#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLC22A15	55356	genome.wustl.edu	37	1	116562264	116562264	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:116562264G>C	ENST00000369503.4	+	3	492	c.362G>C	c.(361-363)gGt>gCt	p.G121A	RP11-159M11.2_ENST00000453128.1_RNA|SLC22A15_ENST00000369502.1_Missense_Mutation_p.G121A	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	121					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)	p.G121A(1)		endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TTCTTCAGTGGTGTATTTGTT	0.373																																																1	Substitution - Missense(1)	ovary(1)	1											189.0	157.0	167.0					1																	116562264		1831	4089	5920	116363787	SO:0001583	missense	55356			AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.362G>C	1.37:g.116562264G>C	ENSP00000358515:p.Gly121Ala		116363787	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	-	p.G109A	ENST00000369503.4	37	c.326	CCDS44198.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399695	0.83120	.	.	ENSG00000163393	ENST00000369503;ENST00000369502	T;T	0.81247	-1.47;0.29	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.100470	0.64402	D	0.000002	D	0.90563	0.7042	M	0.90483	3.12	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.992	D	0.92050	0.5647	10	0.87932	D	0	.	16.8965	0.86102	0.0:0.0:1.0:0.0	.	121;121	Q8IZD6;Q8IZD6-2	S22AF_HUMAN;.	A	121	ENSP00000358515:G121A;ENSP00000358514:G121A	ENSP00000358514:G121A	G	+	2	0	SLC22A15	116363787	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	7.373000	0.79623	2.640000	0.89533	0.655000	0.94253	GGT	-	NULL		0.373	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A15	protein_coding	OTTHUMT00000033220.2	G	NM_018420		116363787	1	no_errors	NM_018420	genbank	human	validated	54_36p	missense	SNP	1	C
GDAP2	54834	genome.wustl.edu	37	1	118420630	118420630	+	Splice_Site	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:118420630C>T	ENST00000369443.5	-	13	1696		c.e13+1		GDAP2_ENST00000369442.3_Missense_Mutation_p.V483I	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2						response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)		p.?(1)		kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		GTACTTCTTACCCTGGCATCA	0.433																																																1	Unknown(1)	ovary(1)	1											123.0	114.0	117.0					1																	118420630		2203	4300	6503	118222153	SO:0001630	splice_region_variant	54834			AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.1446+1G>A	1.37:g.118420630C>T			118222153	Q96DZ0	Splice_Site	SNP	-	e12+1	ENST00000369443.5	37	c.1446+1	CCDS897.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.5|23.5	4.417846|4.417846	0.83449|0.83449	.|.	.|.	ENSG00000196505|ENSG00000196505	ENST00000369443|ENST00000369442	.|T	.|0.37058	.|1.22	4.83|4.83	4.83|4.83	0.62350|0.62350	.|.	.|.	.|.	.|.	.|.	.|T	.|0.16938	.|0.0407	.|.	.|.	.|.	0.34437|0.34437	D|D	0.699232|0.699232	.|B	.|0.33238	.|0.403	.|B	.|0.39738	.|0.308	.|T	.|0.05289	.|-1.0894	.|8	.|0.12103	.|T	.|0.63	.|.	16.6339|16.6339	0.85041|0.85041	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|483	.|Q9NXN4-2	.|.	.|I	-1|483	.|ENSP00000358450:V483I	.|ENSP00000358450:V483I	.|V	-|-	.|1	.|0	GDAP2|GDAP2	118222153|118222153	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	6.965000|6.965000	0.76067|0.76067	2.668000|2.668000	0.90789|0.90789	0.655000|0.655000	0.94253|0.94253	.|GTA	-	-		0.433	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP2	protein_coding	OTTHUMT00000033732.2	C	NM_017686	Intron	118222153	-1	no_errors	NM_017686	genbank	human	validated	54_36p	splice_site	SNP	1	T
HORMAD1	84072	genome.wustl.edu	37	1	150680808	150680808	+	Silent	SNP	A	A	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:150680808A>T	ENST00000361824.2	-	9	576	c.471T>A	c.(469-471)atT>atA	p.I157I	HORMAD1_ENST00000322343.7_Silent_p.I150I|HORMAD1_ENST00000368993.2_Silent_p.I157I|HORMAD1_ENST00000368995.4_Silent_p.I77I	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	157	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)		p.I157I(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			TTAGGATATAAATCTTGCGAA	0.343																																																1	Substitution - coding silent(1)	ovary(1)	1											121.0	117.0	119.0					1																	150680808		2203	4300	6503	148947432	SO:0001819	synonymous_variant	84072			AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.471T>A	1.37:g.150680808A>T			148947432	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Silent	SNP	-	p.I157	ENST00000361824.2	37	c.471	CCDS967.1	1																																																																																			-	NULL		0.343	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HORMAD1	protein_coding	OTTHUMT00000084722.1	A	NM_032132		148947432	-1	no_errors	NM_032132	genbank	human	provisional	54_36p	silent	SNP	1	T
FLG	2312	genome.wustl.edu	37	1	152279337	152279337	+	Silent	SNP	A	A	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:152279337A>G	ENST00000368799.1	-	3	8060	c.8025T>C	c.(8023-8025)gcT>gcC	p.A2675A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2675	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.A2675A(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCAGATGAAGCTTGTCCGT	0.537									Ichthyosis																																							1	Substitution - coding silent(1)	ovary(1)	1											4.0	5.0	5.0					1																	152279337		968	2230	3198	150545961	SO:0001819	synonymous_variant	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8025T>C	1.37:g.152279337A>G			150545961	Q01720|Q5T583|Q9UC71	Silent	SNP	-	p.A2675	ENST00000368799.1	37	c.8025	CCDS30860.1	1																																																																																			-	NULL		0.537	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	protein_coding	OTTHUMT00000033742.1	A	NM_002016		150545961	-1	no_errors	NM_002016	genbank	human	provisional	54_36p	silent	SNP	0	G
KPRP	448834	genome.wustl.edu	37	1	152733725	152733725	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:152733725G>A	ENST00000606109.1	+	1	1689	c.1661G>A	c.(1660-1662)cGg>cAg	p.R554Q	KPRP_ENST00000368773.1_Missense_Mutation_p.R554Q			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	554						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)		p.R554Q(2)		NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTCCAGAGCGGAGGGGTCAG	0.542																																																2	Substitution - Missense(2)	ovary(2)	1											77.0	71.0	73.0					1																	152733725		2203	4300	6503	151000349	SO:0001583	missense	448834			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1661G>A	1.37:g.152733725G>A	ENSP00000475216:p.Arg554Gln		151000349		Missense_Mutation	SNP	-	p.R554Q	ENST00000606109.1	37	c.1661	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	G	9.382	1.073284	0.20147	.	.	ENSG00000203786	ENST00000368773	T	0.11604	2.76	3.93	3.0	0.34707	.	0.412789	0.17984	N	0.155435	T	0.01523	0.0049	N	0.08118	0	0.09310	N	1	B	0.31274	0.317	B	0.23574	0.047	T	0.45991	-0.9223	10	0.30078	T	0.28	-0.1704	9.6976	0.40167	0.0:0.7826:0.2174:0.0	.	554	Q5T749	KPRP_HUMAN	Q	554	ENSP00000357762:R554Q	ENSP00000357762:R554Q	R	+	2	0	KPRP	151000349	0.002000	0.14202	0.078000	0.20375	0.043000	0.13939	0.661000	0.25023	1.013000	0.39391	-0.802000	0.03209	CGG	-	NULL		0.542	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	protein_coding	OTTHUMT00000034522.2	G	NM_001025231		151000349	1	no_errors	NM_001025231	genbank	human	provisional	54_36p	missense	SNP	0.01	A
AK2	204	genome.wustl.edu	37	1	33478791	33478791	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:33478791C>G	ENST00000354858.6	-	6	874	c.711G>C	c.(709-711)atG>atC	p.M237I	RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000548033.1_Intron|AK2_ENST00000373449.2_Intron|AK2_ENST00000480134.1_3'UTR|AK2_ENST00000491241.1_Intron|AK2_ENST00000467905.1_Intron	NM_001625.3	NP_001616.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				ATTAGATAAACATAACCAAGT	0.507																																																0			1											128.0	121.0	123.0					1																	33478791		2203	4300	6503	33251378	SO:0001583	missense	204			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000354858.6:c.711G>C	1.37:g.33478791C>G	ENSP00000346921:p.Met237Ile		33251378		Missense_Mutation	SNP	"HMMPfam_ADK;HMMPfam_ADK_lid;superfamily_P-loop containing nucleoside triphosphate hydrolases;superfamily_Microbial and mitochondrial ADK insert ""zinc finger"" domain"	p.M237I	ENST00000354858.6	37	c.711	CCDS374.1	1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.545079	0.27652	.	.	ENSG00000004455	ENST00000354858	T	0.75477	-0.94	5.51	4.58	0.56647	.	0.301150	0.39985	N	0.001206	T	0.57873	0.2083	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52571	-0.8558	10	0.09843	T	0.71	-20.8194	15.3658	0.74519	0.0:0.9293:0.0:0.0707	.	237	P54819	KAD2_HUMAN	I	237	ENSP00000346921:M237I	ENSP00000346921:M237I	M	-	3	0	AK2	33251378	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.472000	0.45136	2.758000	0.94735	0.563000	0.77884	ATG	-	NULL		0.507	AK2-001	KNOWN	basic|CCDS	protein_coding	AK2	protein_coding	OTTHUMT00000011883.1	C	NM_001625		33251378	-1	no_errors	NM_001625	genbank	human	reviewed	54_36p	missense	SNP	1	G
CLCA2	9635	genome.wustl.edu	37	1	86900279	86900279	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:86900279G>T	ENST00000370565.4	+	6	985	c.823G>T	c.(823-825)Gca>Tca	p.A275S		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	275					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)	p.A275S(1)		NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		CCTCAGAAGTGCATGGGATGT	0.468																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)											1	Substitution - Missense(1)	ovary(1)	1											182.0	159.0	167.0					1																	86900279		2203	4300	6503	86672867	SO:0001583	missense	9635				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.823G>T	1.37:g.86900279G>T	ENSP00000359596:p.Ala275Ser		86672867	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	HMMPfam_VWA;HMMPfam_CLCA_N;HMMPfam_DUF1973;superfamily_vWA-like	p.A275S	ENST00000370565.4	37	c.823	CCDS708.1	1	.	.	.	.	.	.	.	.	.	.	G	19.34	3.809768	0.70797	.	.	ENSG00000137975	ENST00000370565	T	0.03413	3.94	6.17	-8.62	0.00881	.	0.235345	0.40908	D	0.000993	T	0.01421	0.0046	L	0.59436	1.845	0.09310	N	1	B	0.13594	0.008	B	0.14023	0.01	T	0.33137	-0.9880	10	0.56958	D	0.05	0.311	14.9811	0.71311	0.78:0.0:0.1353:0.0847	.	275	Q9UQC9	CLCA2_HUMAN	S	275	ENSP00000359596:A275S	ENSP00000359596:A275S	A	+	1	0	CLCA2	86672867	0.442000	0.25633	0.000000	0.03702	0.753000	0.42808	0.807000	0.27140	-1.646000	0.01513	-0.136000	0.14681	GCA	-	NULL		0.468	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA2	protein_coding	OTTHUMT00000028284.1	G	NM_006536		86672867	1	no_errors	NM_006536	genbank	human	reviewed	54_36p	missense	SNP	0.74	T
NLRP3	114548	genome.wustl.edu	37	1	247599443	247599443	+	Splice_Site	SNP	G	G	C			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:247599443G>C	ENST00000336119.3	+	6	3415		c.e6+1		NLRP3_ENST00000391828.3_Splice_Site|NLRP3_ENST00000366497.2_Intron|NLRP3_ENST00000391827.2_Splice_Site|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000366496.2_Intron	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.?(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGAAACTGGGGTAAGTCTTCA	0.448																																																1	Unknown(1)	ovary(1)	1											71.0	68.0	69.0					1																	247599443		2203	4300	6503	245666066	SO:0001630	splice_region_variant	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2669+1G>C	1.37:g.247599443G>C			245666066	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Splice_Site	SNP	-	e6+1	ENST00000336119.3	37	c.2669+1	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	G	8.567	0.879210	0.17395	.	.	ENSG00000162711	ENST00000391828;ENST00000336119;ENST00000391827	.	.	.	3.63	3.63	0.41609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1784	0.48614	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NLRP3	245666066	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	5.530000	0.67141	2.347000	0.79759	0.536000	0.68110	.	-	-		0.448	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	protein_coding	OTTHUMT00000097740.1	G	NM_004895	Intron	245666066	1	no_errors	NM_001079821	genbank	human	reviewed	54_36p	splice_site	SNP	1	C
FAM171A1	221061	genome.wustl.edu	37	10	15256365	15256365	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr10:15256365C>A	ENST00000378116.4	-	8	1228	c.1222G>T	c.(1222-1224)Ggg>Tgg	p.G408W	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	408						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G408W(1)		breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TGCAGGTCCCCTTCGCCGCCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	10											59.0	63.0	62.0					10																	15256365		2203	4300	6503	15296371	SO:0001583	missense	221061			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.1222G>T	10.37:g.15256365C>A	ENSP00000367356:p.Gly408Trp		15296371	D3DRT9|Q32M49|Q8N4I0	Missense_Mutation	SNP	-	p.G408W	ENST00000378116.4	37	c.1222	CCDS31154.1	10	.	.	.	.	.	.	.	.	.	.	C	11.41	1.629998	0.28978	.	.	ENSG00000148468	ENST00000378116;ENST00000396781	T	0.31769	1.48	5.14	5.14	0.70334	.	0.539387	0.20787	N	0.085682	T	0.36220	0.0959	N	0.22421	0.69	0.24342	N	0.994953	P	0.51537	0.946	P	0.53722	0.733	T	0.17837	-1.0356	10	0.46703	T	0.11	-8.9253	18.8133	0.92068	0.0:1.0:0.0:0.0	.	408	Q5VUB5	F1711_HUMAN	W	408;409	ENSP00000367356:G408W	ENSP00000367356:G408W	G	-	1	0	FAM171A1	15296371	0.895000	0.30542	0.088000	0.20740	0.169000	0.22640	3.519000	0.53458	2.667000	0.90743	0.563000	0.77884	GGG	-	NULL		0.617	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	protein_coding	OTTHUMT00000046984.1	C	XM_167709		15296371	-1	no_errors	NM_001010924	genbank	human	validated	54_36p	missense	SNP	0.71	A
BICC1	80114	genome.wustl.edu	37	10	60560712	60560713	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	GG	GG	GG	TT	GG	GG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr10:60560712_60560713GG>TT	ENST00000373886.3	+	14	1925_1926	c.1921_1922GG>TT	c.(1921-1923)GGt>TTt	p.G641F	BICC1_ENST00000263103.1_Missense_Mutation_p.G267F	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	641					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TGGGAATGCTGGTGACTTGAAA	0.436																																																0			10																																								60230719	SO:0001583	missense	80114			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	Exception_encountered	10.37:g.60560712_60560713delinsTT	ENSP00000362993:p.Gly641Phe		60230718		Missense_Mutation	DNP	-	p.G641F	ENST00000373886.3	37	c.1921_1922	CCDS31206.1	10																																																																																			-	NULL		0.436	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	protein_coding	OTTHUMT00000048150.2	GG	NM_025044		60230719	1	no_errors	NM_001080512	genbank	human	provisional	54_36p	missense	DNP	0.997:0.984	TT
ENTPD7	57089	genome.wustl.edu	37	10	101439150	101439150	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr10:101439150C>A	ENST00000370489.4	+	4	502	c.324C>A	c.(322-324)aaC>aaA	p.N108K		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	108						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.N108K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		ATAATGGGAACCCCCATGACT	0.428																																																1	Substitution - Missense(1)	ovary(1)	10											87.0	88.0	87.0					10																	101439150		2203	4300	6503	101429140	SO:0001583	missense	57089			AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.324C>A	10.37:g.101439150C>A	ENSP00000359520:p.Asn108Lys		101429140	B2RB83|B3KP21|D3DR64	Missense_Mutation	SNP	HMMPfam_GDA1_CD39	p.N108K	ENST00000370489.4	37	c.324	CCDS7480.1	10	.	.	.	.	.	.	.	.	.	.	C	14.59	2.581714	0.46006	.	.	ENSG00000198018	ENST00000370489	T	0.15718	2.4	5.26	2.38	0.29361	.	0.048136	0.85682	D	0.000000	T	0.20251	0.0487	L	0.46157	1.445	0.43107	D	0.994808	P	0.35307	0.494	P	0.44673	0.457	T	0.03555	-1.1025	10	0.33940	T	0.23	-25.7313	9.7089	0.40233	0.0:0.7115:0.0:0.2885	.	108	Q9NQZ7	ENTP7_HUMAN	K	108	ENSP00000359520:N108K	ENSP00000359520:N108K	N	+	3	2	ENTPD7	101429140	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.083000	0.30815	0.801000	0.34066	0.655000	0.94253	AAC	-	HMMPfam_GDA1_CD39		0.428	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD7	protein_coding	OTTHUMT00000049809.2	C	NM_020354		101429140	1	no_errors	NM_020354	genbank	human	validated	54_36p	missense	SNP	1	A
TRIM49B	283116	genome.wustl.edu	37	11	49053317	49053317	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr11:49053317A>C	ENST00000332682.7	+	2	194	c.166A>C	c.(166-168)Aca>Cca	p.T56P		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	56						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						CTCTGAATGCACAAAGTCAAC	0.463																																																0			11																																								49009893	SO:0001583	missense	283116				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.166A>C	11.37:g.49053317A>C	ENSP00000330216:p.Thr56Pro		49009893		Missense_Mutation	SNP	-	p.T56P	ENST00000332682.7	37	c.166	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	A	10.14	1.269165	0.23221	.	.	ENSG00000182053	ENST00000332682	D	0.84146	-1.81	0.49	0.49	0.16861	.	.	.	.	.	T	0.72763	0.3501	N	0.14661	0.345	0.20638	N	0.999878	.	.	.	.	.	.	T	0.64964	-0.6283	7	0.87932	D	0	.	5.2664	0.15601	0.9999:0.0:1.0E-4:0.0	.	.	.	.	P	56	ENSP00000330216:T56P	ENSP00000330216:T56P	T	+	1	0	AC084851.1	49009893	0.732000	0.28121	0.006000	0.13384	0.005000	0.04900	1.162000	0.31786	0.430000	0.26230	0.155000	0.16302	ACA	-	NULL		0.463	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC283116	protein_coding		A			49009893	1	no_errors	XM_208043	genbank	human	model	54_36p	missense	SNP	0.65	C
SLC22A12	116085	genome.wustl.edu	37	11	64359149	64359171	+	Frame_Shift_Del	DEL	TCGGCCGCCGTGCCCAGCCACCG	TCGGCCGCCGTGCCCAGCCACCG	-	rs148378818|rs200499531|rs144313367|rs3802948	byFrequency	TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	TCGGCCGCCGTGCCCAGCCACCG	TCGGCCGCCGTGCCCAGCCACCG	TCGGCCGCCGTGCCCAGCCACCG	-	TCGGCCGCCGTGCCCAGCCACCG	TCGGCCGCCGTGCCCAGCCACCG	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr11:64359149_64359171delTCGGCCGCCGTGCCCAGCCACCG	ENST00000377574.1	+	1	868_890	c.121_143delTCGGCCGCCGTGCCCAGCCACCG	c.(121-144)tcggccgccgtgcccagccaccgcfs	p.SAAVPSHR41fs	SLC22A12_ENST00000377567.2_Frame_Shift_Del_p.SAAVPSHR41fs|SLC22A12_ENST00000473690.1_5'UTR|SLC22A12_ENST00000336464.7_Frame_Shift_Del_p.SAAVPSHR41fs|SLC22A12_ENST00000377572.1_Frame_Shift_Del_p.SAAVPSHR41fs	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	41					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)	p.S41L(1)|p.S41fs*22(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	GGAGAACTTCTCGGCCGCCGTGCCCAGCCACCGCTGCTGGGCA	0.65																																																2	Substitution - Missense(1)|Deletion - Frameshift(1)	ovary(1)|skin(1)	11																																								64115747	SO:0001589	frameshift_variant	116085			AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.121_143delTCGGCCGCCGTGCCCAGCCACCG	11.37:g.64359149_64359171delTCGGCCGCCGTGCCCAGCCACCG	ENSP00000366797:p.Ser41fs		64115725	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Frame_Shift_Del	DEL	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.S41fs	ENST00000377574.1	37	c.121_143	CCDS8075.1	11																																																																																			(deletion:cds_exon[64115605;64116006])	NULL		0.650	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A12	protein_coding	OTTHUMT00000104966.2	TCGGCCGCCGTGCCCAGCCACCG	NM_144585		64115747	1	no_errors	NM_144585	genbank	human	reviewed	54_36p	frame_shift_del	DEL	0.998:0.996:0.987:0.993:0.953:0.668:0.677:0.636:0.570:0.906:0.968:0.970:0.997:0.994:0.765:0.719:0.719:0.758:0.997:1.000:0.998:1.000:1.000	-
KRT2	3849	genome.wustl.edu	37	12	53041563	53041563	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr12:53041563T>C	ENST00000309680.3	-	6	1220	c.1199A>G	c.(1198-1200)aAc>aGc	p.N400S		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	400	Coil 2.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.N400S(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		GATCACGCGGTTCAGCTCGCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	12											100.0	67.0	78.0					12																	53041563		2203	4300	6503	51327830	SO:0001583	missense	3849				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.1199A>G	12.37:g.53041563T>C	ENSP00000310861:p.Asn400Ser		51327830	Q4VAQ2	Missense_Mutation	SNP	HMMPfam_Filament;superfamily_Prefoldin	p.N400S	ENST00000309680.3	37	c.1199	CCDS8835.1	12	.	.	.	.	.	.	.	.	.	.	T	14.04	2.418012	0.42918	.	.	ENSG00000172867	ENST00000309680	D	0.89123	-2.47	4.89	4.89	0.63831	Filament (1);	.	.	.	.	D	0.95191	0.8441	M	0.93106	3.38	0.32810	D	0.501337	D	0.76494	0.999	D	0.78314	0.991	D	0.96600	0.9444	9	0.62326	D	0.03	.	11.3211	0.49421	0.0:0.0:0.1976:0.8024	.	400	P35908	K22E_HUMAN	S	400	ENSP00000310861:N400S	ENSP00000310861:N400S	N	-	2	0	KRT2	51327830	0.997000	0.39634	1.000000	0.80357	0.040000	0.13550	0.735000	0.26115	1.977000	0.57605	0.455000	0.32223	AAC	-	HMMPfam_Filament		0.582	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	protein_coding	OTTHUMT00000405704.1	T	NM_000423		51327830	-1	no_errors	NM_000423	genbank	human	reviewed	54_36p	missense	SNP	1	C
TMBIM4	51643	genome.wustl.edu	37	12	66546129	66546129	+	Silent	SNP	G	G	A	rs201499761		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr12:66546129G>A	ENST00000358230.3	-	3	354	c.234C>T	c.(232-234)ctC>ctT	p.L78L	TMBIM4_ENST00000556010.1_Silent_p.L78L|TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000542724.1_Silent_p.L47L|TMBIM4_ENST00000539652.1_Silent_p.L78L|TMBIM4_ENST00000286424.7_Silent_p.L125L|TMBIM4_ENST00000398033.4_Silent_p.L78L	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	78					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)		p.L78L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		CCAGAGATCCGAGGGCAAACA	0.328													G|||	1	0.000199681	0.0	0.0	5008	,	,		13603	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	12						G		1,3653		0,1,1826	85.0	81.0	82.0		234	-8.7	0.0	12		82	0,8160		0,0,4080	no	coding-synonymous	TMBIM4	NM_016056.2		0,1,5906	AA,AG,GG		0.0,0.0274,0.0085		78/239	66546129	1,11813	1827	4080	5907	64832396	SO:0001819	synonymous_variant	51643			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.234C>T	12.37:g.66546129G>A			64832396	Q542Z6|Q9UHY5|Q9Y3C2	Silent	SNP	-	p.L78	ENST00000358230.3	37	c.234	CCDS41805.1	12																																																																																			-	NULL		0.328	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMBIM4	protein_coding	OTTHUMT00000401832.2	G	NM_016056		64832396	-1	no_errors	NM_016056	genbank	human	validated	54_36p	silent	SNP	0.93	A
RP11-274B21.1	0	genome.wustl.edu	37	7	128218044	128218044	+	RNA	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:128218044G>A	ENST00000605862.1	+	0	261																											AGAATGATCAGCGAAATCGGA	0.328																																																0			7																																								128005280			100128729																															7.37:g.128218044G>A			128005280		RNA	SNP	-	NULL	ENST00000605862.1	37	NULL		7																																																																																			-	-		0.328	RP11-274B21.1-002	KNOWN	basic	processed_transcript	LOC100128729	pseudogene	OTTHUMT00000468355.1	G			128005280	1	pseudogene	XR_042327	genbank	human	model	54_36p	rna	SNP	1	A
FLNC	2318	genome.wustl.edu	37	7	128493414	128493414	+	Intron	SNP	T	T	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	A	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:128493414T>A	ENST00000325888.8	+	38	6469				FLNC_ENST00000346177.6_Intron|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma						cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						TAGTGGTCACTACACACATCG	0.562																																																0			7																																								128280650	SO:0001627	intron_variant	100131134			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.6209-109T>A	7.37:g.128493414T>A			128280650	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	-	p.V3	ENST00000325888.8	37	c.9	CCDS43644.1	7																																																																																			-	NULL		0.562	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LOC100131134	protein_coding	OTTHUMT00000059948.3	T			128280650	-1	no_errors	XM_001726492	genbank	human	model	54_36p	silent	SNP	0	A
MYO16	23026	genome.wustl.edu	37	13	109318342	109318342	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr13:109318342G>A	ENST00000357550.2	+	1	112	c.71G>A	c.(70-72)cGc>cAc	p.R24H	MYO16_ENST00000356711.2_Missense_Mutation_p.R24H|MYO16_ENST00000251041.5_Missense_Mutation_p.R24H	NM_001198950.1	NP_001185879.1			myosin XVI									p.R24H(1)		NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AAGCGCATGCGCTGTGAGCAA	0.507																																																1	Substitution - Missense(1)	ovary(1)	13											88.0	77.0	81.0					13																	109318342		2203	4300	6503	108116343	SO:0001583	missense	23026				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.71G>A	13.37:g.109318342G>A	ENSP00000350160:p.Arg24His		108116343		Missense_Mutation	SNP	HMMPfam_IQ;HMMPfam_Myosin_head;HMMPfam_Ank;superfamily_Ankyrin repeat;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.R24H	ENST00000357550.2	37	c.71	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.266931	0.95399	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.48836	0.8;0.8;0.8	5.37	5.37	0.77165	.	0.000000	0.37261	U	0.002170	T	0.57051	0.2027	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.53933	-0.8368	9	.	.	.	.	18.0975	0.89494	0.0:0.0:1.0:0.0	.	24;24	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	H	24	ENSP00000349145:R24H;ENSP00000350160:R24H;ENSP00000251041:R24H	.	R	+	2	0	MYO16	108116343	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.114000	0.94329	2.506000	0.84524	0.650000	0.86243	CGC	-	NULL		0.507	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	protein_coding	OTTHUMT00000045746.1	G	NM_015011		108116343	1	no_errors	NM_015011	genbank	human	validated	54_36p	missense	SNP	1	A
CTSG	1511	genome.wustl.edu	37	14	25042874	25042874	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr14:25042874T>A	ENST00000216336.2	-	5	773	c.737A>T	c.(736-738)aAa>aTa	p.K246I		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	246					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.K246I(1)		autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		ATCCAGCAGTTTGAAGCTTCT	0.527																																																1	Substitution - Missense(1)	ovary(1)	14											184.0	193.0	190.0					14																	25042874		2203	4300	6503	24112714	SO:0001583	missense	1511			M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.737A>T	14.37:g.25042874T>A	ENSP00000216336:p.Lys246Ile		24112714	Q6IBJ6|Q9UCA5|Q9UCU6	Missense_Mutation	SNP	-	p.K246I	ENST00000216336.2	37	c.737	CCDS9631.1	14	.	.	.	.	.	.	.	.	.	.	T	12.80	2.047902	0.36085	.	.	ENSG00000100448	ENST00000216336	D	0.88975	-2.45	4.63	-0.538	0.11868	.	2.196060	0.02406	N	0.081100	T	0.79730	0.4496	N	0.25332	0.735	0.09310	N	1	P	0.40875	0.731	B	0.34093	0.175	T	0.71234	-0.4653	10	0.54805	T	0.06	.	4.129	0.10141	0.0:0.2092:0.3927:0.3981	.	246	P08311	CATG_HUMAN	I	246	ENSP00000216336:K246I	ENSP00000216336:K246I	K	-	2	0	CTSG	24112714	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.065000	0.14466	0.017000	0.15025	0.448000	0.29417	AAA	-	NULL		0.527	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSG	protein_coding	OTTHUMT00000276536.2	T	NM_001911		24112714	-1	no_errors	NM_001911	genbank	human	reviewed	54_36p	missense	SNP		A
TRBV5-1	28614	genome.wustl.edu	37	7	142021092	142021092	+	RNA	SNP	T	T	C			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:142021092T>C	ENST00000390381.3	+	0	381									T cell receptor beta variable 5-1																		CTGGAGTCACTCAAACTCCAA	0.532																																																0			7											53.0	53.0	53.0					7																	142021092		2011	4180	6191	141667577			0			L36092		7q34	2012-02-07			ENSG00000211734	ENSG00000211734		"""T cell receptors / TRB locus"""	12218	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV51, TCRBV5S1, TCRBV5S1A1T			OTTHUMG00000158520		7.37:g.142021092T>C			141667577		Silent	SNP	-	p.T24	ENST00000390381.3	37	c.72		7																																																																																			-	NULL		0.532	TRBV5-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	uc003vxi.2	TR_V_gene	OTTHUMT00000351226.1	T	NG_001333		141667577	1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390352	ensembl	human	known	54_36p	silent	SNP		C
UNC13C	440279	genome.wustl.edu	37	15	54305940	54305940	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr15:54305940T>A	ENST00000260323.11	+	1	840	c.840T>A	c.(838-840)agT>agA	p.S280R	UNC13C_ENST00000545554.1_Missense_Mutation_p.S280R|UNC13C_ENST00000537900.1_Missense_Mutation_p.S280R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	280					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)	p.S280R(1)		breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCTCCAGCAGTGTGGAGGTTG	0.448																																																1	Substitution - Missense(1)	ovary(1)	15											114.0	111.0	112.0					15																	54305940		1975	4179	6154	52093232	SO:0001583	missense	440279			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.840T>A	15.37:g.54305940T>A	ENSP00000260323:p.Ser280Arg		52093232	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	-	p.S280R	ENST00000260323.11	37	c.840	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	T	17.45	3.392921	0.62066	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83591	-1.74;-1.74;-1.74	5.08	-5.78	0.02362	.	.	.	.	.	D	0.83119	0.5185	L	0.27053	0.805	0.41004	D	0.984953	D	0.76494	0.999	D	0.80764	0.994	T	0.82494	-0.0429	9	0.62326	D	0.03	.	15.7124	0.77641	0.0:0.6401:0.0:0.3599	.	280	Q8NB66	UN13C_HUMAN	R	280	ENSP00000260323:S280R;ENSP00000438156:S280R;ENSP00000442569:S280R	ENSP00000260323:S280R	S	+	3	2	UNC13C	52093232	0.014000	0.17966	0.939000	0.37840	0.915000	0.54546	-0.999000	0.03697	-1.280000	0.02402	-1.064000	0.02280	AGT	-	NULL		0.448	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	T	NM_173166		52093232	1	no_errors	NM_001080534	genbank	human	provisional	54_36p	missense	SNP	0.98	A
ISLR	3671	genome.wustl.edu	37	15	74467669	74467669	+	Missense_Mutation	SNP	G	G	A	rs200106724		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr15:74467669G>A	ENST00000249842.3	+	2	827	c.470G>A	c.(469-471)cGc>cAc	p.R157H	ISLR_ENST00000395118.1_Missense_Mutation_p.R157H|RP11-665J16.1_ENST00000561647.1_RNA	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	157					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)		p.R157H(1)		central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						AACCACAACCGCTTGCACACA	0.627																																																1	Substitution - Missense(1)	ovary(1)	15						G	HIS/ARG,HIS/ARG	0,4396		0,0,2198	73.0	70.0	71.0		470,470	3.1	1.0	15		71	1,8593	1.2+/-3.3	0,1,4296	no	missense,missense	ISLR	NM_005545.3,NM_201526.1	29,29	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	157/429,157/429	74467669	1,12989	2198	4297	6495	72254722	SO:0001583	missense	3671			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.470G>A	15.37:g.74467669G>A	ENSP00000249842:p.Arg157His		72254722		Missense_Mutation	SNP	HMMPfam_LRRCT;HMMPfam_LRR_1;HMMPfam_I-set;superfamily_Immunoglobulin;superfamily_L domain-like	p.R157H	ENST00000249842.3	37	c.470	CCDS10260.1	15	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695464	0.30052	0.0	1.16E-4	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.58210	0.35;0.35	4.05	3.12	0.35913	.	0.155386	0.27966	U	0.017136	T	0.30696	0.0773	L	0.28192	0.835	0.35381	D	0.78995	P	0.38729	0.644	B	0.32022	0.139	T	0.44314	-0.9336	10	0.62326	D	0.03	.	4.009	0.09615	0.3957:0.0:0.6043:0.0	.	157	O14498	ISLR_HUMAN	H	157	ENSP00000249842:R157H;ENSP00000378550:R157H	ENSP00000249842:R157H	R	+	2	0	ISLR	72254722	0.812000	0.29077	1.000000	0.80357	0.156000	0.22039	1.874000	0.39568	1.822000	0.53115	0.313000	0.20887	CGC	-	HMMPfam_LRR_1		0.627	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISLR	protein_coding	OTTHUMT00000269044.1	G	NM_005545		72254722	1	no_errors	NM_005545	genbank	human	validated	54_36p	missense	SNP	0.99	A
GOLGA6C	653641	genome.wustl.edu	37	15	75556405	75556405	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr15:75556405A>G	ENST00000300576.5	+	7	545	c.545A>G	c.(544-546)cAg>cGg	p.Q182R		NM_001164404.1	NP_001157876.1	A6NDK9	GOG6C_HUMAN	golgin A6 family, member C	182						Golgi apparatus (GO:0005794)		p.Q182R(1)		ovary(1)	1						GTGTCTACACAGCAGCAGGAA	0.557																																																1	Substitution - Missense(1)	ovary(1)	15											5.0	6.0	6.0					15																	75556405		84	576	660	73343458	SO:0001583	missense	653641				CCDS58388.1	15q24.2	2014-02-12	2010-02-12		ENSG00000167195	ENSG00000167195			32206	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6C"""				Standard	NM_001164404		Approved		uc002azs.2	A6NDK9	OTTHUMG00000172671	ENST00000300576.5:c.545A>G	15.37:g.75556405A>G	ENSP00000300576:p.Gln182Arg		73343458		Missense_Mutation	SNP	-	p.Q182R	ENST00000300576.5	37	c.545	CCDS58388.1	15	.	.	.	.	.	.	.	.	.	.	A	11.54	1.670427	0.29693	.	.	ENSG00000167195	ENST00000300576	T	0.20598	2.06	.	.	.	.	.	.	.	.	T	0.34106	0.0886	M	0.86343	2.81	0.32073	N	0.594185	P	0.42039	0.769	P	0.49332	0.607	T	0.39121	-0.9629	8	0.40728	T	0.16	.	4.5877	0.12291	0.9995:0.0:5.0E-4:0.0	.	182	A6NDK9	GOG6C_HUMAN	R	182	ENSP00000300576:Q182R	ENSP00000300576:Q182R	Q	+	2	0	GOLGA6C	73343458	1.000000	0.71417	0.030000	0.17652	0.030000	0.12068	3.418000	0.52721	0.138000	0.18790	0.136000	0.15936	CAG	-	NULL		0.557	GOLGA6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC653641	protein_coding	OTTHUMT00000419797.1	A	NM_001164404		73343458	1	no_errors	XM_496076	genbank	human	model	54_36p	missense	SNP	1	G
IL16	3603	genome.wustl.edu	37	15	81552159	81552159	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr15:81552159C>A	ENST00000302987.4	+	2	359	c.359C>A	c.(358-360)gCa>gAa	p.A120E	IL16_ENST00000394660.2_Missense_Mutation_p.A120E			Q14005	IL16_HUMAN	interleukin 16	120					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.A120E(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						AAACTAGAAGCACAAAGTAGT	0.443																																																1	Substitution - Missense(1)	ovary(1)	15											84.0	84.0	84.0					15																	81552159		1891	4105	5996	79339214	SO:0001583	missense	3603			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.359C>A	15.37:g.81552159C>A	ENSP00000302935:p.Ala120Glu		79339214	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	-	p.A120E	ENST00000302987.4	37	c.359	CCDS42069.1	15	.	.	.	.	.	.	.	.	.	.	C	7.910	0.736234	0.15574	.	.	ENSG00000172349	ENST00000394655;ENST00000394660;ENST00000302987	T;T	0.11385	2.78;2.78	4.52	3.61	0.41365	.	0.398331	0.18228	N	0.147651	T	0.12860	0.0312	M	0.63428	1.95	0.09310	N	0.999999	P;P	0.44429	0.745;0.835	B;P	0.44561	0.265;0.453	T	0.11665	-1.0578	10	0.24483	T	0.36	.	5.9329	0.19148	0.0:0.7006:0.1957:0.1037	.	120;120	Q14005;Q14005-2	IL16_HUMAN;.	E	120	ENSP00000378155:A120E;ENSP00000302935:A120E	ENSP00000302935:A120E	A	+	2	0	IL16	79339214	0.089000	0.21612	0.002000	0.10522	0.260000	0.26232	0.870000	0.28010	1.117000	0.41842	0.563000	0.77884	GCA	-	NULL		0.443	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	protein_coding	OTTHUMT00000303952.1	C	NM_172217		79339214	1	no_errors	NM_172217	genbank	human	reviewed	54_36p	missense	SNP	0.03	A
SV2B	9899	genome.wustl.edu	37	15	91795145	91795145	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr15:91795145C>T	ENST00000394232.1	+	3	1018	c.548C>T	c.(547-549)gCc>gTc	p.A183V	SV2B_ENST00000557291.1_3'UTR|SV2B_ENST00000545111.2_Missense_Mutation_p.A32V|SV2B_ENST00000330276.4_Missense_Mutation_p.A183V	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	183					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)	p.A183V(1)		NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			ATGTCTCTGGCCGTCAATGCC	0.572																																																1	Substitution - Missense(1)	ovary(1)	15											145.0	117.0	127.0					15																	91795145		2198	4298	6496	89596149	SO:0001583	missense	9899			AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.548C>T	15.37:g.91795145C>T	ENSP00000377779:p.Ala183Val		89596149	B4DH30|C6G489|O94840|Q6IAR8	Missense_Mutation	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.A183V	ENST00000394232.1	37	c.548	CCDS10370.1	15	.	.	.	.	.	.	.	.	.	.	C	25.3	4.627091	0.87560	.	.	ENSG00000185518	ENST00000545111;ENST00000394232;ENST00000330276	T;T;T	0.73047	-0.71;-0.71;-0.71	5.38	4.44	0.53790	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.313990	0.38959	N	0.001503	T	0.66117	0.2757	L	0.33710	1.025	0.50313	D	0.99986	B	0.34061	0.436	B	0.43155	0.41	T	0.61168	-0.7117	10	0.21014	T	0.42	-25.6936	14.8481	0.70275	0.0:0.8551:0.1449:0.0	.	183	Q7L1I2	SV2B_HUMAN	V	32;183;183	ENSP00000443243:A32V;ENSP00000377779:A183V;ENSP00000332818:A183V	ENSP00000332818:A183V	A	+	2	0	SV2B	89596149	1.000000	0.71417	0.901000	0.35422	0.995000	0.86356	5.849000	0.69465	1.348000	0.45733	0.563000	0.77884	GCC	-	HMMPfam_MFS_1		0.572	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2B	protein_coding	OTTHUMT00000313494.3	C	NM_014848		89596149	1	no_errors	NM_014848	genbank	human	validated	54_36p	missense	SNP	1	T
CHEK2P4	106479021	genome.wustl.edu	37	22	16990301	16990301	+	IGR	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr22:16990301C>T								AP000539.2 (414110 upstream) : KB-67B5.17 (11647 downstream)																							TAGTCGAAAGCGGCCTCATGA	0.453																																																0			22																																								15370301	SO:0001628	intergenic_variant	100132032																															22.37:g.16990301C>T			15370301		Missense_Mutation	SNP	-	p.R31W		37	c.91		22																																																																																			-	NULL	0	0.453					LOC100132032			C			15370301	1	no_errors	XM_001726273	genbank	human	model	54_36p	missense	SNP	0.9	T
E4F1	1877	genome.wustl.edu	37	16	2282783	2282783	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	G	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr16:2282783T>G	ENST00000301727.4	+	6	805	c.757T>G	c.(757-759)Tgt>Ggt	p.C253G	E4F1_ENST00000565090.1_Missense_Mutation_p.C253G|RP11-304L19.12_ENST00000564055.1_lincRNA|E4F1_ENST00000564139.1_Missense_Mutation_p.C253G	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	253	Mediates dimerization, DNA-binding, transcription repression of CCNA2 and interaction with HMGA2.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.C253G(1)		ovary(1)	1						GTGCTCCAAGTGTGGAAAGAG	0.612																																																1	Substitution - Missense(1)	ovary(1)	16											60.0	68.0	65.0					16																	2282783		2197	4300	6497	2222784	SO:0001583	missense	1877			U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.757T>G	16.37:g.2282783T>G	ENSP00000301727:p.Cys253Gly		2222784	A8K2R4|O00146	Missense_Mutation	SNP	HMMPfam_zf-C2H2;superfamily_C2H2 and C2HC zinc fingers	p.C253G	ENST00000301727.4	37	c.757	CCDS32370.1	16	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518966	0.64634	.	.	ENSG00000167967	ENST00000301727	D	0.85861	-2.04	5.84	5.84	0.93424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93818	0.8023	M	0.91818	3.245	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.94977	0.8122	10	0.87932	D	0	-8.6789	15.0285	0.71687	0.0:0.0:0.0:1.0	.	249;253;253	E9PFZ8;E7EMF7;Q66K89	.;.;E4F1_HUMAN	G	253	ENSP00000301727:C253G	ENSP00000301727:C253G	C	+	1	0	E4F1	2222784	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.846000	0.86887	2.234000	0.73211	0.459000	0.35465	TGT	-	HMMPfam_zf-C2H2		0.612	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E4F1	protein_coding	OTTHUMT00000435225.1	T	NM_004424		2222784	1	no_errors	NM_004424	genbank	human	reviewed	54_36p	missense	SNP	1	G
ERN2	10595	genome.wustl.edu	37	16	23706580	23706580	+	Nonsense_Mutation	SNP	C	C	A	rs374029883		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr16:23706580C>A	ENST00000457008.2	-	14	1623	c.1585G>T	c.(1585-1587)Gag>Tag	p.E529*	ERN2_ENST00000256797.4_Nonsense_Mutation_p.E629*					endoplasmic reticulum to nucleus signaling 2									p.E580*(1)		large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		GGTCCCCGCTCGGTGCAGAAG	0.632																																																1	Substitution - Nonsense(1)	ovary(1)	16											37.0	39.0	38.0					16																	23706580		2197	4300	6497	23614081	SO:0001587	stop_gained	10595			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1585G>T	16.37:g.23706580C>A	ENSP00000413812:p.Glu529*		23614081		Nonsense_Mutation	SNP	HMMPfam_Pkinase;HMMPfam_PQQ;HMMPfam_Ribonuc_2-5A;superfamily_Protein kinase-like (PK-like);superfamily_Quinoprotein alcohol dehydrogenase-like	p.E629*	ENST00000457008.2	37	c.1885		16	.	.	.	.	.	.	.	.	.	.	C	39	7.518069	0.98332	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.5778	0.87956	0.0:1.0:0.0:0.0	.	.	.	.	X	629;529	.	ENSP00000256797:E629X	E	-	1	0	ERN2	23614081	1.000000	0.71417	0.957000	0.39632	0.929000	0.56500	7.445000	0.80570	2.825000	0.97269	0.655000	0.94253	GAG	-	HMMPfam_Pkinase		0.632	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	protein_coding	OTTHUMT00000434886.1	C			23614081	-1	no_errors	NM_033266	genbank	human	validated	54_36p	nonsense	SNP	1	A
MMP2	4313	genome.wustl.edu	37	16	55532238	55532238	+	Silent	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr16:55532238G>A	ENST00000219070.4	+	11	2156	c.1647G>A	c.(1645-1647)gaG>gaA	p.E549E	MMP2_ENST00000570308.1_Silent_p.E473E|MMP2_ENST00000437642.2_Silent_p.E499E|MMP2_ENST00000543485.1_Silent_p.E473E	NM_004530.4	NP_004521.1	P08253	MMP2_HUMAN	matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)	549	Required for inhibitor TIMP2 binding.				angiogenesis (GO:0001525)|blood vessel maturation (GO:0001955)|bone trabecula formation (GO:0060346)|cellular protein metabolic process (GO:0044267)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|positive regulation of innate immune response (GO:0045089)|proteolysis (GO:0006508)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|sarcomere (GO:0030017)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.E549E(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|liver(2)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	58		Renal(780;0.00183)|Breast(268;0.00354)|Hepatocellular(780;0.00826)|all_neural(199;0.0189)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0185)|all cancers(182;7.16e-45)|Epithelial(162;5.26e-37)|GBM - Glioblastoma multiforme(240;9e-08)|Kidney(780;0.00227)|BRCA - Breast invasive adenocarcinoma(181;0.00786)	Captopril(DB01197)|Marimastat(DB00786)	GCACCCTGGAGCGAGGGTACC	0.572																																																1	Substitution - coding silent(1)	ovary(1)	16											88.0	74.0	79.0					16																	55532238		2198	4300	6498	54089739	SO:0001819	synonymous_variant	4313				CCDS10752.1, CCDS45487.1	16q13-q21	2008-02-05	2005-08-08		ENSG00000087245	ENSG00000087245	3.4.24.24		7166	protein-coding gene	gene with protein product		120360	"""matrix metalloproteinase 2 (gelatinase A, 72kD gelatinase, 72kD type IV collagenase)"", ""matrix metalloproteinase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)"""	CLG4, CLG4A			Standard	NM_004530		Approved	TBE-1	uc002ehz.4	P08253	OTTHUMG00000133202	ENST00000219070.4:c.1647G>A	16.37:g.55532238G>A			54089739	B2R6U1|B4DWH3|E9PE45|Q9UCJ8	Silent	SNP	"HMMPfam_fn2;HMMPfam_Hemopexin;superfamily_Hemopexin-like domain;HMMPfam_Peptidase_M10;HMMPfam_PG_binding_1;superfamily_PGBD-like;superfamily_Kringle-like;superfamily_Metalloproteases (""zincins"") catalytic domain"	p.E549	ENST00000219070.4	37	c.1647	CCDS10752.1	16																																																																																			-	HMMPfam_Hemopexin		0.572	MMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP2	protein_coding	OTTHUMT00000256913.3	G			54089739	1	no_errors	NM_004530	genbank	human	reviewed	54_36p	silent	SNP	1	A
Unknown	0	genome.wustl.edu	37	3	163719613	163719613	+	IGR	SNP	C	C	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr3:163719613C>A								AC092962.1 (346444 upstream) : MIR1263 (169645 downstream)																							CCTCCAGGTCCTGGATTCCTT	0.473																																																0			3																																								165202307	SO:0001628	intergenic_variant	0																															3.37:g.163719613C>A			165202307		Missense_Mutation	SNP	-	p.Q118H		37	c.354		3																																																																																			-	NULL	0	0.473					ENSG00000214210			C			165202307	-1	no_start_codon	ENST00000397815	ensembl	human	known	54_36p	missense	SNP		A
ESPNP	284729	genome.wustl.edu	37	1	17030615	17030615	+	RNA	SNP	G	G	T	rs200500243	byFrequency	TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr1:17030615G>T	ENST00000492551.1	-	0	720					NR_026567.1				espin pseudogene																		GATGGATCCCGGGAGAGCACG	0.617																																																0			1																																								16903202			284729			AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17030615G>T			16903202		Silent	SNP	HMMPfam_Ank;superfamily_ANK;HMMPfam_WH2	p.R241	ENST00000492551.1	37	c.721		1																																																																																			-	NULL		0.617	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	pseudogene	OTTHUMT00000326311.1	G			16903202	-1	no_start_codon	ENST00000270691	ensembl	human	known	54_36p	silent	SNP	1	T
TP53	7157	genome.wustl.edu	37	17	7577099	7577099	+	Missense_Mutation	SNP	C	C	A	rs121912660		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr17:7577099C>A	ENST00000269305.4	-	8	1028	c.839G>T	c.(838-840)aGa>aTa	p.R280I	TP53_ENST00000420246.2_Missense_Mutation_p.R280I|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R280I|TP53_ENST00000359597.4_Missense_Mutation_p.R280I|TP53_ENST00000445888.2_Missense_Mutation_p.R280I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	280	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> K (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|R -> P (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1631151}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R280T(65)|p.R280K(49)|p.R280I(16)|p.0?(8)|p.?(2)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCGCCGGTCTCTCCCAGGACA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	154	Substitution - Missense(130)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(2)	urinary_tract(50)|breast(22)|lung(20)|upper_aerodigestive_tract(14)|haematopoietic_and_lymphoid_tissue(8)|large_intestine(5)|central_nervous_system(5)|stomach(4)|biliary_tract(4)|oesophagus(4)|skin(4)|ovary(4)|bone(4)|prostate(3)|small_intestine(1)|endometrium(1)|vagina(1)	17	GRCh37	CM993218	TP53	M	rs121912660						77.0	67.0	70.0					17																	7577099		2203	4300	6503	7517824	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.839G>T	17.37:g.7577099C>A	ENSP00000269305:p.Arg280Ile		7517824	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	superfamily_p53-like transcription factors;superfamily_p53 tetramerization domain;P53_tetramer;HMMPfam_P53_tetramer;P53;HMMPfam_P53;P53_TAD;HMMPfam_P53_TAD	p.R280I	ENST00000269305.4	37	c.839	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.380644	0.95945	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.995	D;D;D;D	0.91635	0.99;0.999;0.99;0.99	D	0.96400	0.9296	10	0.87932	D	0	-21.0303	16.1198	0.81342	0.0:1.0:0.0:0.0	.	280;280;280;280	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	I	280;280;280;280;280;269;148	ENSP00000352610:R280I;ENSP00000269305:R280I;ENSP00000398846:R280I;ENSP00000391127:R280I;ENSP00000391478:R280I;ENSP00000425104:R148I	ENSP00000269305:R280I	R	-	2	0	TP53	7517824	0.978000	0.34361	1.000000	0.80357	0.980000	0.70556	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	AGA	-	HMMPfam_P53		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546		7517824	-1	no_errors	NM_000546	genbank	human	reviewed	54_36p	missense	SNP	1	A
MRC2	9902	genome.wustl.edu	37	17	60765701	60765701	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr17:60765701G>A	ENST00000303375.5	+	21	3400	c.2998G>A	c.(2998-3000)Gca>Aca	p.A1000T	MRC2_ENST00000446119.2_5'UTR	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1000	C-type lectin 6. {ECO:0000255|PROSITE- ProRule:PRU00040}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)	p.A1000T(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						GTGGTCAGAGGCACAGTTCTC	0.607																																																1	Substitution - Missense(1)	ovary(1)	17											58.0	49.0	52.0					17																	60765701		2203	4300	6503	58119433	SO:0001583	missense	9902			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2998G>A	17.37:g.60765701G>A	ENSP00000307513:p.Ala1000Thr		58119433	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	HMMPfam_fn2;HMMPfam_Ricin_B_lectin;HMMPfam_Lectin_C;superfamily_Ricin B-like lectins;superfamily_Kringle-like;superfamily_C-type lectin-like	p.A1000T	ENST00000303375.5	37	c.2998	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726969	0.89390	.	.	ENSG00000011028	ENST00000303375	T	0.53857	0.6	5.17	4.2	0.49525	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	T	0.80793	0.4691	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86566	0.1844	10	0.87932	D	0	-8.243	13.2206	0.59885	0.0781:0.0:0.9219:0.0	.	1000	Q9UBG0	MRC2_HUMAN	T	1000	ENSP00000307513:A1000T	ENSP00000307513:A1000T	A	+	1	0	MRC2	58119433	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.815000	0.75242	1.165000	0.42670	0.561000	0.74099	GCA	-	HMMPfam_Lectin_C		0.607	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	protein_coding	OTTHUMT00000445152.1	G			58119433	1	no_errors	NM_006039	genbank	human	validated	54_36p	missense	SNP	1	A
RFXANK	8625	genome.wustl.edu	37	19	19310021	19310021	+	Silent	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr19:19310021C>T	ENST00000303088.4	+	9	1164	c.690C>T	c.(688-690)gcC>gcT	p.A230A	RFXANK_ENST00000407360.3_Silent_p.A230A|RFXANK_ENST00000392324.4_Silent_p.A207A|RFXANK_ENST00000353145.1_Silent_p.A207A|RFXANK_ENST00000456252.3_Silent_p.A208A	NM_003721.2	NP_003712.1	O14593	RFXK_HUMAN	regulatory factor X-associated ankyrin-containing protein	230					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)	p.A230A(1)		NS(1)|breast(1)|endometrium(1)|lung(8)|ovary(2)|prostate(1)	14			Epithelial(12;0.00228)			TGGACCTTGCCGTGGCCCTGG	0.652																																																1	Substitution - coding silent(1)	ovary(1)	19											80.0	78.0	79.0					19																	19310021		2203	4300	6503	19171021	SO:0001819	synonymous_variant	8625			AF094760	CCDS12395.1, CCDS12396.1, CCDS62611.1	19p12	2014-09-17			ENSG00000064490	ENSG00000064490		"""Ankyrin repeat domain containing"""	9987	protein-coding gene	gene with protein product	"""ankyrin repeat-containing regulatory factor X-associated protein"", ""regulatory factor X subunit B"", ""RFX-Bdelta4"", ""DNA-binding protein RFXANK"""	603200				9806546, 10072068	Standard	NM_003721		Approved	BLS, RFX-B, ANKRA1, F14150_1, MGC138628	uc002nls.3	O14593	OTTHUMG00000169224	ENST00000303088.4:c.690C>T	19.37:g.19310021C>T			19171021	O95839|Q24JQ1|Q6FGA8	Silent	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat	p.A230	ENST00000303088.4	37	c.690	CCDS12395.1	19	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942954	0.34283	.	.	ENSG00000064490	ENST00000544923;ENST00000536253	T	0.61040	0.14	5.19	-9.36	0.00629	.	.	.	.	.	T	0.51007	0.1649	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61850	-0.6978	5	.	.	.	-7.4837	12.0553	0.53531	0.103:0.1171:0.0:0.78	.	.	.	.	L	20	ENSP00000441042:P20L	.	P	+	2	0	RFXANK	19171021	0.000000	0.05858	0.308000	0.25141	0.903000	0.53119	-3.482000	0.00456	-1.697000	0.01420	-1.036000	0.02392	CCG	-	HMMPfam_Ank		0.652	RFXANK-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	RFXANK	protein_coding	OTTHUMT00000402923.2	C	NM_003721		19171021	1	no_errors	NM_003721	genbank	human	reviewed	54_36p	silent	SNP	0.69	T
SLC17A7	57030	genome.wustl.edu	37	19	49938043	49938043	+	Silent	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr19:49938043G>A	ENST00000221485.3	-	4	702	c.531C>T	c.(529-531)atC>atT	p.I177I	SLC17A7_ENST00000600601.1_Silent_p.I110I|SLC17A7_ENST00000543531.1_Silent_p.I165I	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	177					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)	p.I177I(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		ACCCCTGCAGGATCCTCACGA	0.547																																																1	Substitution - coding silent(1)	ovary(1)	19											81.0	70.0	73.0					19																	49938043		2203	4300	6503	54629855	SO:0001819	synonymous_variant	57030			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.531C>T	19.37:g.49938043G>A			54629855	B4DFR9|B4DG46|Q6PCD0	Silent	SNP	HMMPfam_MFS_1;superfamily_MFS general substrate transporter	p.I177	ENST00000221485.3	37	c.531	CCDS12764.1	19																																																																																			-	HMMPfam_MFS_1		0.547	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A7	protein_coding	OTTHUMT00000465367.2	G			54629855	-1	no_errors	NM_020309	genbank	human	reviewed	54_36p	silent	SNP	1	A
LENG1	79165	genome.wustl.edu	37	19	54660764	54660764	+	Splice_Site	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr19:54660764C>T	ENST00000222224.3	-	3	499		c.e3-1			NM_024316.1	NP_077292.1	Q96BZ8	LENG1_HUMAN	leukocyte receptor cluster (LRC) member 1									p.?(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	8	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTTGCCTCTCCTGAGGGGGCC	0.542																																																1	Unknown(1)	ovary(1)	19											41.0	37.0	39.0					19																	54660764		2203	4300	6503	59352576	SO:0001630	splice_region_variant	79165			AF211966	CCDS12881.1	19q13.4	2008-02-05			ENSG00000105617	ENSG00000105617			15502	protein-coding gene	gene with protein product						10941842	Standard	NM_024316		Approved		uc002qdm.3	Q96BZ8	OTTHUMG00000066486	ENST00000222224.3:c.313-1G>A	19.37:g.54660764C>T			59352576	Q9HCU7	Splice_Site	SNP	-	e3-1	ENST00000222224.3	37	c.313-1	CCDS12881.1	19	.	.	.	.	.	.	.	.	.	.	c	14.50	2.554130	0.45487	.	.	ENSG00000105617	ENST00000222224	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6414	0.91397	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LENG1	59352576	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	5.959000	0.70339	2.779000	0.95612	0.655000	0.94253	.	-	-		0.542	LENG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG1	protein_coding	OTTHUMT00000142159.1	C	NM_024316	Intron	59352576	-1	no_errors	NM_024316	genbank	human	provisional	54_36p	splice_site	SNP	1	T
COL5A3	50509	genome.wustl.edu	37	19	10097016	10097016	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr19:10097016C>G	ENST00000264828.3	-	30	2412	c.2327G>C	c.(2326-2328)gGg>gCg	p.G776A		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	776	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)	p.G776A(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GCCTGGGGGCCCCTCCTCGCC	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											24.0	29.0	28.0					19																	10097016		2202	4299	6501	9958016	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2327G>C	19.37:g.10097016C>G	ENSP00000264828:p.Gly776Ala		9958016	Q9NZQ6	Missense_Mutation	SNP	HMMPfam_COLFI;HMMPfam_Collagen;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.G776A	ENST00000264828.3	37	c.2327	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168690	0.78339	.	.	ENSG00000080573	ENST00000264828	D	0.96885	-4.16	4.32	4.32	0.51571	.	0.000000	0.64402	D	0.000001	D	0.98548	0.9515	H	0.94183	3.505	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	D	0.99612	1.0981	10	0.87932	D	0	.	14.6541	0.68820	0.0:1.0:0.0:0.0	.	776	P25940	CO5A3_HUMAN	A	776	ENSP00000264828:G776A	ENSP00000264828:G776A	G	-	2	0	COL5A3	9958016	1.000000	0.71417	0.985000	0.45067	0.891000	0.51852	6.969000	0.76092	2.085000	0.62840	0.462000	0.41574	GGG	-	HMMPfam_Collagen		0.632	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	C	NM_015719		9958016	-1	no_errors	NM_015719	genbank	human	reviewed	54_36p	missense	SNP	0.96	G
KIR3DX1	90011	genome.wustl.edu	37	19	55045083	55045083	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr19:55045083G>T	ENST00000335056.3	+	3	241	c.203G>T	c.(202-204)aGc>aTc	p.S68I				Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	68	Ig-like C2-type 1.					extracellular region (GO:0005576)		p.S68I(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		GGGACCCGAAGCCATGAGTTG	0.527																																					Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)											1	Substitution - Missense(1)	ovary(1)	19											79.0	82.0	81.0					19																	55045083		2079	4218	6297	59736895	SO:0001583	missense	90011			BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.203G>T	19.37:g.55045083G>T	ENSP00000335388:p.Ser68Ile		59736895	B7WNL0|Q8N0S4	Missense_Mutation	SNP	HMMPfam_ig;superfamily_SSF48726	p.S68I	ENST00000335056.3	37	c.203		19	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.202168	0.00296	.	.	ENSG00000104970	ENST00000335056	T	0.00682	5.86	2.02	-4.03	0.04021	.	.	.	.	.	T	0.00724	0.0024	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36261	-0.9755	6	0.45353	T	0.12	.	2.4369	0.04485	0.1566:0.1583:0.484:0.2011	.	.	.	.	I	68	ENSP00000335388:S68I	ENSP00000221567:S68I	S	+	2	0	KIR3DX1	59736895	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.866000	0.01647	-2.500000	0.00511	-2.742000	0.00126	AGC	-	NULL		0.527	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	KIR3DX1	protein_coding	OTTHUMT00000140800.2	G	NR_026716		59736895	1	no_errors	ENST00000221567	ensembl	human	known	54_36p	missense	SNP		T
CNTNAP5	129684	genome.wustl.edu	37	2	125671733	125671733	+	Nonsense_Mutation	SNP	C	C	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr2:125671733C>A	ENST00000431078.1	+	24	4153	c.3789C>A	c.(3787-3789)taC>taA	p.Y1263*		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	1263					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.Y1263*(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GGTTCCTCTACCAGCACAAGC	0.448																																																1	Substitution - Nonsense(1)	ovary(1)	2											171.0	162.0	165.0					2																	125671733		1973	4175	6148	125388203	SO:0001587	stop_gained	129684			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3789C>A	2.37:g.125671733C>A	ENSP00000399013:p.Tyr1263*		125388203	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Nonsense_Mutation	SNP	HMMPfam_F5_F8_type_C;HMMPfam_EGF;superfamily_Galactose-binding domain-like;superfamily_Concanavalin A-like lectins/glucanases;HMMPfam_Laminin_G_2;superfamily_Fibrinogen C-terminal domain-like	p.Y1263*	ENST00000431078.1	37	c.3789	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	44	10.643582	0.99443	.	.	ENSG00000155052	ENST00000431078	.	.	.	6.14	2.33	0.28932	.	0.000000	0.45361	D	0.000362	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.3145	0.37926	0.0:0.6174:0.0:0.3826	.	.	.	.	X	1263	.	ENSP00000399013:Y1263X	Y	+	3	2	CNTNAP5	125388203	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	0.734000	0.26101	0.153000	0.19213	0.637000	0.83480	TAC	-	NULL		0.448	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	C			125388203	1	no_errors	NM_130773	genbank	human	reviewed	54_36p	nonsense	SNP	1	A
CASP10	843	genome.wustl.edu	37	2	202070639	202070639	+	Silent	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr2:202070639C>T	ENST00000272879.5	+	7	940	c.756C>T	c.(754-756)gtC>gtT	p.V252V	CASP10_ENST00000286186.6_Silent_p.V252V|CASP10_ENST00000360132.3_Intron|CASP10_ENST00000448480.1_Intron|CASP10_ENST00000492363.1_Intron|CASP10_ENST00000313728.7_Intron|CASP10_ENST00000346817.5_Intron	NM_032974.4	NP_116756.2	Q92851	CASPA_HUMAN	caspase 10, apoptosis-related cysteine peptidase	252					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|innate immune response (GO:0045087)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|death effector domain binding (GO:0035877)|ubiquitin protein ligase binding (GO:0031625)	p.V252V(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27						CAAGCCTGGTCTCCAGGGGGA	0.403																																																1	Substitution - coding silent(1)	ovary(1)	2											77.0	78.0	77.0					2																	202070639		2203	4300	6503	201778884	SO:0001819	synonymous_variant	843			U60519	CCDS2338.1, CCDS2339.1, CCDS2340.1, CCDS56159.1, CCDS56160.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000003400	ENSG00000003400	3.4.22.63	"""Caspases"""	1500	protein-coding gene	gene with protein product		601762	"""caspase 10, apoptosis-related cysteine protease"""			8755496	Standard	NM_032974		Approved	MCH4	uc002uxj.1	Q92851	OTTHUMG00000132818	ENST00000272879.5:c.756C>T	2.37:g.202070639C>T			201778884	Q68HC0|Q6KF62|Q6KF63|Q8IUP5|Q8WYQ8|Q99845|Q9Y2U6|Q9Y2U7	Silent	SNP	HMMPfam_DED;superfamily_DEATH domain;HMMPfam_Peptidase_C14;superfamily_Caspase-like	p.V252	ENST00000272879.5	37	c.756	CCDS2338.1	2																																																																																			-	NULL		0.403	CASP10-002	KNOWN	basic|CCDS	protein_coding	CASP10	protein_coding	OTTHUMT00000256273.1	C	NM_032977		201778884	1	no_errors	NM_032977	genbank	human	reviewed	54_36p	silent	SNP		T
RAPH1	65059	genome.wustl.edu	37	2	204320264	204320264	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr2:204320264C>T	ENST00000319170.5	-	9	1497	c.1198G>A	c.(1198-1200)Gaa>Aaa	p.E400K	RAPH1_ENST00000423104.1_Missense_Mutation_p.E427K|RAPH1_ENST00000374488.2_Missense_Mutation_p.E425K|RAPH1_ENST00000457812.1_Missense_Mutation_p.E400K|RAPH1_ENST00000374489.2_Missense_Mutation_p.E427K|RAPH1_ENST00000308091.4_Missense_Mutation_p.E452K|RAPH1_ENST00000453034.1_Missense_Mutation_p.E452K|RAPH1_ENST00000439222.1_Missense_Mutation_p.E425K|RAPH1_ENST00000419464.1_Missense_Mutation_p.E400K|RAPH1_ENST00000374493.3_Missense_Mutation_p.E452K|RAPH1_ENST00000418114.1_Missense_Mutation_p.E400K	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	400	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)		p.E400K(1)		breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGGACTCCTTCAATTTCTGGT	0.378																																																1	Substitution - Missense(1)	ovary(1)	2											106.0	107.0	106.0					2																	204320264		2203	4300	6503	204028509	SO:0001583	missense	65059			AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.1198G>A	2.37:g.204320264C>T	ENSP00000316543:p.Glu400Lys		204028509	Q96Q37|Q9C0I2	Missense_Mutation	SNP	HMMPfam_RA;HMMPfam_PH;superfamily_PH domain-like	p.E400K	ENST00000319170.5	37	c.1198	CCDS2359.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.598136	0.96614	.	.	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201	T;T;T;T;T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97	5.45	5.45	0.79879	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.51477	D	0.000086	T	0.49218	0.1544	M	0.71206	2.165	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.995;0.996	T	0.48317	-0.9046	10	0.87932	D	0	-26.3273	19.6582	0.95853	0.0:1.0:0.0:0.0	.	452;452;400	Q70E73-6;C9K0J5;Q70E73	.;.;RAPH1_HUMAN	K	400;400;452;427;425;452;425;400;427;452;425;400;427	ENSP00000392854:E400K;ENSP00000316543:E400K;ENSP00000363617:E452K;ENSP00000363613:E427K;ENSP00000363612:E425K;ENSP00000311293:E452K;ENSP00000411138:E425K;ENSP00000390578:E400K;ENSP00000397751:E427K;ENSP00000406662:E452K;ENSP00000396711:E400K	ENSP00000311293:E452K	E	-	1	0	RAPH1	204028509	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.772000	0.85439	2.714000	0.92807	0.655000	0.94253	GAA	-	HMMPfam_PH		0.378	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPH1	protein_coding	OTTHUMT00000256363.2	C	NM_025252		204028509	-1	no_errors	NM_213589	genbank	human	validated	54_36p	missense	SNP	1	T
KIDINS220	57498	genome.wustl.edu	37	2	8926117	8926117	+	Silent	SNP	G	G	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr2:8926117G>T	ENST00000256707.3	-	17	2164	c.1983C>A	c.(1981-1983)gtC>gtA	p.V661V	KIDINS220_ENST00000418530.1_Silent_p.V619V|KIDINS220_ENST00000473731.1_Silent_p.V661V|KIDINS220_ENST00000427284.1_Silent_p.V661V|KIDINS220_ENST00000319688.5_Silent_p.V662V	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	661	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)	p.V661V(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAAGGAAGATGACAAAAGATG	0.323																																																1	Substitution - coding silent(1)	ovary(1)	2											108.0	105.0	106.0					2																	8926117		1849	4095	5944	8843568	SO:0001819	synonymous_variant	57498			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.1983C>A	2.37:g.8926117G>T			8843568	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	-	p.V661	ENST00000256707.3	37	c.1983	CCDS42650.1	2																																																																																			-	NULL		0.323	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	protein_coding	OTTHUMT00000323408.2	G	NM_020738		8843568	-1	no_errors	NM_020738	genbank	human	validated	54_36p	silent	SNP	1	T
HADHB	3032	genome.wustl.edu	37	2	26496570	26496570	+	Silent	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr2:26496570C>T	ENST00000317799.5	+	6	410	c.306C>T	c.(304-306)atC>atT	p.I102I	HADHB_ENST00000545822.1_Silent_p.I80I|HADHB_ENST00000405867.3_Silent_p.I102I|HADHB_ENST00000537713.1_Silent_p.I87I|HADHB_ENST00000494615.1_3'UTR	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	102					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)	p.I102I(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTATATCATCTTTGGTACAG	0.383																																																1	Substitution - coding silent(1)	ovary(1)	2											117.0	110.0	112.0					2																	26496570		2203	4300	6503	26350074	SO:0001819	synonymous_variant	3032				CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.306C>T	2.37:g.26496570C>T			26350074	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Silent	SNP	HMMPfam_Thiolase_N;HMMPfam_Thiolase_C;superfamily_Thiolase-like	p.I102	ENST00000317799.5	37	c.306	CCDS1722.1	2																																																																																			-	HMMPfam_Thiolase_N		0.383	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHB	protein_coding	OTTHUMT00000214050.2	C	NM_000183		26350074	1	no_errors	NM_000183	genbank	human	reviewed	54_36p	silent	SNP	1	T
Unknown	0	genome.wustl.edu	37	2	210044853	210044853	+	IGR	SNP	G	G	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr2:210044853G>T								RNA5SP117 (259465 upstream) : MAP2 (243928 downstream)																							TTAGCAGAAAGTTCCAACCCA	0.527																																																0			2																																								209753098	SO:0001628	intergenic_variant	402116																															2.37:g.210044853G>T			209753098		RNA	SNP	-	NULL		37	NULL		2																																																																																			-	-	0	0.527					LOC402116			G			209753098	1	pseudogene	XR_017081	genbank	human	model	54_36p	rna	SNP	1	T
PDYN	5173	genome.wustl.edu	37	20	1961196	1961196	+	Missense_Mutation	SNP	G	G	A	rs370283678		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr20:1961196G>A	ENST00000217305.2	-	4	763	c.538C>T	c.(538-540)Cgc>Tgc	p.R180C	PDYN_ENST00000540134.1_Missense_Mutation_p.R180C|RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000539905.1_Missense_Mutation_p.R180C	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	180					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.R180C(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGGTATTTGCGCAAAAAGCCC	0.602																																																1	Substitution - Missense(1)	ovary(1)	20						G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	98.0	103.0	101.0		538,538,538,538,538	4.7	1.0	20		101	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	PDYN	NM_001190892.1,NM_001190898.2,NM_001190899.2,NM_001190900.1,NM_024411.4	180,180,180,180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	180/255,180/255,180/255,180/255,180/255	1961196	1,13005	2203	4300	6503	1909196	SO:0001583	missense	5173				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.538C>T	20.37:g.1961196G>A	ENSP00000217305:p.Arg180Cys		1909196	A8K0Q3	Missense_Mutation	SNP	HMMPfam_Opiods_neuropep	p.R180C	ENST00000217305.2	37	c.538	CCDS13023.1	20	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513798	0.85389	0.0	1.16E-4	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	D;D;D	0.86956	-2.19;-2.19;-2.19	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.94162	0.8127	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95090	0.8221	10	0.87932	D	0	-18.2484	15.1657	0.72821	0.0:0.0:1.0:0.0	.	180	P01213	PDYN_HUMAN	C	180	ENSP00000440185:R180C;ENSP00000442259:R180C;ENSP00000217305:R180C	ENSP00000217305:R180C	R	-	1	0	PDYN	1909196	0.995000	0.38212	1.000000	0.80357	0.986000	0.74619	1.034000	0.30204	2.445000	0.82738	0.313000	0.20887	CGC	-	NULL		0.602	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDYN	protein_coding	OTTHUMT00000077569.2	G			1909196	-1	no_errors	NM_024411	genbank	human	reviewed	54_36p	missense	SNP	1	A
NBEAL1	65065	genome.wustl.edu	37	2	203905158	203905158	+	Intron	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr2:203905158C>T	ENST00000449802.1	+	3	384				NBEAL1_ENST00000478884.1_Intron	NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1											NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CGTTGTAAGACTTCGCCTGAA	0.423																																																0			2																																								203613403	SO:0001627	intron_variant	100129743			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.52-1330C>T	2.37:g.203905158C>T			203613403	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	-	p.L110F	ENST00000449802.1	37	c.328	CCDS46495.1	2																																																																																			-	NULL		0.423	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100129743	protein_coding	OTTHUMT00000333982.4	C			203613403	1	pseudogene	XM_001724736	genbank	human	model	54_36p	missense	SNP	0.92	T
DSCAM	1826	genome.wustl.edu	37	21	41505831	41505831	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr21:41505831G>A	ENST00000400454.1	-	19	3989	c.3512C>T	c.(3511-3513)gCa>gTa	p.A1171V		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1171	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.A1171V(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CCCGTCTCCTGCGCGGGTGAA	0.592																																					Melanoma(134;970 1778 1785 21664 32388)											1	Substitution - Missense(1)	ovary(1)	21											81.0	87.0	85.0					21																	41505831		2094	4258	6352	40427701	SO:0001583	missense	1826			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.3512C>T	21.37:g.41505831G>A	ENSP00000383303:p.Ala1171Val		40427701	O60468	Missense_Mutation	SNP	-	p.A1171V	ENST00000400454.1	37	c.3512	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	G	25.0	4.592915	0.86953	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.57273	0.41;0.41	5.39	5.39	0.77823	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.68421	0.2999	L	0.52266	1.64	0.58432	D	0.999998	D	0.76494	0.999	D	0.83275	0.996	T	0.64972	-0.6281	10	0.35671	T	0.21	.	19.1508	0.93487	0.0:0.0:1.0:0.0	.	1171	O60469	DSCAM_HUMAN	V	1171;923	ENSP00000383303:A1171V;ENSP00000385342:A923V	ENSP00000383303:A1171V	A	-	2	0	DSCAM	40427701	1.000000	0.71417	0.155000	0.22561	0.819000	0.46315	9.603000	0.98315	2.514000	0.84764	0.655000	0.94253	GCA	-	NULL		0.592	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	protein_coding	OTTHUMT00000195029.1	G	NM_001389		40427701	-1	no_errors	NM_001389	genbank	human	validated	54_36p	missense	SNP	0.99	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46047294	46047294	+	Nonsense_Mutation	SNP	C	C	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	G	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr21:46047294C>G	ENST00000397911.3	+	1	255	c.206C>G	c.(205-207)tCa>tGa	p.S69*	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	69	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCCTGCCAATCAGGCTGCACC	0.701																																																0			21											53.0	64.0	60.0					21																	46047294		2194	4292	6486	44871722	SO:0001587	stop_gained	386676			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.206C>G	21.37:g.46047294C>G	ENSP00000381009:p.Ser69*		44871722	A2RRG1|A6NIR9|Q70LJ1	Nonsense_Mutation	SNP	HMMPfam_Keratin_B2	p.S69*	ENST00000397911.3	37	c.206	CCDS42961.1	21	.	.	.	.	.	.	.	.	.	.	c	11.03	1.518848	0.27211	.	.	ENSG00000221837	ENST00000397911	.	.	.	3.27	2.35	0.29111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8272	0.13421	0.0:0.7192:0.0:0.2808	.	.	.	.	X	69	.	.	S	+	2	0	KRTAP10-9	44871722	0.002000	0.14202	0.006000	0.13384	0.006000	0.05464	1.510000	0.35790	1.530000	0.49136	0.603000	0.83216	TCA	-	NULL		0.701	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	protein_coding	OTTHUMT00000128040.1	C			44871722	1	no_errors	NM_198690	genbank	human	validated	54_36p	nonsense	SNP	0.11	G
NFKBIZ	64332	genome.wustl.edu	37	3	101574576	101574576	+	Splice_Site	SNP	G	G	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr3:101574576G>T	ENST00000326172.5	+	9	1769		c.e9-1		NFKBIZ_ENST00000394054.2_Splice_Site|NFKBIZ_ENST00000326151.5_Splice_Site	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta						inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.?(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						TTTTCTTCTAGGCCTGACTCC	0.448																																																1	Unknown(1)	ovary(1)	3											119.0	109.0	112.0					3																	101574576		2203	4300	6503	103057266	SO:0001630	splice_region_variant	64332			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1655-1G>T	3.37:g.101574576G>T			103057266	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Splice_Site	SNP	-	e9-1	ENST00000326172.5	37	c.1655-1	CCDS2946.1	3	.	.	.	.	.	.	.	.	.	.	G	18.21	3.572497	0.65765	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.6397	0.99537	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NFKBIZ	103057266	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	8.640000	0.91028	2.880000	0.98712	0.650000	0.86243	.	-	-		0.448	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	protein_coding	OTTHUMT00000353793.1	G	NM_031419	Intron	103057266	1	no_errors	NM_031419	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
WDR5B	54554	genome.wustl.edu	37	3	122133656	122133656	+	Missense_Mutation	SNP	G	G	T	rs546211200		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr3:122133656G>T	ENST00000330689.4	-	1	1226	c.720C>A	c.(718-720)agC>agA	p.S240R	RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	240								p.S240R(1)		kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		ACCTGCCTCTGCTATAATCCC	0.373																																																1	Substitution - Missense(1)	ovary(1)	3											101.0	107.0	105.0					3																	122133656		2203	4300	6503	123616346	SO:0001583	missense	54554			AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.720C>A	3.37:g.122133656G>T	ENSP00000330381:p.Ser240Arg		123616346	B2RCM9|Q9NUL4	Missense_Mutation	SNP	-	p.S240R	ENST00000330689.4	37	c.720	CCDS3012.1	3	.	.	.	.	.	.	.	.	.	.	G	10.67	1.414935	0.25465	.	.	ENSG00000196981	ENST00000330689	T	0.80214	-1.35	4.77	2.95	0.34219	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.149018	0.85682	D	0.000000	T	0.58566	0.2131	N	0.04297	-0.235	0.58432	D	0.999996	B	0.18741	0.03	B	0.12837	0.008	T	0.49597	-0.8923	10	0.31617	T	0.26	.	9.8468	0.41032	0.1572:0.0:0.8428:0.0	.	240	Q86VZ2	WDR5B_HUMAN	R	240	ENSP00000330381:S240R	ENSP00000330381:S240R	S	-	3	2	WDR5B	123616346	1.000000	0.71417	0.997000	0.53966	0.842000	0.47809	3.927000	0.56499	0.709000	0.31976	0.561000	0.74099	AGC	-	NULL		0.373	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR5B	protein_coding	OTTHUMT00000355753.1	G	NM_019069		123616346	-1	no_errors	NM_019069	genbank	human	reviewed	54_36p	missense	SNP	1	T
MRPS22	56945	genome.wustl.edu	37	3	139065782	139065782	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr3:139065782C>G	ENST00000495075.1	+	4	667	c.235C>G	c.(235-237)Ctc>Gtc	p.L79V	MRPS22_ENST00000478464.1_Missense_Mutation_p.L38V|RP11-219D15.3_ENST00000608472.1_RNA|MRPS22_ENST00000310776.4_Missense_Mutation_p.L79V|MRPS22_ENST00000465056.1_Missense_Mutation_p.L78V			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	79						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)	p.L79V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						TCAAAGCATACTCACGAAAAT	0.398																																																1	Substitution - Missense(1)	ovary(1)	3											107.0	103.0	104.0					3																	139065782		2203	4300	6503	140548472	SO:0001583	missense	56945			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.235C>G	3.37:g.139065782C>G	ENSP00000418008:p.Leu79Val		140548472	Q9H3I1	Missense_Mutation	SNP	-	p.L79V	ENST00000495075.1	37	c.235	CCDS3107.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215147	0.79352	.	.	ENSG00000175110	ENST00000495075;ENST00000495225;ENST00000310776;ENST00000465056;ENST00000465373;ENST00000478464	D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6	5.42	5.42	0.78866	.	0.058835	0.64402	D	0.000002	D	0.94840	0.8333	M	0.88450	2.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.95287	0.8391	10	0.87932	D	0	-3.8618	12.5483	0.56212	0.0:0.9233:0.0:0.0767	.	38;78;79	G5E9W7;G5E9V5;P82650	.;.;RT22_HUMAN	V	79;49;79;78;84;38	ENSP00000418008:L79V;ENSP00000310785:L79V;ENSP00000418233:L78V;ENSP00000419920:L84V;ENSP00000419303:L38V	ENSP00000310785:L79V	L	+	1	0	MRPS22	140548472	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	3.298000	0.51818	2.537000	0.85549	0.591000	0.81541	CTC	-	NULL		0.398	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS22	protein_coding	OTTHUMT00000358120.1	C	NM_020191		140548472	1	no_errors	NM_020191	genbank	human	reviewed	54_36p	missense	SNP	0.99	G
CSRNP1	64651	genome.wustl.edu	37	3	39185736	39185736	+	Silent	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr3:39185736C>T	ENST00000273153.5	-	4	849	c.672G>A	c.(670-672)aaG>aaA	p.K224K	CSRNP1_ENST00000514182.1_Silent_p.K224K	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	224					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K224K(1)		central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						GCAGCTCCCGCTTCTCCTCCC	0.632																																																1	Substitution - coding silent(1)	ovary(1)	3											77.0	72.0	74.0					3																	39185736		2203	4300	6503	39160740	SO:0001819	synonymous_variant	64651			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.672G>A	3.37:g.39185736C>T			39160740	Q69YY5	Silent	SNP	-	p.K224	ENST00000273153.5	37	c.672	CCDS2682.1	3																																																																																			-	NULL		0.632	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AXUD1	protein_coding	OTTHUMT00000254061.1	C	NM_033027		39160740	-1	no_errors	NM_033027	genbank	human	reviewed	54_36p	silent	SNP	1	T
RTP3	83597	genome.wustl.edu	37	3	46539651	46539651	+	Silent	SNP	T	T	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr3:46539651T>A	ENST00000296142.3	+	1	671	c.99T>A	c.(97-99)ctT>ctA	p.L33L		NM_031440.1	NP_113628.1	Q9BQQ7	RTP3_HUMAN	receptor (chemosensory) transporter protein 3	33					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.L33L(1)		endometrium(1)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		ACAAGGGCCTTCTTCCCAACG	0.542																																																1	Substitution - coding silent(1)	ovary(1)	3											123.0	109.0	113.0					3																	46539651		2203	4300	6503	46514655	SO:0001819	synonymous_variant	83597			AJ312776	CCDS2740.1	3p21.3	2014-02-20	2006-11-21	2006-02-07	ENSG00000163825	ENSG00000163825		"""Receptor transporter proteins"""	15572	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 3"""	607181	"""transmembrane protein 7"", ""receptor transporter protein 3"""	TMEM7		16271481, 15550249, 16720576	Standard	NM_031440		Approved	LTM1, Z3CXXC3	uc003cps.1	Q9BQQ7	OTTHUMG00000133483	ENST00000296142.3:c.99T>A	3.37:g.46539651T>A			46514655	A2RRP6	Silent	SNP	-	p.L33	ENST00000296142.3	37	c.99	CCDS2740.1	3																																																																																			-	NULL		0.542	RTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP3	protein_coding	OTTHUMT00000257379.2	T	NM_031440		46514655	1	no_errors	NM_031440	genbank	human	provisional	54_36p	silent	SNP	0.01	A
ABCF3	55324	genome.wustl.edu	37	3	183905928	183905928	+	Splice_Site	SNP	G	G	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr3:183905928G>T	ENST00000429586.2	+	7	754		c.e7-1		EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Splice_Site	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3						defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.?(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CACTCCTGCAGAGTACTGCTG	0.527																																																1	Unknown(1)	ovary(1)	3											55.0	62.0	60.0					3																	183905928		2203	4300	6503	185388622	SO:0001630	splice_region_variant	55324			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.570-1G>T	3.37:g.183905928G>T			185388622	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Splice_Site	SNP	-	e7-1	ENST00000429586.2	37	c.570-1	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	G	16.98	3.270575	0.59540	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1033	0.86655	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCF3	185388622	1.000000	0.71417	0.999000	0.59377	0.773000	0.43773	9.593000	0.98250	2.262000	0.75019	0.561000	0.74099	.	-	-		0.527	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	protein_coding	OTTHUMT00000346047.1	G	NM_018358	Intron	185388622	1	no_errors	NM_018358	genbank	human	validated	54_36p	splice_site	SNP	1	T
BBS12	166379	genome.wustl.edu	37	4	123663417	123663417	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr4:123663417A>T	ENST00000314218.3	+	2	563	c.370A>T	c.(370-372)Agt>Tgt	p.S124C	BBS12_ENST00000542236.1_Missense_Mutation_p.S124C	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	124					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)	p.S124C(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						AAACTTTTGTAGTGAAGAGGT	0.363									Bardet-Biedl syndrome																																							1	Substitution - Missense(1)	ovary(1)	4											127.0	122.0	123.0					4																	123663417		2203	4300	6503	123882867	SO:0001583	missense	166379	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.370A>T	4.37:g.123663417A>T	ENSP00000319062:p.Ser124Cys		123882867	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Missense_Mutation	SNP	-	p.S124C	ENST00000314218.3	37	c.370	CCDS3728.1	4	.	.	.	.	.	.	.	.	.	.	A	6.120	0.390369	0.11581	.	.	ENSG00000181004	ENST00000314218;ENST00000542236;ENST00000433287	T;T;T	0.78595	-1.19;-1.19;-1.19	5.2	3.99	0.46301	.	0.569212	0.18563	N	0.137551	T	0.56992	0.2023	N	0.08118	0	0.22639	N	0.998901	B	0.10296	0.003	B	0.10450	0.005	T	0.40701	-0.9549	10	0.20519	T	0.43	-9.9939	10.4736	0.44652	0.728:0.0:0.0:0.272	.	124	Q6ZW61	BBS12_HUMAN	C	124	ENSP00000319062:S124C;ENSP00000438273:S124C;ENSP00000398912:S124C	ENSP00000319062:S124C	S	+	1	0	BBS12	123882867	1.000000	0.71417	0.923000	0.36655	0.295000	0.27426	2.390000	0.44416	0.888000	0.36160	0.528000	0.53228	AGT	-	NULL		0.363	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS12	protein_coding	OTTHUMT00000256710.1	A	NM_152618		123882867	1	no_errors	NM_152618	genbank	human	validated	54_36p	missense	SNP	1	T
BAI3	577	genome.wustl.edu	37	6	70040396	70040396	+	Splice_Site	SNP	A	A	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr6:70040396A>T	ENST00000370598.1	+	23	3856		c.e23-1		BAI3_ENST00000238918.8_Splice_Site|BAI3_ENST00000546190.1_5'Flank	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.?(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGTCATTTTCAGCTGCTGGCT	0.373																																																1	Unknown(1)	ovary(1)	6											108.0	97.0	100.0					6																	70040396		2203	4300	6503	70097117	SO:0001630	splice_region_variant	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3036-1A>T	6.37:g.70040396A>T			70097117	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Splice_Site	SNP	-	e21-2	ENST00000370598.1	37	c.3036-2	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	A	29.7	5.030658	0.93575	.	.	ENSG00000135298	ENST00000370598;ENST00000238918	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BAI3	70097117	1.000000	0.71417	0.988000	0.46212	0.992000	0.81027	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	.	-	-		0.373	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	protein_coding	OTTHUMT00000041120.1	A		Intron	70097117	1	no_errors	NM_001704	genbank	human	reviewed	54_36p	splice_site	SNP	1	T
MAP3K7	6885	genome.wustl.edu	37	6	91257852	91257852	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr6:91257852C>T	ENST00000369329.3	-	10	1155	c.994G>A	c.(994-996)Gac>Aac	p.D332N	MAP3K7_ENST00000369332.3_Missense_Mutation_p.D332N|MAP3K7_ENST00000369320.1_Missense_Mutation_p.D13N|MAP3K7_ENST00000369327.3_Missense_Mutation_p.D332N|MAP3K7_ENST00000369325.3_Missense_Mutation_p.D332N	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	332					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)	p.D332N(1)		endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		ATATTAGTGTCACTTTTGTTA	0.348																																																1	Substitution - Missense(1)	ovary(1)	6											157.0	151.0	153.0					6																	91257852		2203	4300	6503	91314573	SO:0001583	missense	6885			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.994G>A	6.37:g.91257852C>T	ENSP00000358335:p.Asp332Asn		91314573	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	HMMPfam_Pkinase;superfamily_Protein kinase-like (PK-like)	p.D332N	ENST00000369329.3	37	c.994	CCDS5028.1	6	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258733	0.80246	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000369320;ENST00000450832	T;T;T;T	0.77229	-1.01;-1.07;-1.08;-1.01	6.07	6.07	0.98685	.	0.086068	0.85682	D	0.000000	T	0.60521	0.2275	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.26258	0.006;0.145;0.009;0.011	B;B;B;B	0.26969	0.005;0.075;0.019;0.008	T	0.61227	-0.7105	10	0.72032	D	0.01	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	332;332;332;332	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	N	332;332;332;332;13;259	ENSP00000358338:D332N;ENSP00000358335:D332N;ENSP00000358331:D332N;ENSP00000358333:D332N	ENSP00000358326:D13N	D	-	1	0	MAP3K7	91314573	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.072000	0.76777	2.890000	0.99128	0.585000	0.79938	GAC	-	NULL		0.348	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	protein_coding	OTTHUMT00000041530.1	C	NM_145331		91314573	-1	no_errors	NM_145331	genbank	human	reviewed	54_36p	missense	SNP	1	T
EIF3IP1	442720	genome.wustl.edu	37	7	109599734	109599734	+	IGR	SNP	G	G	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:109599734G>T								AC073071.1 (362511 upstream) : AC003088.1 (472561 downstream)																							GCACTATACTGGTTGAGCTTT	0.483																																																0			7																																								109386970	SO:0001628	intergenic_variant	442720																															7.37:g.109599734G>T			109386970		RNA	SNP	-	NULL		37	NULL		7																																																																																			-	-	0	0.483					EIF3IP1			G			109386970	-1	pseudogene	NR_003024	genbank	human	provisional	54_36p	rna	SNP	1	T
WNT16	51384	genome.wustl.edu	37	7	120979284	120979284	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:120979284G>A	ENST00000222462.2	+	4	1273	c.983G>A	c.(982-984)gGt>gAt	p.G328D	WNT16_ENST00000361301.2_Missense_Mutation_p.G318D	NM_057168.1	NP_476509.1	Q9UBV4	WNT16_HUMAN	wingless-type MMTV integration site family, member 16	328					bone remodeling (GO:0046849)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|optic cup formation involved in camera-type eye development (GO:0003408)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|replicative senescence (GO:0090399)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.G328D(1)		breast(1)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)	18	all_neural(327;0.117)					TGTGGCCGAGGTTACAACACC	0.527																																																1	Substitution - Missense(1)	ovary(1)	7											159.0	110.0	126.0					7																	120979284		2203	4300	6503	120766520	SO:0001583	missense	51384			AF152584	CCDS5780.1, CCDS5781.1	7q31	2008-07-18			ENSG00000002745	ENSG00000002745		"""Wingless-type MMTV integration sites"""	16267	protein-coding gene	gene with protein product		606267				10500199	Standard	NM_016087		Approved		uc003vjw.3	Q9UBV4	OTTHUMG00000156963	ENST00000222462.2:c.983G>A	7.37:g.120979284G>A	ENSP00000222462:p.Gly328Asp		120766520	Q2M3G1|Q9Y5C0	Missense_Mutation	SNP	HMMPfam_wnt	p.G328D	ENST00000222462.2	37	c.983	CCDS5781.1	7	.	.	.	.	.	.	.	.	.	.	G	34	5.412862	0.96072	.	.	ENSG00000002745	ENST00000361301;ENST00000222462	T;T	0.79940	-1.32;-1.32	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.92658	0.7667	M	0.92691	3.335	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93596	0.6926	10	0.87932	D	0	.	20.0762	0.97745	0.0:0.0:1.0:0.0	.	328;318	Q9UBV4;E9PH60	WNT16_HUMAN;.	D	318;328	ENSP00000355065:G318D;ENSP00000222462:G328D	ENSP00000222462:G328D	G	+	2	0	WNT16	120766520	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.756000	0.94617	0.655000	0.94253	GGT	-	HMMPfam_wnt		0.527	WNT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT16	protein_coding	OTTHUMT00000346843.1	G	NM_057168		120766520	1	no_errors	NM_057168	genbank	human	reviewed	54_36p	missense	SNP	1	A
MAGI2	9863	genome.wustl.edu	37	7	77885461	77885461	+	Missense_Mutation	SNP	C	C	G	rs140241281		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:77885461C>G	ENST00000354212.4	-	10	2099	c.1846G>C	c.(1846-1848)Ggc>Cgc	p.G616R	MAGI2_ENST00000419488.1_Missense_Mutation_p.G616R|MAGI2_ENST00000535697.1_Missense_Mutation_p.G453R|MAGI2_ENST00000522391.1_Missense_Mutation_p.G616R|MAGI2_ENST00000536571.1_Missense_Mutation_p.G448R	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	616	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.G616R(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ATAGTGAAGCCGAAGCCCTGG	0.522																																																1	Substitution - Missense(1)	ovary(1)	7											73.0	64.0	67.0					7																	77885461		2203	4300	6503	77723397	SO:0001583	missense	9863			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1846G>C	7.37:g.77885461C>G	ENSP00000346151:p.Gly616Arg		77723397	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	HMMPfam_WW;superfamily_WW domain;HMMPfam_PDZ;superfamily_PDZ domain-like;HMMPfam_Guanylate_kin;superfamily_P-loop containing nucleoside triphosphate hydrolases	p.G616R	ENST00000354212.4	37	c.1846	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305951	0.81247	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	D;D;D;D;D	0.89746	-2.56;-2.56;-2.56;-2.56;-2.56	5.85	5.85	0.93711	PDZ/DHR/GLGF (4);	0.000000	0.37261	U	0.002175	D	0.97099	0.9052	H	0.98388	4.22	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.98202	1.0468	10	0.87932	D	0	.	19.1657	0.93557	0.0:1.0:0.0:0.0	.	453;448;616;616;616;616	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	R	616;616;616;616;448;453	ENSP00000405766:G616R;ENSP00000346151:G616R;ENSP00000428389:G616R;ENSP00000441584:G448R;ENSP00000441603:G453R	ENSP00000346151:G616R	G	-	1	0	MAGI2	77723397	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	7.818000	0.86416	2.771000	0.95319	0.561000	0.74099	GGC	-	NULL		0.522	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	protein_coding	OTTHUMT00000253197.3	C	NM_012301		77723397	-1	no_errors	NM_012301	genbank	human	reviewed	54_36p	missense	SNP	1	G
STAG3	10734	genome.wustl.edu	37	7	99798487	99798487	+	Silent	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:99798487C>T	ENST00000426455.1	+	19	2363	c.1956C>T	c.(1954-1956)ctC>ctT	p.L652L	STAG3_ENST00000394018.2_Silent_p.L594L|GATS_ENST00000436886.2_3'UTR|GATS_ENST00000543273.1_RNA|STAG3_ENST00000317296.5_Silent_p.L652L|STAG3_ENST00000440830.1_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	652					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)		p.L652L(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTACCTGCTCTGTAATCCCG	0.587																																																1	Substitution - coding silent(1)	ovary(1)	7											54.0	51.0	52.0					7																	99798487		2203	4300	6503	99636423	SO:0001819	synonymous_variant	10734			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.1956C>T	7.37:g.99798487C>T			99636423	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Silent	SNP	HMMPfam_STAG,superfamily_ARM repeat	p.L652	ENST00000426455.1	37	c.1956	CCDS34703.1	7																																																																																			-	NULL		0.587	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	protein_coding	OTTHUMT00000338734.2	C	NM_012447		99636423	1	no_errors	NM_012447	genbank	human	validated	54_36p	silent	SNP	1	T
TRIM24	8805	genome.wustl.edu	37	7	138269549	138269549	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr7:138269549G>C	ENST00000343526.4	+	19	3221	c.3006G>C	c.(3004-3006)aaG>aaC	p.K1002N	TRIM24_ENST00000415680.2_Missense_Mutation_p.K968N			O15164	TIF1A_HUMAN	tripartite motif containing 24	1002					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.K968N(1)|p.K1002N(1)		breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						AACTTCTAAAGAACCTCTATC	0.333																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)											2	Substitution - Missense(2)	ovary(2)	7											52.0	53.0	53.0					7																	138269549		2200	4299	6499	137920089	SO:0001583	missense	8805			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.3006G>C	7.37:g.138269549G>C	ENSP00000340507:p.Lys1002Asn		137920089	A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	zf-B_box;HMMPfam_zf-B_box;Bromodomain;HMMPfam_Bromodomain;zf-C3HC4;HMMPfam_zf-C3HC4;PHD;HMMPfam_PHD;FYVE/PHD zinc finger;superfamily_FYVE/PHD zinc finger;superfamily_Bromodomain;B-box zinc-binding domain;superfamily_B-box zinc-binding domain;RING/U-box;superfamily_RING/U-box	p.K1002N	ENST00000343526.4	37	c.3006	CCDS5847.1	7	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331646	0.41297	.	.	ENSG00000122779	ENST00000343526;ENST00000452999;ENST00000536822;ENST00000415680	T;T	0.19669	2.13;2.13	5.85	3.83	0.44106	Bromodomain (3);	0.328795	0.33875	N	0.004467	T	0.19046	0.0457	L	0.43152	1.355	0.39408	D	0.966698	P;P	0.47677	0.899;0.483	P;P	0.46076	0.503;0.479	T	0.04268	-1.0964	10	0.25106	T	0.35	-20.4118	7.0927	0.25293	0.1931:0.1455:0.6615:0.0	.	1002;968	O15164;O15164-2	TIF1A_HUMAN;.	N	1002;394;913;968	ENSP00000340507:K1002N;ENSP00000390829:K968N	ENSP00000340507:K1002N	K	+	3	2	TRIM24	137920089	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.926000	0.40084	1.480000	0.48289	-0.142000	0.14014	AAG	-	NULL		0.333	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM24	protein_coding	OTTHUMT00000341814.1	G	NM_015905		137920089	1	no_errors	NM_015905	genbank	human	reviewed	54_36p	missense	SNP	1	C
ALDH1A1	216	genome.wustl.edu	37	9	75531968	75531968	+	Silent	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chr9:75531968C>T	ENST00000297785.3	-	9	957	c.903G>A	c.(901-903)caG>caA	p.Q301Q	ALDH1A1_ENST00000376939.1_Missense_Mutation_p.S228N	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	301					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)	p.Q301Q(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	CTATACAACACTGGCCCTGGT	0.383																																																1	Substitution - coding silent(1)	ovary(1)	9											104.0	108.0	107.0					9																	75531968		2203	4300	6503	74721788	SO:0001819	synonymous_variant	216			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.903G>A	9.37:g.75531968C>T			74721788	O00768|Q5SYR1	Missense_Mutation	SNP	-	p.S228N	ENST00000297785.3	37	c.683	CCDS6644.1	9	.	.	.	.	.	.	.	.	.	.	C	13.24	2.179374	0.38511	.	.	ENSG00000165092	ENST00000376939	T	0.16073	2.37	5.95	-7.39	0.01402	.	.	.	.	.	T	0.25827	0.0629	.	.	.	0.22253	N	0.999252	.	.	.	.	.	.	T	0.43048	-0.9415	6	0.87932	D	0	.	17.9843	0.89151	0.0:0.3046:0.0:0.6954	.	.	.	.	N	228	ENSP00000366138:S228N	ENSP00000366138:S228N	S	-	2	0	ALDH1A1	74721788	0.013000	0.17824	0.252000	0.24328	0.526000	0.34562	-0.979000	0.03774	-1.709000	0.01399	-0.781000	0.03364	AGT	-	NULL		0.383	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	protein_coding	OTTHUMT00000052679.1	C			74721788	-1	no_errors	ENST00000376939	ensembl	human	known	54_36p	missense	SNP	0.98	T
NXF4	55999	genome.wustl.edu	37	X	101822813	101822813	+	RNA	SNP	T	T	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:101822813T>G	ENST00000360035.2	+	0	2566					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						TGTTCTTGCCTTCACCCGAAC	0.468																																																0			X																																								101709469			55999			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101822813T>G			101709469		RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			-	-		0.468	NXF4-001	KNOWN	basic	processed_transcript	NXF4	pseudogene	OTTHUMT00000095720.1	T			101709469	1	pseudogene	NR_002216	genbank	human	validated	54_36p	rna	SNP	1	G
RGAG1	57529	genome.wustl.edu	37	X	109694909	109694909	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:109694909C>A	ENST00000465301.2	+	3	1310	c.1064C>A	c.(1063-1065)cCc>cAc	p.P355H	RGAG1_ENST00000540313.1_Missense_Mutation_p.P355H	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	355								p.P355H(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ACGGCCCTACCCTCTGGAGTG	0.537																																																1	Substitution - Missense(1)	ovary(1)	X											213.0	205.0	208.0					X																	109694909		2203	4300	6503	109581565	SO:0001583	missense	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1064C>A	X.37:g.109694909C>A	ENSP00000419786:p.Pro355His		109581565	Q9P2M8	Missense_Mutation	SNP	HMMPfam_Retrotrans_gag	p.P355H	ENST00000465301.2	37	c.1064	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304245	0.40795	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.43688	0.94;0.94	4.42	1.58	0.23477	.	1.030010	0.07799	N	0.956251	T	0.33089	0.0851	N	0.19112	0.55	0.09310	N	1	P	0.51791	0.948	P	0.47162	0.54	T	0.21177	-1.0253	9	.	.	.	1.1667	8.4118	0.32648	0.1614:0.5308:0.3078:0.0	.	355	Q8NET4	RGAG1_HUMAN	H	355	ENSP00000419786:P355H;ENSP00000441452:P355H	.	P	+	2	0	RGAG1	109581565	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.103000	0.15292	0.195000	0.20347	0.600000	0.82982	CCC	-	NULL		0.537	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	protein_coding	OTTHUMT00000057906.2	C	NM_020769		109581565	1	no_errors	NM_020769	genbank	human	provisional	54_36p	missense	SNP	0.1	A
SLC6A14	11254	genome.wustl.edu	37	X	115572242	115572242	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:115572242G>C	ENST00000371900.4	+	3	411	c.323G>C	c.(322-324)tGg>tCg	p.W108S		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	108					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)	p.W108S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	GTTTCAGTTTGGAGGATTCTT	0.363																																																1	Substitution - Missense(1)	ovary(1)	X											276.0	252.0	260.0					X																	115572242		2203	4300	6503	115486270	SO:0001583	missense	11254			AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.323G>C	X.37:g.115572242G>C	ENSP00000360967:p.Trp108Ser		115486270	Q5H942	Missense_Mutation	SNP	-	p.W108S	ENST00000371900.4	37	c.323	CCDS14570.1	X	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096114	0.76870	.	.	ENSG00000087916	ENST00000371900	T	0.80123	-1.34	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.92299	0.7557	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94342	0.7571	10	0.87932	D	0	.	15.3277	0.74179	0.0:0.0:1.0:0.0	.	108	Q9UN76	S6A14_HUMAN	S	108	ENSP00000360967:W108S	ENSP00000360967:W108S	W	+	2	0	SLC6A14	115486270	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.110000	0.94302	2.211000	0.71520	0.544000	0.68410	TGG	-	NULL		0.363	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A14	protein_coding	OTTHUMT00000057986.1	G			115486270	1	no_errors	NM_007231	genbank	human	validated	54_36p	missense	SNP	1	C
XIAP	331	genome.wustl.edu	37	X	123020045	123020045	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:123020045A>G	ENST00000371199.3	+	2	832	c.533A>G	c.(532-534)cAc>cGc	p.H178R	XIAP_ENST00000355640.3_Missense_Mutation_p.H178R|XIAP_ENST00000468691.1_Intron|XIAP_ENST00000434753.3_Missense_Mutation_p.H178R	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	178					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.H178R(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						GACTATGCTCACCTAACCCCA	0.443									X-linked Lymphoproliferative syndrome																																							1	Substitution - Missense(1)	ovary(1)	X											106.0	93.0	97.0					X																	123020045		2203	4300	6503	122847726	SO:0001583	missense	331	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.533A>G	X.37:g.123020045A>G	ENSP00000360242:p.His178Arg		122847726	D3DTF2|Q9NQ14	Missense_Mutation	SNP	-	p.H178R	ENST00000371199.3	37	c.533	CCDS14606.1	X	.	.	.	.	.	.	.	.	.	.	A	12.35	1.913107	0.33815	.	.	ENSG00000101966	ENST00000434753;ENST00000371199;ENST00000355640	T;T;T	0.71222	-0.55;-0.55;-0.55	5.74	4.51	0.55191	Baculoviral inhibition of apoptosis protein repeat (5);	0.169781	0.40640	N	0.001053	T	0.49218	0.1544	N	0.11427	0.14	0.32007	N	0.602567	D	0.60575	0.988	P	0.47864	0.559	T	0.57093	-0.7870	9	.	.	.	-10.4125	1.4217	0.02314	0.4167:0.259:0.084:0.2403	.	178	P98170	XIAP_HUMAN	R	178	ENSP00000395230:H178R;ENSP00000360242:H178R;ENSP00000347858:H178R	.	H	+	2	0	XIAP	122847726	0.803000	0.28956	0.998000	0.56505	0.912000	0.54170	1.776000	0.38594	1.941000	0.56285	0.413000	0.27773	CAC	-	NULL		0.443	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	XIAP	protein_coding	OTTHUMT00000058165.5	A	NM_001167		122847726	1	no_errors	NM_001167	genbank	human	reviewed	54_36p	missense	SNP	0.65	G
PRRG3	79057	genome.wustl.edu	37	X	150869300	150869301	+	Frame_Shift_Ins	INS	-	-	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_III	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:150869300_150869301insT	ENST00000370353.3	+	4	881_882	c.491_492insT	c.(490-495)gggggcfs	p.GG164fs	PRRG3_ENST00000538575.1_Frame_Shift_Ins_p.GG164fs			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	164						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.R166fs*14(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					CCCAGTCGGGGGGGCAGGACCA	0.663																																																1	Insertion - Frameshift(1)	ovary(1)	X																																								150619957	SO:0001589	frameshift_variant	79057			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	Exception_encountered	X.37:g.150869300_150869301insT	ENSP00000359378:p.Gly164fs		150619956	A1A523|A1A575|Q8N2N6	Frame_Shift_Ins	INS	-	p.R166fs	ENST00000370353.3	37	c.491_492	CCDS14699.1	X																																																																																			-	NULL		0.663	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	protein_coding	OTTHUMT00000060880.1	-	NM_024082		150619957	1	no_errors	NM_024082	genbank	human	provisional	54_36p	frame_shift_ins	INS	0.269:0.274	T
ZNF81	347344	genome.wustl.edu	37	X	47774835	47774835	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:47774835A>G	ENST00000376954.1	+	6	1158	c.790A>G	c.(790-792)Aat>Gat	p.N264D	ZNF81_ENST00000338637.7_Missense_Mutation_p.N264D			P51508	ZNF81_HUMAN	zinc finger protein 81	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				ACTCAGTCAAAATGTGAAATT	0.393																																																0			X											56.0	52.0	53.0					X																	47774835		1914	4104	6018	47659779	SO:0001583	missense	347344			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.790A>G	X.37:g.47774835A>G	ENSP00000366153:p.Asn264Asp		47659779	Q6RX22|Q96QH6	Missense_Mutation	SNP	-	p.N264D	ENST00000376954.1	37	c.790	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	A	14.05	2.420266	0.42918	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.14893	2.47;2.47	3.8	2.62	0.31277	.	0.176982	0.27402	N	0.019538	T	0.09335	0.0230	L	0.27053	0.805	0.21915	N	0.999479	P	0.37781	0.608	B	0.29942	0.109	T	0.21211	-1.0252	10	0.87932	D	0	.	6.5075	0.22204	0.754:0.246:0.0:0.0	.	264	P51508	ZNF81_HUMAN	D	264	ENSP00000366153:N264D;ENSP00000341151:N264D	ENSP00000341151:N264D	N	+	1	0	ZNF81	47659779	0.527000	0.26306	0.454000	0.27019	0.913000	0.54294	2.499000	0.45372	0.628000	0.30357	-0.377000	0.06932	AAT	-	NULL		0.393	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	protein_coding	OTTHUMT00000056455.2	A	NM_007137		47659779	1	no_errors	NM_007137	genbank	human	validated	54_36p	missense	SNP	0.17	G
TAF1	6872	genome.wustl.edu	37	X	70679539	70679539	+	Missense_Mutation	SNP	A	A	C	rs202061337		TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	A	A	A	C	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:70679539A>C	ENST00000373790.4	+	36	5250	c.5199A>C	c.(5197-5199)gaA>gaC	p.E1733D	TAF1_ENST00000449580.1_Missense_Mutation_p.E1767D|TAF1_ENST00000461764.1_3'UTR|TAF1_ENST00000423759.1_Missense_Mutation_p.E1756D|TAF1_ENST00000276072.3_Missense_Mutation_p.E1754D	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1733	Asp/Glu-rich (acidic tail).|Protein kinase 2.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.E1733D(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GTGATGAAGAAGGAGACAATC	0.473																																																1	Substitution - Missense(1)	ovary(1)	X											262.0	192.0	216.0					X																	70679539		2203	4300	6503	70596264	SO:0001583	missense	6872				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.5199A>C	X.37:g.70679539A>C	ENSP00000362895:p.Glu1733Asp		70596264	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	Bromodomain;HMMPfam_Bromodomain;TBP-binding;HMMPfam_TBP-binding;TAF(II)230 TBP-binding fragment;superfamily_TAF(II)230 TBP-binding fragment;superfamily_Bromodomain	p.E1754D	ENST00000373790.4	37	c.5262	CCDS35325.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.78|14.78	2.637112|2.637112	0.47049|0.47049	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000276072|ENST00000437147	T;T;T;T|.	0.10763|.	2.89;2.84;2.95;2.9|.	4.8|4.8	4.8|4.8	0.61643|0.61643	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.40196|0.40196	0.1107|0.1107	N|N	0.20685|0.20685	0.6|0.6	0.46298|0.46298	D|D	0.998978|0.998978	D;D;P;D|.	0.65815|.	0.995;0.99;0.956;0.974|.	D;D;D;D|.	0.73380|.	0.98;0.98;0.931;0.969|.	T|T	0.23833|0.23833	-1.0177|-1.0177	10|5	0.20519|.	T|.	0.43|.	.|.	8.1511|8.1511	0.31141|0.31141	0.8482:0.0:0.1518:0.0|0.8482:0.0:0.1518:0.0	.|.	423;1767;1733;1754|.	A5CVC9;P21675-4;P21675;P21675-2|.	.;.;TAF1_HUMAN;.|.	D|T	1733;1767;1756;475;1754|422	ENSP00000362895:E1733D;ENSP00000389000:E1767D;ENSP00000406549:E1756D;ENSP00000276072:E1754D|.	ENSP00000276072:E1754D|.	E|K	+|+	3|2	2|0	TAF1|TAF1	70596264|70596264	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	3.071000|3.071000	0.50041|0.50041	1.781000|1.781000	0.52344|0.52344	0.430000|0.430000	0.28490|0.28490	GAA|AAG	-	NULL		0.473	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	protein_coding	OTTHUMT00000058995.2	A	NM_004606		70596264	1	no_errors	NM_004606	genbank	human	reviewed	54_36p	missense	SNP	1	C
CXCR3	2833	genome.wustl.edu	37	X	70837303	70837303	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1482-01A-01W-0549-09	TCGA-13-1482-10A-01W-0549-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	a68927d4-e827-49c9-9c3a-23ce0543261b	f0b7b00b-78e4-4668-950c-bc311cdc8d97	g.chrX:70837303C>T	ENST00000373693.3	-	2	86	c.19G>A	c.(19-21)Gac>Aac	p.D7N	CXCR3_ENST00000373691.4_Missense_Mutation_p.D54N	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	7					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)	p.D7N(1)		breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					ACTTGGTGGTCACTCACCTGT	0.522																																																1	Substitution - Missense(1)	ovary(1)	X											45.0	48.0	47.0					X																	70837303		2183	4260	6443	70754028	SO:0001583	missense	2833			U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.19G>A	X.37:g.70837303C>T	ENSP00000362797:p.Asp7Asn		70754028	B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	HMMPfam_7tm_1;superfamily_Family A G protein-coupled receptor-like	p.D7N	ENST00000373693.3	37	c.19	CCDS14416.1	X	.	.	.	.	.	.	.	.	.	.	C	10.62	1.400206	0.25291	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.70869	-0.52;-0.46	4.55	1.84	0.25277	.	6.577780	0.00397	N	0.000048	T	0.58935	0.2157	N	0.22421	0.69	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.06405	0.001;0.002	T	0.44221	-0.9342	10	0.48119	T	0.1	.	6.2166	0.20658	0.0:0.6777:0.0:0.3223	.	54;7	P49682-2;P49682	.;CXCR3_HUMAN	N	54;7;7	ENSP00000362795:D54N;ENSP00000362797:D7N	ENSP00000362791:D7N	D	-	1	0	CXCR3	70754028	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.787000	0.04618	0.137000	0.18759	-0.322000	0.08575	GAC	-	NULL		0.522	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR3	protein_coding	OTTHUMT00000144141.1	C			70754028	-1	no_errors	NM_001504	genbank	human	reviewed	54_36p	missense	SNP		T
