.443	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	protein_coding	OTTHUMT00000356668.1	T	NM_014602		131887939	-1	no_errors	NM_014602	genbank	human	validated	54_36p	missense	SNP	1	G
TMEM108	66000	genome.wustl.edu	37	3	133099844	133099844	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:133099844T>A	ENST00000321871.6	+	4	1499	c.1289T>A	c.(1288-1290)cTc>cAc	p.L430H	TMEM108_ENST00000515826.1_Missense_Mutation_p.L430H|TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Missense_Mutation_p.L430H	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	430						integral component of membrane (GO:0016021)		p.L430H(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						GGCAATTTCCTCAACCGCCTG	0.627																																																1	Substitution - Missense(1)	ovary(1)	3											52.0	57.0	55.0					3																	133099844		2203	4300	6503	134582534	SO:0001583	missense	66000			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.1289T>A	3.37:g.133099844T>A	ENSP00000324651:p.Leu430His		134582534	D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	-	p.L430H	ENST00000321871.6	37	c.1289	CCDS33858.1	3	.	.	.	.	.	.	.	.	.	.	T	19.62	3.862577	0.71949	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000515826	T;T;T	0.60424	0.32;0.32;0.19	3.66	3.66	0.41972	.	0.111282	0.36374	N	0.002637	T	0.70631	0.3246	L	0.60455	1.87	0.47547	D	0.999456	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.74334	-0.3699	10	0.87932	D	0	-19.1789	12.7537	0.57321	0.0:0.0:0.0:1.0	.	430;430	E9PB58;Q6UXF1	.;TM108_HUMAN	H	430	ENSP00000324651:L430H;ENSP00000376838:L430H;ENSP00000423338:L430H	ENSP00000324651:L430H	L	+	2	0	TMEM108	134582534	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.647000	0.67923	1.665000	0.50811	0.459000	0.35465	CTC	-	NULL		0.627	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM108	protein_coding	OTTHUMT00000356907.2	T	NM_023943		134582534	1	no_errors	NM_023943	genbank	human	validated	54_36p	missense	SNP	1	A
EOMES	8320	genome.wustl.edu	37	3	27758785	27758785	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:27758785C>A	ENST00000295743.4	-	6	2040	c.1837G>T	c.(1837-1839)Gaa>Taa	p.E613*	EOMES_ENST00000449599.1_Nonsense_Mutation_p.E632*|EOMES_ENST00000537516.1_Nonsense_Mutation_p.E337*|EOMES_ENST00000461503.1_5'Flank			O95936	EOMES_HUMAN	eomesodermin	613	Required for transcription activation. {ECO:0000250}.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E613*(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						GAGCCAATTTCCTCTTTCACT	0.483																																																1	Substitution - Nonsense(1)	ovary(1)	3											106.0	110.0	108.0					3																	27758785		2203	4300	6503	27733789	SO:0001587	stop_gained	8320			BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.1837G>T	3.37:g.27758785C>A	ENSP00000295743:p.Glu613*		27733789	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Nonsense_Mutation	SNP	-	p.E613*	ENST00000295743.4	37	c.1837	CCDS2646.1	3	.	.	.	.	.	.	.	.	.	.	C	38	6.937863	0.97948	.	.	ENSG00000163508	ENST00000295743;ENST00000449599;ENST00000537516;ENST00000535713	.	.	.	5.05	5.05	0.67936	.	1.966750	0.02853	N	0.129301	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.3091	0.94177	0.0:1.0:0.0:0.0	.	.	.	.	X	613;632;337;497	.	ENSP00000295743:E613X	E	-	1	0	EOMES	27733789	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.665000	0.68052	2.724000	0.93272	0.563000	0.77884	GAA	-	NULL		0.483	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	protein_coding	OTTHUMT00000252995.1	C	NM_005442		27733789	-1	no_errors	NM_005442	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
ZNF860	344787	genome.wustl.edu	37	3	32030804	32030804	+	Missense_Mutation	SNP	C	C	T	rs374760869		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:32030804C>T	ENST00000360311.4	+	2	782	c.233C>T	c.(232-234)gCg>gTg	p.A78V		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	78	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A78V(1)		endometrium(3)|lung(4)|ovary(1)	8						TCATCAACAGCGCAAGGCAAT	0.418																																																1	Substitution - Missense(1)	ovary(1)	3											86.0	68.0	74.0					3																	32030804		692	1591	2283	32005808	SO:0001583	missense	344787			AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.233C>T	3.37:g.32030804C>T	ENSP00000373274:p.Ala78Val		32005808	B4DFA4	Missense_Mutation	SNP	-	p.A62V	ENST00000360311.4	37	c.185	CCDS46784.1	3	.	.	.	.	.	.	.	.	.	.	c	2.551	-0.304007	0.05495	.	.	ENSG00000197385	ENST00000360311	T	0.04862	3.54	0.345	-0.691	0.11305	Krueppel-associated box (3);	.	.	.	.	T	0.04092	0.0114	L	0.29908	0.895	0.09310	N	1	B	0.19706	0.038	B	0.12837	0.008	T	0.45308	-0.9270	8	.	.	.	.	3.4544	0.07510	0.2353:0.2636:0.501:0.0	.	78	A6NHJ4	ZN860_HUMAN	V	78	ENSP00000373274:A78V	.	A	+	2	0	ZNF860	32005808	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.762000	0.04745	-1.862000	0.01151	-1.781000	0.00649	GCG	-	NULL		0.418	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF860	protein_coding	OTTHUMT00000341957.1	C			32005808	1	no_stop_codon	ENST00000360311	ensembl	human	known	54_36p	missense	SNP	0.02	T
DCLK3	85443	genome.wustl.edu	37	3	36756992	36756992	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:36756992G>A	ENST00000416516.2	-	5	2264	c.1774C>T	c.(1774-1776)Cgg>Tgg	p.R592W	DCLK3_ENST00000498047.1_5'Flank	NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	592	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.R592W(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						ACCAGCAACCGGCTCACCAGA	0.473																																																1	Substitution - Missense(1)	ovary(1)	3											79.0	79.0	79.0					3																	36756992		1938	4127	6065	36731996	SO:0001583	missense	85443			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.1774C>T	3.37:g.36756992G>A	ENSP00000394484:p.Arg592Trp		36731996		Missense_Mutation	SNP	-	p.R592W	ENST00000416516.2	37	c.1774	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	G	20.5	4.004690	0.74932	.	.	ENSG00000163673	ENST00000416516	T	0.67345	-0.26	5.75	3.79	0.43588	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.294650	0.06098	N	0.664791	T	0.75042	0.3796	L	0.48260	1.515	0.27854	N	0.940652	D	0.76494	0.999	P	0.57244	0.816	T	0.63703	-0.6577	10	0.87932	D	0	.	12.7537	0.57321	0.0:0.0:0.476:0.524	.	592	Q9C098	DCLK3_HUMAN	W	592	ENSP00000394484:R592W	ENSP00000394484:R592W	R	-	1	2	DCLK3	36731996	0.955000	0.32602	0.921000	0.36526	0.894000	0.52154	1.455000	0.35190	1.515000	0.48885	0.655000	0.94253	CGG	-	NULL		0.473	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	protein_coding	OTTHUMT00000341727.1	G	XM_047355		36731996	-1	no_errors	NM_033403	genbank	human	validated	54_36p	missense	SNP	0.34	A
ATR	545	genome.wustl.edu	37	3	142204036	142204036	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:142204036T>A	ENST00000350721.4	-	36	6288	c.6167A>T	c.(6166-6168)aAc>aTc	p.N2056I	ATR_ENST00000383101.3_Missense_Mutation_p.N1992I	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2056	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.N2056I(1)		NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTCCATTTTGTTGTCTGTGAC	0.413								Other conserved DNA damage response genes																																								1	Substitution - Missense(1)	ovary(1)	3											190.0	177.0	182.0					3																	142204036		2203	4300	6503	143686726	SO:0001583	missense	545			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6167A>T	3.37:g.142204036T>A	ENSP00000343741:p.Asn2056Ile		143686726	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	HMMPfam_HEAT;HMMPfam_PI3_PI4_kinase;HMMPfam_FAT;HMMPfam_FATC;superfamily_Protein kinase-like (PK-like);HMMPfam_UME;superfamily_ARM repeat;superfamily_TPR-like	p.N2056I	ENST00000350721.4	37	c.6167	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	T	28.0	4.880304	0.91740	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.69926	-0.44;-0.44	5.2	5.2	0.72013	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.043992	0.85682	D	0.000000	T	0.76912	0.4054	M	0.66939	2.045	0.80722	D	1	D	0.60575	0.988	P	0.57846	0.828	T	0.79495	-0.1780	10	0.59425	D	0.04	-9.143	15.343	0.74311	0.0:0.0:0.0:1.0	.	2056	Q13535	ATR_HUMAN	I	2056;1992	ENSP00000343741:N2056I;ENSP00000372581:N1992I	ENSP00000343741:N2056I	N	-	2	0	ATR	143686726	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.864000	0.87037	2.088000	0.63022	0.377000	0.23210	AAC	-	HMMPfam_FAT		0.413	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	protein_coding	OTTHUMT00000353995.2	T	NM_001184		143686726	-1	no_errors	NM_001184	genbank	human	reviewed	54_36p	missense	SNP	1	A
KIAA0922	23240	genome.wustl.edu	37	4	154502585	154502585	+	Silent	SNP	T	T	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:154502585T>G	ENST00000409663.3	+	9	817	c.765T>G	c.(763-765)gtT>gtG	p.V255V	KIAA0922_ENST00000440693.1_Silent_p.V255V|KIAA0922_ENST00000409959.3_Silent_p.V255V	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	255						integral component of membrane (GO:0016021)		p.V107V(1)		breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				CTGATGATGTTTTGCGTCTAC	0.333																																																1	Substitution - coding silent(1)	ovary(1)	4											114.0	113.0	113.0					4																	154502585		2203	4300	6503	154722035	SO:0001819	synonymous_variant	23240			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.765T>G	4.37:g.154502585T>G			154722035	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Silent	SNP	-	p.V107	ENST00000409663.3	37	c.321	CCDS3783.2	4																																																																																			-	NULL		0.333	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	protein_coding	OTTHUMT00000330370.1	T	NM_015196		154722035	1	no_errors	NM_015196	genbank	human	validated	54_36p	silent	SNP	0.01	G
ING2	3622	genome.wustl.edu	37	4	184432021	184432021	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:184432021G>T	ENST00000302327.3	+	2	961	c.759G>T	c.(757-759)tgG>tgT	p.W253C	ING2_ENST00000434682.2_Missense_Mutation_p.W213C	NM_001564.2	NP_001555.1	Q9H160	ING2_HUMAN	inhibitor of growth family, member 2	253					chromatin modification (GO:0016568)|male germ-line stem cell asymmetric division (GO:0048133)|male meiosis I (GO:0007141)|negative regulation of cell proliferation (GO:0008285)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cellular senescence (GO:2000772)|regulation of growth (GO:0040008)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|seminiferous tubule development (GO:0072520)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleus (GO:0005634)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)	p.W253C(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	7		all_lung(41;5.16e-14)|Lung NSC(41;1.33e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|all_hematologic(60;0.0207)|Prostate(90;0.0235)|all_neural(102;0.202)		all cancers(43;1.15e-26)|Epithelial(43;2.98e-22)|OV - Ovarian serous cystadenocarcinoma(60;7.64e-10)|GBM - Glioblastoma multiforme(59;4.22e-06)|Colorectal(24;5.87e-06)|STAD - Stomach adenocarcinoma(60;2.09e-05)|COAD - Colon adenocarcinoma(29;5.15e-05)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		AGGGGAAATGGTATTGCCCAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	4											82.0	79.0	80.0					4																	184432021		2203	4300	6503	184669015	SO:0001583	missense	3622			AB012853	CCDS3833.1	4q35.1	2013-01-28	2005-02-10	2005-02-11	ENSG00000168556	ENSG00000168556		"""Zinc fingers, PHD-type"""	6063	protein-coding gene	gene with protein product		604215	"""inhibitor of growth family, member 1-like"""	ING1L		10072587	Standard	XM_005262982		Approved	p33ING2	uc003ivs.1	Q9H160	OTTHUMG00000150502	ENST00000302327.3:c.759G>T	4.37:g.184432021G>T	ENSP00000307183:p.Trp253Cys		184669015	B6ZDS1|O95698	Missense_Mutation	SNP	HMMPfam_PHD;superfamily_FYVE/PHD zinc finger	p.W253C	ENST00000302327.3	37	c.759	CCDS3833.1	4	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222526	0.58668	.	.	ENSG00000168556	ENST00000302327;ENST00000434682	D;D	0.92348	-3.02;-3.02	5.45	5.45	0.79879	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.160978	0.64402	D	0.000020	D	0.98333	0.9447	H	0.99830	4.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.99285	1.0897	10	0.87932	D	0	-15.2284	19.4782	0.94998	0.0:0.0:1.0:0.0	.	213;253	B6ZDS1;Q9H160	.;ING2_HUMAN	C	253;213	ENSP00000307183:W253C;ENSP00000412586:W213C	ENSP00000307183:W253C	W	+	3	0	ING2	184669015	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.838000	0.97847	0.655000	0.94253	TGG	-	HMMPfam_PHD		0.388	ING2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING2	protein_coding	OTTHUMT00000318652.1	G	NM_001564		184669015	1	no_errors	NM_001564	genbank	human	validated	54_36p	missense	SNP	1	T
TBC1D14	57533	genome.wustl.edu	37	4	6995910	6995910	+	Splice_Site	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:6995910G>C	ENST00000409757.4	+	4	967		c.e4-1		TBC1D14_ENST00000448507.1_Splice_Site|AC097382.5_ENST00000441093.1_RNA|RN7SKP292_ENST00000365522.1_RNA|TBC1D14_ENST00000451522.2_Splice_Site|TBC1D14_ENST00000410031.1_Splice_Site	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14						negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)	p.?(1)		breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						ctttgtcctaggaatatgaag	0.443																																																1	Unknown(1)	ovary(1)	4											113.0	106.0	108.0					4																	6995910		2203	4300	6503	7046811	SO:0001630	splice_region_variant	57533			AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.844-1G>C	4.37:g.6995910G>C			7046811	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Splice_Site	SNP	-	e3-1	ENST00000409757.4	37	c.799-1	CCDS3394.2	4																																																																																			-	-		0.443	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D14	protein_coding	OTTHUMT00000206981.3	G	NM_020773	Intron	7046811	1	no_errors	NM_020773	genbank	human	validated	54_36p	splice_site	SNP	1	C
CPZ	8532	genome.wustl.edu	37	4	8608994	8608994	+	Splice_Site	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:8608994G>T	ENST00000360986.4	+	7	1243	c.1069G>T	c.(1069-1071)Gtg>Ttg	p.V357L	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000315782.6_Splice_Site_p.V346L|CPZ_ENST00000382480.2_Splice_Site_p.V220L	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	357					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.V357L(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TCCTGGGCAGGTGGCCCCGGA	0.637																																																1	Substitution - Missense(1)	ovary(1)	4											114.0	109.0	111.0					4																	8608994		2203	4300	6503	8659894	SO:0001630	splice_region_variant	8532			U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1069-1G>T	4.37:g.8608994G>T			8659894	O00520|Q96MX2	Missense_Mutation	SNP	-	p.V357L	ENST00000360986.4	37	c.1069	CCDS33953.1	4	.	.	.	.	.	.	.	.	.	.	g	21.5	4.159786	0.78226	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.03181	4.02;4.02;4.02	3.83	3.83	0.44106	Peptidase M14, carboxypeptidase A (2);	0.072475	0.56097	U	0.000036	T	0.08758	0.0217	L	0.42529	1.33	0.80722	D	1	D;D	0.60160	0.975;0.987	P;P	0.60886	0.725;0.88	T	0.22487	-1.0215	9	.	.	.	-34.3444	9.6335	0.39793	0.0984:0.0:0.9016:0.0	.	346;357	Q66K79-2;Q66K79	.;CBPZ_HUMAN	L	357;220;346	ENSP00000354255:V357L;ENSP00000371920:V220L;ENSP00000315074:V346L	.	V	+	1	0	CPZ	8659894	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	5.869000	0.69613	1.681000	0.50988	0.450000	0.29827	GTG	-	NULL		0.637	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	protein_coding	OTTHUMT00000207001.4	G	NM_003652	Missense_Mutation	8659894	1	no_errors	NM_001014447	genbank	human	reviewed	54_36p	missense	SNP	1	T
KCNIP4	80333	genome.wustl.edu	37	4	20884250	20884250	+	Silent	SNP	C	C	T	rs368526954		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:20884250C>T	ENST00000382152.2	-	2	311	c.144G>A	c.(142-144)acG>acA	p.T48T	KCNIP4_ENST00000382148.3_Intron|KCNIP4_ENST00000382150.4_Intron|KCNIP4_ENST00000359001.5_Intron|KCNIP4_ENST00000509207.1_Intron|KCNIP4_ENST00000382149.4_Intron|KCNIP4_ENST00000447367.2_Intron	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4	48						dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				CAGGAGACGACGTTTTGGCAG	0.448																																																0			4						C	,,,,	1,3933		0,1,1966	85.0	84.0	84.0		,144,,,	-4.9	0.9	4		84	0,8358		0,0,4179	no	intron,coding-synonymous,intron,intron,intron	KCNIP4	NM_001035003.1,NM_025221.5,NM_147181.3,NM_147182.3,NM_147183.3	,,,,	0,1,6145	TT,TC,CC		0.0,0.0254,0.0081	,,,,	,48/251,,,	20884250	1,12291	1967	4179	6146	20493348	SO:0001819	synonymous_variant	80333			AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.144G>A	4.37:g.20884250C>T			20493348	Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	Silent	SNP	-	p.T48	ENST00000382152.2	37	c.144	CCDS43216.1	4																																																																																			-	NULL		0.448	KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	KCNIP4	protein_coding	OTTHUMT00000360407.3	C	NM_025221		20493348	-1	overly_large_intron	NM_025221	genbank	human	reviewed	54_36p	silent	SNP	0.88	T
CNGA1	1259	genome.wustl.edu	37	4	47939444	47939455	+	In_Frame_Del	DEL	GACCAGTAAAGG	GACCAGTAAAGG	TA			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	GACCAGTAAAGG	GACCAGTAAAGG	GACCAGTAAAGG	TA	GACCAGTAAAGG	GACCAGTAAAGG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:47939444_47939455delGACCAGTAAAGG	ENST00000514170.1	-	11	1375_1386	c.1056_1067delCCTTTACTGGTC	c.(1054-1068)agcctttactggtct>agt	p.352_356SLYWS>S	CNGA1_ENST00000420489.2_In_Frame_Del_p.352_356SLYWS>S|CNGA1_ENST00000402813.3_In_Frame_Del_p.421_425SLYWS>S|CNGA1_ENST00000544810.1_In_Frame_Del_p.352_356SLYWS>S|CNGA1_ENST00000358519.4_In_Frame_Del_p.352_356SLYWS>S			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	352					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						AGTCAGTGTAGACCAGTAAAGGCTGTATACGT	0.396																																																0			4																																								47634212	SO:0001651	inframe_deletion	1259			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1056_1067delCCTTTACTGGTC	4.37:g.47939444_47939455delGACCAGTAAAGG	ENSP00000426862:p.Ser352_Trp355del		47634201	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Frame_Shift_Del	DEL			ENST00000514170.1	37		CCDS43226.1	4																																																																																						0.396	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	CNGA1	protein_coding	OTTHUMT00000372070.2	GACCAGTAAAGG	NM_000087		47634212	-1		NM_000087	genbank	human	reviewed	54_36p	frame_shift_del	DEL		TA
FIP1L1	81608	genome.wustl.edu	37	4	54256783	54256783	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:54256783T>A	ENST00000337488.6	+	7	687	c.493T>A	c.(493-495)Tgg>Agg	p.W165R	FIP1L1_ENST00000507166.1_Missense_Mutation_p.W165R|FIP1L1_ENST00000358575.5_Missense_Mutation_p.W150R|FIP1L1_ENST00000306932.6_Missense_Mutation_p.W150R|FIP1L1_ENST00000507922.1_Missense_Mutation_p.W150R	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	165	Necessary for stimulating PAPOLA activity.|Sufficient for interaction with CPSF4.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.W165R(1)		large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AGATAAACCATGGCGTAAACC	0.323			T	PDGFRA	idiopathic hypereosinophilic syndrome																																		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	1	Substitution - Missense(1)	ovary(1)	4											96.0	95.0	95.0					4																	54256783		2203	4300	6503	53951540	SO:0001583	missense	81608			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.493T>A	4.37:g.54256783T>A	ENSP00000336752:p.Trp165Arg		53951540	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	HMMPfam_Fip1	p.W165R	ENST00000337488.6	37	c.493	CCDS3491.1	4	.	.	.	.	.	.	.	.	.	.	T	19.64	3.865989	0.71949	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000507922;ENST00000306932;ENST00000507166	D	0.99748	-6.62	5.43	5.43	0.79202	Pre-mRNA polyadenylation factor Fip1 (1);	0.000000	0.64402	D	0.000004	D	0.99816	0.9919	H	0.96430	3.82	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;1.0;1.0	D;D;D;D	0.97110	0.999;0.991;1.0;1.0	D	0.96749	0.9552	9	.	.	.	-5.8529	15.4589	0.75339	0.0:0.0:0.0:1.0	.	150;150;165;150	G3XAD6;Q6UN15-3;Q6UN15;Q6UN15-4	.;.;FIP1_HUMAN;.	R	165;150;150;150;165	ENSP00000423325:W165R	.	W	+	1	0	FIP1L1	53951540	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.662000	0.83803	2.048000	0.60808	0.482000	0.46254	TGG	-	HMMPfam_Fip1		0.323	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	protein_coding	OTTHUMT00000250602.1	T	NM_030917		53951540	1	no_errors	NM_030917	genbank	human	reviewed	54_36p	missense	SNP	1	A
ALB	213	genome.wustl.edu	37	4	74275110	74275110	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:74275110A>T	ENST00000503124.1	+	3	278	c.71A>T	c.(70-72)tAt>tTt	p.Y24F	ALB_ENST00000401494.3_Missense_Mutation_p.Y59F|ALB_ENST00000509063.1_Missense_Mutation_p.Y174F|ALB_ENST00000415165.2_Intron|ALB_ENST00000295897.4_Missense_Mutation_p.Y174F|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)		p.Y174F(1)		NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCTTACTTTTATGCCCCGGAA	0.348																																																1	Substitution - Missense(1)	ovary(1)	4											68.0	73.0	71.0					4																	74275110		2203	4299	6502	74493974	SO:0001583	missense	213			V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.71A>T	4.37:g.74275110A>T	ENSP00000421027:p.Tyr24Phe		74493974	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	-	p.Y174F	ENST00000503124.1	37	c.521		4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.16|17.16	3.318335|3.318335	0.60524|0.60524	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000511370|ENST00000441319;ENST00000295897;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	.|T;T;T;T;T	.|0.74421	.|-0.84;-0.84;0.9;-0.84;0.9	5.55|5.55	3.09|3.09	0.35607|0.35607	.|Serum albumin-like (1);Serum albumin, N-terminal (3);	.|0.159919	.|0.44097	.|D	.|0.000493	T|T	0.75398|0.75398	0.3844|0.3844	L|L	0.55990|0.55990	1.75|1.75	0.40230|0.40230	D|D	0.977831|0.977831	.|B;B;B;P	.|0.36110	.|0.037;0.141;0.379;0.537	.|B;B;B;P	.|0.47673	.|0.135;0.157;0.311;0.554	T|T	0.77250|0.77250	-0.2657|-0.2657	5|10	.|0.87932	.|D	.|0	-32.146|-32.146	9.4321|9.4321	0.38617|0.38617	0.8506:0.0:0.1494:0.0|0.8506:0.0:0.1494:0.0	.|.	.|59;24;174;174	.|B7WNR0;D6RHD5;A6NBZ8;P02768	.|.;.;.;ALBU_HUMAN	F|F	18|176;174;24;174;59;183	.|ENSP00000392541:Y176F;ENSP00000295897:Y174F;ENSP00000421027:Y24F;ENSP00000422784:Y174F;ENSP00000384695:Y59F	.|ENSP00000295897:Y174F	L|Y	+|+	3|2	2|0	ALB|ALB	74493974|74493974	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.930000|0.930000	0.56654|0.56654	2.134000|2.134000	0.42102|0.42102	1.131000|1.131000	0.42111|0.42111	0.482000|0.482000	0.46254|0.46254	TTA|TAT	-	NULL		0.348	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	ALB	protein_coding	OTTHUMT00000365419.1	A	NM_000477		74493974	1	no_errors	NM_000477	genbank	human	reviewed	54_36p	missense	SNP	1	T
PTPN13	5783	genome.wustl.edu	37	4	87680198	87680198	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:87680198C>G	ENST00000411767.2	+	23	3588	c.3525C>G	c.(3523-3525)atC>atG	p.I1175M	PTPN13_ENST00000427191.2_Missense_Mutation_p.I1156M|PTPN13_ENST00000316707.6_Missense_Mutation_p.I984M|PTPN13_ENST00000436978.1_Missense_Mutation_p.I1175M|PTPN13_ENST00000511467.1_Missense_Mutation_p.I1175M			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1175	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)	p.I1175M(1)		NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CACTTGTTATCTCTCAGCCAA	0.378																																																1	Substitution - Missense(1)	ovary(1)	4											85.0	88.0	87.0					4																	87680198		2030	4206	6236	87899222	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.3525C>G	4.37:g.87680198C>G	ENSP00000407249:p.Ile1175Met		87899222	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	HMMPfam_Y_phosphatase;HMMPfam_Band_41;HMMPfam_PDZ;superfamily_PDZ domain-like;superfamily_PAZ domain;superfamily_Second domain of FERM;superfamily_PH domain-like;superfamily_(Phosphotyrosine protein) phosphatases II;superfamily_Ubiquitin-like	p.I1175M	ENST00000411767.2	37	c.3525	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112105	0.56398	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.42	4.58	0.56647	PDZ/DHR/GLGF (4);	0.000000	0.51477	D	0.000087	T	0.63510	0.2517	M	0.73598	2.24	0.40845	D	0.983707	D;D;D;D	0.67145	0.996;0.991;0.993;0.982	D;P;D;D	0.70935	0.931;0.906;0.971;0.939	T	0.67138	-0.5746	10	0.72032	D	0.01	.	7.3313	0.26584	0.0:0.7136:0.1391:0.1474	.	984;1156;1175;1175	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	M	1156;1175;984;1175;1175;1124	ENSP00000408368:I1156M;ENSP00000394794:I1175M;ENSP00000322675:I984M;ENSP00000407249:I1175M;ENSP00000426626:I1175M	ENSP00000322675:I984M	I	+	3	3	PTPN13	87899222	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.417000	0.21214	1.421000	0.47157	0.585000	0.79938	ATC	-	HMMPfam_PDZ		0.378	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	protein_coding	OTTHUMT00000363191.1	C			87899222	1	no_errors	NM_080685	genbank	human	reviewed	54_36p	missense	SNP	1	G
TLR3	7098	genome.wustl.edu	37	4	187003624	187003624	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:187003624A>G	ENST00000296795.3	+	4	888	c.784A>G	c.(784-786)Acc>Gcc	p.T262A	TLR3_ENST00000508051.1_3'UTR|TLR3_ENST00000504367.1_5'UTR	NM_003265.2	NP_003256.1	O15455	TLR3_HUMAN	toll-like receptor 3	262					activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to drug (GO:0035690)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|detection of virus (GO:0009597)|extrinsic apoptotic signaling pathway (GO:0097191)|hyperosmotic response (GO:0006972)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|microglial cell activation involved in immune response (GO:0002282)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of osteoclast differentiation (GO:0045671)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type III interferon production (GO:0034346)|response to exogenous dsRNA (GO:0043330)|signal transduction (GO:0007165)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	double-stranded RNA binding (GO:0003725)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.T262A(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.47e-11)|BRCA - Breast invasive adenocarcinoma(30;1.14e-05)|GBM - Glioblastoma multiforme(59;0.000107)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.16)		CCAGCTGTCCACCACCAGCAA	0.443																																																1	Substitution - Missense(1)	ovary(1)	4											127.0	119.0	122.0					4																	187003624		2203	4300	6503	187240618	SO:0001583	missense	7098			U88879	CCDS3846.1	4q35	2014-09-17				ENSG00000164342		"""CD molecules"""	11849	protein-coding gene	gene with protein product		603029				9435236	Standard	NM_003265		Approved	CD283	uc003iyq.3	O15455		ENST00000296795.3:c.784A>G	4.37:g.187003624A>G	ENSP00000296795:p.Thr262Ala		187240618	B2RAI7|B7Z7K0|E6Y0F0|E6Y0F1|E9PGH4|Q4VAL2|Q504W0	Missense_Mutation	SNP	HMMPfam_TIR;superfamily_Toll/Interleukin receptor TIR domain;HMMPfam_LRRCT;HMMPfam_LRR_1;superfamily_L domain-like	p.T262A	ENST00000296795.3	37	c.784	CCDS3846.1	4	.	.	.	.	.	.	.	.	.	.	A	0.086	-1.174847	0.01646	.	.	ENSG00000164342	ENST00000296795;ENST00000513189;ENST00000542020	T;T	0.79749	-1.3;-1.3	5.42	-0.179	0.13299	.	0.961599	0.08728	N	0.902533	T	0.67192	0.2867	L	0.44542	1.39	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.46624	-0.9178	10	0.16896	T	0.51	.	2.8145	0.05452	0.4079:0.3444:0.1467:0.101	.	262	O15455	TLR3_HUMAN	A	262	ENSP00000296795:T262A;ENSP00000423386:T262A	ENSP00000296795:T262A	T	+	1	0	TLR3	187240618	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	0.635000	0.24629	0.105000	0.17753	-0.621000	0.04028	ACC	-	HMMPfam_LRR_1		0.443	TLR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR3	protein_coding	OTTHUMT00000360313.4	A			187240618	1	no_errors	NM_003265	genbank	human	reviewed	54_36p	missense	SNP		G
FAM35BP	414241	genome.wustl.edu	37	10	46927863	46927863	+	IGR	SNP	A	A	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:46927863A>C								FAM35BP (4175 upstream) : RP11-38L15.2 (9744 downstream)														p.S128R(1)									AAATGCTCACAGTTCTCTGAA	0.388																																																1	Substitution - Missense(1)	ovary(1)	10																																								46347869	SO:0001628	intergenic_variant	414241																															10.37:g.46927863A>C			46347869		Missense_Mutation	SNP	-	p.S128R		37	c.382		10	.	.	.	.	.	.	.	.	.	.	A	17.40	3.380539	0.61845	.	.	ENSG00000165874	ENST00000301038;ENST00000539388	.	.	.	4.12	2.88	0.33553	.	0.222040	0.45126	D	0.000395	T	0.64681	0.2620	.	.	.	0.33405	D	0.577819	D	0.67145	0.996	D	0.65010	0.931	T	0.74447	-0.3662	7	0.72032	D	0.01	-17.3627	8.1953	0.31392	0.8208:0.0:0.0:0.1792	.	59	F5H2C6	.	R	128;59	.	ENSP00000301038:S128R	S	+	1	0	FAM35B	46347869	0.982000	0.34865	0.635000	0.29338	0.932000	0.56968	2.645000	0.46621	1.862000	0.54008	0.377000	0.23210	AGT	-	NULL	0	0.388					FAM35B			A			46347869	1	no_errors	ENST00000301038	ensembl	human	known	54_36p	missense	SNP	0.67	C
IL3	3562	genome.wustl.edu	37	5	131398245	131398245	+	Silent	SNP	C	C	A	rs372658151		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr5:131398245C>A	ENST00000296870.2	+	4	499	c.321C>A	c.(319-321)gcC>gcA	p.A107A		NM_000588.3	NP_000579.2	P08700	IL3_HUMAN	interleukin 3	107					cell-cell signaling (GO:0007267)|embryonic hemopoiesis (GO:0035162)|immune response (GO:0006955)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-3 receptor binding (GO:0005135)	p.A107A(1)		central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)	10		all_cancers(142;7.42e-12)|Lung NSC(810;4.25e-07)|all_lung(232;1.93e-06)|Prostate(281;0.00741)|Breast(839;0.0544)|Lung SC(612;0.122)|Ovarian(839;0.223)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	GBM - Glioblastoma multiforme(465;0.0161)|Lung(113;0.105)	Amlexanox(DB01025)	TGCCCCTGGCCACGGCCGCAC	0.587																																																1	Substitution - coding silent(1)	ovary(1)	5											192.0	189.0	190.0					5																	131398245		2203	4300	6503	131426144	SO:0001819	synonymous_variant	3562			M14743	CCDS4149.1	5q23-q31	2014-04-04	2014-04-04		ENSG00000164399	ENSG00000164399		"""Interleukins and interleukin receptors"""	6011	protein-coding gene	gene with protein product	"""multilineage-colony-stimulating factor"", ""hematopoietic growth factor"", ""P-cell stimulating factor"", ""mast-cell growth factor"", ""colony-stimulating factor, multiple"""	147740	"""interleukin 3 (colony-stimulating factor, multiple)"""			3489530	Standard	NM_000588		Approved	IL-3, MULTI-CSF, MCGF, MGC79398, MGC79399	uc003kwe.1	P08700	OTTHUMG00000059640	ENST00000296870.2:c.321C>A	5.37:g.131398245C>A			131426144	Q6GS87	Silent	SNP	HMMPfam_IL3;superfamily_4-helical cytokines	p.A107	ENST00000296870.2	37	c.321	CCDS4149.1	5																																																																																			-	HMMPfam_IL3		0.587	IL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL3	protein_coding	OTTHUMT00000132639.1	C	NM_000588		131426144	1	no_errors	NM_000588	genbank	human	reviewed	54_36p	silent	SNP		A
TERT	7015	genome.wustl.edu	37	5	1280401	1280401	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr5:1280401G>T	ENST00000310581.5	-	4	1879	c.1822C>A	c.(1822-1824)Cag>Aag	p.Q608K	TERT_ENST00000508104.2_Missense_Mutation_p.Q608K|TERT_ENST00000334602.6_Missense_Mutation_p.Q608K|TERT_ENST00000296820.5_Missense_Mutation_p.Q608K	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	608	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)	p.Q608K(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	TCCCGATGCTGCCTGACCTCT	0.622									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																																							1	Substitution - Missense(1)	ovary(1)	5											70.0	66.0	67.0					5																	1280401		2203	4300	6503	1333401	SO:0001583	missense	7015	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.1822C>A	5.37:g.1280401G>T	ENSP00000309572:p.Gln608Lys		1333401	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	-	p.Q608K	ENST00000310581.5	37	c.1822	CCDS3861.2	5	.	.	.	.	.	.	.	.	.	.	G	4.293	0.053575	0.08291	.	.	ENSG00000164362	ENST00000310581;ENST00000296820;ENST00000334602;ENST00000508104	D;D;D;D	0.96459	-4.02;-4.01;-3.93;-4.01	4.48	2.49	0.30216	Reverse transcriptase (1);	1.154310	0.06294	N	0.699625	D	0.90380	0.6989	N	0.20685	0.6	0.09310	N	1	B;B;B	0.20780	0.048;0.022;0.028	B;B;B	0.19148	0.024;0.008;0.011	T	0.80533	-0.1340	10	0.07813	T	0.8	-3.6603	6.5739	0.22553	0.0:0.1686:0.447:0.3843	.	608;608;608	O14746-3;O14746;Q8NG38	.;TERT_HUMAN;.	K	608	ENSP00000309572:Q608K;ENSP00000296820:Q608K;ENSP00000334346:Q608K;ENSP00000426042:Q608K	ENSP00000296820:Q608K	Q	-	1	0	TERT	1333401	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.424000	0.21330	0.828000	0.34709	0.407000	0.27541	CAG	-	NULL		0.622	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	protein_coding	OTTHUMT00000206729.2	G			1333401	-1	no_errors	NM_198253	genbank	human	reviewed	54_36p	missense	SNP		T
PDLIM4	8572	genome.wustl.edu	37	5	131607826	131607826	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr5:131607826G>A	ENST00000253754.3	+	7	961	c.897G>A	c.(895-897)cgG>cgA	p.R299R	P4HA2_ENST00000471826.1_Intron|PDLIM4_ENST00000379018.3_3'UTR	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	299	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)	p.R299R(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGGACGAGCGGCTCTACTGTG	0.612																																																1	Substitution - coding silent(1)	ovary(1)	5											92.0	78.0	83.0					5																	131607826		2203	4300	6503	131635725	SO:0001819	synonymous_variant	8572			AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.897G>A	5.37:g.131607826G>A			131635725	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Silent	SNP	HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_LIM;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.R299	ENST00000253754.3	37	c.897	CCDS4152.1	5																																																																																			-	HMMPfam_LIM		0.612	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM4	protein_coding	OTTHUMT00000132644.2	G	NM_003687		131635725	1	no_errors	NM_003687	genbank	human	validated	54_36p	silent	SNP	0.99	A
SPOCK1	6695	genome.wustl.edu	37	5	136328278	136328278	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr5:136328278T>G	ENST00000394945.1	-	7	770	c.601A>C	c.(601-603)Aag>Cag	p.K201Q	SPOCK1_ENST00000282223.7_Missense_Mutation_p.K201Q	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	201					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.K201Q(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CGCAACTCCTTGTCTGTGCAG	0.552																																																1	Substitution - Missense(1)	ovary(1)	5											106.0	99.0	101.0					5																	136328278		2203	4300	6503	136356177	SO:0001583	missense	6695			AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.601A>C	5.37:g.136328278T>G	ENSP00000378401:p.Lys201Gln		136356177	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Missense_Mutation	SNP	HMMPfam_Thyroglobulin_1;HMMPfam_Kazal_2;superfamily_Kazal-type serine protease inhibitors;superfamily_EF-hand;superfamily_EGF/Laminin;superfamily_Thyroglobulin type-1 domain	p.K201Q	ENST00000394945.1	37	c.601	CCDS4191.1	5	.	.	.	.	.	.	.	.	.	.	T	6.949	0.544852	0.13312	.	.	ENSG00000152377	ENST00000394945;ENST00000282223;ENST00000510689	T;T;T	0.42900	0.96;0.96;1.01	5.89	5.89	0.94794	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.266401	0.37304	N	0.002153	T	0.27241	0.0668	N	0.04203	-0.255	0.36636	D	0.876599	P	0.52692	0.955	P	0.51701	0.677	T	0.24012	-1.0172	10	0.06494	T	0.89	.	11.4838	0.50342	0.0:0.0:0.15:0.85	.	201	Q08629	TICN1_HUMAN	Q	201;201;56	ENSP00000378401:K201Q;ENSP00000282223:K201Q;ENSP00000421677:K56Q	ENSP00000282223:K201Q	K	-	1	0	SPOCK1	136356177	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.682000	0.37628	2.254000	0.74563	0.533000	0.62120	AAG	-	NULL		0.552	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOCK1	protein_coding	OTTHUMT00000251222.1	T	NM_004598		136356177	-1	no_errors	NM_004598	genbank	human	reviewed	54_36p	missense	SNP	1	G
PSD2	84249	genome.wustl.edu	37	5	139216581	139216581	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr5:139216581A>G	ENST00000274710.3	+	10	1794	c.1589A>G	c.(1588-1590)aAg>aGg	p.K530R		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	530	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)	p.K530R(1)		breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGGATGGCAAGAGGAGTGGG	0.642																																																1	Substitution - Missense(1)	ovary(1)	5											82.0	78.0	79.0					5																	139216581		2203	4300	6503	139196765	SO:0001583	missense	84249			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1589A>G	5.37:g.139216581A>G	ENSP00000274710:p.Lys530Arg		139196765	D3DQD3|Q8N3J8	Missense_Mutation	SNP	superfamily_Sec7 domain;HMMPfam_PH;superfamily_PH domain-like;HMMPfam_Sec7	p.K530R	ENST00000274710.3	37	c.1589	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	A	24.6	4.547504	0.86022	.	.	ENSG00000146005	ENST00000274710	D	0.82081	-1.57	5.27	5.27	0.74061	Pleckstrin homology-type (1);Pleckstrin homology domain, spectrin-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.81341	0.4802	L	0.58669	1.825	0.80722	D	1	P	0.36837	0.571	B	0.39152	0.292	T	0.79536	-0.1763	10	0.28530	T	0.3	.	15.1724	0.72884	1.0:0.0:0.0:0.0	.	530	Q9BQI7	PSD2_HUMAN	R	530	ENSP00000274710:K530R	ENSP00000274710:K530R	K	+	2	0	PSD2	139196765	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.879000	0.92398	2.003000	0.58678	0.397000	0.26171	AAG	-	HMMPfam_PH		0.642	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	protein_coding	OTTHUMT00000251339.1	A	NM_032289		139196765	1	no_errors	NM_032289	genbank	human	provisional	54_36p	missense	SNP	1	G
SPINK5	11005	genome.wustl.edu	37	5	147510894	147510894	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr5:147510894G>C	ENST00000256084.7	+	31	3079	c.3037G>C	c.(3037-3039)Gtc>Ctc	p.V1013L	SPINK5_ENST00000359874.3_Missense_Mutation_p.V1043L	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	1013	Kazal-like 15. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.V1013L(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTAAAGCCTGTCTGTGGTGA	0.413																																																1	Substitution - Missense(1)	ovary(1)	5											246.0	234.0	238.0					5																	147510894		1970	4164	6134	147491087	SO:0001583	missense	11005			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.3037G>C	5.37:g.147510894G>C	ENSP00000256084:p.Val1013Leu		147491087	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	HMMPfam_Kazal_1;HMMPfam_Kazal_2;superfamily_Kazal-type serine protease inhibitors	p.V1013L	ENST00000256084.7	37	c.3037	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954379	0.73902	.	.	ENSG00000133710	ENST00000359874;ENST00000256084	T;T	0.81163	-1.46;-1.46	4.69	4.69	0.59074	Proteinase inhibitor I1, Kazal (3);	0.000000	0.64402	D	0.000006	D	0.89121	0.6625	M	0.79693	2.465	0.35717	D	0.816831	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.91885	0.5519	10	0.49607	T	0.09	-15.7605	13.8363	0.63410	0.0:0.0:1.0:0.0	.	1043;1013	Q9NQ38-3;Q9NQ38	.;ISK5_HUMAN	L	1043;1013	ENSP00000352936:V1043L;ENSP00000256084:V1013L	ENSP00000256084:V1013L	V	+	1	0	SPINK5	147491087	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	4.484000	0.60271	2.514000	0.84764	0.655000	0.94253	GTC	-	HMMPfam_Kazal_1		0.413	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	protein_coding	OTTHUMT00000259215.2	G	NM_001127698		147491087	1	no_errors	NM_006846	genbank	human	reviewed	54_36p	missense	SNP	1	C
LAMA4	3910	genome.wustl.edu	37	6	112575331	112575347	+	Frame_Shift_Del	DEL	GCCAGGCTGAGCTCAAA	GCCAGGCTGAGCTCAAA	-	rs149430073		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	GCCAGGCTGAGCTCAAA	GCCAGGCTGAGCTCAAA	GCCAGGCTGAGCTCAAA	-	GCCAGGCTGAGCTCAAA	GCCAGGCTGAGCTCAAA	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:112575331_112575347delGCCAGGCTGAGCTCAAA	ENST00000230538.7	-	2	403_419	c.6_22delTTTGAGCTCAGCCTGGC	c.(4-24)gctttgagctcagcctggcgcfs	p.LSSAWR3fs	RP11-506B6.6_ENST00000587816.1_RNA|RP11-506B6.6_ENST00000585504.1_RNA|LAMA4_ENST00000368638.4_Frame_Shift_Del_p.LSSAWR3fs|RP11-506B6.6_ENST00000590804.1_RNA|RP11-506B6.6_ENST00000590673.1_RNA|RP11-506B6.6_ENST00000585611.1_RNA|RP11-506B6.6_ENST00000590293.1_RNA|LAMA4_ENST00000453937.2_Frame_Shift_Del_p.LSSAWR3fs|RP11-506B6.6_ENST00000585450.1_RNA|LAMA4_ENST00000522006.1_Frame_Shift_Del_p.LSSAWR3fs|LAMA4_ENST00000431543.2_Frame_Shift_Del_p.LSSAWR3fs|LAMA4_ENST00000389463.4_Frame_Shift_Del_p.LSSAWR3fs|LAMA4_ENST00000424408.2_Frame_Shift_Del_p.LSSAWR3fs|RP11-506B6.6_ENST00000590584.1_RNA|RP11-506B6.6_ENST00000588837.1_RNA|RP11-506B6.6_ENST00000433684.3_RNA	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	3					blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)	p.S4fs*26(1)		NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		AGAACCGAGCGCCAGGCTGAGCTCAAAGCCATTTCTC	0.631																																																1	Deletion - Frameshift(1)	ovary(1)	6																																								112682040	SO:0001589	frameshift_variant	3910				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.6_22delTTTGAGCTCAGCCTGGC	6.37:g.112575331_112575347delGCCAGGCTGAGCTCAAA	ENSP00000230538:p.Leu3fs		112682024	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Frame_Shift_Del	DEL	-	p.S4fs	ENST00000230538.7	37	c.22_6	CCDS43491.1	6																																																																																			(deletion:cds_exon[112681851,112682045])	NULL		0.631	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	protein_coding	OTTHUMT00000041876.2	GCCAGGCTGAGCTCAAA	NM_001105206		112682040	-1	no_errors	NM_001105206	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.491:0.957:0.996:1.000:1.000:1.000:0.999:0.998:1.000:1.000:1.000:0.999:0.999:1.000:0.999:1.000:1.000	-
RREB1	6239	genome.wustl.edu	37	6	7230677	7230677	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:7230677G>T	ENST00000349384.6	+	10	2659	c.2345G>T	c.(2344-2346)gGg>gTg	p.G782V	RREB1_ENST00000334984.6_Missense_Mutation_p.G782V|RREB1_ENST00000379938.2_Missense_Mutation_p.G782V|RREB1_ENST00000379933.3_Missense_Mutation_p.G782V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	782					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G782V(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GGCCTGGGCGGGGGCCACAAG	0.697																																																1	Substitution - Missense(1)	ovary(1)	6											9.0	9.0	9.0					6																	7230677		2138	4136	6274	7175676	SO:0001583	missense	6239			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2345G>T	6.37:g.7230677G>T	ENSP00000305560:p.Gly782Val		7175676	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	HMMPfam_zf-C2H2,superfamily_C2H2 and C2HC zinc fingers	p.G782V	ENST00000349384.6	37	c.2345	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984939	0.53934	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.10960	2.92;2.89;2.92;2.82	5.09	5.09	0.68999	.	0.214779	0.34025	N	0.004321	T	0.06050	0.0157	N	0.05351	-0.065	0.50467	D	0.999876	D;D;D	0.60575	0.973;0.988;0.985	P;D;P	0.63283	0.859;0.913;0.859	T	0.16867	-1.0388	10	0.49607	T	0.09	-44.8555	6.078	0.19925	0.2181:0.0:0.7819:0.0	.	782;782;782	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	782	ENSP00000369265:G782V;ENSP00000369270:G782V;ENSP00000305560:G782V;ENSP00000335574:G782V	ENSP00000335574:G782V	G	+	2	0	RREB1	7175676	0.999000	0.42202	0.999000	0.59377	0.763000	0.43281	2.047000	0.41269	2.642000	0.89623	0.655000	0.94253	GGG	-	NULL		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	protein_coding	OTTHUMT00000352985.1	G			7175676	1	no_errors	NM_001003699	genbank	human	validated	54_36p	missense	SNP	0.545	T
DSP	1832	genome.wustl.edu	37	6	7559457	7559457	+	Splice_Site	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:7559457A>G	ENST00000379802.3	+	4	763		c.e4-1		DSP_ENST00000418664.2_Splice_Site	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.?(1)		biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TTTTCTTTGCAGGCTTCTTCA	0.483																																																1	Unknown(1)	ovary(1)	6											75.0	82.0	80.0					6																	7559457		2203	4300	6503	7504456	SO:0001630	splice_region_variant	1832			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.423-1A>G	6.37:g.7559457A>G			7504456	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Splice_Site	SNP	-	e4-2	ENST00000379802.3	37	c.423-2	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	A	14.93	2.682877	0.47991	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.925	0.79609	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DSP	7504456	1.000000	0.71417	0.907000	0.35723	0.619000	0.37552	6.283000	0.72646	2.225000	0.72522	0.533000	0.62120	.	-	-		0.483	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	protein_coding	OTTHUMT00000039786.2	A	NM_004415	Intron	7504456	1	no_errors	NM_004415	genbank	human	reviewed	54_36p	splice_site	SNP	0.95	G
VPS52	6293	genome.wustl.edu	37	6	33231828	33231828	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:33231828G>C	ENST00000445902.2	-	15	1795	c.1577C>G	c.(1576-1578)aCa>aGa	p.T526R	VPS52_ENST00000478934.1_5'UTR|VPS52_ENST00000436044.2_Missense_Mutation_p.T401R|VPS52_ENST00000482399.1_3'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	526					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)		p.T526R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						ATTAGGAATTGTCTGGTTGAT	0.557																																																1	Substitution - Missense(1)	ovary(1)	6											165.0	155.0	158.0					6																	33231828		2203	4300	6503	33339806	SO:0001583	missense	6293			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1577C>G	6.37:g.33231828G>C	ENSP00000409952:p.Thr526Arg		33339806	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	-	p.T526R	ENST00000445902.2	37	c.1577	CCDS4770.2	6	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099279	0.56183	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	M	0.64997	1.995	0.80722	D	1	D;P	0.55172	0.97;0.889	P;P	0.51385	0.668;0.641	T	0.46527	-0.9185	9	0.14252	T	0.57	-13.3763	16.1132	0.81278	0.0:0.0:1.0:0.0	.	337;526	B3KMF7;Q8N1B4	.;VPS52_HUMAN	R	526;504;401	.	ENSP00000414785:T504R	T	-	2	0	VPS52	33339806	1.000000	0.71417	0.990000	0.47175	0.958000	0.62258	8.246000	0.89828	2.766000	0.95052	0.573000	0.79308	ACA	-	NULL		0.557	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	protein_coding	OTTHUMT00000076598.2	G	NM_022553		33339806	-1	no_errors	NM_022553	genbank	human	reviewed	54_36p	missense	SNP	1	C
SPDEF	25803	genome.wustl.edu	37	6	34512224	34512224	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:34512224G>A	ENST00000374037.3	-	2	423	c.9C>T	c.(7-9)agC>agT	p.S3S	SPDEF_ENST00000544425.1_Silent_p.S3S	NM_012391.2	NP_036523.1	O95238	SPDEF_HUMAN	SAM pointed domain containing ETS transcription factor	3					cell differentiation (GO:0030154)|intestinal epithelial cell development (GO:0060576)|lung goblet cell differentiation (GO:0060480)|multicellular organismal development (GO:0007275)|negative regulation of cell fate commitment (GO:0010454)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell fate commitment (GO:0010455)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.S3S(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)	15						CCGGGCTGGCGCTGCCCATGC	0.662																																																1	Substitution - coding silent(1)	ovary(1)	6											10.0	10.0	10.0					6																	34512224		2085	4093	6178	34620202	SO:0001819	synonymous_variant	25803			AF071538	CCDS4794.1, CCDS59013.1	6p21.3	2013-08-07	2013-08-07		ENSG00000124664	ENSG00000124664			17257	protein-coding gene	gene with protein product		608144	"""SAM pointed domain containing ets transcription factor"""			10625666, 6857767	Standard	NM_012391		Approved	PDEF, bA375E1.3	uc003ojq.2	O95238	OTTHUMG00000014548	ENST00000374037.3:c.9C>T	6.37:g.34512224G>A			34620202	B4DWH8|F5H778	Silent	SNP	"HMMPfam_Ets;HMMPfam_SAM_PNT;superfamily_SAM/Pointed domain;superfamily_""Winged helix"" DNA-binding domain"	p.S3	ENST00000374037.3	37	c.9	CCDS4794.1	6																																																																																			-	NULL		0.662	SPDEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDEF	protein_coding	OTTHUMT00000040246.1	G	NM_012391		34620202	-1	no_errors	NM_012391	genbank	human	provisional	54_36p	silent	SNP	1	A
UHRF1BP1	54887	genome.wustl.edu	37	6	34831840	34831840	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:34831840C>A	ENST00000192788.5	+	15	3448	c.3277C>A	c.(3277-3279)Ctc>Atc	p.L1093I	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.L1093I	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	1093							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.L1093I(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TGCTGCACGACTCCGATTTTT	0.488																																																1	Substitution - Missense(1)	ovary(1)	6											99.0	109.0	106.0					6																	34831840		2018	4159	6177	34939818	SO:0001583	missense	54887			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.3277C>A	6.37:g.34831840C>A	ENSP00000192788:p.Leu1093Ile		34939818	Q9NXE0	Missense_Mutation	SNP	-	p.L1093I	ENST00000192788.5	37	c.3277	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707158	0.48412	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.15952	2.38;2.38	5.51	5.51	0.81932	.	0.160393	0.43919	D	0.000510	T	0.05640	0.0148	N	0.08118	0	0.35405	D	0.791934	D	0.54397	0.966	P	0.46144	0.505	T	0.23547	-1.0185	10	0.35671	T	0.21	-18.2959	12.0132	0.53299	0.2159:0.7841:0.0:0.0	.	1093	Q6BDS2	URFB1_HUMAN	I	1093	ENSP00000192788:L1093I;ENSP00000400628:L1093I	ENSP00000192788:L1093I	L	+	1	0	UHRF1BP1	34939818	1.000000	0.71417	1.000000	0.80357	0.439000	0.31926	2.901000	0.48695	2.873000	0.98535	0.561000	0.74099	CTC	-	NULL		0.488	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	protein_coding	OTTHUMT00000040260.1	C	NM_017754		34939818	1	no_errors	NM_017754	genbank	human	validated	54_36p	missense	SNP	1	A
RHAG	6005	genome.wustl.edu	37	6	49582561	49582562	+	Missense_Mutation	DNP	GA	GA	TT			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	GA	GA	GA	TT	GA	GA	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:49582561_49582562GA>TT	ENST00000371175.4	-	5	671_672	c.645_646TC>AA	c.(643-648)acTCtc>acAAtc	p.L216I	RHAG_ENST00000229810.7_Missense_Mutation_p.L216I	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	216					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					CACAGAAAGAGAGTCCCTGTAG	0.421																																					Ovarian(176;476 2003 7720 43408 44749)											0			6																																								49690521	SO:0001583	missense	6005				CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.645_646delinsTT	6.37:g.49582561_49582562delinsTT	ENSP00000360217:p.Leu216Ile		49690520	B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Missense_Mutation	DNP	-	p.L216I	ENST00000371175.4	37	c.646_645	CCDS4927.1	6																																																																																			-	NULL		0.421	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHAG	protein_coding	OTTHUMT00000043806.1	GA			49690521	-1	no_errors	NM_000324	genbank	human	reviewed	54_36p	missense	DNP	0.988:0.693	TT
DST	667	genome.wustl.edu	37	6	56417764	56417764	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:56417764T>C	ENST00000361203.3	-	57	15200	c.15193A>G	c.(15193-15195)Aaa>Gaa	p.K5065E	DST_ENST00000446842.2_Missense_Mutation_p.K4741E|DST_ENST00000370769.4_Missense_Mutation_p.K5067E|DST_ENST00000244364.6_Missense_Mutation_p.K2653E|DST_ENST00000312431.6_3'UTR|DST_ENST00000370788.2_Missense_Mutation_p.K2979E|DST_ENST00000421834.2_Missense_Mutation_p.K2979E|DST_ENST00000370754.5_Missense_Mutation_p.K5245E			Q03001	DYST_HUMAN	dystonin	5065					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.K5067E(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGAAATTCTTTAAACTTCTGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											141.0	137.0	138.0					6																	56417764		1846	4105	5951	56525723	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.15193A>G	6.37:g.56417764T>C	ENSP00000354508:p.Lys5065Glu		56525723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	-	p.K2979E	ENST00000361203.3	37	c.8935		6	.	.	.	.	.	.	.	.	.	.	T	16.47	3.131101	0.56828	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.65549	1.09;-0.09;-0.11;0.03;0.84;0.01;-0.16	5.76	5.76	0.90799	.	0.000000	0.56097	D	0.000029	T	0.71617	0.3361	M	0.79475	2.455	0.25251	N	0.989674	D;D;D;D;P	0.76494	0.999;0.969;0.969;0.999;0.935	D;P;P;D;P	0.80764	0.991;0.593;0.701;0.994;0.596	T	0.69416	-0.5151	9	0.17369	T	0.5	.	16.3634	0.83296	0.0:0.0:0.0:1.0	.	2979;5067;5245;5065;2653	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	E	2653;5245;5067;2979;4741;2979;5065	ENSP00000244364:K2653E;ENSP00000359790:K5245E;ENSP00000359805:K5067E;ENSP00000400883:K2979E;ENSP00000393645:K4741E;ENSP00000359824:K2979E;ENSP00000354508:K5065E	ENSP00000244364:K2653E	K	-	1	0	DST	56525723	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.970000	0.88000	2.324000	0.78689	0.533000	0.62120	AAA	-	NULL		0.408	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	T	NM_001723		56525723	-1	no_errors	NM_183380	genbank	human	reviewed	54_36p	missense	SNP	1	C
DST	667	genome.wustl.edu	37	6	56466364	56466364	+	Silent	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:56466364T>C	ENST00000361203.3	-	40	10792	c.10785A>G	c.(10783-10785)aaA>aaG	p.K3595K	DST_ENST00000446842.2_Silent_p.K3271K|DST_ENST00000370769.4_Silent_p.K3597K|DST_ENST00000244364.6_Intron|DST_ENST00000312431.6_Silent_p.K3595K|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Silent_p.K3775K			Q03001	DYST_HUMAN	dystonin	3595					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.K3597K(1)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCAGCAGTTGTTTGCTTTGGT	0.428																																																1	Substitution - coding silent(1)	ovary(1)	6											23.0	22.0	22.0					6																	56466364		876	1991	2867	56574323	SO:0001819	synonymous_variant	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.10785A>G	6.37:g.56466364T>C			56574323	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	HMMPfam_CH;Spectrin;HMMPfam_Spectrin;efhand;HMMPfam_efhand;GAS2;HMMPfam_GAS2;Spectrin repeat;superfamily_Spectrin repeat;EF-hand;superfamily_EF-hand;Calponin-homology domain CH-domain;superfamily_Calponin-homology domain CH-domain;Adenylyl and guanylyl cyclase catalytic domain;superfamily_Adenylyl and guanylyl cyclase catalytic domain;Plakin repeat;superfamily_Plakin repeat;Plectin;HMMPfam_Plectin;SH3_1;HMMPfam_SH3_1;CH	p.K3597	ENST00000361203.3	37	c.10791		6																																																																																			-	NULL		0.428	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	T	NM_001723		56574323	-1	no_errors	ENST00000370769	ensembl	human	known	54_36p	silent	SNP	0.98	C
DST	667	genome.wustl.edu	37	6	56497780	56497780	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:56497780C>T	ENST00000361203.3	-	24	3051	c.3044G>A	c.(3043-3045)cGt>cAt	p.R1015H	DST_ENST00000446842.2_Missense_Mutation_p.R689H|DST_ENST00000518935.1_Missense_Mutation_p.R689H|DST_ENST00000370769.4_Missense_Mutation_p.R1015H|DST_ENST00000244364.6_Missense_Mutation_p.R689H|DST_ENST00000312431.6_Missense_Mutation_p.R1015H|DST_ENST00000370765.6_Missense_Mutation_p.R689H|DST_ENST00000370788.2_Missense_Mutation_p.R1015H|DST_ENST00000421834.2_Missense_Mutation_p.R1015H|DST_ENST00000370754.5_Missense_Mutation_p.R1193H			Q03001	DYST_HUMAN	dystonin	1015					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)	p.R689H(4)|p.R1015H(2)		NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATCTTCAAAACGAGATTGTAG	0.358																																																6	Substitution - Missense(6)	lung(4)|ovary(2)	6											110.0	107.0	108.0					6																	56497780		2203	4300	6503	56605739	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3044G>A	6.37:g.56497780C>T	ENSP00000354508:p.Arg1015His		56605739	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	-	p.R1015H	ENST00000361203.3	37	c.3044		6	.	.	.	.	.	.	.	.	.	.	C	9.502	1.103451	0.20632	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	T;T;T;T;T;T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.69	4.82	0.62117	.	0.111665	0.40554	N	0.001080	T	0.12050	0.0293	N	0.00360	-1.595	0.33753	D	0.620823	B;D;B;B;B;P;B;P	0.89917	0.007;1.0;0.007;0.005;0.006;0.568;0.007;0.49	B;D;B;B;B;B;B;B	0.78314	0.001;0.991;0.001;0.001;0.003;0.165;0.001;0.081	T	0.36114	-0.9761	9	0.02654	T	1	.	14.7848	0.69793	0.0:0.931:0.0:0.069	.	1015;1015;1193;689;689;689;1015;689	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;DYST_HUMAN;.	H	689;1193;1015;1015;689;1015;1015;1015;689;1055;689;689	ENSP00000244364:R689H;ENSP00000359790:R1193H;ENSP00000359805:R1015H;ENSP00000400883:R1015H;ENSP00000393645:R689H;ENSP00000307959:R1015H;ENSP00000359824:R1015H;ENSP00000354508:R1015H;ENSP00000404924:R689H;ENSP00000431030:R1055H;ENSP00000359801:R689H;ENSP00000431003:R689H	ENSP00000244364:R689H	R	-	2	0	DST	56605739	1.000000	0.71417	0.947000	0.38551	0.669000	0.39330	3.746000	0.55127	1.558000	0.49541	0.650000	0.86243	CGT	-	NULL		0.358	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	C	NM_001723		56605739	-1	no_errors	NM_183380	genbank	human	reviewed	54_36p	missense	SNP	1	T
BAI3	577	genome.wustl.edu	37	6	69685227	69685227	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:69685227C>G	ENST00000370598.1	+	10	2550	c.1729C>G	c.(1729-1731)Cat>Gat	p.H577D		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	577					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.H577D(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ACACTTGCAGCATTCAGTAGG	0.438																																																1	Substitution - Missense(1)	ovary(1)	6											87.0	75.0	79.0					6																	69685227		2203	4300	6503	69741948	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1729C>G	6.37:g.69685227C>G	ENSP00000359630:p.His577Asp		69741948	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	GPS;HMMPfam_GPS;7tm_2;HMMPfam_7tm_2;Spermadhesin CUB domain;superfamily_Spermadhesin CUB domain;TSP_1;HMMPfam_TSP_1;HRM;HMMPfam_HRM;TSP-1 type 1 repeat;superfamily_TSP-1 type 1 repeat	p.H577D	ENST00000370598.1	37	c.1729	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475945	0.63737	.	.	ENSG00000135298	ENST00000370598	T	0.19250	2.16	5.75	5.75	0.90469	.	0.306795	0.36303	N	0.002676	T	0.05731	0.0150	N	0.08118	0	0.80722	D	1	B	0.17465	0.022	B	0.14023	0.01	T	0.30880	-0.9963	10	0.12430	T	0.62	.	20.3046	0.98621	0.0:1.0:0.0:0.0	.	577	O60242	BAI3_HUMAN	D	577	ENSP00000359630:H577D	ENSP00000359630:H577D	H	+	1	0	BAI3	69741948	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.878000	0.98634	0.650000	0.86243	CAT	-	NULL		0.438	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	protein_coding	OTTHUMT00000041120.1	C			69741948	1	no_errors	NM_001704	genbank	human	reviewed	54_36p	missense	SNP	1	G
COL9A1	1297	genome.wustl.edu	37	6	70942435	70942459	+	Frame_Shift_Del	DEL	TCTGGACGCTTAAGACTGGCAGCCA	TCTGGACGCTTAAGACTGGCAGCCA	-	rs566003668|rs375684014		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	TCTGGACGCTTAAGACTGGCAGCCA	TCTGGACGCTTAAGACTGGCAGCCA	TCTGGACGCTTAAGACTGGCAGCCA	-	TCTGGACGCTTAAGACTGGCAGCCA	TCTGGACGCTTAAGACTGGCAGCCA	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:70942435_70942459delTCTGGACGCTTAAGACTGGCAGCCA	ENST00000357250.6	-	36	2488_2512	c.2330_2354delTGGCTGCCAGTCTTAAGCGTCCAGA	c.(2329-2355)atggctgccagtcttaagcgtccagacfs	p.MAASLKRPD777fs	COL9A1_ENST00000320755.7_Frame_Shift_Del_p.MAASLKRPD534fs|COL9A1_ENST00000370499.4_Frame_Shift_Del_p.MAASLKRPD534fs|RP1-149L1.1_ENST00000522264.1_RNA|COL9A1_ENST00000489611.1_5'UTR	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	777	Nonhelical region (NC2).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)	p.M777fs*46(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGCACCTGAGTCTGGACGCTTAAGACTGGCAGCCATCTCAGCAAA	0.489																																																1	Deletion - Frameshift(1)	ovary(1)	6																																								70999180	SO:0001589	frameshift_variant	1297				CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.2330_2354delTGGCTGCCAGTCTTAAGCGTCCAGA	6.37:g.70942435_70942459delTCTGGACGCTTAAGACTGGCAGCCA	ENSP00000349790:p.Met777fs		70999156	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Frame_Shift_Del	DEL	-	p.M777fs	ENST00000357250.6	37	c.2354_2330	CCDS4971.1	6																																																																																			(deletion:cds_exon[70999007;70999195])	NULL		0.489	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A1	protein_coding	OTTHUMT00000041131.2	TCTGGACGCTTAAGACTGGCAGCCA			70999180	-1	no_errors	NM_001851	genbank	human	reviewed	54_36p	frame_shift_del	DEL	1.000:1.000:0.960:1.000:1.000:0.998:1.000:0.999:0.997:0.990:0.905:0.860:0.999:1.000:0.999:1.000:1.000:0.994:1.000:1.000:0.987:1.000:1.000:1.000:1.000	-
ERMARD	55780	genome.wustl.edu	37	6	170179380	170179381	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	GC	GC	AG	AG	GC	GC	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr6:170179380_170179381GC>AG	ENST00000366773.3	+	17	1875_1876	c.1842_1843GC>AG	c.(1840-1845)caGCag>caAGag	p.Q615E	ERMARD_ENST00000588451.1_Missense_Mutation_p.Q479E|ERMARD_ENST00000418781.3_Missense_Mutation_p.Q542E|ERMARD_ENST00000392095.4_Missense_Mutation_p.Q489E|ERMARD_ENST00000366772.2_Missense_Mutation_p.Q568E	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	615					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											ATGAGTATCAGCAGTACCTAAA	0.5																																																0			6																																								169921306	SO:0001583	missense	55780			AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	Exception_encountered	6.37:g.170179380_170179381delinsAG	ENSP00000355735:p.Gln615Glu		169921305	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	DNP	-	p.Q615E	ENST00000366773.3	37	c.1842_1843	CCDS34576.1	6																																																																																			-	NULL		0.500	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf70	protein_coding	OTTHUMT00000043238.2	GC	NM_018341		169921306	1	no_errors	NM_018341	genbank	human	validated	54_36p	missense	DNP	1.000:1.000	AG
DBF4P1	645084	genome.wustl.edu	37	10	65930381	65930381	+	IGR	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr10:65930381T>C								RP11-174J11.1 (133341 upstream) : RP11-179K3.2 (730512 downstream)																							TGCTGAGAAATTCTTCAACTC	0.383																																																0			10																																								65600387	SO:0001628	intergenic_variant	100129267																															10.37:g.65930381T>C			65600387		RNA	SNP	-	NULL		37	NULL		10																																																																																			-	-	0	0.383					LOC100129267			T			65600387	-1	pseudogene	XR_037245	genbank	human	model	54_36p	rna	SNP	0.99	C
NAT16	375607	genome.wustl.edu	37	7	100817976	100817976	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:100817976G>T	ENST00000300303.2	-	2	351	c.113C>A	c.(112-114)gCc>gAc	p.A38D	NAT16_ENST00000443096.1_Missense_Mutation_p.A38D|NAT16_ENST00000455377.1_Missense_Mutation_p.A38D	NM_198571.2	NP_940973.2	Q8N8M0	NAT16_HUMAN	N-acetyltransferase 16 (GCN5-related, putative)	38							N-acetyltransferase activity (GO:0008080)	p.A38D(1)									CCTGGGCTCGGCCTCCACCTC	0.647																																																1	Substitution - Missense(1)	ovary(1)	7											55.0	57.0	56.0					7																	100817976		2203	4300	6503	100604696	SO:0001583	missense	375607			AK096556	CCDS5713.1	7q22.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000167011	ENSG00000167011			22030	protein-coding gene	gene with protein product		615783	"""chromosome 7 open reading frame 52"""	C7orf52			Standard	NM_198571		Approved	FLJ39237	uc003uxy.2	Q8N8M0	OTTHUMG00000157110	ENST00000300303.2:c.113C>A	7.37:g.100817976G>T	ENSP00000300303:p.Ala38Asp		100604696	B3KRS2|Q8NDR1	Missense_Mutation	SNP	-	p.A38D	ENST00000300303.2	37	c.113	CCDS5713.1	7	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073839	0.55646	.	.	ENSG00000167011	ENST00000300303;ENST00000455377;ENST00000444446;ENST00000443096	T;T;T;T	0.60920	0.15;0.15;0.24;0.27	3.82	1.91	0.25777	.	.	.	.	.	T	0.32912	0.0845	N	0.08118	0	0.09310	N	1	B;B	0.22909	0.077;0.033	B;B	0.19391	0.025;0.013	T	0.23797	-1.0178	9	0.72032	D	0.01	.	4.0914	0.09972	0.1253:0.0:0.644:0.2307	.	38;38	B3KRS2;Q8N8M0	.;CG052_HUMAN	D	38	ENSP00000300303:A38D;ENSP00000395125:A38D;ENSP00000391769:A38D;ENSP00000394435:A38D	ENSP00000300303:A38D	A	-	2	0	C7orf52	100604696	0.001000	0.12720	0.003000	0.11579	0.194000	0.23727	0.585000	0.23879	0.263000	0.21812	0.407000	0.27541	GCC	-	NULL		0.647	NAT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf52	protein_coding	OTTHUMT00000347465.1	G	NM_198571		100604696	-1	no_errors	NM_198571	genbank	human	predicted	54_36p	missense	SNP	0.01	T
SCIN	85477	genome.wustl.edu	37	7	12664740	12664740	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:12664740G>A	ENST00000297029.5	+	6	966	c.865G>A	c.(865-867)Gct>Act	p.A289T	SCIN_ENST00000519209.1_Missense_Mutation_p.A42T|SCIN_ENST00000445618.2_Missense_Mutation_p.A42T|SCIN_ENST00000473722.1_3'UTR	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	289	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.A289T(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GGACCACGGGGCTGCCAAACA	0.388																																																1	Substitution - Missense(1)	ovary(1)	7											56.0	56.0	56.0					7																	12664740		1871	4110	5981	12631265	SO:0001583	missense	85477			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.865G>A	7.37:g.12664740G>A	ENSP00000297029:p.Ala289Thr		12631265	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	HMMPfam_Gelsolin;superfamily_Actin depolymerizing proteins;superfamily_C-terminal gelsolin-like domain of Sec23/24	p.A42T	ENST00000297029.5	37	c.124	CCDS47545.1	7	.	.	.	.	.	.	.	.	.	.	G	13.39	2.221742	0.39300	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.53423	0.62;0.62;0.62	5.53	4.64	0.57946	Gelsolin domain (1);	0.398687	0.28187	N	0.016276	T	0.35566	0.0936	L	0.31578	0.945	0.09310	N	1	B	0.10296	0.003	B	0.21151	0.033	T	0.13980	-1.0489	10	0.36615	T	0.2	-8.9575	11.4949	0.50402	0.137:0.0:0.863:0.0	.	289	Q9Y6U3	ADSV_HUMAN	T	289;42;42	ENSP00000297029:A289T;ENSP00000430997:A42T;ENSP00000390189:A42T	ENSP00000297029:A289T	A	+	1	0	SCIN	12631265	0.000000	0.05858	1.000000	0.80357	0.842000	0.47809	0.845000	0.27668	2.775000	0.95449	0.585000	0.79938	GCT	-	HMMPfam_Gelsolin		0.388	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCIN	protein_coding	OTTHUMT00000326041.1	G	NM_033128		12631265	1	no_errors	NM_033128	genbank	human	validated	54_36p	missense	SNP	0.02	A
ZNF277	11179	genome.wustl.edu	37	7	111936289	111936289	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:111936289C>A	ENST00000361822.3	+	4	517	c.388C>A	c.(388-390)Caa>Aaa	p.Q130K	ZNF277_ENST00000450657.1_Missense_Mutation_p.Q130K	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	130					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.Q130K(1)		breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						AACAGAAGAACAAGAGAATTA	0.313																																																1	Substitution - Missense(1)	ovary(1)	7											57.0	62.0	60.0					7																	111936289		2198	4284	6482	111723525	SO:0001583	missense	11179			AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.388C>A	7.37:g.111936289C>A	ENSP00000354501:p.Gln130Lys		111723525	Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	-	p.Q130K	ENST00000361822.3	37	c.388	CCDS5755.2	7	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548937	0.27652	.	.	ENSG00000198839	ENST00000361822;ENST00000450657	T;T	0.30182	1.55;1.54	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.40297	0.1111	L	0.59912	1.85	0.80722	D	1	D;P	0.53151	0.958;0.48	P;B	0.46026	0.501;0.09	T	0.03728	-1.1009	10	0.33141	T	0.24	-19.3218	20.8794	0.99867	0.0:1.0:0.0:0.0	.	130;130	Q9NRM2;G5E9M4	ZN277_HUMAN;.	K	130	ENSP00000354501:Q130K;ENSP00000402292:Q130K	ENSP00000354501:Q130K	Q	+	1	0	ZNF277	111723525	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.538000	0.73852	2.941000	0.99782	0.655000	0.94253	CAA	-	NULL		0.313	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF277	protein_coding	OTTHUMT00000316843.2	C	NM_021994		111723525	1	no_errors	NM_021994	genbank	human	validated	54_36p	missense	SNP	1	A
CNOT4	4850	genome.wustl.edu	37	7	135129800	135129800	+	Intron	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:135129800T>C	ENST00000315544.5	-	2	188				CNOT4_ENST00000451834.1_Intron|CNOT4_ENST00000423368.2_Intron|CNOT4_ENST00000428680.2_Intron|CNOT4_ENST00000361528.4_Intron|CNOT4_ENST00000356162.4_Intron|CNOT4_ENST00000541284.1_Intron	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						AGCCTTCTTCTCTTAATCACA	0.373																																					Ovarian(51;766 1130 5502 35047 50875)											0			7																																								134780340	SO:0001627	intron_variant	647081			AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.92-6629A>G	7.37:g.135129800T>C			134780340	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	RNA	SNP	-	NULL	ENST00000315544.5	37	NULL	CCDS55166.1	7																																																																																			-	-		0.373	CNOT4-201	KNOWN	basic|CCDS	protein_coding	LOC647081	protein_coding		T	NM_013316		134780340	1	pseudogene	XR_017490	genbank	human	model	54_36p	rna	SNP	0.16	C
CAMK2B	816	genome.wustl.edu	37	7	44281378	44281378	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:44281378C>T	ENST00000395749.2	-	11	900	c.824G>A	c.(823-825)cGc>cAc	p.R275H	CAMK2B_ENST00000502837.2_Missense_Mutation_p.R146H|CAMK2B_ENST00000395747.2_Missense_Mutation_p.R275H|CAMK2B_ENST00000440254.2_Missense_Mutation_p.R275H|CAMK2B_ENST00000350811.3_Missense_Mutation_p.R275H|CAMK2B_ENST00000457475.1_Missense_Mutation_p.R275H|CAMK2B_ENST00000346990.4_Missense_Mutation_p.R275H|CAMK2B_ENST00000358707.3_Missense_Mutation_p.R275H|CAMK2B_ENST00000353625.4_Missense_Mutation_p.R275H|CAMK2B_ENST00000347193.4_Missense_Mutation_p.R275H|CAMK2B_ENST00000258682.6_Missense_Mutation_p.R275H	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	275					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)	p.R275H(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						TACCGTGGAGCGTTGCTGTGG	0.602																																																1	Substitution - Missense(1)	ovary(1)	7											144.0	129.0	134.0					7																	44281378		2203	4300	6503	44247903	SO:0001583	missense	816			U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.824G>A	7.37:g.44281378C>T	ENSP00000379098:p.Arg275His		44247903	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like);HMMPfam_CaMKII_AD;superfamily_NTF2-like	p.R275H	ENST00000395749.2	37	c.824	CCDS5483.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.260128|4.260128	0.80246|0.80246	.|.	.|.	ENSG00000058404|ENSG00000058404	ENST00000433930|ENST00000350811;ENST00000457475;ENST00000395749;ENST00000502837;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747	.|T;T;T;T;T;T;T;T;T;T;T	.|0.68479	.|1.86;1.86;-0.33;1.86;1.86;1.86;1.86;1.86;1.86;1.86;1.86	4.0|4.0	4.0|4.0	0.46444|0.46444	.|Protein kinase-like domain (1);	.|.	.|.	.|.	.|.	T|T	0.79941|0.79941	0.4533|0.4533	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	.|P;D;B;P;D;P;P;D;P	.|0.89917	.|0.807;0.999;0.161;0.944;1.0;0.708;0.524;1.0;0.882	.|P;D;B;P;D;B;B;D;B	.|0.85130	.|0.46;0.925;0.051;0.57;0.997;0.271;0.159;0.956;0.235	T|T	0.82999|0.82999	-0.0178|-0.0178	5|9	.|0.72032	.|D	.|0.01	.|.	15.8814|15.8814	0.79207|0.79207	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|275;275;275;275;275;275;275;275;275	.|Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2	.|.;.;.;.;.;.;.;KCC2B_HUMAN;.	T|H	32|275;275;275;146;275;275;275;275;275;275;275	.|ENSP00000326375:R275H;ENSP00000390292:R275H;ENSP00000379098:R275H;ENSP00000422416:R146H;ENSP00000397937:R275H;ENSP00000351542:R275H;ENSP00000326427:R275H;ENSP00000326544:R275H;ENSP00000326518:R275H;ENSP00000258682:R275H;ENSP00000379096:R275H	.|ENSP00000258682:R275H	A|R	-|-	1|2	0|0	CAMK2B|CAMK2B	44247903|44247903	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.561000|0.561000	0.35649|0.35649	7.380000|7.380000	0.79704|0.79704	2.058000|2.058000	0.61347|0.61347	0.462000|0.462000	0.41574|0.41574	GCT|CGC	-	NULL		0.602	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	CAMK2B	protein_coding	OTTHUMT00000251138.2	C	NM_172084		44247903	-1	no_errors	NM_001220	genbank	human	reviewed	54_36p	missense	SNP	1	T
ZNF727	442319	genome.wustl.edu	37	7	63539027	63539027	+	IGR	SNP	A	A	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:63539027A>T	ENST00000550760.3	+	0	1679				RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						ACTGGAGAGAAACCCTACATT	0.388																																																0			7																																								63176462	SO:0001628	intergenic_variant	442319					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536		7.37:g.63539027A>T			63176462		RNA	SNP	-	NULL	ENST00000550760.3	37	NULL	CCDS55113.1	7																																																																																			-	-		0.388	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC442319	protein_coding		A	NM_001159522		63176462	1	no_errors	XR_016680	genbank	human	model	54_36p	rna	SNP	1	T
Unknown	0	genome.wustl.edu	37	7	64196624	64196624	+	IGR	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:64196624C>T								ZNF107 (25220 upstream) : ZNF138 (58141 downstream)																							CCACCACTACCCAAACTGGAA	0.463																																																0			7																																								63834059	SO:0001628	intergenic_variant	644387																															7.37:g.64196624C>T			63834059		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.463					LOC644387			C			63834059	-1	pseudogene	XR_016224	genbank	human	model	54_36p	rna	SNP	0.13	T
DYNC1I1	1780	genome.wustl.edu	37	7	95442627	95442627	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:95442627G>A	ENST00000324972.6	+	4	536	c.343G>A	c.(343-345)Ggc>Agc	p.G115S	DYNC1I1_ENST00000447467.2_Missense_Mutation_p.G98S|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.G98S|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.G115S|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.G98S|DYNC1I1_ENST00000413338.1_Missense_Mutation_p.G98S|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.G98S	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	115	Interaction with DCTN1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.G115S(1)|p.G115C(1)		NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			CCAAGACTCAGGCGATCTGGG	0.423																																																2	Substitution - Missense(2)	ovary(1)|lung(1)	7											74.0	71.0	72.0					7																	95442627		2203	4300	6503	95280563	SO:0001583	missense	1780			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.343G>A	7.37:g.95442627G>A	ENSP00000320130:p.Gly115Ser		95280563	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	HMMPfam_WD40;superfamily_WD40 repeat-like	p.G115S	ENST00000324972.6	37	c.343	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	G	14.54	2.567105	0.45694	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000413338;ENST00000518089;ENST00000457059	T;T;T;T;T;T	0.74315	-0.54;-0.79;-0.83;-0.62;-0.61;-0.54	4.55	4.55	0.56014	.	0.267161	0.36628	N	0.002492	T	0.66829	0.2829	L	0.43152	1.355	0.39097	D	0.961216	B;B;B;B;B	0.18166	0.006;0.026;0.01;0.015;0.01	B;B;B;B;B	0.25405	0.017;0.06;0.015;0.007;0.037	T	0.62077	-0.6930	10	0.07030	T	0.85	-1.1365	18.616	0.91303	0.0:0.0:1.0:0.0	.	98;115;98;115;98	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	S	98;115;98;115;98;98;98;98	ENSP00000392337:G98S;ENSP00000320130:G115S;ENSP00000438377:G98S;ENSP00000398118:G115S;ENSP00000352348:G98S;ENSP00000412444:G98S	ENSP00000320130:G115S	G	+	1	0	DYNC1I1	95280563	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.429000	0.73387	2.810000	0.96702	0.655000	0.94253	GGC	-	NULL		0.423	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	protein_coding	OTTHUMT00000333432.1	G	NM_004411		95280563	1	no_errors	NM_004411	genbank	human	validated	54_36p	missense	SNP	0.99	A
ZSCAN25	221785	genome.wustl.edu	37	7	99219046	99219046	+	Silent	SNP	C	C	T	rs376411021		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:99219046C>T	ENST00000394152.2	+	5	765	c.438C>T	c.(436-438)ggC>ggT	p.G146G	ZSCAN25_ENST00000262941.6_Silent_p.G146G|ZSCAN25_ENST00000466948.1_3'UTR|ZSCAN25_ENST00000334715.3_Silent_p.G146G	NM_145115.2	NP_660090.2	Q6NSZ9	ZSC25_HUMAN	zinc finger and SCAN domain containing 25	146					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G146G(1)									TTTGCAGAGGCGCTTGGGAGC	0.597																																																1	Substitution - coding silent(1)	ovary(1)	7						C		0,4406		0,0,2203	76.0	74.0	75.0		438	-6.4	0.0	7		75	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF498	NM_145115.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		146/545	99219046	1,13005	2203	4300	6503	99056982	SO:0001819	synonymous_variant	221785			AK057030	CCDS5671.2	7q22.1	2013-01-09	2013-01-09	2013-01-09	ENSG00000197037	ENSG00000197037		"""-"", ""Zinc fingers, C2H2-type"""	21961	protein-coding gene	gene with protein product			"""zinc finger protein 498"""	ZNF498		11179890	Standard	XM_005250194		Approved	FLJ32468	uc003url.1	Q6NSZ9	OTTHUMG00000074055	ENST00000394152.2:c.438C>T	7.37:g.99219046C>T			99056982	A4D290|D6W5T5|Q14C82|Q14C99|Q5EBM9|Q6DJZ0|Q6N032|Q6ZML3	Silent	SNP	-	p.G146	ENST00000394152.2	37	c.438	CCDS5671.2	7																																																																																			-	NULL		0.597	ZSCAN25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF498	protein_coding	OTTHUMT00000157203.4	C	NM_145115		99056982	1	no_errors	NM_145115	genbank	human	validated	54_36p	silent	SNP	0.01	T
ZNF425	155054	genome.wustl.edu	37	7	148801416	148801416	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr7:148801416T>C	ENST00000378061.2	-	4	1679	c.1547A>G	c.(1546-1548)cAc>cGc	p.H516R		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	516					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H516R(1)		breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GACCTTCAGGTGCTGCGTGAG	0.617																																																1	Substitution - Missense(1)	ovary(1)	7											45.0	37.0	40.0					7																	148801416		2203	4299	6502	148432349	SO:0001583	missense	155054			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1547A>G	7.37:g.148801416T>C	ENSP00000367300:p.His516Arg		148432349	B3KPM1|Q08AG3	Missense_Mutation	SNP	HMMPfam_KRAB;HMMPfam_zf-C2H2;superfamily_KRAB domain (Kruppel-associated box Pfam 01352);superfamily_C2H2 and C2HC zinc fingers	p.H516R	ENST00000378061.2	37	c.1547	CCDS34773.1	7	.	.	.	.	.	.	.	.	.	.	T	22.6	4.311746	0.81358	.	.	ENSG00000204947	ENST00000378061	D	0.86865	-2.18	3.02	3.02	0.34903	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94739	0.8302	H	0.96015	3.755	0.36136	D	0.846458	D	0.89917	1.0	D	0.91635	0.999	D	0.95929	0.8937	9	0.87932	D	0	.	9.4166	0.38525	0.0:0.0:0.0:1.0	.	516	Q6IV72	ZN425_HUMAN	R	516	ENSP00000367300:H516R	ENSP00000367300:H516R	H	-	2	0	ZNF425	148432349	0.992000	0.36948	0.185000	0.23176	0.462000	0.32619	1.818000	0.39012	1.388000	0.46506	0.533000	0.62120	CAC	-	HMMPfam_zf-C2H2		0.617	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	protein_coding	OTTHUMT00000352726.1	T	XM_088140		148432349	-1	no_errors	NM_001001661	genbank	human	provisional	54_36p	missense	SNP	0.88	C
CCDC158	339965	genome.wustl.edu	37	4	77266077	77266077	+	Intron	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr4:77266077G>C	ENST00000388914.3	-	17	2817					NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158											breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						AGAAATGTTTGGTGGCTTCTT	0.413																																																0			4																																								77485101	SO:0001627	intron_variant	100131940			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.2664+6071C>G	4.37:g.77266077G>C			77485101	Q8IYQ1|Q8N7D4|Q8N7E3	RNA	SNP	-	NULL	ENST00000388914.3	37	NULL	CCDS43242.1	4																																																																																			-	-		0.413	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131940	protein_coding	OTTHUMT00000362694.2	G	NM_001042784		77485101	1	pseudogene	XR_037574	genbank	human	model	54_36p	rna	SNP	1	C
CSMD3	114788	genome.wustl.edu	37	8	113326672	113326672	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr8:113326672A>T	ENST00000297405.5	-	48	7779	c.7535T>A	c.(7534-7536)cTt>cAt	p.L2512H	CSMD3_ENST00000343508.3_Missense_Mutation_p.L2472H|CSMD3_ENST00000455883.2_Missense_Mutation_p.L2408H|CSMD3_ENST00000352409.3_Missense_Mutation_p.L2442H	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2512	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.L2512H(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATACACCTGAAGAACATCAAA	0.323										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																						1	Substitution - Missense(1)	ovary(1)	8											97.0	94.0	95.0					8																	113326672		2203	4300	6503	113395848	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7535T>A	8.37:g.113326672A>T	ENSP00000297405:p.Leu2512His		113395848	Q96PZ3	Missense_Mutation	SNP	HMMPfam_Sushi;HMMPfam_CUB;superfamily_Spermadhesin CUB domain;superfamily_Complement control module/SCR domain	p.L2512H	ENST00000297405.5	37	c.7535	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	A	19.55	3.849368	0.71603	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48	4.98	3.82	0.43975	CUB (5);	0.093892	0.42420	D	0.000715	T	0.80037	0.4550	H	0.97707	4.06	0.46376	D	0.999017	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.987;1.0;0.993	T	0.83125	-0.0116	10	0.49607	T	0.09	.	10.6389	0.45582	0.9244:0.0:0.0756:0.0	.	2408;2512;2472	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	H	2472;2512;1782;2408;2442	ENSP00000345799:L2472H;ENSP00000297405:L2512H;ENSP00000341558:L1782H;ENSP00000412263:L2408H;ENSP00000343124:L2442H	ENSP00000297405:L2512H	L	-	2	0	CSMD3	113395848	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.329000	0.79170	0.920000	0.36970	0.472000	0.43445	CTT	-	HMMPfam_CUB		0.323	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	protein_coding	OTTHUMT00000347141.1	A	NM_052900		113395848	-1	no_errors	NM_198123	genbank	human	validated	54_36p	missense	SNP	1	T
EXT1	2131	genome.wustl.edu	37	8	118825129	118825129	+	Silent	SNP	C	C	T	rs146389596		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr8:118825129C>T	ENST00000378204.2	-	8	2510	c.1704G>A	c.(1702-1704)acG>acA	p.T568T		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	568					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)	p.T568T(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TTGAAAGCACCGTGTCCTCGT	0.537			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																													yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	1	Substitution - coding silent(1)	ovary(1)	8						C		0,4406		0,0,2203	136.0	104.0	115.0		1704	-11.7	0.5	8	dbSNP_134	115	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EXT1	NM_000127.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		568/747	118825129	1,13005	2203	4300	6503	118894310	SO:0001819	synonymous_variant	2131	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1704G>A	8.37:g.118825129C>T			118894310	B2R7V2|Q9BVI9	Silent	SNP	HMMPfam_Exostosin;HMMPfam_EXTL2;superfamily_Nucleotide-diphospho-sugar transferases	p.T568	ENST00000378204.2	37	c.1704	CCDS6324.1	8																																																																																			-	HMMPfam_EXTL2		0.537	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXT1	protein_coding	OTTHUMT00000132768.3	C	NM_000127		118894310	-1	no_errors	NM_000127	genbank	human	reviewed	54_36p	silent	SNP	0.38	T
ZHX1	11244	genome.wustl.edu	37	8	124267211	124267211	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr8:124267211C>A	ENST00000522655.1	-	3	1516	c.976G>T	c.(976-978)Gaa>Taa	p.E326*	ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Nonsense_Mutation_p.E326*|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000395571.3_Nonsense_Mutation_p.E326*			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	326	Required for dimerization.|Required for interaction with NFYA.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.E326*(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TTGATCTGTTCCTCTGTATAT	0.393																																																1	Substitution - Nonsense(1)	ovary(1)	8											206.0	205.0	205.0					8																	124267211		2203	4300	6503	124336392	SO:0001587	stop_gained	11244			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.976G>T	8.37:g.124267211C>A	ENSP00000428821:p.Glu326*		124336392	Q8IWD8	Nonsense_Mutation	SNP	-	p.E326*	ENST00000522655.1	37	c.976	CCDS6342.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.767490|9.767490	0.99259|0.99259	.|.	.|.	ENSG00000165156|ENSG00000165156	ENST00000297857;ENST00000395571;ENST00000522655|ENST00000520474	.|.	.|.	.|.	5.8|5.8	4.92|4.92	0.64577|0.64577	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.71517	.|0.3349	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73956	.|-0.3819	.|3	0.87932|.	D|.	0|.	-7.5121|-7.5121	16.1995|16.1995	0.82060|0.82060	0.1343:0.8657:0.0:0.0|0.1343:0.8657:0.0:0.0	.|.	.|.	.|.	.|.	X|S	326|10	.|.	ENSP00000297857:E326X|.	E|R	-|-	1|3	0|2	ZHX1|ZHX1	124336392|124336392	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.916000|5.916000	0.69981|0.69981	1.432000|1.432000	0.47375|0.47375	0.555000|0.555000	0.69702|0.69702	GAA|AGG	-	NULL		0.393	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	protein_coding	OTTHUMT00000381759.1	C			124336392	-1	no_errors	NM_001017926	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
SULF1	23213	genome.wustl.edu	37	8	70551056	70551056	+	Silent	SNP	T	T	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr8:70551056T>C	ENST00000260128.4	+	21	3231	c.2514T>C	c.(2512-2514)taT>taC	p.Y838Y	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000402687.4_Silent_p.Y838Y|SULF1_ENST00000419716.3_Silent_p.Y838Y|SULF1_ENST00000458141.2_Silent_p.Y838Y	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	838					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.Y838Y(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GTCAAGGATATAAGCAGTGCA	0.388																																																1	Substitution - coding silent(1)	ovary(1)	8											91.0	79.0	83.0					8																	70551056		2203	4300	6503	70713610	SO:0001819	synonymous_variant	23213			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2514T>C	8.37:g.70551056T>C			70713610	Q86YV8|Q8NCA2|Q9UPS5	Silent	SNP	HMMPfam_Sulfatase;superfamily_Alkaline phosphatase-like	p.Y838	ENST00000260128.4	37	c.2514	CCDS6204.1	8																																																																																			-	NULL		0.388	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	protein_coding	OTTHUMT00000378885.2	T	NM_015170		70713610	1	no_errors	NM_015170	genbank	human	validated	54_36p	silent	SNP	0.98	C
FAM135B	51059	genome.wustl.edu	37	8	139180202	139180202	+	Silent	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr8:139180202G>A	ENST00000395297.1	-	12	1364	c.1194C>T	c.(1192-1194)atC>atT	p.I398I		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	398								p.I398I(2)		NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			AATCGCCGTCGATGTCCAGGC	0.557										HNSCC(54;0.14)																																						2	Substitution - coding silent(2)	ovary(2)	8											111.0	116.0	114.0					8																	139180202		2071	4223	6294	139249384	SO:0001819	synonymous_variant	51059			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1194C>T	8.37:g.139180202G>A			139249384	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	-	p.I398	ENST00000395297.1	37	c.1194	CCDS6375.2	8																																																																																			-	NULL		0.557	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	protein_coding	OTTHUMT00000313590.3	G	NM_015912		139249384	-1	no_errors	NM_015912	genbank	human	validated	54_36p	silent	SNP	0.99	A
TLR4	7099	genome.wustl.edu	37	9	120470866	120470866	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr9:120470866G>T	ENST00000355622.6	+	2	220	c.119G>T	c.(118-120)tGc>tTc	p.C40F	TLR4_ENST00000394487.4_5'UTR|RNU6-1082P_ENST00000364574.1_RNA|TLR4_ENST00000472304.1_Intron	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	40					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.C40F(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACTTATCAATGCATGGAGCTG	0.458																																																1	Substitution - Missense(1)	ovary(1)	9											158.0	154.0	155.0					9																	120470866		2203	4300	6503	119510687	SO:0001583	missense	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.119G>T	9.37:g.120470866G>T	ENSP00000363089:p.Cys40Phe		119510687	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	HMMPfam_TIR;superfamily_Toll/Interleukin receptor TIR domain;HMMPfam_LRRCT;HMMPfam_LRR_1;superfamily_L domain-like	p.C40F	ENST00000355622.6	37	c.119	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910307	0.72983	.	.	ENSG00000136869	ENST00000355622	T	0.59224	0.28	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.74696	0.3750	M	0.64404	1.975	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.76195	-0.3048	10	0.87932	D	0	.	17.9564	0.89070	0.0:0.0:1.0:0.0	.	40	O00206	TLR4_HUMAN	F	40	ENSP00000363089:C40F	ENSP00000363089:C40F	C	+	2	0	TLR4	119510687	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.993000	0.63895	2.750000	0.94351	0.655000	0.94253	TGC	-	NULL		0.458	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	protein_coding	OTTHUMT00000055549.3	G	NM_138554		119510687	1	no_errors	NM_138554	genbank	human	reviewed	54_36p	missense	SNP	1	T
TLR4	7099	genome.wustl.edu	37	9	120476846	120476846	+	Missense_Mutation	SNP	G	G	A	rs55751501	byFrequency	TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr9:120476846G>A	ENST00000355622.6	+	3	2541	c.2440G>A	c.(2440-2442)Gcc>Acc	p.A814T	TLR4_ENST00000394487.4_Missense_Mutation_p.A774T|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	814	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.A814T(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACTCAGAAAAGCCCTGCTGGA	0.512													G|||	2	0.000399361	0.0	0.0	5008	,	,		19001	0.002		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	9											96.0	100.0	99.0					9																	120476846		2203	4300	6503	119516667	SO:0001583	missense	7099			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2440G>A	9.37:g.120476846G>A	ENSP00000363089:p.Ala814Thr		119516667	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	HMMPfam_TIR,superfamily_Toll/Interleukin receptor TIR domain,HMMPfam_LRRCT,HMMPfam_LRR_1,superfamily_L domain-like	p.A814T	ENST00000355622.6	37	c.2440	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299280	0.81136	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.03607	3.87;3.87	6.03	4.19	0.49359	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.167214	0.42682	D	0.000674	T	0.15003	0.0362	M	0.70595	2.14	0.43018	D	0.994561	D	0.89917	1.0	D	0.87578	0.998	T	0.00182	-1.1946	10	0.87932	D	0	.	10.0182	0.42027	0.0687:0.0:0.7943:0.137	rs55751501	814	O00206	TLR4_HUMAN	T	774;814	ENSP00000377997:A774T;ENSP00000363089:A814T	ENSP00000363089:A814T	A	+	1	0	TLR4	119516667	1.000000	0.71417	0.998000	0.56505	0.851000	0.48451	5.537000	0.67186	0.880000	0.35969	0.655000	0.94253	GCC	-	HMMPfam_TIR		0.512	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	protein_coding	OTTHUMT00000055549.3	G	NM_138554		119516667	1	no_errors	NM_138554	genbank	human	reviewed	54_36p	missense	SNP	1	A
KIAA2026	158358	genome.wustl.edu	37	9	5969314	5969314	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr9:5969314G>C	ENST00000399933.3	-	3	916	c.917C>G	c.(916-918)gCt>gGt	p.A306G	KIAA2026_ENST00000381461.2_Missense_Mutation_p.A306G	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	306								p.A306G(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ATGCCCAATAGCTGGAATTTC	0.398																																																1	Substitution - Missense(1)	ovary(1)	9											80.0	73.0	75.0					9																	5969314		1849	4088	5937	5959314	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.917C>G	9.37:g.5969314G>C	ENSP00000382815:p.Ala306Gly		5959314	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	-	p.A306G	ENST00000399933.3	37	c.917		9	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102103	0.76983	.	.	ENSG00000183354	ENST00000399933;ENST00000381461;ENST00000513355	.	.	.	5.85	5.85	0.93711	.	0.000000	0.48767	U	0.000166	T	0.78342	0.4268	M	0.63843	1.955	0.58432	D	0.999997	D	0.67145	0.996	D	0.71656	0.974	T	0.78568	-0.2154	9	0.72032	D	0.01	.	20.1663	0.98152	0.0:0.0:1.0:0.0	.	306	Q5HYC2	K2026_HUMAN	G	306;306;239	.	ENSP00000370870:A306G	A	-	2	0	KIAA2026	5959314	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.439000	0.97543	2.773000	0.95371	0.585000	0.79938	GCT	-	NULL		0.398	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	protein_coding	OTTHUMT00000051652.2	G	NM_001017969		5959314	-1	no_errors	NM_001017969	genbank	human	validated	54_36p	missense	SNP	1	C
UNC13B	10497	genome.wustl.edu	37	9	35403794	35403794	+	Missense_Mutation	SNP	G	G	A	rs371689397		TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr9:35403794G>A	ENST00000378495.3	+	39	4762	c.4540G>A	c.(4540-4542)Gtg>Atg	p.V1514M	UNC13B_ENST00000378496.4_Missense_Mutation_p.V1533M|ATP8B5P_ENST00000430846.1_RNA|UNC13B_ENST00000396787.1_Missense_Mutation_p.V1545M	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1514	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.V1514M(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GCAGATATGCGTGAAGGATTA	0.562																																																1	Substitution - Missense(1)	ovary(1)	9						G	MET/VAL	0,4406		0,0,2203	87.0	81.0	83.0		4540	5.9	1.0	9		83	1,8597	1.2+/-3.3	0,1,4298	no	missense	UNC13B	NM_006377.3	21	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1514/1592	35403794	1,13003	2203	4299	6502	35393794	SO:0001583	missense	10497			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4540G>A	9.37:g.35403794G>A	ENSP00000367756:p.Val1514Met		35393794	Q5VYM8	Missense_Mutation	SNP	-	p.V1514M	ENST00000378495.3	37	c.4540	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926797	0.92319	0.0	1.16E-4	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.86164	-2.08;-2.08;-2.08	5.93	5.93	0.95920	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.95661	0.8589	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95937	0.8943	10	0.87932	D	0	-18.5213	20.3368	0.98748	0.0:0.0:1.0:0.0	.	1533;1514	F8W8M9;O14795	.;UN13B_HUMAN	M	1545;1514;1533;1120	ENSP00000380006:V1545M;ENSP00000367756:V1514M;ENSP00000367757:V1533M	ENSP00000367756:V1514M	V	+	1	0	UNC13B	35393794	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.760000	0.98935	2.805000	0.96524	0.655000	0.94253	GTG	-	NULL		0.562	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	protein_coding	OTTHUMT00000052296.1	G	NM_006377		35393794	1	no_errors	NM_006377	genbank	human	reviewed	54_36p	missense	SNP	1	A
ZBTB5	9925	genome.wustl.edu	37	9	37442187	37442187	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr9:37442187G>T	ENST00000307750.4	-	2	550	c.362C>A	c.(361-363)aCa>aAa	p.T121K		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T121K(1)		NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		CAGCGTCCTTGTCGTTAAGTA	0.532																																																1	Substitution - Missense(1)	ovary(1)	9											97.0	89.0	92.0					9																	37442187		2203	4300	6503	37432187	SO:0001583	missense	9925			AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.362C>A	9.37:g.37442187G>T	ENSP00000307604:p.Thr121Lys		37432187		Missense_Mutation	SNP	-	p.T121K	ENST00000307750.4	37	c.362	CCDS6610.1	9	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935859	0.73442	.	.	ENSG00000168795	ENST00000307750	T	0.65916	-0.18	5.54	5.54	0.83059	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.62925	0.2468	N	0.11427	0.14	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.57642	-0.7776	10	0.11794	T	0.64	.	19.6787	0.95950	0.0:0.0:1.0:0.0	.	121	O15062	ZBTB5_HUMAN	K	121	ENSP00000307604:T121K	ENSP00000307604:T121K	T	-	2	0	ZBTB5	37432187	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	7.211000	0.77933	2.884000	0.98904	0.655000	0.94253	ACA	-	NULL		0.532	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB5	protein_coding	OTTHUMT00000052462.1	G	NM_014872		37432187	-1	no_errors	NM_014872	genbank	human	validated	54_36p	missense	SNP	1	T
C9orf129	445577	genome.wustl.edu	37	9	96080830	96080830	+	Splice_Site	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr9:96080830T>A	ENST00000375419.1	-	5	804	c.441A>T	c.(439-441)gcA>gcT	p.A147A	WNK2_ENST00000395477.2_Intron|WNK2_ENST00000349097.3_Intron|WNK2_ENST00000395475.2_Intron|WNK2_ENST00000356055.3_Intron|WNK2_ENST00000471076.1_Intron	NM_001098808.1	NP_001092278.1	Q5T035	CI129_HUMAN	chromosome 9 open reading frame 129	147								p.A147A(1)		endometrium(2)|large_intestine(1)|lung(1)|ovary(2)	6						GCCAGTGGGCTGCTGTGAGTG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	9											85.0	93.0	90.0					9																	96080830		2103	4226	6329	95120651	SO:0001630	splice_region_variant	445577				CCDS43850.1	9q22.31	2012-04-02			ENSG00000204352	ENSG00000204352			31116	protein-coding gene	gene with protein product							Standard	NM_001098808		Approved	bA165J3.3	uc010mre.3	Q5T035	OTTHUMG00000020248	ENST00000375419.1:c.440-1A>T	9.37:g.96080830T>A			95120651		Silent	SNP	-	p.A147	ENST00000375419.1	37	c.441	CCDS43850.1	9																																																																																			-	NULL		0.587	C9orf129-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	C9orf129	protein_coding	OTTHUMT00000053147.1	T	NM_001098808	Silent	95120651	-1	no_errors	NM_001098808	genbank	human	predicted	54_36p	silent	SNP		A
RPL35	11224	genome.wustl.edu	37	9	127620287	127620287	+	Silent	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr9:127620287C>T	ENST00000348462.3	-	4	330	c.282G>A	c.(280-282)cgG>cgA	p.R94R	RPL35_ENST00000373570.4_3'UTR	NM_007209.3	NP_009140.1	P42766	RL35_HUMAN	ribosomal protein L35	94					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.R94R(1)		breast(1)|large_intestine(1)|lung(1)|ovary(1)	4				GBM - Glioblastoma multiforme(294;0.182)		GCTTGTTGAGCCGGCGGCGCA	0.627																																																1	Substitution - coding silent(1)	ovary(1)	9											43.0	36.0	39.0					9																	127620287		2203	4300	6503	126660108	SO:0001819	synonymous_variant	11224			U12465	CCDS6858.1	9q34.1	2011-04-06			ENSG00000136942	ENSG00000136942		"""L ribosomal proteins"""	10344	protein-coding gene	gene with protein product	"""60S ribosomal protein L35"""					11401437	Standard	NM_007209		Approved	L35	uc004boy.1	P42766	OTTHUMG00000020659	ENST00000348462.3:c.282G>A	9.37:g.127620287C>T			126660108	A8K4V7|Q4VBY5|Q5JTN5|Q6IBC7|Q96QJ7|Q9BYF4	Silent	SNP	-	p.R94	ENST00000348462.3	37	c.282	CCDS6858.1	9																																																																																			-	NULL		0.627	RPL35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL35	protein_coding	OTTHUMT00000054035.1	C	NM_007209		126660108	-1	no_errors	NM_007209	genbank	human	reviewed	54_36p	silent	SNP	1	T
PROS2P	5628	genome.wustl.edu	37	3	90255197	90255197	+	IGR	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chr3:90255197C>A								RNU6-712P (21314 upstream) : None (None downstream)																							ACCACTTTTGCTTTCATTGCT	0.333																																																0			3																																								90337887	SO:0001628	intergenic_variant	0																															3.37:g.90255197C>A			90337887		Missense_Mutation	SNP	-	p.A3S		37	c.7		3																																																																																			-	NULL	0	0.333					ENSG00000189002			C			90337887	-1	no_errors	ENST00000340162	ensembl	human	known	54_36p	missense	SNP	0.02	A
GPR119	139760	genome.wustl.edu	37	X	129518509	129518509	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:129518509G>A	ENST00000276218.2	-	1	1002	c.913C>T	c.(913-915)Ctc>Ttc	p.L305F		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	305					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)	p.L305F(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						AGAAAGAGGAGGAATGAGGTG	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											84.0	76.0	79.0					X																	129518509		2203	4300	6503	129346190	SO:0001583	missense	139760			AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.913C>T	X.37:g.129518509G>A	ENSP00000276218:p.Leu305Phe		129346190	Q495H7|Q4VBN3	Missense_Mutation	SNP	-	p.L305F	ENST00000276218.2	37	c.913	CCDS14625.1	X	.	.	.	.	.	.	.	.	.	.	G	6.583	0.475824	0.12521	.	.	ENSG00000147262	ENST00000276218	T	0.61274	0.12	5.25	3.31	0.37934	.	0.512402	0.17513	N	0.171539	T	0.34890	0.0913	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.16808	-1.0390	10	0.10111	T	0.7	-7.246	5.2681	0.15611	0.3219:0.0:0.6781:0.0	.	305	Q8TDV5	GP119_HUMAN	F	305	ENSP00000276218:L305F	ENSP00000276218:L305F	L	-	1	0	GPR119	129346190	0.000000	0.05858	0.102000	0.21198	0.556000	0.35491	0.079000	0.14782	1.170000	0.42753	0.600000	0.82982	CTC	-	NULL		0.547	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR119	protein_coding	OTTHUMT00000058270.1	G	NM_178471		129346190	-1	no_errors	NM_178471	genbank	human	provisional	54_36p	missense	SNP		A
SLITRK2	84631	genome.wustl.edu	37	X	144904347	144904347	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:144904347G>A	ENST00000370490.1	+	1	4659	c.404G>A	c.(403-405)aGc>aAc	p.S135N	SLITRK2_ENST00000447897.2_Missense_Mutation_p.S135N|SLITRK2_ENST00000428560.2_Missense_Mutation_p.S135N|SLITRK2_ENST00000434188.2_Missense_Mutation_p.S135N|SLITRK2_ENST00000413937.2_Missense_Mutation_p.S135N			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	135					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.S135N(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					GGCCTGGAGAGCCTGGAGTAT	0.498																																																1	Substitution - Missense(1)	ovary(1)	X											82.0	64.0	70.0					X																	144904347		2203	4300	6503	144712039	SO:0001583	missense	84631			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.404G>A	X.37:g.144904347G>A	ENSP00000359521:p.Ser135Asn		144712039	A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Missense_Mutation	SNP	-	p.S135N	ENST00000370490.1	37	c.404	CCDS14680.1	X	.	.	.	.	.	.	.	.	.	.	G	12.96	2.095549	0.36952	.	.	ENSG00000185985	ENST00000335565;ENST00000447897;ENST00000370490;ENST00000434188;ENST00000413937;ENST00000428560	T;T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17;0.17	4.95	3.18	0.36537	.	0.046626	0.85682	N	0.000000	T	0.31544	0.0800	N	0.11756	0.17	0.47778	D	0.999518	P	0.44521	0.837	B	0.40782	0.34	T	0.35226	-0.9797	10	0.02654	T	1	-6.3428	8.7228	0.34452	0.1922:0.0:0.8078:0.0	.	135	Q9H156	SLIK2_HUMAN	N	135	ENSP00000334374:S135N;ENSP00000411681:S135N;ENSP00000359521:S135N;ENSP00000397015:S135N;ENSP00000407347:S135N;ENSP00000412010:S135N	ENSP00000334374:S135N	S	+	2	0	SLITRK2	144712039	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	5.769000	0.68865	0.343000	0.23821	-0.192000	0.12808	AGC	-	NULL		0.498	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	protein_coding	OTTHUMT00000058633.1	G	NM_032539		144712039	1	no_errors	NM_032539	genbank	human	validated	54_36p	missense	SNP	1	A
DDX3X	1654	genome.wustl.edu	37	X	41206139	41206139	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	G	G	C	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:41206139G>C	ENST00000399959.2	+	15	2498	c.1643G>C	c.(1642-1644)aGg>aCg	p.R548T	DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000457138.2_Missense_Mutation_p.R532T|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	548	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)	p.R548T(1)		NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TTTAACGAGAGGAACATAAAT	0.358										HNSCC(61;0.18)																																						1	Substitution - Missense(1)	ovary(1)	X											88.0	85.0	86.0					X																	41206139		2135	4249	6384	41091083	SO:0001583	missense	1654			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1643G>C	X.37:g.41206139G>C	ENSP00000382840:p.Arg548Thr		41091083	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	-	p.R548T	ENST00000399959.2	37	c.1643	CCDS43931.1	X	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808078	0.50421	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.04758	3.56;3.56	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.043865	0.85682	D	0.000000	T	0.04952	0.0133	L	0.39147	1.195	0.80722	D	1	B;B;P;P	0.37015	0.002;0.052;0.578;0.578	B;B;B;B	0.31191	0.003;0.033;0.125;0.125	T	0.36504	-0.9745	10	0.62326	D	0.03	-8.0171	11.6173	0.51096	0.0835:0.0:0.9165:0.0	.	418;532;560;548	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	T	548;532	ENSP00000382840:R548T;ENSP00000392494:R532T	ENSP00000382840:R548T	R	+	2	0	DDX3X	41091083	1.000000	0.71417	0.954000	0.39281	0.984000	0.73092	7.426000	0.80270	2.209000	0.71365	0.529000	0.55759	AGG	-	NULL		0.358	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	protein_coding	OTTHUMT00000056253.1	G	NM_024005		41091083	1	no_errors	NM_001356	genbank	human	reviewed	54_36p	missense	SNP	1	C
DDX3X	1654	genome.wustl.edu	37	X	41206147	41206147	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:41206147A>C	ENST00000399959.2	+	15	2506	c.1651A>C	c.(1651-1653)Aat>Cat	p.N551H	DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000457138.2_Missense_Mutation_p.N535H|RN7SL15P_ENST00000582825.1_RNA	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	551	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)	p.N551H(1)		NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						GAGGAACATAAATATTACTAA	0.368										HNSCC(61;0.18)																																						1	Substitution - Missense(1)	ovary(1)	X											89.0	87.0	88.0					X																	41206147		2146	4254	6400	41091091	SO:0001583	missense	1654			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1651A>C	X.37:g.41206147A>C	ENSP00000382840:p.Asn551His		41091091	A8K538|B4E3E8|O15536	Missense_Mutation	SNP	-	p.N551H	ENST00000399959.2	37	c.1651	CCDS43931.1	X	.	.	.	.	.	.	.	.	.	.	A	21.4	4.147668	0.77888	.	.	ENSG00000215301	ENST00000399959;ENST00000457138	T;T	0.04758	3.56;3.56	5.28	5.28	0.74379	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.13114	0.0318	L	0.39020	1.185	0.80722	D	1	B;P;D;D	0.76494	0.007;0.665;0.999;0.999	B;B;D;D	0.66351	0.002;0.078;0.943;0.918	T	0.01252	-1.1405	10	0.87932	D	0	-7.9939	14.3593	0.66761	1.0:0.0:0.0:0.0	.	421;535;563;551	B4DLU5;B4E3E8;Q59GX6;O00571	.;.;.;DDX3X_HUMAN	H	551;535	ENSP00000382840:N551H;ENSP00000392494:N535H	ENSP00000382840:N551H	N	+	1	0	DDX3X	41091091	1.000000	0.71417	0.565000	0.28409	0.969000	0.65631	9.284000	0.95882	1.770000	0.52166	0.430000	0.28490	AAT	-	NULL		0.368	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	protein_coding	OTTHUMT00000056253.1	A	NM_024005		41091091	1	no_errors	NM_001356	genbank	human	reviewed	54_36p	missense	SNP	1	C
MAGED1	9500	genome.wustl.edu	37	X	51638326	51638326	+	Nonsense_Mutation	SNP	A	A	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:51638326A>T	ENST00000375722.1	+	3	475	c.223A>T	c.(223-225)Aag>Tag	p.K75*	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Nonsense_Mutation_p.K75*|MAGED1_ENST00000375772.3_Nonsense_Mutation_p.K75*|MAGED1_ENST00000375695.2_Nonsense_Mutation_p.K131*			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	75					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)	p.K131*(1)		breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CGCTAGGCCTAAGTCAGCCTT	0.532										Multiple Myeloma(10;0.10)																																						1	Substitution - Nonsense(1)	ovary(1)	X											45.0	36.0	39.0					X																	51638326		2203	4300	6503	51655066	SO:0001587	stop_gained	9500			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.223A>T	X.37:g.51638326A>T	ENSP00000364874:p.Lys75*		51655066	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Nonsense_Mutation	SNP	-	p.K131*	ENST00000375722.1	37	c.391	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	A	29.9	5.045835	0.93685	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695;ENST00000430189	.	.	.	3.47	2.3	0.28687	.	0.000000	0.41938	D	0.000795	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.6845	0.12752	0.8515:0.0:0.1485:0.0	.	.	.	.	X	75;75;75;131;75	.	ENSP00000325333:K75X	K	+	1	0	MAGED1	51655066	1.000000	0.71417	0.948000	0.38648	0.972000	0.66771	1.301000	0.33447	0.558000	0.29135	0.372000	0.22366	AAG	-	NULL		0.532	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	protein_coding	OTTHUMT00000056593.1	A	NM_001005332		51655066	1	no_errors	NM_001005333	genbank	human	reviewed	54_36p	nonsense	SNP	1	T
ARHGEF9	23229	genome.wustl.edu	37	X	62898438	62898438	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:62898438C>A	ENST00000253401.6	-	5	1376	c.576G>T	c.(574-576)tgG>tgT	p.W192C	ARHGEF9_ENST00000374872.1_Missense_Mutation_p.W171C|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374878.1_Missense_Mutation_p.W190C|ARHGEF9_ENST00000433323.2_5'Flank|ARHGEF9_ENST00000374870.4_Missense_Mutation_p.W90C|ARHGEF9_ENST00000437457.2_Missense_Mutation_p.W139C	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	192	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.W190C(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						CAGAGTATATCCAGAATCCAT	0.443																																																1	Substitution - Missense(1)	ovary(1)	X											48.0	41.0	43.0					X																	62898438		2203	4300	6503	62815163	SO:0001583	missense	23229			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.576G>T	X.37:g.62898438C>A	ENSP00000253401:p.Trp192Cys		62815163	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	HMMPfam_RhoGEF;HMMPfam_SH3_1;superfamily_SH3-domain;HMMPfam_PH;superfamily_DBL homology domain (DH-domain);superfamily_PH domain-like	p.W192C	ENST00000253401.6	37	c.576	CCDS35315.1	X	.	.	.	.	.	.	.	.	.	.	C	12.57	1.979100	0.34942	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000437457;ENST00000374870;ENST00000374872	T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0	5.08	5.08	0.68730	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.37812	0.1017	N	0.02011	-0.69	0.80722	D	1	B;B;B;B	0.21147	0.052;0.013;0.013;0.013	B;B;B;B	0.12156	0.007;0.004;0.004;0.004	T	0.32052	-0.9921	10	0.46703	T	0.11	.	16.0426	0.80695	0.0:1.0:0.0:0.0	.	139;190;192;192	B4DHC7;B1AMR4;O43307;A8K1S8	.;.;ARHG9_HUMAN;.	C	192;190;139;90;171	ENSP00000253401:W192C;ENSP00000364012:W190C;ENSP00000399994:W139C;ENSP00000364004:W90C;ENSP00000364006:W171C	ENSP00000253401:W192C	W	-	3	0	ARHGEF9	62815163	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.502000	0.66956	2.087000	0.62958	0.600000	0.82982	TGG	-	HMMPfam_RhoGEF		0.443	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	protein_coding	OTTHUMT00000056937.1	C			62815163	-1	no_errors	NM_015185	genbank	human	validated	54_36p	missense	SNP	1	A
AR	367	genome.wustl.edu	37	X	66937331	66937331	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:66937331T>A	ENST00000374690.3	+	5	2709	c.2185T>A	c.(2185-2187)Tta>Ata	p.L729I	AR_ENST00000396044.3_Intron|AR_ENST00000396043.2_Missense_Mutation_p.L197I	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	728	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L729I(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTTCCGCAACTTACACGTGGA	0.552									Androgen Insensitivity Syndrome																																							1	Substitution - Missense(1)	ovary(1)	X											122.0	81.0	95.0					X																	66937331		2203	4300	6503	66854056	SO:0001583	missense	367	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2185T>A	X.37:g.66937331T>A	ENSP00000363822:p.Leu729Ile		66854056	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	HMMPfam_Hormone_recep;HMMPfam_Androgen_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.L729I	ENST00000374690.3	37	c.2185	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	t	20.2	3.957453	0.73902	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000396043	D;D	0.99955	-8.87;-8.87	4.99	1.25	0.21368	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.64402	D	0.000001	D	0.99933	0.9970	M	0.85777	2.775	0.80722	D	1	P;D	0.62365	0.825;0.991	P;D	0.80764	0.867;0.994	D	0.96546	0.9404	10	0.87932	D	0	.	7.1037	0.25353	0.0:0.4056:0.0:0.5944	.	197;728	F1D8N5;P10275	.;ANDR_HUMAN	I	539;729;197	ENSP00000363822:L729I;ENSP00000379358:L197I	ENSP00000363822:L729I	L	+	1	2	AR	66854056	0.999000	0.42202	0.993000	0.49108	0.931000	0.56810	0.910000	0.28571	0.252000	0.21531	0.483000	0.47432	TTA	-	HMMPfam_Hormone_recep		0.552	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	protein_coding	OTTHUMT00000057007.1	T	NM_000044		66854056	1	no_errors	NM_000044	genbank	human	reviewed	54_36p	missense	SNP	0.98	A
KIF4A	24137	genome.wustl.edu	37	X	69573489	69573489	+	Silent	SNP	A	A	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:69573489A>G	ENST00000374403.3	+	15	1588	c.1506A>G	c.(1504-1506)ccA>ccG	p.P502P	KIF4A_ENST00000374388.3_Silent_p.P502P	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	502					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.P502P(1)		breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AAACCAGTCCAGAGACGAGCA	0.443																																																1	Substitution - coding silent(1)	ovary(1)	X											43.0	40.0	41.0					X																	69573489		2203	4300	6503	69490214	SO:0001819	synonymous_variant	24137			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1506A>G	X.37:g.69573489A>G			69490214	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Silent	SNP	HMMPfam_Kinesin;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.P502	ENST00000374403.3	37	c.1506	CCDS14401.1	X																																																																																			-	NULL		0.443	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	protein_coding	OTTHUMT00000057068.1	A	NM_012310		69490214	1	no_errors	NM_012310	genbank	human	validated	54_36p	silent	SNP	0.44	G
KLHL4	56062	genome.wustl.edu	37	X	86873049	86873049	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:86873049C>A	ENST00000373119.4	+	4	987	c.842C>A	c.(841-843)cCt>cAt	p.P281H	KLHL4_ENST00000373114.4_Missense_Mutation_p.P281H	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	281						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.P281H(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						CAGCTCCATCCTTCAAACTGC	0.423																																																1	Substitution - Missense(1)	ovary(1)	X											106.0	87.0	93.0					X																	86873049		2203	4300	6503	86759705	SO:0001583	missense	56062			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.842C>A	X.37:g.86873049C>A	ENSP00000362211:p.Pro281His		86759705	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	HMMPfam_Kelch_1;superfamily_Galactose oxidase central domain;HMMPfam_BACK;HMMPfam_BTB;superfamily_POZ domain	p.P281H	ENST00000373119.4	37	c.842	CCDS14457.1	X	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356767	0.82243	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.77358	-1.09;-1.06	4.74	4.74	0.60224	.	0.061530	0.64402	D	0.000003	D	0.89753	0.6806	M	0.89715	3.055	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.72075	0.946;0.976	D	0.92014	0.5620	10	0.66056	D	0.02	.	15.9642	0.79952	0.0:1.0:0.0:0.0	.	281;281	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	H	281	ENSP00000362211:P281H;ENSP00000362206:P281H	ENSP00000362206:P281H	P	+	2	0	KLHL4	86759705	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.243000	0.78219	1.960000	0.56953	0.502000	0.49764	CCT	-	NULL		0.423	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL4	protein_coding	OTTHUMT00000057413.1	C			86759705	1	no_errors	NM_057162	genbank	human	reviewed	54_36p	missense	SNP	1	A
BRDTP1	643486	genome.wustl.edu	37	X	95592565	95592565	+	IGR	SNP	C	C	G			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:95592565C>G								RN7SL379P (313921 upstream) : RN7SKP194 (72865 downstream)																							CTTTTACTTCCTTTTCTATGG	0.408																																																0			X																																								95479221	SO:0001628	intergenic_variant	643486																															X.37:g.95592565C>G			95479221		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.408					LOC643486			C			95479221	-1	pseudogene	NR_003539	genbank	human	provisional	54_36p	rna	SNP	0.97	G
SLC10A3	8273	genome.wustl.edu	37	X	153716442	153716442	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0760-01A-01W-0372-09	TCGA-13-0760-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	5181630f-246a-4cb4-88c2-1534b5fb8e37	62d69c6c-457c-40d4-a43a-4aeb93c8bf80	g.chrX:153716442C>T	ENST00000393587.4	-	3	1101	c.838G>A	c.(838-840)Gac>Aac	p.D280N	SLC10A3_ENST00000369649.4_Missense_Mutation_p.D251N|SLC10A3_ENST00000263512.4_Missense_Mutation_p.D280N|UBL4A_ENST00000477777.1_5'Flank|UBL4A_ENST00000369653.4_5'Flank|SLC10A3_ENST00000393586.1_Missense_Mutation_p.D335N|UBL4A_ENST00000369660.4_5'Flank	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	280					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)	p.D280N(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGGTGACGTCCCCTCCAAGA	0.627																																																1	Substitution - Missense(1)	ovary(1)	X											73.0	67.0	69.0					X																	153716442		2203	4300	6503	153369636	SO:0001583	missense	8273			X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.838G>A	X.37:g.153716442C>T	ENSP00000377212:p.Asp280Asn		153369636	Q5HY79|Q9BSL2	Missense_Mutation	SNP	HMMPfam_SBF	p.D280N	ENST00000393587.4	37	c.838	CCDS14755.1	X	.	.	.	.	.	.	.	.	.	.	C	25.9	4.687810	0.88639	.	.	ENSG00000126903	ENST00000369649;ENST00000393586;ENST00000263512;ENST00000393587	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	5.09	5.09	0.68999	.	0.000000	0.85682	U	0.000000	T	0.32615	0.0835	L	0.55834	1.745	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.01613	-1.1312	10	0.33940	T	0.23	-24.661	16.2495	0.82475	0.0:1.0:0.0:0.0	.	251;280	Q9BSL2;P09131	.;P3_HUMAN	N	251;335;280;280	ENSP00000358663:D251N;ENSP00000377211:D335N;ENSP00000263512:D280N;ENSP00000377212:D280N	ENSP00000263512:D280N	D	-	1	0	SLC10A3	153369636	1.000000	0.71417	0.906000	0.35671	0.686000	0.39977	5.184000	0.65070	2.089000	0.63090	0.600000	0.82982	GAC	-	HMMPfam_SBF		0.627	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A3	protein_coding	OTTHUMT00000037235.3	C	NM_019848		153369636	-1	no_errors	NM_019848	genbank	human	reviewed	54_36p	missense	SNP	1	T
