#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLCH2	9651	broad.mit.edu	37	1	2420688	2420688	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr1:2420688C>G	ENST00000419816.2	+	9	1552	c.1278C>G	c.(1276-1278)atC>atG	p.I426M	PLCH2_ENST00000449969.1_Missense_Mutation_p.I399M|PLCH2_ENST00000378486.3_Missense_Mutation_p.I426M|PLCH2_ENST00000288766.5_Intron|PLCH2_ENST00000378488.3_Missense_Mutation_p.I426M			O75038	PLCH2_HUMAN	phospholipase C, eta 2	426	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.I273M(1)		central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GCAGTGTCATCCAGCAGAAGA	0.557																																																1	Substitution - Missense(1)	ovary(1)	1											186.0	184.0	185.0					1																	2420688		2079	4213	6292	2410548	SO:0001583	missense	9651			AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.1278C>G	1.37:g.2420688C>G	ENSP00000389803:p.Ile426Met		2410548	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	ENST00000419816.2	37		.	.	.	.	.	.	.	.	.	.	C	13.17	2.157220	0.38119	.	.	ENSG00000149527	ENST00000449969;ENST00000378486;ENST00000378488;ENST00000343889;ENST00000278878	T;T;T	0.62941	-0.01;-0.01;-0.01	5.25	-0.715	0.11215	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	1.258880	0.05139	N	0.493813	T	0.51075	0.1653	L	0.34521	1.04	0.80722	D	1	P;P;P;P	0.41710	0.76;0.76;0.704;0.76	P;P;B;P	0.45474	0.482;0.482;0.286;0.482	T	0.54497	-0.8285	10	0.30854	T	0.27	.	1.7164	0.02902	0.1275:0.1905:0.3602:0.3218	.	273;214;399;426	B9DI81;B9DI82;O75038-2;O75038	.;.;.;PLCH2_HUMAN	M	399;426;426;273;214	ENSP00000397289:I399M;ENSP00000367747:I426M;ENSP00000367749:I426M	ENSP00000278878:I214M	I	+	3	3	PLCH2	2410548	0.003000	0.15002	0.332000	0.25469	0.966000	0.64601	-0.005000	0.12855	0.194000	0.20326	-0.258000	0.10820	ATC		0.557	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467514.1	NM_014638	
CRNN	49860	broad.mit.edu	37	1	152382720	152382720	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr1:152382720G>T	ENST00000271835.3	-	3	900	c.838C>A	c.(838-840)Cag>Aag	p.Q280K	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	280	Gln-rich.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.Q280K(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCACAGCCTGGCTGGTCTGG	0.607																																																1	Substitution - Missense(1)	ovary(1)	1											272.0	268.0	269.0					1																	152382720		2203	4300	6503	150649344	SO:0001583	missense	49860			AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.838C>A	1.37:g.152382720G>T	ENSP00000271835:p.Gln280Lys		150649344	B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	37	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	G	17.71	3.456867	0.63401	.	.	ENSG00000143536	ENST00000271835	T	0.04454	3.62	4.83	3.87	0.44632	.	0.128385	0.36002	N	0.002858	T	0.06917	0.0176	L	0.46157	1.445	0.09310	N	0.999996	D	0.71674	0.998	D	0.79108	0.992	T	0.10683	-1.0619	10	0.48119	T	0.1	.	10.142	0.42740	0.0:0.2205:0.7795:0.0	.	280	Q9UBG3	CRNN_HUMAN	K	280	ENSP00000271835:Q280K	ENSP00000271835:Q280K	Q	-	1	0	CRNN	150649344	0.811000	0.29063	0.873000	0.34254	0.248000	0.25809	1.701000	0.37825	2.489000	0.83994	0.585000	0.79938	CAG		0.607	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
NTRK1	4914	broad.mit.edu	37	1	156846212	156846212	+	Silent	SNP	G	G	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr1:156846212G>A	ENST00000524377.1	+	14	1694	c.1653G>A	c.(1651-1653)gaG>gaA	p.E551E	NTRK1_ENST00000368196.3_Silent_p.E545E|NTRK1_ENST00000392302.2_Silent_p.E515E|NTRK1_ENST00000358660.3_Silent_p.E548E	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	551	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E551E(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	AGGCGTCCGAGAGTGCTCGGC	0.682			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																													Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	1	Substitution - coding silent(1)	ovary(1)	1											48.0	46.0	47.0					1																	156846212		2203	4300	6503	155112836	SO:0001819	synonymous_variant	4914			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1653G>A	1.37:g.156846212G>A			155112836	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	ENST00000524377.1	37	CCDS1161.1																																																																																				0.682	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
ANXA7	310	broad.mit.edu	37	10	75156305	75156305	+	Missense_Mutation	SNP	G	G	C	rs534428824	byFrequency	TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr10:75156305G>C	ENST00000372921.5	-	5	463	c.407C>G	c.(406-408)cCt>cGt	p.P136R	ANXA7_ENST00000492380.1_5'UTR|ANXA7_ENST00000535178.1_Missense_Mutation_p.P6R	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	136	Repeat-rich region.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)	p.P136R(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					TTGTCCTCCAGGATACTGAGA	0.373																																																1	Substitution - Missense(1)	ovary(1)	10											71.0	66.0	68.0					10																	75156305		2203	4300	6503	74826311	SO:0001583	missense	310			J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.407C>G	10.37:g.75156305G>C	ENSP00000362012:p.Pro136Arg		74826311	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	ENST00000372921.5	37	CCDS7325.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.768988	0.69992	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178;ENST00000394847	T;T;T	0.05139	3.49;4.33;3.49	5.45	3.55	0.40652	.	2.506280	0.01205	N	0.007688	T	0.23649	0.0572	L	0.54323	1.7	0.44024	D	0.996748	D;D;D;D;D	0.89917	0.998;0.993;0.987;0.996;1.0	P;P;P;D;D	0.91635	0.878;0.878;0.634;0.943;0.999	T	0.00072	-1.2129	10	0.56958	D	0.05	.	9.169	0.37069	0.0:0.16:0.6738:0.1662	.	136;136;63;136;136	Q53HM8;B2R7L2;B4DWU2;P20073-2;P20073	.;.;.;.;ANXA7_HUMAN	R	136;136;6;136	ENSP00000362012:P136R;ENSP00000362010:P136R;ENSP00000442864:P6R	ENSP00000362010:P136R	P	-	2	0	ANXA7	74826311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.947000	0.49058	0.734000	0.32515	0.650000	0.86243	CCT		0.373	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048646.2	NM_001156	
LCOR	84458	broad.mit.edu	37	10	98708852	98708852	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr10:98708852C>T	ENST00000371097.4	+	6	584	c.38C>T	c.(37-39)aCc>aTc	p.T13I	LCOR_ENST00000356016.3_Missense_Mutation_p.T13I|LCOR_ENST00000540664.1_Missense_Mutation_p.T13I|LCOR_ENST00000371103.3_Missense_Mutation_p.T13I			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	13					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T13I(1)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GCTGAATATACCTCAAAAAAT	0.507																																																1	Substitution - Missense(1)	ovary(1)	10											84.0	83.0	83.0					10																	98708852		2203	4300	6503	98698842	SO:0001583	missense	84458				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.38C>T	10.37:g.98708852C>T	ENSP00000360138:p.Thr13Ile		98698842	D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	ENST00000371097.4	37	CCDS7451.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.713690	0.48517	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.58935	0.2157	N	0.16368	0.405	0.53005	D	0.999967	D;D	0.69078	0.994;0.997	D;D	0.77557	0.99;0.979	T	0.51795	-0.8660	9	0.07175	T	0.84	-2.6279	18.323	0.90244	0.0:1.0:0.0:0.0	.	13;13	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	I	13	.	ENSP00000348298:T13I	T	+	2	0	LCOR	98698842	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.866000	0.69590	2.379000	0.81126	0.650000	0.86243	ACC		0.507	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049628.2		
RRP12	23223	broad.mit.edu	37	10	99150572	99150572	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr10:99150572A>T	ENST00000370992.4	-	5	671	c.560T>A	c.(559-561)tTc>tAc	p.F187Y	RRP12_ENST00000315563.6_Intron|RRP12_ENST00000414986.1_Intron|RRP12_ENST00000536831.1_5'UTR	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	187						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.F187Y(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		GGTATCAGAGAACTTCTTAAT	0.542																																																1	Substitution - Missense(1)	ovary(1)	10											137.0	141.0	139.0					10																	99150572		2203	4300	6503	99140562	SO:0001583	missense	23223				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.560T>A	10.37:g.99150572A>T	ENSP00000360031:p.Phe187Tyr		99140562	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	ENST00000370992.4	37	CCDS7457.1	.	.	.	.	.	.	.	.	.	.	A	34	5.379580	0.95945	.	.	ENSG00000052749	ENST00000370992	T	0.65549	-0.16	5.78	5.78	0.91487	Armadillo-like helical (1);Armadillo-type fold (1);	0.044332	0.85682	D	0.000000	T	0.79323	0.4426	M	0.89601	3.045	0.80722	D	1	P	0.46395	0.877	P	0.53266	0.722	D	0.83903	0.0291	10	0.87932	D	0	-14.1579	16.1528	0.81634	1.0:0.0:0.0:0.0	.	187	Q5JTH9	RRP12_HUMAN	Y	187	ENSP00000360031:F187Y	ENSP00000360031:F187Y	F	-	2	0	RRP12	99140562	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.041000	0.76558	2.210000	0.71456	0.529000	0.55759	TTC		0.542	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179	
CRTAC1	55118	broad.mit.edu	37	10	99667899	99667899	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr10:99667899G>A	ENST00000370597.3	-	6	1076	c.721C>T	c.(721-723)Cga>Tga	p.R241*	CRTAC1_ENST00000298819.4_Nonsense_Mutation_p.R241*|CRTAC1_ENST00000370591.2_Nonsense_Mutation_p.R241*	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	241						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.R241*(1)		autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CTGACGCCTCGGCCCCCTAGA	0.617																																																1	Substitution - Nonsense(1)	ovary(1)	10											45.0	38.0	40.0					10																	99667899		2203	4300	6503	99657889	SO:0001587	stop_gained	55118			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.721C>T	10.37:g.99667899G>A	ENSP00000359629:p.Arg241*		99657889	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Nonsense_Mutation	SNP	ENST00000370597.3	37	CCDS31266.1	.	.	.	.	.	.	.	.	.	.	G	41	9.069125	0.99055	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5904	18.8318	0.92143	0.0:0.0:1.0:0.0	.	.	.	.	X	137;241;241;233;241	.	ENSP00000298819:R241X	R	-	1	2	CRTAC1	99657889	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	6.652000	0.74377	2.440000	0.82611	0.555000	0.69702	CGA		0.617	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058	
PPRC1	23082	broad.mit.edu	37	10	103897627	103897627	+	Silent	SNP	G	G	A	rs574814323		TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr10:103897627G>A	ENST00000278070.2	+	2	213	c.174G>A	c.(172-174)gcG>gcA	p.A58A	PPRC1_ENST00000413464.2_Silent_p.A58A	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	58					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.A58A(1)		central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		ATGAGGAGGCGGGTGATTCTG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		19871	0.0		0.0	False		,,,				2504	0.001															1	Substitution - coding silent(1)	ovary(1)	10											83.0	70.0	74.0					10																	103897627		2203	4300	6503	103887617	SO:0001819	synonymous_variant	23082			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.174G>A	10.37:g.103897627G>A			103887617	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Silent	SNP	ENST00000278070.2	37	CCDS7529.1																																																																																				0.547	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
OBFC1	79991	broad.mit.edu	37	10	105648867	105648867	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr10:105648867G>C	ENST00000224950.3	-	9	1079	c.912C>G	c.(910-912)atC>atG	p.I304M	OBFC1_ENST00000369764.1_Missense_Mutation_p.I304M|OBFC1_ENST00000466828.1_5'UTR	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	304	Winged helix-turn-helix (wHTH) 2.				positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)	p.I304M(1)		large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		TGATCCGGTGGATCTTTCTGT	0.468																																																1	Substitution - Missense(1)	ovary(1)	10											164.0	152.0	156.0					10																	105648867		2203	4300	6503	105638857	SO:0001583	missense	79991			BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.912C>G	10.37:g.105648867G>C	ENSP00000224950:p.Ile304Met		105638857	D3DR99|Q5TCZ0	Missense_Mutation	SNP	ENST00000224950.3	37	CCDS7552.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082355	0.36758	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.55052	0.54;0.54	5.25	2.34	0.29019	Domain of unknown function DUF1879, CTS complex STN1 subunit (1);	0.181068	0.48767	D	0.000161	T	0.59622	0.2207	M	0.75447	2.3	0.35338	D	0.786276	P	0.50819	0.939	P	0.53006	0.715	T	0.66999	-0.5781	10	0.72032	D	0.01	-10.2385	7.2178	0.25969	0.0812:0.0:0.6164:0.3024	.	304	Q9H668	STN1_HUMAN	M	304	ENSP00000224950:I304M;ENSP00000358779:I304M	ENSP00000224950:I304M	I	-	3	3	OBFC1	105638857	1.000000	0.71417	0.209000	0.23619	0.299000	0.27559	2.737000	0.47393	0.199000	0.20427	0.561000	0.74099	ATC		0.468	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050174.1	NM_024928	
KIAA1549L	25758	broad.mit.edu	37	11	33566506	33566506	+	Silent	SNP	C	C	T	rs531225970		TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr11:33566506C>T	ENST00000321505.4	+	2	2256	c.2076C>T	c.(2074-2076)gcC>gcT	p.A692A	KIAA1549L_ENST00000389726.3_Silent_p.A698A|KIAA1549L_ENST00000265654.5_Silent_p.A698A			Q6ZVL6	K154L_HUMAN	KIAA1549-like	692						integral component of membrane (GO:0016021)		p.A698A(1)									CAAACAAGGCCGCATCTGGCC	0.527													c|||	1	0.000199681	0.0	0.0	5008	,	,		22666	0.0		0.001	False		,,,				2504	0.0															1	Substitution - coding silent(1)	ovary(1)	11											71.0	83.0	79.0					11																	33566506		2051	4177	6228	33523082	SO:0001819	synonymous_variant	25758			U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2076C>T	11.37:g.33566506C>T			33523082	B0QYU0	Silent	SNP	ENST00000321505.4	37	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	c	0.014	-1.593529	0.00864	.	.	ENSG00000110427	ENST00000526400	.	.	.	4.7	-6.27	0.02026	.	.	.	.	.	T	0.15305	0.0369	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22138	-1.0225	4	.	.	.	-0.568	0.7139	0.00929	0.1698:0.2853:0.2239:0.321	.	.	.	.	L	90	.	.	P	+	2	0	C11orf41	33523082	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.092000	0.11129	-1.595000	0.01613	-3.005000	0.00076	CCG		0.527	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
RNF169	254225	broad.mit.edu	37	11	74556116	74556116	+	IGR	SNP	A	A	G			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr11:74556116A>G	ENST00000299563.4	+	0	7823				XRRA1_ENST00000340360.6_Splice_Site|XRRA1_ENST00000527087.1_Splice_Site|RN7SL239P_ENST00000490061.2_RNA|XRRA1_ENST00000321448.8_Splice_Site	NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169						cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						GCCCTCACATACCCTTTGGCT	0.547																																																0			11											136.0	139.0	138.0					11																	74556116		2016	4183	6199	74233764	SO:0001628	intergenic_variant	143570			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516		11.37:g.74556116A>G			74233764	Q6N015	Splice_Site	SNP	ENST00000299563.4	37	CCDS41691.1	.	.	.	.	.	.	.	.	.	.	A	18.05	3.537549	0.65085	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418;ENST00000527087	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8738	0.63638	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	XRRA1	74233764	1.000000	0.71417	0.988000	0.46212	0.771000	0.43674	5.110000	0.64622	2.371000	0.80710	0.533000	0.62120	.		0.547	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384741.1	XM_495886	
SLC37A2	219855	broad.mit.edu	37	11	124950579	124950579	+	Silent	SNP	C	C	A	rs368215154		TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr11:124950579C>A	ENST00000403796.2	+	7	898	c.597C>A	c.(595-597)gcC>gcA	p.A199A	SLC37A2_ENST00000407458.1_Silent_p.A199A|SLC37A2_ENST00000298280.5_Silent_p.A199A|SLC37A2_ENST00000308074.4_Silent_p.A199A	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	199					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)	p.A199A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		CCCTGATCGCCGGCATCTGGG	0.587																																					Melanoma(11;373 620 21213 26083 47768)											1	Substitution - coding silent(1)	ovary(1)	11											83.0	73.0	76.0					11																	124950579		2201	4299	6500	124455789	SO:0001819	synonymous_variant	219855			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.597C>A	11.37:g.124950579C>A			124455789	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Silent	SNP	ENST00000403796.2	37	CCDS44757.1																																																																																				0.587	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386837.1	XM_166184	
LRFN5	145581	broad.mit.edu	37	14	42357161	42357161	+	Missense_Mutation	SNP	C	C	T	rs548468008		TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr14:42357161C>T	ENST00000298119.4	+	3	2522	c.1333C>T	c.(1333-1335)Cgt>Tgt	p.R445C	LRFN5_ENST00000554120.1_Missense_Mutation_p.R445C|LRFN5_ENST00000554171.1_Missense_Mutation_p.R445C	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	445	Fibronectin type-III.					integral component of membrane (GO:0016021)		p.R445C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CCCTGGAATACGTATGTTTCA	0.333										HNSCC(30;0.082)																																						1	Substitution - Missense(1)	ovary(1)	14											40.0	40.0	40.0					14																	42357161		2203	4299	6502	41426911	SO:0001583	missense	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1333C>T	14.37:g.42357161C>T	ENSP00000298119:p.Arg445Cys		41426911	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	37	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690969	0.48097	.	.	ENSG00000165379	ENST00000298119;ENST00000554120;ENST00000554171	T;T;T	0.69561	-0.41;0.55;0.54	5.4	5.4	0.78164	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000021	T	0.79805	0.4509	M	0.70595	2.14	0.80722	D	1	D;P	0.69078	0.997;0.8	D;B	0.63033	0.91;0.188	T	0.81382	-0.0958	10	0.66056	D	0.02	.	17.0338	0.86468	0.0:1.0:0.0:0.0	.	445;445	G3V364;Q96NI6	.;LRFN5_HUMAN	C	445	ENSP00000298119:R445C;ENSP00000451897:R445C;ENSP00000451067:R445C	ENSP00000298119:R445C	R	+	1	0	LRFN5	41426911	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.965000	0.56788	2.680000	0.91292	0.563000	0.77884	CGT		0.333	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
KCNH5	27133	broad.mit.edu	37	14	63175122	63175122	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr14:63175122G>A	ENST00000322893.7	-	11	2339	c.2071C>T	c.(2071-2073)Cgg>Tgg	p.R691W	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	691					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.R691W(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TTCTTCTGCCGGAGGCGCTCC	0.512																																																1	Substitution - Missense(1)	ovary(1)	14											90.0	96.0	94.0					14																	63175122		2203	4300	6503	62244875	SO:0001583	missense	27133			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2071C>T	14.37:g.63175122G>A	ENSP00000321427:p.Arg691Trp		62244875	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	37	CCDS9756.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694519	0.48202	.	.	ENSG00000140015	ENST00000322893	T	0.18810	2.19	5.72	-1.01	0.10169	.	0.061597	0.64402	D	0.000005	T	0.35480	0.0933	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	P	0.55455	0.776	T	0.48958	-0.8988	10	0.72032	D	0.01	.	18.1397	0.89636	0.0:0.0:0.5687:0.4313	.	691	Q8NCM2	KCNH5_HUMAN	W	691	ENSP00000321427:R691W	ENSP00000321427:R691W	R	-	1	2	KCNH5	62244875	0.987000	0.35691	0.336000	0.25522	0.988000	0.76386	0.335000	0.19806	-0.125000	0.11703	-0.169000	0.13324	CGG		0.512	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
CES3	23491	broad.mit.edu	37	16	67000733	67000733	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr16:67000733G>T	ENST00000303334.4	+	8	1098	c.1027G>T	c.(1027-1029)Gtc>Ttc	p.V343F	CES3_ENST00000394037.1_Missense_Mutation_p.V343F|CES3_ENST00000543856.1_5'Flank	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	343						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)	p.V343F(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		CCTCATGGGTGTCAACAACCA	0.577																																																1	Substitution - Missense(1)	ovary(1)	16											135.0	132.0	133.0					16																	67000733		2200	4300	6500	65558234	SO:0001583	missense	23491			AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1027G>T	16.37:g.67000733G>T	ENSP00000304782:p.Val343Phe		65558234	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Missense_Mutation	SNP	ENST00000303334.4	37	CCDS10826.1	.	.	.	.	.	.	.	.	.	.	G	7.963	0.747408	0.15710	.	.	ENSG00000172828	ENST00000303334;ENST00000394037	T;T	0.69926	-0.44;-0.44	3.97	-4.55	0.03441	Carboxylesterase, type B (1);	0.966274	0.08423	N	0.947996	T	0.50922	0.1644	L	0.31804	0.96	0.38946	D	0.95825	B	0.20368	0.044	B	0.26614	0.071	T	0.14615	-1.0466	10	0.30078	T	0.28	.	10.0584	0.42259	0.0:0.1208:0.2634:0.6159	.	343	Q6UWW8	EST3_HUMAN	F	343	ENSP00000304782:V343F;ENSP00000377602:V343F	ENSP00000304782:V343F	V	+	1	0	CES3	65558234	0.000000	0.05858	0.308000	0.25141	0.291000	0.27294	-0.895000	0.04118	-1.177000	0.02744	-0.919000	0.02742	GTC		0.577	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
TAT	6898	broad.mit.edu	37	16	71604176	71604176	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr16:71604176A>C	ENST00000355962.4	-	9	1170	c.1037T>G	c.(1036-1038)cTc>cGc	p.L346R	RP11-432I5.1_ENST00000561529.1_RNA	NM_000353.2	NP_000344.1	P17735	ATTY_HUMAN	tyrosine aminotransferase	346					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|L-phenylalanine catabolic process (GO:0006559)|response to glucocorticoid (GO:0051384)|response to mercury ion (GO:0046689)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|L-tyrosine:2-oxoglutarate aminotransferase activity (GO:0004838)|pyridoxal phosphate binding (GO:0030170)	p.L346R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(3)	29		Ovarian(137;0.125)		Kidney(780;0.0157)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)	CCTTACCTTGAGGAAGCTCAG	0.527																																					Melanoma(198;542 2142 10292 21661 50033)|Esophageal Squamous(48;487 1013 5572 44395 52594)											1	Substitution - Missense(1)	ovary(1)	16											57.0	53.0	54.0					16																	71604176		2198	4300	6498	70161677	SO:0001583	missense	6898				CCDS10903.1	16q22.1	2012-10-02			ENSG00000198650	ENSG00000198650	2.6.1.5		11573	protein-coding gene	gene with protein product		613018					Standard	NM_000353		Approved		uc002fap.2	P17735	OTTHUMG00000137590	ENST00000355962.4:c.1037T>G	16.37:g.71604176A>C	ENSP00000348234:p.Leu346Arg		70161677	B2R8I1|D3DWS2	Missense_Mutation	SNP	ENST00000355962.4	37	CCDS10903.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.666510	0.88251	.	.	ENSG00000198650	ENST00000355962	D	0.92858	-3.12	5.7	5.7	0.88788	Tyrosine aminotransferase (1);Aminotransferase, class I/classII (1);Tyrosine/nicotianamine aminotransferase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.117288	0.64402	D	0.000013	D	0.96241	0.8774	H	0.94183	3.505	0.80722	D	1	D	0.65815	0.995	P	0.59056	0.851	D	0.96765	0.9564	10	0.87932	D	0	-23.6302	10.3856	0.44138	0.9274:0.0:0.0726:0.0	.	346	P17735	ATTY_HUMAN	R	346	ENSP00000348234:L346R	ENSP00000348234:L346R	L	-	2	0	TAT	70161677	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.570000	0.82390	2.187000	0.69744	0.524000	0.50904	CTC		0.527	TAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268989.1		
TP53	7157	broad.mit.edu	37	17	7577581	7577581	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr17:7577581A>T	ENST00000269305.4	-	7	889	c.700T>A	c.(700-702)Tac>Aac	p.Y234N	TP53_ENST00000413465.2_Missense_Mutation_p.Y234N|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.Y234N|TP53_ENST00000359597.4_Missense_Mutation_p.Y234N|TP53_ENST00000420246.2_Missense_Mutation_p.Y234N|TP53_ENST00000445888.2_Missense_Mutation_p.Y234N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	234	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y234H(20)|p.Y234N(14)|p.0?(8)|p.Y234D(6)|p.?(5)|p.Y234del(3)|p.Y141H(1)|p.Y234R(1)|p.I232_Y236delIHYNY(1)|p.Y234fs*2(1)|p.Y234fs*6(1)|p.Y141D(1)|p.T230_Y234delTTIHY(1)|p.Y141N(1)|p.H233fs*6(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.I232fs*5(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGTAGTTGTAGTGGATGGTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	71	Substitution - Missense(44)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(5)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(11)|skin(9)|stomach(6)|large_intestine(6)|breast(6)|biliary_tract(5)|prostate(5)|ovary(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|lung(2)|oesophagus(2)|liver(2)|eye(1)|kidney(1)|endometrium(1)|urinary_tract(1)	17											117.0	93.0	101.0					17																	7577581		2203	4300	6503	7518306	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.700T>A	17.37:g.7577581A>T	ENSP00000269305:p.Tyr234Asn		7518306	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	18.38	3.611438	0.66558	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99824	-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.211900	0.41823	D	0.000804	D	0.99809	0.9917	M	0.88105	2.93	0.50467	D	0.999875	D;D;D;D;D;D	0.89917	0.979;1.0;0.999;0.968;0.99;1.0	D;D;D;D;D;D	0.97110	0.911;0.997;0.983;0.923;0.971;1.0	D	0.96833	0.9612	10	0.87932	D	0	-10.1131	12.3101	0.54924	1.0:0.0:0.0:0.0	.	234;234;141;234;234;234	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	N	234;234;234;234;234;234;223;141;102;141	ENSP00000410739:Y234N;ENSP00000352610:Y234N;ENSP00000269305:Y234N;ENSP00000398846:Y234N;ENSP00000391127:Y234N;ENSP00000391478:Y234N;ENSP00000425104:Y102N;ENSP00000423862:Y141N	ENSP00000269305:Y234N	Y	-	1	0	TP53	7518306	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.278000	0.58946	2.074000	0.62210	0.379000	0.24179	TAC		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ZPBP2	124626	broad.mit.edu	37	17	38029310	38029310	+	Silent	SNP	G	G	A	rs138409314	byFrequency	TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr17:38029310G>A	ENST00000348931.4	+	6	830	c.639G>A	c.(637-639)gcG>gcA	p.A213A	ZPBP2_ENST00000584588.1_Silent_p.A140A|ZPBP2_ENST00000377940.3_Silent_p.A191A	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	213					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)		p.A213A(1)		kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			ATCCTTTTGCGCCGGGGTGGA	0.383																																																1	Substitution - coding silent(1)	ovary(1)	17											126.0	113.0	117.0					17																	38029310		2203	4300	6503	35282836	SO:0001819	synonymous_variant	124626			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.639G>A	17.37:g.38029310G>A			35282836	A8K8L8|Q6X783|Q86XL5	Silent	SNP	ENST00000348931.4	37	CCDS11352.1																																																																																				0.383	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256609.2	NM_198844	
SEPT9	10801	broad.mit.edu	37	17	75484371	75484371	+	Silent	SNP	A	A	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr17:75484371A>T	ENST00000427177.1	+	6	1218	c.1092A>T	c.(1090-1092)ccA>ccT	p.P364P	SEPT9_ENST00000431235.2_Silent_p.P200P|SEPT9_ENST00000591198.1_Silent_p.P345P|SEPT9_ENST00000541152.2_Silent_p.P113P|SEPT9_ENST00000588690.1_Silent_p.P200P|SEPT9_ENST00000427180.1_Silent_p.P252P|SEPT9_ENST00000590294.1_Silent_p.P346P|SEPT9_ENST00000585930.1_Silent_p.P140P|SEPT9_ENST00000449803.2_Silent_p.P200P|SEPT9_ENST00000591088.1_Silent_p.P113P|SEPT9_ENST00000592481.1_3'UTR|SEPT9_ENST00000329047.8_Silent_p.P346P|SEPT9_ENST00000592951.1_Silent_p.P113P|SEPT9_ENST00000423034.2_Silent_p.P357P|SEPT9_ENST00000427674.2_Silent_p.P200P	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	364	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.P346P(1)		autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			TTGACACACCAGGGTTCGGGG	0.607																																																1	Substitution - coding silent(1)	ovary(1)	17											78.0	83.0	81.0					17																	75484371		2060	4208	6268	72995966	SO:0001819	synonymous_variant	10801			AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.1092A>T	17.37:g.75484371A>T			72995966	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Silent	SNP	ENST00000427177.1	37	CCDS45790.1																																																																																				0.607	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640	
MBD3	53615	broad.mit.edu	37	19	1578479	1578479	+	Missense_Mutation	SNP	C	C	G	rs548368623		TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr19:1578479C>G	ENST00000434436.3	-	6	865	c.736G>C	c.(736-738)Gac>Cac	p.D246H	UQCR11_ENST00000585937.1_3'UTR|MBD3_ENST00000592012.1_Missense_Mutation_p.D214H|MBD3_ENST00000156825.1_Missense_Mutation_p.D246H|MBD3_ENST00000585967.1_5'Flank|MBD3_ENST00000590550.2_Missense_Mutation_p.D190H	NM_001281453.1	NP_001268382.1	O95983	MBD3_HUMAN	methyl-CpG binding domain protein 3	246					ATP-dependent chromatin remodeling (GO:0043044)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|tissue development (GO:0009888)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)	p.D246H(1)		central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.179)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGCATGTCGGCCATCAGC	0.672																																																1	Substitution - Missense(1)	ovary(1)	19											67.0	68.0	68.0					19																	1578479		2203	4300	6503	1529479	SO:0001583	missense	53615			AF072247	CCDS12072.1, CCDS62481.1	19p13	2008-07-17				ENSG00000071655			6918	protein-coding gene	gene with protein product		603573				9774669, 10441743	Standard	NM_001281454		Approved		uc002ltl.1	O95983		ENST00000434436.3:c.736G>C	19.37:g.1578479C>G	ENSP00000412302:p.Asp246His		1529479	A8K4B7|D6W5Z2|Q6PIL9|Q6PJZ9|Q86XF4	Missense_Mutation	SNP	ENST00000434436.3	37	CCDS12072.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.935106	0.73442	.	.	ENSG00000071655	ENST00000434436;ENST00000156825	D	0.99136	-5.47	4.32	4.32	0.51571	.	0.000000	0.85682	D	0.000000	D	0.98498	0.9499	L	0.29908	0.895	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.81914	0.993;0.995	D	0.99828	1.1052	10	0.56958	D	0.05	-41.8659	15.3787	0.74633	0.0:1.0:0.0:0.0	.	214;246	O95983-2;O95983	.;MBD3_HUMAN	H	214;246	ENSP00000156825:D246H	ENSP00000156825:D246H	D	-	1	0	MBD3	1529479	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	5.833000	0.69349	1.950000	0.56595	0.313000	0.20887	GAC		0.672	MBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449658.2	NM_003926	
ZNF77	58492	broad.mit.edu	37	19	2933602	2933602	+	Missense_Mutation	SNP	C	C	T	rs139100623|rs565530193	byFrequency	TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr19:2933602C>T	ENST00000314531.4	-	4	1615	c.1523G>A	c.(1522-1524)cGt>cAt	p.R508H		NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77	508					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R508H(1)		breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		CACGTGCACACGAAGGGACGA	0.493																																																1	Substitution - Missense(1)	ovary(1)	19						C	HIS/ARG	0,4406		0,0,2203	212.0	174.0	187.0		1523	1.5	0.0	19	dbSNP_134	187	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF77	NM_021217.2	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	508/546	2933602	2,13004	2203	4300	6503	2884602	SO:0001583	missense	58492			X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935		ENST00000314531.4:c.1523G>A	19.37:g.2933602C>T	ENSP00000319053:p.Arg508His		2884602	Q86XJ3|Q9NPP0	Missense_Mutation	SNP	ENST00000314531.4	37	CCDS12099.1	.	.	.	.	.	.	.	.	.	.	C	12.35	1.910970	0.33721	0.0	2.33E-4	ENSG00000175691	ENST00000341064;ENST00000314531	T	0.08102	3.13	2.56	1.5	0.22942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08044	0.0201	L	0.31120	0.905	0.09310	N	1	D	0.63880	0.993	P	0.48952	0.596	T	0.30504	-0.9976	9	0.35671	T	0.21	.	4.6621	0.12648	0.0:0.6857:0.0:0.3143	.	508	Q15935	ZNF77_HUMAN	H	302;508	ENSP00000319053:R508H	ENSP00000319053:R508H	R	-	2	0	ZNF77	2884602	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-1.909000	0.01586	0.415000	0.25817	0.491000	0.48974	CGT		0.493	ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451924.1	NM_021217	
NDUFB7	4713	broad.mit.edu	37	19	14677058	14677058	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr19:14677058C>T	ENST00000215565.2	-	3	362	c.301G>A	c.(301-303)Gag>Aag	p.E101K		NM_004146.5	NP_004137.2	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa	101					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.E101K(1)		endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						CGCTCAAACTCCTTCATGCGC	0.667																																																1	Substitution - Missense(1)	ovary(1)	19											38.0	42.0	41.0					19																	14677058		2203	4300	6503	14538058	SO:0001583	missense	4713				CCDS12314.1	19p13.12	2011-07-04	2002-08-29		ENSG00000099795	ENSG00000099795		"""Mitochondrial respiratory chain complex / Complex I"""	7702	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase B18 subunit"", ""complex I B18 subunit"""	603842	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 (18kD, B18)"""			9763677, 10830904	Standard	NM_004146		Approved	B18, CI-B18, MGC2480	uc002mzg.3	P17568		ENST00000215565.2:c.301G>A	19.37:g.14677058C>T	ENSP00000215565:p.Glu101Lys		14538058	Q6ICN9|Q9UI16	Missense_Mutation	SNP	ENST00000215565.2	37	CCDS12314.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.638664	0.87760	.	.	ENSG00000099795	ENST00000215565	T	0.47177	0.85	5.47	5.47	0.80525	.	0.052695	0.64402	D	0.000001	T	0.55689	0.1936	L	0.41492	1.28	0.80722	D	1	D	0.63046	0.992	D	0.63192	0.912	T	0.52808	-0.8526	10	0.42905	T	0.14	-8.8489	12.5382	0.56154	0.0:0.8321:0.1679:0.0	.	101	P17568	NDUB7_HUMAN	K	101	ENSP00000215565:E101K	ENSP00000215565:E101K	E	-	1	0	NDUFB7	14538058	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	5.436000	0.66538	2.579000	0.87056	0.585000	0.79938	GAG		0.667	NDUFB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466025.1	NM_004146	
USP29	57663	broad.mit.edu	37	19	57640874	57640874	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr19:57640874C>A	ENST00000254181.4	+	4	1285	c.831C>A	c.(829-831)gaC>gaA	p.D277E	USP29_ENST00000598197.1_Missense_Mutation_p.D277E	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	277					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)	p.D277E(1)		breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGCCTCTTGACTCTCATTCAC	0.473																																																1	Substitution - Missense(1)	ovary(1)	19											81.0	79.0	80.0					19																	57640874		2203	4300	6503	62332686	SO:0001583	missense	57663				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.831C>A	19.37:g.57640874C>A	ENSP00000254181:p.Asp277Glu		62332686		Missense_Mutation	SNP	ENST00000254181.4	37	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	C	4.716	0.133164	0.09032	.	.	ENSG00000131864	ENST00000254181	T	0.47869	0.83	2.44	1.4	0.22301	.	0.810321	0.10056	U	0.721568	T	0.28599	0.0708	N	0.21373	0.66	0.09310	N	1	B	0.30511	0.282	B	0.30943	0.122	T	0.22765	-1.0207	10	0.17369	T	0.5	-4.1205	5.1453	0.14981	0.0:0.8309:0.0:0.1691	.	277	Q9HBJ7	UBP29_HUMAN	E	277	ENSP00000254181:D277E	ENSP00000254181:D277E	D	+	3	2	USP29	62332686	0.000000	0.05858	0.006000	0.13384	0.006000	0.05464	0.106000	0.15354	0.577000	0.29470	-0.237000	0.12165	GAC		0.473	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465075.1		
FZD5	7855	broad.mit.edu	37	2	208632119	208632119	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr2:208632119G>A	ENST00000295417.3	-	2	1898	c.1345C>T	c.(1345-1347)Cgc>Tgc	p.R449C		NM_003468.3	NP_003459.2	Q13467	FZD5_HUMAN	frizzled class receptor 5	449					angiogenesis (GO:0001525)|anterior/posterior axis specification, embryo (GO:0008595)|apoptotic process (GO:0006915)|apoptotic process involved in morphogenesis (GO:0060561)|axonogenesis (GO:0007409)|brain development (GO:0007420)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|canonical Wnt signaling pathway (GO:0060070)|cell maturation (GO:0048469)|cellular response to molecule of bacterial origin (GO:0071219)|chorionic trophoblast cell differentiation (GO:0060718)|embryonic axis specification (GO:0000578)|embryonic camera-type eye development (GO:0031076)|gonad development (GO:0008406)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|neuron differentiation (GO:0030182)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic camera-type eye development (GO:0031077)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of chorionic trophoblast cell proliferation (GO:1901382)|regulation of tight junction assembly (GO:2000810)|Spemann organizer formation (GO:0060061)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell differentiation in thymus (GO:0033077)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	cell projection (GO:0042995)|cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R449C(1)		NS(1)|kidney(1)|lung(1)|ovary(2)|prostate(1)|skin(1)	7				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.13)|Lung(261;0.134)		ATGCCGATGCGGATCATGAGC	0.637																																																1	Substitution - Missense(1)	ovary(1)	2											54.0	50.0	51.0					2																	208632119		2202	4300	6502	208340364	SO:0001583	missense	7855			U43318	CCDS33366.1	2q33.3	2014-01-29	2014-01-29		ENSG00000163251	ENSG00000163251		"""GPCR / Class F : Frizzled receptors"""	4043	protein-coding gene	gene with protein product		601723	"""frizzled (Drosophila) homolog 5"", ""chromosome 2 open reading frame 31"", ""frizzled homolog 5 (Drosophila)"", ""frizzled 5, seven transmembrane spanning receptor"", ""frizzled family receptor 5"""	C2orf31		8626800, 11408929	Standard	NM_003468		Approved	HFZ5, DKFZP434E2135	uc002vcj.3	Q13467	OTTHUMG00000154790	ENST00000295417.3:c.1345C>T	2.37:g.208632119G>A	ENSP00000354607:p.Arg449Cys		208340364	A8K2X1|B2RCZ1|Q53R22	Missense_Mutation	SNP	ENST00000295417.3	37	CCDS33366.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963614	0.74016	.	.	ENSG00000163251	ENST00000295417	D	0.86366	-2.11	5.3	5.3	0.74995	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.95598	0.8569	H	0.96970	3.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96705	0.9521	10	0.87932	D	0	.	13.87	0.63612	0.0:0.0:0.8474:0.1526	.	449	Q13467	FZD5_HUMAN	C	449	ENSP00000354607:R449C	ENSP00000354607:R449C	R	-	1	0	FZD5	208340364	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.521000	0.67086	2.468000	0.83385	0.561000	0.74099	CGC		0.637	FZD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337060.1	NM_003468	
KANSL1L	151050	broad.mit.edu	37	2	210940324	210940324	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr2:210940324G>C	ENST00000281772.9	-	6	1970	c.1707C>G	c.(1705-1707)caC>caG	p.H569Q	KANSL1L_ENST00000452086.1_Missense_Mutation_p.H569Q|KANSL1L_ENST00000457374.1_Missense_Mutation_p.H569Q|KANSL1L_ENST00000418791.1_Missense_Mutation_p.H569Q	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	569						histone acetyltransferase complex (GO:0000123)		p.H569Q(1)									GTTTTCGTTTGTGGAAACTCT	0.413																																																1	Substitution - Missense(1)	ovary(1)	2											161.0	139.0	146.0					2																	210940324		2203	4300	6503	210648569	SO:0001583	missense	151050			AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.1707C>G	2.37:g.210940324G>C	ENSP00000281772:p.His569Gln		210648569	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	Missense_Mutation	SNP	ENST00000281772.9	37	CCDS33370.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.19|10.19	1.281496|1.281496	0.23392|0.23392	.|.	.|.	ENSG00000144445|ENSG00000144445	ENST00000281772;ENST00000418791;ENST00000457374;ENST00000452086|ENST00000428655	.|.	.|.	.|.	5.75|5.75	3.89|3.89	0.44902|0.44902	.|.	0.363356|.	0.27922|.	N|.	0.017305|.	T|T	0.36580|0.36580	0.0972|0.0972	L|L	0.31926|0.31926	0.97|0.97	0.33413|0.33413	D|D	0.578835|0.578835	B;B;B;B|.	0.20052|.	0.026;0.017;0.041;0.041|.	B;B;B;B|.	0.18561|.	0.015;0.01;0.022;0.022|.	T|T	0.44757|0.44757	-0.9307|-0.9307	9|5	0.18276|.	T|.	0.48|.	.|.	4.3291|4.3291	0.11055|0.11055	0.0865:0.1681:0.5933:0.1521|0.0865:0.1681:0.5933:0.1521	.|.	569;569;569;569|.	A0AUZ9-4;A0AUZ9-3;A0AUZ9-2;A0AUZ9|.	.;.;.;CB067_HUMAN|.	Q|E	569|264	.|.	ENSP00000281772:H569Q|.	H|Q	-|-	3|1	2|0	C2orf67|C2orf67	210648569|210648569	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	2.118000|2.118000	0.41949|0.41949	0.709000|0.709000	0.31976|0.31976	0.557000|0.557000	0.71058|0.71058	CAC|CAA		0.413	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336633.3	NM_152519	
WNT6	7475	broad.mit.edu	37	2	219738535	219738535	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr2:219738535C>T	ENST00000233948.3	+	4	1283	c.1066C>T	c.(1066-1068)Cgt>Tgt	p.R356C		NM_006522.3	NP_006513.1	Q9Y6F9	WNT6_HUMAN	wingless-type MMTV integration site family, member 6	356					axis specification (GO:0009798)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|epithelial-mesenchymal cell signaling (GO:0060684)|nephron tubule formation (GO:0072079)|neuron differentiation (GO:0030182)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of gene expression (GO:0010628)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription, DNA-templated (GO:0045893)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.R356C(1)		large_intestine(1)|ovary(2)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.53e-07)|all cancers(144;9.3e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCACCGCTGCCGTGTGCGCAA	0.697																																																1	Substitution - Missense(1)	ovary(1)	2											13.0	10.0	11.0					2																	219738535		2133	4179	6312	219446779	SO:0001583	missense	7475			AF079522	CCDS2425.1	2q35	2008-05-23			ENSG00000115596	ENSG00000115596		"""Wingless-type MMTV integration sites"""	12785	protein-coding gene	gene with protein product		604663				10343101, 11350055	Standard	NM_006522		Approved		uc002vjc.1	Q9Y6F9	OTTHUMG00000133082	ENST00000233948.3:c.1066C>T	2.37:g.219738535C>T	ENSP00000233948:p.Arg356Cys		219446779	Q9H1J6|Q9H238	Missense_Mutation	SNP	ENST00000233948.3	37	CCDS2425.1	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807053	0.50421	.	.	ENSG00000115596	ENST00000233948	T	0.77358	-1.09	4.32	3.44	0.39384	.	0.493477	0.20647	N	0.088287	T	0.67942	0.2947	L	0.58510	1.815	0.34455	D	0.701152	P	0.39116	0.66	B	0.35073	0.195	T	0.72640	-0.4232	10	0.45353	T	0.12	.	4.8106	0.13342	0.3874:0.5089:0.0:0.1037	.	356	Q9Y6F9	WNT6_HUMAN	C	356	ENSP00000233948:R356C	ENSP00000233948:R356C	R	+	1	0	WNT6	219446779	0.121000	0.22262	1.000000	0.80357	0.880000	0.50808	0.054000	0.14205	1.021000	0.39600	-0.268000	0.10319	CGT		0.697	WNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256727.2	NM_006522	
COL6A3	1293	broad.mit.edu	37	2	238249531	238249531	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr2:238249531G>C	ENST00000295550.4	-	38	8480	c.8028C>G	c.(8026-8028)gaC>gaG	p.D2676E	COL6A3_ENST00000472056.1_Missense_Mutation_p.D2069E|COL6A3_ENST00000347401.3_Missense_Mutation_p.D2475E|COL6A3_ENST00000409809.1_Missense_Mutation_p.D2470E|COL6A3_ENST00000346358.4_Missense_Mutation_p.D2476E|COL6A3_ENST00000353578.4_Missense_Mutation_p.D2470E	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2676	Nonhelical region.|VWFA 12. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.D2676E(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TGCTGGCATTGTCCACGGACT	0.582																																																1	Substitution - Missense(1)	ovary(1)	2											87.0	81.0	83.0					2																	238249531		2203	4300	6503	237914270	SO:0001583	missense	1293			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8028C>G	2.37:g.238249531G>C	ENSP00000295550:p.Asp2676Glu		237914270	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	G	2.037	-0.420995	0.04734	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.87491	-2.26;-2.24;-2.23;-2.22;-2.23;-2.22	5.16	-0.285	0.12866	von Willebrand factor, type A (3);	0.810587	0.10842	N	0.628151	D	0.82486	0.5047	N	0.22421	0.69	0.09310	N	1	B;B;D	0.55385	0.049;0.039;0.971	B;B;P	0.56823	0.034;0.014;0.807	T	0.69928	-0.5012	10	0.06236	T	0.91	.	10.5462	0.45062	0.0702:0.1892:0.6639:0.0767	.	2069;2470;2676	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	E	2676;2475;2470;2069;2470;2476	ENSP00000295550:D2676E;ENSP00000315609:D2475E;ENSP00000315873:D2470E;ENSP00000418285:D2069E;ENSP00000386844:D2470E;ENSP00000295546:D2476E	ENSP00000295550:D2676E	D	-	3	2	COL6A3	237914270	0.683000	0.27633	0.000000	0.03702	0.007000	0.05969	0.895000	0.28363	0.001000	0.14605	-0.137000	0.14449	GAC		0.582	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CASS4	57091	broad.mit.edu	37	20	55033485	55033485	+	Silent	SNP	G	G	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr20:55033485G>A	ENST00000360314.3	+	7	2268	c.2043G>A	c.(2041-2043)ggG>ggA	p.G681G	CASS4_ENST00000371336.3_Silent_p.G681G|AL121914.1_ENST00000390795.2_RNA|CASS4_ENST00000434344.1_Silent_p.G244G	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	681					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.G681G(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						TCTACTTTGGGGCGCTCTTCA	0.557																																																1	Substitution - coding silent(1)	ovary(1)	20											59.0	59.0	59.0					20																	55033485		2203	4300	6503	54466892	SO:0001819	synonymous_variant	57091			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.2043G>A	20.37:g.55033485G>A			54466892	E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Silent	SNP	ENST00000360314.3	37	CCDS33492.1																																																																																				0.557	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079789.2	NM_020356	
HHLA2	11148	broad.mit.edu	37	3	108076721	108076721	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr3:108076721T>A	ENST00000357759.5	+	6	1130	c.716T>A	c.(715-717)gTt>gAt	p.V239D	HHLA2_ENST00000467562.1_Missense_Mutation_p.V175D|HHLA2_ENST00000489514.2_Missense_Mutation_p.V239D|HHLA2_ENST00000491820.1_Missense_Mutation_p.V239D|HHLA2_ENST00000467761.1_Missense_Mutation_p.V239D	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	239	Ig-like V-type 2.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)		p.V239D(1)		endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						AGTGAACACGTTTCACTCTCA	0.343																																																1	Substitution - Missense(1)	ovary(1)	3											95.0	94.0	95.0					3																	108076721		1847	4089	5936	109559411	SO:0001583	missense	11148			AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.716T>A	3.37:g.108076721T>A	ENSP00000350402:p.Val239Asp		109559411	B4DKN2|D3DN60|Q9NWQ6	Missense_Mutation	SNP	ENST00000357759.5	37	CCDS46883.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.048866	0.36181	.	.	ENSG00000114455	ENST00000491820;ENST00000467562;ENST00000357759;ENST00000467761;ENST00000489514	T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82	5.52	5.52	0.82312	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.196400	0.06465	N	0.730022	T	0.77698	0.4169	N	0.14661	0.345	0.45662	D	0.998582	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.68483	0.958;0.958;0.958	T	0.68565	-0.5375	10	0.72032	D	0.01	-1.2002	12.3232	0.54997	0.0:0.0:0.0:1.0	.	175;239;239	B4DKN2;C9J7D0;Q9UM44	.;.;HHLA2_HUMAN	D	239;175;239;239;239	ENSP00000418284:V239D;ENSP00000418345:V175D;ENSP00000350402:V239D;ENSP00000419207:V239D;ENSP00000417856:V239D	ENSP00000350402:V239D	V	+	2	0	HHLA2	109559411	0.063000	0.20901	0.115000	0.21578	0.014000	0.08584	1.400000	0.34577	2.216000	0.71823	0.528000	0.53228	GTT		0.343	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353924.1	NM_007072	
FTMT	94033	broad.mit.edu	37	5	121187836	121187836	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr5:121187836G>T	ENST00000321339.1	+	1	187	c.178G>T	c.(178-180)Ggg>Tgg	p.G60W		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	60					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)	p.G60W(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		GGACCCTACCGGGCCCGCCGC	0.751																																																1	Substitution - Missense(1)	ovary(1)	5											12.0	14.0	13.0					5																	121187836		2195	4287	6482	121215735	SO:0001583	missense	94033			BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.178G>T	5.37:g.121187836G>T	ENSP00000313691:p.Gly60Trp		121215735		Missense_Mutation	SNP	ENST00000321339.1	37	CCDS4128.1	.	.	.	.	.	.	.	.	.	.	G	5.514	0.279758	0.10458	.	.	ENSG00000181867	ENST00000321339	T	0.65732	-0.17	2.64	-5.28	0.02755	.	.	.	.	.	T	0.44222	0.1283	N	0.19112	0.55	0.09310	N	1	D	0.59357	0.985	P	0.48552	0.581	T	0.48468	-0.9033	9	0.48119	T	0.1	.	2.9831	0.05960	0.2345:0.1044:0.4745:0.1866	.	60	Q8N4E7	FTMT_HUMAN	W	60	ENSP00000313691:G60W	ENSP00000313691:G60W	G	+	1	0	FTMT	121215735	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.351000	0.07711	-3.383000	0.00174	-3.757000	0.00021	GGG		0.751	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250884.1	NM_177478	
ARAP3	64411	broad.mit.edu	37	5	141051840	141051840	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr5:141051840G>A	ENST00000239440.4	-	10	1479	c.1414C>T	c.(1414-1416)Cag>Tag	p.Q472*	ARAP3_ENST00000508305.1_Nonsense_Mutation_p.Q394*|ARAP3_ENST00000513878.1_Nonsense_Mutation_p.Q134*	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	472	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)	p.Q472*(1)		NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GCCCAGCTCTGCCGAGCACCC	0.632																																																1	Substitution - Nonsense(1)	ovary(1)	5											43.0	46.0	45.0					5																	141051840		2201	4296	6497	141032024	SO:0001587	stop_gained	64411			AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.1414C>T	5.37:g.141051840G>A	ENSP00000239440:p.Gln472*		141032024	B4DIT1|D3DQE3	Nonsense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	G	33	5.258730	0.95368	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878;ENST00000504448	.	.	.	3.9	3.9	0.45041	.	0.342307	0.27618	U	0.018578	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	8.9668	0.35881	0.0:0.0:0.6464:0.3536	.	.	.	.	X	394;472;134;472	.	ENSP00000239440:Q472X	Q	-	1	0	ARAP3	141032024	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.195000	0.32186	1.991000	0.58162	0.467000	0.42956	CAG		0.632	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
SYNGAP1	8831	broad.mit.edu	37	6	33411249	33411249	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr6:33411249G>A	ENST00000418600.2	+	15	3021	c.2920G>A	c.(2920-2922)Gac>Aac	p.D974N	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.D915N|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.D974N	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	974					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.D974N(1)|p.D959N(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GCCCCCTGGGGACACCTTTGC	0.647																																																2	Substitution - Missense(2)	ovary(2)	6											103.0	114.0	110.0					6																	33411249		2203	4300	6503	33519227	SO:0001583	missense	8831			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.2920G>A	6.37:g.33411249G>A	ENSP00000403636:p.Asp974Asn		33519227	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	37	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330959	0.41297	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.16073	2.37;2.46;2.45	4.37	4.37	0.52481	.	0.921904	0.09261	N	0.826534	T	0.04137	0.0115	N	0.08118	0	0.36746	D	0.882475	B;B;B	0.26195	0.144;0.119;0.119	B;B;B	0.28011	0.085;0.051;0.037	T	0.32745	-0.9895	10	0.15499	T	0.54	.	14.454	0.67404	0.0:0.0:1.0:0.0	.	974;974;974	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	N	974;974;960;915	ENSP00000293748:D974N;ENSP00000403636:D974N;ENSP00000412475:D915N	ENSP00000293748:D974N	D	+	1	0	SYNGAP1	33519227	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.609000	0.61148	2.275000	0.75901	0.491000	0.48974	GAC		0.647	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
TFAP2D	83741	broad.mit.edu	37	6	50696990	50696990	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr6:50696990C>A	ENST00000008391.3	+	5	1076	c.848C>A	c.(847-849)gCa>gAa	p.A283E	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.A283E(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					AGACGGAAAGCAGCTAATGTC	0.433																																																1	Substitution - Missense(1)	ovary(1)	6											167.0	147.0	154.0					6																	50696990		2203	4300	6503	50804949	SO:0001583	missense	83741			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.848C>A	6.37:g.50696990C>A	ENSP00000008391:p.Ala283Glu		50804949		Missense_Mutation	SNP	ENST00000008391.3	37	CCDS4933.1	.	.	.	.	.	.	.	.	.	.	C	35	5.450512	0.96205	.	.	ENSG00000008197	ENST00000008391	D	0.96940	-4.18	6.08	6.08	0.98989	Transcription factor AP-2, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98695	0.9562	M	0.92604	3.325	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.98931	1.0787	10	0.87932	D	0	-8.76	20.6721	0.99693	0.0:1.0:0.0:0.0	.	283	Q7Z6R9	AP2D_HUMAN	E	283	ENSP00000008391:A283E	ENSP00000008391:A283E	A	+	2	0	TFAP2D	50804949	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.894000	0.99253	0.591000	0.81541	GCA		0.433	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040881.1	NM_172238	
SHPRH	257218	broad.mit.edu	37	6	146264368	146264368	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr6:146264368C>T	ENST00000367505.2	-	9	2413	c.2149G>A	c.(2149-2151)Gca>Aca	p.A717T	SHPRH_ENST00000438092.2_Missense_Mutation_p.A717T|SHPRH_ENST00000275233.7_Missense_Mutation_p.A717T|SHPRH_ENST00000367503.3_Missense_Mutation_p.A717T			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	717	Helicase ATP-binding; second part. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A717T(1)		breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		ATCAGAGTTGCTCTTGTTGAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	6											75.0	77.0	76.0					6																	146264368		1975	4160	6135	146306061	SO:0001583	missense	257218			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2149G>A	6.37:g.146264368C>T	ENSP00000356475:p.Ala717Thr		146306061	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	C	35	5.529563	0.96446	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.36	5.36	0.76844	DEAD-like helicase (1);SNF2-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	D	0.000001	D	0.94066	0.8098	L	0.31157	0.91	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;0.999	D	0.94943	0.8093	10	0.87932	D	0	-22.1676	19.4564	0.94892	0.0:1.0:0.0:0.0	.	606;717;717;606	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	T	717;717;717;717;606	ENSP00000356475:A717T;ENSP00000356473:A717T;ENSP00000412797:A717T;ENSP00000275233:A717T	ENSP00000275233:A717T	A	-	1	0	SHPRH	146306061	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.750000	0.85110	2.684000	0.91462	0.650000	0.86243	GCA		0.463	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
TRRAP	8295	broad.mit.edu	37	7	98573789	98573789	+	Silent	SNP	C	C	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr7:98573789C>T	ENST00000359863.4	+	53	8045	c.7836C>T	c.(7834-7836)agC>agT	p.S2612S	TRRAP_ENST00000355540.3_Silent_p.S2594S|TRRAP_ENST00000446306.3_Silent_p.S2594S	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2612					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.S2594S(1)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CGCTGCTCAGCGCTTTCGTTC	0.567																																																1	Substitution - coding silent(1)	ovary(1)	7											107.0	93.0	98.0					7																	98573789		2203	4300	6503	98411725	SO:0001819	synonymous_variant	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.7836C>T	7.37:g.98573789C>T			98411725	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	9.639	1.138443	0.21123	.	.	ENSG00000196367	ENST00000456197	.	.	.	6.06	-2.06	0.07298	.	.	.	.	.	T	0.57888	0.2084	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56565	-0.7958	4	.	.	.	.	11.9051	0.52705	0.0:0.2189:0.0:0.7811	.	.	.	.	V	2334	.	.	A	+	2	0	TRRAP	98411725	0.026000	0.19158	0.992000	0.48379	0.790000	0.44656	-0.840000	0.04363	-0.241000	0.09681	-0.136000	0.14681	GCG		0.567	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
PTCHD1	139411	broad.mit.edu	37	X	23411777	23411777	+	Silent	SNP	G	G	T			TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chrX:23411777G>T	ENST00000379361.4	+	3	3002	c.2142G>T	c.(2140-2142)tcG>tcT	p.S714S		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	714					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)	p.S609S(1)		NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TCTTCTTCTCGGCATTCCTGG	0.483																																																1	Substitution - coding silent(1)	ovary(1)	X											114.0	102.0	106.0					X																	23411777		2203	4300	6503	23321698	SO:0001819	synonymous_variant	139411			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2142G>T	X.37:g.23411777G>T			23321698	B4DQH0|Q0IJ60|Q6P6B8	Silent	SNP	ENST00000379361.4	37	CCDS35215.2																																																																																				0.483	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
DDX12P	440081	broad.mit.edu	37	12	9590651	9590652	+	IGR	INS	-	-	CTGAGTAAC	rs376958229		TCGA-13-1484-01A-01W-0545-08	TCGA-13-1484-10A-01W-0545-08	-	-	CTGAGTAAC	CTGAGTAAC	-	-	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	379ee54e-fe99-4051-87bc-ecb12a55616d	1a26bbf3-b968-4d45-9c86-3d9c8fd31947	g.chr12:9590651_9590652insCTGAGTAAC								RP13-735L24.1 (40438 upstream) : SNORA75 (7001 downstream)														p.Q116_F117insVTQ(1)									TTCTGCACAAACTGAGTAACCC	0.564														1256	0.250799	0.2231	0.1988	5008	,	,		14239	0.2847		0.2237	False		,,,				2504	0.318															1	Insertion - In frame(1)	ovary(1)	12								705,2671		132,441,1115						2.4	1.0			56	1273,5605		63,1147,2229	no	intergenic				195,1588,3344	A1A1,A1R,RR		18.5083,20.8827,19.29				1978,8276				9481919	SO:0001628	intergenic_variant	440081																															12.37:g.9590652_9590660dupCTGAGTAAC			9481918		In_Frame_Ins	INS		37																																																																																				0	0.564								
