#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLC25A24	29957	genome.wustl.edu	37	1	108697655	108697655	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr1:108697655C>T	ENST00000565488.1	-	6	991	c.772G>A	c.(772-774)Gtc>Atc	p.V258I	SLC25A24_ENST00000370041.4_Missense_Mutation_p.V239I	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24	258					ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)	p.V239I(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		ATTTTGATGACGTTTGTACCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	1											128.0	120.0	123.0					1																	108697655		2203	4300	6503	108499178	SO:0001583	missense	29957			AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.772G>A	1.37:g.108697655C>T	ENSP00000457733:p.Val258Ile		108499178	B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Missense_Mutation	SNP	-	p.V258I	ENST00000565488.1	37	c.772	CCDS41361.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815631	0.90790	.	.	ENSG00000085491	ENST00000264128;ENST00000370041	T	0.78924	-1.22	5.4	5.4	0.78164	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.80844	0.4701	L	0.53617	1.68	0.80722	D	1	D;D	0.69078	0.997;0.997	P;P	0.59487	0.858;0.778	T	0.80741	-0.1247	10	0.48119	T	0.1	-20.2275	18.1686	0.89737	0.0:1.0:0.0:0.0	.	258;239	Q6NUK1;Q6NUK1-2	SCMC1_HUMAN;.	I	258;239	ENSP00000359058:V239I	ENSP00000264128:V258I	V	-	1	0	SLC25A24	108499178	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.747000	0.85070	2.522000	0.85027	0.484000	0.47621	GTC	-	NULL		0.403	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	SLC25A24	protein_coding	OTTHUMT00000030280.2	C	NM_013386		108499178	-1	no_errors	NM_013386	genbank	human	validated	54_36p	missense	SNP	1	T
USH2A	7399	genome.wustl.edu	37	1	216040513	216040513	+	Splice_Site	SNP	C	C	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr1:216040513C>A	ENST00000307340.3	-	44	9068		c.e44-1		USH2A_ENST00000366943.2_Splice_Site	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)						hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.?(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGTTGTAAACCTAAAATGTTG	0.338										HNSCC(13;0.011)																																						1	Unknown(1)	ovary(1)	1											52.0	52.0	52.0					1																	216040513		2203	4300	6503	214107136	SO:0001630	splice_region_variant	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8682-1G>T	1.37:g.216040513C>A			214107136	Q5VVM9|Q6S362|Q9NS27	Splice_Site	SNP	-	e43-1	ENST00000307340.3	37	c.8682-1	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	15.12	2.740320	0.49045	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0206	0.97499	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	USH2A	214107136	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	5.677000	0.68142	2.745000	0.94114	0.557000	0.71058	.	-	-		0.338	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	C	NM_007123	Intron	214107136	-1	no_errors	NM_206933	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
NEGR1	257194	genome.wustl.edu	37	1	72076726	72076726	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr1:72076726C>A	ENST00000357731.5	-	5	1010	c.771G>T	c.(769-771)tgG>tgT	p.W257C	NEGR1_ENST00000434200.1_Missense_Mutation_p.W211C|NEGR1_ENST00000306821.3_Missense_Mutation_p.W129C	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	257	Ig-like C2-type 3.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)		p.W257C(1)		endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		CTCCTTTGTACCATTCAAAGG	0.458																																																1	Substitution - Missense(1)	ovary(1)	1											118.0	120.0	119.0					1																	72076726		2203	4300	6503	71849314	SO:0001583	missense	257194			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.771G>T	1.37:g.72076726C>A	ENSP00000350364:p.Trp257Cys		71849314	Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	HMMPfam_I-set;HMMPfam_ig;superfamily_Immunoglobulin	p.W257C	ENST00000357731.5	37	c.771	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.064284	0.76187	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	D;D;D	0.96300	-3.97;-3.97;-3.97	6.07	6.07	0.98685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99108	0.9693	H	0.98682	4.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99133	1.0853	10	0.87932	D	0	-5.8913	19.4154	0.94694	0.0:1.0:0.0:0.0	.	211;257	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	C	257;129;211	ENSP00000350364:W257C;ENSP00000305938:W129C;ENSP00000413294:W211C	ENSP00000305938:W129C	W	-	3	0	NEGR1	71849314	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.028000	0.70889	2.884000	0.98904	0.655000	0.94253	TGG	-	HMMPfam_ig		0.458	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	protein_coding	OTTHUMT00000026722.4	C	NM_173808		71849314	-1	no_errors	NM_173808	genbank	human	validated	54_36p	missense	SNP	1	A
PLPPR5	163404	genome.wustl.edu	37	1	99380399	99380399	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr1:99380399C>T	ENST00000263177.4	-	5	1097	c.876G>A	c.(874-876)atG>atA	p.M292I	LPPR5_ENST00000370188.3_Missense_Mutation_p.M292I	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		292						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.M292I(1)									TGATCATTGGCATCTGTGCCA	0.358																																																1	Substitution - Missense(1)	ovary(1)	1											167.0	158.0	161.0					1																	99380399		2203	4300	6503	99152987	SO:0001583	missense	163404																														ENST00000263177.4:c.876G>A	1.37:g.99380399C>T	ENSP00000263177:p.Met292Ile		99152987	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	-	p.M292I	ENST00000263177.4	37	c.876	CCDS30778.1	1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.418646	0.42918	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.29655	1.56;1.56	5.98	5.98	0.97165	.	0.316334	0.34025	N	0.004325	T	0.11537	0.0281	N	0.19112	0.55	0.36951	D	0.892877	B;B	0.13594	0.008;0.002	B;B	0.15052	0.012;0.002	T	0.10660	-1.0620	10	0.15499	T	0.54	.	19.4463	0.94849	0.0:1.0:0.0:0.0	.	292;292	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	I	292	ENSP00000359207:M292I;ENSP00000263177:M292I	ENSP00000263177:M292I	M	-	3	0	AL161744.1	99152987	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	3.555000	0.53727	2.835000	0.97688	0.650000	0.86243	ATG	-	NULL		0.358	LPPR5-002	KNOWN	basic|CCDS	protein_coding	PAP2D	protein_coding	OTTHUMT00000393221.1	C			99152987	-1	no_errors	NM_001037317	genbank	human	reviewed	54_36p	missense	SNP	1	T
LYST	1130	genome.wustl.edu	37	1	235897870	235897870	+	Silent	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr1:235897870C>T	ENST00000389794.3	-	32	8622	c.8448G>A	c.(8446-8448)ctG>ctA	p.L2816L	LYST_ENST00000389793.2_Silent_p.L2816L|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2816					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.L2816L(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CATTCATAAGCAGTTCTGCTG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	1											237.0	205.0	216.0					1																	235897870		2203	4300	6503	233964493	SO:0001819	synonymous_variant	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8448G>A	1.37:g.235897870C>T			233964493	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	-	p.L2816	ENST00000389794.3	37	c.8448	CCDS31062.1	1																																																																																			-	NULL		0.383	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	protein_coding	OTTHUMT00000097533.5	C			233964493	-1	no_errors	NM_000081	genbank	human	reviewed	54_36p	silent	SNP	0.05	T
MTPAP	55149	genome.wustl.edu	37	10	30629242	30629242	+	Silent	SNP	C	C	T	rs547303023		TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr10:30629242C>T	ENST00000263063.4	-	3	511	c.468G>A	c.(466-468)caG>caA	p.Q156Q	MTPAP_ENST00000358107.4_Silent_p.Q286Q|MTPAP_ENST00000488290.1_5'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	156					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)	p.Q156Q(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GTTCAGAAGTCTGGTTTTTCA	0.428																																																1	Substitution - coding silent(1)	ovary(1)	10											126.0	115.0	118.0					10																	30629242		2203	4300	6503	30669248	SO:0001819	synonymous_variant	55149			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.468G>A	10.37:g.30629242C>T			30669248	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	-	p.Q156	ENST00000263063.4	37	c.468	CCDS7165.1	10																																																																																			-	NULL		0.428	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	protein_coding	OTTHUMT00000047426.2	C	NM_018109		30669248	-1	no_errors	NM_018109	genbank	human	validated	54_36p	silent	SNP		T
OIT3	170392	genome.wustl.edu	37	10	74692131	74692131	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr10:74692131G>T	ENST00000334011.5	+	9	1705	c.1487G>T	c.(1486-1488)cGg>cTg	p.R496L		NM_152635.1	NP_689848.1	Q8WWZ8	OIT3_HUMAN	oncoprotein induced transcript 3	496	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					nucleus (GO:0005634)	calcium ion binding (GO:0005509)	p.R496L(2)		autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|liver(2)|lung(14)|ovary(2)|prostate(1)|skin(2)	35	Prostate(51;0.0198)					CTGCACTGCCGGGTTCTTGTC	0.527																																					Colon(7;19 345 13446 17537)											2	Substitution - Missense(2)	ovary(1)|lung(1)	10											135.0	143.0	140.0					10																	74692131		2203	4300	6503	74362137	SO:0001583	missense	170392				CCDS7318.1	10q22.2-q22.3	2004-04-21			ENSG00000138315	ENSG00000138315			29953	protein-coding gene	gene with protein product		609330				12975309, 12939600	Standard	NM_152635		Approved	LZP, FLJ39116	uc001jte.1	Q8WWZ8	OTTHUMG00000018444	ENST00000334011.5:c.1487G>T	10.37:g.74692131G>T	ENSP00000333900:p.Arg496Leu		74362137	A0AVP3|Q8N1M8	Missense_Mutation	SNP	-	p.R496L	ENST00000334011.5	37	c.1487	CCDS7318.1	10	.	.	.	.	.	.	.	.	.	.	G	18.21	3.574302	0.65878	.	.	ENSG00000138315	ENST00000334011	D	0.82255	-1.59	6.06	4.17	0.49024	Endoglin/CD105 antigen subgroup (1);Zona pellucida sperm-binding protein (3);	0.258337	0.27397	N	0.019560	T	0.80417	0.4619	M	0.66939	2.045	0.50813	D	0.999896	B	0.29612	0.251	B	0.32211	0.142	T	0.77178	-0.2683	10	0.59425	D	0.04	-10.3452	8.5626	0.33520	0.2958:0.0:0.7042:0.0	.	496	Q8WWZ8	OIT3_HUMAN	L	496	ENSP00000333900:R496L	ENSP00000333900:R496L	R	+	2	0	OIT3	74362137	0.999000	0.42202	0.998000	0.56505	0.994000	0.84299	3.080000	0.50112	0.847000	0.35167	0.655000	0.94253	CGG	-	NULL		0.527	OIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OIT3	protein_coding	OTTHUMT00000048596.1	G	NM_152635		74362137	1	no_errors	NM_152635	genbank	human	provisional	54_36p	missense	SNP	0.99	T
LRRC4C	57689	genome.wustl.edu	37	11	40136105	40136105	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr11:40136105G>C	ENST00000278198.2	-	2	3701	c.1738C>G	c.(1738-1740)Ccc>Gcc	p.P580A	LRRC4C_ENST00000527150.1_Missense_Mutation_p.P580A|LRRC4C_ENST00000528697.1_Missense_Mutation_p.P580A|LRRC4C_ENST00000530763.1_Missense_Mutation_p.P580A			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	580					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)		p.P580A(1)		NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				CTTTCCATGGGTGTGTCTCCC	0.453																																																1	Substitution - Missense(1)	ovary(1)	11											219.0	212.0	215.0					11																	40136105		2203	4300	6503	40092681	SO:0001583	missense	57689			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.1738C>G	11.37:g.40136105G>C	ENSP00000278198:p.Pro580Ala		40092681	A8K0T1|Q7L0N3	Missense_Mutation	SNP	HMMPfam_LRRNT;HMMPfam_LRR_1;HMMPfam_I-set;superfamily_Immunoglobulin;superfamily_L domain-like	p.P580A	ENST00000278198.2	37	c.1738	CCDS31464.1	11	.	.	.	.	.	.	.	.	.	.	G	1.720	-0.496791	0.04291	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	6.17	6.17	0.99709	.	0.055857	0.64402	D	0.000001	T	0.10294	0.0252	N	0.01048	-1.04	0.43107	D	0.994807	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	10	0.08381	T	0.77	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	580	Q9HCJ2	LRC4C_HUMAN	A	580	ENSP00000278198:P580A;ENSP00000436976:P580A;ENSP00000437132:P580A;ENSP00000434761:P580A	ENSP00000278198:P580A	P	-	1	0	LRRC4C	40092681	1.000000	0.71417	0.988000	0.46212	0.992000	0.81027	5.773000	0.68898	2.941000	0.99782	0.655000	0.94253	CCC	-	NULL		0.453	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	protein_coding	OTTHUMT00000389499.1	G	NM_020929		40092681	-1	no_errors	NM_020929	genbank	human	validated	54_36p	missense	SNP	1	C
SLC22A25	387601	genome.wustl.edu	37	11	62997119	62997119	+	Silent	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr11:62997119G>A	ENST00000306494.6	-	1	5	c.6C>T	c.(4-6)gcC>gcT	p.A2A	SLC22A25_ENST00000403374.2_5'Flank|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000535888.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25									p.A2A(1)		NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						GGTCCTGAAAGGCCATTGAGG	0.413																																																1	Substitution - coding silent(1)	ovary(1)	11											39.0	42.0	41.0					11																	62997119		2201	4298	6499	62753695	SO:0001819	synonymous_variant	387601			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.6C>T	11.37:g.62997119G>A			62753695		Silent	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.A2	ENST00000306494.6	37	c.6	CCDS31592.1	11																																																																																			-	NULL		0.413	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	protein_coding	OTTHUMT00000383519.3	G	NM_199352		62753695	-1	no_errors	NM_199352	genbank	human	validated	54_36p	silent	SNP	0.92	A
C12orf40	283461	genome.wustl.edu	37	12	40078683	40078683	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr12:40078683C>T	ENST00000324616.5	+	10	1455	c.1301C>T	c.(1300-1302)tCg>tTg	p.S434L	C12orf40_ENST00000405531.3_Missense_Mutation_p.S434L	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	434								p.S434L(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						AATATACCTTCGGAAGAATTG	0.363																																																1	Substitution - Missense(1)	ovary(1)	12											119.0	114.0	115.0					12																	40078683		1838	4078	5916	38364950	SO:0001583	missense	283461			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.1301C>T	12.37:g.40078683C>T	ENSP00000317671:p.Ser434Leu		38364950	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	-	p.S434L	ENST00000324616.5	37	c.1301	CCDS41770.1	12	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.859581	0.00552	.	.	ENSG00000180116	ENST00000405531;ENST00000324616	T;T	0.34859	1.34;1.34	5.15	1.52	0.23074	.	0.742196	0.11596	N	0.548187	T	0.12944	0.0314	N	0.02247	-0.625	0.58432	D	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.17167	-1.0378	10	0.11182	T	0.66	.	7.3814	0.26858	0.0:0.2695:0.0:0.7305	.	434	Q86WS4	CL040_HUMAN	L	434	ENSP00000383897:S434L;ENSP00000317671:S434L	ENSP00000317671:S434L	S	+	2	0	C12orf40	38364950	0.977000	0.34250	0.844000	0.33320	0.034000	0.12701	0.860000	0.27871	0.152000	0.19188	-0.302000	0.09304	TCG	-	NULL		0.363	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	protein_coding	OTTHUMT00000257664.2	C	NM_173599		38364950	1	no_errors	NM_001031748	genbank	human	validated	54_36p	missense	SNP	0.25	T
MTMR6	9107	genome.wustl.edu	37	13	25826045	25826045	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr13:25826045G>A	ENST00000381801.5	-	12	2185	c.1424C>T	c.(1423-1425)tCc>tTc	p.S475F	MTMR6_ENST00000540661.1_Missense_Mutation_p.S475F	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	475	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)	p.S475F(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		GTGAGATTCGGAACTGTAGAG	0.328																																																1	Substitution - Missense(1)	ovary(1)	13											116.0	132.0	127.0					13																	25826045		2203	4299	6502	24724045	SO:0001583	missense	9107			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1424C>T	13.37:g.25826045G>A	ENSP00000371221:p.Ser475Phe		24724045	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	HMMPfam_Myotub-related;superfamily_PH domain-like;superfamily_(Phosphotyrosine protein) phosphatases II	p.S475F	ENST00000381801.5	37	c.1424	CCDS9313.1	13	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680395	0.47886	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801;ENST00000319298	D;D	0.90444	-2.67;-2.67	5.51	5.51	0.81932	Myotubularin phosphatase domain (1);	0.315828	0.38959	N	0.001517	D	0.87617	0.6222	L	0.35644	1.08	0.51482	D	0.999926	B;B	0.26845	0.1;0.161	B;B	0.35039	0.148;0.194	D	0.85578	0.1238	10	0.59425	D	0.04	.	12.9901	0.58614	0.0:0.0:0.7174:0.2825	.	475;475	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	F	475;475;475;43	ENSP00000443161:S475F;ENSP00000371221:S475F	ENSP00000317987:S43F	S	-	2	0	MTMR6	24724045	0.883000	0.30277	0.447000	0.26932	0.876000	0.50452	3.735000	0.55044	2.578000	0.87016	0.585000	0.79938	TCC	-	NULL		0.328	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR6	protein_coding	OTTHUMT00000044225.1	G	NM_004685		24724045	-1	no_errors	NM_004685	genbank	human	validated	54_36p	missense	SNP	0.95	A
PCDH17	27253	genome.wustl.edu	37	13	58208327	58208327	+	Silent	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr13:58208327G>A	ENST00000377918.3	+	1	1673	c.1647G>A	c.(1645-1647)gaG>gaA	p.E549E		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	549	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E549E(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AGGCTTTTGAGTTCAAGGTGC	0.577																																					Melanoma(72;952 1291 1619 12849 33676)											1	Substitution - coding silent(1)	ovary(1)	13											43.0	44.0	44.0					13																	58208327		2203	4300	6503	57106328	SO:0001819	synonymous_variant	27253			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1647G>A	13.37:g.58208327G>A			57106328	A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	-	p.E549	ENST00000377918.3	37	c.1647	CCDS31986.1	13																																																																																			-	NULL		0.577	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	protein_coding	OTTHUMT00000045139.1	G	NM_001040429		57106328	1	no_errors	NM_001040429	genbank	human	reviewed	54_36p	silent	SNP	1	A
PCDH20	64881	genome.wustl.edu	37	13	61985959	61985959	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr13:61985959G>T	ENST00000409186.1	-	5	4378	c.2273C>A	c.(2272-2274)aCt>aAt	p.T758N	PCDH20_ENST00000409204.4_Missense_Mutation_p.T758N			Q8N6Y1	PCD20_HUMAN	protocadherin 20	758	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.T731N(1)		breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GCCTGGCAGAGTAGAAGGCAG	0.438																																																1	Substitution - Missense(1)	ovary(1)	13											86.0	92.0	90.0					13																	61985959		2203	4300	6503	60883960	SO:0001583	missense	64881			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2273C>A	13.37:g.61985959G>T	ENSP00000386653:p.Thr758Asn		60883960	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	HMMPfam_Cadherin;HMMPfam_Cadherin_2;superfamily_Cadherin-like	p.T731N	ENST00000409186.1	37	c.2192	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822895	0.71028	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.43294	0.95;0.95	6.06	6.06	0.98353	.	0.174258	0.40554	N	0.001061	T	0.63861	0.2547	L	0.56124	1.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62469	-0.6848	10	0.87932	D	0	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	758	A8K1K9	.	N	758;758;504	ENSP00000387250:T758N;ENSP00000386653:T758N	ENSP00000351500:T504N	T	-	2	0	PCDH20	60883960	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.773000	0.98989	2.880000	0.98712	0.650000	0.86243	ACT	-	HMMPfam_Cadherin		0.438	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	protein_coding	OTTHUMT00000333054.2	G	NM_022843		60883960	-1	no_errors	NM_022843	genbank	human	validated	54_36p	missense	SNP	1	T
DICER1	23405	genome.wustl.edu	37	14	95574680	95574680	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr14:95574680G>A	ENST00000526495.1	-	17	2708	c.2417C>T	c.(2416-2418)aCg>aTg	p.T806M	DICER1_ENST00000541352.1_Missense_Mutation_p.T806M|DICER1_ENST00000343455.3_Missense_Mutation_p.T806M|DICER1_ENST00000393063.1_Missense_Mutation_p.T806M|DICER1_ENST00000527414.1_Missense_Mutation_p.T806M|DICER1_ENST00000556045.1_5'Flank			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	806					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)	p.T806M(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		GGGTTTGGCCGTCAGTATTCC	0.378			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																													yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	1	Substitution - Missense(1)	ovary(1)	14											163.0	157.0	159.0					14																	95574680		2203	4300	6503	94644433	SO:0001583	missense	23405	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.2417C>T	14.37:g.95574680G>A	ENSP00000437256:p.Thr806Met		94644433	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	HMMPfam_Ribonuclease_3;superfamily_RNase III catalytic domain-like (Pfam 00636);HMMPfam_dsrm;HMMPfam_Helicase_C;HMMPfam_PAZ;HMMPfam_DUF283;HMMPfam_DEAD;superfamily_PAZ domain;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_dsRNA-binding domain-like	p.T806M	ENST00000526495.1	37	c.2417	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756865	0.89843	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.89259	0.6664	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88569	0.3128	10	0.54805	T	0.06	-25.3484	20.0965	0.97849	0.0:0.0:1.0:0.0	.	806	Q9UPY3	DICER_HUMAN	M	806	ENSP00000343745:T806M;ENSP00000437256:T806M;ENSP00000376783:T806M;ENSP00000435681:T806M;ENSP00000444719:T806M	ENSP00000343745:T806M	T	-	2	0	DICER1	94644433	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	9.525000	0.98039	2.824000	0.97209	0.655000	0.94253	ACG	-	NULL		0.378	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	protein_coding	OTTHUMT00000387997.1	G			94644433	-1	no_errors	NM_030621	genbank	human	reviewed	54_36p	missense	SNP	1	A
SNRPN	6638	genome.wustl.edu	37	15	25223429	25223429	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr15:25223429C>G	ENST00000400100.1	+	12	1539	c.649C>G	c.(649-651)Cct>Gct	p.P217A	SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000346403.6_Missense_Mutation_p.P217A|SNRPN_ENST00000444203.2_Missense_Mutation_p.P221A|SNRPN_ENST00000400098.1_Missense_Mutation_p.P217A|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000400097.1_Missense_Mutation_p.P217A|SNRPN_ENST00000577565.1_Missense_Mutation_p.P217A|SNRPN_ENST00000390687.4_Missense_Mutation_p.P217A|SNRPN_ENST00000554227.2_Missense_Mutation_p.P221A|SNHG14_ENST00000551631.2_RNA	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	217	Repeat-rich region.				response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)	p.P217A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		AGGCATGCCGCCTCCGGGAAT	0.567									Prader-Willi syndrome																																							1	Substitution - Missense(1)	ovary(1)	15											125.0	124.0	124.0					15																	25223429		1898	4111	6009	22774522	SO:0001583	missense	6638	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.649C>G	15.37:g.25223429C>G	ENSP00000382972:p.Pro217Ala		22774522	B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	-	p.P217A	ENST00000400100.1	37	c.649	CCDS10017.1	15	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641091	0.29157	.	.	ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000128739;ENSG00000214265	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203;ENST00000346403	T;T;T;T;T;T	0.53857	0.73;0.73;0.73;0.6;0.73;0.6	3.83	1.95	0.26073	.	0.110120	0.64402	D	0.000005	T	0.37972	0.1023	L	0.38953	1.18	0.80722	D	1	B;B	0.32302	0.363;0.363	B;B	0.28916	0.096;0.096	T	0.29427	-1.0012	10	0.87932	D	0	-4.2165	8.1631	0.31211	0.0:0.795:0.0:0.2049	.	221;217	B3KVR1;P63162	.;RSMN_HUMAN	A	217;217;217;221;217;221;76	ENSP00000382972:P217A;ENSP00000382970:P217A;ENSP00000382969:P217A;ENSP00000452342:P221A;ENSP00000375105:P217A;ENSP00000408767:P221A	ENSP00000306223:P76A	P	+	1	0	SNRPN;SNURF	22774522	1.000000	0.71417	0.993000	0.49108	0.937000	0.57800	6.652000	0.74377	0.596000	0.29794	0.591000	0.81541	CCT	-	NULL		0.567	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	protein_coding	OTTHUMT00000413849.10	C	NM_003097		22774522	1	no_errors	NM_003097	genbank	human	reviewed	54_36p	missense	SNP	1	G
CYP1A2	1544	genome.wustl.edu	37	15	75047328	75047328	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr15:75047328C>A	ENST00000343932.4	+	7	1513	c.1450C>A	c.(1450-1452)Ccg>Acg	p.P484T		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	484					alkaloid metabolic process (GO:0009820)|arachidonic acid metabolic process (GO:0019369)|cellular respiration (GO:0045333)|cellular response to cadmium ion (GO:0071276)|dibenzo-p-dioxin metabolic process (GO:0018894)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|hydrogen peroxide biosynthetic process (GO:0050665)|lung development (GO:0030324)|methylation (GO:0032259)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative deethylation (GO:0071615)|oxidative demethylation (GO:0070989)|porphyrin-containing compound metabolic process (GO:0006778)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|toxin biosynthetic process (GO:0009403)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|demethylase activity (GO:0032451)|electron carrier activity (GO:0009055)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)	p.P484T(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					"""""""Insulin(DB00071)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Agomelatine(DB06594)|Albendazole(DB00518)|Alitretinoin(DB00523)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Anagrelide(DB00261)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Asenapine(DB06216)|Atropine(DB00572)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzyl alcohol(DB06770)|Betaxolol(DB00195)|Bortezomib(DB00188)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Caffeine(DB00201)|Carbamazepine(DB00564)|Carmustine(DB00262)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clenbuterol(DB01407)|Clevidipine(DB04920)|Clobetasol propionate(DB01013)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Diazepam(DB00829)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Edetic Acid(DB00974)|Efavirenz(DB00625)|Eltrombopag(DB06210)|Enoxacin(DB00467)|Epinephrine(DB00668)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Ethanol(DB00898)|Etoposide(DB00773)|Etoricoxib(DB01628)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Gemfibrozil(DB01241)|Griseofulvin(DB00400)|Guanabenz(DB00629)|Haloperidol(DB00502)|Hesperetin(DB01094)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|inhaled insulin(DB05278)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Losartan(DB00678)|Lumiracoxib(DB01283)|Malathion(DB00772)|Maprotiline(DB00934)|Meclizine(DB00737)|Melatonin(DB01065)|Menadione(DB00170)|Methadone(DB00333)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Nabumetone(DB00461)|Nafcillin(DB00607)|Naproxen(DB00788)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitric Oxide(DB00435)|Nitroprusside(DB00325)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxaliplatin(DB00526)|Oxtriphylline(DB01303)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pefloxacin(DB00487)|Pentamidine(DB00738)|Pentoxifylline(DB00806)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pomalidomide(DB08910)|Praziquantel(DB01058)|Primaquine(DB01087)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|SIMEPREVIR(DB06290)|Sorafenib(DB00398)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Tenofovir(DB00300)|Terbinafine(DB00857)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiabendazole(DB00730)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tizanidine(DB00697)|Tocainide(DB01056)|Toremifene(DB00539)|Tranylcypromine(DB00752)|Triamterene(DB00384)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)|Vemurafenib(DB08881)|Verapamil(DB00661)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)|Zolpidem(DB00425)"""	GTTCAGCGTGCCGCCGGGCGT	0.617																																																1	Substitution - Missense(1)	ovary(1)	15											86.0	71.0	76.0					15																	75047328		2197	4296	6493	72834381	SO:0001583	missense	1544			AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1.14.14.1	"""Cytochrome P450s"""	2596	protein-coding gene	gene with protein product		124060	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2"""			15128046	Standard	NM_000761		Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	ENST00000343932.4:c.1450C>A	15.37:g.75047328C>A	ENSP00000342007:p.Pro484Thr		72834381	Q16754|Q6NWU5|Q9BXX7|Q9UK49	Missense_Mutation	SNP	HMMPfam_p450;superfamily_Cytochrome P450	p.P484T	ENST00000343932.4	37	c.1450	CCDS32293.1	15	.	.	.	.	.	.	.	.	.	.	C	0.032	-1.330745	0.01298	.	.	ENSG00000140505	ENST00000343932	T	0.68903	-0.36	4.39	2.42	0.29668	.	0.474372	0.25192	N	0.032445	T	0.61714	0.2369	M	0.87328	2.875	0.09310	N	1	B	0.12013	0.005	B	0.12837	0.008	T	0.49986	-0.8880	10	0.13853	T	0.58	.	3.4535	0.07507	0.3025:0.4615:0.1473:0.0887	.	484	P05177-2	.	T	484	ENSP00000342007:P484T	ENSP00000342007:P484T	P	+	1	0	CYP1A2	72834381	0.000000	0.05858	0.273000	0.24645	0.161000	0.22273	-0.713000	0.05007	0.423000	0.26033	0.455000	0.32223	CCG	-	HMMPfam_p450		0.617	CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1A2	protein_coding	OTTHUMT00000421263.2	C	NM_000761		72834381	1	no_errors	NM_000761	genbank	human	reviewed	54_36p	missense	SNP	0.03	A
MYH13	8735	genome.wustl.edu	37	17	10212731	10212731	+	Silent	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr17:10212731G>A	ENST00000418404.3	-	34	5152	c.4989C>T	c.(4987-4989)gaC>gaT	p.D1663D	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Silent_p.D1663D			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1663					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.D1663D(1)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TCCTCAGGGCGTCATCGAGAT	0.667																																																1	Substitution - coding silent(1)	ovary(1)	17											17.0	17.0	17.0					17																	10212731		2122	4245	6367	10153456	SO:0001819	synonymous_variant	8735			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4989C>T	17.37:g.10212731G>A			10153456	O95252|Q9P0U8	Silent	SNP	HMMPfam_IQ,HMMPfam_Myosin_head,HMMPfam_Myosin_tail_1,HMMPfam_Myosin_N,superfamily_Prefoldin,superfamily_Spectrin repeat,superfamily_P-loop containing nucleoside triphosphate hydrolases	p.D1663	ENST00000418404.3	37	c.4989	CCDS45613.1	17																																																																																			-	HMMPfam_Myosin_tail_1		0.667	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	protein_coding	OTTHUMT00000442255.1	G	NM_003802		10153456	-1	no_errors	NM_003802	genbank	human	validated	54_36p	silent	SNP	0.99	A
Unknown	0	genome.wustl.edu	37	Unknown	0	0	+	IGR	SNP	C	C	G			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	G	C	C	Unknown	Invalid:failed_liftOver	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chrUnknown:0C>G								None (None upstream) : None (None downstream)																								0.0																																																0			17																																								59779420	SO:0001628	intergenic_variant	5175																															Unknown.37:g.0C>G			59779420		Splice_Site	SNP	-	e19-1		37	c.2040-1		17																																																																																			-	-	0	0					PECAM1			C			59779420	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_000442	genbank	human	provisional	54_36p	splice_site	SNP	1	G
TP53	7157	genome.wustl.edu	37	17	7577108	7577108	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr17:7577108C>A	ENST00000269305.4	-	8	1019	c.830G>T	c.(829-831)tGt>tTt	p.C277F	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C277F|TP53_ENST00000445888.2_Missense_Mutation_p.C277F|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.C277F|TP53_ENST00000420246.2_Missense_Mutation_p.C277F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	277	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C277F(24)|p.C277Y(15)|p.0?(8)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.A276_C277delAC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.C277S(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTCCCAGGACAGGCACAAAC	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	61	Substitution - Missense(40)|Whole gene deletion(8)|Deletion - In frame(7)|Deletion - Frameshift(4)|Unknown(2)	lung(11)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|bone(6)|upper_aerodigestive_tract(5)|oesophagus(5)|stomach(4)|urinary_tract(4)|central_nervous_system(3)|skin(2)|cervix(1)|peritoneum(1)|large_intestine(1)|ovary(1)|prostate(1)|liver(1)	17											72.0	62.0	66.0					17																	7577108		2203	4300	6503	7517833	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.830G>T	17.37:g.7577108C>A	ENSP00000269305:p.Cys277Phe		7517833	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.C277F	ENST00000269305.4	37	c.830	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	21.9	4.209345	0.79240	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.044315	0.85682	D	0.000000	D	0.99880	0.9943	M	0.91872	3.25	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;0.998	D;D;D;D	0.85130	0.982;0.997;0.99;0.986	D	0.96422	0.9312	10	0.87932	D	0	-10.0792	16.1198	0.81342	0.0:1.0:0.0:0.0	.	277;277;277;277	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	F	277;277;277;277;277;266;145	ENSP00000352610:C277F;ENSP00000269305:C277F;ENSP00000398846:C277F;ENSP00000391127:C277F;ENSP00000391478:C277F;ENSP00000425104:C145F	ENSP00000269305:C277F	C	-	2	0	TP53	7517833	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.781000	0.68964	2.667000	0.90743	0.462000	0.41574	TGT	-	HMMPfam_P53		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517833	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	A
ZNF208	7757	genome.wustl.edu	37	19	22157074	22157074	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr19:22157074C>A	ENST00000397126.4	-	4	910	c.762G>T	c.(760-762)gaG>gaT	p.E254D	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E254D(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTAGGATTTCTCTCCAGTAT	0.368																																																1	Substitution - Missense(1)	ovary(1)	19											34.0	37.0	36.0					19																	22157074		2117	4256	6373	21948914	SO:0001583	missense	7757			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.762G>T	19.37:g.22157074C>A	ENSP00000380315:p.Glu254Asp		21948914		Missense_Mutation	SNP	-	p.E254D	ENST00000397126.4	37	c.762	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	7.277	0.608261	0.14002	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.26810	1.71	2.89	0.578	0.17391	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17492	0.0420	.	.	.	0.09310	N	1	B	0.26876	0.162	B	0.30179	0.112	T	0.29212	-1.0019	8	0.52906	T	0.07	.	3.6122	0.08065	0.1913:0.5722:0.0:0.2365	.	254	O43345	ZN208_HUMAN	D	254	ENSP00000380315:E254D	ENSP00000380315:E254D	E	-	3	2	ZNF208	21948914	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.799000	0.01746	-0.143000	0.11334	-0.699000	0.03677	GAG	-	NULL		0.368	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	protein_coding	OTTHUMT00000464302.1	C	NM_007153		21948914	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_007153	genbank	human	provisional	54_36p	missense	SNP		A
ZNF536	9745	genome.wustl.edu	37	19	31038887	31038887	+	Silent	SNP	C	C	T	rs200755943		TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr19:31038887C>T	ENST00000355537.3	+	4	2508	c.2361C>T	c.(2359-2361)gcC>gcT	p.A787A		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	787					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)	p.A787A(1)		NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GTGACTATGCCGGCACGCAGT	0.512													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17925	0.0		0.0	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	19											65.0	69.0	68.0					19																	31038887		2203	4300	6503	35730727	SO:0001819	synonymous_variant	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2361C>T	19.37:g.31038887C>T			35730727	A2RU18	Silent	SNP	-	p.A787	ENST00000355537.3	37	c.2361	CCDS32984.1	19																																																																																			-	NULL		0.512	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	protein_coding	OTTHUMT00000459667.2	C	NM_014717		35730727	1	no_errors	NM_014717	genbank	human	provisional	54_36p	silent	SNP	0.97	T
GRIN2D	2906	genome.wustl.edu	37	19	48922616	48922616	+	Splice_Site	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr19:48922616C>T	ENST00000263269.3	+	8	1949	c.1861C>T	c.(1861-1863)Cgc>Tgc	p.R621C		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	621					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)	p.R621C(1)		autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACGGGCAAGCGTGAGTCCCC	0.592																																																1	Substitution - Missense(1)	ovary(1)	19											93.0	68.0	76.0					19																	48922616		2203	4300	6503	53614428	SO:0001630	splice_region_variant	2906			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1861+1C>T	19.37:g.48922616C>T			53614428		Missense_Mutation	SNP	HMMPfam_Lig_chan;HMMPfam_ANF_receptor;superfamily_Periplasmic binding protein-like I;superfamily_Periplasmic binding protein-like II	p.R621C	ENST00000263269.3	37	c.1861	CCDS12719.1	19	.	.	.	.	.	.	.	.	.	.	C	21.4	4.143924	0.77888	.	.	ENSG00000105464	ENST00000263269	T	0.54279	0.58	4.38	4.38	0.52667	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.066061	0.56097	D	0.000025	T	0.66567	0.2802	L	0.49126	1.545	0.54753	D	0.999989	D	0.89917	1.0	D	0.70935	0.971	T	0.70026	-0.4985	10	0.72032	D	0.01	.	16.2406	0.82405	0.0:1.0:0.0:0.0	.	621	O15399	NMDE4_HUMAN	C	621	ENSP00000263269:R621C	ENSP00000263269:R621C	R	+	1	0	GRIN2D	53614428	0.684000	0.27642	1.000000	0.80357	0.979000	0.70002	0.781000	0.26774	2.447000	0.82792	0.643000	0.83706	CGC	-	HMMPfam_Lig_chan		0.592	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	protein_coding	OTTHUMT00000466121.1	C		Missense_Mutation	53614428	1	no_errors	NM_000836	genbank	human	reviewed	54_36p	missense	SNP	1	T
LAIR1	3903	genome.wustl.edu	37	19	54871663	54871663	+	Silent	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr19:54871663C>T	ENST00000391742.2	-	4	533	c.381G>A	c.(379-381)ccG>ccA	p.P127P	LAIR1_ENST00000313038.6_Silent_p.P120P|LAIR1_ENST00000474878.1_Intron|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000348231.4_Intron|LAIR1_ENST00000434277.2_Silent_p.P126P|LAIR1_ENST00000391743.3_Silent_p.P109P			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	127					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P127P(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		CCGGGGAGTCCGGGCCTCCAG	0.632																																																1	Substitution - coding silent(1)	ovary(1)	19											50.0	55.0	53.0					19																	54871663		2189	4297	6486	59563475	SO:0001819	synonymous_variant	3903			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.381G>A	19.37:g.54871663C>T			59563475		Silent	SNP	superfamily_Immunoglobulin	p.P127	ENST00000391742.2	37	c.381	CCDS12891.1	19																																																																																			-	NULL		0.632	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR1	protein_coding	OTTHUMT00000140506.1	C			59563475	-1	no_errors	NM_002287	genbank	human	reviewed	54_36p	silent	SNP		T
IGHV4OR15-8	28317	genome.wustl.edu	37	15	22473162	22473162	+	RNA	SNP	G	G	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr15:22473162G>T	ENST00000557788.2	-	0	108							A6NJ16	IV4F8_HUMAN	immunoglobulin heavy variable 4/OR15-8 (non-functional)							extracellular region (GO:0005576)											GTGAGGGACAGGGTCTCCGAA	0.637																																																0			15																																								19974526			642131			Z29598		15q11.2	2012-02-20	2008-09-15		ENSG00000259261	ENSG00000259261		"""Immunoglobulins / IGH orphons"""	5658	other	immunoglobulin gene			"""immunoglobulin heavy variable 4/OR15-8"", ""V-set and immunoglobulin domain containing 6"""	VSIG6		7951227	Standard			Approved	IGHV4/OR15-8, IGHV4OR158		A6NJ16	OTTHUMG00000171934		15.37:g.22473162G>T			19974526		Missense_Mutation	SNP	-	p.L44M	ENST00000557788.2	37	c.130		15																																																																																			-	NULL		0.637	IGHV4OR15-8-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	LOC642131	IG_V_gene	OTTHUMT00000415968.2	G			19974526	-1	no_errors	XM_001716834	genbank	human	model	54_36p	missense	SNP	0.6	T
TBC1D8	11138	genome.wustl.edu	37	2	101656711	101656711	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr2:101656711C>T	ENST00000376840.4	-	6	963	c.964G>A	c.(964-966)Gcc>Acc	p.A322T	TBC1D8_ENST00000409318.1_Missense_Mutation_p.A337T			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	322	GRAM 2.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)	p.A337T(1)		breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						CTGTCAGAGGCGAACATCCGC	0.577																																																1	Substitution - Missense(1)	ovary(1)	2											69.0	73.0	72.0					2																	101656711		2042	4188	6230	101023143	SO:0001583	missense	11138			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.964G>A	2.37:g.101656711C>T	ENSP00000366036:p.Ala322Thr		101023143	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	-	p.A322T	ENST00000376840.4	37	c.964	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	C	11.25	1.583712	0.28268	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	D;D	0.86769	-2.17;-2.17	5.86	-7.1	0.01547	GRAM (2);	0.503517	0.20539	N	0.090356	T	0.66247	0.2770	N	0.08118	0	0.09310	N	0.999995	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.002	T	0.52586	-0.8556	10	0.41790	T	0.15	-9.2577	8.092	0.30805	0.1779:0.4128:0.0:0.4093	.	337;322	B7Z6L4;O95759	.;TBCD8_HUMAN	T	322;337	ENSP00000366036:A322T;ENSP00000386856:A337T	ENSP00000366036:A322T	A	-	1	0	TBC1D8	101023143	0.000000	0.05858	0.054000	0.19295	0.601000	0.36947	-0.415000	0.07106	-1.140000	0.02877	-1.147000	0.01851	GCC	-	NULL		0.577	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	protein_coding	OTTHUMT00000376092.1	C	NM_007063		101023143	-1	no_errors	NM_001102426	genbank	human	validated	54_36p	missense	SNP	0.98	T
GPR45	11250	genome.wustl.edu	37	2	105859168	105859168	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr2:105859168G>A	ENST00000258456.1	+	1	969	c.853G>A	c.(853-855)Gtc>Atc	p.V285I		NM_007227.3	NP_009158.3	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V285I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	28						GCCCCACTCCGTCTACAGCCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											177.0	170.0	173.0					2																	105859168		2203	4300	6503	105225600	SO:0001583	missense	11250			AF118266	CCDS2066.1	2q11.1-q12	2012-08-21			ENSG00000135973	ENSG00000135973		"""GPCR / Class A : Orphans"""	4503	protein-coding gene	gene with protein product		604838				10036181	Standard	NM_007227		Approved	PSP24, PSP24A	uc002tco.1	Q9Y5Y3	OTTHUMG00000130805	ENST00000258456.1:c.853G>A	2.37:g.105859168G>A	ENSP00000258456:p.Val285Ile		105225600	Q6NWS4|Q6NXU6	Missense_Mutation	SNP	-	p.V285I	ENST00000258456.1	37	c.853	CCDS2066.1	2	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.044509	0.00398	.	.	ENSG00000135973	ENST00000258456	T	0.69435	-0.4	4.25	0.384	0.16244	GPCR, rhodopsin-like superfamily (1);	0.229694	0.35151	N	0.003405	T	0.40719	0.1128	N	0.11818	0.18	0.45015	D	0.998034	B	0.15930	0.015	B	0.14578	0.011	T	0.21724	-1.0237	10	0.07482	T	0.82	-33.0518	11.1903	0.48681	0.2609:0.0:0.7391:0.0	.	285	Q9Y5Y3	GPR45_HUMAN	I	285	ENSP00000258456:V285I	ENSP00000258456:V285I	V	+	1	0	GPR45	105225600	0.992000	0.36948	0.309000	0.25155	0.250000	0.25880	2.231000	0.43009	0.182000	0.20032	-1.327000	0.01280	GTC	-	NULL		0.582	GPR45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR45	protein_coding	OTTHUMT00000253348.1	G	NM_007227		105225600	1	no_errors	NM_007227	genbank	human	reviewed	54_36p	missense	SNP	0.73	A
C2orf27A	29798	genome.wustl.edu	37	2	132481044	132481044	+	Intron	SNP	A	A	C			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr2:132481044A>C	ENST00000355171.4	+	1	274					NM_013310.3	NP_037442.3	Q580R0	CB027_HUMAN	chromosome 2 open reading frame 27A											kidney(1)	1						TGTTGCGTGCATGCCCGCCTG	0.572																																																0			2																																								132197514	SO:0001627	intron_variant	389049			AF038169	CCDS2168.1	2q21.2	2010-05-11	2009-04-02	2009-04-02	ENSG00000197927	ENSG00000197927			25077	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 27"""	C2orf27		9110174, 8619474	Standard	NM_013310		Approved		uc002ttf.1	Q580R0	OTTHUMG00000131666	ENST00000355171.4:c.-248+823A>C	2.37:g.132481044A>C			132197514	O43575|Q2M1X0|Q52M10|Q86XG2	RNA	SNP	-	NULL	ENST00000355171.4	37	NULL	CCDS2168.1	2																																																																																			-	-		0.572	C2orf27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC389049	protein_coding	OTTHUMT00000254569.4	A	NM_013310		132197514	-1	pseudogene	XR_017334	genbank	human	model	54_36p	rna	SNP	0.98	C
NR4A2	4929	genome.wustl.edu	37	2	157186267	157186267	+	Silent	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr2:157186267G>A	ENST00000339562.4	-	3	794	c.432C>T	c.(430-432)gaC>gaT	p.D144D	NR4A2_ENST00000426264.1_Silent_p.D81D|NR4A2_ENST00000409108.2_Silent_p.D144D|NR4A2_ENST00000409572.1_Silent_p.D144D|NR4A2_ENST00000429376.1_Silent_p.D81D|NR4A2_ENST00000539077.1_Silent_p.D155D	NM_006186.3	NP_006177.1	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	144	Pro-rich.				adult locomotory behavior (GO:0008344)|cellular response to extracellular stimulus (GO:0031668)|cellular response to oxidative stress (GO:0034599)|central nervous system projection neuron axonogenesis (GO:0021952)|death (GO:0016265)|dopamine biosynthetic process (GO:0042416)|dopaminergic neuron differentiation (GO:0071542)|gene expression (GO:0010467)|general adaptation syndrome (GO:0051866)|habenula development (GO:0021986)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of neuron apoptotic process (GO:0043524)|neuron maturation (GO:0042551)|neuron migration (GO:0001764)|positive regulation of catalytic activity (GO:0043085)|post-embryonic development (GO:0009791)|regulation of dopamine metabolic process (GO:0042053)|regulation of respiratory gaseous exchange (GO:0043576)|response to amphetamine (GO:0001975)|response to hypoxia (GO:0001666)|response to inorganic substance (GO:0010035)|response to insecticide (GO:0017085)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.D144D(1)		breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	40						ATCCCGGGTCGTCCCACATGG	0.627																																																1	Substitution - coding silent(1)	ovary(1)	2											74.0	87.0	83.0					2																	157186267		2203	4300	6503	156894513	SO:0001819	synonymous_variant	4929			X75918	CCDS2201.1	2q22-q23	2013-01-16			ENSG00000153234	ENSG00000153234		"""Nuclear hormone receptors"""	7981	protein-coding gene	gene with protein product		601828		NURR1		7706727	Standard	NM_006186		Approved	TINUR, NOT, RNR1, HZF-3	uc002tyz.4	P43354	OTTHUMG00000131950	ENST00000339562.4:c.432C>T	2.37:g.157186267G>A			156894513	Q16311|Q53RZ2|Q6NXU0	Silent	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.D144	ENST00000339562.4	37	c.432	CCDS2201.1	2																																																																																			-	NULL		0.627	NR4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A2	protein_coding	OTTHUMT00000254909.2	G			156894513	-1	no_errors	NM_006186	genbank	human	reviewed	54_36p	silent	SNP	1	A
B3GALT1	8708	genome.wustl.edu	37	2	168725675	168725675	+	Silent	SNP	A	A	G			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr2:168725675A>G	ENST00000392690.3	+	1	218	c.126A>G	c.(124-126)acA>acG	p.T42T	AC016723.4_ENST00000436982.2_RNA|AC016723.4_ENST00000430546.1_RNA|B3GALT1_ENST00000305861.1_Silent_p.T42T			Q9Y5Z6	B3GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1	42					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)	p.T42T(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18						GCCACCTAACAGTTGCCAGGA	0.433																																																1	Substitution - coding silent(1)	ovary(1)	2											112.0	111.0	111.0					2																	168725675		2203	4300	6503	168433921	SO:0001819	synonymous_variant	8708			E07739	CCDS2227.1	2q24.3	2013-02-19			ENSG00000172318	ENSG00000172318		"""Beta 3-glycosyltransferases"""	916	protein-coding gene	gene with protein product		603093				9582303	Standard	NM_020981		Approved	beta3Gal-T1	uc002udz.1	Q9Y5Z6	OTTHUMG00000132163	ENST00000392690.3:c.126A>G	2.37:g.168725675A>G			168433921	D3DPB8|Q53SS2	Silent	SNP	HMMPfam_Galactosyl_T	p.T42	ENST00000392690.3	37	c.126	CCDS2227.1	2																																																																																			-	NULL		0.433	B3GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT1	protein_coding	OTTHUMT00000255211.2	A	NM_020981		168433921	1	no_errors	NM_020981	genbank	human	reviewed	54_36p	silent	SNP	0.8	G
PUM2	23369	genome.wustl.edu	37	2	20508295	20508295	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr2:20508295A>G	ENST00000361078.2	-	5	591	c.569T>C	c.(568-570)tTg>tCg	p.L190S	PUM2_ENST00000536417.1_Missense_Mutation_p.L134S|PUM2_ENST00000338086.5_Missense_Mutation_p.L190S|PUM2_ENST00000403432.1_Missense_Mutation_p.L190S|PUM2_ENST00000420234.1_5'UTR|PUM2_ENST00000319801.5_Missense_Mutation_p.L190S			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	190	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)	p.L190S(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTGGGGCCCAAGCGCTCAAC	0.398																																																1	Substitution - Missense(1)	ovary(1)	2											58.0	62.0	61.0					2																	20508295		2203	4300	6503	20371776	SO:0001583	missense	23369			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.569T>C	2.37:g.20508295A>G	ENSP00000354370:p.Leu190Ser		20371776	B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Missense_Mutation	SNP	-	p.L190S	ENST00000361078.2	37	c.569		2	.	.	.	.	.	.	.	.	.	.	A	26.7	4.758330	0.89843	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417;ENST00000442400	T;T;T;T;T;T	0.19105	2.22;2.49;2.45;2.17;2.22;2.21	6.07	6.07	0.98685	.	0.131998	0.64402	D	0.000017	T	0.27967	0.0689	L	0.46157	1.445	0.51767	D	0.999931	B;P;P	0.41313	0.325;0.745;0.609	B;B;P	0.44860	0.275;0.425;0.462	T	0.00829	-1.1549	10	0.44086	T	0.13	-3.8478	16.6277	0.84984	1.0:0.0:0.0:0.0	.	134;190;190	B4E2B6;B7ZL34;Q8TB72-3	.;.;.	S	190;190;190;81;190;134;190	ENSP00000338173:L190S;ENSP00000354370:L190S;ENSP00000326746:L190S;ENSP00000409905:L81S;ENSP00000385992:L190S;ENSP00000440093:L134S	ENSP00000326746:L190S	L	-	2	0	PUM2	20371776	1.000000	0.71417	0.997000	0.53966	0.970000	0.65996	9.109000	0.94291	2.330000	0.79161	0.528000	0.53228	TTG	-	NULL		0.398	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	protein_coding		A	NM_015317		20371776	-1	no_errors	NM_015317	genbank	human	provisional	54_36p	missense	SNP	1	G
CERKL	375298	genome.wustl.edu	37	2	182521671	182521671	+	Silent	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr2:182521671C>T	ENST00000339098.5	-	1	62	c.63G>A	c.(61-63)gcG>gcA	p.A21A	CERKL_ENST00000410087.3_Silent_p.A21A|CERKL_ENST00000374970.2_Silent_p.A21A|CERKL_ENST00000374969.2_Silent_p.A21A|CERKL_ENST00000479558.1_Intron|CERKL_ENST00000409440.3_Silent_p.A21A			Q49MI3	CERKL_HUMAN	ceramide kinase-like	21					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)	p.A21A(1)		NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CCTCCGGGGGCGCCTCTTCCT	0.741																																																1	Substitution - coding silent(1)	ovary(1)	2											9.0	13.0	12.0					2																	182521671		2168	4245	6413	182229916	SO:0001819	synonymous_variant	375298			BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.63G>A	2.37:g.182521671C>T			182229916	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Silent	SNP	-	p.A21	ENST00000339098.5	37	c.63	CCDS42789.1	2																																																																																			-	NULL		0.741	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERKL	protein_coding	OTTHUMT00000334811.1	C			182229916	-1	no_errors	NM_201548	genbank	human	validated	54_36p	silent	SNP	0.229	T
CSNK2A1	1457	genome.wustl.edu	37	20	478408	478408	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr20:478408A>G	ENST00000217244.3	-	7	758	c.383T>C	c.(382-384)tTa>tCa	p.L128S	CSNK2A1_ENST00000400227.3_Missense_Mutation_p.L128S|CSNK2A1_ENST00000349736.5_Missense_Mutation_p.L128S|CSNK2A1_ENST00000400217.2_5'UTR	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	128	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			L -> F (in Ref. 3; CAA49758). {ECO:0000305}.	axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)	p.L128S(1)		autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			ATAGTCTGTTAACGTCTGGTA	0.318																																																1	Substitution - Missense(1)	ovary(1)	20											91.0	94.0	93.0					20																	478408		2203	4300	6503	426408	SO:0001583	missense	1457			M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.383T>C	20.37:g.478408A>G	ENSP00000217244:p.Leu128Ser		426408	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.L128S	ENST00000217244.3	37	c.383	CCDS13003.1	20	.	.	.	.	.	.	.	.	.	.	A	23.5	4.424614	0.83667	.	.	ENSG00000101266	ENST00000400227;ENST00000349736;ENST00000217244;ENST00000381973	T;T;T	0.71341	-0.56;-0.56;-0.56	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85362	0.5679	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87761	0.2598	10	0.87932	D	0	-3.8723	14.8606	0.70379	1.0:0.0:0.0:0.0	.	128	P68400	CSK21_HUMAN	S	128	ENSP00000383086:L128S;ENSP00000339247:L128S;ENSP00000217244:L128S	ENSP00000217244:L128S	L	-	2	0	CSNK2A1	426408	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.139000	0.94554	2.296000	0.77279	0.482000	0.46254	TTA	-	HMMPfam_Pkinase		0.318	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CSNK2A1	protein_coding	OTTHUMT00000077466.1	A	NM_001895		426408	-1	no_errors	NM_001895	genbank	human	reviewed	54_36p	missense	SNP	1	G
SIRPB1	10326	genome.wustl.edu	37	20	1551592	1551592	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr20:1551592G>A	ENST00000381605.4	-	4	1007	c.943C>T	c.(943-945)Ctc>Ttc	p.L315F	RP4-576H24.4_ENST00000564763.1_Intron|SIRPB1_ENST00000381603.3_Intron|SIRPB1_ENST00000262929.5_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	315	Ig-like C1-type 2.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.L315F(1)		central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						TTCACCAGGAGCCAGCTCATC	0.542																																																1	Substitution - Missense(1)	ovary(1)	20											214.0	184.0	194.0					20																	1551592		2203	4300	6503	1499592	SO:0001583	missense	10326			Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.943C>T	20.37:g.1551592G>A	ENSP00000371018:p.Leu315Phe		1499592	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	-	p.L315F	ENST00000381605.4	37	c.943	CCDS13019.1	20	.	.	.	.	.	.	.	.	.	.	.	7.925	0.739324	0.15642	.	.	ENSG00000101307	ENST00000381605	T	0.08984	3.03	2.51	-0.903	0.10534	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.532876	0.17189	N	0.183590	T	0.09379	0.0231	M	0.76574	2.34	0.80722	D	1	B	0.21309	0.054	B	0.26310	0.068	T	0.10941	-1.0608	10	0.42905	T	0.14	.	2.9901	0.05980	0.154:0.0:0.368:0.4779	.	315	O00241	SIRB1_HUMAN	F	315	ENSP00000371018:L315F	ENSP00000371018:L315F	L	-	1	0	SIRPB1	1499592	0.980000	0.34600	0.963000	0.40424	0.009000	0.06853	0.148000	0.16224	-0.031000	0.13781	-0.475000	0.04921	CTC	-	NULL		0.542	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIRPB1	protein_coding	OTTHUMT00000077555.2	G	NM_006065		1499592	-1	no_errors	NM_006065	genbank	human	reviewed	54_36p	missense	SNP	0.44	A
CDH26	60437	genome.wustl.edu	37	20	58567484	58567484	+	Silent	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr20:58567484C>T	ENST00000244047.5	+	10	1646	c.1335C>T	c.(1333-1335)tcC>tcT	p.S445S	CDH26_ENST00000348616.4_Silent_p.S445S			Q8IXH8	CAD26_HUMAN	cadherin 26	445	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S445S(1)		breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			ACAAAAACTCCGGAGTGGTCA	0.398																																																1	Substitution - coding silent(1)	ovary(1)	20											100.0	90.0	94.0					20																	58567484		2203	4300	6503	58000879	SO:0001819	synonymous_variant	60437			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1335C>T	20.37:g.58567484C>T			58000879	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Silent	SNP	-	p.S445	ENST00000244047.5	37	c.1335		20	.	.	.	.	.	.	.	.	.	.	C	5.717	0.316858	0.10845	.	.	ENSG00000124215	ENST00000370991	.	.	.	4.98	-9.96	0.00443	.	.	.	.	.	T	0.34890	0.0913	.	.	.	0.41596	D	0.988824	.	.	.	.	.	.	T	0.41538	-0.9503	4	.	.	.	.	3.7045	0.08395	0.1203:0.0826:0.2631:0.5341	.	.	.	.	L	37	.	.	P	+	2	0	CDH26	58000879	0.013000	0.17824	0.000000	0.03702	0.005000	0.04900	-1.457000	0.02374	-2.092000	0.00857	-1.442000	0.01069	CCG	-	NULL		0.398	CDH26-201	KNOWN	basic	protein_coding	CDH26	protein_coding		C	NM_177980		58000879	1	no_errors	NM_177980	genbank	human	reviewed	54_36p	silent	SNP	0.05	T
CLTCL1	8218	genome.wustl.edu	37	22	19209499	19209499	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr22:19209499C>A	ENST00000263200.10	-	16	2608	c.2536G>T	c.(2536-2538)Gtg>Ttg	p.V846L	CLTCL1_ENST00000353891.5_Missense_Mutation_p.V846L|CLTCL1_ENST00000427926.1_Missense_Mutation_p.V846L	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	846	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)	p.V846L(1)		breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					ACTTCAGCCACCAACTCATCA	0.428			T	?	ALCL																																		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	1	Substitution - Missense(1)	ovary(1)	22											117.0	121.0	120.0					22																	19209499		1967	4146	6113	17589499	SO:0001583	missense	8218				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.2536G>T	22.37:g.19209499C>A	ENSP00000445677:p.Val846Leu		17589499	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	HMMPfam_Clathrin;HMMPfam_Clathrin_propel;HMMPfam_Clathrin-link;superfamily_ARM repeat;superfamily_Clathrin heavy-chain terminal domain	p.V846L	ENST00000263200.10	37	c.2536	CCDS46662.1	22	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631414	0.87660	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.29142	1.58;1.58;1.58	4.0	4.0	0.46444	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.65709	0.2717	M	0.94021	3.485	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.91635	0.999;0.998	T	0.77905	-0.2413	10	0.87932	D	0	-15.4641	16.2854	0.82717	0.0:1.0:0.0:0.0	.	846;846	P53675-2;P53675	.;CLH2_HUMAN	L	846	ENSP00000439662:V846L;ENSP00000445677:V846L;ENSP00000441158:V846L	ENSP00000445677:V846L	V	-	1	0	CLTCL1	17589499	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	6.923000	0.75817	2.071000	0.62044	0.563000	0.77884	GTG	-	HMMPfam_Clathrin		0.428	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CLTCL1	protein_coding	OTTHUMT00000316397.5	C	NM_007098		17589499	-1	no_errors	ENST00000263200	ensembl	human	known	54_36p	missense	SNP	1	A
SMARCB1	6598	genome.wustl.edu	37	22	24159112	24159112	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr22:24159112G>A	ENST00000263121.7	+	6	980	c.784G>A	c.(784-786)Gtc>Atc	p.V262I	SMARCB1_ENST00000407082.3_Missense_Mutation_p.V216I|SMARCB1_ENST00000477836.1_3'UTR|SMARCB1_ENST00000344921.6_Missense_Mutation_p.V271I|SMARCB1_ENST00000407422.3_Missense_Mutation_p.V253I	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	262	2 X approximate tandem repeats.				ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(3)|p.V262I(1)|p.E210fs*15(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				AGACCAGCGCGTCATCATCAA	0.602			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	5	Unknown(3)|Substitution - Missense(1)|Deletion - Frameshift(1)	central_nervous_system(3)|ovary(1)|soft_tissue(1)	22											97.0	73.0	81.0					22																	24159112		2203	4300	6503	22489112	SO:0001583	missense	6598			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.784G>A	22.37:g.24159112G>A	ENSP00000263121:p.Val262Ile		22489112	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	HMMPfam_SNF5	p.V262I	ENST00000263121.7	37	c.784	CCDS13817.1	22	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452772	0.63290	.	.	ENSG00000099956	ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.77519	0.4142	L	0.31420	0.93	0.80722	D	1	D;D;D	0.59767	0.983;0.986;0.975	P;P;P	0.55055	0.767;0.742;0.742	T	0.74188	-0.3746	10	0.23891	T	0.37	-39.2253	17.8543	0.88758	0.0:0.0:1.0:0.0	.	271;253;262	G5E975;Q17S11;Q12824	.;.;SNF5_HUMAN	I	271;262;253;216	ENSP00000340883:V271I;ENSP00000263121:V262I;ENSP00000383984:V253I;ENSP00000385226:V216I	ENSP00000263121:V262I	V	+	1	0	SMARCB1	22489112	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	9.744000	0.98853	2.546000	0.85860	0.585000	0.79938	GTC	-	HMMPfam_SNF5		0.602	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCB1	protein_coding	OTTHUMT00000319872.1	G	NM_003073		22489112	1	no_errors	NM_003073	genbank	human	reviewed	54_36p	missense	SNP	1	A
PPARG	5468	genome.wustl.edu	37	3	12458478	12458478	+	Silent	SNP	T	T	C			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr3:12458478T>C	ENST00000287820.6	+	6	1216	c.1095T>C	c.(1093-1095)gaT>gaC	p.D365D	PPARG_ENST00000397010.2_Silent_p.D337D|PPARG_ENST00000539812.1_Intron|PPARG_ENST00000397026.2_Silent_p.D343D|PPARG_ENST00000309576.6_Silent_p.D337D|PPARG_ENST00000397012.2_Silent_p.D337D|PPARG_ENST00000397000.1_Intron|PPARG_ENST00000397015.2_Silent_p.D337D	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	365	Ligand-binding.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.D365D(1)	PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	TGAATAAAGATGGGGTTCTCA	0.443			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	1	Substitution - coding silent(1)	ovary(1)	3											58.0	56.0	57.0					3																	12458478		2203	4300	6503	12433478	SO:0001819	synonymous_variant	5468			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.1095T>C	3.37:g.12458478T>C			12433478	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Silent	SNP	HMMPfam_Hormone_recep;HMMPfam_zf-C4;superfamily_Nuclear receptor ligand-binding domain;superfamily_Glucocorticoid receptor-like (DNA-binding domain)	p.D365	ENST00000287820.6	37	c.1095	CCDS2609.1	3																																																																																			-	HMMPfam_Hormone_recep		0.443	PPARG-002	KNOWN	basic|CCDS	protein_coding	PPARG	protein_coding	OTTHUMT00000251979.2	T	NM_005037		12433478	1	no_errors	NM_015869	genbank	human	reviewed	54_36p	silent	SNP	0.98	C
CBLB	868	genome.wustl.edu	37	3	105397360	105397360	+	Silent	SNP	T	T	G			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr3:105397360T>G	ENST00000264122.4	-	17	2805	c.2484A>C	c.(2482-2484)gcA>gcC	p.A828A	CBLB_ENST00000394027.3_Silent_p.A806A|CBLB_ENST00000407712.1_Silent_p.A43A	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	828	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A828A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GACTATGCCTTGCAGGAGGTG	0.488			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	1	Substitution - coding silent(1)	ovary(1)	3											69.0	68.0	68.0					3																	105397360		2203	4300	6503	106880050	SO:0001819	synonymous_variant	868			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.2484A>C	3.37:g.105397360T>G			106880050	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Silent	SNP	UBA;HMMPfam_UBA;zf-C3HC4;HMMPfam_zf-C3HC4;Cbl_N;HMMPfam_Cbl_N;Cbl_N2;HMMPfam_Cbl_N2;Cbl_N3;HMMPfam_Cbl_N3	p.A828	ENST00000264122.4	37	c.2484	CCDS2948.1	3																																																																																			-	NULL		0.488	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	protein_coding	OTTHUMT00000319417.2	T	NM_170662		106880050	-1	no_errors	NM_170662	genbank	human	validated	54_36p	silent	SNP	1	G
ACAA1	30	genome.wustl.edu	37	3	38175457	38175457	+	Silent	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr3:38175457G>A	ENST00000333167.8	-	3	481	c.309C>T	c.(307-309)atC>atT	p.I103I	ACAA1_ENST00000480865.1_5'Flank|ACAA1_ENST00000544624.1_5'UTR|ACAA1_ENST00000301810.7_Silent_p.I103I|ACAA1_ENST00000450296.1_Silent_p.I103I|ACAA1_ENST00000444607.2_Silent_p.I103I	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1	103					alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)	p.I103I(1)		endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		GAAACTGGGCGATTCGGGCCA	0.537																																																1	Substitution - coding silent(1)	ovary(1)	3											67.0	69.0	68.0					3																	38175457		2203	4300	6503	38150461	SO:0001819	synonymous_variant	30			X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.309C>T	3.37:g.38175457G>A			38150461	G5E935|Q96CA6	Silent	SNP	HMMPfam_Thiolase_N,HMMPfam_Thiolase_C,superfamily_Thiolase-like	p.I103	ENST00000333167.8	37	c.309	CCDS2673.1	3	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972719	0.34848	.	.	ENSG00000060971	ENST00000421218	.	.	.	5.58	-5.2	0.02823	.	.	.	.	.	T	0.65873	0.2733	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66674	-0.5864	4	.	.	.	-21.0765	17.161	0.86803	0.8191:0.0:0.1809:0.0	.	.	.	.	L	26	.	.	S	-	2	0	ACAA1	38150461	0.000000	0.05858	0.306000	0.25113	0.989000	0.77384	-1.996000	0.01471	-1.152000	0.02832	-0.140000	0.14226	TCG	-	HMMPfam_Thiolase_N		0.537	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAA1	protein_coding	OTTHUMT00000342980.1	G	NM_001607		38150461	-1	no_errors	NM_001607	genbank	human	reviewed	54_36p	silent	SNP	0.832	A
SNX4	8723	genome.wustl.edu	37	3	125195602	125195602	+	Splice_Site	SNP	T	T	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr3:125195602T>A	ENST00000251775.4	-	8	751		c.e8-2		SNX4_ENST00000473417.1_Splice_Site|SNX4_ENST00000536067.1_Splice_Site	NM_003794.2	NP_003785.1	O95219	SNX4_HUMAN	sorting nexin 4						endocytic recycling (GO:0032456)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|early endosome membrane (GO:0031901)|membrane (GO:0016020)|protein complex (GO:0043234)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)	p.?(1)		breast(2)|central_nervous_system(1)|lung(6)|ovary(1)|skin(1)	11						TGCTACTCTCTGAAATAAATA	0.284																																																1	Unknown(1)	ovary(1)	3											46.0	48.0	47.0					3																	125195602		2202	4292	6494	126678292	SO:0001630	splice_region_variant	8723			AF065485	CCDS3032.1	3q21.2	2014-02-12			ENSG00000114520	ENSG00000114520		"""Sorting nexins"""	11175	protein-coding gene	gene with protein product		605931				9819414	Standard	NM_003794		Approved	ATG24B	uc003eib.4	O95219	OTTHUMG00000159575	ENST00000251775.4:c.727-2A>T	3.37:g.125195602T>A			126678292	B3KMH0|B4DQV4|D3DNA3	Splice_Site	SNP	-	e8-2	ENST00000251775.4	37	c.727-2	CCDS3032.1	3	.	.	.	.	.	.	.	.	.	.	T	17.62	3.435300	0.62955	.	.	ENSG00000114520	ENST00000251775;ENST00000536067	.	.	.	4.08	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.938	0.47257	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNX4	126678292	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.879000	0.63100	1.834000	0.53371	0.455000	0.32223	.	-	-		0.284	SNX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX4	protein_coding	OTTHUMT00000356299.1	T	NM_003794	Intron	126678292	-1	no_errors	NM_003794	genbank	human	reviewed	54_36p	splice_site	SNP	1	A
PRDM9	56979	genome.wustl.edu	37	5	23509610	23509610	+	Missense_Mutation	SNP	A	A	G	rs571933768		TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr5:23509610A>G	ENST00000296682.3	+	3	283	c.101A>G	c.(100-102)tAc>tGc	p.Y34C		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	34	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)	p.Y34C(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						ATTTCCATATACTTCACCAAG	0.413										HNSCC(3;0.000094)																																						1	Substitution - Missense(1)	ovary(1)	5											203.0	190.0	194.0					5																	23509610		1858	4116	5974	23545367	SO:0001583	missense	56979			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.101A>G	5.37:g.23509610A>G	ENSP00000296682:p.Tyr34Cys		23545367	B4DX22|Q27Q50	Missense_Mutation	SNP	-	p.Y34C	ENST00000296682.3	37	c.101	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	A	14.76	2.632911	0.47049	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	T;T	0.01871	4.59;4.59	2.76	2.76	0.32466	Krueppel-associated box-related (1);Krueppel-associated box (3);	.	.	.	.	T	0.09512	0.0234	M	0.73217	2.22	0.27274	N	0.958286	D	0.89917	1.0	D	0.87578	0.998	T	0.05468	-1.0883	9	0.72032	D	0.01	-4.1354	7.3251	0.26551	1.0:0.0:0.0:0.0	.	34	Q9NQV7	PRDM9_HUMAN	C	34	ENSP00000425471:Y34C;ENSP00000296682:Y34C	ENSP00000296682:Y34C	Y	+	2	0	PRDM9	23545367	0.977000	0.34250	0.997000	0.53966	0.927000	0.56198	2.457000	0.45005	1.498000	0.48600	0.496000	0.49642	TAC	-	NULL		0.413	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	protein_coding	OTTHUMT00000366375.1	A	NM_020227		23545367	1	no_errors	NM_020227	genbank	human	provisional	54_36p	missense	SNP	0.87	G
MTRR	4552	genome.wustl.edu	37	5	7885939	7885940	+	Nonsense_Mutation	DNP	GA	GA	AT			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	GA	GA	GA	AT	GA	GA	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr5:7885939_7885940GA>AT	ENST00000264668.2	+	7	1140_1141	c.1110_1111GA>AT	c.(1108-1113)ttGAaa>ttATaa	p.K371*	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Nonsense_Mutation_p.K344*	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	371	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	GCGTCCTTTTGAAAATAAAGGC	0.495																																																0			5																																								7938940	SO:0001587	stop_gained	4552			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	Exception_encountered	5.37:g.7885939_7885940delinsAT	ENSP00000264668:p.Lys371*		7938939	O60471|Q32MA9|Q7Z4M8	Nonsense_Mutation	DNP	HMMPfam_NAD_binding_1;HMMPfam_FAD_binding_1;HMMPfam_Flavodoxin_1;superfamily_Flavoproteins;superfamily_Ferredoxin reductase-like C-terminal NADP-linked domain;superfamily_Riboflavin synthase domain-like	p.KI371*	ENST00000264668.2	37	c.1110_1111	CCDS3874.1	5																																																																																			-	HMMPfam_FAD_binding_1		0.495	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	protein_coding	OTTHUMT00000206931.1	GA			7938940	1	no_errors	NM_024010	genbank	human	reviewed	54_36p	nonsense	DNP	0.278:0.003	AT
NIM1K	167359	genome.wustl.edu	37	5	43246058	43246058	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr5:43246058G>T	ENST00000512796.1	+	2	1680	c.181G>T	c.(181-183)Gtg>Ttg	p.V61L	NIM1_ENST00000326035.2_Missense_Mutation_p.V61L			Q8IY84	NIM1_HUMAN		61					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.V61L(1)									GGATGAGAAGGTGGTGAGGGA	0.562																																																1	Substitution - Missense(1)	ovary(1)	5											108.0	102.0	104.0					5																	43246058		2203	4300	6503	43281815	SO:0001583	missense	167359																														ENST00000512796.1:c.181G>T	5.37:g.43246058G>T	ENSP00000420849:p.Val61Leu		43281815	B3KVM1	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.V61L	ENST00000512796.1	37	c.181	CCDS3943.1	5	.	.	.	.	.	.	.	.	.	.	G	17.74	3.462779	0.63513	.	.	ENSG00000177453	ENST00000326035;ENST00000512796	T;T	0.71579	-0.58;-0.58	5.59	5.59	0.84812	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000001	T	0.63885	0.2549	L	0.51422	1.61	0.54753	D	0.999982	B	0.11235	0.004	B	0.11329	0.006	T	0.57670	-0.7771	9	.	.	.	.	12.8826	0.58026	0.074:0.0:0.926:0.0	.	61	Q8IY84	NIM1_HUMAN	L	61	ENSP00000313572:V61L;ENSP00000420849:V61L	.	V	+	1	0	AC114947.1	43281815	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.725000	0.68507	2.640000	0.89533	0.650000	0.86243	GTG	-	NULL		0.562	NIM1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGC42105	protein_coding	OTTHUMT00000368017.1	G			43281815	1	no_errors	NM_153361	genbank	human	provisional	54_36p	missense	SNP	1	T
CCNH	902	genome.wustl.edu	37	5	86690284	86690284	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr5:86690284G>C	ENST00000256897.4	-	9	1175	c.951C>G	c.(949-951)gaC>gaG	p.D317E	CCNH_ENST00000504878.1_Missense_Mutation_p.D243E|CCNH_ENST00000508855.1_3'UTR	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	317					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)	p.D317E(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		CTACCAGGTCGTCATCAGTCC	0.343								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																																								1	Substitution - Missense(1)	ovary(1)	5											99.0	97.0	98.0					5																	86690284		2203	4300	6503	86726040	SO:0001583	missense	902			U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.951C>G	5.37:g.86690284G>C	ENSP00000256897:p.Asp317Glu		86726040	Q53X72|Q8TBL9	Missense_Mutation	SNP	HMMPfam_Cyclin_N;superfamily_Cyclin-like	p.D317E	ENST00000256897.4	37	c.951	CCDS4064.1	5	.	.	.	.	.	.	.	.	.	.	G	4.546	0.101423	0.08731	.	.	ENSG00000134480	ENST00000256897;ENST00000504878	T;T	0.42900	0.96;0.96	5.17	-1.14	0.09741	.	0.590158	0.19205	N	0.120065	T	0.11965	0.0291	N	0.02158	-0.66	0.29585	N	0.848867	B	0.10296	0.003	B	0.09377	0.004	T	0.28681	-1.0036	10	0.10377	T	0.69	-5.5263	4.9598	0.14061	0.5119:0.0:0.2821:0.206	.	317	P51946	CCNH_HUMAN	E	317;243	ENSP00000256897:D317E;ENSP00000426075:D243E	ENSP00000256897:D317E	D	-	3	2	CCNH	86726040	0.007000	0.16637	0.989000	0.46669	0.952000	0.60782	-1.454000	0.02381	-0.139000	0.11414	-0.302000	0.09304	GAC	-	NULL		0.343	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNH	protein_coding	OTTHUMT00000239291.3	G	NM_001239		86726040	-1	no_errors	NM_001239	genbank	human	reviewed	54_36p	missense	SNP	0.99	C
C6orf89	221477	genome.wustl.edu	37	6	36887353	36887353	+	Splice_Site	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr6:36887353G>A	ENST00000480824.2	+	8	1119		c.e8-1		C6orf89_ENST00000359359.2_Splice_Site|C6orf89_ENST00000373685.1_Splice_Site|C6orf89_ENST00000355190.3_Splice_Site|C6orf89_ENST00000510325.2_Splice_Site			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89						epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.?(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						CTTTCCTCCAGATGCATAAGA	0.463																																																1	Unknown(1)	ovary(1)	6											113.0	109.0	110.0					6																	36887353		2203	4300	6503	36995331	SO:0001630	splice_region_variant	221477			AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.826-1G>A	6.37:g.36887353G>A			36995331	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Splice_Site	SNP	-	e7-1	ENST00000480824.2	37	c.847-1		6	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217199	0.79352	.	.	ENSG00000198663	ENST00000359359;ENST00000510325;ENST00000355190;ENST00000373685	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3795	0.83443	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C6orf89	36995331	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.411000	0.59781	2.941000	0.99782	0.655000	0.94253	.	-	-		0.463	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	C6orf89	protein_coding	OTTHUMT00000040387.2	G	NM_152734	Intron	36995331	1	no_errors	NM_152734	genbank	human	validated	54_36p	splice_site	SNP	1	A
GPRC6A	222545	genome.wustl.edu	37	6	117121828	117121828	+	Silent	SNP	A	A	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr6:117121828A>T	ENST00000310357.3	-	4	1488	c.1467T>A	c.(1465-1467)acT>acA	p.T489T	GPRC6A_ENST00000368549.3_Intron|GPRC6A_ENST00000530250.1_Silent_p.T314T	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	489					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.T489T(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CTGCCATCTTAGTGACAGTCA	0.403																																																1	Substitution - coding silent(1)	ovary(1)	6											216.0	188.0	197.0					6																	117121828		2203	4300	6503	117228521	SO:0001819	synonymous_variant	222545			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1467T>A	6.37:g.117121828A>T			117228521	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Silent	SNP	-	p.T489	ENST00000310357.3	37	c.1467	CCDS5112.1	6																																																																																			-	NULL		0.403	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	protein_coding	OTTHUMT00000041966.2	A			117228521	-1	no_errors	NM_148963	genbank	human	validated	54_36p	silent	SNP	0.6	T
KDELR2	11014	genome.wustl.edu	37	7	6509280	6509280	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr7:6509280C>T	ENST00000258739.4	-	3	482	c.298G>A	c.(298-300)Gtc>Atc	p.V100I	DAGLB_ENST00000436575.1_Intron|KDELR2_ENST00000490996.1_Missense_Mutation_p.V100I|KDELR2_ENST00000463747.1_Intron	NM_006854.3	NP_006845.1	P33947	ERD22_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2	100					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	KDEL sequence binding (GO:0005046)	p.V100I(1)		central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		CCCACAGGGACCACCAGAAAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	7											107.0	107.0	107.0					7																	6509280		2203	4300	6503	6475805	SO:0001583	missense	11014			X63745	CCDS5351.1, CCDS43550.1	7p	2008-05-02			ENSG00000136240	ENSG00000136240			6305	protein-coding gene	gene with protein product		609024				1316805, 1325562	Standard	NM_006854		Approved	ELP-1, ERD2.2	uc003sqe.4	P33947	OTTHUMG00000023103	ENST00000258739.4:c.298G>A	7.37:g.6509280C>T	ENSP00000258739:p.Val100Ile		6475805	A4D2P4|Q6IPC5|Q96E30	Missense_Mutation	SNP	HMMPfam_ER_lumen_recept	p.V100I	ENST00000258739.4	37	c.298	CCDS5351.1	7	.	.	.	.	.	.	.	.	.	.	C	17.98	3.520613	0.64747	.	.	ENSG00000136240	ENST00000258739;ENST00000490996	T	0.44881	0.91	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.32645	0.0836	N	0.10874	0.06	0.80722	D	1	B;B	0.27791	0.189;0.01	B;B	0.38683	0.279;0.042	T	0.10706	-1.0618	10	0.10377	T	0.69	-33.2673	20.0431	0.97598	0.0:1.0:0.0:0.0	.	100;100	P33947-2;P33947	.;ERD22_HUMAN	I	100	ENSP00000258739:V100I	ENSP00000258739:V100I	V	-	1	0	KDELR2	6475805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.730000	0.84881	2.811000	0.96726	0.557000	0.71058	GTC	-	HMMPfam_ER_lumen_recept		0.473	KDELR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELR2	protein_coding	OTTHUMT00000059424.2	C			6475805	-1	no_errors	NM_006854	genbank	human	reviewed	54_36p	missense	SNP	1	T
PXDNL	137902	genome.wustl.edu	37	8	52252290	52252290	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr8:52252290C>G	ENST00000356297.4	-	21	4140	c.4040G>C	c.(4039-4041)gGt>gCt	p.G1347A	PXDNL_ENST00000543296.1_Intron	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1347					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.G1347A(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGCATCTTCACCCACATATAT	0.343																																																1	Substitution - Missense(1)	ovary(1)	8											135.0	127.0	129.0					8																	52252290		1829	4073	5902	52414843	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4040G>C	8.37:g.52252290C>G	ENSP00000348645:p.Gly1347Ala		52414843	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	-	p.G1347A	ENST00000356297.4	37	c.4040	CCDS47855.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.861|8.861	0.947024|0.947024	0.18356|0.18356	.|.	.|.	ENSG00000147485|ENSG00000147485	ENST00000356297|ENST00000522933	T|.	0.62941|.	-0.01|.	5.0|5.0	-4.48|-4.48	0.03515|0.03515	.|.	.|.	.|.	.|.	.|.	T|T	0.17874|0.17874	0.0429|0.0429	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	B|.	0.16396|.	0.017|.	B|.	0.09377|.	0.004|.	T|T	0.32640|0.32640	-0.9899|-0.9899	9|5	0.09338|.	T|.	0.73|.	.|.	7.1905|7.1905	0.25822|0.25822	0.0:0.5128:0.1493:0.3378|0.0:0.5128:0.1493:0.3378	.|.	1347|.	A1KZ92|.	PXDNL_HUMAN|.	A|L	1347|421	ENSP00000348645:G1347A|.	ENSP00000348645:G1347A|.	G|V	-|-	2|1	0|0	PXDNL|PXDNL	52414843|52414843	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.673000|0.673000	0.39480|0.39480	-0.074000|-0.074000	0.11450|0.11450	-0.656000|-0.656000	0.05380|0.05380	0.591000|0.591000	0.81541|0.81541	GGT|GTG	-	NULL		0.343	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	C	NM_144651		52414843	-1	no_errors	NM_144651	genbank	human	validated	54_36p	missense	SNP		G
PHF20L1	51105	genome.wustl.edu	37	8	133851828	133851828	+	Splice_Site	SNP	G	G	A			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr8:133851828G>A	ENST00000395386.2	+	18	2686		c.e18+1		PHF20L1_ENST00000395390.2_Splice_Site|AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000220847.7_Splice_Site|AF230666.2_ENST00000608375.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1								zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GAATACTAAAGTAAGTGAAGG	0.438																																																1	Unknown(1)	ovary(1)	8											83.0	75.0	77.0					8																	133851828		1905	4117	6022	133921010	SO:0001630	splice_region_variant	51105			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2387+1G>A	8.37:g.133851828G>A			133921010	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Splice_Site	SNP	-	e17+1	ENST00000395386.2	37	c.2387+1	CCDS6367.2	8	.	.	.	.	.	.	.	.	.	.	G	19.95	3.922016	0.73213	.	.	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1918	0.89809	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHF20L1	133921010	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	9.476000	0.97823	2.552000	0.86080	0.655000	0.94253	.	-	-		0.438	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	protein_coding	OTTHUMT00000308949.3	G	NM_016018	Intron	133921010	1	no_errors	NM_016018	genbank	human	validated	54_36p	splice_site	SNP	1	A
TLE4	7091	genome.wustl.edu	37	9	82319728	82319728	+	Nonsense_Mutation	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr9:82319728C>T	ENST00000376552.2	+	9	1658	c.640C>T	c.(640-642)Cga>Tga	p.R214*	TLE4_ENST00000376537.4_Nonsense_Mutation_p.R214*|TLE4_ENST00000376534.4_5'UTR|TLE4_ENST00000376520.4_Nonsense_Mutation_p.R214*|TLE4_ENST00000376544.3_Nonsense_Mutation_p.R214*|TLE4_ENST00000265284.6_Nonsense_Mutation_p.R189*	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	214	CCN domain.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)	p.R214*(2)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						AGCCAGTTTCCGAGGTGCTGA	0.423																																																2	Substitution - Nonsense(2)	upper_aerodigestive_tract(1)|ovary(1)	9											163.0	161.0	161.0					9																	82319728		1851	4100	5951	81509548	SO:0001587	stop_gained	7091			M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.640C>T	9.37:g.82319728C>T	ENSP00000365735:p.Arg214*		81509548	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Nonsense_Mutation	SNP	HMMPfam_WD40;HMMPfam_TLE_N;superfamily_WD40 repeat-like	p.R214*	ENST00000376552.2	37	c.640	CCDS43837.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.318466|8.318466	0.98757|0.98757	.|.	.|.	ENSG00000106829|ENSG00000106829	ENST00000496114|ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000265284;ENST00000428713;ENST00000490347;ENST00000467142	.|.	.|.	.|.	5.92|5.92	4.96|4.96	0.65561|0.65561	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.33411|.	0.0862|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.16394|.	-1.0404|.	5|.	0.87932|0.02654	D|T	0|1	-11.1033|-11.1033	11.6575|11.6575	0.51325|0.51325	0.3797:0.6203:0.0:0.0|0.3797:0.6203:0.0:0.0	.|.	.|.	.|.	.|.	L|X	4|214;214;214;214;189;199;84;11	.|.	ENSP00000417715:P257L|ENSP00000265284:R189X	P|R	+|+	2|1	0|2	TLE4|TLE4	81509548|81509548	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.321000|3.321000	0.51999|0.51999	2.813000|2.813000	0.96785|0.96785	0.561000|0.561000	0.74099|0.74099	CCG|CGA	-	NULL		0.423	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	protein_coding	OTTHUMT00000052792.4	C	XM_212237		81509548	1	no_errors	NM_007005	genbank	human	validated	54_36p	nonsense	SNP	1	T
RAD23B	5887	genome.wustl.edu	37	9	110081063	110081063	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chr9:110081063C>T	ENST00000358015.3	+	6	935	c.584C>T	c.(583-585)aCt>aTt	p.T195I	RAD23B_ENST00000416373.2_Missense_Mutation_p.T123I	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	195	UBA 1. {ECO:0000255|PROSITE- ProRule:PRU00212}.				DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)	p.T195I(1)		breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						AATATGGTAACTGAGATCATG	0.408								Direct reversal of damage;Nucleotide excision repair (NER)																																								1	Substitution - Missense(1)	ovary(1)	9											143.0	137.0	139.0					9																	110081063		2203	4300	6503	109120884	SO:0001583	missense	5887				CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.584C>T	9.37:g.110081063C>T	ENSP00000350708:p.Thr195Ile		109120884	B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	HMMPfam_UBA;HMMPfam_ubiquitin;superfamily_UBA-like;HMMPfam_XPC-binding;superfamily_XPC-binding domain;superfamily_Ubiquitin-like	p.T195I	ENST00000358015.3	37	c.584	CCDS6769.1	9	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485282	0.84854	.	.	ENSG00000119318	ENST00000358015;ENST00000374678;ENST00000416373	T;T	0.22134	1.97;1.97	4.87	4.87	0.63330	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.049352	0.85682	D	0.000000	T	0.49372	0.1553	M	0.82056	2.57	0.58432	D	0.999992	D;P;P	0.71674	0.998;0.823;0.888	D;P;P	0.67382	0.951;0.847;0.815	T	0.55309	-0.8161	10	0.62326	D	0.03	-16.4193	18.3721	0.90411	0.0:1.0:0.0:0.0	.	174;195;195	B7Z4W4;B4DEA3;P54727	.;.;RD23B_HUMAN	I	195;123;123	ENSP00000350708:T195I;ENSP00000405623:T123I	ENSP00000350708:T195I	T	+	2	0	RAD23B	109120884	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.842000	0.55858	2.412000	0.81896	0.561000	0.74099	ACT	-	HMMPfam_UBA		0.408	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD23B	protein_coding	OTTHUMT00000053548.1	C	NM_002874		109120884	1	no_errors	NM_002874	genbank	human	reviewed	54_36p	missense	SNP	1	T
ASB12	142689	genome.wustl.edu	37	X	63445178	63445178	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chrX:63445178T>C	ENST00000396130.2	-	1	325	c.326A>G	c.(325-327)cAt>cGt	p.H109R	ASB12_ENST00000362002.2_Missense_Mutation_p.H118R|MTMR8_ENST00000453546.1_Missense_Mutation_p.H493R			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	109					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)|p.H109R(1)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						ACAGTCCAGATGGCCATGACT	0.532																																																3	Whole gene deletion(2)|Substitution - Missense(1)	ovary(2)|large_intestine(1)	X											112.0	65.0	81.0					X																	63445178		2203	4300	6503	63361903	SO:0001583	missense	142689			AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.326A>G	X.37:g.63445178T>C	ENSP00000379435:p.His109Arg		63361903	J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	-	p.H109R	ENST00000396130.2	37	c.326		X	.	.	.	.	.	.	.	.	.	.	T	15.11	2.737538	0.49045	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.65732	-0.17;-0.17;-0.17	4.0	4.0	0.46444	Ankyrin repeat-containing domain (4);	0.053700	0.85682	D	0.000000	T	0.47967	0.1474	L	0.33753	1.03	0.24345	N	0.994949	B;B	0.15719	0.014;0.005	B;B	0.19391	0.025;0.017	T	0.43702	-0.9375	10	0.56958	D	0.05	-10.0207	6.9421	0.24498	0.0:0.1136:0.0:0.8864	.	493;109	B4DQL0;Q8WXK4	.;ASB12_HUMAN	R	118;109;118;493	ENSP00000355195:H118R;ENSP00000379435:H109R;ENSP00000394003:H493R	ENSP00000354626:H118R	H	-	2	0	ASB12;MTMR8	63361903	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.485000	0.66850	1.595000	0.50050	0.381000	0.24937	CAT	-	NULL		0.532	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	ASB12	protein_coding		T			63361903	-1	no_errors	NM_130388	genbank	human	reviewed	54_36p	missense	SNP	1	C
CYLC1	1538	genome.wustl.edu	37	X	83128243	83128243	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chrX:83128243A>T	ENST00000329312.4	+	4	564	c.527A>T	c.(526-528)aAa>aTa	p.K176I		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	176					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K175I(1)		NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AAGAAGTCAAAATCCAGTTCA	0.313																																																1	Substitution - Missense(1)	ovary(1)	X											26.0	26.0	26.0					X																	83128243		2186	4254	6440	83014899	SO:0001583	missense	1538			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.527A>T	X.37:g.83128243A>T	ENSP00000331556:p.Lys176Ile		83014899	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	-	p.K176I	ENST00000329312.4	37	c.527	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	a	11.02	1.517141	0.27123	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.51817	0.69	4.11	1.52	0.23074	.	.	.	.	.	T	0.34077	0.0885	L	0.42245	1.32	0.09310	N	1	P;P	0.37955	0.612;0.612	B;B	0.35470	0.203;0.203	T	0.20472	-1.0274	9	0.51188	T	0.08	0.022	3.8731	0.09045	0.5589:0.2225:0.0:0.2186	.	176;176	P35663;F5H4V5	CYLC1_HUMAN;.	I	176	ENSP00000331556:K176I	ENSP00000331556:K176I	K	+	2	0	CYLC1	83014899	0.739000	0.28196	0.001000	0.08648	0.002000	0.02628	1.684000	0.37649	0.178000	0.19917	0.486000	0.48141	AAA	-	NULL		0.313	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	protein_coding	OTTHUMT00000057371.1	A	NM_021118		83014899	1	no_errors	NM_021118	genbank	human	provisional	54_36p	missense	SNP	0.01	T
PRRG3	79057	genome.wustl.edu	37	X	150869191	150869191	+	Missense_Mutation	SNP	A	A	T	rs138478062		TCGA-13-1411-01A-01W-0494-09	TCGA-13-1411-10A-01W-0495-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	e254d7f4-1edf-4054-9ca6-9fe058a05484	315fa173-8011-466c-abbc-72c2044a6835	g.chrX:150869191A>T	ENST00000370353.3	+	4	772	c.382A>T	c.(382-384)Acc>Tcc	p.T128S	PRRG3_ENST00000538575.1_Missense_Mutation_p.T128S|PRRG3_ENST00000370354.1_3'UTR			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	128						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.T128S(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					CGCCGGGCACACCCTCCCCCG	0.652																																																1	Substitution - Missense(1)	ovary(1)	X											65.0	67.0	66.0					X																	150869191		2203	4300	6503	150619847	SO:0001583	missense	79057			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.382A>T	X.37:g.150869191A>T	ENSP00000359378:p.Thr128Ser		150619847	A1A523|A1A575|Q8N2N6	Missense_Mutation	SNP	-	p.T128S	ENST00000370353.3	37	c.382	CCDS14699.1	X	.	.	.	.	.	.	.	.	.	.	A	4.279	0.050960	0.08243	.	.	ENSG00000130032	ENST00000538575;ENST00000370353	D;D	0.97941	-4.62;-4.62	4.65	4.65	0.58169	.	0.470429	0.21916	N	0.067230	D	0.87775	0.6262	N	0.00926	-1.1	0.20821	N	0.999845	B	0.02656	0.0	B	0.01281	0.0	T	0.76979	-0.2758	10	0.02654	T	1	-9.7802	9.7924	0.40715	1.0:0.0:0.0:0.0	.	128	Q9BZD7	TMG3_HUMAN	S	128	ENSP00000440217:T128S;ENSP00000359378:T128S	ENSP00000359378:T128S	T	+	1	0	PRRG3	150619847	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.015000	0.64035	1.646000	0.50622	0.430000	0.28490	ACC	-	NULL		0.652	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	protein_coding	OTTHUMT00000060880.1	A	NM_024082		150619847	1	no_errors	NM_024082	genbank	human	provisional	54_36p	missense	SNP	0.99	T
