#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BAI2	576	broad.mit.edu	37	1	32221906	32221906	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:32221906G>T	ENST00000373658.3	-	4	873	c.532C>A	c.(532-534)Cta>Ata	p.L178I	BAI2_ENST00000398538.1_Missense_Mutation_p.L166I|MIR4254_ENST00000581063.1_RNA|BAI2_ENST00000398542.1_Missense_Mutation_p.L166I|BAI2_ENST00000398556.3_Missense_Mutation_p.L181I|BAI2_ENST00000527361.1_Missense_Mutation_p.L178I|BAI2_ENST00000373655.2_Missense_Mutation_p.L178I|BAI2_ENST00000398547.1_Missense_Mutation_p.L166I|BAI2_ENST00000257070.4_Missense_Mutation_p.L178I	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	178					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L178I(1)		breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		CGGAAGGCTAGGGCAGCGGGC	0.622																																																1	Substitution - Missense(1)	ovary(1)	1											30.0	37.0	34.0					1																	32221906		2203	4299	6502	31994493	SO:0001583	missense	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.532C>A	1.37:g.32221906G>T	ENSP00000362762:p.Leu178Ile		31994493	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466630	0.26335	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000398538;ENST00000420125;ENST00000533175	T;T;T;T;T;T;T;T;T;T	0.48201	1.48;1.68;0.87;0.87;1.85;0.82;0.82;0.9;1.45;1.32	5.08	5.08	0.68730	.	0.000000	0.32175	N	0.006469	T	0.37320	0.0999	L	0.43152	1.355	0.80722	D	1	P;P;P;P;P;B	0.46457	0.851;0.702;0.749;0.717;0.878;0.434	B;B;B;B;B;B	0.36845	0.116;0.234;0.234;0.102;0.234;0.081	T	0.23261	-1.0193	10	0.33940	T	0.23	.	13.9719	0.64245	0.0:0.1531:0.8469:0.0	.	166;178;166;166;178;178	A2A3C3;O60241-4;O60241-3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	I	181;166;178;178;166;178;178;166;171;212	ENSP00000381564:L181I;ENSP00000381555:L166I;ENSP00000362762:L178I;ENSP00000362759:L178I;ENSP00000381550:L166I;ENSP00000257070:L178I;ENSP00000435397:L178I;ENSP00000381548:L166I;ENSP00000410921:L171I;ENSP00000437219:L212I	ENSP00000257070:L178I	L	-	1	2	BAI2	31994493	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	4.174000	0.58256	2.536000	0.85505	0.462000	0.41574	CTA		0.622	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
KHDRBS1	10657	broad.mit.edu	37	1	32504195	32504195	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:32504195G>A	ENST00000327300.7	+	7	1317	c.1150G>A	c.(1150-1152)Gaa>Aaa	p.E384K	KHDRBS1_ENST00000492989.1_Missense_Mutation_p.E345K|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1									p.E384K(1)		endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CGAAGGCTACGAAGGCTATTA	0.398																																					Ovarian(173;401 1982 12359 31110 42403)											1	Substitution - Missense(1)	ovary(1)	1											131.0	116.0	121.0					1																	32504195		2203	4300	6503	32276782	SO:0001583	missense	10657			U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.1150G>A	1.37:g.32504195G>A	ENSP00000313829:p.Glu384Lys		32276782		Missense_Mutation	SNP	ENST00000327300.7	37	CCDS350.1	.	.	.	.	.	.	.	.	.	.	G	33	5.271013	0.95429	.	.	ENSG00000121774	ENST00000327300;ENST00000492989;ENST00000355201	T;T	0.50813	0.73;0.77	5.33	5.33	0.75918	.	0.458675	0.26457	N	0.024276	T	0.62344	0.2420	L	0.55481	1.735	0.58432	D	0.999999	D;D	0.69078	0.995;0.997	P;P	0.58454	0.695;0.839	T	0.64402	-0.6416	10	0.72032	D	0.01	.	19.4098	0.94665	0.0:0.0:1.0:0.0	.	384;345	Q07666;Q07666-3	KHDR1_HUMAN;.	K	384;345;360	ENSP00000313829:E384K;ENSP00000417731:E345K	ENSP00000313829:E384K	E	+	1	0	KHDRBS1	32276782	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.891000	0.92485	2.670000	0.90874	0.655000	0.94253	GAA		0.398	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011199.4	NM_006559	
ERMAP	114625	broad.mit.edu	37	1	43308368	43308368	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:43308368A>T	ENST00000372517.2	+	12	1137	c.893A>T	c.(892-894)tAt>tTt	p.Y298F	ERMAP_ENST00000328249.3_Missense_Mutation_p.Y208F|RP11-342M1.3_ENST00000444563.1_RNA|RP11-342M1.3_ENST00000425076.1_RNA|ERMAP_ENST00000487556.1_3'UTR|ERMAP_ENST00000372514.3_Missense_Mutation_p.Y298F|RP11-342M1.3_ENST00000414798.1_RNA|RP11-342M1.3_ENST00000416809.2_RNA	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	298	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.		Missing (in Sc-3 allele).			cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y298F(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGGGAGGTGTATGTGGGAGAC	0.522																																																1	Substitution - Missense(1)	ovary(1)	1											164.0	142.0	150.0					1																	43308368		2203	4300	6503	43080955	SO:0001583	missense	114625			AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.893A>T	1.37:g.43308368A>T	ENSP00000361595:p.Tyr298Phe		43080955	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Missense_Mutation	SNP	ENST00000372517.2	37	CCDS475.1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.415468	0.25552	.	.	ENSG00000164010	ENST00000372517;ENST00000372514;ENST00000328249	T;T;T	0.69040	-0.37;-0.37;-0.37	5.16	-3.44	0.04796	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	1.690210	0.02959	N	0.142793	T	0.41949	0.1181	N	0.10972	0.075	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.23048	-1.0199	10	0.62326	D	0.03	.	0.5823	0.00714	0.3687:0.1286:0.1577:0.3451	.	298	Q96PL5	ERMAP_HUMAN	F	298;298;208	ENSP00000361595:Y298F;ENSP00000361592:Y298F;ENSP00000332439:Y208F	ENSP00000332439:Y208F	Y	+	2	0	ERMAP	43080955	0.001000	0.12720	0.206000	0.23566	0.687000	0.40016	0.372000	0.20467	-0.485000	0.06754	-0.256000	0.11100	TAT		0.522	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020180.1	NM_018538	
EIF2B3	8891	broad.mit.edu	37	1	45341323	45341323	+	Silent	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:45341323G>C	ENST00000360403.2	-	9	1146	c.1020C>G	c.(1018-1020)gtC>gtG	p.V340V	EIF2B3_ENST00000372183.3_Silent_p.V340V	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	340					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)	p.V340V(1)		endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					CTGACGAATGGACTGGTGGTT	0.488																																					Colon(26;357 658 2581 11857 12657)											1	Substitution - coding silent(1)	ovary(1)	1											159.0	141.0	147.0					1																	45341323		2203	4300	6503	45113910	SO:0001819	synonymous_variant	8891			AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.1020C>G	1.37:g.45341323G>C			45113910	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Silent	SNP	ENST00000360403.2	37	CCDS517.1	.	.	.	.	.	.	.	.	.	.	G	1.666	-0.510130	0.04231	.	.	ENSG00000070785	ENST00000439363	.	.	.	5.4	-2.16	0.07080	.	.	.	.	.	T	0.50360	0.1611	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43523	-0.9386	4	.	.	.	-13.0412	6.4688	0.21997	0.5453:0.1321:0.3226:0.0	.	.	.	.	C	161	.	.	S	-	2	0	EIF2B3	45113910	0.942000	0.31987	0.279000	0.24732	0.264000	0.26372	0.046000	0.14035	-0.241000	0.09681	0.655000	0.94253	TCC		0.488	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365	
POMGNT1	55624	broad.mit.edu	37	1	46659015	46659015	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:46659015G>C	ENST00000371984.3	-	12	1229	c.1072C>G	c.(1072-1074)Cat>Gat	p.H358D	POMGNT1_ENST00000535522.1_Missense_Mutation_p.H336D|POMGNT1_ENST00000371992.1_Missense_Mutation_p.H358D|POMGNT1_ENST00000485714.1_5'UTR|POMGNT1_ENST00000371986.3_Missense_Mutation_p.H358D|POMGNT1_ENST00000396420.3_3'UTR	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)	358					protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)	p.H358D(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					ATGGGAGTATGCTGGATGCCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	1											119.0	108.0	112.0					1																	46659015		2203	4300	6503	46431602	SO:0001583	missense	55624				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.1072C>G	1.37:g.46659015G>C	ENSP00000361052:p.His358Asp		46431602	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Missense_Mutation	SNP	ENST00000371984.3	37	CCDS531.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500971	0.85176	.	.	ENSG00000085998	ENST00000371984;ENST00000371992;ENST00000535522;ENST00000371986	D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.95655	0.8587	M	0.90595	3.13	0.80722	D	1	D;D;D;D;D	0.89917	0.996;0.999;1.0;0.999;1.0	D;D;D;D;D	0.79784	0.921;0.984;0.993;0.984;0.99	D	0.95717	0.8763	10	0.62326	D	0.03	-21.0442	19.3554	0.94410	0.0:0.0:1.0:0.0	.	336;336;358;215;358	F5H827;B7Z7Q4;Q5VST3;B7Z7F2;Q8WZA1	.;.;.;.;PMGT1_HUMAN	D	358;358;336;358	ENSP00000361052:H358D;ENSP00000361060:H358D;ENSP00000443767:H336D;ENSP00000361054:H358D	ENSP00000361052:H358D	H	-	1	0	POMGNT1	46431602	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.892000	0.92491	2.813000	0.96785	0.561000	0.74099	CAT		0.577	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020146.1	NM_017739	
USP24	23358	broad.mit.edu	37	1	55591073	55591073	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:55591073A>T	ENST00000294383.6	-	34	3879	c.3880T>A	c.(3880-3882)Tcc>Acc	p.S1294T	USP24_ENST00000407756.1_Missense_Mutation_p.S1134T	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1294					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.S1211T(1)		breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TGTCGGTAGGATGACTTTTCT	0.463																																																1	Substitution - Missense(1)	ovary(1)	1											169.0	159.0	162.0					1																	55591073		1927	4140	6067	55363661	SO:0001583	missense	23358			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.3880T>A	1.37:g.55591073A>T	ENSP00000294383:p.Ser1294Thr		55363661	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	A	15.60	2.881371	0.51801	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.02498	4.29;4.27	5.13	5.13	0.70059	.	0.052612	0.85682	D	0.000000	T	0.02970	0.0088	N	0.22421	0.69	0.52099	D	0.999945	B	0.10296	0.003	B	0.06405	0.002	T	0.54289	-0.8316	10	0.33940	T	0.23	.	14.9324	0.70926	1.0:0.0:0.0:0.0	.	1134	B7WPF4	.	T	1294;1134	ENSP00000294383:S1294T;ENSP00000385700:S1134T	ENSP00000294383:S1294T	S	-	1	0	USP24	55363661	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	8.923000	0.92808	1.938000	0.56188	0.460000	0.39030	TCC		0.463	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
SF3B4	10262	broad.mit.edu	37	1	149897731	149897731	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:149897731G>A	ENST00000271628.8	-	4	1494	c.910C>T	c.(910-912)Cca>Tca	p.P304S	MTMR11_ENST00000492824.1_5'Flank	NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	304					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.P304S(1)		endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CACCTACCTGGATGGGGCATC	0.572																																																1	Substitution - Missense(1)	ovary(1)	1											50.0	42.0	44.0					1																	149897731		2203	4300	6503	148164355	SO:0001583	missense	10262			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.910C>T	1.37:g.149897731G>A	ENSP00000271628:p.Pro304Ser		148164355	Q5SZ63	Missense_Mutation	SNP	ENST00000271628.8	37	CCDS941.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638882	0.47153	.	.	ENSG00000143368	ENST00000271628	T	0.26223	1.75	4.58	4.58	0.56647	.	0.104187	0.64402	D	0.000003	T	0.33556	0.0867	L	0.49350	1.555	0.80722	D	1	D;P	0.89917	1.0;0.909	D;P	0.80764	0.994;0.641	T	0.01545	-1.1328	10	0.34782	T	0.22	.	14.565	0.68168	0.0:0.0:1.0:0.0	.	304;304	Q53FG6;Q15427	.;SF3B4_HUMAN	S	304	ENSP00000271628:P304S	ENSP00000271628:P304S	P	-	1	0	SF3B4	148164355	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.075000	0.76798	2.511000	0.84671	0.462000	0.41574	CCA		0.572	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033753.1	NM_005850	
ARHGEF11	9826	broad.mit.edu	37	1	156911192	156911192	+	Silent	SNP	A	A	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:156911192A>T	ENST00000361409.2	-	34	4108	c.3366T>A	c.(3364-3366)ggT>ggA	p.G1122G	ARHGEF11_ENST00000315174.8_Silent_p.G538G|ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000368194.3_Silent_p.G1162G	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1122					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G1162G(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GTTCAGGTTCACCATGGAACA	0.532																																																1	Substitution - coding silent(1)	ovary(1)	1											105.0	95.0	98.0					1																	156911192		2203	4300	6503	155177816	SO:0001819	synonymous_variant	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3366T>A	1.37:g.156911192A>T			155177816	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	ENST00000361409.2	37	CCDS1162.1																																																																																				0.532	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
FAM20B	9917	broad.mit.edu	37	1	179013091	179013091	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:179013091G>A	ENST00000263733.4	+	2	445	c.109G>A	c.(109-111)Gac>Aac	p.D37N		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	37						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)	p.D37N(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						CAACCGGGAGGACCAGAGGGC	0.517																																																1	Substitution - Missense(1)	ovary(1)	1											80.0	76.0	77.0					1																	179013091		2203	4300	6503	177279714	SO:0001583	missense	9917			AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.109G>A	1.37:g.179013091G>A	ENSP00000263733:p.Asp37Asn		177279714	Q5W0C3|Q5W0C4	Missense_Mutation	SNP	ENST00000263733.4	37	CCDS1328.1	.	.	.	.	.	.	.	.	.	.	G	36	5.653128	0.96724	.	.	ENSG00000116199	ENST00000440702;ENST00000263733	D	0.87966	-2.32	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.92071	0.7487	L	0.54323	1.7	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	D	0.89632	0.3856	10	0.33141	T	0.24	-47.0843	20.3167	0.98654	0.0:0.0:1.0:0.0	.	37	O75063	XYLK_HUMAN	N	37	ENSP00000263733:D37N	ENSP00000263733:D37N	D	+	1	0	FAM20B	177279714	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.809000	0.96659	0.557000	0.71058	GAC		0.517	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	NM_014864	
KLHDC8A	55220	broad.mit.edu	37	1	205312382	205312382	+	Silent	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:205312382G>C	ENST00000367156.3	-	5	1167	c.351C>G	c.(349-351)gcC>gcG	p.A117A	KLHDC8A_ENST00000537168.1_Intron|KLHDC8A_ENST00000606529.1_5'Flank|KLHDC8A_ENST00000539253.1_Silent_p.A117A|KLHDC8A_ENST00000460687.1_Intron|KLHDC8A_ENST00000367155.3_Silent_p.A117A	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	117								p.A117A(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AAATGCCCATGGCGGCCTCAC	0.607																																																1	Substitution - coding silent(1)	ovary(1)	1											81.0	79.0	80.0					1																	205312382		2202	4299	6501	203579005	SO:0001819	synonymous_variant	55220				CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.351C>G	1.37:g.205312382G>C			203579005	B3KU70|Q9NVG5	Silent	SNP	ENST00000367156.3	37	CCDS30985.1																																																																																				0.607	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	NM_018203	
USH2A	7399	broad.mit.edu	37	1	216380668	216380668	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr1:216380668C>T	ENST00000307340.3	-	16	3649	c.3263G>A	c.(3262-3264)aGt>aAt	p.S1088N	USH2A_ENST00000366942.3_Missense_Mutation_p.S1088N|USH2A_ENST00000366943.2_Missense_Mutation_p.S1088N|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1088	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.S1088N(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCTGAGTAAACTGTAAGTAAG	0.418										HNSCC(13;0.011)																																						1	Substitution - Missense(1)	ovary(1)	1											117.0	115.0	116.0					1																	216380668		2203	4300	6503	214447291	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3263G>A	1.37:g.216380668C>T	ENSP00000305941:p.Ser1088Asn		214447291	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	9.792	1.178295	0.21787	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	D;T;T	0.84730	-1.89;0.6;0.39	5.86	3.96	0.45880	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.953389	0.08608	N	0.920419	T	0.75525	0.3861	L	0.44542	1.39	0.09310	N	0.99999	B;B	0.31625	0.332;0.094	B;B	0.29598	0.104;0.037	T	0.60865	-0.7178	10	0.19147	T	0.46	.	1.4314	0.02334	0.1483:0.4458:0.1538:0.2521	.	1088;1088	O75445-2;O75445	.;USH2A_HUMAN	N	1088	ENSP00000305941:S1088N;ENSP00000355910:S1088N;ENSP00000355909:S1088N	ENSP00000305941:S1088N	S	-	2	0	USH2A	214447291	0.007000	0.16637	0.984000	0.44739	0.998000	0.95712	0.812000	0.27211	0.780000	0.33566	0.655000	0.94253	AGT		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
VWA2	340706	broad.mit.edu	37	10	116037774	116037774	+	Missense_Mutation	SNP	G	G	T	rs199562177	byFrequency	TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr10:116037774G>T	ENST00000392982.3	+	7	918	c.668G>T	c.(667-669)aGc>aTc	p.S223I	VWA2_ENST00000603594.1_Missense_Mutation_p.S223I			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	223					calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)	p.S223I(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		AGCACCCTCAGCAGCTCGGCC	0.647																																																1	Substitution - Missense(1)	ovary(1)	10											58.0	49.0	52.0					10																	116037774		2203	4300	6503	116027764	SO:0001583	missense	340706			AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.668G>T	10.37:g.116037774G>T	ENSP00000376708:p.Ser223Ile		116027764	A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Missense_Mutation	SNP	ENST00000392982.3	37		.	.	.	.	.	.	.	.	.	.	G	12.55	1.972630	0.34848	.	.	ENSG00000165816	ENST00000392982;ENST00000298715	T	0.67698	-0.28	5.6	2.62	0.31277	von Willebrand factor, type A (1);	0.952104	0.08840	N	0.885977	T	0.63663	0.2530	M	0.72118	2.19	0.09310	N	1	P;P	0.46912	0.818;0.886	B;B	0.39876	0.165;0.312	T	0.50363	-0.8837	10	0.25751	T	0.34	.	10.4772	0.44672	0.0:0.3669:0.519:0.1141	.	223;223	Q5GFL6;Q5GFL6-2	VWA2_HUMAN;.	I	223	ENSP00000376708:S223I	ENSP00000298715:S223I	S	+	2	0	VWA2	116027764	0.001000	0.12720	0.077000	0.20336	0.417000	0.31264	0.706000	0.25690	0.707000	0.31934	0.561000	0.74099	AGC		0.647	VWA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050456.3	NM_198496	
ART5	116969	broad.mit.edu	37	11	3661421	3661421	+	Nonsense_Mutation	SNP	G	G	A	rs376288672		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr11:3661421G>A	ENST00000397068.3	-	2	630	c.238C>T	c.(238-240)Cga>Tga	p.R80*	ART5_ENST00000359918.4_Nonsense_Mutation_p.R80*|ART5_ENST00000397067.3_Nonsense_Mutation_p.R80*|TRPC2_ENST00000526541.1_RNA	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	80					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)	p.R80*(1)		breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTAAGCCCTCGACGCTTGTCC	0.582																																																1	Substitution - Nonsense(1)	ovary(1)	11						G	stop/ARG,stop/ARG	1,4401	2.1+/-5.4	0,1,2200	65.0	62.0	63.0		238,238	3.0	0.0	11		63	0,8596		0,0,4298	no	stop-gained,stop-gained	ART5	NM_001079536.1,NM_053017.3	,	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	,	80/292,80/292	3661421	1,12997	2201	4298	6499	3617997	SO:0001587	stop_gained	116969			Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.238C>T	11.37:g.3661421G>A	ENSP00000380258:p.Arg80*		3617997	C9IYG7|Q6UX84|Q86W02	Nonsense_Mutation	SNP	ENST00000397068.3	37	CCDS7743.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.84|11.84	1.758406|1.758406	0.31137|0.31137	2.27E-4|2.27E-4	0.0|0.0	ENSG00000167311|ENSG00000167311	ENST00000397068;ENST00000397067;ENST00000359918;ENST00000425767|ENST00000453353	.|.	.|.	.|.	6.07|6.07	2.97|2.97	0.34412|0.34412	.|.	1.988220|.	0.01958|.	N|.	0.043143|.	.|T	.|0.44393	.|0.1291	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.54111	.|-0.8342	.|3	0.16896|.	T|.	0.51|.	5.9041|5.9041	8.2867|8.2867	0.31932|0.31932	0.0:0.2994:0.5259:0.1747|0.0:0.2994:0.5259:0.1747	.|.	.|.	.|.	.|.	X|L	80;80;80;59|36	.|.	ENSP00000352992:R80X|.	R|S	-|-	1|2	2|0	ART5|ART5	3617997|3617997	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.015000|0.015000	0.08874|0.08874	0.157000|0.157000	0.16402|0.16402	1.537000|1.537000	0.49254|0.49254	0.655000|0.655000	0.94253|0.94253	CGA|TCG		0.582	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032760.2	NM_053017	
ACCSL	390110	broad.mit.edu	37	11	44077627	44077627	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr11:44077627A>T	ENST00000378832.1	+	10	1233	c.1177A>T	c.(1177-1179)Acc>Tcc	p.T393S		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	393					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)	p.T393S(1)		central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						GATCTGGGGTACCAGTAAGGT	0.438																																																1	Substitution - Missense(1)	ovary(1)	11											147.0	138.0	141.0					11																	44077627		1921	4130	6051	44034203	SO:0001583	missense	390110				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.1177A>T	11.37:g.44077627A>T	ENSP00000368109:p.Thr393Ser		44034203		Missense_Mutation	SNP	ENST00000378832.1	37	CCDS41636.1	.	.	.	.	.	.	.	.	.	.	A	12.11	1.838704	0.32513	.	.	ENSG00000205126	ENST00000378832	D	0.90620	-2.7	5.08	-1.53	0.08611	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.403435	0.28821	N	0.014025	D	0.88858	0.6551	M	0.71206	2.165	0.09310	N	0.999995	B	0.25235	0.121	B	0.39152	0.292	T	0.82252	-0.0549	10	0.72032	D	0.01	-8.2622	5.0271	0.14391	0.4978:0.2715:0.2307:0.0	.	393	Q4AC99	1A1L2_HUMAN	S	393	ENSP00000368109:T393S	ENSP00000368109:T393S	T	+	1	0	ACCSL	44034203	0.559000	0.26562	0.387000	0.26183	0.763000	0.43281	0.798000	0.27014	-0.353000	0.08224	-0.250000	0.11733	ACC		0.438	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854	
ATM	472	broad.mit.edu	37	11	108235819	108235819	+	Missense_Mutation	SNP	A	A	G	rs587780644		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr11:108235819A>G	ENST00000452508.2	+	63	9050	c.8861A>G	c.(8860-8862)tAt>tGt	p.Y2954C	ATM_ENST00000525178.1_3'UTR|C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Missense_Mutation_p.Y2954C|C11orf65_ENST00000526725.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2954	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.Y2954C(2)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GTCCTTCTATATGATCCACTC	0.368			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	2	Substitution - Missense(2)	ovary(1)|liver(1)	11											85.0	79.0	81.0					11																	108235819		2201	4298	6499	107741029	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8861A>G	11.37:g.108235819A>G	ENSP00000388058:p.Tyr2954Cys		107741029	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	18.91	3.724599	0.68959	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.81908	-1.55;-1.55	5.71	5.71	0.89125	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.93615	0.7961	H	0.94306	3.52	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95248	0.8357	10	0.87932	D	0	.	16.0336	0.80603	1.0:0.0:0.0:0.0	.	2954	Q13315	ATM_HUMAN	C	2954	ENSP00000278616:Y2954C;ENSP00000388058:Y2954C	ENSP00000278616:Y2954C	Y	+	2	0	ATM	107741029	1.000000	0.71417	0.994000	0.49952	0.892000	0.51952	7.100000	0.76989	2.189000	0.69895	0.529000	0.55759	TAT		0.368	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
DIXDC1	85458	broad.mit.edu	37	11	111856023	111856023	+	Missense_Mutation	SNP	G	G	A	rs371156857		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr11:111856023G>A	ENST00000440460.2	+	9	1280	c.983G>A	c.(982-984)gGt>gAt	p.G328D	DIXDC1_ENST00000389821.4_3'UTR|DIXDC1_ENST00000315253.5_Missense_Mutation_p.G117D	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	329					camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)	p.G328D(1)		cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		TGTGAACCAGGTGTCAATCCC	0.433																																																1	Substitution - Missense(1)	ovary(1)	11											112.0	107.0	108.0					11																	111856023		1888	4108	5996	111361233	SO:0001583	missense	85458			AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.983G>A	11.37:g.111856023G>A	ENSP00000394352:p.Gly328Asp		111361233	A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	ENST00000440460.2	37		.	.	.	.	.	.	.	.	.	.	G	24.6	4.553558	0.86127	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.19938	2.11;2.11	5.68	5.68	0.88126	.	0.150213	0.64402	D	0.000014	T	0.50497	0.1619	.	.	.	0.51482	D	0.999925	D;D	0.89917	0.999;1.0	D;D	0.97110	0.959;1.0	T	0.48937	-0.8990	9	0.56958	D	0.05	-16.243	18.777	0.91915	0.0:0.0:1.0:0.0	.	117;329	E7EQ17;Q155Q3	.;DIXC1_HUMAN	D	328;117	ENSP00000394352:G328D;ENSP00000314068:G117D	ENSP00000314068:G117D	G	+	2	0	DIXDC1	111361233	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	5.269000	0.65542	2.697000	0.92050	0.491000	0.48974	GGT		0.433	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001037954	
MCAM	4162	broad.mit.edu	37	11	119182586	119182586	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr11:119182586C>G	ENST00000264036.4	-	10	1231	c.1217G>C	c.(1216-1218)cGc>cCc	p.R406P	MCAM_ENST00000392814.1_Missense_Mutation_p.R355P	NM_006500.2	NP_006491.2	P43121	MUC18_HUMAN	melanoma cell adhesion molecule	406	Ig-like C2-type 2.				anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|glomerular filtration (GO:0003094)|vascular wound healing (GO:0061042)	external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R406P(1)		breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|skin(1)	22		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.78e-05)		CGCCACGCAGCGATAGCCGCC	0.622																																																1	Substitution - Missense(1)	ovary(1)	11											102.0	103.0	103.0					11																	119182586		2199	4295	6494	118687796	SO:0001583	missense	4162			X68264	CCDS31690.1	11q23.3	2013-01-29				ENSG00000076706		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6934	protein-coding gene	gene with protein product	"""Gicerin"""	155735				2602381, 10702685	Standard	XM_005271552		Approved	MUC18, CD146	uc001pwf.3	P43121		ENST00000264036.4:c.1217G>C	11.37:g.119182586C>G	ENSP00000264036:p.Arg406Pro		118687796	O95812|Q59E86|Q6PHR3|Q6ZTR2	Missense_Mutation	SNP	ENST00000264036.4	37	CCDS31690.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530401	0.27387	.	.	ENSG00000076706	ENST00000264036;ENST00000392814	T;T	0.22743	1.94;1.94	4.73	2.42	0.29668	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.34745	0.0908	M	0.80616	2.505	0.30204	N	0.798345	P	0.40909	0.732	P	0.48488	0.579	T	0.22661	-1.0210	9	0.34782	T	0.22	-11.1508	10.0077	0.41968	0.6736:0.3264:0.0:0.0	.	406	P43121	MUC18_HUMAN	P	406;355	ENSP00000264036:R406P;ENSP00000376561:R355P	ENSP00000264036:R406P	R	-	2	0	MCAM	118687796	1.000000	0.71417	1.000000	0.80357	0.044000	0.14063	1.317000	0.33631	0.373000	0.24621	0.462000	0.41574	CGC		0.622	MCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388332.2		
CD163L1	283316	broad.mit.edu	37	12	7586046	7586046	+	Silent	SNP	A	A	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr12:7586046A>G	ENST00000313599.3	-	3	426	c.369T>C	c.(367-369)gcT>gcC	p.A123A	CD163L1_ENST00000416109.2_Silent_p.A123A|CD163L1_ENST00000396630.1_Silent_p.A123A			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	123	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.A123A(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ATTCCCAGAGAGCTGACTCAT	0.423																																																1	Substitution - coding silent(1)	ovary(1)	12											109.0	103.0	105.0					12																	7586046		2203	4300	6503	7477313	SO:0001819	synonymous_variant	283316			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.369T>C	12.37:g.7586046A>G			7477313	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	ENST00000313599.3	37	CCDS8577.1																																																																																				0.423	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
PDE3A	5139	broad.mit.edu	37	12	20799874	20799874	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr12:20799874G>C	ENST00000359062.3	+	12	2595	c.2555G>C	c.(2554-2556)aGt>aCt	p.S852T	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	852	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.S852T(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GTTGCAACTAGTGCTCCTCAG	0.418																																																1	Substitution - Missense(1)	ovary(1)	12											108.0	101.0	103.0					12																	20799874		2203	4300	6503	20691141	SO:0001583	missense	5139				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2555G>C	12.37:g.20799874G>C	ENSP00000351957:p.Ser852Thr		20691141	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.222737	0.79464	.	.	ENSG00000172572	ENST00000359062	T	0.77750	-1.12	5.85	5.85	0.93711	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.116052	0.85682	D	0.000000	D	0.86723	0.6001	M	0.76433	2.335	0.51482	D	0.999922	D	0.76494	0.999	D	0.70487	0.969	D	0.87448	0.2399	10	0.72032	D	0.01	.	13.3699	0.60707	0.0717:0.0:0.9283:0.0	.	852	Q14432	PDE3A_HUMAN	T	852	ENSP00000351957:S852T	ENSP00000351957:S852T	S	+	2	0	PDE3A	20691141	1.000000	0.71417	0.988000	0.46212	0.971000	0.66376	7.568000	0.82369	2.766000	0.95052	0.643000	0.83706	AGT		0.418	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		
KRT6A	3853	broad.mit.edu	37	12	52881580	52881580	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr12:52881580C>A	ENST00000330722.6	-	9	1687	c.1619G>T	c.(1618-1620)aGc>aTc	p.S540I		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	540	Tail.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.S540I(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCAACAGAGCTGAGGCCACC	0.582																																																1	Substitution - Missense(1)	ovary(1)	12											77.0	85.0	82.0					12																	52881580		2203	4296	6499	51167847	SO:0001583	missense	3853			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.1619G>T	12.37:g.52881580C>A	ENSP00000369317:p.Ser540Ile		51167847	A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	ENST00000330722.6	37	CCDS41786.1	.	.	.	.	.	.	.	.	.	.	c	15.33	2.801280	0.50315	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.88509	-2.39	4.53	4.53	0.55603	.	0.000000	0.56097	D	0.000023	D	0.89822	0.6826	M	0.74881	2.28	0.36572	D	0.873067	P	0.36733	0.567	B	0.40534	0.332	D	0.91604	0.5297	10	0.35671	T	0.21	.	17.827	0.88668	0.0:1.0:0.0:0.0	.	540	P02538	K2C6A_HUMAN	I	540;496	ENSP00000369317:S540I	ENSP00000369317:S540I	S	-	2	0	KRT6A	51167847	0.013000	0.17824	1.000000	0.80357	0.977000	0.68977	1.571000	0.36450	2.449000	0.82847	0.650000	0.86243	AGC		0.582	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404978.2	NM_005554	
MTUS2	23281	broad.mit.edu	37	13	29599077	29599077	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr13:29599077T>C	ENST00000431530.3	+	1	330	c.272T>C	c.(271-273)cTt>cCt	p.L91P		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	81						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.L91P(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TTTCACCAACTTCAGGGCTTT	0.453																																																1	Substitution - Missense(1)	ovary(1)	13											34.0	32.0	33.0					13																	29599077		1815	4071	5886	28497077	SO:0001583	missense	23281			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.272T>C	13.37:g.29599077T>C	ENSP00000392057:p.Leu91Pro		28497077	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	t	2.552	-0.303769	0.05495	.	.	ENSG00000132938	ENST00000431530	T	0.18174	2.23	5.37	1.67	0.24075	.	0.297582	0.23787	N	0.044579	T	0.12689	0.0308	L	0.43152	1.355	0.35396	D	0.791174	B	0.23249	0.082	B	0.22386	0.039	T	0.16958	-1.0385	9	.	.	.	.	7.7097	0.28671	0.0:0.322:0.0:0.678	.	81	Q5JR59	MTUS2_HUMAN	P	91	ENSP00000392057:L91P	.	L	+	2	0	MTUS2	28497077	0.022000	0.18835	0.833000	0.33012	0.021000	0.10359	0.352000	0.20113	0.352000	0.24053	-0.376000	0.06991	CTT		0.453	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
MAB21L1	4081	broad.mit.edu	37	13	36049751	36049751	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr13:36049751T>G	ENST00000379919.4	-	1	1081	c.525A>C	c.(523-525)aaA>aaC	p.K175N	NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_5'Flank	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	175					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.K175N(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		TCCCGGTGCATTTAAAGGCCG	0.592																																																1	Substitution - Missense(1)	ovary(1)	13											61.0	66.0	64.0					13																	36049751		2203	4300	6503	34947751	SO:0001583	missense	4081			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.525A>C	13.37:g.36049751T>G	ENSP00000369251:p.Lys175Asn		34947751	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	37	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518274	0.64634	.	.	ENSG00000180660	ENST00000379919	T	0.09350	2.99	5.66	1.75	0.24633	.	0.000000	0.85682	D	0.000000	T	0.14787	0.0357	M	0.73962	2.25	0.80722	D	1	B	0.29590	0.25	B	0.36885	0.235	T	0.02533	-1.1145	10	0.37606	T	0.19	-41.1483	7.4006	0.26962	0.0:0.5411:0.0:0.4589	.	175	Q13394	MB211_HUMAN	N	175	ENSP00000369251:K175N	ENSP00000369251:K175N	K	-	3	2	MAB21L1	34947751	0.997000	0.39634	1.000000	0.80357	0.939000	0.58152	0.516000	0.22817	0.414000	0.25790	-0.250000	0.11733	AAA		0.592	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
NDFIP2	54602	broad.mit.edu	37	13	80095082	80095082	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr13:80095082T>A	ENST00000218652.7	+	2	511	c.459T>A	c.(457-459)agT>agA	p.S153R	NDFIP2_ENST00000494647.1_3'UTR	NM_001161407.1|NM_019080.2	NP_001154879.1|NP_061953.2	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2	153					negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of transporter activity (GO:0032410)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)	p.S153R(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|lung(3)|ovary(2)|prostate(1)|skin(1)	14		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		CATATAGTAGTATTACTGTGG	0.393																																																1	Substitution - Missense(1)	ovary(1)	13											97.0	87.0	90.0					13																	80095082		2203	4300	6503	78993083	SO:0001583	missense	54602			AB032991	CCDS31998.1	13q22.1	2011-05-18			ENSG00000102471	ENSG00000102471			18537	protein-coding gene	gene with protein product		610041				10574461, 12050153	Standard	NM_019080		Approved	KIAA1165, N4wbp5a	uc001vlf.3	Q9NV92	OTTHUMG00000017136	ENST00000218652.7:c.459T>A	13.37:g.80095082T>A	ENSP00000218652:p.Ser153Arg		78993083	Q7Z2H3|Q7Z428|Q8TAR3|Q9ULQ5	Missense_Mutation	SNP	ENST00000218652.7	37	CCDS31998.1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.836774	0.50951	.	.	ENSG00000102471	ENST00000218652;ENST00000487865	T;T	0.36878	1.24;1.23	5.75	0.187	0.15109	.	0.226724	0.49916	D	0.000124	T	0.26195	0.0639	L	0.47716	1.5	0.43271	D	0.995226	B;B	0.20550	0.042;0.046	B;B	0.22152	0.038;0.011	T	0.05289	-1.0894	10	0.51188	T	0.08	0.2312	5.1664	0.15088	0.0:0.4072:0.1619:0.4309	.	59;153	B4DGY6;Q9NV92	.;NFIP2_HUMAN	R	153;70	ENSP00000218652:S153R;ENSP00000419200:S70R	ENSP00000218652:S153R	S	+	3	2	NDFIP2	78993083	1.000000	0.71417	0.999000	0.59377	0.846000	0.48090	0.532000	0.23067	0.112000	0.17975	0.533000	0.62120	AGT		0.393	NDFIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045380.2		
OR6S1	341799	broad.mit.edu	37	14	21109650	21109650	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr14:21109650G>C	ENST00000320704.3	-	1	200	c.201C>G	c.(199-201)aaC>aaG	p.N67K		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N67K(1)		kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		GGCAGGACAGGTTACCCAGAA	0.453																																																1	Substitution - Missense(1)	ovary(1)	14											110.0	104.0	106.0					14																	21109650		2203	4300	6503	20179490	SO:0001583	missense	341799			AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.201C>G	14.37:g.21109650G>C	ENSP00000313110:p.Asn67Lys		20179490	Q6IFJ9	Missense_Mutation	SNP	ENST00000320704.3	37	CCDS32038.1	.	.	.	.	.	.	.	.	.	.	G	17.14	3.314140	0.60414	.	.	ENSG00000181803	ENST00000320704	T	0.12879	2.64	5.76	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000049	T	0.30103	0.0754	M	0.86864	2.845	0.30246	N	0.794522	D	0.61080	0.989	P	0.54100	0.742	T	0.34004	-0.9846	10	0.87932	D	0	-12.6385	8.0041	0.30315	0.318:0.0:0.682:0.0	.	67	Q8NH40	OR6S1_HUMAN	K	67	ENSP00000313110:N67K	ENSP00000313110:N67K	N	-	3	2	OR6S1	20179490	0.013000	0.17824	0.990000	0.47175	0.996000	0.88848	0.683000	0.25349	0.334000	0.23590	0.655000	0.94253	AAC		0.453	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411227.1		
MDGA2	161357	broad.mit.edu	37	14	47389224	47389224	+	Silent	SNP	G	G	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr14:47389224G>T	ENST00000399232.2	-	10	2386	c.2022C>A	c.(2020-2022)ggC>ggA	p.G674G	MDGA2_ENST00000357362.3_Silent_p.G445G|MDGA2_ENST00000426342.1_Silent_p.G445G|MDGA2_ENST00000439988.3_Silent_p.G743G	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	674	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.G445G(1)		breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CCTGCCTGATGCCCAACCGGT	0.423																																																1	Substitution - coding silent(1)	ovary(1)	14											110.0	102.0	104.0					14																	47389224		1897	4119	6016	46458974	SO:0001819	synonymous_variant	161357			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2022C>A	14.37:g.47389224G>T			46458974	F6W3S7|J3KPX6	Silent	SNP	ENST00000399232.2	37																																																																																					0.423	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5	NM_182830	
ZC3H14	79882	broad.mit.edu	37	14	89039323	89039323	+	Missense_Mutation	SNP	G	G	C	rs370316955		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr14:89039323G>C	ENST00000251038.5	+	6	1058	c.833G>C	c.(832-834)aGa>aCa	p.R278T	ZC3H14_ENST00000555755.1_Missense_Mutation_p.R278T|ZC3H14_ENST00000359301.3_Missense_Mutation_p.R244T|ZC3H14_ENST00000302216.8_Missense_Mutation_p.R278T|ZC3H14_ENST00000557607.1_Missense_Mutation_p.R123T|ZC3H14_ENST00000336693.4_Missense_Mutation_p.R244T|ZC3H14_ENST00000393514.5_Missense_Mutation_p.R278T|ZC3H14_ENST00000556945.1_Missense_Mutation_p.R278T	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	278						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R278T(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						CCGTTCTTTAGAAACAACTCG	0.373																																																1	Substitution - Missense(1)	ovary(1)	14											72.0	74.0	74.0					14																	89039323		2203	4300	6503	88109076	SO:0001583	missense	79882			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.833G>C	14.37:g.89039323G>C	ENSP00000251038:p.Arg278Thr		88109076	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	37	CCDS32133.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.48|11.48	1.649872|1.649872	0.29336|0.29336	.|.	.|.	ENSG00000100722|ENSG00000100722	ENST00000556000|ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000557607;ENST00000555755;ENST00000393514;ENST00000336693	.|.	.|.	.|.	5.92|5.92	3.85|3.85	0.44370|0.44370	.|.	.|0.195823	.|0.45867	.|D	.|0.000322	T|T	0.37404|0.37404	0.1002|0.1002	L|L	0.43152|0.43152	1.355|1.355	0.32969|0.32969	D|D	0.522139|0.522139	.|B;B;B;B;B;B	.|0.34329	.|0.372;0.241;0.277;0.066;0.449;0.066	.|B;B;B;B;B;B	.|0.35550	.|0.116;0.094;0.109;0.074;0.205;0.074	T|T	0.53194|0.53194	-0.8473|-0.8473	5|9	.|0.54805	.|T	.|0.06	-15.0966|-15.0966	6.8825|6.8825	0.24181|0.24181	0.3027:0.0:0.6973:0.0|0.3027:0.0:0.6973:0.0	.|.	.|278;259;278;278;278;278	.|G3V256;F8W848;G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7	.|.;.;.;.;.;ZC3HE_HUMAN	Q|T	194|278;278;278;244;278;259;278;123;278;278;244	.|.	.|ENSP00000251038:R278T	E|R	+|+	1|2	0|0	ZC3H14|ZC3H14	88109076|88109076	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.209000|0.209000	0.24338|0.24338	3.039000|3.039000	0.49791|0.49791	1.488000|1.488000	0.48433|0.48433	0.655000|0.655000	0.94253|0.94253	GAA|AGA		0.373	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
HCN4	10021	broad.mit.edu	37	15	73635779	73635779	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr15:73635779A>T	ENST00000261917.3	-	2	2149	c.1156T>A	c.(1156-1158)Tta>Ata	p.L386I	RP11-272D12.1_ENST00000557981.1_RNA|RP11-272D12.1_ENST00000558742.1_RNA	NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	386					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.L386I(1)		NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		AACAGGCGTAAGAGGCTGAGG	0.562																																																1	Substitution - Missense(1)	ovary(1)	15											85.0	67.0	73.0					15																	73635779		2198	4297	6495	71422832	SO:0001583	missense	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1156T>A	15.37:g.73635779A>T	ENSP00000261917:p.Leu386Ile		71422832	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.445158	0.63178	.	.	ENSG00000138622	ENST00000261917	D	0.98926	-5.24	5.34	1.31	0.21738	Ion transport (1);	.	.	.	.	D	0.98305	0.9438	L	0.52905	1.665	0.45979	D	0.998799	D	0.89917	1.0	D	0.87578	0.998	D	0.96345	0.9254	9	0.36615	T	0.2	.	9.5508	0.39308	0.3509:0.0:0.6491:0.0	.	386	Q9Y3Q4	HCN4_HUMAN	I	386	ENSP00000261917:L386I	ENSP00000261917:L386I	L	-	1	2	HCN4	71422832	1.000000	0.71417	0.996000	0.52242	0.641000	0.38312	2.869000	0.48444	0.051000	0.15978	-0.899000	0.02877	TTA		0.562	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
UBE2Q2	92912	broad.mit.edu	37	15	76165768	76165768	+	Splice_Site	SNP	G	G	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr15:76165768G>T	ENST00000267938.4	+	5	829		c.e5-1		UBE2Q2_ENST00000561851.1_Splice_Site|UBE2Q2_ENST00000338677.4_Splice_Site|UBE2Q2_ENST00000569423.1_Splice_Site	NM_173469.2	NP_775740.1	Q8WVN8	UB2Q2_HUMAN	ubiquitin-conjugating enzyme E2Q family member 2						protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	12						TCTCTTTGTAGGATATAGAAG	0.318																																																1	Unknown(1)	ovary(1)	15											62.0	62.0	62.0					15																	76165768		2197	4293	6490	73952823	SO:0001630	splice_region_variant	92912			BC017708	CCDS10286.1, CCDS45309.1, CCDS66839.1	15q24.2	2010-05-12	2008-05-02		ENSG00000140367	ENSG00000140367		"""Ubiquitin-conjugating enzymes E2"""	19248	protein-coding gene	gene with protein product		612501	"""ubiquitin-conjugating enzyme E2Q (putative) 2"""			16300736	Standard	NM_001145335		Approved	DKFZp762C143	uc002bbg.2	Q8WVN8	OTTHUMG00000142839	ENST00000267938.4:c.448-1G>T	15.37:g.76165768G>T			73952823	B7Z3Q2|H3BRG2|Q8N4G6|Q96J08	Splice_Site	SNP	ENST00000267938.4	37	CCDS10286.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326375	0.60743	.	.	ENSG00000140367	ENST00000338677;ENST00000267938;ENST00000426727	.	.	.	4.25	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5159	0.84300	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UBE2Q2	73952823	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	6.475000	0.73582	2.304000	0.77564	0.637000	0.83480	.		0.318	UBE2Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286475.1	NM_173469	Intron
ITFG1	81533	broad.mit.edu	37	16	47494797	47494797	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr16:47494797C>A	ENST00000320640.6	-	1	388	c.160G>T	c.(160-162)Ggg>Tgg	p.G54W	ITFG1_ENST00000544001.2_Intron|PHKB_ENST00000299167.8_5'Flank|PHKB_ENST00000566044.1_5'Flank|PHKB_ENST00000455779.1_5'Flank|PHKB_ENST00000323584.5_5'Flank	NM_030790.3	NP_110417.2	Q8TB96	TIP_HUMAN	integrin alpha FG-GAP repeat containing 1	54						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.G54W(1)		breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	19		all_cancers(37;0.0613)|all_lung(18;0.0543)|Lung NSC(13;0.227)				TTGAGGTCCCCGAAAGCCGCA	0.677																																																1	Substitution - Missense(1)	ovary(1)	16											34.0	28.0	30.0					16																	47494797		2201	4300	6501	46052298	SO:0001583	missense	81533			AF503339	CCDS10728.1	16q12.1	2008-02-05			ENSG00000129636	ENSG00000129636			30697	protein-coding gene	gene with protein product	"""T cell immunomodulatory protein"""	611803				12598909	Standard	NM_030790		Approved	CDA08, TIP	uc002eet.3	Q8TB96	OTTHUMG00000133103	ENST00000320640.6:c.160G>T	16.37:g.47494797C>A	ENSP00000319918:p.Gly54Trp		46052298	Q96SR4|Q9BRE2|Q9H2V9	Missense_Mutation	SNP	ENST00000320640.6	37	CCDS10728.1	.	.	.	.	.	.	.	.	.	.	C	31	5.060989	0.93846	.	.	ENSG00000129636	ENST00000320640	T	0.27890	1.64	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.64997	-0.6275	10	0.87932	D	0	-8.1625	17.5503	0.87873	0.0:1.0:0.0:0.0	.	54	Q8TB96	TIP_HUMAN	W	54	ENSP00000319918:G54W	ENSP00000319918:G54W	G	-	1	0	ITFG1	46052298	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.385000	0.73182	2.359000	0.80004	0.591000	0.81541	GGG		0.677	ITFG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256768.3	NM_030790	
TP53	7157	broad.mit.edu	37	17	7578496	7578496	+	Missense_Mutation	SNP	A	A	T	rs587782197		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr17:7578496A>T	ENST00000269305.4	-	5	623	c.434T>A	c.(433-435)cTg>cAg	p.L145Q	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.L145Q|TP53_ENST00000413465.2_Missense_Mutation_p.L145Q|TP53_ENST00000455263.2_Missense_Mutation_p.L145Q|TP53_ENST00000359597.4_Missense_Mutation_p.L145Q|TP53_ENST00000420246.2_Missense_Mutation_p.L145Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	145	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		L -> M (in sporadic cancers; somatic mutation).|L -> P (in sporadic cancers; somatic mutation).|L -> Q (in sporadic cancers; somatic mutation).|L -> R (in sporadic cancers; somatic mutation).|L -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.L145Q(17)|p.L145P(17)|p.0?(8)|p.L145R(7)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.W146fs*25(1)|p.W146fs*22(1)|p.L145del(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATCAACCCACAGCTGCACAGG	0.602		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	57	Substitution - Missense(41)|Whole gene deletion(8)|Deletion - In frame(4)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	breast(11)|ovary(9)|large_intestine(7)|central_nervous_system(5)|oesophagus(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|lung(3)|stomach(2)|urinary_tract(2)|liver(2)|prostate(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	17											57.0	57.0	57.0					17																	7578496		2203	4300	6503	7519221	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.434T>A	17.37:g.7578496A>T	ENSP00000269305:p.Leu145Gln		7519221	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.089239	0.55968	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99818	-6.92;-6.92;-6.92;-6.92;-6.92;-6.92;-6.92;-6.92;-6.92	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.153372	0.45361	D	0.000370	D	0.99736	0.9896	M	0.71581	2.175	0.51482	D	0.999926	D;D;D;D;D;D;D	0.89917	1.0;0.967;0.996;1.0;0.978;0.993;1.0	D;P;D;D;D;D;D	0.87578	0.998;0.899;0.955;0.997;0.966;0.955;0.997	D	0.97018	0.9741	10	0.87932	D	0	-1.0943	13.8301	0.63375	1.0:0.0:0.0:0.0	.	106;145;145;52;145;145;145	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Q	145;145;145;145;145;145;134;52;13;52;13;145	ENSP00000410739:L145Q;ENSP00000352610:L145Q;ENSP00000269305:L145Q;ENSP00000398846:L145Q;ENSP00000391127:L145Q;ENSP00000391478:L145Q;ENSP00000425104:L13Q;ENSP00000423862:L52Q;ENSP00000424104:L145Q	ENSP00000269305:L145Q	L	-	2	0	TP53	7519221	1.000000	0.71417	0.420000	0.26596	0.013000	0.08279	9.283000	0.95860	2.206000	0.71126	0.533000	0.62120	CTG		0.602	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ACLY	47	broad.mit.edu	37	17	40025030	40025030	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr17:40025030G>C	ENST00000352035.2	-	28	3273	c.3143C>G	c.(3142-3144)gCt>gGt	p.A1048G	ACLY_ENST00000393896.2_Missense_Mutation_p.A1038G|ACLY_ENST00000537919.1_Missense_Mutation_p.A777G|ACLY_ENST00000588779.1_5'UTR|ACLY_ENST00000353196.1_Missense_Mutation_p.A1038G|ACLY_ENST00000590151.1_Missense_Mutation_p.A1048G	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	1048					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)	p.A1048G(1)	NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				ATATTCATCAGCTTCCTCCCT	0.448																																					Colon(64;807 1396 15971 30971)											1	Substitution - Missense(1)	ovary(1)	17											157.0	138.0	145.0					17																	40025030		2203	4300	6503	37278556	SO:0001583	missense	47			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.3143C>G	17.37:g.40025030G>C	ENSP00000253792:p.Ala1048Gly		37278556	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	37	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	g	36	5.613920	0.96637	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	D;D;D;D	0.90004	-1.63;-1.63;-2.6;-1.63	5.52	5.52	0.82312	Citrate synthase-like, core (1);	0.000000	0.85682	D	0.000000	D	0.94791	0.8318	M	0.81802	2.56	0.80722	D	1	P;D;D;D;D	0.76494	0.944;0.989;0.989;0.999;0.969	P;P;P;D;P	0.74023	0.722;0.861;0.861;0.982;0.793	D	0.94777	0.7950	10	0.87932	D	0	.	19.6407	0.95757	0.0:0.0:1.0:0.0	.	777;1092;1102;1038;1048	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	G	1048;1102;1038;777;1038	ENSP00000253792:A1048G;ENSP00000345398:A1038G;ENSP00000445349:A777G;ENSP00000377474:A1038G	ENSP00000253792:A1048G	A	-	2	0	ACLY	37278556	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.050000	0.93843	2.878000	0.98634	0.651000	0.88453	GCT		0.448	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
ANKRD29	147463	broad.mit.edu	37	18	21218841	21218841	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr18:21218841A>C	ENST00000592179.1	-	4	456	c.302T>G	c.(301-303)tTt>tGt	p.F101C	ANKRD29_ENST00000284207.7_Missense_Mutation_p.F101C|ANKRD29_ENST00000322980.9_Missense_Mutation_p.F101C	NM_173505.2	NP_775776.2	Q8N6D5	ANR29_HUMAN	ankyrin repeat domain 29	101								p.F101C(1)		breast(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)	13	all_cancers(21;5.07e-05)|all_epithelial(16;2.49e-07)|Lung NSC(20;0.00211)|all_lung(20;0.00676)|Colorectal(14;0.0202)|Ovarian(20;0.127)					GGATGCTCCAAATCCAAAGAG	0.423																																																1	Substitution - Missense(1)	ovary(1)	18											111.0	103.0	106.0					18																	21218841		2203	4300	6503	19472839	SO:0001583	missense	147463			AK057782	CCDS11879.1	18q11.2	2013-01-10			ENSG00000154065	ENSG00000154065		"""Ankyrin repeat domain containing"""	27110	protein-coding gene	gene with protein product							Standard	NM_173505		Approved	FLJ25053	uc002kun.3	Q8N6D5	OTTHUMG00000131875	ENST00000592179.1:c.302T>G	18.37:g.21218841A>C	ENSP00000468354:p.Phe101Cys		19472839	B2R972|Q6ZWE8|Q96LU9	Missense_Mutation	SNP	ENST00000592179.1	37	CCDS11879.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.500804	0.64298	.	.	ENSG00000154065	ENST00000322980;ENST00000284207	T;T	0.64438	-0.09;-0.1	5.69	5.69	0.88448	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.66781	0.2824	L	0.36672	1.1	0.80722	D	1	D;D	0.65815	0.988;0.995	P;D	0.64237	0.724;0.923	T	0.65742	-0.6094	10	0.38643	T	0.18	.	10.9096	0.47101	0.8594:0.0:0.0:0.1406	.	101;101	Q8N6D5-3;Q8N6D5	.;ANR29_HUMAN	C	101	ENSP00000323387:F101C;ENSP00000284207:F101C	ENSP00000284207:F101C	F	-	2	0	ANKRD29	19472839	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.300000	0.72776	2.291000	0.77112	0.533000	0.62120	TTT		0.423	ANKRD29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254825.1	NM_173505	
ZNF57	126295	broad.mit.edu	37	19	2917849	2917849	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	T	T	G	G	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr19:2917849T>G	ENST00000306908.5	+	4	1378	c.1230T>G	c.(1228-1230)caT>caG	p.H410Q	AC006277.2_ENST00000520090.2_RNA|ZNF57_ENST00000523428.1_Missense_Mutation_p.H378Q	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H410Q(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCGAGGTCATTTGAGGACGC	0.433																																					NSCLC(150;910 1964 4303 10464 26498)											1	Substitution - Missense(1)	ovary(1)	19											99.0	89.0	92.0					19																	2917849		2203	4300	6503	2868849	SO:0001583	missense	126295			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.1230T>G	19.37:g.2917849T>G	ENSP00000303696:p.His410Gln		2868849	Q8N6R9	Missense_Mutation	SNP	ENST00000306908.5	37	CCDS12098.1	.	.	.	.	.	.	.	.	.	.	T	10.70	1.423025	0.25639	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000523428	D;D	0.86865	-2.18;-2.18	2.25	-3.65	0.04502	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94548	0.8244	H	0.97540	4.025	0.09310	N	0.999999	D	0.89917	1.0	D	0.85130	0.997	D	0.88115	0.2828	9	0.87932	D	0	.	8.2465	0.31691	0.0:0.2628:0.0:0.7372	.	410	Q68EA5	ZNF57_HUMAN	Q	410;412;378	ENSP00000303696:H410Q;ENSP00000430223:H378Q	ENSP00000303696:H410Q	H	+	3	2	ZNF57	2868849	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-1.929000	0.01558	-1.193000	0.02688	0.418000	0.28097	CAT		0.433	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
OR7D4	125958	broad.mit.edu	37	19	9324997	9324997	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr19:9324997C>T	ENST00000308682.2	-	1	545	c.517G>A	c.(517-519)Gag>Aag	p.E173K		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E173K(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						TGCGGAATCTCAGTGCCTGTG	0.507																																																1	Substitution - Missense(1)	ovary(1)	19											96.0	90.0	92.0					19																	9324997		2203	4300	6503	9185997	SO:0001583	missense	125958				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.517G>A	19.37:g.9324997C>T	ENSP00000310488:p.Glu173Lys		9185997	A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	ENST00000308682.2	37	CCDS32901.1	.	.	.	.	.	.	.	.	.	.	C	9.671	1.146698	0.21288	.	.	ENSG00000174667	ENST00000308682	T	0.00115	8.71	4.0	1.85	0.25348	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000014	T	0.00144	0.0004	L	0.33792	1.035	0.09310	N	1	P	0.35628	0.513	B	0.43838	0.433	T	0.19811	-1.0294	10	0.51188	T	0.08	.	5.2584	0.15559	0.0:0.6389:0.1684:0.1926	.	173	Q8NG98	OR7D4_HUMAN	K	173	ENSP00000310488:E173K	ENSP00000310488:E173K	E	-	1	0	OR7D4	9185997	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	-1.227000	0.02950	0.484000	0.27630	0.436000	0.28706	GAG		0.507	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449004.1		
SMARCA4	6597	broad.mit.edu	37	19	11105512	11105512	+	Silent	SNP	C	C	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr19:11105512C>A	ENST00000429416.3	+	10	1709	c.1428C>A	c.(1426-1428)ctC>ctA	p.L476L	SMARCA4_ENST00000541122.2_Silent_p.L476L|SMARCA4_ENST00000358026.2_Silent_p.L476L|SMARCA4_ENST00000444061.3_Silent_p.L476L|SMARCA4_ENST00000413806.3_Silent_p.L476L|SMARCA4_ENST00000450717.3_Silent_p.L476L|SMARCA4_ENST00000590574.1_Silent_p.L476L|SMARCA4_ENST00000589677.1_Silent_p.L476L|SMARCA4_ENST00000344626.4_Silent_p.L476L	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	476	HSA. {ECO:0000255|PROSITE- ProRule:PRU00549}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.L476L(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				AGGAATACCTCAATAGCATTC	0.493			"""F, N, Mis"""		NSCLC																																		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	2	Unknown(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	19											76.0	72.0	73.0					19																	11105512		2203	4300	6503	10966512	SO:0001819	synonymous_variant	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.1428C>A	19.37:g.11105512C>A			10966512	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Silent	SNP	ENST00000429416.3	37	CCDS12253.1																																																																																				0.493	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
ATP1A3	478	broad.mit.edu	37	19	42472996	42472996	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr19:42472996C>A	ENST00000302102.5	-	20	2910	c.2760G>T	c.(2758-2760)caG>caT	p.Q920H	ATP1A3_ENST00000543770.1_Missense_Mutation_p.Q931H|ATP1A3_ENST00000545399.1_Missense_Mutation_p.Q933H|ATP1A3_ENST00000602133.1_Missense_Mutation_p.Q890H	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	920					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)	p.Q920H(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						GATCGGCCCACTGGACGACAA	0.607																																																1	Substitution - Missense(1)	ovary(1)	19											132.0	97.0	109.0					19																	42472996		2203	4300	6503	47164836	SO:0001583	missense	478				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2760G>T	19.37:g.42472996C>A	ENSP00000302397:p.Gln920His		47164836	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	37	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.831146	0.50845	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.97328	-4.34;-4.34;-4.34;-4.34	3.27	2.23	0.28157	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.072732	0.56097	D	0.000026	D	0.98792	0.9593	H	0.99336	4.52	0.80722	D	1	D;D;D;D	0.76494	0.994;0.992;0.999;0.993	D;D;D;D	0.79108	0.978;0.968;0.992;0.981	D	0.97114	0.9806	10	0.87932	D	0	.	4.5861	0.12282	0.0:0.7327:0.0:0.2673	.	933;931;920;920	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	H	920;920;933;890;664;931	ENSP00000302397:Q920H;ENSP00000411503:Q920H;ENSP00000444688:Q933H;ENSP00000437577:Q931H	ENSP00000302397:Q920H	Q	-	3	2	ATP1A3	47164836	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	0.955000	0.29188	1.854000	0.53819	0.462000	0.41574	CAG		0.607	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
CACNG6	59285	broad.mit.edu	37	19	54515404	54515404	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr19:54515404G>A	ENST00000252729.2	+	4	1334	c.744G>A	c.(742-744)tgG>tgA	p.W248*	CACNG6_ENST00000352529.1_Nonsense_Mutation_p.W177*|CACNG6_ENST00000346968.2_Nonsense_Mutation_p.W202*	NM_145814.1	NP_665813.1	Q9BXT2	CCG6_HUMAN	calcium channel, voltage-dependent, gamma subunit 6	248					calcium ion transport (GO:0006816)	voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)	p.W248*(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.168)		CCTGGCCCTGGGGGTCCCTCT	0.662																																																1	Substitution - Nonsense(1)	ovary(1)	19											38.0	43.0	41.0					19																	54515404		2194	4286	6480	59207216	SO:0001587	stop_gained	59285			AF288386	CCDS12870.1, CCDS12871.1	19q13.4	2008-05-02			ENSG00000130433	ENSG00000130433		"""Calcium channel subunits"""	13625	protein-coding gene	gene with protein product		606898				11170751	Standard	NM_145814		Approved		uc002qct.3	Q9BXT2	OTTHUMG00000064907	ENST00000252729.2:c.744G>A	19.37:g.54515404G>A	ENSP00000252729:p.Trp248*		59207216		Nonsense_Mutation	SNP	ENST00000252729.2	37	CCDS12870.1	.	.	.	.	.	.	.	.	.	.	G	38	7.143028	0.98092	.	.	ENSG00000130433	ENST00000252729;ENST00000352529;ENST00000346968	.	.	.	3.89	3.89	0.44902	.	0.086330	0.49916	D	0.000122	.	.	.	.	.	.	0.40690	D	0.98238	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.5603	11.7327	0.51746	0.0:0.0:1.0:0.0	.	.	.	.	X	248;177;202	.	ENSP00000252729:W248X	W	+	3	0	CACNG6	59207216	0.993000	0.37304	0.958000	0.39756	0.636000	0.38137	2.689000	0.46993	2.491000	0.84063	0.650000	0.86243	TGG		0.662	CACNG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139359.1		
HEATR5B	54497	broad.mit.edu	37	2	37255209	37255209	+	Nonsense_Mutation	SNP	G	G	T	rs145210064		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:37255209G>T	ENST00000233099.5	-	24	3805	c.3710C>A	c.(3709-3711)tCa>tAa	p.S1237*	HEATR5B_ENST00000354531.2_Nonsense_Mutation_p.S1237*	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1237						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.S1237*(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				AAAGGGCTTTGATTTATCTTC	0.443																																																1	Substitution - Nonsense(1)	ovary(1)	2											104.0	109.0	107.0					2																	37255209		2203	4300	6503	37108713	SO:0001587	stop_gained	54497			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.3710C>A	2.37:g.37255209G>T	ENSP00000233099:p.Ser1237*		37108713	B5MDU8|Q7Z3B2|Q9NVL7	Nonsense_Mutation	SNP	ENST00000233099.5	37	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	G	42	9.701090	0.99242	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	.	.	.	4.6	4.6	0.57074	.	0.352028	0.30575	N	0.009322	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.4785	17.7732	0.88499	0.0:0.0:1.0:0.0	.	.	.	.	X	1237	.	ENSP00000233099:S1237X	S	-	2	0	HEATR5B	37108713	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.513000	0.73742	2.267000	0.75376	0.313000	0.20887	TCA		0.443	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
FAM161A	84140	broad.mit.edu	37	2	62067260	62067260	+	Silent	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:62067260G>C	ENST00000405894.3	-	3	980	c.879C>G	c.(877-879)ctC>ctG	p.L293L	FAM161A_ENST00000404929.1_Silent_p.L293L	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	293					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)		p.L184L(1)		breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGTAAAGGGGGAGAAAGACAG	0.403																																																1	Substitution - coding silent(1)	ovary(1)	2											167.0	153.0	157.0					2																	62067260		1854	4091	5945	61920764	SO:0001819	synonymous_variant	84140				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.879C>G	2.37:g.62067260G>C			61920764	B4DJV7|Q9H8R2	Silent	SNP	ENST00000405894.3	37	CCDS42687.2																																																																																				0.403	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
FER1L5	90342	broad.mit.edu	37	2	97363280	97363280	+	RNA	SNP	C	C	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:97363280C>T	ENST00000457909.1	+	0	3604							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Y1394Y(1)		NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GCTACCTCTACAGAAAGTTCT	0.562																																																1	Substitution - coding silent(1)	ovary(1)	2											47.0	49.0	48.0					2																	97363280		1943	4120	6063	96727007			90342			BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97363280C>T			96727007	Q17RH2|Q6ZU24	Silent	SNP	ENST00000457909.1	37																																																																																					0.562	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
CCNT2	905	broad.mit.edu	37	2	135711863	135711863	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:135711863G>A	ENST00000264157.5	+	9	1868	c.1838G>A	c.(1837-1839)aGc>aAc	p.S613N	CCNT2_ENST00000295238.6_Missense_Mutation_p.S613N|CCNT2_ENST00000537343.1_Missense_Mutation_p.S438N	NM_001241.3|NM_058241.2	NP_001232.1|NP_490595.1	O60583	CCNT2_HUMAN	cyclin T2	613	Poly-Ser.				cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.S613N(1)		endometrium(2)|kidney(3)|large_intestine(10)|lung(6)|ovary(2)|prostate(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.107)		ATTTCCTCTAGCTCCAGCTCT	0.502																																																1	Substitution - Missense(1)	ovary(1)	2											138.0	130.0	133.0					2																	135711863		2203	4300	6503	135428333	SO:0001583	missense	905			AF048731	CCDS2174.1, CCDS2175.1	2q21.3	2010-11-15			ENSG00000082258	ENSG00000082258			1600	protein-coding gene	gene with protein product		603862				9499409, 10465067	Standard	NM_001241		Approved		uc002tuc.2	O60583	OTTHUMG00000131712	ENST00000264157.5:c.1838G>A	2.37:g.135711863G>A	ENSP00000264157:p.Ser613Asn		135428333	A8KA48|D3DP73|D3DP74|O60582|Q29R66|Q53SR4|Q5I1Y0	Missense_Mutation	SNP	ENST00000264157.5	37	CCDS2174.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.254194	0.39896	.	.	ENSG00000082258	ENST00000537343;ENST00000295238;ENST00000264157	T;T	0.45276	0.9;1.43	5.58	4.69	0.59074	.	0.335566	0.40469	N	0.001083	T	0.58538	0.2129	L	0.52573	1.65	0.35495	D	0.799304	B;D;D	0.67145	0.403;0.993;0.996	B;D;P	0.70227	0.157;0.968;0.889	T	0.68119	-0.5493	10	0.45353	T	0.12	.	16.7395	0.85455	0.0:0.1289:0.8711:0.0	.	438;613;613	B4DH21;O60583;O60583-2	.;CCNT2_HUMAN;.	N	438;613;613	ENSP00000295238:S613N;ENSP00000264157:S613N	ENSP00000264157:S613N	S	+	2	0	CCNT2	135428333	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.795000	0.62489	1.338000	0.45544	0.655000	0.94253	AGC		0.502	CCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254629.1	NM_058241	
DPP4	1803	broad.mit.edu	37	2	162881421	162881421	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:162881421C>T	ENST00000360534.3	-	11	1476	c.916G>A	c.(916-918)Gca>Aca	p.A306T		NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	306					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.A306T(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	TCTTGTGTTGCCCATGTCACA	0.423																																																1	Substitution - Missense(1)	ovary(1)	2											126.0	115.0	119.0					2																	162881421		2203	4300	6503	162589667	SO:0001583	missense	1803			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.916G>A	2.37:g.162881421C>T	ENSP00000353731:p.Ala306Thr		162589667	Q53TN1	Missense_Mutation	SNP	ENST00000360534.3	37	CCDS2216.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.930774	0.73327	.	.	ENSG00000197635	ENST00000360534	D	0.95690	-3.78	5.47	5.47	0.80525	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.525914	0.20977	N	0.082283	D	0.94437	0.8210	L	0.59436	1.845	0.42507	D	0.992957	B	0.30793	0.295	B	0.32724	0.151	D	0.93672	0.6991	10	0.62326	D	0.03	-19.6943	17.5034	0.87738	0.0:1.0:0.0:0.0	.	306	P27487	DPP4_HUMAN	T	306	ENSP00000353731:A306T	ENSP00000353731:A306T	A	-	1	0	DPP4	162589667	0.995000	0.38212	0.984000	0.44739	0.915000	0.54546	3.594000	0.54008	2.563000	0.86464	0.655000	0.94253	GCA		0.423	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255079.2		
ABCA12	26154	broad.mit.edu	37	2	215843638	215843638	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:215843638A>G	ENST00000272895.7	-	32	5086	c.4867T>C	c.(4867-4869)Ttc>Ctc	p.F1623L	ABCA12_ENST00000389661.4_Missense_Mutation_p.F1305L	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1623					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)	p.F1623L(1)		NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTGGTGCTGAATGGAGGAAGT	0.527																																					Ovarian(66;664 1488 5121 34295)											1	Substitution - Missense(1)	ovary(1)	2											174.0	151.0	159.0					2																	215843638		2203	4300	6503	215551883	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.4867T>C	2.37:g.215843638A>G	ENSP00000272895:p.Phe1623Leu		215551883	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	14.75	2.627594	0.46944	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.79749	-1.3;-1.3	5.36	5.36	0.76844	.	0.157646	0.45606	D	0.000359	D	0.82737	0.5102	L	0.42632	1.34	0.80722	D	1	D;D	0.64830	0.994;0.968	P;P	0.61397	0.888;0.852	T	0.78368	-0.2231	10	0.10377	T	0.69	.	15.6478	0.77068	1.0:0.0:0.0:0.0	.	1623;1305	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	L	1623;1305	ENSP00000272895:F1623L;ENSP00000374312:F1305L	ENSP00000272895:F1623L	F	-	1	0	ABCA12	215551883	1.000000	0.71417	0.853000	0.33588	0.333000	0.28666	7.254000	0.78329	2.156000	0.67533	0.533000	0.62120	TTC		0.527	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
MARCH4	57574	broad.mit.edu	37	2	217142538	217142538	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:217142538G>C	ENST00000273067.4	-	3	2488	c.722C>G	c.(721-723)gCc>gGc	p.A241G		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	241						Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A241G(1)		breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		GCCCAGGATGGCGGCTGCAAC	0.567																																																1	Substitution - Missense(1)	ovary(1)	2											81.0	73.0	76.0					2																	217142538		2203	4300	6503	216850783	SO:0001583	missense	57574			AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.722C>G	2.37:g.217142538G>C	ENSP00000273067:p.Ala241Gly		216850783	Q4KMN7|Q86WR8	Missense_Mutation	SNP	ENST00000273067.4	37	CCDS33376.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.521866	0.85600	.	.	ENSG00000144583	ENST00000273067	T	0.61392	0.11	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.70168	0.3193	L	0.57536	1.79	0.58432	D	0.999998	D	0.63046	0.992	P	0.60541	0.876	T	0.68492	-0.5394	10	0.37606	T	0.19	2.3155	17.829	0.88674	0.0:0.0:1.0:0.0	.	241	Q9P2E8	MARH4_HUMAN	G	241	ENSP00000273067:A241G	ENSP00000273067:A241G	A	-	2	0	MARCH4	216850783	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.793000	0.75130	2.465000	0.83290	0.655000	0.94253	GCC		0.567	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337272.2	NM_020814	
FAM134A	79137	broad.mit.edu	37	2	220044835	220044835	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr2:220044835G>C	ENST00000430297.2	+	4	559	c.423G>C	c.(421-423)gaG>gaC	p.E141D	CNPPD1_ENST00000409789.1_5'Flank	NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	141						integral component of membrane (GO:0016021)		p.E141D(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCCCAGTGAGGGTGCGGGGT	0.557																																																1	Substitution - Missense(1)	ovary(1)	2											56.0	60.0	58.0					2																	220044835		2203	4300	6503	219753079	SO:0001583	missense	79137			AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.423G>C	2.37:g.220044835G>C	ENSP00000395249:p.Glu141Asp		219753079	Q6P1P5|Q9H0K7	Missense_Mutation	SNP	ENST00000430297.2	37	CCDS2434.1	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690015	0.29962	.	.	ENSG00000144567	ENST00000430297	T	0.44083	0.93	4.53	4.53	0.55603	.	0.583983	0.18785	N	0.131234	T	0.42539	0.1207	M	0.77820	2.39	0.43617	D	0.995999	B	0.29232	0.238	B	0.28011	0.085	T	0.27938	-1.0059	10	0.18710	T	0.47	-13.9884	11.7361	0.51765	0.0:0.0:0.8244:0.1756	.	141	Q8NC44	F134A_HUMAN	D	141	ENSP00000395249:E141D	ENSP00000395249:E141D	E	+	3	2	FAM134A	219753079	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.691000	0.54720	2.342000	0.79632	0.561000	0.74099	GAG		0.557	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
PCSK2	5126	broad.mit.edu	37	20	17446023	17446023	+	Missense_Mutation	SNP	C	C	T	rs142020979		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr20:17446023C>T	ENST00000262545.2	+	11	1570	c.1255C>T	c.(1255-1257)Cgg>Tgg	p.R419W	PCSK2_ENST00000377899.1_Missense_Mutation_p.R400W|PCSK2_ENST00000536609.1_Missense_Mutation_p.R384W|PCSK2_ENST00000459871.1_3'UTR	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	419	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)	p.R419W(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CACCTCCAAACGGAACCAGCT	0.582																																																1	Substitution - Missense(1)	ovary(1)	20						C	TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	101.0	73.0	83.0		1198,1150,1255	2.4	0.9	20	dbSNP_134	83	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PCSK2	NM_001201528.1,NM_001201529.1,NM_002594.3	101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	400/620,384/604,419/639	17446023	1,13005	2203	4300	6503	17394023	SO:0001583	missense	5126			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1255C>T	20.37:g.17446023C>T	ENSP00000262545:p.Arg419Trp		17394023	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554926	0.65425	0.0	1.16E-4	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	D;D;D	0.87256	-2.23;-2.23;-2.23	5.61	2.37	0.29283	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	D	0.91680	0.7370	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.935	D	0.90027	0.4132	10	0.66056	D	0.02	-27.8199	6.946	0.24518	0.5006:0.4112:0.0:0.0881	.	384;400;419	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	W	400;419;384	ENSP00000367131:R400W;ENSP00000262545:R419W;ENSP00000437458:R384W	ENSP00000262545:R419W	R	+	1	2	PCSK2	17394023	1.000000	0.71417	0.949000	0.38748	0.988000	0.76386	2.261000	0.43276	0.722000	0.32252	0.555000	0.69702	CGG		0.582	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
STAU1	6780	broad.mit.edu	37	20	47741010	47741010	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr20:47741010C>T	ENST00000371856.2	-	7	1134	c.724G>A	c.(724-726)Gcc>Acc	p.A242T	STAU1_ENST00000340954.7_Missense_Mutation_p.A161T|STAU1_ENST00000360426.4_Missense_Mutation_p.A161T|STAU1_ENST00000371802.1_Missense_Mutation_p.A167T|STAU1_ENST00000347458.5_Missense_Mutation_p.A161T|STAU1_ENST00000371792.1_Missense_Mutation_p.A161T|STAU1_ENST00000371828.3_Missense_Mutation_p.A167T	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	242	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)	p.A242T(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			ACAGCTATGGCGGCATTTTTC	0.468																																																1	Substitution - Missense(1)	ovary(1)	20											163.0	181.0	175.0					20																	47741010		2203	4300	6503	47174417	SO:0001583	missense	6780				CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.724G>A	20.37:g.47741010C>T	ENSP00000360922:p.Ala242Thr		47174417	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	ENST00000371856.2	37	CCDS13414.1	.	.	.	.	.	.	.	.	.	.	C	34	5.337601	0.95758	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792;ENST00000437404	D;D;D;D;D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46	5.33	5.33	0.75918	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.98795	0.9594	H	0.99650	4.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99461	1.0943	10	0.87932	D	0	-10.4462	19.0449	0.93015	0.0:1.0:0.0:0.0	.	242;167	O95793;Q5JW29	STAU1_HUMAN;.	T	167;161;242;161;161;161;167;161;167	ENSP00000360893:A167T;ENSP00000345425:A161T;ENSP00000360922:A242T;ENSP00000353604:A161T;ENSP00000323443:A161T;ENSP00000360867:A167T;ENSP00000360857:A161T;ENSP00000416779:A167T	ENSP00000345425:A161T	A	-	1	0	STAU1	47174417	1.000000	0.71417	0.376000	0.26042	0.702000	0.40608	7.814000	0.86154	2.492000	0.84095	0.650000	0.86243	GCC		0.468	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079633.1	NM_017453	
GCNT4	51301	broad.mit.edu	37	5	74324666	74324666	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr5:74324666C>A	ENST00000322348.4	-	1	2058	c.1197G>T	c.(1195-1197)agG>agT	p.R399S		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	399					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)	p.R399S(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		TGATAAGCCACCTTAATTCTG	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											100.0	99.0	99.0					5																	74324666		2203	4300	6503	74360422	SO:0001583	missense	51301			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.1197G>T	5.37:g.74324666C>A	ENSP00000317027:p.Arg399Ser		74360422		Missense_Mutation	SNP	ENST00000322348.4	37	CCDS4026.1	.	.	.	.	.	.	.	.	.	.	.	15.13	2.742524	0.49151	.	.	ENSG00000176928	ENST00000322348	T	0.11277	2.79	6.06	2.92	0.33932	.	0.000000	0.85682	D	0.000000	T	0.15262	0.0368	L	0.43923	1.385	0.40810	D	0.983417	P	0.44776	0.843	P	0.53549	0.729	T	0.08086	-1.0739	10	0.10902	T	0.67	-13.7788	11.4579	0.50193	0.0:0.7181:0.0:0.2819	.	399	Q9P109	GCNT4_HUMAN	S	399	ENSP00000317027:R399S	ENSP00000317027:R399S	R	-	3	2	GCNT4	74360422	0.947000	0.32204	1.000000	0.80357	0.997000	0.91878	0.002000	0.13061	0.898000	0.36418	0.650000	0.86243	AGG		0.403	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254040.1	NM_016591	
FBXO38	81545	broad.mit.edu	37	5	147795556	147795556	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr5:147795556T>A	ENST00000340253.5	+	11	1498	c.1330T>A	c.(1330-1332)Tct>Act	p.S444T	FBXO38_ENST00000394370.3_Missense_Mutation_p.S444T|FBXO38_ENST00000513826.1_Missense_Mutation_p.S444T|FBXO38_ENST00000296701.6_Missense_Mutation_p.S444T			Q6PIJ6	FBX38_HUMAN	F-box protein 38	444					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.S444T(1)	ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAGCTGGACTCTTTTGGCCA	0.403																																																1	Substitution - Missense(1)	ovary(1)	5											133.0	133.0	133.0					5																	147795556		2203	4300	6503	147775749	SO:0001583	missense	81545			BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.1330T>A	5.37:g.147795556T>A	ENSP00000342023:p.Ser444Thr		147775749	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	ENST00000340253.5	37		.	.	.	.	.	.	.	.	.	.	T	25.5	4.647889	0.87958	.	.	ENSG00000145868	ENST00000340253;ENST00000296701;ENST00000394370;ENST00000513826	T;T;T;T	0.17691	2.26;5.46;2.26;5.46	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.31702	0.0805	L	0.34521	1.04	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.996	D;D;D	0.78314	0.991;0.991;0.987	T	0.03555	-1.1025	10	0.87932	D	0	-12.1686	14.9044	0.70706	0.0:0.0:0.0:1.0	.	444;444;444	Q6PIJ6-3;Q6PIJ6-2;Q6PIJ6	.;.;FBX38_HUMAN	T	444	ENSP00000342023:S444T;ENSP00000296701:S444T;ENSP00000377895:S444T;ENSP00000426410:S444T	ENSP00000296701:S444T	S	+	1	0	FBXO38	147775749	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.698000	0.84413	2.266000	0.75297	0.528000	0.53228	TCT		0.403	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000252185.2	NM_030793	
RUFY1	80230	broad.mit.edu	37	5	179012844	179012844	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr5:179012844C>G	ENST00000319449.4	+	8	1016	c.1004C>G	c.(1003-1005)aCt>aGt	p.T335S	RUFY1_ENST00000377001.2_Missense_Mutation_p.T335S|RUFY1_ENST00000437570.2_Missense_Mutation_p.T227S|RUFY1_ENST00000393438.2_Missense_Mutation_p.T227S	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	335					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.T227S(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGGAAAAGACTAACTCAAAG	0.348										HNSCC(44;0.11)																																						1	Substitution - Missense(1)	ovary(1)	5											99.0	106.0	103.0					5																	179012844		2203	4300	6503	178945450	SO:0001583	missense	80230			AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1004C>G	5.37:g.179012844C>G	ENSP00000325594:p.Thr335Ser		178945450	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	37	CCDS4445.2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	8.134|8.134|8.134	0.783635|0.783635|0.783635	0.16189|0.16189|0.16189	.|.|.	.|.|.	ENSG00000176783|ENSG00000176783|ENSG00000176783	ENST00000502434|ENST00000508609|ENST00000319449;ENST00000377001;ENST00000437570;ENST00000393438	.|.|T;T;T;T	.|.|0.76968	.|.|-1.06;1.79;-1.06;-1.06	5.77|5.77|5.77	4.91|4.91|4.91	0.64330|0.64330|0.64330	.|.|.	.|.|0.050151	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.66771|0.66771|0.66771	0.2823|0.2823|0.2823	L|L|L	0.39514|0.39514|0.39514	1.22|1.22|1.22	0.44373|0.44373|0.44373	D|D|D	0.997274|0.997274|0.997274	.|.|B	.|.|0.15719	.|.|0.014	.|.|B	.|.|0.18263	.|.|0.021	T|T|T	0.60596|0.60596|0.60596	-0.7232|-0.7232|-0.7232	5|5|10	.|.|0.02654	.|.|T	.|.|1	-4.724|-4.724|-4.724	14.657|14.657|14.657	0.68841|0.68841|0.68841	0.0:0.9306:0.0:0.0693|0.0:0.9306:0.0:0.0693|0.0:0.9306:0.0:0.0693	.|.|.	.|.|335	.|.|Q96T51	.|.|RUFY1_HUMAN	E|V|S	46|124|335;335;227;227	.|.|ENSP00000325594:T335S;ENSP00000366200:T335S;ENSP00000390025:T227S;ENSP00000377087:T227S	.|.|ENSP00000325594:T335S	D|L|T	+|+|+	3|1|2	2|2|0	RUFY1|RUFY1|RUFY1	178945450|178945450|178945450	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.890000|0.890000|0.890000	0.34922|0.34922|0.34922	0.897000|0.897000|0.897000	0.52465|0.52465|0.52465	5.539000|5.539000|5.539000	0.67199|0.67199|0.67199	1.453000|1.453000|1.453000	0.47775|0.47775|0.47775	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAC|CTA|ACT		0.348	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451	
HIST1H1A	3024	broad.mit.edu	37	6	26017677	26017677	+	Missense_Mutation	SNP	G	G	C	rs375118598		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr6:26017677G>C	ENST00000244573.3	-	1	363	c.284C>G	c.(283-285)aCg>aGg	p.T95R		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	95	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)	p.T95R(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						CTGCACCAACGTTCCCTTGCT	0.572																																																1	Substitution - Missense(1)	ovary(1)	6											78.0	81.0	80.0					6																	26017677		2203	4300	6503	26125656	SO:0001583	missense	3024			AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.284C>G	6.37:g.26017677G>C	ENSP00000244573:p.Thr95Arg		26125656	Q3MJ34	Missense_Mutation	SNP	ENST00000244573.3	37	CCDS4569.1	.	.	.	.	.	.	.	.	.	.	N	17.83	3.484465	0.63962	.	.	ENSG00000124610	ENST00000244573	T	0.09817	2.94	4.2	4.2	0.49525	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.159960	0.53938	D	0.000041	T	0.24547	0.0595	M	0.71296	2.17	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.02868	-1.1100	10	0.72032	D	0.01	-14.8275	16.4244	0.83809	0.0:0.0:1.0:0.0	.	95	Q02539	H11_HUMAN	R	95	ENSP00000244573:T95R	ENSP00000244573:T95R	T	-	2	0	HIST1H1A	26125656	1.000000	0.71417	0.982000	0.44146	0.147000	0.21601	5.607000	0.67648	2.260000	0.74910	0.609000	0.83330	ACG		0.572	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043884.1	NM_005325	
ZNF184	7738	broad.mit.edu	37	6	27420013	27420013	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr6:27420013C>G	ENST00000211936.6	-	6	1609	c.1325G>C	c.(1324-1326)gGg>gCg	p.G442A	ZNF184_ENST00000377419.1_Missense_Mutation_p.G442A	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	442					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G442A(1)		breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GGGTTTCTCCCCAGTATGAGT	0.403																																																1	Substitution - Missense(1)	ovary(1)	6											85.0	85.0	85.0					6																	27420013		2203	4300	6503	27527992	SO:0001583	missense	7738			U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1325G>C	6.37:g.27420013C>G	ENSP00000211936:p.Gly442Ala		27527992	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	C	18.25	3.583456	0.65992	.	.	ENSG00000096654	ENST00000211936;ENST00000377419	T;T	0.26373	1.74;1.74	5.27	5.27	0.74061	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.50627	D	0.000117	T	0.29945	0.0749	L	0.56124	1.755	0.42806	D	0.993947	D	0.56287	0.975	P	0.53102	0.718	T	0.02533	-1.1145	10	0.87932	D	0	.	16.4094	0.83703	0.0:1.0:0.0:0.0	.	442	Q99676	ZN184_HUMAN	A	442	ENSP00000211936:G442A;ENSP00000366636:G442A	ENSP00000211936:G442A	G	-	2	0	ZNF184	27527992	0.226000	0.23696	0.989000	0.46669	0.999000	0.98932	2.419000	0.44671	2.744000	0.94065	0.655000	0.94253	GGG		0.403	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
GNL1	2794	broad.mit.edu	37	6	30521236	30521236	+	Silent	SNP	A	A	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr6:30521236A>G	ENST00000376621.3	-	6	1669	c.699T>C	c.(697-699)gcT>gcC	p.A233A		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	233	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.			PA -> RR (in Ref. 1; AAA66492). {ECO:0000305}.	cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)	p.A233A(1)		cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						CAACCACAAGAGCTGGCGGGG	0.547																																																1	Substitution - coding silent(1)	ovary(1)	6											135.0	141.0	139.0					6																	30521236		1510	2709	4219	30629215	SO:0001819	synonymous_variant	2794				CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.699T>C	6.37:g.30521236A>G			30629215	B0S838|Q96CT5	Silent	SNP	ENST00000376621.3	37	CCDS4680.1																																																																																				0.547	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076241.2		
DAGLB	221955	broad.mit.edu	37	7	6476149	6476149	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr7:6476149G>A	ENST00000297056.6	-	3	432	c.263C>T	c.(262-264)cCt>cTt	p.P88L	DAGLB_ENST00000436575.1_Missense_Mutation_p.P47L|DAGLB_ENST00000425398.2_Missense_Mutation_p.P88L|DAGLB_ENST00000421761.2_Intron|DAGLB_ENST00000428902.2_Intron|DAGLB_ENST00000479922.2_5'UTR	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	88					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.P88L(1)		breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		CCGCGGTCCAGGGTTACAAAT	0.493																																																1	Substitution - Missense(1)	ovary(1)	7											73.0	80.0	78.0					7																	6476149		2203	4300	6503	6442674	SO:0001583	missense	221955			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.263C>T	7.37:g.6476149G>A	ENSP00000297056:p.Pro88Leu		6442674	A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Missense_Mutation	SNP	ENST00000297056.6	37	CCDS5350.1	.	.	.	.	.	.	.	.	.	.	G	33	5.246543	0.95305	.	.	ENSG00000164535	ENST00000297056;ENST00000425398;ENST00000436575;ENST00000471132;ENST00000432248	T;T;T	0.43294	0.95;0.96;0.96	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.85130	0.997;0.88	T	0.59129	-0.7512	10	0.24483	T	0.36	-5.0408	20.5827	0.99408	0.0:0.0:1.0:0.0	.	88;88	B4DQU0;Q8NCG7	.;DGLB_HUMAN	L	88;88;47;88;88	ENSP00000297056:P88L;ENSP00000391171:P88L;ENSP00000404785:P47L	ENSP00000297056:P88L	P	-	2	0	DAGLB	6442674	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.109000	0.77062	2.941000	0.99782	0.655000	0.94253	CCT		0.493	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246840.2	NM_139179	
EGFR	1956	broad.mit.edu	37	7	55273168	55273168	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr7:55273168A>G	ENST00000275493.2	+	28	3668	c.3491A>G	c.(3490-3492)cAa>cGa	p.Q1164R	EGFR_ENST00000454757.2_Missense_Mutation_p.Q1111R|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	1164					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.Q1164R(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	GGCAGCCACCAAATTAGCCTG	0.542		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																												yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	1	Substitution - Missense(1)	ovary(1)	7											88.0	72.0	78.0					7																	55273168		2203	4300	6503	55240662	SO:0001583	missense	1956	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.3491A>G	7.37:g.55273168A>G	ENSP00000275493:p.Gln1164Arg		55240662	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	A	0.840	-0.742118	0.03088	.	.	ENSG00000146648	ENST00000395504;ENST00000275493;ENST00000454757	T;T	0.72835	-0.68;-0.69	5.34	4.12	0.48240	.	0.058150	0.64402	D	0.000001	T	0.56906	0.2017	L	0.43923	1.385	0.43874	D	0.996481	B	0.21688	0.059	B	0.21917	0.037	T	0.50642	-0.8804	10	0.02654	T	1	.	11.9149	0.52759	0.8557:0.1443:0.0:0.0	.	1164	P00533	EGFR_HUMAN	R	1034;1164;1111	ENSP00000275493:Q1164R;ENSP00000395243:Q1111R	ENSP00000275493:Q1164R	Q	+	2	0	EGFR	55240662	1.000000	0.71417	0.907000	0.35723	0.242000	0.25591	6.916000	0.75776	2.152000	0.67230	0.456000	0.33151	CAA		0.542	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
CPA4	51200	broad.mit.edu	37	7	129950719	129950719	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	A	A	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr7:129950719C>A	ENST00000222482.4	+	9	914	c.886C>A	c.(886-888)Caa>Aaa	p.Q296K	CPA4_ENST00000445470.2_Missense_Mutation_p.Q263K|CPA4_ENST00000493259.1_Missense_Mutation_p.Q192K	NM_016352.3	NP_057436.2	Q9UI42	CBPA4_HUMAN	carboxypeptidase A4	296					histone acetylation (GO:0016573)	extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.Q296K(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Melanoma(18;0.0435)					AGATTTCATCCAAAAACATGG	0.517																																																1	Substitution - Missense(1)	ovary(1)	7											139.0	133.0	135.0					7																	129950719		2203	4300	6503	129737955	SO:0001583	missense	51200			AF095719	CCDS5818.1, CCDS55163.1	7q32	2008-07-18			ENSG00000128510	ENSG00000128510			15740	protein-coding gene	gene with protein product	"""carboxypeptidase A3"""	607635				10383164, 10860668	Standard	NM_016352		Approved	CPA3	uc003vpr.3	Q9UI42	OTTHUMG00000157825	ENST00000222482.4:c.886C>A	7.37:g.129950719C>A	ENSP00000222482:p.Gln296Lys		129737955	B7Z576|Q86UY9	Missense_Mutation	SNP	ENST00000222482.4	37	CCDS5818.1	.	.	.	.	.	.	.	.	.	.	C	5.172	0.217294	0.09810	.	.	ENSG00000128510	ENST00000445470;ENST00000222482;ENST00000538687;ENST00000493259	T;T;T	0.11385	2.78;2.78;2.78	6.07	1.8	0.24995	Peptidase M14, carboxypeptidase A (2);	0.316366	0.32218	N	0.006414	T	0.03739	0.0106	N	0.01789	-0.72	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.41179	-0.9523	10	0.08381	T	0.77	.	14.5637	0.68159	0.5897:0.4103:0.0:0.0	.	263;296	B7Z576;Q9UI42	.;CBPA4_HUMAN	K	263;296;101;192	ENSP00000412947:Q263K;ENSP00000222482:Q296K;ENSP00000419660:Q192K	ENSP00000222482:Q296K	Q	+	1	0	CPA4	129737955	0.000000	0.05858	0.077000	0.20336	0.939000	0.58152	-0.229000	0.09098	0.852000	0.35287	0.655000	0.94253	CAA		0.517	CPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349725.1	NM_016352	
AKR1B15	441282	broad.mit.edu	37	7	134260193	134260193	+	Missense_Mutation	SNP	G	G	A	rs375750709		TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr7:134260193G>A	ENST00000457545.2	+	7	795	c.535G>A	c.(535-537)Gag>Aag	p.E179K	AKR1B15_ENST00000423958.1_Missense_Mutation_p.E151K	NM_001080538.2	NP_001074007.2	C9JRZ8	AK1BF_HUMAN	aldo-keto reductase family 1, member B15	179							oxidoreductase activity (GO:0016491)	p.E197K(1)		endometrium(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|urinary_tract(1)	18						GCTGGTGGACGAGGGGCTGGT	0.517																																																1	Substitution - Missense(1)	ovary(1)	7						G	LYS/GLU	1,4405		0,1,2202	62.0	65.0	64.0		535	0.6	0.9	7		64	0,8600		0,0,4300	no	missense	AKR1B15	NM_001080538.2	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	179/345	134260193	1,13005	2203	4300	6503	133910733	SO:0001583	missense	441282				CCDS47715.1, CCDS47715.2	7q33	2009-09-09			ENSG00000227471	ENSG00000227471		"""Aldo-keto reductases"""	37281	protein-coding gene	gene with protein product							Standard	NM_001080538		Approved		uc011kpr.2	C9JRZ8	OTTHUMG00000155376	ENST00000457545.2:c.535G>A	7.37:g.134260193G>A	ENSP00000389289:p.Glu179Lys		133910733	C9J3V2	Missense_Mutation	SNP	ENST00000457545.2	37	CCDS47715.2	.	.	.	.	.	.	.	.	.	.	-	10.71	1.426927	0.25726	2.27E-4	0.0	ENSG00000227471	ENST00000457545;ENST00000423958	T;T	0.26660	1.72;1.72	3.63	0.561	0.17285	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);	.	.	.	.	T	0.12944	0.0314	N	0.17872	0.535	0.24424	N	0.994602	B;B	0.29481	0.003;0.245	B;B	0.23716	0.012;0.048	T	0.27434	-1.0074	9	0.26408	T	0.33	.	5.7519	0.18152	0.2009:0.1657:0.6334:0.0	.	151;179	C9JRZ8-2;C9JRZ8	.;AK1BF_HUMAN	K	179;151	ENSP00000389289:E179K;ENSP00000397009:E151K	ENSP00000397009:E151K	E	+	1	0	AKR1B15	133910733	0.001000	0.12720	0.899000	0.35326	0.707000	0.40811	1.066000	0.30604	0.189000	0.20188	-0.324000	0.08512	GAG		0.517	AKR1B15-001	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339726.2		
ZNF746	155061	broad.mit.edu	37	7	149191528	149191528	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr7:149191528G>A	ENST00000340622.3	-	2	371	c.91C>T	c.(91-93)Cgc>Tgc	p.R31C	ZNF746_ENST00000458143.2_Missense_Mutation_p.R31C|ZNF746_ENST00000461958.2_Missense_Mutation_p.R31C			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	31					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)	p.R31C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GAAAGCAGGCGAGCAGCCTGC	0.547																																																1	Substitution - Missense(1)	ovary(1)	7											90.0	92.0	91.0					7																	149191528		2203	4300	6503	148822461	SO:0001583	missense	155061			AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.91C>T	7.37:g.149191528G>A	ENSP00000345140:p.Arg31Cys		148822461	A8K6Z9|Q6ZRF9	Missense_Mutation	SNP	ENST00000340622.3	37	CCDS5897.1	.	.	.	.	.	.	.	.	.	.	.	19.64	3.865333	0.71949	.	.	ENSG00000181220	ENST00000340622;ENST00000458143;ENST00000461958	T;T	0.26373	1.74;1.74	4.64	4.64	0.57946	.	0.000000	0.43747	D	0.000521	T	0.34687	0.0906	N	0.19112	0.55	0.45490	D	0.998458	D;D	0.89917	1.0;1.0	D;D	0.80764	0.992;0.994	T	0.23797	-1.0178	10	0.87932	D	0	-24.5085	13.0146	0.58749	0.0:0.0:1.0:0.0	.	31;31	Q6NUN9-2;Q6NUN9	.;ZN746_HUMAN	C	31;31;18	ENSP00000345140:R31C;ENSP00000395007:R31C	ENSP00000345140:R31C	R	-	1	0	ZNF746	148822461	0.981000	0.34729	1.000000	0.80357	0.903000	0.53119	4.167000	0.58209	2.119000	0.64992	0.514000	0.50259	CGC		0.547	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	NM_152557	
HRSP12	10247	broad.mit.edu	37	8	99116773	99116773	+	Splice_Site	SNP	C	C	G			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr8:99116773C>G	ENST00000254878.3	-	5	440		c.e5-1			NM_005836.2	NP_005827.1	P52758	UK114_HUMAN	heat-responsive protein 12						regulation of translational termination (GO:0006449)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deaminase activity (GO:0019239)|endonuclease activity (GO:0004519)|poly(A) RNA binding (GO:0044822)	p.?(1)		large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	6	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.214)			CTCTTGAAATCTGAATTTAAA	0.269																																																1	Unknown(1)	ovary(1)	8											73.0	78.0	76.0					8																	99116773		2203	4300	6503	99185949	SO:0001630	splice_region_variant	10247			BC008418	CCDS6276.1	8q22	2014-05-09			ENSG00000132541	ENSG00000132541			16897	protein-coding gene	gene with protein product	"""translational inhibitor p14.5"""	602487				8973653, 9405234, 20817725	Standard	NM_005836		Approved	UK114, P14.5, PSP	uc003yii.1	P52758	OTTHUMG00000164670	ENST00000254878.3:c.296-1G>C	8.37:g.99116773C>G			99185949	Q6FHU9|Q6IBG0	Splice_Site	SNP	ENST00000254878.3	37	CCDS6276.1	.	.	.	.	.	.	.	.	.	.	C	16.99	3.273897	0.59649	.	.	ENSG00000132541	ENST00000254878;ENST00000520507;ENST00000521560;ENST00000520989	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4742	0.67535	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HRSP12	99185949	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	6.066000	0.71185	2.135000	0.66039	0.467000	0.42956	.		0.269	HRSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379687.1	NM_005836	Intron
POP1	10940	broad.mit.edu	37	8	99169860	99169860	+	Silent	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr8:99169860G>A	ENST00000401707.2	+	16	2517	c.2436G>A	c.(2434-2436)ctG>ctA	p.L812L	POP1_ENST00000349693.3_Silent_p.L812L	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	812					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)	p.L812L(1)		autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GAAAATTACTGAAGCAACTGT	0.483																																																1	Substitution - coding silent(1)	ovary(1)	8											46.0	50.0	48.0					8																	99169860		2203	4297	6500	99239036	SO:0001819	synonymous_variant	10940			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.2436G>A	8.37:g.99169860G>A			99239036	A8K5W9|Q15037	Silent	SNP	ENST00000401707.2	37	CCDS6277.1																																																																																				0.483	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379470.1	NM_015029	
MROH5	389690	broad.mit.edu	37	8	142445324	142445324	+	RNA	SNP	C	C	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr8:142445324C>T	ENST00000606664.1	+	0	680				MROH5_ENST00000430863.1_RNA														p.?(2)									CAGCACAGCACAGCGGTAGAA	0.662																																																2	Unknown(2)	ovary(2)	8											34.0	44.0	41.0					8																	142445324		2157	4260	6417	142514506			389690																															8.37:g.142445324C>T			142514506		Missense_Mutation	SNP	ENST00000606664.1	37																																																																																					0.662	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	antisense	OTTHUMT00000470872.1		
AK3	50808	broad.mit.edu	37	9	4718447	4718447	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr9:4718447G>C	ENST00000381809.3	-	4	765	c.535C>G	c.(535-537)Caa>Gaa	p.Q179E	AK3_ENST00000359883.2_Missense_Mutation_p.Q109E|AK3_ENST00000447596.4_Missense_Mutation_p.Q139E	NM_016282.3	NP_057366.2	P27144	KAD4_HUMAN	adenylate kinase 3	177					ADP biosynthetic process (GO:0006172)|AMP metabolic process (GO:0046033)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|GTP metabolic process (GO:0046039)|liver development (GO:0001889)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|response to drug (GO:0042493)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside triphosphate adenylate kinase activity (GO:0046899)	p.Q179E(1)		large_intestine(2)|lung(1)|ovary(2)	5	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)	Adefovir Dipivoxil(DB00718)|Tenofovir(DB00300)	GGCTTTGTTTGGTCTTCATAA	0.433																																																1	Substitution - Missense(1)	ovary(1)	9											168.0	153.0	158.0					9																	4718447		2203	4300	6503	4708447	SO:0001583	missense	50808			BC013771	CCDS6455.1, CCDS56561.1, CCDS56562.1	9p24.1	2010-09-29	2004-06-11	2005-04-07	ENSG00000147853	ENSG00000147853			17376	protein-coding gene	gene with protein product		609290	"""adenylate kinase 6"", ""adenylate kinase 3 like 1"""	AK6, AK3L1		8288, 182062	Standard	NM_001199852		Approved	AKL3L1	uc003ziq.2	Q9UIJ7	OTTHUMG00000019472	ENST00000381809.3:c.535C>G	9.37:g.4718447G>C	ENSP00000371230:p.Gln179Glu		4708447	B2R927|D3DQ62|Q6IBH4|Q6NXQ5|Q8IUU9	Missense_Mutation	SNP	ENST00000381809.3	37	CCDS6455.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566274	0.65651	.	.	ENSG00000147853	ENST00000381809;ENST00000359883;ENST00000474822;ENST00000447596	T;T;T	0.76839	0.96;-1.05;0.96	5.36	2.33	0.28932	.	0.234638	0.46145	N	0.000307	T	0.75302	0.3831	L	0.46947	1.48	0.38960	D	0.958523	P;D	0.57257	0.931;0.979	P;P	0.49665	0.519;0.618	T	0.73824	-0.3861	10	0.44086	T	0.13	-13.3043	11.601	0.51003	0.0:0.2529:0.6159:0.1312	.	139;179	E7ET30;Q9UIJ7	.;KAD3_HUMAN	E	179;109;109;139	ENSP00000371230:Q179E;ENSP00000352948:Q109E;ENSP00000413933:Q139E	ENSP00000352948:Q109E	Q	-	1	0	AK3	4708447	0.997000	0.39634	0.012000	0.15200	0.994000	0.84299	2.450000	0.44943	0.185000	0.20105	0.655000	0.94253	CAA		0.433	AK3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051585.1	NM_016282	
PPP1R3F	89801	broad.mit.edu	37	X	49142296	49142296	+	Splice_Site	SNP	G	G	C			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chrX:49142296G>C	ENST00000055335.6	+	4	1160	c.1144G>C	c.(1144-1146)Gtt>Ctt	p.V382L	PPP1R3F_ENST00000495799.1_Splice_Site_p.V36L|PPP1R3F_ENST00000438316.1_Splice_Site_p.V53L|PPP1R3F_ENST00000376188.1_Splice_Site_p.V36L|PPP1R3F_ENST00000466508.1_Splice_Site_p.V36L	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	382					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)	p.V382L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					ATGGCTCCAGGTTTCTGACGT	0.572																																																1	Substitution - Missense(1)	ovary(1)	X											37.0	37.0	37.0					X																	49142296		2203	4300	6503	49029240	SO:0001630	splice_region_variant	89801				CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1144-1G>C	X.37:g.49142296G>C			49029240	A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	ENST00000055335.6	37	CCDS35254.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012863	0.54468	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	T;T;T;T;T	0.62105	0.48;0.48;0.05;0.48;0.48	5.27	4.4	0.53042	.	0.000000	0.43110	D	0.000612	T	0.58821	0.2149	L	0.27053	0.805	0.30122	N	0.8056	P;D;P	0.54964	0.94;0.969;0.901	P;P;P	0.56434	0.798;0.798;0.458	T	0.56829	-0.7914	9	.	.	.	-10.6803	9.3255	0.37990	0.1056:0.0:0.8944:0.0	.	53;67;382	F5H262;A2VDJ8;Q6ZSY5	.;.;PPR3F_HUMAN	L	36;53;382;36;36	ENSP00000420687:V36L;ENSP00000415548:V53L;ENSP00000055335:V382L;ENSP00000417535:V36L;ENSP00000365359:V36L	.	V	+	1	0	PPP1R3F	49029240	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	2.292000	0.43549	2.195000	0.70347	0.529000	0.55759	GTT		0.572	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060819.2	NM_033215	Missense_Mutation
CCNB3	85417	broad.mit.edu	37	X	50037981	50037981	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chrX:50037981G>A	ENST00000376042.1	+	5	621	c.323G>A	c.(322-324)cGg>cAg	p.R108Q	CCNB3_ENST00000276014.7_Missense_Mutation_p.R108Q|CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	108					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.R108Q(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					AAGAATAAGCGGAATCTAAAA	0.398																																																2	Substitution - Missense(2)	ovary(2)	X											115.0	98.0	104.0					X																	50037981		2203	4300	6503	50054721	SO:0001583	missense	85417			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.323G>A	X.37:g.50037981G>A	ENSP00000365210:p.Arg108Gln		50054721	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	ENST00000376042.1	37	CCDS14331.1	.	.	.	.	.	.	.	.	.	.	G	10.60	1.394712	0.25205	.	.	ENSG00000147082	ENST00000376042;ENST00000396540;ENST00000276014	T;T	0.12361	2.69;2.69	3.98	-0.506	0.11989	.	.	.	.	.	T	0.03871	0.0109	N	0.08118	0	0.09310	N	1	P	0.36222	0.544	B	0.24269	0.052	T	0.32798	-0.9893	8	.	.	.	.	0.4556	0.00508	0.2569:0.1257:0.1934:0.424	.	108	Q8WWL7	CCNB3_HUMAN	Q	108	ENSP00000365210:R108Q;ENSP00000276014:R108Q	.	R	+	2	0	CCNB3	50054721	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.151000	0.16283	-0.272000	0.09259	-0.332000	0.08345	CGG		0.398	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056558.1		
MORC4	79710	broad.mit.edu	37	X	106205288	106205288	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chrX:106205288T>A	ENST00000355610.4	-	10	1484	c.1210A>T	c.(1210-1212)Aca>Tca	p.T404S	MORC4_ENST00000535534.1_Missense_Mutation_p.T152S|MORC4_ENST00000255495.7_Missense_Mutation_p.T404S	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	404						nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.T227S(1)		endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						TCTTGAGATGTTTTTTCCTTC	0.368																																																1	Substitution - Missense(1)	ovary(1)	X											278.0	245.0	256.0					X																	106205288		2203	4300	6503	106091944	SO:0001583	missense	79710			AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.1210A>T	X.37:g.106205288T>A	ENSP00000347821:p.Thr404Ser		106091944	A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	ENST00000355610.4	37	CCDS14525.2	.	.	.	.	.	.	.	.	.	.	t	8.958	0.969844	0.18659	.	.	ENSG00000133131	ENST00000355610;ENST00000535534;ENST00000255495	T;T;T	0.29917	2.78;1.55;2.77	5.06	2.35	0.29111	.	0.581530	0.17155	N	0.184910	T	0.12305	0.0299	N	0.12182	0.205	0.19575	N	0.999965	B;B;B	0.16166	0.003;0.016;0.001	B;B;B	0.11329	0.005;0.006;0.003	T	0.22626	-1.0211	10	0.14252	T	0.57	-0.6653	2.1135	0.03708	0.2503:0.1699:0.0:0.5798	.	152;404;404	A1YR24;A1YR23;Q8TE76	.;.;MORC4_HUMAN	S	404;152;404	ENSP00000347821:T404S;ENSP00000440359:T152S;ENSP00000255495:T404S	ENSP00000255495:T404S	T	-	1	0	MORC4	106091944	0.963000	0.33076	0.743000	0.31040	0.617000	0.37484	0.421000	0.21280	0.671000	0.31185	-0.373000	0.07131	ACA		0.368	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057816.3	NM_024657	
MID2	11043	broad.mit.edu	37	X	107084208	107084208	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chrX:107084208C>T	ENST00000262843.6	+	2	861	c.313C>T	c.(313-315)Cgc>Tgc	p.R105C	MID2_ENST00000443968.2_Missense_Mutation_p.R105C	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	105					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)	p.R85C(1)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						CATTATTGATCGCTTCCAGAA	0.547																																																1	Substitution - Missense(1)	ovary(1)	X											74.0	64.0	67.0					X																	107084208		2203	4300	6503	106970864	SO:0001583	missense	11043				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.313C>T	X.37:g.107084208C>T	ENSP00000262843:p.Arg105Cys		106970864	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	ENST00000262843.6	37	CCDS14532.2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.132723	0.77662	.	.	ENSG00000080561	ENST00000451923;ENST00000262843;ENST00000443968	T;T;T	0.18174	2.23;2.23;2.23	5.94	5.94	0.96194	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.45054	0.1323	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.972;0.993	T	0.41502	-0.9505	10	0.87932	D	0	.	16.5117	0.84287	0.0:1.0:0.0:0.0	.	105;105	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	C	85;105;105	ENSP00000410730:R85C;ENSP00000262843:R105C;ENSP00000413976:R105C	ENSP00000262843:R105C	R	+	1	0	MID2	106970864	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.987000	0.56944	2.506000	0.84524	0.600000	0.82982	CGC		0.547	MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057852.2	NM_012216	
COL4A6	1288	broad.mit.edu	37	X	107554056	107554056	+	Silent	SNP	T	T	A			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chrX:107554056T>A	ENST00000372216.4	-	3	169	c.69A>T	c.(67-69)ggA>ggT	p.G23G	COL4A6_ENST00000334504.7_Silent_p.G22G|COL4A6_ENST00000538570.1_Silent_p.G22G|COL4A6_ENST00000394872.2_Silent_p.G22G|COL4A6_ENST00000461897.1_5'UTR|COL4A6_ENST00000545689.1_Silent_p.G22G	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	23	7S domain.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)	p.G22G(1)		breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AAGACTTCTCTCCCTATTAAA	0.408									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)											1	Substitution - coding silent(1)	ovary(1)	X											81.0	76.0	78.0					X																	107554056		2203	4300	6503	107440712	SO:0001819	synonymous_variant	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.69A>T	X.37:g.107554056T>A			107440712	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Silent	SNP	ENST00000372216.4	37	CCDS14541.1																																																																																				0.408	COL4A6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057875.2		
GLDC	2731	broad.mit.edu	37	9	6554727	6554736	+	Frame_Shift_Del	DEL	GAAGATTTAG	GAAGATTTAG	-			TCGA-13-1501-01A-01W-0545-08	TCGA-13-1501-10A-01W-0546-08	GAAGATTTAG	GAAGATTTAG	-	-	GAAGATTTAG	GAAGATTTAG	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	0ac17b64-67f6-4440-bb66-df1c27b6090e	87f543e5-a25b-480b-a5bf-66b37e3ed596	g.chr9:6554727_6554736delGAAGATTTAG	ENST00000321612.6	-	19	2398_2407	c.2248_2257delCTAAATCTTC	c.(2248-2259)ctaaatcttcacfs	p.LNLH750fs		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	750					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)	p.L750fs*20(1)		cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	AAGGTCTTGTGAAGATTTAGGTGCGAGACA	0.552																																																1	Deletion - Frameshift(1)	ovary(1)	9																																								6544736	SO:0001589	frameshift_variant	2731			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.2248_2257delCTAAATCTTC	9.37:g.6554727_6554736delGAAGATTTAG	ENSP00000370737:p.Leu750fs		6544727	Q2M2F8	Frame_Shift_Del	DEL	ENST00000321612.6	37	CCDS34987.1																																																																																				0.552	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
