#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RAP1GAP	5909	broad.mit.edu	37	1	21943859	21943859	+	Silent	SNP	G	G	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr1:21943859G>T	ENST00000374765.4	-	7	431	c.231C>A	c.(229-231)acC>acA	p.T77T	RAP1GAP_ENST00000374763.2_Silent_p.T77T|RAP1GAP_ENST00000374757.3_5'UTR|RAP1GAP_ENST00000542643.2_Silent_p.T77T|RAP1GAP_ENST00000374761.2_Silent_p.T108T|RAP1GAP_ENST00000290101.4_Silent_p.T141T	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	77					GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)	p.T77T(1)|p.T108T(1)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GCTTCACCTTGGTTGTGGGCG	0.642																																																2	Substitution - coding silent(2)	ovary(2)	1											158.0	126.0	137.0					1																	21943859		2198	4299	6497	21816446	SO:0001819	synonymous_variant	5909			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.231C>A	1.37:g.21943859G>T			21816446	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Silent	SNP	ENST00000374765.4	37	CCDS218.1																																																																																				0.642	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885	
IQCC	55721	broad.mit.edu	37	1	32672631	32672631	+	Silent	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr1:32672631C>T	ENST00000291358.6	+	4	489	c.468C>T	c.(466-468)agC>agT	p.S156S	RP4-622L5.7_ENST00000373604.4_RNA|DCDC2B_ENST00000409358.1_5'Flank|IQCC_ENST00000537469.1_Silent_p.S236S|RP4-622L5.7_ENST00000421616.1_RNA	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	156								p.S156S(2)		endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TGCCCCACAGCCAACCTCAGC	0.527																																																2	Substitution - coding silent(2)	ovary(1)|lung(1)	1											108.0	109.0	109.0					1																	32672631		2203	4300	6503	32445218	SO:0001819	synonymous_variant	55721			AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.468C>T	1.37:g.32672631C>T			32445218	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Silent	SNP	ENST00000291358.6	37	CCDS355.1																																																																																				0.527	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015731.3	NM_018134	
GLB1L2	89944	broad.mit.edu	37	11	134212707	134212707	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr11:134212707C>T	ENST00000535456.2	+	2	334	c.146C>T	c.(145-147)gCc>gTc	p.A49V	GLB1L2_ENST00000339772.7_Missense_Mutation_p.A49V|GLB1L2_ENST00000389881.3_Missense_Mutation_p.A49V	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	49					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)	p.A49V(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		GGGCTGCAGGCCAAGGGCTGG	0.627																																																1	Substitution - Missense(1)	ovary(1)	11											55.0	59.0	57.0					11																	134212707		2201	4297	6498	133717917	SO:0001583	missense	89944				CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.146C>T	11.37:g.134212707C>T	ENSP00000444628:p.Ala49Val		133717917	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	ENST00000535456.2	37	CCDS31724.1	.	.	.	.	.	.	.	.	.	.	C	10.03	1.238415	0.22711	.	.	ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881	D;D;D	0.97066	-4.23;-4.23;-4.23	4.86	2.99	0.34606	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.414019	0.26963	N	0.021609	D	0.89497	0.6732	N	0.08118	0	0.09310	N	1	B	0.23058	0.079	B	0.23852	0.049	T	0.78288	-0.2262	10	0.09338	T	0.73	-4.6079	8.5144	0.33237	0.0:0.7637:0.0:0.2363	.	49	Q8IW92	GLBL2_HUMAN	V	49	ENSP00000344659:A49V;ENSP00000444628:A49V;ENSP00000374531:A49V	ENSP00000344659:A49V	A	+	2	0	GLB1L2	133717917	0.898000	0.30612	0.000000	0.03702	0.001000	0.01503	4.385000	0.59613	0.655000	0.30866	-0.140000	0.14226	GCC		0.627	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393629.2	NM_138342	
STAB2	55576	broad.mit.edu	37	12	104118857	104118857	+	Silent	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr12:104118857C>T	ENST00000388887.2	+	45	4992	c.4788C>T	c.(4786-4788)cgC>cgT	p.R1596R		NM_017564.9	NP_060034.9			stabilin 2									p.R1596R(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTACCTGCCGCGGCAGCATTT	0.448																																																1	Substitution - coding silent(1)	ovary(1)	12											120.0	116.0	118.0					12																	104118857		2203	4300	6503	102642987	SO:0001819	synonymous_variant	55576			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4788C>T	12.37:g.104118857C>T			102642987		Silent	SNP	ENST00000388887.2	37	CCDS31888.1																																																																																				0.448	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
SRRM4	84530	broad.mit.edu	37	12	119568488	119568488	+	Missense_Mutation	SNP	G	G	A	rs532719039		TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr12:119568488G>A	ENST00000267260.4	+	8	1008	c.620G>A	c.(619-621)cGc>cAc	p.R207H	SRRM4_ENST00000537597.1_3'UTR	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	207	Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)	p.R207H(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CCCAGGCACCGCGGCCGGTCC	0.622													G|||	1	0.000199681	0.0	0.0	5008	,	,		13812	0.001		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	12											15.0	18.0	17.0					12																	119568488		1876	4091	5967	118052871	SO:0001583	missense	84530			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.620G>A	12.37:g.119568488G>A	ENSP00000267260:p.Arg207His		118052871	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212125	0.58452	.	.	ENSG00000139767	ENST00000267260	T	0.27402	1.67	5.17	4.27	0.50696	.	0.412269	0.22551	N	0.058589	T	0.41328	0.1154	L	0.47716	1.5	0.34760	D	0.73263	D	0.69078	0.997	P	0.58391	0.838	T	0.53823	-0.8384	10	0.56958	D	0.05	-12.928	11.3983	0.49856	0.0856:0.0:0.9144:0.0	.	207	A7MD48	SRRM4_HUMAN	H	207	ENSP00000267260:R207H	ENSP00000267260:R207H	R	+	2	0	SRRM4	118052871	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	4.164000	0.58190	2.415000	0.81967	0.448000	0.29417	CGC		0.622	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
AP5M1	55745	broad.mit.edu	37	14	57752967	57752967	+	Silent	SNP	A	A	G			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr14:57752967A>G	ENST00000261558.3	+	7	1726	c.1320A>G	c.(1318-1320)acA>acG	p.T440T	AP5M1_ENST00000431972.2_Silent_p.T454T	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	440	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)		p.T440T(1)									TAGATTACACACTTACTGGAT	0.323																																																1	Substitution - coding silent(1)	ovary(1)	14											168.0	164.0	165.0					14																	57752967		2203	4298	6501	56822720	SO:0001819	synonymous_variant	55745			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.1320A>G	14.37:g.57752967A>G			56822720	O95354|Q6ZMD7|Q96DX3|Q9NVC5	Silent	SNP	ENST00000261558.3	37	CCDS9729.1																																																																																				0.323	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276922.1	NM_018229	
DYNC1H1	1778	broad.mit.edu	37	14	102492939	102492939	+	Nonsense_Mutation	SNP	T	T	A			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	T	T	A	A	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr14:102492939T>A	ENST00000360184.4	+	44	8830	c.8666T>A	c.(8665-8667)tTa>tAa	p.L2889*		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2889					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.L2889*(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CAAGAAGAGTTAAGAGATTAT	0.363																																																1	Substitution - Nonsense(1)	ovary(1)	14											113.0	112.0	112.0					14																	102492939		2203	4300	6503	101562692	SO:0001587	stop_gained	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8666T>A	14.37:g.102492939T>A	ENSP00000348965:p.Leu2889*		101562692	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Nonsense_Mutation	SNP	ENST00000360184.4	37	CCDS9966.1	.	.	.	.	.	.	.	.	.	.	T	51	18.131922	0.99900	.	.	ENSG00000197102	ENST00000360184	.	.	.	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3483	0.83171	0.0:0.0:0.0:1.0	.	.	.	.	X	2889	.	ENSP00000348965:L2889X	L	+	2	0	DYNC1H1	101562692	1.000000	0.71417	0.448000	0.26945	0.981000	0.71138	7.768000	0.85345	2.254000	0.74563	0.533000	0.62120	TTA		0.363	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
ACAN	176	broad.mit.edu	37	15	89417204	89417204	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr15:89417204C>T	ENST00000561243.1	+	16	7465	c.7465C>T	c.(7465-7467)Cgg>Tgg	p.R2489W	ACAN_ENST00000352105.7_Intron|ACAN_ENST00000559004.1_Missense_Mutation_p.R2451W|ACAN_ENST00000439576.2_Missense_Mutation_p.R2489W			P16112	PGCA_HUMAN	aggrecan	2374					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)	p.R2375W(1)		NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GCCCACCATCCGGTGCCAGCC	0.617																																																1	Substitution - Missense(1)	ovary(1)	15											38.0	49.0	45.0					15																	89417204		2158	4243	6401	87218208	SO:0001583	missense	176			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.7465C>T	15.37:g.89417204C>T	ENSP00000453342:p.Arg2489Trp		87218208	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346924	0.61183	.	.	ENSG00000157766	ENST00000439576;ENST00000268134	T	0.66099	-0.19	5.32	4.4	0.53042	.	0.000000	0.30347	N	0.009831	T	0.82047	0.4952	M	0.90252	3.1	0.37768	D	0.926582	D	0.89917	1.0	D	0.79784	0.993	D	0.87710	0.2566	10	0.87932	D	0	-17.4759	14.3858	0.66942	0.149:0.851:0.0:0.0	.	2489	E7EX88	.	W	2489;2375	ENSP00000387356:R2489W	ENSP00000268134:R2375W	R	+	1	2	ACAN	87218208	1.000000	0.71417	0.999000	0.59377	0.085000	0.17905	5.882000	0.69714	1.220000	0.43490	-0.181000	0.13052	CGG		0.617	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
WDR90	197335	broad.mit.edu	37	16	705065	705065	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr16:705065G>A	ENST00000293879.4	+	14	1474	c.1474G>A	c.(1474-1476)Ggt>Agt	p.G492S	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Missense_Mutation_p.G492S			Q96KV7	WDR90_HUMAN	WD repeat domain 90	492								p.G492S(1)		endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GGTGGGCCTCGGTGGCGAGGT	0.647																																																1	Substitution - Missense(1)	ovary(1)	16											41.0	51.0	47.0					16																	705065		2098	4211	6309	645066	SO:0001583	missense	197335			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1474G>A	16.37:g.705065G>A	ENSP00000293879:p.Gly492Ser		645066	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047394	0.36085	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.31510	1.52;1.49	4.56	2.61	0.31194	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.081387	0.48767	U	0.000166	T	0.28001	0.0690	L	0.44542	1.39	0.80722	D	1	D;D;D	0.71674	0.989;0.998;0.99	P;P;B	0.50708	0.586;0.648;0.425	T	0.10989	-1.0606	10	0.12103	T	0.63	.	7.4184	0.27057	0.2664:0.0:0.7336:0.0	.	492;493;492	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	S	492	ENSP00000448122:G492S;ENSP00000293879:G492S	ENSP00000293879:G492S	G	+	1	0	WDR90	645066	1.000000	0.71417	0.003000	0.11579	0.005000	0.04900	3.773000	0.55333	0.393000	0.25203	-0.215000	0.12644	GGT		0.647	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
WIPF2	147179	broad.mit.edu	37	17	38416786	38416786	+	Splice_Site	SNP	G	G	A			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr17:38416786G>A	ENST00000323571.4	+	3	303		c.e3-1		WIPF2_ENST00000394103.3_Splice_Site|WIPF2_ENST00000583130.1_Splice_Site|WIPF2_ENST00000536600.1_Splice_Site|WIPF2_ENST00000585043.1_Splice_Site|WIPF2_ENST00000494757.1_Splice_Site	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.?(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						TTATCCTCCAGGCAAACACAG	0.542										HNSCC(43;0.11)																																						1	Unknown(1)	ovary(1)	17											87.0	82.0	84.0					17																	38416786		2203	4300	6503	35670312	SO:0001630	splice_region_variant	147179			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.64-1G>A	17.37:g.38416786G>A			35670312	A8K0L3|Q658J8|Q71RE1|Q8TE44	Splice_Site	SNP	ENST00000323571.4	37	CCDS11364.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377519	0.82682	.	.	ENSG00000171475	ENST00000323571;ENST00000394103;ENST00000536600	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9225	0.97093	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WIPF2	35670312	1.000000	0.71417	0.998000	0.56505	0.790000	0.44656	8.851000	0.92205	2.709000	0.92574	0.555000	0.69702	.		0.542	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257157.2	NM_133264	Intron
OR7C1	26664	broad.mit.edu	37	19	14910869	14910869	+	Missense_Mutation	SNP	A	A	G	rs373552926		TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr19:14910869A>G	ENST00000248073.2	-	1	154	c.80T>C	c.(79-81)cTc>cCc	p.L27P	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	27					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L27P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						CAGCCCAAAGAGAATGAACTG	0.483																																																1	Substitution - Missense(1)	ovary(1)	19						A	PRO/LEU	1,4405		0,1,2202	93.0	84.0	87.0		80	3.6	0.0	19		87	0,8600		0,0,4300	no	missense	OR7C1	NM_198944.1	98	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	probably-damaging	27/321	14910869	1,13005	2203	4300	6503	14771869	SO:0001583	missense	26664			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.80T>C	19.37:g.14910869A>G	ENSP00000248073:p.Leu27Pro		14771869	Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	ENST00000248073.2	37	CCDS12317.1	.	.	.	.	.	.	.	.	.	.	a	13.39	2.222642	0.39300	2.27E-4	0.0	ENSG00000127530	ENST00000248073	T	0.17691	2.26	3.64	3.64	0.41730	.	0.247416	0.20723	U	0.086867	T	0.47432	0.1445	M	0.92555	3.32	0.09310	N	1	D	0.89917	1.0	D	0.70227	0.968	T	0.44483	-0.9325	10	0.87932	D	0	.	10.5226	0.44929	1.0:0.0:0.0:0.0	.	27	O76099	OR7C1_HUMAN	P	27	ENSP00000248073:L27P	ENSP00000248073:L27P	L	-	2	0	OR7C1	14771869	0.021000	0.18746	0.002000	0.10522	0.030000	0.12068	3.167000	0.50793	1.646000	0.50622	0.443000	0.29094	CTC		0.483	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1		
AMER3	205147	broad.mit.edu	37	2	131520567	131520567	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr2:131520567A>T	ENST00000423981.1	+	2	1032	c.922A>T	c.(922-924)Agg>Tgg	p.R308W	AMER3_ENST00000321420.4_Missense_Mutation_p.R308W	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	308					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)	p.R308W(1)									TGACTTCACCAGGTTCTGGGA	0.657																																																1	Substitution - Missense(1)	ovary(1)	2											32.0	38.0	36.0					2																	131520567		2202	4299	6501	131237037	SO:0001583	missense	205147			AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.922A>T	2.37:g.131520567A>T	ENSP00000392700:p.Arg308Trp		131237037	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	A	13.16	2.155310	0.38021	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.18657	2.2;2.2	5.21	4.04	0.47022	.	0.525997	0.20253	N	0.096032	T	0.23727	0.0574	N	0.22421	0.69	0.20489	N	0.999892	D	0.58620	0.983	P	0.54346	0.749	T	0.04565	-1.0942	10	0.72032	D	0.01	.	10.7781	0.46361	0.8406:0.1594:0.0:0.0	.	308	Q8N944	F123C_HUMAN	W	308	ENSP00000314914:R308W;ENSP00000392700:R308W	ENSP00000314914:R308W	R	+	1	2	FAM123C	131237037	0.988000	0.35896	0.338000	0.25549	0.133000	0.20885	6.134000	0.71689	0.913000	0.36797	-0.488000	0.04728	AGG		0.657	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
C20orf197	284756	broad.mit.edu	37	20	58645767	58645767	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr20:58645767T>C	ENST00000313426.1	+	4	491	c.185T>C	c.(184-186)cTg>cCg	p.L62P		NM_173644.1	NP_775915.1	Q8N268	CT197_HUMAN	chromosome 20 open reading frame 197	62								p.L62P(1)		large_intestine(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	5			BRCA - Breast invasive adenocarcinoma(7;2.33e-09)			CATCCCACACTGTCCCATGAC	0.463																																																1	Substitution - Missense(1)	ovary(1)	20											113.0	102.0	106.0					20																	58645767		2203	4300	6503	58079162	SO:0001583	missense	284756			AK091179	CCDS13487.1	20q13.33	2006-07-07			ENSG00000176659	ENSG00000176659			26601	protein-coding gene	gene with protein product						12975309	Standard	NM_173644		Approved	FLJ33860	uc002ybj.1	Q8N268	OTTHUMG00000032880	ENST00000313426.1:c.185T>C	20.37:g.58645767T>C	ENSP00000316457:p.Leu62Pro		58079162	Q08EQ0	Missense_Mutation	SNP	ENST00000313426.1	37	CCDS13487.1	.	.	.	.	.	.	.	.	.	.	T	7.771	0.707370	0.15239	.	.	ENSG00000176659	ENST00000313426	.	.	.	2.5	0.0182	0.14116	.	.	.	.	.	T	0.19886	0.0478	N	0.08118	0	0.09310	N	1	B	0.33135	0.399	B	0.40134	0.32	T	0.26916	-1.0089	8	0.87932	D	0	.	2.9418	0.05833	0.0:0.1545:0.259:0.5866	.	62	Q8N268	CT197_HUMAN	P	62	.	ENSP00000316457:L62P	L	+	2	0	C20orf197	58079162	0.000000	0.05858	0.004000	0.12327	0.062000	0.15995	-0.450000	0.06803	-0.023000	0.13963	0.402000	0.26972	CTG		0.463	C20orf197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079944.1	NM_173644	
WBP2NL	164684	broad.mit.edu	37	22	42394838	42394838	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	A	A	T	T	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr22:42394838A>T	ENST00000328823.9	+	1	47	c.16A>T	c.(16-18)Agc>Tgc	p.S6C	WBP2NL_ENST00000461730.1_3'UTR	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like	6					egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)	p.S6C(1)		breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						GGTGAATCAGAGCCACACCGA	0.657																																																1	Substitution - Missense(1)	ovary(1)	22											44.0	42.0	43.0					22																	42394838		2203	4300	6503	40724784	SO:0001583	missense	164684			BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.16A>T	22.37:g.42394838A>T	ENSP00000332983:p.Ser6Cys		40724784	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	Missense_Mutation	SNP	ENST00000328823.9	37	CCDS14029.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.492978	0.64186	.	.	ENSG00000183066	ENST00000328823	T	0.36157	1.27	4.62	3.5	0.40072	.	0.520140	0.16281	N	0.221362	T	0.39226	0.1070	M	0.68952	2.095	0.80722	D	1	D	0.58620	0.983	P	0.47206	0.541	T	0.25882	-1.0119	10	0.41790	T	0.15	-3.0591	7.8584	0.29495	0.7891:0.2109:0.0:0.0	.	6	Q6ICG8	WBP2L_HUMAN	C	6	ENSP00000332983:S6C	ENSP00000332983:S6C	S	+	1	0	WBP2NL	40724784	1.000000	0.71417	0.975000	0.42487	0.436000	0.31835	2.688000	0.46984	2.078000	0.62432	0.459000	0.35465	AGC		0.657	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322037.1	NM_152613	
SEMA3G	56920	broad.mit.edu	37	3	52475405	52475405	+	Missense_Mutation	SNP	C	C	T	rs143736196		TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr3:52475405C>T	ENST00000231721.2	-	7	687	c.688G>A	c.(688-690)Gcc>Acc	p.A230T		NM_020163.1	NP_064548.1	Q9NS98	SEM3G_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G	230	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.A230T(1)		kidney(1)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)	18				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)		GGGATCCGGGCGGCCATCACA	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18557	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	3						C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	59.0	47.0	51.0		688	-2.6	0.0	3	dbSNP_134	51	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SEMA3G	NM_020163.1	58	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	probably-damaging	230/783	52475405	2,13004	2203	4300	6503	52450445	SO:0001583	missense	56920				CCDS2856.1	3p21.1	2013-01-11			ENSG00000010319	ENSG00000010319		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30400	protein-coding gene	gene with protein product						11214971	Standard	XM_005265327		Approved	FLJ00014, sem2	uc003dea.1	Q9NS98	OTTHUMG00000158570	ENST00000231721.2:c.688G>A	3.37:g.52475405C>T	ENSP00000231721:p.Ala230Thr		52450445	Q7L9D9|Q9H7Q3	Missense_Mutation	SNP	ENST00000231721.2	37	CCDS2856.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	11.49	1.655506	0.29425	2.27E-4	1.16E-4	ENSG00000010319	ENST00000231721	T	0.10477	2.87	4.56	-2.61	0.06171	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.430329	0.27092	N	0.020978	T	0.06325	0.0163	L	0.41124	1.26	0.09310	N	1	B	0.16802	0.019	B	0.21708	0.036	T	0.33954	-0.9848	10	0.22706	T	0.39	.	2.8178	0.05463	0.1884:0.1861:0.1037:0.5218	.	230	Q9NS98	SEM3G_HUMAN	T	230	ENSP00000231721:A230T	ENSP00000231721:A230T	A	-	1	0	SEMA3G	52450445	0.000000	0.05858	0.003000	0.11579	0.914000	0.54420	0.115000	0.15540	-0.903000	0.03881	-0.215000	0.12644	GCC		0.607	SEMA3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351354.1	NM_020163	
ST3GAL6	10402	broad.mit.edu	37	3	98510736	98510736	+	Missense_Mutation	SNP	A	A	G			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	A	A	G	G	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr3:98510736A>G	ENST00000483910.1	+	9	1097	c.808A>G	c.(808-810)Ata>Gta	p.I270V	ST3GAL6_ENST00000265261.6_Missense_Mutation_p.I152V|ST3GAL6_ENST00000394162.1_Missense_Mutation_p.I270V|ST3GAL6_ENST00000462152.1_3'UTR	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	270					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)	p.I270V(1)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						GGCGTTTTACATATGTCACGA	0.393																																																1	Substitution - Missense(1)	ovary(1)	3											182.0	170.0	174.0					3																	98510736		2203	4300	6503	99993426	SO:0001583	missense	10402			AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.808A>G	3.37:g.98510736A>G	ENSP00000417376:p.Ile270Val		99993426	B2RCH2|B3KMI1|D3DN39|F8W6U0	Missense_Mutation	SNP	ENST00000483910.1	37	CCDS2933.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.351896	0.41700	.	.	ENSG00000064225	ENST00000483910;ENST00000265261;ENST00000394162	T;T;T	0.29655	1.56;1.56;1.56	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	L	0.43646	1.37	0.45690	D	0.998606	B;B	0.34103	0.34;0.437	B;B	0.44224	0.237;0.444	T	0.08638	-1.0712	10	0.20519	T	0.43	-28.8281	13.9197	0.63923	1.0:0.0:0.0:0.0	.	152;270	F8W6U0;Q9Y274	.;SIA10_HUMAN	V	270;152;270	ENSP00000417376:I270V;ENSP00000265261:I152V;ENSP00000377717:I270V	ENSP00000265261:I152V	I	+	1	0	ST3GAL6	99993426	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	2.628000	0.46477	2.181000	0.69327	0.533000	0.62120	ATA		0.393	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353013.2	NM_006100	
MED10	84246	broad.mit.edu	37	5	6372624	6372624	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr5:6372624G>A	ENST00000255764.3	-	4	510	c.400C>T	c.(400-402)Cct>Tct	p.P134S		NM_032286.2	NP_115662.2	Q9BTT4	MED10_HUMAN	mediator complex subunit 10	134					gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.P134S(1)		kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|urinary_tract(1)	5						GGTTAAGAAGGCGGGTGATCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	5											110.0	109.0	109.0					5																	6372624		2203	4300	6503	6425624	SO:0001583	missense	84246				CCDS34134.1	5p15.31	2008-02-05	2007-07-30		ENSG00000133398	ENSG00000133398			28760	protein-coding gene	gene with protein product	"""NUT2 homolog (S. cerevisiae)"""	612382	"""mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)"""			15657623, 15175163	Standard	NM_032286		Approved	TRG20, L6, MGC5309, NUT2	uc003jdo.3	Q9BTT4	OTTHUMG00000161682	ENST00000255764.3:c.400C>T	5.37:g.6372624G>A	ENSP00000255764:p.Pro134Ser		6425624	C6G491	Missense_Mutation	SNP	ENST00000255764.3	37	CCDS34134.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315448	0.40996	.	.	ENSG00000133398	ENST00000255764	.	.	.	5.97	4.16	0.48862	.	0.160951	0.56097	N	0.000022	T	0.24314	0.0589	N	0.01352	-0.895	0.39651	D	0.970467	B	0.02656	0.0	B	0.01281	0.0	T	0.06534	-1.0821	9	0.51188	T	0.08	-10.1669	10.6405	0.45590	0.0707:0.1334:0.7958:0.0	.	134	Q9BTT4	MED10_HUMAN	S	134	.	ENSP00000255764:P134S	P	-	1	0	MED10	6425624	1.000000	0.71417	0.006000	0.13384	0.035000	0.12851	5.668000	0.68074	0.831000	0.34780	0.655000	0.94253	CCT		0.522	MED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365714.1	NM_032286	
MAST4	375449	broad.mit.edu	37	5	66350300	66350300	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr5:66350300C>T	ENST00000403625.2	+	5	1038	c.743C>T	c.(742-744)tCa>tTa	p.S248L	MAST4_ENST00000490016.2_Missense_Mutation_p.S59L|MAST4_ENST00000261569.7_Missense_Mutation_p.S54L|MAST4_ENST00000405643.1_Missense_Mutation_p.S66L|MAST4_ENST00000404260.3_Missense_Mutation_p.S248L|MAST4_ENST00000403666.1_Missense_Mutation_p.S59L	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	248						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.S73L(1)		breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		CGACCACACTCACCTCTCTCT	0.343																																																1	Substitution - Missense(1)	ovary(1)	5											98.0	101.0	100.0					5																	66350300		1907	4122	6029	66386056	SO:0001583	missense	375449			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.743C>T	5.37:g.66350300C>T	ENSP00000385727:p.Ser248Leu		66386056	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	C	32	5.155900	0.94686	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000432426;ENST00000380908;ENST00000261569;ENST00000436277;ENST00000432399	D;D;T;D;T;D	0.84442	-1.84;-1.85;0.49;-1.8;-1.41;-1.77	5.93	5.93	0.95920	.	0.000000	0.50627	U	0.000118	D	0.92450	0.7603	M	0.71206	2.165	0.39818	D	0.972796	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.987;0.998;0.999;0.999;0.998	D	0.92759	0.6222	10	0.87932	D	0	-7.7046	20.328	0.98708	0.0:1.0:0.0:0.0	.	66;248;54;59;59	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	L	248;248;59;59;66;39;66;54;54;54	ENSP00000385048:S248L;ENSP00000385727:S248L;ENSP00000421739:S59L;ENSP00000384313:S59L;ENSP00000384099:S66L;ENSP00000261569:S54L	ENSP00000261569:S54L	S	+	2	0	MAST4	66386056	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.654000	0.74387	2.802000	0.96397	0.561000	0.74099	TCA		0.343	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
KCNN2	3781	broad.mit.edu	37	5	113740528	113740528	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr5:113740528G>A	ENST00000512097.3	+	4	1994	c.976G>A	c.(976-978)Gca>Aca	p.A326T	KCNN2_ENST00000264773.3_Missense_Mutation_p.A326T|KCNN2_ENST00000507750.1_Intron			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	326					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.A326T(3)|p.A326P(2)		breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	GATAATTGCCGCATGGACTGT	0.328																																																5	Substitution - Missense(5)	lung(2)|large_intestine(2)|ovary(1)	5											132.0	132.0	132.0					5																	113740528		2202	4300	6502	113768427	SO:0001583	missense	3781			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.976G>A	5.37:g.113740528G>A	ENSP00000427120:p.Ala326Thr		113768427	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	ENST00000512097.3	37	CCDS4114.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.328347	0.81690	.	.	ENSG00000080709	ENST00000512097;ENST00000264773	T;T	0.33438	1.41;1.41	5.54	5.54	0.83059	Ion transport 2 (1);	0.048822	0.85682	D	0.000000	T	0.42539	0.1207	M	0.73372	2.23	0.80722	D	1	P	0.41643	0.758	B	0.42882	0.401	T	0.45160	-0.9280	10	0.87932	D	0	-3.3539	19.0766	0.93165	0.0:0.0:1.0:0.0	.	326	Q9H2S1	KCNN2_HUMAN	T	326	ENSP00000427120:A326T;ENSP00000264773:A326T	ENSP00000264773:A326T	A	+	1	0	KCNN2	113768427	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.751000	0.98889	2.616000	0.88540	0.491000	0.48974	GCA		0.328	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250775.2	NM_021614	
FOXC1	2296	broad.mit.edu	37	6	1611121	1611121	+	Silent	SNP	C	C	T	rs376255999		TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr6:1611121C>T	ENST00000380874.2	+	1	441	c.441C>T	c.(439-441)ggC>ggT	p.G147G		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	147					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G147G(1)		large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		AGAAGCCGGGCAAGGGCAGCT	0.627																																					Pancreas(133;719 1821 3197 26645 35015)											1	Substitution - coding silent(1)	ovary(1)	6						C		1,4405	2.1+/-5.4	0,1,2202	70.0	76.0	74.0		441	3.7	1.0	6		74	0,8600		0,0,4300	no	coding-synonymous	FOXC1	NM_001453.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		147/554	1611121	1,13005	2203	4300	6503	1556120	SO:0001819	synonymous_variant	2296			AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.441C>T	6.37:g.1611121C>T			1556120	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Silent	SNP	ENST00000380874.2	37	CCDS4473.1																																																																																				0.627	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
MAS1L	116511	broad.mit.edu	37	6	29454807	29454807	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr6:29454807C>T	ENST00000377127.3	-	1	931	c.873G>A	c.(871-873)atG>atA	p.M291I		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	291					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.M291I(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						TGGTGACAAACATTTTGAAAT	0.498																																					NSCLC(153;755 1987 3859 11251 32945)											1	Substitution - Missense(1)	ovary(1)	6											40.0	44.0	42.0					6																	29454807		2203	4300	6503	29562786	SO:0001583	missense	116511			S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.873G>A	6.37:g.29454807C>T	ENSP00000366331:p.Met291Ile		29562786	Q5SUN5	Missense_Mutation	SNP	ENST00000377127.3	37	CCDS4661.1	.	.	.	.	.	.	.	.	.	.	C	1.528	-0.545016	0.04024	.	.	ENSG00000204687	ENST00000377127	T	0.71579	-0.58	1.87	-3.73	0.04398	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.16896	0.0406	N	0.11201	0.11	0.09310	N	1	B	0.15141	0.012	B	0.18871	0.023	T	0.13899	-1.0492	9	0.16896	T	0.51	.	0.0097	0.00001	0.284:0.2183:0.1932:0.3044	.	291	P35410	MAS1L_HUMAN	I	291	ENSP00000366331:M291I	ENSP00000366331:M291I	M	-	3	0	MAS1L	29562786	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.090000	0.15025	-0.870000	0.04047	0.420000	0.28162	ATG		0.498	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076126.2	NM_052967	
DNAH8	1769	broad.mit.edu	37	6	38841076	38841076	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	T	T	C	C	T	T	Unknown	Valid	Somatic	Phase_I	Capture	Capture;Sequenom			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr6:38841076T>C	ENST00000359357.3	+	50	7147	c.6893T>C	c.(6892-6894)tTt>tCt	p.F2298S	DNAH8_ENST00000441566.1_Missense_Mutation_p.F2262S|DNAH8_ENST00000449981.2_Missense_Mutation_p.F2515S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2298	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.F2298S(1)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAGAAAGTCTTTGAAGATACA	0.363																																																1	Substitution - Missense(1)	ovary(1)	6											95.0	86.0	89.0					6																	38841076		2203	4300	6503	38949054	SO:0001583	missense	1769			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.6893T>C	6.37:g.38841076T>C	ENSP00000352312:p.Phe2298Ser		38949054	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	T	18.66	3.671073	0.67814	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.24723	1.84;1.84;1.84	5.78	5.78	0.91487	.	0.109600	0.64402	D	0.000007	T	0.40094	0.1103	M	0.67569	2.06	0.58432	D	0.999994	D	0.71674	0.998	D	0.71656	0.974	T	0.34254	-0.9836	10	0.66056	D	0.02	.	14.6774	0.68989	0.0:0.0:0.0:1.0	.	2298	Q96JB1	DYH8_HUMAN	S	2503;2503;2298;2262	ENSP00000333363:F2503S;ENSP00000352312:F2298S;ENSP00000402294:F2262S	ENSP00000333363:F2503S	F	+	2	0	DNAH8	38949054	1.000000	0.71417	0.894000	0.35097	0.315000	0.28087	5.178000	0.65037	2.197000	0.70478	0.533000	0.62120	TTT		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
PAPOLB	56903	broad.mit.edu	37	7	4901292	4901292	+	Silent	SNP	G	G	A	rs367608195		TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr7:4901292G>A	ENST00000404991.1	-	1	333	c.147C>T	c.(145-147)ttC>ttT	p.F49F	RADIL_ENST00000399583.3_Intron|RADIL_ENST00000536091.1_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	49					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)	p.F49F(1)		kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		CGAAGACCCCGAAGGGCCTGA	0.512																																																1	Substitution - coding silent(1)	ovary(1)	7						G	,	0,3816		0,0,1908	23.0	23.0	23.0		,150	-6.1	0.8	7		23	1,8291		0,1,4145	no	intron,coding-synonymous	RADIL,PAPOLB	NM_018059.4,NM_020144.4	,	0,1,6053	AA,AG,GG		0.0121,0.0,0.0083	,	,50/638	4901292	1,12107	1908	4146	6054	4867818	SO:0001819	synonymous_variant	56903			AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.147C>T	7.37:g.4901292G>A			4867818	Q75LH1|Q8NE14	Silent	SNP	ENST00000404991.1	37																																																																																					0.512	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1	NM_020144	
PRKAR2B	5577	broad.mit.edu	37	7	106786832	106786832	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr7:106786832G>A	ENST00000265717.4	+	6	926	c.667G>A	c.(667-669)Gaa>Aaa	p.E223K		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	223					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)	p.E223K(1)		breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						GAGTTTCGGCGAACTGGCCTT	0.423																																																1	Substitution - Missense(1)	ovary(1)	7											195.0	168.0	177.0					7																	106786832		2203	4300	6503	106574068	SO:0001583	missense	5577				CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.667G>A	7.37:g.106786832G>A	ENSP00000265717:p.Glu223Lys		106574068	A4D0R9	Missense_Mutation	SNP	ENST00000265717.4	37	CCDS5740.1	.	.	.	.	.	.	.	.	.	.	G	36	5.894434	0.97074	.	.	ENSG00000005249	ENST00000265717;ENST00000543645;ENST00000539794	T	0.59364	0.27	5.57	5.57	0.84162	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.83557	0.5280	H	0.94423	3.535	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.87848	0.2656	10	0.87932	D	0	-0.9786	19.5505	0.95315	0.0:0.0:1.0:0.0	.	223	P31323	KAP3_HUMAN	K	223;223;210	ENSP00000265717:E223K	ENSP00000265717:E223K	E	+	1	0	PRKAR2B	106574068	1.000000	0.71417	0.987000	0.45799	0.988000	0.76386	9.807000	0.99171	2.641000	0.89580	0.655000	0.94253	GAA		0.423	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268386.1		
ING3	54556	broad.mit.edu	37	7	120609159	120609159	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr7:120609159G>C	ENST00000315870.5	+	9	957	c.809G>C	c.(808-810)aGg>aCg	p.R270T	ING3_ENST00000431467.1_Missense_Mutation_p.R255T	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	270					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.R270T(1)		NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					TCAATGGCCAGGGAAACAGTT	0.408																																																1	Substitution - Missense(1)	ovary(1)	7											91.0	88.0	89.0					7																	120609159		2203	4300	6503	120396395	SO:0001583	missense	54556			AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.809G>C	7.37:g.120609159G>C	ENSP00000320566:p.Arg270Thr		120396395	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Missense_Mutation	SNP	ENST00000315870.5	37	CCDS5778.1	.	.	.	.	.	.	.	.	.	.	g	27.7	4.857214	0.91433	.	.	ENSG00000071243	ENST00000315870;ENST00000431467	T;T	0.40756	1.02;1.02	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.60971	0.2310	M	0.62723	1.935	0.80722	D	1	D;D	0.57899	0.981;0.967	D;P	0.69824	0.966;0.879	T	0.51585	-0.8687	10	0.13470	T	0.59	-17.6529	19.6916	0.96005	0.0:0.0:1.0:0.0	.	270;270	Q5GRH6;Q9NXR8	.;ING3_HUMAN	T	270;255	ENSP00000320566:R270T;ENSP00000388506:R255T	ENSP00000320566:R270T	R	+	2	0	ING3	120396395	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.224000	0.95209	2.659000	0.90383	0.484000	0.47621	AGG		0.408	ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280453.2	NM_019071	
FLNC	2318	broad.mit.edu	37	7	128484983	128484983	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr7:128484983C>T	ENST00000325888.8	+	21	3725	c.3464C>T	c.(3463-3465)cCg>cTg	p.P1155L	FLNC_ENST00000346177.6_Missense_Mutation_p.P1155L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1155					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)	p.P1155L(1)		biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GTGTTTGACCCGAGCAAGGTG	0.652																																																1	Substitution - Missense(1)	ovary(1)	7											59.0	64.0	62.0					7																	128484983		2108	4228	6336	128272219	SO:0001583	missense	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3464C>T	7.37:g.128484983C>T	ENSP00000327145:p.Pro1155Leu		128272219	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554408	0.65425	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.86432	-2.12;-2.12	5.56	5.56	0.83823	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92668	0.7670	M	0.89414	3.03	0.80722	D	1	D;D	0.65815	0.995;0.974	P;P	0.56343	0.796;0.698	D	0.93652	0.6974	10	0.87932	D	0	.	13.2469	0.60028	0.0:0.9179:0.0:0.0821	.	1155;1155	Q14315-2;Q14315	.;FLNC_HUMAN	L	1155	ENSP00000327145:P1155L;ENSP00000344002:P1155L	ENSP00000327145:P1155L	P	+	2	0	FLNC	128272219	0.720000	0.27996	0.959000	0.39883	0.364000	0.29643	2.972000	0.49256	2.615000	0.88500	0.555000	0.69702	CCG		0.652	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
ZFHX4	79776	broad.mit.edu	37	8	77766282	77766282	+	Silent	SNP	C	C	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr8:77766282C>T	ENST00000521891.2	+	10	7573	c.7125C>T	c.(7123-7125)aaC>aaT	p.N2375N	ZFHX4_ENST00000050961.6_Silent_p.N2330N|ZFHX4_ENST00000455469.2_Silent_p.N2330N|ZFHX4_ENST00000518282.1_Silent_p.N2349N	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2330	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.N2359K(1)|p.N2359N(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CAGCTAAAAACGCTGCTGCCC	0.507										HNSCC(33;0.089)																																						2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	8											111.0	110.0	110.0					8																	77766282		2001	4168	6169	77928837	SO:0001819	synonymous_variant	79776				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7125C>T	8.37:g.77766282C>T			77928837	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																				0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
DCAF4L2	138009	broad.mit.edu	37	8	88885752	88885752	+	Missense_Mutation	SNP	C	C	G			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	G	G	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr8:88885752C>G	ENST00000319675.3	-	1	544	c.448G>C	c.(448-450)Gca>Cca	p.A150P		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	150								p.A150P(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GGAGTATCTGCAAGTCCCACG	0.547																																																1	Substitution - Missense(1)	ovary(1)	8											95.0	89.0	91.0					8																	88885752		2203	4300	6503	88954868	SO:0001583	missense	138009			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.448G>C	8.37:g.88885752C>G	ENSP00000316496:p.Ala150Pro		88954868		Missense_Mutation	SNP	ENST00000319675.3	37	CCDS6245.1	.	.	.	.	.	.	.	.	.	.	C	7.403	0.633217	0.14322	.	.	ENSG00000176566	ENST00000319675	T	0.69926	-0.44	1.68	-0.6	0.11642	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.098022	0.64402	D	0.000001	T	0.66848	0.2831	L	0.51422	1.61	0.23581	N	0.997364	D	0.56746	0.977	P	0.62649	0.905	T	0.57236	-0.7846	10	0.36615	T	0.2	.	4.2677	0.10771	0.0:0.5677:0.0:0.4323	.	150	Q8NA75	DC4L2_HUMAN	P	150	ENSP00000316496:A150P	ENSP00000316496:A150P	A	-	1	0	DCAF4L2	88954868	1.000000	0.71417	0.004000	0.12327	0.027000	0.11550	2.312000	0.43726	-0.345000	0.08325	0.467000	0.42956	GCA		0.547	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
CBWD1	55871	broad.mit.edu	37	9	178930	178930	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	C	C	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr9:178930G>C	ENST00000356521.4	-	1	128	c.40C>G	c.(40-42)Cct>Gct	p.P14A	CBWD1_ENST00000314367.10_De_novo_Start_OutOfFrame|CBWD1_ENST00000431099.2_De_novo_Start_OutOfFrame|CBWD1_ENST00000382447.4_Missense_Mutation_p.P14A|CBWD1_ENST00000382389.1_De_novo_Start_OutOfFrame|CBWD1_ENST00000377447.3_Missense_Mutation_p.P14A|CBWD1_ENST00000382393.1_Missense_Mutation_p.P14A|CBWD1_ENST00000377400.4_Missense_Mutation_p.P14A	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1	14							ATP binding (GO:0005524)	p.P14A(1)		kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TCCTCCGCAGGATCCTCCTCC	0.577																																																1	Substitution - Missense(1)	ovary(1)	9											58.0	44.0	49.0					9																	178930		2091	3087	5178	168930	SO:0001583	missense	55871			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.40C>G	9.37:g.178930G>C	ENSP00000348915:p.Pro14Ala		168930	A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Missense_Mutation	SNP	ENST00000356521.4	37	CCDS6438.1	.	.	.	.	.	.	.	.	.	.	.	0.349	-0.945738	0.02304	.	.	ENSG00000172785	ENST00000356521;ENST00000377400;ENST00000382447;ENST00000377447;ENST00000377347;ENST00000417415;ENST00000382393	T;T;T;T;T	0.40225	3.21;3.2;3.21;1.62;1.04	3.76	-0.177	0.13307	.	0.660669	0.14559	N	0.312151	T	0.15825	0.0381	N	0.08118	0	0.09310	N	1	B;B	0.15930	0.015;0.011	B;B	0.15484	0.013;0.005	T	0.23868	-1.0176	10	0.10377	T	0.69	-7.8286	3.3809	0.07254	0.3336:0.2402:0.4263:0.0	.	14;14	Q9BRT8-3;Q9BRT8	.;CBWD1_HUMAN	A	14	ENSP00000348915:P14A;ENSP00000366617:P14A;ENSP00000371885:P14A;ENSP00000366666:P14A;ENSP00000371830:P14A	ENSP00000348915:P14A	P	-	1	0	CBWD1	168930	0.005000	0.15991	0.109000	0.21407	0.246000	0.25737	0.229000	0.17833	0.090000	0.17273	0.479000	0.44913	CCT		0.577	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051463.1	NM_018491	
ADAMTSL1	92949	broad.mit.edu	37	9	18574169	18574169	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	A	A	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture;Sequenom			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr9:18574169G>A	ENST00000380548.4	+	4	718	c.379G>A	c.(379-381)Gga>Aga	p.G127R	ADAMTSL1_ENST00000380566.4_Missense_Mutation_p.G127R|ADAMTSL1_ENST00000380570.4_Missense_Mutation_p.G127R|ADAMTSL1_ENST00000431052.2_Missense_Mutation_p.G127R|ADAMTSL1_ENST00000276935.6_Missense_Mutation_p.G127R|MIR3152_ENST00000579801.1_RNA|ADAMTSL1_ENST00000327883.7_Missense_Mutation_p.G127R	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	127						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.G127R(2)		breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCAAGCCAAAGGAACAACCCT	0.448																																																2	Substitution - Missense(2)	ovary(2)	9											209.0	175.0	187.0					9																	18574169		2203	4300	6503	18564169	SO:0001583	missense	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.379G>A	9.37:g.18574169G>A	ENSP00000369921:p.Gly127Arg		18564169	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	G	32	5.155530	0.94686	.	.	ENSG00000178031	ENST00000380548;ENST00000327883;ENST00000431052;ENST00000380570;ENST00000380566;ENST00000276935	T;D;D;D;D;D	0.85955	-0.21;-2.05;-2.05;-2.05;-2.05;-2.05	5.25	5.25	0.73442	.	.	.	.	.	D	0.93969	0.8069	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	0.977;1.0	P;D	0.76575	0.726;0.988	D	0.94842	0.8006	9	0.87932	D	0	.	19.2077	0.93739	0.0:0.0:1.0:0.0	.	127;127	Q8N6G6;Q8N6G6-2	ATL1_HUMAN;.	R	127	ENSP00000369921:G127R;ENSP00000327887:G127R;ENSP00000401157:G127R;ENSP00000369944:G127R;ENSP00000369940:G127R;ENSP00000276935:G127R	ENSP00000276935:G127R	G	+	1	0	ADAMTSL1	18564169	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.751000	0.98889	2.620000	0.88729	0.643000	0.83706	GGA		0.448	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
SLC44A1	23446	broad.mit.edu	37	9	108110708	108110708	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	G	G	T	T	G	G	Unknown	Valid	Somatic	Phase_I	Capture	Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr9:108110708G>T	ENST00000374720.3	+	5	723	c.476G>T	c.(475-477)tGc>tTc	p.C159F	SLC44A1_ENST00000374723.1_Missense_Mutation_p.C159F|SLC44A1_ENST00000374724.1_Missense_Mutation_p.C159F	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	159					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)	p.C159F(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	TCTGTTCTCTGCCCCAAACTA	0.358																																																1	Substitution - Missense(1)	ovary(1)	9											110.0	109.0	109.0					9																	108110708		2203	4300	6503	107150529	SO:0001583	missense	23446			AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.476G>T	9.37:g.108110708G>T	ENSP00000363852:p.Cys159Phe		107150529	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	ENST00000374720.3	37	CCDS6763.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.496875	0.85069	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724	T;T;T	0.78364	-1.17;-1.17;-1.17	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.89171	0.6639	M	0.86502	2.82	0.80722	D	1	D;B	0.53745	0.962;0.145	D;B	0.64042	0.921;0.133	D	0.88774	0.3266	10	0.40728	T	0.16	-12.4654	19.2931	0.94110	0.0:0.0:1.0:0.0	.	159;159	Q8WWI5-3;Q8WWI5	.;CTL1_HUMAN	F	159	ENSP00000363855:C159F;ENSP00000363852:C159F;ENSP00000363856:C159F	ENSP00000363852:C159F	C	+	2	0	SLC44A1	107150529	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.417000	0.90247	2.554000	0.86153	0.655000	0.94253	TGC		0.358	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546	
PLP1	5354	broad.mit.edu	37	X	103041611	103041611	+	Missense_Mutation	SNP	C	C	T	rs132630295		TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	C	C	T	T	C	C	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chrX:103041611C>T	ENST00000303958.2	+	3	555	c.409C>T	c.(409-411)Cgg>Tgg	p.R137W	PLP1_ENST00000361621.2_Intron|PLP1_ENST00000418604.1_Missense_Mutation_p.R137W	NM_000533.3	NP_000524.3	P60201	MYPR_HUMAN	proteolipid protein 1	137			Missing (in HLD1).|R -> W (in SPG2). {ECO:0000269|PubMed:17438221}.		astrocyte development (GO:0014002)|axon development (GO:0061564)|axon ensheathment (GO:0008366)|cell death (GO:0008219)|cell maturation (GO:0048469)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|long-chain fatty acid biosynthetic process (GO:0042759)|positive regulation of gene expression (GO:0010628)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|plasma membrane (GO:0005886)	structural constituent of myelin sheath (GO:0019911)|structural molecule activity (GO:0005198)	p.R137W(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	17						TTCTTTGGAGCGGGTGTGTCA	0.552																																																1	Substitution - Missense(1)	ovary(1)	X											147.0	125.0	133.0					X																	103041611		2203	4300	6503	102928267	SO:0001583	missense	5354			M27110	CCDS14513.1, CCDS14514.1	Xq22	2013-05-14	2008-07-28		ENSG00000123560	ENSG00000123560			9086	protein-coding gene	gene with protein product	"""Pelizaeus-Merzbacher disease"""	300401	"""spastic paraplegia 2, uncomplicated"""	SPG2, PLP			Standard	NM_001128834		Approved	GPM6C	uc004elk.3	P60201	OTTHUMG00000022111	ENST00000303958.2:c.409C>T	X.37:g.103041611C>T	ENSP00000305152:p.Arg137Trp		102928267	P04400|P06905|Q502Y1|Q6FHZ6	Missense_Mutation	SNP	ENST00000303958.2	37	CCDS14513.1	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639468	0.67244	.	.	ENSG00000123560	ENST00000418604;ENST00000303958;ENST00000428755	D;D	0.99376	-5.79;-5.79	5.78	4.84	0.62591	.	0.094680	0.45126	D	0.000386	D	0.98648	0.9547	L	0.36672	1.1	0.33805	A	0.627105	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	P;P;P;P	0.60541	0.761;0.761;0.876;0.761	D	0.99913	1.1213	9	0.62326	D	0.03	-11.6148	13.7799	0.63077	0.1648:0.8352:0.0:0.0	.	82;137;137;137	B4DI30;A8K9L3;B1B1G6;P60201	.;.;.;MYPR_HUMAN	W	137;137;115	ENSP00000405750:R137W;ENSP00000305152:R137W	ENSP00000305152:R137W	R	+	1	2	PLP1	102928267	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.363000	0.44178	2.417000	0.82017	0.600000	0.82982	CGG		0.552	PLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057743.2		
TP53	7157	broad.mit.edu	37	17	7577529	7577529	+	Missense_Mutation	SNP	A	A	C			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	A	A	C	C	A	A	Unknown	Valid	Somatic	Phase_I	Capture	Sequenom;Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr17:7577529A>C	ENST00000269305.4	-	7	941	c.752T>G	c.(751-753)aTc>aGc	p.I251S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.I251S|TP53_ENST00000445888.2_Missense_Mutation_p.I251S|TP53_ENST00000420246.2_Missense_Mutation_p.I251S|TP53_ENST00000413465.2_Missense_Mutation_p.I251S|TP53_ENST00000455263.2_Missense_Mutation_p.I251S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	251	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in sporadic cancers; somatic mutation).|I -> M (in LFS; germline mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I251S(11)|p.I251N(10)|p.0?(8)|p.I251T(4)|p.I251_T253delILT(4)|p.L252delL(3)|p.I251del(2)|p.P250_L252delPIL(2)|p.I251fs*12(1)|p.P250_T253delPILT(1)|p.R249_T256delRPILTIIT(1)|p.I251fs*94(1)|p.R249_I251delRPI(1)|p.I251fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGTGAGGATGGGCCTCCG	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	50	Substitution - Missense(25)|Deletion - In frame(14)|Whole gene deletion(8)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(6)|stomach(6)|haematopoietic_and_lymphoid_tissue(6)|upper_aerodigestive_tract(5)|oesophagus(4)|liver(4)|bone(4)|breast(4)|central_nervous_system(3)|prostate(3)|ovary(2)|thyroid(1)|soft_tissue(1)|skin(1)	17											153.0	111.0	125.0					17																	7577529		2203	4300	6503	7518254	SO:0001583	missense	7157	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.752T>G	17.37:g.7577529A>C	ENSP00000269305:p.Ile251Ser		7518254	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.713126	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99855	-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.88105	2.93	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;1.0	D	0.96495	0.9367	10	0.87932	D	0	-1.7057	12.3101	0.54924	1.0:0.0:0.0:0.0	.	251;251;251;251;251	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	251;251;251;251;251;251;240;119	ENSP00000410739:I251S;ENSP00000352610:I251S;ENSP00000269305:I251S;ENSP00000398846:I251S;ENSP00000391127:I251S;ENSP00000391478:I251S;ENSP00000425104:I119S	ENSP00000269305:I251S	I	-	2	0	TP53	7518254	1.000000	0.71417	0.998000	0.56505	0.536000	0.34869	9.087000	0.94110	2.074000	0.62210	0.379000	0.24179	ATC		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ITPKB	3707	broad.mit.edu	37	1	226923331	226923333	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-13-1504-01A-01W-0545-08	TCGA-13-1504-10A-01W-0546-08	GAG	GAG	-	-	GAG	GAG	Unknown	Valid	Somatic	Phase_I	Capture	Illumina_Capture			Illumina GAIIx	15c62cbb-78de-42a2-acd8-46599cd61986	4a43a38c-892c-4478-b94f-318dbe282269	g.chr1:226923331_226923333delGAG	ENST00000272117.3	-	1	1826_1828	c.1827_1829delCTC	c.(1825-1830)tcctca>tca	p.609_610SS>S	ITPKB_ENST00000429204.1_In_Frame_Del_p.609_610SS>S|ITPKB_ENST00000366784.1_In_Frame_Del_p.609_610SS>S			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	609					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)	p.S136L(1)|p.S610L(1)|p.S137del(1)		central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TTCGTAGGATGAGGAGAAGCCCG	0.621																																					Colon(84;110 1851 5306 33547)											3	Substitution - Missense(2)|Deletion - In frame(1)	lung(2)|ovary(1)	1																																								224989956	SO:0001651	inframe_deletion	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1827_1829delCTC	1.37:g.226923334_226923336delGAG	ENSP00000272117:p.Ser611del		224989954	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Del	DEL	ENST00000272117.3	37	CCDS1555.1																																																																																				0.621	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
