#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AGO1	26523	genome.wustl.edu	37	1	36367869	36367869	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr1:36367869G>T	ENST00000373204.4	+	11	1541	c.1328G>T	c.(1327-1329)gGg>gTg	p.G443V	AGO1_ENST00000373206.1_Missense_Mutation_p.G368V	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	443					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G443V(1)									TTCTACAATGGGATTGAGATC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											108.0	107.0	107.0					1																	36367869		2203	4300	6503	36140456	SO:0001583	missense	26523			AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.1328G>T	1.37:g.36367869G>T	ENSP00000362300:p.Gly443Val		36140456	Q5TA57|Q6P4S0	Missense_Mutation	SNP	-	p.G443V	ENST00000373204.4	37	c.1328	CCDS398.1	1	.	.	.	.	.	.	.	.	.	.	G	30	5.054995	0.93793	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.12879	2.64;2.64	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.47322	0.1439	H	0.95539	3.685	0.80722	D	1	P	0.38827	0.649	P	0.51055	0.657	T	0.58482	-0.7629	10	0.87932	D	0	-25.2753	19.7706	0.96363	0.0:0.0:1.0:0.0	.	443	Q9UL18	AGO1_HUMAN	V	368;443	ENSP00000362302:G368V;ENSP00000362300:G443V	ENSP00000362300:G443V	G	+	2	0	EIF2C1	36140456	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.697000	0.92050	0.655000	0.94253	GGG	-	NULL		0.577	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C1	protein_coding	OTTHUMT00000019337.3	G			36140456	1	no_errors	NM_012199	genbank	human	reviewed	54_36p	missense	SNP	1	T
KCNT2	343450	genome.wustl.edu	37	1	196295870	196295870	+	Silent	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr1:196295870G>A	ENST00000294725.9	-	19	3168	c.2253C>T	c.(2251-2253)ccC>ccT	p.P751P	KCNT2_ENST00000609185.1_Silent_p.P701P|KCNT2_ENST00000367433.5_Silent_p.P751P|KCNT2_ENST00000451324.2_Silent_p.P362P|KCNT2_ENST00000367431.4_Silent_p.P701P|KCNT2_ENST00000498426.1_Intron			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	751					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.P751P(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						GCAGTACTATGGGATTAAGTT	0.289																																																1	Substitution - coding silent(1)	ovary(1)	1											64.0	65.0	65.0					1																	196295870		2202	4294	6496	194562493	SO:0001819	synonymous_variant	343450			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2253C>T	1.37:g.196295870G>A			194562493	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	-	p.P751	ENST00000294725.9	37	c.2253	CCDS1384.1	1																																																																																			-	NULL		0.289	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	protein_coding	OTTHUMT00000086418.2	G	NM_198503		194562493	-1	no_errors	NM_198503	genbank	human	validated	54_36p	silent	SNP	1	A
LOXL4	84171	genome.wustl.edu	37	10	100011378	100011378	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr10:100011378A>G	ENST00000260702.3	-	13	2183	c.2033T>C	c.(2032-2034)aTt>aCt	p.I678T	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	678	Lysyl-oxidase like.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)	p.I678T(1)		breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		CTGGCAATCAATGTCATGCCG	0.562																																																1	Substitution - Missense(1)	ovary(1)	10											95.0	83.0	87.0					10																	100011378		2203	4300	6503	100001368	SO:0001583	missense	84171			AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.2033T>C	10.37:g.100011378A>G	ENSP00000260702:p.Ile678Thr		100001368	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Missense_Mutation	SNP	HMMPfam_SRCR;superfamily_SRCR-like;HMMPfam_Lysyl_oxidase	p.I678T	ENST00000260702.3	37	c.2033	CCDS7473.1	10	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480351	0.84747	.	.	ENSG00000138131	ENST00000260702	T	0.40225	1.04	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.69468	0.3114	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76520	-0.2929	10	0.87932	D	0	.	14.1079	0.65104	1.0:0.0:0.0:0.0	.	678	Q96JB6	LOXL4_HUMAN	T	678	ENSP00000260702:I678T	ENSP00000260702:I678T	I	-	2	0	LOXL4	100001368	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	9.309000	0.96252	1.954000	0.56735	0.533000	0.62120	ATT	-	HMMPfam_Lysyl_oxidase		0.562	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL4	protein_coding	OTTHUMT00000049766.1	A	NM_032211		100001368	-1	no_errors	NM_032211	genbank	human	reviewed	54_36p	missense	SNP	1	G
MKI67	4288	genome.wustl.edu	37	10	129905140	129905140	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr10:129905140G>A	ENST00000368654.3	-	13	5339	c.4964C>T	c.(4963-4965)aCa>aTa	p.T1655I	MKI67_ENST00000368653.3_Missense_Mutation_p.T1295I	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1655	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)	p.T1655I(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTCTCCTGATGTCTGTGTGAG	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											217.0	211.0	213.0					10																	129905140		2203	4300	6503	129795130	SO:0001583	missense	4288			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4964C>T	10.37:g.129905140G>A	ENSP00000357643:p.Thr1655Ile		129795130	Q5VWH2	Missense_Mutation	SNP	HMMPfam_FHA;superfamily_SMAD/FHA domain;HMMPfam_K167R	p.T1655I	ENST00000368654.3	37	c.4964	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	8.361	0.833194	0.16820	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02395	4.31;4.31	2.95	-1.18	0.09617	.	2.416420	0.02583	N	0.099025	T	0.04588	0.0125	M	0.65975	2.015	0.09310	N	1	B;B;P	0.35793	0.131;0.307;0.521	B;B;B	0.35182	0.06;0.117;0.197	T	0.40683	-0.9550	10	0.30078	T	0.28	.	4.5622	0.12166	0.4092:0.1612:0.4296:0.0	.	1654;1295;1655	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	I	1655;1295;1654	ENSP00000357643:T1655I;ENSP00000357642:T1295I	ENSP00000357642:T1295I	T	-	2	0	MKI67	129795130	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.838000	0.04372	-0.269000	0.09298	-0.244000	0.11960	ACA	-	HMMPfam_K167R		0.507	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	protein_coding	OTTHUMT00000050999.1	G	NM_002417		129795130	-1	no_errors	NM_002417	genbank	human	reviewed	54_36p	missense	SNP		A
RAB40AL	282808	genome.wustl.edu	37	X	102192455	102192456	+	Missense_Mutation	DNP	CG	CG	TT			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C|G	C|G	C|G	T	C|G	C|G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chrX:102192455_102192456CG>TT	ENST00000218249.5	+	1	256_257	c.209_210CG>TT	c.(208-210)aCG>aTT	p.T70I	LL0XNC01-237H1.3_ENST00000413528.1_RNA	NM_001031834.1	NP_001027004.1	P0C0E4	RB40L_HUMAN	RAB40A, member RAS oncogene family-like	70					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.T70M(2)|p.T70T(2)		endometrium(4)|large_intestine(2)|lung(3)|ovary(3)	12						CTCTGGGATACGTCGGGGCAGG	0.584																																																4	Substitution - Missense(2)|Substitution - coding silent(2)	ovary(4)	X																																								102079111|102079112	SO:0001583	missense	282808			BC101169	CCDS35353.1	Xq22.2	2008-02-05			ENSG00000102128	ENSG00000102128			25410	protein-coding gene	gene with protein product	"""Ras like GTPase"""	300405					Standard	NM_001031834		Approved	RAR2, RLGP	uc004ejs.3	P0C0E4	OTTHUMG00000022084	Exception_encountered	X.37:g.102192455_102192456delinsTT	ENSP00000218249:p.Thr70Ile		102079111|102079112	Q495H3	Missense_Mutation|Silent	SNP	-	p.T70M|p.T70	ENST00000218249.5	37	c.209|c.210	CCDS35353.1	X																																																																																			-	NULL		0.584	RAB40AL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40AL	protein_coding	OTTHUMT00000057679.1	C|G	NM_001031834		102079111|102079112	1	no_errors	NM_001031834	genbank	human	provisional	54_36p	missense|silent	SNP	1|0.99	T
PTPN5	84867	genome.wustl.edu	37	11	18759442	18759442	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr11:18759442T>C	ENST00000358540.2	-	9	1415	c.985A>G	c.(985-987)Aaa>Gaa	p.K329E	PTPN5_ENST00000396171.4_Missense_Mutation_p.K329E|PTPN5_ENST00000496201.2_5'Flank|PTPN5_ENST00000396170.1_Missense_Mutation_p.K297E|PTPN5_ENST00000396167.2_Missense_Mutation_p.K297E|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396168.1_Missense_Mutation_p.K305E|PTPN5_ENST00000477854.1_Missense_Mutation_p.K133E	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	329	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)	p.K329E(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						AGTATGGTTTTGTACCGGTTC	0.587																																																1	Substitution - Missense(1)	ovary(1)	11											147.0	121.0	130.0					11																	18759442		2199	4293	6492	18716018	SO:0001583	missense	84867			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.985A>G	11.37:g.18759442T>C	ENSP00000351342:p.Lys329Glu		18716018	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	HMMPfam_Y_phosphatase;superfamily_(Phosphotyrosine protein) phosphatases II	p.K329E	ENST00000358540.2	37	c.985	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707103	0.68615	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.25	5.25	0.73442	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.85344	0.5675	M	0.83852	2.665	0.80722	D	1	B;B	0.27971	0.047;0.196	B;B	0.32022	0.139;0.138	D	0.85257	0.1048	10	0.62326	D	0.03	.	15.1609	0.72785	0.0:0.0:0.0:1.0	.	329;297	P54829;B3KXG7	PTN5_HUMAN;.	E	133;329;297;329;297;305	ENSP00000435056:K133E;ENSP00000351342:K329E;ENSP00000379473:K297E;ENSP00000379474:K329E;ENSP00000379470:K297E;ENSP00000379471:K305E	ENSP00000351342:K329E	K	-	1	0	PTPN5	18716018	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.921000	0.70028	1.991000	0.58162	0.460000	0.39030	AAA	-	HMMPfam_Y_phosphatase		0.587	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	protein_coding	OTTHUMT00000259196.2	T	NM_001039970		18716018	-1	no_errors	NM_006906	genbank	human	validated	54_36p	missense	SNP	1	C
CAT	847	genome.wustl.edu	37	11	34470831	34470831	+	Silent	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr11:34470831G>A	ENST00000241052.4	+	2	248	c.159G>A	c.(157-159)caG>caA	p.Q53Q		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	53					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.Q53Q(1)		breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	TTCTTGTTCAGGATGTGGTTT	0.468																																																1	Substitution - coding silent(1)	ovary(1)	11											109.0	107.0	108.0					11																	34470831		2202	4298	6500	34427407	SO:0001819	synonymous_variant	847			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.159G>A	11.37:g.34470831G>A			34427407	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Silent	SNP	HMMPfam_Catalase,superfamily_Heme-dependent catalases	p.Q53	ENST00000241052.4	37	c.159	CCDS7891.1	11																																																																																			-	HMMPfam_Catalase		0.468	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAT	protein_coding	OTTHUMT00000103197.2	G	NM_001752		34427407	1	no_errors	NM_001752	genbank	human	validated	54_36p	silent	SNP	1	A
STX3	6809	genome.wustl.edu	37	11	59560622	59560622	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr11:59560622A>G	ENST00000337979.4	+	7	1064	c.517A>G	c.(517-519)Aac>Gac	p.N173D	STX3_ENST00000437946.2_Missense_Mutation_p.N76D|STX3_ENST00000529177.1_Missense_Mutation_p.N173D|STX3_ENST00000535361.1_Missense_Mutation_p.N173D|STX3_ENST00000300150.7_Missense_Mutation_p.N142D	NM_001178040.1|NM_004177.4	NP_001171511.1|NP_004168.1	Q13277	STX3_HUMAN	syntaxin 3	173					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|long-term synaptic potentiation (GO:0060291)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|neurotransmitter transport (GO:0006836)	apical plasma membrane (GO:0016324)|azurophil granule (GO:0042582)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|SNARE complex (GO:0031201)|specific granule (GO:0042581)|vacuole (GO:0005773)	arachidonic acid binding (GO:0050544)	p.N173D(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|skin(1)	13						GGAGAGTGGCAACCCGGCCAT	0.532																																																1	Substitution - Missense(1)	ovary(1)	11											106.0	97.0	100.0					11																	59560622		2201	4295	6496	59317198	SO:0001583	missense	6809			AJ002076	CCDS7975.1, CCDS53637.1	11q12.1	2008-02-05	2006-04-25	2006-04-25	ENSG00000166900	ENSG00000166900			11438	protein-coding gene	gene with protein product		600876	"""syntaxin 3A"""	STX3A		16598260, 16339081	Standard	NM_004177		Approved		uc001nog.3	Q13277	OTTHUMG00000167353	ENST00000337979.4:c.517A>G	11.37:g.59560622A>G	ENSP00000338562:p.Asn173Asp		59317198	B4DME0|O43750|O43751|Q15360	Missense_Mutation	SNP	-	p.N173D	ENST00000337979.4	37	c.517	CCDS7975.1	11	.	.	.	.	.	.	.	.	.	.	A	22.3	4.265284	0.80358	.	.	ENSG00000166900	ENST00000300150;ENST00000337979;ENST00000535361;ENST00000437946;ENST00000529177;ENST00000528805	T;T;T;T;T;T	0.22945	1.93;1.93;1.93;1.93;1.93;1.93	5.11	5.11	0.69529	t-SNARE (1);	0.000000	0.85682	D	0.000000	T	0.34366	0.0895	M	0.66506	2.035	0.80722	D	1	B;P;P;P	0.42161	0.003;0.525;0.772;0.663	B;B;P;B	0.44623	0.01;0.163;0.455;0.338	T	0.11084	-1.0602	10	0.44086	T	0.13	-7.7903	13.7354	0.62815	1.0:0.0:0.0:0.0	.	76;173;173;173	E7ET77;B4DME0;Q13277-2;Q13277	.;.;.;STX3_HUMAN	D	142;173;173;76;173;125	ENSP00000300150:N142D;ENSP00000338562:N173D;ENSP00000441649:N173D;ENSP00000393536:N76D;ENSP00000433248:N173D;ENSP00000431386:N125D	ENSP00000300150:N142D	N	+	1	0	STX3	59317198	1.000000	0.71417	0.999000	0.59377	0.685000	0.39939	8.775000	0.91772	1.927000	0.55829	0.454000	0.30748	AAC	-	NULL		0.532	STX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX3	protein_coding	OTTHUMT00000394264.1	A	NM_004177		59317198	1	no_errors	NM_004177	genbank	human	provisional	54_36p	missense	SNP	1	G
BATF2	116071	genome.wustl.edu	37	11	64757120	64757120	+	Silent	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr11:64757120C>T	ENST00000301887.4	-	3	436	c.306G>A	c.(304-306)caG>caA	p.Q102Q	BATF2_ENST00000527716.1_Silent_p.Q78Q|BATF2_ENST00000435842.2_Silent_p.Q17Q	NM_138456.3	NP_612465.3	Q8N1L9	BATF2_HUMAN	basic leucine zipper transcription factor, ATF-like 2	102					defense response to protozoan (GO:0042832)|myeloid dendritic cell differentiation (GO:0043011)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q102Q(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|skin(1)	9						GCCCCTCAGCCTGGTCCCAGC	0.687																																																1	Substitution - coding silent(1)	ovary(1)	11											20.0	21.0	21.0					11																	64757120		2195	4294	6489	64513696	SO:0001819	synonymous_variant	116071			AK092453	CCDS8087.1, CCDS73317.1	11q13.1	2013-01-10			ENSG00000168062	ENSG00000168062		"""basic leucine zipper proteins"""	25163	protein-coding gene	gene with protein product		614983					Standard	NM_138456		Approved	MGC20410	uc001ocf.1	Q8N1L9	OTTHUMG00000165633	ENST00000301887.4:c.306G>A	11.37:g.64757120C>T			64513696	D9IC56|Q8NAF4|Q8NAL8|Q96EH4	Silent	SNP	-	p.Q102	ENST00000301887.4	37	c.306	CCDS8087.1	11																																																																																			-	NULL		0.687	BATF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BATF2	protein_coding	OTTHUMT00000385478.2	C	NM_138456		64513696	-1	no_errors	NM_138456	genbank	human	validated	54_36p	silent	SNP	0.03	T
MALAT1	378938	genome.wustl.edu	37	11	65270102	65270102	+	lincRNA	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr11:65270102C>T	ENST00000534336.1	+	0	4870					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTTTTTTTTTCTATAGACTTT	0.373																																																0			11											63.0	66.0	65.0					11																	65270102		874	1988	2862	65026678			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65270102C>T			65026678		RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.373	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	C	NR_002819		65026678	1	no_errors	NR_002819	genbank	human	provisional	54_36p	rna	SNP	1	T
FAT3	120114	genome.wustl.edu	37	11	92600264	92600264	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr11:92600264G>A	ENST00000298047.6	+	21	12033	c.12016G>A	c.(12016-12018)Gcg>Acg	p.A4006T	FAT3_ENST00000409404.2_Missense_Mutation_p.A4006T|FAT3_ENST00000525166.1_Missense_Mutation_p.A3856T|FAT3_ENST00000533797.1_Missense_Mutation_p.A341T			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	4006	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A581T(1)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGCAGCTTCGCGGAGGTGGT	0.662										TCGA Ovarian(4;0.039)																																						1	Substitution - Missense(1)	ovary(1)	11											10.0	12.0	11.0					11																	92600264		2012	4168	6180	92239912	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.12016G>A	11.37:g.92600264G>A	ENSP00000298047:p.Ala4006Thr		92239912	B5MDB0|Q96AU6	Missense_Mutation	SNP	-	p.A4006T	ENST00000298047.6	37	c.12016		11	.	.	.	.	.	.	.	.	.	.	G	36	5.672652	0.96754	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;D	0.86432	-0.94;-0.95;-0.95;-2.12	5.94	5.94	0.96194	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	D	0.92532	0.7628	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;0.99	D;P	0.74023	0.982;0.611	D	0.91475	0.5200	9	0.49607	T	0.09	.	20.3632	0.98871	0.0:0.0:1.0:0.0	.	4006;4006	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	T	4006;4006;3856;341	ENSP00000298047:A4006T;ENSP00000387040:A4006T;ENSP00000432586:A3856T;ENSP00000436399:A341T	ENSP00000298047:A4006T	A	+	1	0	FAT3	92239912	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.377000	0.97184	2.826000	0.97356	0.561000	0.74099	GCG	-	NULL		0.662	FAT3-201	KNOWN	basic	protein_coding	FAT3	protein_coding		G	NM_001008781		92239912	1	no_errors	NM_001008781	genbank	human	validated	54_36p	missense	SNP	1	A
LRRK2	120892	genome.wustl.edu	37	12	40699656	40699656	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr12:40699656T>A	ENST00000298910.7	+	28	3905	c.3847T>A	c.(3847-3849)Tcc>Acc	p.S1283T		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1283					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)	p.S1283T(2)		NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GGAACTAAGATCCTTTCCCAA	0.363																																																2	Substitution - Missense(2)	ovary(2)	12											91.0	88.0	89.0					12																	40699656		2203	4300	6503	38985923	SO:0001583	missense	120892			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.3847T>A	12.37:g.40699656T>A	ENSP00000298910:p.Ser1283Thr		38985923	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	HMMPfam_Pkinase,superfamily_Ankyrin repeat,superfamily_Protein kinase-like (PK-like),superfamily_WD40 repeat-like,superfamily_ARM repeat,superfamily_L domain-like,superfamily_P-loop containing nucleoside triphosphate hydrolases,Pkinase,LRR_1,HMMPfam_LRR_1,LRR_2,HMMPfam_LRR_2,Miro,HMMPfam_Miro	p.S1283T	ENST00000298910.7	37	c.3847	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	11.20	1.568002	0.28003	.	.	ENSG00000188906	ENST00000298910	T	0.25579	1.79	5.82	5.82	0.92795	.	0.055581	0.85682	D	0.000000	T	0.21062	0.0507	L	0.41824	1.3	0.37980	D	0.933571	B;B	0.25667	0.128;0.131	B;B	0.24974	0.056;0.057	T	0.12811	-1.0533	10	0.22109	T	0.4	.	11.2821	0.49201	0.1361:0.0:0.0:0.8639	.	1283;1283	Q17RV3;Q5S007	.;LRRK2_HUMAN	T	1283	ENSP00000298910:S1283T	ENSP00000298910:S1283T	S	+	1	0	LRRK2	38985923	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.734000	0.68580	2.214000	0.71695	0.533000	0.62120	TCC	-	HMMPfam_LRR_1		0.363	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	T	XM_058513		38985923	1	no_errors	NM_198578	genbank	human	reviewed	54_36p	missense	SNP	1	A
GLIPR1	11010	genome.wustl.edu	37	12	75884247	75884247	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr12:75884247G>T	ENST00000266659.3	+	3	683	c.482G>T	c.(481-483)gGc>gTc	p.G161V	RP11-585P4.5_ENST00000547326.1_RNA	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	161	SCP.				cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.G161V(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						AAAGTTTCTGGCTTTGACGCT	0.453																																																1	Substitution - Missense(1)	ovary(1)	12											97.0	94.0	95.0					12																	75884247		2203	4300	6503	74170514	SO:0001583	missense	11010			U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.482G>T	12.37:g.75884247G>T	ENSP00000266659:p.Gly161Val		74170514	A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	-	p.G161V	ENST00000266659.3	37	c.482	CCDS9011.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.39|12.39	1.923328|1.923328	0.33908|0.33908	.|.	.|.	ENSG00000139278|ENSG00000139278	ENST00000456650;ENST00000550491|ENST00000266659	T|T	0.13538|0.08102	2.58|3.13	4.86|4.86	2.99|2.99	0.34606|0.34606	.|CAP domain (3);	.|0.603639	.|0.16865	.|N	.|0.196368	T|T	0.10121|0.10121	0.0248|0.0248	L|L	0.48642|0.48642	1.525|1.525	0.19945|0.19945	N|N	0.999948|0.999948	P|P	0.46512|0.46784	0.879|0.884	B|P	0.43274|0.49252	0.414|0.604	T|T	0.07046|0.07046	-1.0793|-1.0793	9|10	0.18710|0.08179	T|T	0.47|0.78	.|.	8.6397|8.6397	0.33970|0.33970	0.2641:0.0:0.7359:0.0|0.2641:0.0:0.7359:0.0	.|.	185|161	F6VVE8|P48060	.|GLIP1_HUMAN	S|V	185;44|161	ENSP00000391144:A185S|ENSP00000266659:G161V	ENSP00000391144:A185S|ENSP00000266659:G161V	A|G	+|+	1|2	0|0	GLIPR1|GLIPR1	74170514|74170514	0.039000|0.039000	0.19947|0.19947	0.011000|0.011000	0.14972|0.14972	0.053000|0.053000	0.15095|0.15095	1.844000|1.844000	0.39269|0.39269	1.020000|1.020000	0.39573|0.39573	0.655000|0.655000	0.94253|0.94253	GCT|GGC	-	NULL		0.453	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1	protein_coding	OTTHUMT00000405722.1	G	NM_006851		74170514	1	no_errors	NM_006851	genbank	human	reviewed	54_36p	missense	SNP	0.022	T
NR2C1	7181	genome.wustl.edu	37	12	95445552	95445552	+	Silent	SNP	G	G	A	rs113197444		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr12:95445552G>A	ENST00000333003.5	-	8	1281	c.951C>T	c.(949-951)aaC>aaT	p.N317N	NR2C1_ENST00000330677.7_Silent_p.N317N|NR2C1_ENST00000393101.3_Silent_p.N317N|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	317					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.N317N(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						AAACATCACCGTTGGTCTGCA	0.284																																																1	Substitution - coding silent(1)	ovary(1)	12											104.0	95.0	98.0					12																	95445552		2203	4297	6500	93969683	SO:0001819	synonymous_variant	7181			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.951C>T	12.37:g.95445552G>A			93969683	A8K5K4|Q15625|Q15626	Silent	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.N317	ENST00000333003.5	37	c.951	CCDS9051.1	12																																																																																			-	NULL		0.284	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	protein_coding	OTTHUMT00000407565.2	G	NM_003297		93969683	-1	no_errors	NM_003297	genbank	human	reviewed	54_36p	silent	SNP	0.33	A
ELK3	2004	genome.wustl.edu	37	12	96640793	96640793	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr12:96640793C>G	ENST00000228741.3	+	3	609	c.283C>G	c.(283-285)Cct>Gct	p.P95A	ELK3_ENST00000552142.1_Intron	NM_005230.2	NP_005221.2	P41970	ELK3_HUMAN	ELK3, ETS-domain protein (SRF accessory protein 2)	95					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|wound healing (GO:0042060)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P95A(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(5)|ovary(2)|prostate(1)|stomach(2)	20	all_cancers(2;0.00173)					GAAGATGGATCCTCACGCGGT	0.562																																																1	Substitution - Missense(1)	ovary(1)	12											67.0	72.0	70.0					12																	96640793		2203	4300	6503	95164924	SO:0001583	missense	2004			BC017371	CCDS9060.1	12q23	2006-12-30				ENSG00000111145			3325	protein-coding gene	gene with protein product		600247				7851904	Standard	NM_005230		Approved	ERP, NET, SAP2	uc001teo.1	P41970		ENST00000228741.3:c.283C>G	12.37:g.96640793C>G	ENSP00000228741:p.Pro95Ala		95164924	B2R6S6|Q6FG57|Q6GU29|Q9UD17	Missense_Mutation	SNP	-	p.P95A	ENST00000228741.3	37	c.283	CCDS9060.1	12	.	.	.	.	.	.	.	.	.	.	C	18.57	3.653053	0.67472	.	.	ENSG00000111145	ENST00000228741;ENST00000547860	T;T	0.53857	0.6;0.6	5.74	3.87	0.44632	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.045675	0.85682	N	0.000000	T	0.53045	0.1772	M	0.79258	2.445	0.80722	D	1	B	0.17038	0.02	B	0.15870	0.014	T	0.51810	-0.8658	10	0.49607	T	0.09	.	11.4034	0.49883	0.0:0.805:0.1268:0.0682	.	95	P41970	ELK3_HUMAN	A	95	ENSP00000228741:P95A;ENSP00000447857:P95A	ENSP00000228741:P95A	P	+	1	0	ELK3	95164924	1.000000	0.71417	0.880000	0.34516	0.903000	0.53119	5.700000	0.68318	0.740000	0.32651	0.561000	0.74099	CCT	-	NULL		0.562	ELK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELK3	protein_coding	OTTHUMT00000408694.1	C	NM_005230		95164924	1	no_errors	NM_005230	genbank	human	reviewed	54_36p	missense	SNP	1	G
DHRS4	10901	genome.wustl.edu	37	14	24424255	24424255	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr14:24424255C>T	ENST00000313250.5	+	2	343	c.140C>T	c.(139-141)gCc>gTc	p.A47V	DHRS4-AS1_ENST00000556379.1_RNA|DHRS4_ENST00000397073.2_Missense_Mutation_p.A29V|DHRS4_ENST00000558581.1_Missense_Mutation_p.A47V|DHRS4_ENST00000421831.1_Missense_Mutation_p.A29V|DHRS4_ENST00000382761.3_Missense_Mutation_p.A29V|DHRS4_ENST00000397074.3_Missense_Mutation_p.A47V|DHRS4_ENST00000559632.1_Missense_Mutation_p.A47V|DHRS4_ENST00000543741.2_Missense_Mutation_p.A47V|DHRS4_ENST00000308178.8_Missense_Mutation_p.A29V|DHRS4_ENST00000397075.3_Missense_Mutation_p.A47V|DHRS4_ENST00000558263.1_Missense_Mutation_p.A47V	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	47					alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)	p.A47V(1)		central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	ATCGGCTTCGCCATCGCCCGG	0.622																																																1	Substitution - Missense(1)	ovary(1)	14											48.0	54.0	52.0					14																	24424255		2203	4300	6503	23494095	SO:0001583	missense	10901			AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.140C>T	14.37:g.24424255C>T	ENSP00000326219:p.Ala47Val		23494095	B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Missense_Mutation	SNP	-	p.A47V	ENST00000313250.5	37	c.140	CCDS9605.1	14	.	.	.	.	.	.	.	.	.	.	.	16.87	3.242536	0.58995	.	.	ENSG00000157326	ENST00000313250;ENST00000421831;ENST00000397073;ENST00000308178;ENST00000382761;ENST00000397075;ENST00000397074;ENST00000543741	T;T;T;D;T;D;D;T	0.89196	1.53;1.53;1.53;-2.48;1.53;-2.48;-2.48;1.53	3.48	2.56	0.30785	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93739	0.7999	M	0.86097	2.795	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.83275	0.994;0.977;0.987;0.969;0.996;0.986	D	0.93001	0.6423	10	0.87932	D	0	.	9.6328	0.39789	0.2104:0.7896:0.0:0.0	.	47;47;47;47;47;47	Q9BTZ2-5;F5GWZ1;Q9BTZ2-2;Q9BTZ2-7;Q9BTZ2-4;Q9BTZ2	.;.;.;.;.;DHRS4_HUMAN	V	47;29;29;29;29;47;47;47	ENSP00000326219:A47V;ENSP00000404147:A29V;ENSP00000380263:A29V;ENSP00000311993:A29V;ENSP00000372209:A29V;ENSP00000380265:A47V;ENSP00000380264:A47V;ENSP00000440508:A47V	ENSP00000311993:A29V	A	+	2	0	DHRS4	23494095	1.000000	0.71417	0.878000	0.34440	0.378000	0.30076	6.855000	0.75445	0.652000	0.30806	0.479000	0.44913	GCC	-	NULL		0.622	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS4	protein_coding	OTTHUMT00000071857.3	C			23494095	1	no_errors	NM_021004	genbank	human	validated	54_36p	missense	SNP	1	T
SNW1	22938	genome.wustl.edu	37	14	78203372	78203372	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr14:78203372G>C	ENST00000261531.7	-	6	642	c.580C>G	c.(580-582)Cag>Gag	p.Q194E	SNW1_ENST00000555761.1_Missense_Mutation_p.Q194E|SLIRP_ENST00000557431.1_Intron|SNW1_ENST00000554775.1_Missense_Mutation_p.Q32E	NM_012245.2	NP_036377.1	Q13573	SNW1_HUMAN	SNW domain containing 1	194	SNW.				cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of vitamin D receptor signaling pathway (GO:0070564)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin D receptor signaling pathway (GO:0070562)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|chromatin (GO:0000785)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	Notch binding (GO:0005112)|nuclear hormone receptor binding (GO:0035257)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)|SMAD binding (GO:0046332)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|vitamin D receptor binding (GO:0042809)	p.Q194E(1)		NS(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		ATAACCCTCTGTTTAGCTCCA	0.398																																																1	Substitution - Missense(1)	ovary(1)	14											170.0	152.0	158.0					14																	78203372		2203	4300	6503	77273125	SO:0001583	missense	22938			AF045184	CCDS9867.1	14q22.1-q22.3	2005-09-13	2005-09-13	2005-09-13		ENSG00000100603			16696	protein-coding gene	gene with protein product		603055	"""SKI interacting protein"""	SKIIP		8973337, 9632709	Standard	NM_012245		Approved	NCoA-62, SKIP, Prp45, PRPF45, Bx42	uc001xuf.3	Q13573		ENST00000261531.7:c.580C>G	14.37:g.78203372G>C	ENSP00000261531:p.Gln194Glu		77273125	A8K8A9|Q13483|Q32N03|Q5D0D6	Missense_Mutation	SNP	HMMPfam_SKIP_SNW;superfamily_Domain of the SRP/SRP receptor G-proteins	p.Q194E	ENST00000261531.7	37	c.580	CCDS9867.1	14	.	.	.	.	.	.	.	.	.	.	G	25.5	4.649129	0.87958	.	.	ENSG00000100603	ENST00000261531;ENST00000554775;ENST00000555761;ENST00000416259	.	.	.	5.98	5.98	0.97165	SKI-interacting protein SKIP, SNW domain (1);	0.000000	0.85682	D	0.000000	T	0.74107	0.3673	L	0.60957	1.885	0.80722	D	1	D;B	0.54601	0.967;0.071	P;B	0.60886	0.88;0.078	T	0.65721	-0.6099	9	0.18710	T	0.47	.	20.4366	0.99092	0.0:0.0:1.0:0.0	.	194;194	G3V3A4;Q13573	.;SNW1_HUMAN	E	194;32;194;194	.	ENSP00000261531:Q194E	Q	-	1	0	SNW1	77273125	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.809000	0.99208	2.843000	0.97960	0.585000	0.79938	CAG	-	HMMPfam_SKIP_SNW		0.398	SNW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNW1	protein_coding	OTTHUMT00000413912.1	G	NM_012245		77273125	-1	no_errors	NM_012245	genbank	human	reviewed	54_36p	missense	SNP	1	C
SCAMP2	10066	genome.wustl.edu	37	15	75140947	75140947	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr15:75140947C>G	ENST00000268099.9	-	7	837	c.728G>C	c.(727-729)gGg>gCg	p.G243A		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	243					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)		p.G243A(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						TCACCTGTCCCCCAGGCCAGG	0.507																																																1	Substitution - Missense(1)	ovary(1)	15											57.0	54.0	55.0					15																	75140947		2197	4295	6492	72928000	SO:0001583	missense	10066			AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.728G>C	15.37:g.75140947C>G	ENSP00000268099:p.Gly243Ala		72928000	B2RDF0|Q9BQE8	Missense_Mutation	SNP	HMMPfam_SCAMP	p.G243A	ENST00000268099.9	37	c.728	CCDS10271.1	15	.	.	.	.	.	.	.	.	.	.	C	32	5.114036	0.94339	.	.	ENSG00000140497	ENST00000268099;ENST00000543345	T	0.29917	1.55	5.69	5.69	0.88448	.	0.051099	0.85682	N	0.000000	T	0.59445	0.2194	M	0.79614	2.46	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.979;0.996	T	0.59947	-0.7358	10	0.54805	T	0.06	.	18.8151	0.92073	0.0:1.0:0.0:0.0	.	243;212	O15127;B3KU14	SCAM2_HUMAN;.	A	243;212	ENSP00000268099:G243A	ENSP00000268099:G243A	G	-	2	0	SCAMP2	72928000	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.684000	0.84104	2.700000	0.92200	0.643000	0.83706	GGG	-	HMMPfam_SCAMP		0.507	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP2	protein_coding	OTTHUMT00000286403.3	C	NM_005697		72928000	-1	no_errors	NM_005697	genbank	human	reviewed	54_36p	missense	SNP	1	G
WDR93	56964	genome.wustl.edu	37	15	90270453	90270453	+	Missense_Mutation	SNP	G	G	A	rs142014935		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr15:90270453G>A	ENST00000268130.7	+	9	1047	c.946G>A	c.(946-948)Ggg>Agg	p.G316R	WDR93_ENST00000444934.2_Missense_Mutation_p.G33R|WDR93_ENST00000560294.1_Missense_Mutation_p.G316R	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	316					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.G316R(1)		NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			ACTGGGCTCCGGGCAGAATCA	0.483													G|||	1	0.000199681	0.0	0.0	5008	,	,		17635	0.0		0.001	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	15						G	ARG/GLY	0,4400		0,0,2200	55.0	54.0	54.0		946	5.6	1.0	15	dbSNP_134	54	1,8597	1.2+/-3.3	0,1,4298	yes	missense	WDR93	NM_020212.1	125	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	316/687	90270453	1,12997	2200	4299	6499	88071457	SO:0001583	missense	56964				CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.946G>A	15.37:g.90270453G>A	ENSP00000268130:p.Gly316Arg		88071457	Q8N7Y8|Q9NP89	Missense_Mutation	SNP	-	p.G316R	ENST00000268130.7	37	c.946	CCDS32326.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	24.2	4.507534	0.85282	0.0	1.16E-4	ENSG00000140527	ENST00000268130;ENST00000444934	T;D	0.85339	0.46;-1.97	5.59	5.59	0.84812	WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000002	D	0.91808	0.7408	M	0.74881	2.28	0.43667	D	0.996099	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.92416	0.5941	10	0.87932	D	0	-27.3154	15.0792	0.72103	0.0:0.0:1.0:0.0	.	316;316	Q6P2C0-2;Q6P2C0	.;WDR93_HUMAN	R	316;33	ENSP00000268130:G316R;ENSP00000403871:G33R	ENSP00000268130:G316R	G	+	1	0	WDR93	88071457	1.000000	0.71417	0.964000	0.40570	0.982000	0.71751	5.373000	0.66162	2.631000	0.89168	0.563000	0.77884	GGG	-	NULL		0.483	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR93	protein_coding	OTTHUMT00000416369.1	G	NM_020212		88071457	1	no_errors	NM_020212	genbank	human	provisional	54_36p	missense	SNP	0.98	A
IFT140	9742	genome.wustl.edu	37	16	1642487	1642487	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr16:1642487G>A	ENST00000426508.2	-	5	835	c.472C>T	c.(472-474)Cgg>Tgg	p.R158W	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	158					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)		p.R158W(1)		breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				GGGGGGAGCCGGAAGATGCAG	0.607																																																1	Substitution - Missense(1)	ovary(1)	16											104.0	92.0	96.0					16																	1642487		2199	4300	6499	1582488	SO:0001583	missense	9742			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.472C>T	16.37:g.1642487G>A	ENSP00000406012:p.Arg158Trp		1582488	A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	-	p.R158W	ENST00000426508.2	37	c.472	CCDS10439.1	16	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137047	0.77775	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	T	0.62639	0.01	5.4	4.31	0.51392	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.113741	0.64402	N	0.000014	T	0.70666	0.3250	M	0.77103	2.36	0.54753	D	0.999988	D	0.89917	1.0	P	0.56514	0.8	T	0.72554	-0.4258	10	0.72032	D	0.01	.	6.313	0.21174	0.1153:0.0:0.7149:0.1698	.	158	Q96RY7	IF140_HUMAN	W	158	ENSP00000406012:R158W	ENSP00000380562:R158W	R	-	1	2	IFT140	1582488	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	1.753000	0.38359	1.154000	0.42482	0.591000	0.81541	CGG	-	NULL		0.607	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	protein_coding	OTTHUMT00000250438.2	G	NM_014714		1582488	-1	no_errors	NM_014714	genbank	human	validated	54_36p	missense	SNP	1	A
SETD6	79918	genome.wustl.edu	37	16	58552386	58552386	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr16:58552386G>A	ENST00000219315.4	+	7	1105	c.1055G>A	c.(1054-1056)gGa>gAa	p.G352E	SETD6_ENST00000310682.2_Missense_Mutation_p.G328E|SETD6_ENST00000394266.4_Missense_Mutation_p.G283E			Q8TBK2	SETD6_HUMAN	SET domain containing 6	352					negative regulation of NF-kappaB transcription factor activity (GO:0032088)|peptidyl-lysine monomethylation (GO:0018026)|regulation of inflammatory response (GO:0050727)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	NF-kappaB binding (GO:0051059)|protein-lysine N-methyltransferase activity (GO:0016279)	p.G328E(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	7						GGGGAAGAGGGAGCCTTTGTG	0.473																																																1	Substitution - Missense(1)	ovary(1)	16											113.0	109.0	110.0					16																	58552386		2198	4300	6498	57109887	SO:0001583	missense	79918			AK024801	CCDS10798.1, CCDS54013.1	16q21	2008-02-05			ENSG00000103037	ENSG00000103037			26116	protein-coding gene	gene with protein product						12477932	Standard	NM_024860		Approved	FLJ21148	uc002ens.3	Q8TBK2	OTTHUMG00000150276	ENST00000219315.4:c.1055G>A	16.37:g.58552386G>A	ENSP00000219315:p.Gly352Glu		57109887	A8K380|B5ME38|Q9H787	Missense_Mutation	SNP	-	p.G328E	ENST00000219315.4	37	c.983	CCDS54013.1	16	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102054	0.56183	.	.	ENSG00000103037	ENST00000310682;ENST00000394266;ENST00000219315;ENST00000447443	T;T;T;T	0.22743	2.36;2.36;2.36;1.94	5.73	4.78	0.61160	Rubisco LS methyltransferase, substrate-binding domain (2);	0.054325	0.64402	D	0.000001	T	0.33614	0.0869	M	0.72894	2.215	0.58432	D	0.999998	D;D	0.59767	0.957;0.986	P;P	0.55087	0.768;0.717	T	0.27331	-1.0077	10	0.07482	T	0.82	-17.7037	13.808	0.63246	0.0732:0.0:0.9268:0.0	.	352;328	Q8TBK2;Q8TBK2-2	SETD6_HUMAN;.	E	328;283;352;114	ENSP00000310082:G328E;ENSP00000377809:G283E;ENSP00000219315:G352E;ENSP00000396437:G114E	ENSP00000219315:G352E	G	+	2	0	SETD6	57109887	1.000000	0.71417	0.977000	0.42913	0.248000	0.25809	4.622000	0.61240	1.423000	0.47198	-0.136000	0.14681	GGA	-	NULL		0.473	SETD6-003	KNOWN	basic|CCDS	protein_coding	SETD6	protein_coding	OTTHUMT00000317274.2	G	NM_024860		57109887	1	no_errors	NM_024860	genbank	human	provisional	54_36p	missense	SNP	1	A
MYH3	4621	genome.wustl.edu	37	17	10545920	10545920	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr17:10545920T>C	ENST00000583535.1	-	16	1789	c.1702A>G	c.(1702-1704)Aag>Gag	p.K568E	MYH3_ENST00000226209.7_Missense_Mutation_p.K568E	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	568	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)	p.K568E(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TTGACCACCTTGGGCTTCTGG	0.542																																																1	Substitution - Missense(1)	ovary(1)	17											168.0	165.0	166.0					17																	10545920		2203	4300	6503	10486645	SO:0001583	missense	4621				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.1702A>G	17.37:g.10545920T>C	ENSP00000464317:p.Lys568Glu		10486645	Q15492	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Myosin_tail_1;HMMPfam_Myosin_N;superfamily_Prefoldin;superfamily_Spectrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.K568E	ENST00000583535.1	37	c.1702	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	T	27.0	4.786679	0.90367	.	.	ENSG00000109063	ENST00000226209	T	0.73258	-0.73	4.74	4.74	0.60224	Myosin head, motor domain (2);	.	.	.	.	D	0.85720	0.5762	M	0.90369	3.11	0.41782	D	0.989826	B	0.22080	0.064	P	0.48770	0.589	D	0.87004	0.2118	9	0.87932	D	0	.	14.6914	0.69087	0.0:0.0:0.0:1.0	.	568	P11055	MYH3_HUMAN	E	568	ENSP00000226209:K568E	ENSP00000226209:K568E	K	-	1	0	MYH3	10486645	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	3.370000	0.52372	2.122000	0.65172	0.528000	0.53228	AAG	-	HMMPfam_Myosin_head		0.542	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	protein_coding	OTTHUMT00000252734.2	T	NM_002470		10486645	-1	no_errors	NM_002470	genbank	human	reviewed	54_36p	missense	SNP	1	C
PIP4K2B	8396	genome.wustl.edu	37	17	36936743	36936743	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr17:36936743C>A	ENST00000269554.3	-	4	949	c.469G>T	c.(469-471)Gtg>Ttg	p.V157L	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	157	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)	p.V157L(1)		endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						ATCTCCGCCACGTCCTCGCTG	0.582																																																1	Substitution - Missense(1)	ovary(1)	17											100.0	89.0	93.0					17																	36936743		2203	4300	6503	34190269	SO:0001583	missense	8396			U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.469G>T	17.37:g.36936743C>A	ENSP00000269554:p.Val157Leu		34190269	Q5U0E8|Q8TBP2	Missense_Mutation	SNP	-	p.V157L	ENST00000269554.3	37	c.469	CCDS11329.1	17	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156740	0.78114	.	.	ENSG00000141720	ENST00000269554;ENST00000311500	T	0.34472	1.36	5.21	5.21	0.72293	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.056354	0.64402	D	0.000001	T	0.46852	0.1414	L	0.46614	1.455	0.58432	D	0.999999	P;P;B	0.40970	0.734;0.688;0.39	P;P;P	0.51487	0.671;0.618;0.547	T	0.16512	-1.0400	10	0.33940	T	0.23	-20.3191	17.4822	0.87675	0.0:1.0:0.0:0.0	.	157;157;157	C9JMM2;P78356-2;P78356	.;.;PI42B_HUMAN	L	157	ENSP00000269554:V157L	ENSP00000269554:V157L	V	-	1	0	PIP4K2B	34190269	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.360000	0.59455	2.716000	0.92895	0.561000	0.74099	GTG	-	NULL		0.582	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2B	protein_coding	OTTHUMT00000256791.1	C	NM_003559		34190269	-1	no_errors	NM_003559	genbank	human	reviewed	54_36p	missense	SNP	1	A
ZNF594	84622	genome.wustl.edu	37	17	5085758	5085758	+	Silent	SNP	G	G	A	rs144567321		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr17:5085758G>A	ENST00000399604.4	-	1	1934	c.1794C>T	c.(1792-1794)tgC>tgT	p.C598C	ZNF594_ENST00000575779.1_Silent_p.C598C			Q96JF6	ZN594_HUMAN	zinc finger protein 594	598					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C598C(1)		NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CACATTCTTTGCATTCATATG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	17											163.0	165.0	165.0					17																	5085758		2036	4211	6247	5026482	SO:0001819	synonymous_variant	84622			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.1794C>T	17.37:g.5085758G>A			5026482	Q6RFS0	Silent	SNP	-	p.C598	ENST00000399604.4	37	c.1794	CCDS42241.1	17																																																																																			-	NULL		0.413	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF594	protein_coding	OTTHUMT00000438996.1	G	XM_290737		5026482	-1	no_errors	NM_032530	genbank	human	validated	54_36p	silent	SNP	0.05	A
TP53	7157	genome.wustl.edu	37	17	7578526	7578526	+	Missense_Mutation	SNP	C	C	T	rs587781991		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr17:7578526C>T	ENST00000269305.4	-	5	593	c.404G>A	c.(403-405)tGc>tAc	p.C135Y	TP53_ENST00000445888.2_Missense_Mutation_p.C135Y|TP53_ENST00000420246.2_Missense_Mutation_p.C135Y|TP53_ENST00000413465.2_Missense_Mutation_p.C135Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C135Y|TP53_ENST00000359597.4_Missense_Mutation_p.C135Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135Y(60)|p.C135F(43)|p.C135S(8)|p.0?(8)|p.C42Y(4)|p.C3Y(4)|p.C135fs*9(3)|p.N131fs*27(2)|p.C3F(2)|p.C42F(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*15(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.C42S(1)|p.M133fs*13(1)|p.C3S(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCAGTTGGCAAAACATCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	152	Substitution - Missense(126)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(1)	large_intestine(19)|breast(17)|oesophagus(16)|haematopoietic_and_lymphoid_tissue(13)|urinary_tract(13)|upper_aerodigestive_tract(12)|prostate(11)|lung(9)|ovary(9)|liver(7)|bone(6)|stomach(5)|central_nervous_system(5)|soft_tissue(2)|autonomic_ganglia(2)|eye(1)|kidney(1)|pancreas(1)|skin(1)|NS(1)|pituitary(1)	17											50.0	50.0	50.0					17																	7578526		2203	4300	6503	7519251	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.404G>A	17.37:g.7578526C>T	ENSP00000269305:p.Cys135Tyr		7519251	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.C135Y	ENST00000269305.4	37	c.404	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	25.4	4.639320	0.87760	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.999;1.0;0.929;1.0;1.0;1.0;1.0	D	0.97312	0.9938	10	0.87932	D	0	-26.815	17.2272	0.86973	0.0:1.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135Y;ENSP00000352610:C135Y;ENSP00000269305:C135Y;ENSP00000398846:C135Y;ENSP00000391127:C135Y;ENSP00000391478:C135Y;ENSP00000425104:C3Y;ENSP00000423862:C42Y;ENSP00000424104:C135Y	ENSP00000269305:C135Y	C	-	2	0	TP53	7519251	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.772000	0.85439	2.733000	0.93635	0.655000	0.94253	TGC	-	HMMPfam_P53		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7519251	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	T
KLHL10	317719	genome.wustl.edu	37	17	40001495	40001495	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr17:40001495G>C	ENST00000293303.4	+	3	955	c.802G>C	c.(802-804)Gac>Cac	p.D268H		NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	268					cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)		p.D268H(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				GGCCATGTATGACCTCAACAT	0.453																																																1	Substitution - Missense(1)	ovary(1)	17											154.0	145.0	148.0					17																	40001495		2050	4203	6253	37255021	SO:0001583	missense	317719			AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.802G>C	17.37:g.40001495G>C	ENSP00000293303:p.Asp268His		37255021	Q6NW28|Q96MC0	Missense_Mutation	SNP	HMMPfam_Kelch_1;superfamily_Galactose oxidase central domain;HMMPfam_BACK;HMMPfam_BTB;superfamily_POZ domain	p.D268H	ENST00000293303.4	37	c.802	CCDS42340.1	17	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901968	0.72754	.	.	ENSG00000161594	ENST00000293303	T	0.68765	-0.35	6.17	6.17	0.99709	.	0.353708	0.35838	N	0.002948	T	0.64114	0.2569	M	0.69358	2.11	0.46478	D	0.999067	P;P	0.45283	0.855;0.855	B;B	0.39027	0.2;0.288	T	0.65788	-0.6083	9	.	.	.	.	13.6567	0.62341	0.0738:0.0:0.9262:0.0	.	262;268	B4DXV2;Q6JEL2	.;KLH10_HUMAN	H	268	ENSP00000293303:D268H	.	D	+	1	0	KLHL10	37255021	0.988000	0.35896	1.000000	0.80357	0.994000	0.84299	2.036000	0.41165	2.941000	0.99782	0.655000	0.94253	GAC	-	NULL		0.453	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL10	protein_coding	OTTHUMT00000326535.1	G	NM_152467		37255021	1	no_errors	NM_152467	genbank	human	validated	54_36p	missense	SNP	1	C
DSEL	92126	genome.wustl.edu	37	18	65180980	65180981	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	TG	TG					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr18:65180980_65180981delTG	ENST00000310045.7	-	2	2368_2369	c.895_896delCA	c.(895-897)cagfs	p.Q299fs	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	289					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)	p.Q299fs*10(1)		NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				AAAAACATACTGTGTGACGGAT	0.396																																																1	Deletion - Frameshift(1)	ovary(1)	18																																								63331961	SO:0001589	frameshift_variant	92126			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.895_896delCA	18.37:g.65180984_65180985delTG	ENSP00000310565:p.Gln299fs		63331960	Q17RH1|Q6P5Z3	Frame_Shift_Del	DEL	superfamily_P-loop containing nucleoside triphosphate hydrolases	p.Q299fs	ENST00000310045.7	37	c.896_895	CCDS11995.1	18																																																																																			(deletion:cds_exon[63329187;63332855])	NULL		0.396	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	protein_coding	OTTHUMT00000256221.1	TG	NM_032160		63331961	-1	no_errors	NM_032160	genbank	human	validated	54_36p	frame_shift_del	DEL	1.000:1.000	-
UNC13A	23025	genome.wustl.edu	37	19	17743933	17743933	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr19:17743933C>T	ENST00000519716.2	-	27	3284	c.3285G>A	c.(3283-3285)atG>atA	p.M1095I	UNC13A_ENST00000552293.1_Missense_Mutation_p.M1095I|UNC13A_ENST00000550896.1_Missense_Mutation_p.M1093I|UNC13A_ENST00000551649.1_Missense_Mutation_p.M1095I|UNC13A_ENST00000252773.7_Missense_Mutation_p.M1095I|UNC13A_ENST00000428389.2_Missense_Mutation_p.M1183I	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1095	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.M1183I(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TGGCGTACTTCATGTCTTGGG	0.537																																																1	Substitution - Missense(1)	ovary(1)	19											126.0	130.0	129.0					19																	17743933		2170	4286	6456	17604933	SO:0001583	missense	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.3285G>A	19.37:g.17743933C>T	ENSP00000429562:p.Met1095Ile		17604933	E5RHY9	Missense_Mutation	SNP	-	p.M1183I	ENST00000519716.2	37	c.3549	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	c	15.42	2.827948	0.50845	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	D;D;D;T;T;D	0.81821	-1.54;-1.54;-1.54;-1.4;-1.4;-1.54	3.41	3.41	0.39046	Calcium-dependent secretion activator (1);Munc13 homology 1 (1);	0.123173	0.56097	U	0.000022	T	0.76863	0.4047	L	0.42529	1.33	0.49389	D	0.999785	B	0.27910	0.193	B	0.37091	0.241	T	0.77368	-0.2614	10	0.54805	T	0.06	.	12.3225	0.54993	0.0:1.0:0.0:0.0	.	1095	Q9UPW8	UN13A_HUMAN	I	1095;1183;1095;1095;1095;1093	ENSP00000429562:M1095I;ENSP00000400409:M1183I;ENSP00000252773:M1095I;ENSP00000447236:M1095I;ENSP00000447572:M1095I;ENSP00000446831:M1093I	ENSP00000252773:M1095I	M	-	3	0	UNC13A	17604933	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.440000	0.80464	1.743000	0.51761	0.298000	0.19748	ATG	-	NULL		0.537	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	protein_coding	OTTHUMT00000376169.2	C	XM_038604		17604933	-1	no_errors	NM_001080421	genbank	human	provisional	54_36p	missense	SNP	1	T
SCN1A	6323	genome.wustl.edu	37	2	166848837	166848837	+	Missense_Mutation	SNP	T	T	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr2:166848837T>A	ENST00000303395.4	-	26	4947	c.4948A>T	c.(4948-4950)Atc>Ttc	p.I1650F	SCN1A_ENST00000423058.2_Missense_Mutation_p.I1650F|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.I1639F|SCN1A_ENST00000409050.1_Missense_Mutation_p.I1622F			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1650					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.I1639F(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTCCTTTGATCAGACGTAGG	0.488																																																1	Substitution - Missense(1)	ovary(1)	2											117.0	114.0	115.0					2																	166848837		2203	4300	6503	166557083	SO:0001583	missense	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4948A>T	2.37:g.166848837T>A	ENSP00000303540:p.Ile1650Phe		166557083	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Ion_trans;HMMPfam_Na_trans_assoc;superfamily_EF-hand;superfamily_Voltage-gated potassium channels	p.I1639F	ENST00000303395.4	37	c.4915	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	T	25.8	4.675759	0.88445	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98732	-5.1;-5.1;-5.1;-5.1	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000010	D	0.98874	0.9619	M	0.69463	2.115	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99883	1.1117	10	0.87932	D	0	.	15.2026	0.73153	0.0:0.0:0.0:1.0	.	1639	P35498-2	.	F	1650;1650;1639;1622	ENSP00000407030:I1650F;ENSP00000303540:I1650F;ENSP00000364554:I1639F;ENSP00000386312:I1622F	ENSP00000303540:I1650F	I	-	1	0	SCN1A	166557083	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.916000	0.87491	1.979000	0.57680	0.528000	0.53228	ATC	-	HMMPfam_Ion_trans		0.488	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	T	NM_006920		166557083	-1	no_errors	NM_006920	genbank	human	validated	54_36p	missense	SNP	1	A
TTN	7273	genome.wustl.edu	37	2	179592405	179592405	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr2:179592405A>C	ENST00000591111.1	-	66	19173	c.18949T>G	c.(18949-18951)Tac>Gac	p.Y6317D	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Y5390D|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.Y6634D			Q8WZ42	TITIN_HUMAN	titin	13093	Ig-like 44.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.Y5390D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCACTGAGTAGAGATTTAAG	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											192.0	198.0	196.0					2																	179592405		1984	4177	6161	179300650	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18949T>G	2.37:g.179592405A>C	ENSP00000465570:p.Tyr6317Asp		179300650	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.Y5390D	ENST00000591111.1	37	c.16168		2	.	.	.	.	.	.	.	.	.	.	A	10.18	1.279018	0.23307	.	.	ENSG00000155657	ENST00000342992	T	0.65549	-0.16	5.99	5.99	0.97316	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64283	0.2584	L	0.28608	0.87	0.80722	D	1	P	0.50369	0.934	P	0.52856	0.711	T	0.68119	-0.5493	9	0.87932	D	0	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	6317	Q8WZ42	TITIN_HUMAN	D	5390	ENSP00000343764:Y5390D	ENSP00000343764:Y5390D	Y	-	1	0	TTN	179300650	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.297000	0.72757	2.291000	0.77112	0.533000	0.62120	TAC	-	NULL		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179300650	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	1	C
PREPL	9581	genome.wustl.edu	37	2	44548965	44548965	+	Splice_Site	SNP	C	C	A	rs113296383		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr2:44548965C>A	ENST00000409936.1	-	14	2532		c.e14+1		PREPL_ENST00000409957.1_Splice_Site|PREPL_ENST00000409272.1_Splice_Site|PREPL_ENST00000378520.3_Splice_Site|PREPL_ENST00000378511.3_Splice_Site|PREPL_ENST00000409411.1_Splice_Site|PREPL_ENST00000260648.6_Splice_Site|PREPL_ENST00000541738.1_Splice_Site|PREPL_ENST00000410081.1_Splice_Site	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like							cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)	p.?(1)		breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TGATAACATACCTTTTTGTGA	0.398																																																1	Unknown(1)	ovary(1)	2											110.0	107.0	108.0					2																	44548965		2203	4300	6503	44402469	SO:0001630	splice_region_variant	9581			AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.2094+1G>T	2.37:g.44548965C>A			44402469	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Splice_Site	SNP	-	e13+1	ENST00000409936.1	37	c.2094+1	CCDS33190.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.19|18.19	3.568328|3.568328	0.65651|0.65651	.|.	.|.	ENSG00000138078|ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378520;ENST00000378511|ENST00000420756	.|.	.|.	.|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72317	.|0.3445	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71052	.|-0.4704	.|4	.|.	.|.	.|.	.|.	16.6622|16.6622	0.85244|0.85244	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	.|S	-1|80	.|.	.|.	.|R	-|-	.|3	.|2	PREPL|PREPL	44402469|44402469	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.891000|0.891000	0.51852|0.51852	4.966000|4.966000	0.63715|0.63715	2.581000|2.581000	0.87130|0.87130	0.655000|0.655000	0.94253|0.94253	.|AGG	-	-		0.398	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PREPL	protein_coding	OTTHUMT00000327900.1	C	NM_006036	Intron	44402469	-1	no_errors	NM_006036	genbank	human	validated	54_36p	splice_site	SNP	1	A
TTN	7273	genome.wustl.edu	37	2	179592407	179592407	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr2:179592407A>C	ENST00000591111.1	-	66	19171	c.18947T>G	c.(18946-18948)cTc>cGc	p.L6316R	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.L5389R|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.L6633R			Q8WZ42	TITIN_HUMAN	titin	13092	Ig-like 44.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.L5389R(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTGAGTAGAGATTTAAGAA	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											192.0	197.0	195.0					2																	179592407		1979	4175	6154	179300652	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18947T>G	2.37:g.179592407A>C	ENSP00000465570:p.Leu6316Arg		179300652	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	-	p.L5389R	ENST00000591111.1	37	c.16166		2	.	.	.	.	.	.	.	.	.	.	A	12.92	2.082708	0.36758	.	.	ENSG00000155657	ENST00000342992	T	0.69806	-0.43	5.99	5.99	0.97316	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.87740	0.6253	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.91497	0.5216	9	0.87932	D	0	.	16.4943	0.84223	1.0:0.0:0.0:0.0	.	6316	Q8WZ42	TITIN_HUMAN	R	5389	ENSP00000343764:L5389R	ENSP00000343764:L5389R	L	-	2	0	TTN	179300652	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.291000	0.77112	0.533000	0.62120	CTC	-	NULL		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179300652	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_133378	genbank	human	reviewed	54_36p	missense	SNP	1	C
CRNKL1	51340	genome.wustl.edu	37	20	20022259	20022259	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr20:20022259C>T	ENST00000377340.2	-	10	1689	c.1658G>A	c.(1657-1659)aGg>aAg	p.R553K	CRNKL1_ENST00000377327.4_Missense_Mutation_p.R541K|CRNKL1_ENST00000536226.1_Missense_Mutation_p.R392K	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	553	Mediates interaction with HSP90. {ECO:0000250|UniProtKB:P63154}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R553K(1)		breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						CTGTCTTGTCCTCTCAGGATC	0.348																																																1	Substitution - Missense(1)	ovary(1)	20											104.0	99.0	101.0					20																	20022259		2203	4300	6503	19970259	SO:0001583	missense	51340			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.1658G>A	20.37:g.20022259C>T	ENSP00000366557:p.Arg553Lys		19970259	A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	HMMPfam_HAT;superfamily_TPR-like	p.R553K	ENST00000377340.2	37	c.1658	CCDS33446.1	20	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661201	0.67700	.	.	ENSG00000101343	ENST00000377327;ENST00000377340;ENST00000536226	T;T;T	0.32515	1.45;1.45;1.45	5.8	5.8	0.92144	Tetratricopeptide-like helical (1);	0.082885	0.85682	D	0.000000	T	0.33059	0.0850	L	0.60957	1.885	0.80722	D	1	P	0.36837	0.571	B	0.31191	0.125	T	0.09443	-1.0674	10	0.45353	T	0.12	-14.7932	20.0706	0.97721	0.0:1.0:0.0:0.0	.	553	Q9BZJ0	CRNL1_HUMAN	K	541;553;392	ENSP00000366544:R541K;ENSP00000366557:R553K;ENSP00000440733:R392K	ENSP00000366544:R541K	R	-	2	0	CRNKL1	19970259	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.047000	0.71038	2.744000	0.94065	0.655000	0.94253	AGG	-	HMMPfam_HAT		0.348	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	protein_coding	OTTHUMT00000127787.1	C			19970259	-1	no_errors	NM_016652	genbank	human	reviewed	54_36p	missense	SNP	1	T
XKR7	343702	genome.wustl.edu	37	20	30585011	30585011	+	Silent	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr20:30585011C>T	ENST00000562532.2	+	3	1665	c.1491C>T	c.(1489-1491)acC>acT	p.T497T		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	497						integral component of membrane (GO:0016021)		p.T497T(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GGACCCCCACCCCACCTGTCT	0.682																																																1	Substitution - coding silent(1)	ovary(1)	20											29.0	33.0	32.0					20																	30585011		2201	4299	6500	30048672	SO:0001819	synonymous_variant	343702			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1491C>T	20.37:g.30585011C>T			30048672	Q9NUG5	Silent	SNP	-	p.T497	ENST00000562532.2	37	c.1491	CCDS33459.1	20																																																																																			-	NULL		0.682	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	protein_coding	OTTHUMT00000078597.3	C	NM_001011718		30048672	1	no_errors	NM_001011718	genbank	human	provisional	54_36p	silent	SNP	0.63	T
CHGB	1114	genome.wustl.edu	37	20	5904197	5904197	+	Missense_Mutation	SNP	A	A	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr20:5904197A>T	ENST00000378961.4	+	4	1611	c.1407A>T	c.(1405-1407)agA>agT	p.R469S		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	469						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)	p.R469S(1)		breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						AGCTGGACAGAAATTATCTCA	0.517																																																1	Substitution - Missense(1)	ovary(1)	20											92.0	95.0	94.0					20																	5904197		2203	4300	6503	5852197	SO:0001583	missense	1114				CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1407A>T	20.37:g.5904197A>T	ENSP00000368244:p.Arg469Ser		5852197	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	HMMPfam_Granin	p.R469S	ENST00000378961.4	37	c.1407	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	A	15.45	2.837932	0.50951	.	.	ENSG00000089199	ENST00000378961	T	0.01665	4.7	5.48	0.661	0.17874	.	0.425467	0.19370	N	0.115932	T	0.02418	0.0074	M	0.71581	2.175	0.09310	N	1	P	0.42456	0.78	B	0.40602	0.334	T	0.40534	-0.9558	10	0.59425	D	0.04	-1.4173	2.0715	0.03614	0.4893:0.1224:0.2697:0.1185	.	469	P05060	SCG1_HUMAN	S	469	ENSP00000368244:R469S	ENSP00000368244:R469S	R	+	3	2	CHGB	5852197	0.000000	0.05858	0.000000	0.03702	0.583000	0.36354	0.280000	0.18790	0.045000	0.15804	0.533000	0.62120	AGA	-	HMMPfam_Granin		0.517	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	protein_coding	OTTHUMT00000077897.2	A	NM_001819		5852197	1	no_errors	NM_001819	genbank	human	reviewed	54_36p	missense	SNP	0.06	T
ATP9A	10079	genome.wustl.edu	37	20	50310638	50310638	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr20:50310638G>A	ENST00000338821.5	-	7	815	c.551C>T	c.(550-552)tCa>tTa	p.S184L	ATP9A_ENST00000402822.1_Intron|ATP9A_ENST00000311637.5_Intron	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	184					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.S184L(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAAGAAGCATGACCCTGTGGA	0.632																																																1	Substitution - Missense(1)	ovary(1)	20											55.0	50.0	51.0					20																	50310638		2203	4300	6503	49744045	SO:0001583	missense	10079			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.551C>T	20.37:g.50310638G>A	ENSP00000342481:p.Ser184Leu		49744045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	-	p.S184L	ENST00000338821.5	37	c.551	CCDS33489.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.140081	0.94560	.	.	ENSG00000054793	ENST00000338821	D	0.91631	-2.88	5.04	5.04	0.67666	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.90539	0.7035	N	0.17631	0.505	0.80722	D	1	D	0.56287	0.975	P	0.56088	0.791	D	0.88285	0.2939	10	0.17369	T	0.5	-21.8079	18.3987	0.90509	0.0:0.0:1.0:0.0	.	184	O75110	ATP9A_HUMAN	L	184	ENSP00000342481:S184L	ENSP00000342481:S184L	S	-	2	0	ATP9A	49744045	1.000000	0.71417	0.956000	0.39512	0.741000	0.42261	9.368000	0.97152	2.329000	0.79093	0.655000	0.94253	TCA	-	NULL		0.632	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	protein_coding	OTTHUMT00000106494.1	G	NM_006045		49744045	-1	no_errors	NM_006045	genbank	human	validated	54_36p	missense	SNP	1	A
USP25	29761	genome.wustl.edu	37	21	17250151	17250151	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr21:17250151G>C	ENST00000285679.6	+	23	3205	c.2836G>C	c.(2836-2838)Gga>Cga	p.G946R	USP25_ENST00000351097.5_Missense_Mutation_p.G341R|USP25_ENST00000400183.2_Missense_Mutation_p.G1016R|USP25_ENST00000285681.2_Missense_Mutation_p.G978R	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	946					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)	p.G946R(1)		breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		CTTCGAATCTGGAGAGGATCG	0.328																																																1	Substitution - Missense(1)	ovary(1)	21											91.0	93.0	92.0					21																	17250151		2203	4300	6503	16172022	SO:0001583	missense	29761			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.2836G>C	21.37:g.17250151G>C	ENSP00000285679:p.Gly946Arg		16172022	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	HMMPfam_UBA,HMMPfam_UCH,HMMPfam_UIM,superfamily_UBA-like,superfamily_Cysteine proteinases	p.G946R	ENST00000285679.6	37	c.2836	CCDS33515.1	21	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738339	0.89573	.	.	ENSG00000155313	ENST00000285681;ENST00000285679;ENST00000351097;ENST00000400183	T;T;T;T	0.33438	1.78;1.78;1.41;1.78	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.55465	0.1922	M	0.66939	2.045	0.80722	D	1	D;D;P;P	0.71674	0.995;0.998;0.951;0.949	D;D;P;P	0.69479	0.923;0.964;0.743;0.652	T	0.55127	-0.8189	10	0.59425	D	0.04	.	19.1605	0.93529	0.0:0.0:1.0:0.0	.	1016;341;978;946	Q9UHP3-3;Q96B65;Q9UHP3-1;Q9UHP3	.;.;.;UBP25_HUMAN	R	978;946;341;1016	ENSP00000285681:G978R;ENSP00000285679:G946R;ENSP00000299574:G341R;ENSP00000383044:G1016R	ENSP00000285679:G946R	G	+	1	0	USP25	16172022	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.412000	0.97347	2.641000	0.89580	0.585000	0.79938	GGA	-	NULL		0.328	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	protein_coding	OTTHUMT00000157964.1	G			16172022	1	no_errors	NM_013396	genbank	human	validated	54_36p	missense	SNP	1	C
YBEY	54059	genome.wustl.edu	37	21	47711310	47711310	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr21:47711310T>G	ENST00000329319.3	+	3	671	c.273T>G	c.(271-273)atT>atG	p.I91M	YBEY_ENST00000397701.4_Missense_Mutation_p.I91M|YBEY_ENST00000397692.1_Intron|YBEY_ENST00000339195.6_Intron|YBEY_ENST00000397691.1_Missense_Mutation_p.I91M|YBEY_ENST00000397694.1_Missense_Mutation_p.I46M	NM_058181.1	NP_478061.1	P58557	YBEY_HUMAN	ybeY metallopeptidase (putative)	91					rRNA processing (GO:0006364)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.I91M(1)		endometrium(2)|large_intestine(1)|lung(4)|ovary(2)	9						TGGGAGACATTTTCCTAGGAG	0.398																																																1	Substitution - Missense(1)	ovary(1)	21											99.0	101.0	100.0					21																	47711310		2203	4300	6503	46535738	SO:0001583	missense	54059			AK294975	CCDS33591.1	21q22.3	2010-12-08	2010-12-08	2010-12-08	ENSG00000182362	ENSG00000182362			1299	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 57"""	C21orf57			Standard	XM_005261155		Approved		uc002ziv.3	P58557	OTTHUMG00000090632	ENST00000329319.3:c.273T>G	21.37:g.47711310T>G	ENSP00000329614:p.Ile91Met		46535738	B7WPA9|B7WPF7|D3DSN2	Missense_Mutation	SNP	-	p.I91M	ENST00000329319.3	37	c.273	CCDS33591.1	21	.	.	.	.	.	.	.	.	.	.	T	15.11	2.734807	0.48939	.	.	ENSG00000182362	ENST00000397701;ENST00000397694;ENST00000329319;ENST00000397691	.	.	.	5.09	-4.33	0.03677	Metalloprotease catalytic domain, predicted (1);	0.186977	0.44097	D	0.000484	T	0.66809	0.2827	M	0.85373	2.75	0.34872	D	0.743662	D;P;P	0.61080	0.989;0.898;0.638	P;P;P	0.58873	0.847;0.578;0.467	T	0.71669	-0.4523	9	0.56958	D	0.05	-10.0487	8.443	0.32826	0.1026:0.439:0.0:0.4584	.	46;91;91	P58557-3;P58557;Q8TBC8	.;YBEY_HUMAN;.	M	91;46;91;91	.	ENSP00000329614:I91M	I	+	3	3	YBEY	46535738	0.830000	0.29337	0.874000	0.34290	0.881000	0.50899	-0.238000	0.08977	-0.714000	0.04975	0.418000	0.28097	ATT	-	NULL		0.398	YBEY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf57	protein_coding	OTTHUMT00000207265.1	T	NM_058181		46535738	1	no_errors	NM_058181	genbank	human	validated	54_36p	missense	SNP	0.99	G
HMOX1	3162	genome.wustl.edu	37	22	35782809	35782809	+	Silent	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr22:35782809C>T	ENST00000216117.8	+	3	615	c.276C>T	c.(274-276)gaC>gaT	p.D92D		NM_002133.2	NP_002124.1	P09601	HMOX1_HUMAN	heme oxygenase (decycling) 1	92					angiogenesis (GO:0001525)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to cadmium ion (GO:0071276)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient (GO:0031670)|endothelial cell proliferation (GO:0001935)|erythrocyte homeostasis (GO:0034101)|excretion (GO:0007588)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|iron ion homeostasis (GO:0055072)|low-density lipoprotein particle clearance (GO:0034383)|negative regulation of DNA binding (GO:0043392)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|protein homooligomerization (GO:0051260)|regulation of angiogenesis (GO:0045765)|regulation of blood pressure (GO:0008217)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to estrogen (GO:0043627)|response to hydrogen peroxide (GO:0042542)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|smooth muscle hyperplasia (GO:0014806)|transmembrane transport (GO:0055085)|wound healing involved in inflammatory response (GO:0002246)	caveola (GO:0005901)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)|phospholipase D activity (GO:0004630)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.D92D(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16					Vitamin E(DB00163)	TGGAGCAGGACCTGGCCTTCT	0.647																																																1	Substitution - coding silent(1)	ovary(1)	22											50.0	53.0	52.0					22																	35782809		2203	4300	6503	34112809	SO:0001819	synonymous_variant	3162				CCDS13914.1	22q12	2003-10-13			ENSG00000100292	ENSG00000100292	1.14.99.3		5013	protein-coding gene	gene with protein product		141250				10591208	Standard	NM_002133		Approved	bK286B10, HO-1	uc003ant.2	P09601	OTTHUMG00000150960	ENST00000216117.8:c.276C>T	22.37:g.35782809C>T			34112809		Silent	SNP	HMMPfam_Heme_oxygenase;superfamily_Heme oxygenase-like	p.D92	ENST00000216117.8	37	c.276	CCDS13914.1	22																																																																																			-	HMMPfam_Heme_oxygenase		0.647	HMOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMOX1	protein_coding	OTTHUMT00000320657.1	C			34112809	1	no_errors	NM_002133	genbank	human	reviewed	54_36p	silent	SNP	1	T
ZPLD1	131368	genome.wustl.edu	37	3	102187821	102187821	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:102187821C>A	ENST00000491959.1	+	15	1657	c.775C>A	c.(775-777)Cct>Act	p.P259T	ZPLD1_ENST00000306176.1_Missense_Mutation_p.P275T|ZPLD1_ENST00000466937.1_Missense_Mutation_p.P259T			Q8TCW7	ZPLD1_HUMAN	zona pellucida-like domain containing 1	259	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					integral component of membrane (GO:0016021)		p.P275T(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(18)|ovary(2)|skin(3)	35						TGACAAGGACCCTCAGACCAC	0.438																																																1	Substitution - Missense(1)	ovary(1)	3											64.0	65.0	65.0					3																	102187821		2203	4300	6503	103670511	SO:0001583	missense	131368			AY090780	CCDS2947.1	3q12.3	2009-03-25			ENSG00000170044	ENSG00000170044			27022	protein-coding gene	gene with protein product		615915				18632209	Standard	NM_175056		Approved		uc003dvt.1	Q8TCW7	OTTHUMG00000159229	ENST00000491959.1:c.775C>A	3.37:g.102187821C>A	ENSP00000420265:p.Pro259Thr		103670511	Q49AS1|Q8WU36	Missense_Mutation	SNP	-	p.P275T	ENST00000491959.1	37	c.823		3	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305671	0.81247	.	.	ENSG00000170044	ENST00000491959;ENST00000306176;ENST00000466937	D;D;D	0.81908	-1.55;-1.55;-1.55	5.47	5.47	0.80525	Zona pellucida sperm-binding protein (3);	0.047572	0.85682	D	0.000000	D	0.87422	0.6173	L	0.55743	1.74	0.80722	D	1	D;P	0.63046	0.992;0.918	P;P	0.57101	0.813;0.524	D	0.86208	0.1623	10	0.39692	T	0.17	-13.8774	19.3006	0.94143	0.0:1.0:0.0:0.0	.	275;259	Q8TCW7-2;Q8TCW7	.;ZPLD1_HUMAN	T	259;275;259	ENSP00000420265:P259T;ENSP00000307801:P275T;ENSP00000418253:P259T	ENSP00000307801:P275T	P	+	1	0	ZPLD1	103670511	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.042000	0.70996	2.571000	0.86741	0.462000	0.41574	CCT	-	NULL		0.438	ZPLD1-001	KNOWN	basic|appris_principal	protein_coding	ZPLD1	protein_coding	OTTHUMT00000353984.1	C	NM_175056		103670511	1	no_errors	NM_175056	genbank	human	provisional	54_36p	missense	SNP	1	A
ADPRH	141	genome.wustl.edu	37	3	119305486	119305486	+	Missense_Mutation	SNP	A	A	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:119305486A>C	ENST00000478399.1	+	3	2058	c.653A>C	c.(652-654)cAa>cCa	p.Q218P	ADPRH_ENST00000478927.1_Missense_Mutation_p.Q218P|ADPRH_ENST00000465513.1_Missense_Mutation_p.Q218P|ADPRH_ENST00000357003.3_Missense_Mutation_p.Q218P|ADPRH_ENST00000471850.1_3'UTR			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	218					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)	p.Q218P(1)		breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		GAAAATCTTCAACACTGGTGA	0.473																																					GBM(133;579 1804 5989 9967 40052)											1	Substitution - Missense(1)	ovary(1)	3											73.0	74.0	74.0					3																	119305486		2203	4300	6503	120788176	SO:0001583	missense	141			L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.653A>C	3.37:g.119305486A>C	ENSP00000420200:p.Gln218Pro		120788176	B2R8H1|D3DN83	Missense_Mutation	SNP	-	p.Q218P	ENST00000478399.1	37	c.653	CCDS2990.1	3	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824935	0.50739	.	.	ENSG00000144843	ENST00000478399;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.54	4.39	0.52855	.	0.399207	0.28140	N	0.016450	T	0.24392	0.0591	L	0.35414	1.06	0.33655	D	0.608911	B	0.28233	0.204	B	0.37422	0.249	T	0.31392	-0.9945	10	0.33940	T	0.23	-19.9283	4.9384	0.13952	0.7539:0.0:0.0845:0.1616	.	218	P54922	ADPRH_HUMAN	P	218	ENSP00000420200:Q218P;ENSP00000417528:Q218P;ENSP00000349496:Q218P;ENSP00000417430:Q218P	ENSP00000349496:Q218P	Q	+	2	0	ADPRH	120788176	0.040000	0.19996	0.993000	0.49108	0.992000	0.81027	0.835000	0.27531	1.125000	0.41998	0.533000	0.62120	CAA	-	NULL		0.473	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRH	protein_coding	OTTHUMT00000355199.1	A	NM_001125		120788176	1	no_errors	NM_001125	genbank	human	reviewed	54_36p	missense	SNP	0.36	C
PARP14	54625	genome.wustl.edu	37	3	122437033	122437033	+	Silent	SNP	G	G	T	rs201050912		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:122437033G>T	ENST00000474629.2	+	13	4382	c.4116G>T	c.(4114-4116)ctG>ctT	p.L1372L		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1372	Macro 3. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.L1209L(1)		NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TTATCTTTCTGCCTCAAGTAC	0.408																																																1	Substitution - coding silent(1)	ovary(1)	3											105.0	97.0	99.0					3																	122437033		1868	4112	5980	123919723	SO:0001819	synonymous_variant	54625			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.4116G>T	3.37:g.122437033G>T			123919723	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	-	p.L1372	ENST00000474629.2	37	c.4116	CCDS46894.1	3																																																																																			-	NULL		0.408	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	protein_coding	OTTHUMT00000356173.2	G	NM_017554		123919723	1	no_errors	NM_017554	genbank	human	validated	54_36p	silent	SNP	0.99	T
SLC2A2	6514	genome.wustl.edu	37	3	170724960	170724960	+	Missense_Mutation	SNP	C	C	T	rs121909741		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:170724960C>T	ENST00000314251.3	-	5	668	c.589G>A	c.(589-591)Gtc>Atc	p.V197I	SLC2A2_ENST00000382808.4_Missense_Mutation_p.V78I	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	197			V -> I (in NIDDM; abolishes transport activity of the transporter expressed in Xenopus oocytes). {ECO:0000269|PubMed:8063045}.		carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)	p.V197I(1)		central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	ATGCCCGTGACGATGGCCAGC	0.483																																																1	Substitution - Missense(1)	ovary(1)	3	GRCh37	CM941278	SLC2A2	M	rs121909741	C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	106.0	95.0	99.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	589	5.7	1.0	3	dbSNP_133	99	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC2A2	NM_000340.1	29	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	197/525	170724960	2,13004	2203	4300	6503	172207654	SO:0001583	missense	6514			J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.589G>A	3.37:g.170724960C>T	ENSP00000323568:p.Val197Ile		172207654	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	Sugar_tr;HMMPfam_Sugar_tr;MFS general substrate transporter;superfamily_MFS general substrate transporter	p.V197I	ENST00000314251.3	37	c.589	CCDS3215.1	3	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506749	0.85282	2.27E-4	1.16E-4	ENSG00000163581	ENST00000314251;ENST00000382808;ENST00000461867	T;T;T	0.74526	-0.85;-0.85;-0.85	5.73	5.73	0.89815	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.86121	0.5857	M	0.83312	2.635	0.80722	A	1	D	0.64830	0.994	P	0.58820	0.846	D	0.85624	0.1266	9	0.46703	T	0.11	.	20.27	0.98469	0.0:1.0:0.0:0.0	.	197	P11168	GTR2_HUMAN	I	197;78;24	ENSP00000323568:V197I;ENSP00000372258:V78I;ENSP00000418888:V24I	ENSP00000323568:V197I	V	-	1	0	SLC2A2	172207654	1.000000	0.71417	0.993000	0.49108	0.378000	0.30076	5.697000	0.68295	2.854000	0.98071	0.655000	0.94253	GTC	-	HMMPfam_Sugar_tr		0.483	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A2	protein_coding	OTTHUMT00000352834.1	C	NM_000340		172207654	-1	no_errors	NM_000340	genbank	human	reviewed	54_36p	missense	SNP	1	T
CLASP2	23122	genome.wustl.edu	37	3	33686307	33686307	+	Silent	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:33686307G>A	ENST00000468888.2	-	8	850	c.804C>T	c.(802-804)tcC>tcT	p.S268S	CLASP2_ENST00000539981.1_Silent_p.S41S|CLASP2_ENST00000487200.1_Silent_p.S41S|CLASP2_ENST00000461133.3_Silent_p.S35S|CLASP2_ENST00000399362.4_Silent_p.S268S|CLASP2_ENST00000307312.7_5'UTR|CLASP2_ENST00000333778.6_Silent_p.S45S|CLASP2_ENST00000313350.6_Silent_p.S41S|CLASP2_ENST00000359576.5_Silent_p.S268S|CLASP2_ENST00000482896.1_5'UTR|CLASP2_ENST00000480013.1_Silent_p.S35S			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	35					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)	p.S268S(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						CAGGATTTCCGGATGTTTTAG	0.463																																																1	Substitution - coding silent(1)	ovary(1)	3											95.0	91.0	92.0					3																	33686307		1955	4153	6108	33661311	SO:0001819	synonymous_variant	23122			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.804C>T	3.37:g.33686307G>A			33661311	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	HMMPfam_HEAT;superfamily_ARM repeat	p.S268	ENST00000468888.2	37	c.804		3																																																																																			-	NULL		0.463	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CLASP2	protein_coding	OTTHUMT00000344320.4	G	NM_001207044		33661311	-1	no_errors	NM_015097	genbank	human	validated	54_36p	silent	SNP	1	A
LRRFIP2	9209	genome.wustl.edu	37	3	37125235	37125235	+	Silent	SNP	G	G	A	rs576073289		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:37125235G>A	ENST00000336686.4	-	19	1250	c.1170C>T	c.(1168-1170)gaC>gaT	p.D390D	LRRFIP2_ENST00000396428.2_Silent_p.D206D|LRRFIP2_ENST00000421307.1_Silent_p.D390D|LRRFIP2_ENST00000421276.2_Silent_p.D158D|LRRFIP2_ENST00000440230.1_Silent_p.D158D|LRRFIP2_ENST00000354379.4_Silent_p.D134D			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	390					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.D390D(1)|p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TCTTCTCATTGTCTAACTGTG	0.348													G|||	1	0.000199681	0.0	0.0	5008	,	,		18328	0.001		0.0	False		,,,				2504	0.0															2	Whole gene deletion(1)|Substitution - coding silent(1)	ovary(2)	3											198.0	187.0	191.0					3																	37125235		2203	4300	6503	37100239	SO:0001819	synonymous_variant	9209			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1170C>T	3.37:g.37125235G>A			37100239	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Silent	SNP	-	p.D390	ENST00000336686.4	37	c.1170	CCDS2664.1	3	.	.	.	.	.	.	.	.	.	.	G	9.805	1.181639	0.21787	.	.	ENSG00000093167	ENST00000440742	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.0785	14.1881	0.65620	0.0712:0.0:0.9288:0.0	.	.	.	.	X	3	.	.	Q	-	1	0	LRRFIP2	37100239	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.978000	0.49305	2.733000	0.93635	0.561000	0.74099	CAA	-	NULL		0.348	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	protein_coding	OTTHUMT00000253335.3	G	NM_006309		37100239	-1	no_errors	NM_006309	genbank	human	validated	54_36p	silent	SNP	1	A
ZNF197	10168	genome.wustl.edu	37	3	44684620	44684620	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:44684620T>G	ENST00000396058.1	+	5	2165	c.1998T>G	c.(1996-1998)atT>atG	p.I666M	ZNF197_ENST00000344387.4_Missense_Mutation_p.I666M|RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383745.2_Intron|ZNF197_ENST00000383744.4_Intron			O14709	ZN197_HUMAN	zinc finger protein 197	666					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I666M(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		AGAGCCTCATTTTACATCAAA	0.408																																																1	Substitution - Missense(1)	ovary(1)	3											60.0	62.0	61.0					3																	44684620		2203	4300	6503	44659624	SO:0001583	missense	10168			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.1998T>G	3.37:g.44684620T>G	ENSP00000379370:p.Ile666Met		44659624	B2RAH8|Q86VG0	Missense_Mutation	SNP	-	p.I666M	ENST00000396058.1	37	c.1998	CCDS2717.1	3	.	.	.	.	.	.	.	.	.	.	T	12.21	1.870277	0.33069	.	.	ENSG00000186448	ENST00000344387;ENST00000396058	T;T	0.07567	3.18;3.18	4.51	0.831	0.18860	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.288469	0.19366	U	0.116009	T	0.06690	0.0171	L	0.45422	1.42	0.09310	N	1	P	0.41978	0.767	B	0.43052	0.406	T	0.20874	-1.0262	10	0.35671	T	0.21	.	0.1324	0.00075	0.3067:0.1833:0.1589:0.3511	.	666	O14709	ZN197_HUMAN	M	666	ENSP00000345809:I666M;ENSP00000379370:I666M	ENSP00000345809:I666M	I	+	3	3	ZNF197	44659624	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-1.535000	0.02210	0.321000	0.23259	0.455000	0.32223	ATT	-	NULL		0.408	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF197	protein_coding	OTTHUMT00000256747.4	T	NM_006991		44659624	1	no_errors	NM_006991	genbank	human	reviewed	54_36p	missense	SNP		G
SLC51A	200931	genome.wustl.edu	37	3	195959313	195959313	+	Silent	SNP	A	A	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr3:195959313A>C	ENST00000296327.5	+	8	1013	c.804A>C	c.(802-804)ctA>ctC	p.L268L	PCYT1A_ENST00000419333.1_Intron	NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	268					bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.L268L(1)								Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	TGACTGCCCTACAGCCCTCCA	0.582																																																1	Substitution - coding silent(1)	ovary(1)	3											189.0	146.0	161.0					3																	195959313		2203	4300	6503	197443710	SO:0001819	synonymous_variant	200931				CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.804A>C	3.37:g.195959313A>C			197443710	Q6ZMC7	Silent	SNP	-	p.L268	ENST00000296327.5	37	c.804	CCDS3314.1	3																																																																																			-	NULL		0.582	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSTalpha	protein_coding	OTTHUMT00000341253.1	A	NM_152672		197443710	1	no_errors	NM_152672	genbank	human	validated	54_36p	silent	SNP	1	C
ENAM	10117	genome.wustl.edu	37	4	71509967	71509967	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr4:71509967C>G	ENST00000396073.3	+	9	3105	c.2824C>G	c.(2824-2826)Caa>Gaa	p.Q942E	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	942					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)		p.Q942E(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			GAGGGAAAGCCAAAACCCTTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	4											109.0	103.0	105.0					4																	71509967		2203	4300	6503	71728831	SO:0001583	missense	10117			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.2824C>G	4.37:g.71509967C>G	ENSP00000379383:p.Gln942Glu		71728831	Q17RI5|Q9H3D1	Missense_Mutation	SNP	-	p.Q942E	ENST00000396073.3	37	c.2824	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.144867	0.00029	.	.	ENSG00000132464	ENST00000396073	T	0.32753	1.44	5.97	0.886	0.19194	.	0.853061	0.10186	N	0.705244	T	0.28433	0.0703	L	0.49126	1.545	0.09310	N	1	B	0.13145	0.007	B	0.20184	0.028	T	0.34054	-0.9844	10	0.18276	T	0.48	-0.2653	13.0364	0.58875	0.1047:0.3855:0.5098:0.0	.	942	Q9NRM1	ENAM_HUMAN	E	942	ENSP00000379383:Q942E	ENSP00000379383:Q942E	Q	+	1	0	ENAM	71728831	0.000000	0.05858	0.873000	0.34254	0.001000	0.01503	-0.745000	0.04834	-0.109000	0.12044	-0.795000	0.03280	CAA	-	NULL		0.453	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	protein_coding	OTTHUMT00000252166.3	C	NM_031889		71728831	1	no_errors	NM_031889	genbank	human	validated	54_36p	missense	SNP	0.01	G
RPL7P20	728843	genome.wustl.edu	37	5	165455976	165455976	+	IGR	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr5:165455976C>T								CTC-535M15.2 (250282 upstream) : RP11-67M9.1 (99526 downstream)																							GAAAATTTGACGAAGGCGAAG	0.438																																																0			5																																								165388554	SO:0001628	intergenic_variant	728843																															5.37:g.165455976C>T			165388554		RNA	SNP	-	NULL		37	NULL		5																																																																																			-	-	0	0.438					LOC728843			C			165388554	-1	pseudogene	XR_015391	genbank	human	model	54_36p	rna	SNP	1	T
RANBP17	64901	genome.wustl.edu	37	5	170351442	170351442	+	Silent	SNP	A	A	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr5:170351442A>G	ENST00000523189.1	+	12	1520	c.1356A>G	c.(1354-1356)gaA>gaG	p.E452E		NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	452					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.E452E(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCAGATGTGAATATGAAAAGA	0.418			T	TRD@	ALL																																		Dom	yes		5	5q34	64901	RAN binding protein 17		L	1	Substitution - coding silent(1)	ovary(1)	5											169.0	149.0	156.0					5																	170351442		2203	4300	6503	170284047	SO:0001819	synonymous_variant	64901			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1356A>G	5.37:g.170351442A>G			170284047	Q8IU74	Silent	SNP	HMMPfam_IBN_N;superfamily_ARM repeat	p.E452	ENST00000523189.1	37	c.1356	CCDS34287.1	5																																																																																			-	NULL		0.418	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	protein_coding	OTTHUMT00000372036.1	A	NM_022897		170284047	1	no_errors	NM_022897	genbank	human	provisional	54_36p	silent	SNP	1	G
GPR98	84059	genome.wustl.edu	37	5	90024538	90024538	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr5:90024538G>C	ENST00000405460.2	+	49	10310	c.10214G>C	c.(10213-10215)cGa>cCa	p.R3405P		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3405					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R3405P(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CTCCCTGTCCGAGGTGTGCTG	0.463																																																1	Substitution - Missense(1)	ovary(1)	5											167.0	164.0	165.0					5																	90024538		1984	4165	6149	90060294	SO:0001583	missense	84059			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.10214G>C	5.37:g.90024538G>C	ENSP00000384582:p.Arg3405Pro		90060294	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	HMMPfam_GPS;HMMPfam_Calx-beta;HMMPfam_EPTP;superfamily_Concanavalin A-like lectins/glucanases;superfamily_Phosphoglucomutase first 3 domains	p.R3405P	ENST00000405460.2	37	c.10214	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.51|13.51	2.258594|2.258594	0.39896|0.39896	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000509621|ENST00000405460;ENST00000296619	.|D	.|0.83335	.|-1.71	5.46|5.46	1.11|1.11	0.20524|0.20524	.|.	.|0.807344	.|0.11743	.|N	.|0.533781	T|T	0.73931|0.73931	0.3650|0.3650	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	0.999999|0.999999	.|P;P	.|0.39480	.|0.675;0.62	.|B;B	.|0.36808	.|0.217;0.233	T|T	0.64850|0.64850	-0.6310|-0.6310	5|10	.|0.62326	.|D	.|0.03	.|.	3.5583|3.5583	0.07873|0.07873	0.5323:0.0:0.2755:0.1922|0.5323:0.0:0.2755:0.1922	.|.	.|3405;3405	.|E7ETI5;Q8WXG9	.|.;GPR98_HUMAN	Q|P	971|3405	.|ENSP00000384582:R3405P	.|ENSP00000296619:R3405P	E|R	+|+	1|2	0|0	GPR98|GPR98	90060294|90060294	0.027000|0.027000	0.19231|0.19231	0.946000|0.946000	0.38457|0.38457	0.902000|0.902000	0.53008|0.53008	0.604000|0.604000	0.24164|0.24164	0.286000|0.286000	0.22352|0.22352	0.557000|0.557000	0.71058|0.71058	GAG|CGA	-	HMMPfam_EPTP		0.463	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119		90060294	1	no_errors	NM_032119	genbank	human	reviewed	54_36p	missense	SNP	0.15	C
ERAP1	51752	genome.wustl.edu	37	5	96121496	96121496	+	Missense_Mutation	SNP	C	C	T	rs111363347	byFrequency	TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr5:96121496C>T	ENST00000443439.2	-	13	2005	c.1939G>A	c.(1939-1941)Gtc>Atc	p.V647I	CTD-2260A17.1_ENST00000602972.1_RNA|ERAP1_ENST00000296754.3_Missense_Mutation_p.V647I|ERAP1_ENST00000514604.1_5'UTR|CTD-2260A17.1_ENST00000512856.1_RNA	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	647					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)	p.V647I(1)		endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		TATTACCTGACGAGCTGAAAT	0.403													.|||	8	0.00159744	0.0	0.0043	5008	,	,		20118	0.0		0.001	False		,,,				2504	0.0041															1	Substitution - Missense(1)	ovary(1)	5						C	ILE/VAL,ILE/VAL,ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	130.0	103.0	112.0		1939,1939,1939	5.8	1.0	5	dbSNP_132	112	22,8578	16.6+/-54.9	0,22,4278	yes	missense,missense,missense	ERAP1	NM_001040458.1,NM_001198541.1,NM_016442.3	29,29,29	0,23,6480	TT,TC,CC		0.2558,0.0227,0.1768	possibly-damaging,possibly-damaging,possibly-damaging	647/942,647/942,647/949	96121496	23,12983	2203	4300	6503	96147252	SO:0001583	missense	51752			AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.1939G>A	5.37:g.96121496C>T	ENSP00000406304:p.Val647Ile		96147252	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	-	p.V647I	ENST00000443439.2	37	c.1939	CCDS47250.1	5	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	22.6	4.314660	0.81358	2.27E-4	0.002558	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.06294	3.32;3.32	5.77	5.77	0.91146	.	0.179513	0.48286	D	0.000200	T	0.30230	0.0758	M	0.83012	2.62	0.58432	D	0.999999	D;D;D	0.64830	0.971;0.994;0.993	P;D;D	0.71414	0.842;0.973;0.955	T	0.01345	-1.1379	10	0.72032	D	0.01	.	19.5934	0.95525	0.0:1.0:0.0:0.0	.	647;647;647	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	I	647	ENSP00000296754:V647I;ENSP00000406304:V647I	ENSP00000296754:V647I	V	-	1	0	ERAP1	96147252	1.000000	0.71417	1.000000	0.80357	0.149000	0.21700	7.372000	0.79612	2.724000	0.93272	0.561000	0.74099	GTC	-	NULL		0.403	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP1	protein_coding	OTTHUMT00000370699.1	C	NM_016442		96147252	-1	no_errors	NM_016442	genbank	human	validated	54_36p	missense	SNP	1	T
BNIP1	662	genome.wustl.edu	37	5	172571575	172571575	+	Silent	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr5:172571575C>T	ENST00000351486.5	+	1	58	c.27C>T	c.(25-27)gtC>gtT	p.V9V	BNIP1_ENST00000352523.6_Silent_p.V9V|BNIP1_ENST00000393770.4_Silent_p.V9V|BNIP1_ENST00000231668.9_Silent_p.V9V|CTC-209H22.3_ENST00000521251.1_RNA	NM_001205.2	NP_001196.2	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 1	9					apoptotic process (GO:0006915)|autophagy (GO:0006914)|endoplasmic reticulum membrane fusion (GO:0016320)|endoplasmic reticulum organization (GO:0007029)|execution phase of apoptosis (GO:0097194)|negative regulation of apoptotic process (GO:0043066)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.V9V(1)		breast(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|skin(1)	11	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ACGTCCACGTCCGGATCTGTA	0.602											OREG0017054	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																				1	Substitution - coding silent(1)	ovary(1)	5											50.0	49.0	49.0					5																	172571575		2203	4300	6503	172504181	SO:0001819	synonymous_variant	100128619			AF083957	CCDS4384.1, CCDS4385.1, CCDS4386.1, CCDS43400.1	5q33-q34	2008-02-05	2002-08-29		ENSG00000113734	ENSG00000113734			1082	protein-coding gene	gene with protein product		603291	"""BCL2/adenovirus E1B 19kD-interacting protein 1"""			7954800, 15272311	Standard	NM_013979		Approved	Nip1, SEC20	uc003mcj.4	Q12981	OTTHUMG00000130521	ENST00000351486.5:c.27C>T	5.37:g.172571575C>T		1901	172504181	D3DQM3|D3DQM4|D3DQM5|D3DQM6|O75622|O75623|O75624|Q6K044|Q96FG4	Missense_Mutation	SNP	-	p.D17N	ENST00000351486.5	37	c.49	CCDS4384.1	5																																																																																			-	NULL		0.602	BNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128619	protein_coding	OTTHUMT00000252939.1	C	NM_013979		172504181	-1	no_errors	XM_001720411	genbank	human	model	54_36p	missense	SNP	1	T
SCGN	10590	genome.wustl.edu	37	6	25670237	25670237	+	Missense_Mutation	SNP	G	G	A	rs200986563		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:25670237G>A	ENST00000377961.2	+	6	572	c.404G>A	c.(403-405)cGa>cAa	p.R135Q	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	135	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.R135Q(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						AACTTCCTCCGAGACCTCTTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											164.0	172.0	169.0					6																	25670237		2203	4300	6503	25778216	SO:0001583	missense	10590			BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.404G>A	6.37:g.25670237G>A	ENSP00000367197:p.Arg135Gln		25778216	A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	HMMPfam_efhand;superfamily_EF-hand	p.R135Q	ENST00000377961.2	37	c.404	CCDS4561.1	6	.	.	.	.	.	.	.	.	.	.	G	14.53	2.561910	0.45590	.	.	ENSG00000079689	ENST00000377961	T	0.70164	-0.46	5.6	5.6	0.85130	EF-hand-like domain (1);	0.269234	0.37053	N	0.002275	T	0.23249	0.0562	N	0.04063	-0.285	0.80722	D	1	B	0.30511	0.282	B	0.17433	0.018	T	0.21348	-1.0248	10	0.33141	T	0.24	.	8.6882	0.34251	0.1622:0.0:0.8378:0.0	.	135	O76038	SEGN_HUMAN	Q	135	ENSP00000367197:R135Q	ENSP00000367197:R135Q	R	+	2	0	SCGN	25778216	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	2.293000	0.43558	2.618000	0.88619	0.563000	0.77884	CGA	-	HMMPfam_efhand		0.408	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGN	protein_coding	OTTHUMT00000040067.1	G			25778216	1	no_errors	NM_006998	genbank	human	reviewed	54_36p	missense	SNP	1	A
HIST1H1C	3006	genome.wustl.edu	37	6	26056015	26056015	+	Nonstop_Mutation	SNP	C	C	G	rs11540003		TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:26056015C>G	ENST00000343677.2	-	1	684	c.642G>C	c.(640-642)taG>taC	p.*214Y		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	0					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.*214Y(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						AGGCGTTCGCCTATTTCTTCT	0.473																																																1	Nonstop extension(1)	ovary(1)	6																																								26163994	SO:0001578	stop_lost	3006			X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.642G>C	6.37:g.26056015C>G			26163994	A8K4I2	Nonstop_Mutation	SNP	-	p.*214Y	ENST00000343677.2	37	c.642	CCDS4577.1	6	.	.	.	.	.	.	.	.	.	.	C	2.422	-0.332958	0.05278	.	.	ENSG00000187837	ENST00000343677	.	.	.	5.18	2.99	0.34606	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.4539	0.04524	0.2315:0.4734:0.0:0.2951	.	.	.	.	Y	214	.	.	X	-	3	2	HIST1H1C	26163994	0.006000	0.16342	0.868000	0.34077	0.067000	0.16453	0.841000	0.27613	1.324000	0.45282	-0.251000	0.11542	TAG	-	NULL		0.473	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1C	protein_coding	OTTHUMT00000043372.1	C	NM_005319		26163994	-1	no_errors	NM_005319	genbank	human	reviewed	54_36p	nonstop	SNP	0.679	G
HIST1H4H	8365	genome.wustl.edu	37	6	26285723	26285723	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:26285723G>C	ENST00000377727.1	-	1	14	c.5C>G	c.(4-6)tCt>tGt	p.S2C	HIST1H4H_ENST00000289352.1_Missense_Mutation_p.S2C	NM_003543.3	NP_003534.1	P62805	H4_HUMAN	histone cluster 1, H4h	2					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.S2C(1)		lung(2)|ovary(2)|upper_aerodigestive_tract(3)	7						ACCACGGCCAGACATGACTAA	0.473										HNSCC(76;0.23)																																						1	Substitution - Missense(1)	ovary(1)	6											61.0	63.0	62.0					6																	26285723		2203	4300	6503	26393702	SO:0001583	missense	8365			X60487	CCDS4604.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158406	ENSG00000158406		"""Histones / Replication-dependent"""	4788	protein-coding gene	gene with protein product		602828	"""H4 histone family, member H"", ""histone 1, H4h"""	H4FH		9119399, 12408966	Standard	NM_003543		Approved	H4/h	uc003nhm.2	P62805	OTTHUMG00000014454	ENST00000377727.1:c.5C>G	6.37:g.26285723G>C	ENSP00000366956:p.Ser2Cys		26393702	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	-	p.S2C	ENST00000377727.1	37	c.5	CCDS4604.1	6	.	.	.	.	.	.	.	.	.	.	.	12.92	2.081418	0.36758	.	.	ENSG00000158406	ENST00000289352;ENST00000377727	.	.	.	4.4	4.4	0.53042	.	0.284296	0.23252	U	0.050228	T	0.51736	0.1692	.	.	.	0.30514	N	0.769126	.	.	.	.	.	.	T	0.54490	-0.8286	6	0.87932	D	0	.	14.8602	0.70376	0.0:0.0:1.0:0.0	.	.	.	.	C	2	.	ENSP00000289352:S2C	S	-	2	0	HIST1H4H	26393702	1.000000	0.71417	1.000000	0.80357	0.160000	0.22226	7.493000	0.81493	2.181000	0.69327	0.491000	0.48974	TCT	-	NULL		0.473	HIST1H4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4H	protein_coding	OTTHUMT00000040119.1	G	NM_003543		26393702	-1	no_errors	NM_003543	genbank	human	reviewed	54_36p	missense	SNP	1	C
NKAPL	222698	genome.wustl.edu	37	6	28227718	28227718	+	Missense_Mutation	SNP	A	A	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:28227718A>G	ENST00000343684.3	+	1	621	c.569A>G	c.(568-570)aAg>aGg	p.K190R	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	190	Lys-rich.							p.K190R(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						AAAAAAAGAAAGAATAAGTCG	0.363																																																1	Substitution - Missense(1)	ovary(1)	6											32.0	39.0	37.0					6																	28227718		2200	4298	6498	28335697	SO:0001583	missense	222698			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.569A>G	6.37:g.28227718A>G	ENSP00000345716:p.Lys190Arg		28335697	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	-	p.K190R	ENST00000343684.3	37	c.569	CCDS34353.1	6	.	.	.	.	.	.	.	.	.	.	A	8.195	0.796969	0.16327	.	.	ENSG00000189134	ENST00000343684	T	0.15372	2.43	4.95	3.8	0.43715	.	0.367801	0.28057	N	0.016778	T	0.02807	0.0084	N	0.11845	0.185	0.43175	D	0.994987	B	0.19583	0.037	B	0.20184	0.028	T	0.33675	-0.9859	10	0.13108	T	0.6	-1.7813	8.9768	0.35941	0.9121:0.0:0.0879:0.0	.	190	Q5M9Q1	NKAPL_HUMAN	R	190	ENSP00000345716:K190R	ENSP00000345716:K190R	K	+	2	0	NKAPL	28335697	1.000000	0.71417	0.998000	0.56505	0.010000	0.07245	1.453000	0.35167	1.033000	0.39918	-0.250000	0.11733	AAG	-	NULL		0.363	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAPL	protein_coding	OTTHUMT00000040185.1	A			28335697	1	no_errors	NM_001007531	genbank	human	provisional	54_36p	missense	SNP	1	G
PPARD	5467	genome.wustl.edu	37	6	35392337	35392337	+	Missense_Mutation	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:35392337C>T	ENST00000311565.4	+	8	1208	c.859C>T	c.(859-861)Cac>Tac	p.H287Y	PPARD_ENST00000337400.2_Missense_Mutation_p.H287Y|PPARD_ENST00000448077.2_Missense_Mutation_p.H248Y|PPARD_ENST00000418635.2_Missense_Mutation_p.H189Y|PPARD_ENST00000444397.1_Missense_Mutation_p.H287Y|PPARD_ENST00000540939.1_Missense_Mutation_p.H184Y|PPARD_ENST00000360694.3_Missense_Mutation_p.H287Y	NM_001171818.1	NP_001165289.1	Q03181	PPARD_HUMAN	peroxisome proliferator-activated receptor delta	287	Ligand-binding.				adipose tissue development (GO:0060612)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|axon ensheathment (GO:0008366)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular response to hypoxia (GO:0071456)|cholesterol metabolic process (GO:0008203)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|fatty acid beta-oxidation (GO:0006635)|fatty acid catabolic process (GO:0009062)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)|lipid metabolic process (GO:0006629)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of inflammatory response (GO:0050728)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid biosynthetic process (GO:0008654)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermis development (GO:0045684)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of insulin secretion (GO:0032024)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|proteoglycan metabolic process (GO:0006029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to vitamin A (GO:0033189)|transcription initiation from RNA polymerase II promoter (GO:0006367)|vitamin A metabolic process (GO:0006776)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|linoleic acid binding (GO:0070539)|lipid binding (GO:0008289)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.H287Y(2)		autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(4)|liver(2)|lung(9)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23					Bezafibrate(DB01393)|Icosapent(DB00159)|Sulindac(DB00605)|Treprostinil(DB00374)	GTATGGCGTGCACGAGGCCAT	0.597																																																2	Substitution - Missense(2)	ovary(1)|prostate(1)	6											96.0	78.0	84.0					6																	35392337		2203	4300	6503	35500315	SO:0001583	missense	5467			L07592	CCDS4803.1, CCDS4804.1, CCDS54994.1, CCDS54995.1	6p21.2	2013-01-16	2006-10-17		ENSG00000112033	ENSG00000112033		"""Nuclear hormone receptors"""	9235	protein-coding gene	gene with protein product		600409	"""peroxisome proliferative activated receptor, delta"""			1333051	Standard	NM_177435		Approved	NUC1, NUCII, FAAR, NR1C2	uc003okm.3	Q03181	OTTHUMG00000014567	ENST00000311565.4:c.859C>T	6.37:g.35392337C>T	ENSP00000310928:p.His287Tyr		35500315	A8K6J6|B4E3V3|B6ZGS1|B7Z3W1|E9PE18|Q5D1P0|Q7Z5K0|Q9BUD4	Missense_Mutation	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.H287Y	ENST00000311565.4	37	c.859	CCDS4803.1	6	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577621	0.45902	.	.	ENSG00000112033	ENST00000448077;ENST00000360694;ENST00000418635;ENST00000444397;ENST00000311565;ENST00000337400;ENST00000540939	D;D;D;D;D;D;D	0.97232	-4.3;-4.3;-4.3;-4.3;-4.3;-4.3;-4.3	5.82	5.82	0.92795	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.95667	0.8591	N	0.08118	0	0.80722	D	1	D;D;D;P	0.89917	1.0;0.984;0.984;0.645	D;P;P;B	0.85130	0.997;0.666;0.666;0.342	D	0.95768	0.8806	10	0.36615	T	0.2	.	20.0953	0.97838	0.0:1.0:0.0:0.0	.	189;248;287;287	E9PE18;B7Z3W1;Q03181;F1D8S7	.;.;PPARD_HUMAN;.	Y	248;287;189;287;287;287;184	ENSP00000414372:H248Y;ENSP00000353916:H287Y;ENSP00000413314:H189Y;ENSP00000410837:H287Y;ENSP00000310928:H287Y;ENSP00000337063:H287Y;ENSP00000443759:H184Y	ENSP00000310928:H287Y	H	+	1	0	PPARD	35500315	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	6.091000	0.71406	2.767000	0.95098	0.655000	0.94253	CAC	-	HMMPfam_Hormone_recep		0.597	PPARD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARD	protein_coding	OTTHUMT00000040288.1	C	NM_006238		35500315	1	no_errors	NM_006238	genbank	human	reviewed	54_36p	missense	SNP	1	T
STK38	11329	genome.wustl.edu	37	6	36466154	36466154	+	Missense_Mutation	SNP	C	C	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:36466154C>A	ENST00000229812.7	-	11	1347	c.1062G>T	c.(1060-1062)aaG>aaT	p.K354N		NM_007271.2	NP_009202.1			serine/threonine kinase 38									p.K354N(1)		NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAATTAGATCCTTGGCTTTCT	0.363																																					Colon(180;997 3561 16158)											1	Substitution - Missense(1)	ovary(1)	6											122.0	126.0	125.0					6																	36466154		2203	4300	6503	36574132	SO:0001583	missense	11329				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.1062G>T	6.37:g.36466154C>A	ENSP00000229812:p.Lys354Asn		36574132		Missense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_Pkinase_C;superfamily_Protein kinase-like (PK-like)	p.K354N	ENST00000229812.7	37	c.1062	CCDS4822.1	6	.	.	.	.	.	.	.	.	.	.	C	19.80	3.894343	0.72639	.	.	ENSG00000112079	ENST00000229812	T	0.68479	-0.33	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67126	0.2860	L	0.60012	1.86	0.80722	D	1	P	0.49447	0.924	P	0.52823	0.71	T	0.70791	-0.4776	10	0.72032	D	0.01	.	14.4536	0.67401	0.0:0.93:0.0:0.0699	.	354	Q15208	STK38_HUMAN	N	354	ENSP00000229812:K354N	ENSP00000229812:K354N	K	-	3	2	STK38	36574132	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.356000	0.44116	2.804000	0.96469	0.650000	0.86243	AAG	-	HMMPfam_Pkinase		0.363	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38	protein_coding	OTTHUMT00000040346.1	C	NM_007271		36574132	-1	no_errors	NM_007271	genbank	human	provisional	54_36p	missense	SNP	1	A
SYNCRIP	10492	genome.wustl.edu	37	6	86324762	86324762	+	Silent	SNP	A	A	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:86324762A>C	ENST00000369622.3	-	11	2084	c.1584T>G	c.(1582-1584)ggT>ggG	p.G528G	SYNCRIP_ENST00000355238.6_Silent_p.G528G|RP11-321N4.5_ENST00000503906.1_Missense_Mutation_p.V64G	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	528	8 X 3 AA repeats of R-G-G.|Interaction with APOBEC1.|Interaction with SMN.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G528G(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		CTGATCCAGGACCTCCTCTCT	0.632																																																1	Substitution - coding silent(1)	ovary(1)	6											116.0	123.0	121.0					6																	86324762		2203	4300	6503	86381481	SO:0001819	synonymous_variant	10492			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.1584T>G	6.37:g.86324762A>C			86381481	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Silent	SNP	-	p.G528	ENST00000369622.3	37	c.1584	CCDS5005.1	6																																																																																			-	NULL		0.632	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNCRIP	protein_coding	OTTHUMT00000041396.1	A	NM_006372		86381481	-1	no_errors	NM_006372	genbank	human	provisional	54_36p	silent	SNP	1	C
CCR6	1235	genome.wustl.edu	37	6	167549746	167549746	+	Missense_Mutation	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr6:167549746G>A	ENST00000341935.5	+	3	580	c.28G>A	c.(28-30)Gat>Aat	p.D10N	CCR6_ENST00000349984.4_Missense_Mutation_p.D10N|RP11-517H2.6_ENST00000609590.1_RNA|CCR6_ENST00000400926.2_Missense_Mutation_p.D10N	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	10					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)	p.D10N(1)		endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		GAATTTCAGCGATGTTTTCGA	0.408																																																1	Substitution - Missense(1)	ovary(1)	6											152.0	151.0	152.0					6																	167549746		2203	4300	6503	167469736	SO:0001583	missense	1235			U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.28G>A	6.37:g.167549746G>A	ENSP00000343952:p.Asp10Asn		167469736	E1P5C6|P78553|Q92846	Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.D10N	ENST00000341935.5	37	c.28	CCDS5298.1	6	.	.	.	.	.	.	.	.	.	.	G	8.718	0.913764	0.17907	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	T;T;T	0.66280	-0.2;-0.2;-0.2	4.57	-7.52	0.01341	.	7739.210000	0.00166	N	0.000000	T	0.17789	0.0427	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.03922	-1.0992	10	0.17369	T	0.5	.	8.3791	0.32461	0.4587:0.0:0.442:0.0993	.	10	P51684	CCR6_HUMAN	N	10	ENSP00000383715:D10N;ENSP00000343952:D10N;ENSP00000339393:D10N	ENSP00000343952:D10N	D	+	1	0	CCR6	167469736	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.320000	0.08028	-1.888000	0.01113	-0.258000	0.10820	GAT	-	NULL		0.408	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCR6	protein_coding	OTTHUMT00000043118.1	G			167469736	1	no_errors	NM_004367	genbank	human	reviewed	54_36p	missense	SNP		A
GRM8	2918	genome.wustl.edu	37	7	126173509	126173509	+	Missense_Mutation	SNP	G	G	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr7:126173509G>T	ENST00000339582.2	-	9	2735	c.1927C>A	c.(1927-1929)Cca>Aca	p.P643T	GRM8_ENST00000444921.2_Missense_Mutation_p.P643T|GRM8_ENST00000358373.3_Missense_Mutation_p.P643T|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	643					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.P643T(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				ATTGTATCTGGTGCTGCAATC	0.463										HNSCC(24;0.065)																																						1	Substitution - Missense(1)	ovary(1)	7											90.0	90.0	90.0					7																	126173509		2203	4300	6503	125960745	SO:0001583	missense	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1927C>A	7.37:g.126173509G>T	ENSP00000344173:p.Pro643Thr		125960745	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	-	p.P643T	ENST00000339582.2	37	c.1927	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240814	0.79912	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.90900	-2.75;-2.75;-2.75	5.75	5.75	0.90469	GPCR, family 3, C-terminal (2);	0.050021	0.85682	D	0.000000	D	0.96901	0.8988	H	0.94542	3.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	D	0.97546	1.0089	10	0.87932	D	0	.	18.9383	0.92595	0.0:0.0:1.0:0.0	.	643;643	O00222-2;O00222	.;GRM8_HUMAN	T	643	ENSP00000344173:P643T;ENSP00000409790:P643T;ENSP00000351142:P643T	ENSP00000344173:P643T	P	-	1	0	GRM8	125960745	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	9.869000	0.99810	2.732000	0.93576	0.655000	0.94253	CCA	-	NULL		0.463	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	protein_coding	OTTHUMT00000059209.4	G			125960745	-1	no_errors	NM_000845	genbank	human	reviewed	54_36p	missense	SNP	1	T
GRM8	2918	genome.wustl.edu	37	7	126173771	126173771	+	Silent	SNP	A	A	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr7:126173771A>T	ENST00000339582.2	-	9	2473	c.1665T>A	c.(1663-1665)ctT>ctA	p.L555L	GRM8_ENST00000444921.2_Silent_p.L555L|GRM8_ENST00000358373.3_Silent_p.L555L|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	555					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.L555L(1)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CCAGAGGGCAAAGTTCACAGG	0.547										HNSCC(24;0.065)																																						1	Substitution - coding silent(1)	ovary(1)	7											148.0	133.0	138.0					7																	126173771		2203	4300	6503	125961007	SO:0001819	synonymous_variant	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1665T>A	7.37:g.126173771A>T			125961007	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Silent	SNP	-	p.L555	ENST00000339582.2	37	c.1665	CCDS5794.1	7																																																																																			-	NULL		0.547	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	protein_coding	OTTHUMT00000059209.4	A			125961007	-1	no_errors	NM_000845	genbank	human	reviewed	54_36p	silent	SNP	0.98	T
AHCYL2	23382	genome.wustl.edu	37	7	129019563	129019563	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr7:129019563C>T	ENST00000325006.3	+	2	502	c.448C>T	c.(448-450)Cag>Tag	p.Q150*	AHCYL2_ENST00000446544.2_Nonsense_Mutation_p.Q149*|AHCYL2_ENST00000446212.1_Nonsense_Mutation_p.Q48*|AHCYL2_ENST00000474594.1_Nonsense_Mutation_p.Q47*|AHCYL2_ENST00000531335.2_Nonsense_Mutation_p.Q69*|AHCYL2_ENST00000490911.1_Nonsense_Mutation_p.Q47*	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	150					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)	p.Q150*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						TTCCATTTCTCAGTCATCTAC	0.468																																					Pancreas(160;1736 1964 29875 40941 45605)											1	Substitution - Nonsense(1)	ovary(1)	7											104.0	87.0	93.0					7																	129019563		2203	4300	6503	128806799	SO:0001587	stop_gained	23382			AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.448C>T	7.37:g.129019563C>T	ENSP00000315931:p.Gln150*		128806799	B4DIZ5|D9N155|O94917	Nonsense_Mutation	SNP	-	p.Q150*	ENST00000325006.3	37	c.448	CCDS5812.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.774568	0.96922	.	.	ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000460109;ENST00000474594;ENST00000446212;ENST00000490911;ENST00000466993	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-14.4168	18.0999	0.89503	0.0:1.0:0.0:0.0	.	.	.	.	X	150;149;69;48;47;48;47;48	.	ENSP00000315931:Q150X	Q	+	1	0	AHCYL2	128806799	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.696000	0.84270	2.527000	0.85204	0.555000	0.69702	CAG	-	NULL		0.468	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHCYL2	protein_coding	OTTHUMT00000354065.1	C			128806799	1	no_errors	NM_015328	genbank	human	validated	54_36p	nonsense	SNP	1	T
ELMO1	9844	genome.wustl.edu	37	7	37253054	37253054	+	Silent	SNP	G	G	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr7:37253054G>A	ENST00000310758.4	-	12	1487	c.840C>T	c.(838-840)atC>atT	p.I280I	ELMO1_ENST00000442504.1_Silent_p.I280I|ELMO1_ENST00000448602.1_Silent_p.I280I	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	280					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)	p.I280I(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GCTGGGCTCGGATGACATGCT	0.433																																																1	Substitution - coding silent(1)	ovary(1)	7											66.0	54.0	58.0					7																	37253054		2203	4300	6503	37219579	SO:0001819	synonymous_variant	9844			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.840C>T	7.37:g.37253054G>A			37219579	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	-	p.I280	ENST00000310758.4	37	c.840	CCDS5449.1	7	.	.	.	.	.	.	.	.	.	.	G	10.46	1.355169	0.24512	.	.	ENSG00000155849	ENST00000433246	.	.	.	5.2	4.32	0.51571	.	.	.	.	.	T	0.69967	0.3170	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69815	-0.5043	4	.	.	.	.	14.5877	0.68339	0.0715:0.0:0.9285:0.0	.	.	.	.	F	60	.	.	S	-	2	0	ELMO1	37219579	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.854000	0.55949	1.522000	0.49001	0.655000	0.94253	TCC	-	NULL		0.433	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	protein_coding	OTTHUMT00000219830.4	G	NM_130442		37219579	-1	no_errors	NM_014800	genbank	human	reviewed	54_36p	silent	SNP	1	A
CASD1	64921	genome.wustl.edu	37	7	94168341	94168341	+	Missense_Mutation	SNP	G	G	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr7:94168341G>C	ENST00000297273.4	+	10	1616	c.1329G>C	c.(1327-1329)ttG>ttC	p.L443F		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	443						integral component of membrane (GO:0016021)		p.L443F(1)		NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TTGTGATTTTGATTTATCACA	0.323																																																1	Substitution - Missense(1)	ovary(1)	7											118.0	115.0	116.0					7																	94168341		2203	4298	6501	94006277	SO:0001583	missense	64921			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1329G>C	7.37:g.94168341G>C	ENSP00000297273:p.Leu443Phe		94006277	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	superfamily_Cyclin-like;HMMPfam_Cas1p	p.L443F	ENST00000297273.4	37	c.1329	CCDS5636.1	7	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361504	0.61403	.	.	ENSG00000127995	ENST00000297273	T	0.62941	-0.01	4.82	1.8	0.24995	.	0.000000	0.64402	D	0.000001	T	0.78836	0.4346	M	0.88775	2.98	0.54753	D	0.999989	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.999	T	0.79296	-0.1862	10	0.87932	D	0	.	9.0311	0.36260	0.1215:0.1287:0.7498:0.0	.	443;443	Q8WZ77;Q96PB1	.;CASD1_HUMAN	F	443	ENSP00000297273:L443F	ENSP00000297273:L443F	L	+	3	2	CASD1	94006277	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.716000	0.25836	0.562000	0.29204	0.591000	0.81541	TTG	-	HMMPfam_Cas1p		0.323	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASD1	protein_coding	OTTHUMT00000255216.1	G	NM_022900		94006277	1	no_errors	NM_022900	genbank	human	validated	54_36p	missense	SNP	1	C
MGAM	8972	genome.wustl.edu	37	7	141759305	141759305	+	Silent	SNP	C	C	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr7:141759305C>A	ENST00000549489.2	+	32	3948	c.3853C>A	c.(3853-3855)Cgg>Agg	p.R1285R	MGAM_ENST00000475668.2_Silent_p.R1285R	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1285	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R1285R(1)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTACATGGAGCGGCAGCTGGA	0.552																																																1	Substitution - coding silent(1)	ovary(1)	7											33.0	32.0	32.0					7																	141759305		1991	4143	6134	141405774	SO:0001819	synonymous_variant	8972			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3853C>A	7.37:g.141759305C>A			141405774	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	HMMPfam_Glyco_hydro_31,HMMPfam_Trefoil,superfamily_Trefoil,superfamily_(Trans)glycosidases	p.R1285	ENST00000549489.2	37	c.3853	CCDS47727.1	7																																																																																			-	HMMPfam_Glyco_hydro_31		0.552	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	protein_coding	OTTHUMT00000351244.3	C			141405774	1	no_errors	NM_004668	genbank	human	reviewed	54_36p	silent	SNP	1	A
PRKDC	5591	genome.wustl.edu	37	8	48746759	48746759	+	Missense_Mutation	SNP	T	T	C			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr8:48746759T>C	ENST00000314191.2	-	60	8203	c.8147A>G	c.(8146-8148)aAa>aGa	p.K2716R	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.K2716R	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2717	KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.K2717R(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CAGCTTACCTTTCACTTTGTT	0.483								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)											1	Substitution - Missense(1)	ovary(1)	8											215.0	216.0	216.0					8																	48746759		1951	4157	6108	48909312	SO:0001583	missense	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.8147A>G	8.37:g.48746759T>C	ENSP00000313420:p.Lys2716Arg		48909312	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	HEAT,HMMPfam_HEAT,PI3_PI4_kinase,HMMPfam_PI3_PI4_kinase,FAT,HMMPfam_FAT,FATC,HMMPfam_FATC,Protein kinase-like (PK-like),superfamily_Protein kinase-like (PK-like),NUC194,HMMPfam_NUC194,ARM repeat,superfamily_ARM repeat,TPR-like,superfamily_TPR-like	p.K2716R	ENST00000314191.2	37	c.8147		8	.	.	.	.	.	.	.	.	.	.	T	12.39	1.923074	0.33908	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02552	4.32;4.25	5.27	4.08	0.47627	.	0.329561	0.27345	N	0.019790	T	0.04318	0.0119	L	0.59912	1.85	0.27828	N	0.941549	B;B	0.11235	0.004;0.004	B;B	0.14578	0.011;0.011	T	0.25293	-1.0136	10	0.23891	T	0.37	.	12.1942	0.54288	0.0:0.0:0.1428:0.8572	.	2716;2717	E7EUY0;P78527	.;PRKDC_HUMAN	R	2716	ENSP00000313420:K2716R;ENSP00000345182:K2716R	ENSP00000313420:K2716R	K	-	2	0	PRKDC	48909312	1.000000	0.71417	0.317000	0.25265	0.823000	0.46562	3.052000	0.49893	0.800000	0.34041	0.460000	0.39030	AAA	-	NULL		0.483	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	protein_coding		T	NM_001081640		48909312	-1	no_errors	ENST00000314191	ensembl	human	known	54_36p	missense	SNP	1	C
ELMOD3	84173	genome.wustl.edu	37	2	85598576	85598576	+	Missense_Mutation	SNP	C	C	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr2:85598576C>G	ENST00000409890.2	+	10	1165	c.498C>G	c.(496-498)agC>agG	p.S166R	ELMOD3_ENST00000315658.7_Missense_Mutation_p.S166R|ELMOD3_ENST00000490508.1_3'UTR|ELMOD3_ENST00000409344.3_Missense_Mutation_p.S166R|ELMOD3_ENST00000393852.4_Missense_Mutation_p.S166R|ELMOD3_ENST00000409013.3_Missense_Mutation_p.S166R|ELMOD3_ENST00000428955.2_Missense_Mutation_p.S166R|RN7SL113P_ENST00000497900.2_RNA|RNU7-162P_ENST00000516669.1_RNA			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3	166					phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.S166R(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						GCCTGGATAGCCAAGACCCAG	0.562																																																1	Substitution - Missense(1)	ovary(1)	2											69.0	67.0	68.0					2																	85598576		2203	4300	6503	85452087	SO:0001583	missense	84173			AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.498C>G	2.37:g.85598576C>G	ENSP00000386304:p.Ser166Arg		85452087	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	Missense_Mutation	SNP	-	p.S166R	ENST00000409890.2	37	c.498	CCDS46352.1	2	.	.	.	.	.	.	.	.	.	.	C	19.77	3.888602	0.72524	.	.	ENSG00000115459	ENST00000409331;ENST00000409013;ENST00000409890;ENST00000409344;ENST00000393852;ENST00000428955;ENST00000315658	T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51	6.17	1.34	0.21922	Engulfment/cell motility, ELMO (1);	0.351701	0.34700	N	0.003746	T	0.30885	0.0779	L	0.38838	1.175	0.29836	N	0.829653	D;P	0.53462	0.96;0.867	P;B	0.52856	0.711;0.411	T	0.15350	-1.0440	10	0.38643	T	0.18	-15.9684	9.3793	0.38304	0.0:0.6377:0.0:0.3623	.	166;166	Q96FG2-6;Q96FG2	.;ELMD3_HUMAN	R	166	ENSP00000386257:S166R;ENSP00000387139:S166R;ENSP00000386304:S166R;ENSP00000386248:S166R;ENSP00000377434:S166R;ENSP00000412692:S166R;ENSP00000318264:S166R	ENSP00000318264:S166R	S	+	3	2	ELMOD3	85452087	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	0.329000	0.19698	0.485000	0.27652	0.655000	0.94253	AGC	-	NULL		0.562	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMOD3	protein_coding	OTTHUMT00000329124.1	C	NM_032213		85452087	1	no_errors	NM_032213	genbank	human	validated	54_36p	missense	SNP	1	G
CCDC180	100499483	genome.wustl.edu	37	9	100092886	100092886	+	Nonsense_Mutation	SNP	T	T	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chr9:100092886T>G	ENST00000357054.1	+	32	3595	c.2660T>G	c.(2659-2661)tTa>tGa	p.L887*	CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000529487.1_Nonsense_Mutation_p.L748*|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000411667.2_Nonsense_Mutation_p.L745*|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Nonsense_Mutation_p.L748*			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	887	Glu-rich.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.L887*(1)									GAGGGCTCCTTAAACCCATCC	0.488																																																1	Substitution - Nonsense(1)	ovary(1)	9											53.0	52.0	53.0					9																	100092886		2203	4300	6503	99132707	SO:0001587	stop_gained	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2660T>G	9.37:g.100092886T>G	ENSP00000349562:p.Leu887*		99132707	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Nonsense_Mutation	SNP	-	p.L887*	ENST00000357054.1	37	c.2660		9	.	.	.	.	.	.	.	.	.	.	T	46	12.787460	0.99696	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	.	.	.	4.13	-4.24	0.03777	.	1.872970	0.02496	N	0.089926	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	0.2495	5.2003	0.15260	0.278:0.5651:0.0:0.1569	.	.	.	.	X	887;748;745;771;748	.	ENSP00000349562:L887X	L	+	2	0	C9orf174	99132707	0.001000	0.12720	0.000000	0.03702	0.114000	0.19823	0.005000	0.13129	-0.766000	0.04639	0.397000	0.26171	TTA	-	NULL		0.488	CCDC180-201	KNOWN	basic	protein_coding	KIAA1529	protein_coding		T	NM_020893		99132707	1	no_errors	NM_020893	genbank	human	predicted	54_36p	nonsense	SNP		G
ENOX2	10495	genome.wustl.edu	37	X	129771385	129771385	+	Splice_Site	SNP	C	C	A			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chrX:129771385C>A	ENST00000370927.1	-	9	1238		c.e9-1		ENOX2_ENST00000370935.1_Splice_Site|ENOX2_ENST00000394363.1_Splice_Site|ENOX2_ENST00000338144.3_Splice_Site			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2						cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)	p.?(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						GATACTAAGGCTAACAATCAA	0.398																																					Ovarian(101;828 1506 2951 9500 35258)											1	Unknown(1)	ovary(1)	X											108.0	87.0	94.0					X																	129771385		2203	4300	6503	129599066	SO:0001630	splice_region_variant	10495			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.1217-1G>T	X.37:g.129771385C>A			129599066	A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Splice_Site	SNP	-	e9-1	ENST00000370927.1	37	c.1217-1	CCDS14626.1	X	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413235	0.42817	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927	.	.	.	5.0	4.14	0.48551	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9159	0.41434	0.0:0.8988:0.0:0.1012	.	.	.	.	.	-1	.	.	.	-	.	.	ENOX2	129599066	1.000000	0.71417	0.932000	0.37286	0.692000	0.40212	2.780000	0.47742	1.084000	0.41184	0.544000	0.68410	.	-	-		0.398	ENOX2-004	KNOWN	basic|CCDS	protein_coding	ENOX2	protein_coding	OTTHUMT00000058277.1	C	NM_182314	Intron	129599066	-1	no_errors	NM_182314	genbank	human	reviewed	54_36p	splice_site	SNP	0.99	A
SPIN3	169981	genome.wustl.edu	37	X	57021238	57021238	+	Missense_Mutation	SNP	T	T	G			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chrX:57021238T>G	ENST00000374919.3	-	2	465	c.143A>C	c.(142-144)aAc>aCc	p.N48T		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	48					gamete generation (GO:0007276)			p.N48T(1)		central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						GCCCACGATGTTCCCCCGAGG	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											134.0	138.0	136.0					X																	57021238		2173	4267	6440	57037963	SO:0001583	missense	169981			AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.143A>C	X.37:g.57021238T>G	ENSP00000364054:p.Asn48Thr		57037963	B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	-	p.N48T	ENST00000374919.3	37	c.143	CCDS43963.1	X	.	.	.	.	.	.	.	.	.	.	T	12.40	1.927985	0.34002	.	.	ENSG00000204271	ENST00000374919;ENST00000374915	T	0.53206	0.63	2.45	2.45	0.29901	.	0.000000	0.64402	U	0.000004	T	0.45856	0.1363	M	0.65975	2.015	0.37522	D	0.917569	P	0.36990	0.577	B	0.40009	0.316	T	0.56202	-0.8018	10	0.87932	D	0	-6.8191	8.0376	0.30502	0.0:0.0:0.0:1.0	.	48	Q5JUX0	SPIN3_HUMAN	T	48	ENSP00000364054:N48T	ENSP00000364050:N48T	N	-	2	0	SPIN3	57037963	1.000000	0.71417	0.074000	0.20217	0.011000	0.07611	6.311000	0.72835	1.229000	0.43630	0.486000	0.48141	AAC	-	NULL		0.547	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN3	protein_coding	OTTHUMT00000056908.1	T	XM_093024		57037963	-1	no_errors	NM_001010862	genbank	human	validated	54_36p	missense	SNP	1	G
FMR1	2332	genome.wustl.edu	37	X	147009912	147009912	+	Splice_Site	SNP	G	G	T			TCGA-13-0795-01A-01W-0372-09	TCGA-13-0795-10A-01W-0372-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	b266a007-694a-4580-ad67-48b0f709bc43	6826e606-44fb-4cc0-9f41-4c60797abbe1	g.chrX:147009912G>T	ENST00000370475.4	+	4	398		c.e4+1		FMR1_ENST00000370471.3_Splice_Site|FMR1_ENST00000440235.2_5'Flank|FMR1_ENST00000370477.1_Splice_Site|FMR1_ENST00000334557.6_Splice_Site|FMR1_ENST00000218200.8_Splice_Site|FMR1_ENST00000370470.1_Splice_Site|FMR1_ENST00000439526.2_Splice_Site	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1						central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.?(1)		NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					AAAGGGTGAGGTAGGAAAATG	0.328									Fragile X syndrome																																							1	Unknown(1)	ovary(1)	X											124.0	130.0	128.0					X																	147009912		2203	4299	6502	146817604	SO:0001630	splice_region_variant	2332	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.270+1G>T	X.37:g.147009912G>T			146817604	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Splice_Site	SNP	-	e4+1	ENST00000370475.4	37	c.270+1	CCDS14682.1	X	.	.	.	.	.	.	.	.	.	.	G	23.2	4.393073	0.83011	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2637	0.87079	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FMR1	146817604	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.361000	0.97122	2.376000	0.81061	0.594000	0.82650	.	-	-		0.328	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	protein_coding	OTTHUMT00000058655.1	G	NM_002024	Intron	146817604	1	no_errors	NM_002024	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
