#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_Chromosome_hg18	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_End_position_hg18	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_Start_position_hg18	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LRIG2	9860	genome.wustl.edu	37	1	113641326	113641326	+	Splice_Site	SNP	G	G	A			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr1:113641326G>A	ENST00000361127.5	+	9	1289		c.e9-1			NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2						innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.?(1)		breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CATTTTTGTAGAGACTTAAGA	0.363																																																1	Unknown(1)	ovary(1)	1											88.0	89.0	89.0					1																	113641326		2203	4300	6503	113442849	SO:0001630	splice_region_variant	9860			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1092-1G>A	1.37:g.113641326G>A			113442849	Q9NSN2	Splice_Site	SNP	-	e9-1	ENST00000361127.5	37	c.1092-1	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	g	19.75	3.885743	0.72410	.	.	ENSG00000198799	ENST00000361127	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1809	0.93623	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRIG2	113442849	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.395000	0.97266	2.608000	0.88229	0.596000	0.82720	.	-	-		0.363	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	protein_coding	OTTHUMT00000033549.2	G	NM_014813	Intron	113442849	1	no_errors	NM_014813	genbank	human	provisional	54_36p	splice_site	SNP	1	A
BCL2L15	440603	genome.wustl.edu	37	1	114429215	114429215	+	Missense_Mutation	SNP	T	T	G			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	T	T	T	G	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr1:114429215T>G	ENST00000393316.3	-	2	364	c.193A>C	c.(193-195)Aac>Cac	p.N65H	BCL2L15_ENST00000488450.1_Intron|BCL2L15_ENST00000471267.1_Missense_Mutation_p.N65H|AP4B1-AS1_ENST00000419536.1_RNA|BCL2L15_ENST00000393320.3_Intron	NM_001010922.2	NP_001010922.1	Q5TBC7	B2L15_HUMAN	BCL2-like 15	65					apoptotic process (GO:0006915)	cytosol (GO:0005829)|nucleus (GO:0005634)		p.N65H(1)		breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)	9	Lung SC(450;0.184)	all_cancers(81;3.95e-08)|all_epithelial(167;9.95e-08)|all_lung(203;1.31e-05)|Lung NSC(69;2.46e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATTCTCCGTTGAACTGGTCA	0.428																																																1	Substitution - Missense(1)	ovary(1)	1											129.0	111.0	117.0					1																	114429215		2203	4300	6503	114230738	SO:0001583	missense	440603				CCDS30809.1	1p13.2	2014-03-07			ENSG00000188761	ENSG00000188761			33624	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 178"""	C1orf178		12700646, 15961081, 16690252, 17412810	Standard	NM_001010922		Approved	Bfk, FLJ22588	uc001edw.3	Q5TBC7	OTTHUMG00000011940	ENST00000393316.3:c.193A>C	1.37:g.114429215T>G	ENSP00000376992:p.Asn65His		114230738	A0PJY6|A8K074|I6LA82	Missense_Mutation	SNP	-	p.N65H	ENST00000393316.3	37	c.193	CCDS30809.1	1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.483456	0.44147	.	.	ENSG00000188761	ENST00000393316;ENST00000471267	T;T	0.04654	3.58;3.58	5.63	5.63	0.86233	.	0.051302	0.85682	D	0.000000	T	0.12347	0.0300	M	0.72118	2.19	0.42344	D	0.992343	D	0.89917	1.0	D	0.71870	0.975	T	0.00428	-1.1745	10	0.87932	D	0	.	13.382	0.60773	0.0:0.0:0.0:1.0	.	65	Q5TBC7	B2L15_HUMAN	H	65	ENSP00000376992:N65H;ENSP00000417458:N65H	ENSP00000376992:N65H	N	-	1	0	BCL2L15	114230738	1.000000	0.71417	0.732000	0.30844	0.003000	0.03518	4.112000	0.57845	2.155000	0.67459	0.528000	0.53228	AAC	-	NULL		0.428	BCL2L15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L15	protein_coding	OTTHUMT00000033026.2	T	NM_001010922		114230738	-1	no_errors	NM_001010922	genbank	human	validated	54_36p	missense	SNP	0.96	G
LHX8	431707	genome.wustl.edu	37	1	75608823	75608823	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr1:75608823C>T	ENST00000294638.5	+	6	1074	c.410C>T	c.(409-411)tCt>tTt	p.S137F	LHX8_ENST00000356261.3_Missense_Mutation_p.S127F	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	137	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.S137F(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						ACTCGCTGCTCTCGATGTGGG	0.443																																																1	Substitution - Missense(1)	ovary(1)	1											98.0	93.0	95.0					1																	75608823		2203	4299	6502	75381411	SO:0001583	missense	431707			AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.410C>T	1.37:g.75608823C>T	ENSP00000294638:p.Ser137Phe		75381411	E9PGE3	Missense_Mutation	SNP	-	p.S137F	ENST00000294638.5	37	c.410	CCDS30756.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820920	0.90873	.	.	ENSG00000162624	ENST00000294638;ENST00000356261	D;D	0.88354	-2.37;-2.37	5.3	5.3	0.74995	Zinc finger, LIM-type (5);	0.101236	0.64402	D	0.000002	D	0.91489	0.7313	L	0.52823	1.66	0.80722	D	1	D	0.61697	0.99	P	0.60541	0.876	D	0.91998	0.5608	10	0.87932	D	0	.	19.3413	0.94342	0.0:1.0:0.0:0.0	.	137	Q68G74	LHX8_HUMAN	F	137;127	ENSP00000294638:S137F;ENSP00000348597:S127F	ENSP00000294638:S137F	S	+	2	0	LHX8	75381411	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.660000	0.90430	0.650000	0.86243	TCT	-	NULL		0.443	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LHX8	protein_coding	OTTHUMT00000026700.1	C	NM_001001933		75381411	1	no_errors	NM_001001933	genbank	human	validated	54_36p	missense	SNP	1	T
IGSF3	3321	genome.wustl.edu	37	1	117131694	117131694	+	Missense_Mutation	SNP	T	T	C			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr1:117131694T>C	ENST00000369486.3	-	8	2827	c.2062A>G	c.(2062-2064)Acc>Gcc	p.T688A	IGSF3_ENST00000318837.6_Missense_Mutation_p.T708A|IGSF3_ENST00000369483.1_Missense_Mutation_p.T708A	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	688	Ig-like C2-type 6.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.T688A(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		AGGGTGAGGGTCCTCTTCGAT	0.532																																																1	Substitution - Missense(1)	ovary(1)	1											85.0	82.0	83.0					1																	117131694		2203	4300	6503	116933217	SO:0001583	missense	3321			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2062A>G	1.37:g.117131694T>C	ENSP00000358498:p.Thr688Ala		116933217	A6NJZ6|A6NMC7	Missense_Mutation	SNP	-	p.T708A	ENST00000369486.3	37	c.2122	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.848969	0.32699	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.64991	-0.13;-0.13;-0.13	4.16	4.16	0.48862	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.472387	0.21950	N	0.066751	T	0.29588	0.0738	N	0.21282	0.65	0.33958	D	0.645311	B;B;B	0.21688	0.012;0.059;0.016	B;B;B	0.22152	0.023;0.038;0.038	T	0.13255	-1.0516	10	0.33141	T	0.24	-34.646	11.1892	0.48675	0.0:0.0:0.0:1.0	.	708;688;708	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	A	688;708;708	ENSP00000358498:T688A;ENSP00000358495:T708A;ENSP00000321184:T708A	ENSP00000321184:T708A	T	-	1	0	IGSF3	116933217	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	3.606000	0.54095	1.749000	0.51849	0.379000	0.24179	ACC	-	NULL		0.532	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	protein_coding	OTTHUMT00000059040.1	T	NM_001542		116933217	-1	no_errors	NM_001542	genbank	human	validated	54_36p	missense	SNP	1	C
FAM160A2	84067	genome.wustl.edu	37	11	6239044	6239044	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C					Unknown	Unknown	Somatic	4	Capture	none	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr11:6239044C>T	ENST00000449352.2	-	9	2035	c.1772G>A	c.(1771-1773)cGg>cAg	p.R591Q	FAM160A2_ENST00000524416.1_Missense_Mutation_p.R591Q|FAM160A2_ENST00000265978.4_Missense_Mutation_p.R605Q|FAM160A2_ENST00000529360.1_5'Flank			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	591					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)		p.R605Q(2)		NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TTTCTTAGTCCGGGAGCCAAA	0.667																																																2	Substitution - Missense(2)	ovary(1)|large_intestine(1)	11											35.0	35.0	35.0					11																	6239044		2201	4296	6497	6195620	SO:0001583	missense	84067				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1772G>A	11.37:g.6239044C>T	ENSP00000416918:p.Arg591Gln		6195620	Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	-	p.R605Q	ENST00000449352.2	37	c.1814	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236984	0.58886	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.52295	0.67;0.67;0.67	5.16	5.16	0.70880	.	0.698200	0.14387	N	0.322754	T	0.56659	0.2000	L	0.56769	1.78	0.31859	N	0.621249	D;D;D	0.76494	0.995;0.98;0.999	P;B;P	0.59115	0.636;0.294;0.852	T	0.52465	-0.8572	10	0.12103	T	0.63	-8.8008	12.4521	0.55682	0.1676:0.8324:0.0:0.0	.	591;591;605	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	Q	591;516;605;591	ENSP00000416918:R591Q;ENSP00000265978:R605Q;ENSP00000431773:R591Q	ENSP00000265978:R605Q	R	-	2	0	FAM160A2	6195620	0.954000	0.32549	1.000000	0.80357	0.980000	0.70556	0.241000	0.18065	2.692000	0.91855	0.561000	0.74099	CGG	-	NULL		0.667	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	protein_coding	OTTHUMT00000383759.1	C	NM_032127		6195620	-1	no_errors	NM_032127	genbank	human	validated	54_36p	missense	SNP	1	T
SYTL2	54843	genome.wustl.edu	37	11	85436342	85436342	+	Intron	SNP	C	C	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr11:85436342C>T	ENST00000528231.1	-	7	1737				SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000359152.5_Silent_p.S910S|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000354566.3_Silent_p.S386S|SYTL2_ENST00000525423.1_Silent_p.S386S|SYTL2_ENST00000524452.1_Intron	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)	p.S386S(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		CTACAGTCTCCGAAATTTCCG	0.473																																																1	Substitution - coding silent(1)	ovary(1)	11											55.0	56.0	56.0					11																	85436342		2203	4299	6502	85113990	SO:0001627	intron_variant	54843			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+2596G>A	11.37:g.85436342C>T			85113990	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Silent	SNP	HMMPfam_C2;superfamily_C2 domain (Calcium/lipid-binding domain CaLB)	p.S386	ENST00000528231.1	37	c.1158	CCDS53688.1	11																																																																																			-	NULL		0.473	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	protein_coding	OTTHUMT00000392192.1	C	NM_206927		85113990	-1	no_errors	NM_206927	genbank	human	reviewed	54_36p	silent	SNP	1	T
SSH1	54434	genome.wustl.edu	37	12	109198956	109198956	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr12:109198956C>T	ENST00000326495.5	-	10	923	c.830G>A	c.(829-831)cGt>cAt	p.R277H	SSH1_ENST00000551165.1_Missense_Mutation_p.R277H|SSH1_ENST00000360239.3_5'UTR|SSH1_ENST00000326470.5_Missense_Mutation_p.R288H	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	277					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R277H(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TAATTCATTACGAATCTGTGG	0.348																																																1	Substitution - Missense(1)	ovary(1)	12											100.0	96.0	97.0					12																	109198956		2203	4300	6503	107723085	SO:0001583	missense	54434			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.830G>A	12.37:g.109198956C>T	ENSP00000315713:p.Arg277His		107723085	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	-	p.R277H	ENST00000326495.5	37	c.830	CCDS9121.1	12	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045069	0.93685	.	.	ENSG00000084112	ENST00000326495;ENST00000551165;ENST00000326470	T;T;T	0.36699	1.24;1.24;1.24	5.13	5.13	0.70059	DEK, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.64416	0.2596	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.989	D;D;P	0.80764	0.992;0.994;0.875	T	0.69566	-0.5111	10	0.87932	D	0	-15.4873	18.9648	0.92692	0.0:1.0:0.0:0.0	.	288;277;277	Q8WYL5-5;Q8WYL5-2;Q8WYL5	.;.;SSH1_HUMAN	H	277;277;288	ENSP00000315713:R277H;ENSP00000448824:R277H;ENSP00000326107:R288H	ENSP00000326107:R288H	R	-	2	0	SSH1	107723085	1.000000	0.71417	0.994000	0.49952	0.928000	0.56348	7.725000	0.84808	2.523000	0.85059	0.655000	0.94253	CGT	-	NULL		0.348	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	protein_coding	OTTHUMT00000403724.1	C	NM_018984		107723085	-1	no_errors	NM_018984	genbank	human	provisional	54_36p	missense	SNP	1	T
OVCH1	341350	genome.wustl.edu	37	12	29597205	29597205	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr12:29597205C>T	ENST00000318184.5	-	24	2889	c.2890G>A	c.(2890-2892)Gac>Aac	p.D964N	OVCH1-AS1_ENST00000551108.1_Intron|OVCH1-AS1_ENST00000549411.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	964						extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)	p.D964N(1)		NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					ATTTTACTGTCCTTTGGACCT	0.413																																																1	Substitution - Missense(1)	ovary(1)	12											86.0	86.0	86.0					12																	29597205		1818	4087	5905	29488472	SO:0001583	missense	341350			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2890G>A	12.37:g.29597205C>T	ENSP00000326708:p.Asp964Asn		29488472		Missense_Mutation	SNP	HMMPfam_CUB;superfamily_Spermadhesin CUB domain;HMMPfam_Trypsin;superfamily_Trypsin-like serine proteases	p.D964N	ENST00000318184.5	37	c.2890		12	.	.	.	.	.	.	.	.	.	.	C	3.067	-0.191943	0.06299	.	.	ENSG00000187950	ENST00000318184	D	0.86432	-2.12	2.35	-0.684	0.11331	.	.	.	.	.	T	0.65344	0.2682	N	0.08118	0	0.09310	N	1	P	0.35011	0.48	B	0.19391	0.025	T	0.55528	-0.8127	8	.	.	.	.	5.3136	0.15843	0.0:0.5473:0.0:0.4527	.	964	Q7RTY7	OVCH1_HUMAN	N	964	ENSP00000326708:D964N	.	D	-	1	0	OVCH1	29488472	0.000000	0.05858	0.010000	0.14722	0.716000	0.41182	-0.236000	0.09003	-0.171000	0.10797	0.563000	0.77884	GAC	-	NULL		0.413	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	protein_coding	OTTHUMT00000395997.2	C	NM_183378		29488472	-1	no_errors	NM_183378	genbank	human	validated	54_36p	missense	SNP	0.01	T
RASSF9	9182	genome.wustl.edu	37	12	86199045	86199045	+	Missense_Mutation	SNP	T	T	A			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	T	T	T	A	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr12:86199045T>A	ENST00000361228.3	-	2	1111	c.743A>T	c.(742-744)gAc>gTc	p.D248V		NM_005447.3	NP_005438.2	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 9	248					endosomal transport (GO:0016197)|protein targeting (GO:0006605)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|trans-Golgi network transport vesicle membrane (GO:0012510)	transporter activity (GO:0005215)	p.D248V(1)		endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ATACTGCAAGTCTAGATTTTG	0.398																																																1	Substitution - Missense(1)	ovary(1)	12											123.0	120.0	121.0					12																	86199045		1904	4123	6027	84723176	SO:0001583	missense	9182				CCDS44950.1	12q21.31	2008-02-22	2008-02-22	2008-02-22		ENSG00000198774			15739	protein-coding gene	gene with protein product		610383	"""peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor"""	PAMCI		9837933, 18272789	Standard	NM_005447		Approved	P-CIP1	uc001taf.1	O75901	OTTHUMG00000169831	ENST00000361228.3:c.743A>T	12.37:g.86199045T>A	ENSP00000354884:p.Asp248Val		84723176	B3KMQ4|Q8N5U8	Missense_Mutation	SNP	-	p.D248V	ENST00000361228.3	37	c.743	CCDS44950.1	12	.	.	.	.	.	.	.	.	.	.	T	0.453	-0.892698	0.02491	.	.	ENSG00000198774	ENST00000361228	T	0.47177	0.85	4.84	1.03	0.20045	.	1.056190	0.07368	U	0.885183	T	0.36690	0.0976	L	0.44542	1.39	0.09310	N	0.999992	B	0.22983	0.078	B	0.23852	0.049	T	0.28618	-1.0038	10	0.20519	T	0.43	-14.1532	5.5176	0.16916	0.0:0.2415:0.1365:0.622	.	248	O75901	RASF9_HUMAN	V	248	ENSP00000354884:D248V	ENSP00000354884:D248V	D	-	2	0	RASSF9	84723176	0.001000	0.12720	0.009000	0.14445	0.006000	0.05464	0.958000	0.29227	0.000000	0.14550	0.528000	0.53228	GAC	-	NULL		0.398	RASSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF9	protein_coding	OTTHUMT00000406109.1	T			84723176	-1	no_errors	NM_005447	genbank	human	reviewed	54_36p	missense	SNP		A
TMEM132B	114795	genome.wustl.edu	37	12	126135439	126135439	+	Silent	SNP	C	C	T	rs370664891		TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr12:126135439C>T	ENST00000299308.3	+	7	1847	c.1839C>T	c.(1837-1839)atC>atT	p.I613I	TMEM132B_ENST00000535886.1_Silent_p.I125I	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	613						integral component of membrane (GO:0016021)		p.I613I(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AGCCGAAAATCGCTCAGTTAC	0.592																																																1	Substitution - coding silent(1)	ovary(1)	12						C		0,4156		0,0,2078	62.0	67.0	65.0		1839	-8.4	0.0	12		65	3,8413		0,3,4205	no	coding-synonymous	TMEM132B	NM_052907.2		0,3,6283	TT,TC,CC		0.0356,0.0,0.0239		613/1079	126135439	3,12569	2078	4208	6286	124701392	SO:0001819	synonymous_variant	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1839C>T	12.37:g.126135439C>T			124701392	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Silent	SNP	-	p.I613	ENST00000299308.3	37	c.1839	CCDS41859.1	12																																																																																			-	NULL		0.592	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	protein_coding	OTTHUMT00000400043.1	C	NM_052907		124701392	1	no_errors	NM_052907	genbank	human	provisional	54_36p	silent	SNP	0.39	T
ATP4B	496	genome.wustl.edu	37	13	114307239	114307239	+	Silent	SNP	G	G	C			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr13:114307239G>C	ENST00000335288.4	-	4	545	c.504C>G	c.(502-504)ccC>ccG	p.P168P		NM_000705.3	NP_000696.1	P51164	ATP4B_HUMAN	ATPase, H+/K+ exchanging, beta polypeptide	168					cell adhesion (GO:0007155)|hydrogen ion transmembrane transport (GO:1902600)|ion transmembrane transport (GO:0034220)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	hydrogen:potassium-exchanging ATPase activity (GO:0008900)	p.P168P(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)			AGCCGAAGTTGGGATCCGCCA	0.502																																																1	Substitution - coding silent(1)	ovary(1)	13											82.0	80.0	81.0					13																	114307239		2203	4300	6503	113355240	SO:0001819	synonymous_variant	496				CCDS9539.1	13q34	2011-08-01			ENSG00000186009	ENSG00000186009	3.6.3.10	"""ATPases / P-type"""	820	protein-coding gene	gene with protein product		137217				1330887, 15057823	Standard	NM_000705		Approved	ATP6B	uc001vtz.3	P51164	OTTHUMG00000140234	ENST00000335288.4:c.504C>G	13.37:g.114307239G>C			113355240	B1B0N8	Silent	SNP	HMMPfam_Na_K-ATPase	p.P168	ENST00000335288.4	37	c.504	CCDS9539.1	13																																																																																			-	HMMPfam_Na_K-ATPase		0.502	ATP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4B	protein_coding	OTTHUMT00000276703.2	G	NM_000705		113355240	-1	no_errors	NM_000705	genbank	human	reviewed	54_36p	silent	SNP	0.52	C
PABPC1P2	728773	genome.wustl.edu	37	2	147345777	147345777	+	IGR	SNP	T	T	C			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	T	T	T	C	T	T	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr2:147345777T>C								RNU7-2P (442992 upstream) : AC103881.1 (249539 downstream)														p.N79N(1)									TCAGTGGAAATCAAACTTACA	0.393																																																1	Substitution - coding silent(1)	ovary(1)	2																																								147062247	SO:0001628	intergenic_variant	728773																															2.37:g.147345777T>C			147062247		Silent	SNP	-	p.N79		37	c.237		2																																																																																			-	NULL	0	0.393					PABPCP2			T			147062247	1	no_errors	ENST00000359464	ensembl	human	known	54_36p	silent	SNP	0.53	C
Unknown	0	genome.wustl.edu	37	15	20462611	20462611	+	IGR	SNP	C	C	G			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr15:20462611C>G								RP11-173D3.1 (109405 upstream) : CHEK2P2 (25385 downstream)														p.Q144H(1)									ACGTCCCAATCTGGGTGTAGA	0.577																																																1	Substitution - Missense(1)	ovary(1)	15																																								18722625	SO:0001628	intergenic_variant	646090																															15.37:g.20462611C>G			18722625		RNA	SNP	-	NULL		37	NULL		15																																																																																			-	-	0	0.577					LOC646090			C			18722625	-1	pseudogene	XR_017120	genbank	human	model	54_36p	rna	SNP	1	G
ALPK3	57538	genome.wustl.edu	37	15	85400502	85400502	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr15:85400502G>C	ENST00000258888.5	+	6	3306	c.3139G>C	c.(3139-3141)Ggg>Cgg	p.G1047R		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1047					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G1047R(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GGAGCGGCCAGGGGGAGTGCC	0.642																																																1	Substitution - Missense(1)	ovary(1)	15											65.0	56.0	59.0					15																	85400502		2203	4299	6502	83201506	SO:0001583	missense	57538			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3139G>C	15.37:g.85400502G>C	ENSP00000258888:p.Gly1047Arg		83201506	Q9P2L6	Missense_Mutation	SNP	HMMPfam_Alpha_kinase;superfamily_Protein kinase-like (PK-like);HMMPfam_I-set;superfamily_Immunoglobulin	p.G1047R	ENST00000258888.5	37	c.3139	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	12.01	1.809821	0.31961	.	.	ENSG00000136383	ENST00000258888	T	0.63417	-0.04	4.96	3.03	0.35002	.	13.053500	0.00166	N	0.000000	T	0.54303	0.1850	L	0.32530	0.975	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.39921	-0.9590	10	0.56958	D	0.05	-4.863	6.3773	0.21515	0.1029:0.1955:0.7015:0.0	.	1047	Q96L96	ALPK3_HUMAN	R	1047	ENSP00000258888:G1047R	ENSP00000258888:G1047R	G	+	1	0	ALPK3	83201506	0.000000	0.05858	0.003000	0.11579	0.060000	0.15804	-0.525000	0.06214	0.472000	0.27344	0.563000	0.77884	GGG	-	NULL		0.642	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	protein_coding	OTTHUMT00000308997.1	G	NM_020778		83201506	1	no_errors	NM_020778	genbank	human	validated	54_36p	missense	SNP		C
GPR179	440435	genome.wustl.edu	37	17	36484432	36484432	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr17:36484432G>A	ENST00000342292.4	-	11	5040	c.5020C>T	c.(5020-5022)Ctt>Ttt	p.L1674F	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1674					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L1674F(1)		breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				ATCTGGAGAAGGGTTTGGGGT	0.562																																																1	Substitution - Missense(1)	ovary(1)	17											113.0	112.0	112.0					17																	36484432		1937	4150	6087	33737958	SO:0001583	missense	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.5020C>T	17.37:g.36484432G>A	ENSP00000345060:p.Leu1674Phe		33737958		Missense_Mutation	SNP	-	p.L1674F	ENST00000342292.4	37	c.5020	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	G	9.474	1.096389	0.20552	.	.	ENSG00000188888	ENST00000342292	T	0.51071	0.72	4.92	-0.555	0.11807	.	1.416550	0.04265	N	0.341114	T	0.23688	0.0573	N	0.08118	0	0.09310	N	1	B	0.26744	0.158	B	0.23018	0.043	T	0.12167	-1.0558	10	0.46703	T	0.11	1.4519	0.124	0.00067	0.2802:0.2104:0.156:0.3534	.	1674	Q6PRD1	GP179_HUMAN	F	1674	ENSP00000345060:L1674F	ENSP00000345060:L1674F	L	-	1	0	GPR179	33737958	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.977000	0.03782	-0.289000	0.09038	-0.262000	0.10625	CTT	-	NULL		0.562	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	protein_coding	OTTHUMT00000255329.2	G			33737958	-1	no_errors	NM_001004334	genbank	human	validated	54_36p	missense	SNP		A
PIEZO2	63895	genome.wustl.edu	37	18	10691284	10691284	+	Nonsense_Mutation	SNP	G	G	A			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr18:10691284G>A	ENST00000503781.3	-	44	6948	c.6949C>T	c.(6949-6951)Cga>Tga	p.R2317*	PIEZO2_ENST00000302079.6_Nonsense_Mutation_p.R2317*|PIEZO2_ENST00000538948.1_Nonsense_Mutation_p.R274*|PIEZO2_ENST00000580640.1_Nonsense_Mutation_p.R2342*|PIEZO2_ENST00000285141.4_Nonsense_Mutation_p.R172*	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	2317					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.R172*(1)									CCCAGGACTCGCGTTGGGTAG	0.493																																																1	Substitution - Nonsense(1)	ovary(1)	18											106.0	93.0	98.0					18																	10691284		2203	4300	6503	10681284	SO:0001587	stop_gained	63895			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.6949C>T	18.37:g.10691284G>A	ENSP00000421377:p.Arg2317*		10681284	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Nonsense_Mutation	SNP	-	p.R172*	ENST00000503781.3	37	c.514		18	.	.	.	.	.	.	.	.	.	.	G	41	8.918582	0.99002	.	.	ENSG00000154864	ENST00000503781;ENST00000302079;ENST00000538948;ENST00000285141	.	.	.	5.62	3.78	0.43462	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	14.9249	0.70868	0.0:0.0:0.7381:0.2619	.	.	.	.	X	274;2317;274;172	.	ENSP00000285141:R172X	R	-	1	2	FAM38B	10681284	1.000000	0.71417	0.042000	0.18584	0.854000	0.48673	7.803000	0.85983	0.794000	0.33899	-0.181000	0.13052	CGA	-	NULL		0.493	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	FAM38B	protein_coding	OTTHUMT00000442385.4	G	NM_022068		10681284	-1	no_errors	NM_022068	genbank	human	predicted	54_36p	nonsense	SNP	0.99	A
CTIF	9811	genome.wustl.edu	37	18	46284504	46284504	+	Missense_Mutation	SNP	G	G	A	rs202032754		TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	A	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr18:46284504G>A	ENST00000256413.3	+	8	1094	c.799G>A	c.(799-801)Gca>Aca	p.A267T	CTIF_ENST00000382998.4_Missense_Mutation_p.A267T	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	267	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)	p.A267T(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GGAGGCAGGCGCACACCGCAA	0.652													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17129	0.0		0.0	False		,,,				2504	0.0															1	Substitution - Missense(1)	ovary(1)	18											91.0	85.0	87.0					18																	46284504		2203	4299	6502	44538502	SO:0001583	missense	9811			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.799G>A	18.37:g.46284504G>A	ENSP00000256413:p.Ala267Thr		44538502	B3KTR8|Q8IVD5	Missense_Mutation	SNP	HMMPfam_MIF4G;superfamily_ARM repeat	p.A267T	ENST00000256413.3	37	c.799	CCDS11935.1	18	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	8.373	0.835744	0.16820	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.41400	1.01;1.0	5.19	-5.39	0.02664	.	1.302590	0.05017	N	0.471985	T	0.21841	0.0526	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.19484	-1.0304	10	0.21540	T	0.41	-11.6721	7.579	0.27952	0.6209:0.0:0.2693:0.1098	.	267;267	O43310-2;O43310	.;CTIF_HUMAN	T	267;267;219	ENSP00000256413:A267T;ENSP00000372459:A267T	ENSP00000256413:A267T	A	+	1	0	CTIF	44538502	0.000000	0.05858	0.573000	0.28510	0.983000	0.72400	-1.284000	0.02793	-0.702000	0.05056	-0.367000	0.07326	GCA	-	NULL		0.652	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0427	protein_coding	OTTHUMT00000255907.1	G	NM_014772		44538502	1	no_errors	NM_014772	genbank	human	validated	54_36p	missense	SNP		A
BTBD2	55643	genome.wustl.edu	37	19	1997416	1997416	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	T	T	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr19:1997416C>T	ENST00000255608.4	-	2	470	c.454G>A	c.(454-456)Ggg>Agg	p.G152R	BTBD2_ENST00000590646.1_5'UTR	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	152	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoplasmic mRNA processing body (GO:0000932)		p.G152R(1)		endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCATTCCCCCGTTGAACATG	0.632																																																1	Substitution - Missense(1)	ovary(1)	19											171.0	151.0	158.0					19																	1997416		2203	4300	6503	1948416	SO:0001583	missense	55643			AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.454G>A	19.37:g.1997416C>T	ENSP00000255608:p.Gly152Arg		1948416	O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Missense_Mutation	SNP	HMMPfam_BACK;HMMPfam_PHR;HMMPfam_BTB;superfamily_POZ domain	p.G152R	ENST00000255608.4	37	c.454	CCDS12078.1	19	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309866	0.81247	.	.	ENSG00000133243	ENST00000255608	T	0.26223	1.75	4.31	4.31	0.51392	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.62660	0.2446	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76072	-0.3093	10	0.87932	D	0	-48.253	16.1069	0.81230	0.0:1.0:0.0:0.0	.	152	Q9BX70	BTBD2_HUMAN	R	152	ENSP00000255608:G152R	ENSP00000255608:G152R	G	-	1	0	BTBD2	1948416	1.000000	0.71417	0.993000	0.49108	0.533000	0.34776	7.495000	0.81514	2.123000	0.65237	0.561000	0.74099	GGG	-	HMMPfam_BTB		0.632	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD2	protein_coding	OTTHUMT00000449300.2	C			1948416	-1	no_errors	NM_017797	genbank	human	reviewed	54_36p	missense	SNP	1	T
ANKRD27	84079	genome.wustl.edu	37	19	33096796	33096796	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr19:33096796G>A	ENST00000306065.4	-	24	2596	c.2438C>T	c.(2437-2439)cCc>cTc	p.P813L	SNORA68_ENST00000364518.1_RNA	NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	813					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.P813L(1)		breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					GTAAATGAGGGGCGTGTTTCC	0.522																																																1	Substitution - Missense(1)	ovary(1)	19											150.0	138.0	142.0					19																	33096796		2203	4300	6503	37788636	SO:0001583	missense	84079			AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2438C>T	19.37:g.33096796G>A	ENSP00000304292:p.Pro813Leu		37788636	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	HMMPfam_Ank;superfamily_Ankyrin repeat;HMMPfam_VPS9;superfamily_VPS9 domain (Pfam 02204)	p.P813L	ENST00000306065.4	37	c.2438	CCDS32986.1	19	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978755	0.74360	.	.	ENSG00000105186	ENST00000306065	T	0.71698	-0.59	5.92	5.92	0.95590	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000014	D	0.85801	0.5781	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.86491	0.1797	10	0.87932	D	0	-32.6523	19.9016	0.96988	0.0:0.0:1.0:0.0	.	813	Q96NW4	ANR27_HUMAN	L	813	ENSP00000304292:P813L	ENSP00000304292:P813L	P	-	2	0	ANKRD27	37788636	1.000000	0.71417	1.000000	0.80357	0.131000	0.20780	8.086000	0.89520	2.809000	0.96659	0.650000	0.86243	CCC	-	HMMPfam_Ank		0.522	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD27	protein_coding	OTTHUMT00000450329.1	G	NM_032139		37788636	-1	no_errors	NM_032139	genbank	human	validated	54_36p	missense	SNP	1	A
BTN1A1	696	genome.wustl.edu	37	6	26502054	26502054	+	Missense_Mutation	SNP	C	C	A			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	A	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr6:26502054C>A	ENST00000244513.6	+	2	382	c.316C>A	c.(316-318)Cgc>Agc	p.R106S		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	106	Ig-like V-type 1.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.R106S(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						CGCCAAGGGGCGCGTGGCCTT	0.657																																																1	Substitution - Missense(1)	ovary(1)	6											30.0	32.0	31.0					6																	26502054		2201	4296	6497	26610033	SO:0001583	missense	696			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.316C>A	6.37:g.26502054C>A	ENSP00000244513:p.Arg106Ser		26610033	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	-	p.R106S	ENST00000244513.6	37	c.316	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472460	0.26423	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.02369	4.32	6.08	-0.107	0.13592	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.653399	0.15070	N	0.282243	T	0.00468	0.0015	N	0.11892	0.195	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.44003	-0.9356	10	0.14252	T	0.57	.	5.1347	0.14928	0.5182:0.3204:0.0:0.1614	.	106	Q13410	BT1A1_HUMAN	S	106	ENSP00000244513:R106S	ENSP00000244513:R106S	R	+	1	0	BTN1A1	26610033	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	0.806000	0.27126	0.424000	0.26061	0.655000	0.94253	CGC	-	NULL		0.657	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	protein_coding	OTTHUMT00000043776.1	C	NM_001732		26610033	1	no_errors	NM_001732	genbank	human	validated	54_36p	missense	SNP		A
TFAP2D	83741	genome.wustl.edu	37	6	50682841	50682841	+	Missense_Mutation	SNP	G	G	A			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	A	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr6:50682841G>A	ENST00000008391.3	+	2	280	c.52G>A	c.(52-54)Gga>Aga	p.G18R		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)									p.G18R(1)		NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					ACGTCACGACGGATCAAACAG	0.527																																																1	Substitution - Missense(1)	ovary(1)	6											113.0	93.0	100.0					6																	50682841		2203	4300	6503	50790800	SO:0001583	missense	83741			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.52G>A	6.37:g.50682841G>A	ENSP00000008391:p.Gly18Arg		50790800		Missense_Mutation	SNP	-	p.G18R	ENST00000008391.3	37	c.52	CCDS4933.1	6	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032011	0.75504	.	.	ENSG00000008197	ENST00000008391	D	0.98701	-5.08	5.67	5.67	0.87782	.	0.104261	0.64402	D	0.000003	D	0.97642	0.9227	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99938	1.1383	10	0.87932	D	0	-1.3239	19.7755	0.96391	0.0:0.0:1.0:0.0	.	18	Q7Z6R9	AP2D_HUMAN	R	18	ENSP00000008391:G18R	ENSP00000008391:G18R	G	+	1	0	TFAP2D	50790800	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.785000	0.99042	2.676000	0.91093	0.655000	0.94253	GGA	-	NULL		0.527	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	protein_coding	OTTHUMT00000040881.1	G	NM_172238		50790800	1	no_errors	NM_172238	genbank	human	validated	54_36p	missense	SNP	1	A
FAM19A1	407738	genome.wustl.edu	37	3	68194271	68194271	+	Intron	SNP	C	C	T	rs533558748		TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr3:68194271C>T	ENST00000478136.1	+	2	608				FAM19A1_ENST00000496687.1_Intron	NM_213609.3	NP_998774.2	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A1							endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	7		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		GTATGGTCAGCGTCTAGCTTT	0.463													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17753	0.0		0.0	False		,,,				2504	0.0															0			3																																								68276961	SO:0001627	intron_variant	0			AY325114	CCDS54606.1	3p14.1	2005-01-20			ENSG00000183662	ENSG00000183662			21587	protein-coding gene	gene with protein product						15028294	Standard	NM_213609		Approved	TAFA-1	uc003dnd.3	Q7Z5A9	OTTHUMG00000158745	ENST00000478136.1:c.118+138384C>T	3.37:g.68194271C>T			68276961	A8K0V3|Q8TCL8	Missense_Mutation	SNP	-	p.R40C	ENST00000478136.1	37	c.118	CCDS54606.1	3																																																																																			-	NULL		0.463	FAM19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000214552	protein_coding	OTTHUMT00000352004.1	C	NM_213609		68276961	1	no_errors	ENST00000398570	ensembl	human	known	54_36p	missense	SNP	0.3	T
ABCA13	154664	genome.wustl.edu	37	7	48318317	48318317	+	Missense_Mutation	SNP	G	G	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	T	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr7:48318317G>T	ENST00000435803.1	+	18	7550	c.7526G>T	c.(7525-7527)aGt>aTt	p.S2509I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2509					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S2454I(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTGAATGACAGTGCTGACCTG	0.428																																																1	Substitution - Missense(1)	ovary(1)	7											193.0	192.0	192.0					7																	48318317		1868	4101	5969	48288863	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7526G>T	7.37:g.48318317G>T	ENSP00000411096:p.Ser2509Ile		48288863	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	-	p.V2455L	ENST00000435803.1	37	c.7363	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	13.32	2.202191	0.38905	.	.	ENSG00000179869	ENST00000435803	T	0.53857	0.6	4.87	1.5	0.22942	.	0.554792	0.16119	N	0.228747	T	0.26195	0.0639	N	0.04880	-0.145	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.13899	-1.0492	10	0.32370	T	0.25	.	6.1359	0.20233	0.0:0.1602:0.3666:0.4732	.	2509	Q86UQ4	ABCAD_HUMAN	I	2509	ENSP00000411096:S2509I	ENSP00000411096:S2509I	S	+	2	0	ABCA13	48288863	0.000000	0.05858	0.001000	0.08648	0.890000	0.51754	0.027000	0.13621	0.415000	0.25817	0.655000	0.94253	AGT	-	NULL		0.428	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	protein_coding	OTTHUMT00000341964.2	G	NM_152701		48288863	1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	NM_152701	genbank	human	reviewed	54_36p	missense	SNP		T
Unknown	0	genome.wustl.edu	37	9	14863	14863	+	IGR	SNP	A	A	G	rs71509923	byFrequency	TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	A	A	A	G	A	A	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr9:14863A>G								None (None upstream) : MIR1302-2 (12793 downstream)																							GGTGGCGGCAAAGGAGGGATG	0.647													.|||	1047	0.209065	0.3124	0.2176	5008	,	,		15478	0.1508		0.1789	False		,,,				2504	0.1544															0			9											9.0	16.0	14.0					9																	14863		1472	3710	5182	4863	SO:0001628	intergenic_variant	100287171																															9.37:g.14863A>G			4863		Silent	SNP	-	p.L247		37	c.739		9																																																																																			-	NULL	0	0.647					WASH1			A			4863	-1	no_errors	NM_182905	genbank	human	validated	54_36p	silent	SNP	1	G
GLIS3	169792	genome.wustl.edu	37	9	3856099	3856099	+	Missense_Mutation	SNP	G	G	C			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	G	G	G	C	G	G	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chr9:3856099G>C	ENST00000324333.10	-	8	2111	c.1918C>G	c.(1918-1920)Ccc>Gcc	p.P640A	GLIS3_ENST00000461870.1_5'UTR|GLIS3_ENST00000381971.3_Missense_Mutation_p.P795A	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	640					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.P640A(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		TGGGTATAGGGAGGCTGTGTT	0.473																																																1	Substitution - Missense(1)	ovary(1)	9											154.0	145.0	148.0					9																	3856099		2203	4300	6503	3846099	SO:0001583	missense	169792			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1918C>G	9.37:g.3856099G>C	ENSP00000325494:p.Pro640Ala		3846099	B1AL19|Q1PHK5	Missense_Mutation	SNP	-	p.P795A	ENST00000324333.10	37	c.2383	CCDS6451.1	9	.	.	.	.	.	.	.	.	.	.	g	6.450	0.451172	0.12223	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.11277	2.79;2.79	5.59	3.42	0.39159	.	0.261947	0.26400	N	0.024582	T	0.07234	0.0183	N	0.17082	0.46	0.28668	N	0.905798	P;B;B;B	0.40431	0.717;0.001;0.433;0.001	B;B;B;B	0.41271	0.352;0.002;0.164;0.002	T	0.11616	-1.0580	10	0.46703	T	0.11	.	7.4922	0.27469	0.211:0.1329:0.656:0.0	.	235;308;795;640	Q59FQ6;Q1PHK3;Q8NEA6-2;Q8NEA6	.;.;.;GLIS3_HUMAN	A	640;795	ENSP00000325494:P640A;ENSP00000371398:P795A	ENSP00000325494:P640A	P	-	1	0	GLIS3	3846099	0.996000	0.38824	0.994000	0.49952	0.362000	0.29581	0.341000	0.19909	1.380000	0.46344	0.561000	0.74099	CCC	-	NULL		0.473	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	protein_coding	OTTHUMT00000051559.1	G	NM_152629		3846099	-1	no_errors	NM_001042413	genbank	human	reviewed	54_36p	missense	SNP	1	C
PPP1R3F	89801	genome.wustl.edu	37	X	49143088	49143088	+	Missense_Mutation	SNP	A	A	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	A	A	A	T	A	A	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chrX:49143088A>T	ENST00000055335.6	+	4	1952	c.1936A>T	c.(1936-1938)Atg>Ttg	p.M646L	PPP1R3F_ENST00000466508.1_Missense_Mutation_p.M300L|PPP1R3F_ENST00000495799.1_Missense_Mutation_p.M300L|PPP1R3F_ENST00000438316.1_Missense_Mutation_p.M317L|PPP1R3F_ENST00000376188.1_Missense_Mutation_p.M300L	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	646					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)	p.M646L(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					TGAGAAAGGGATGGGCAAGGA	0.587																																																1	Substitution - Missense(1)	ovary(1)	X											56.0	42.0	47.0					X																	49143088		2203	4299	6502	49030032	SO:0001583	missense	89801				CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1936A>T	X.37:g.49143088A>T	ENSP00000055335:p.Met646Leu		49030032	A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	HMMPfam_CBM_21	p.M646L	ENST00000055335.6	37	c.1936	CCDS35254.1	X	.	.	.	.	.	.	.	.	.	.	A	0.029	-1.345547	0.01266	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	T;T;T;T;T	0.55930	0.92;0.92;0.49;0.92;0.92	4.58	-9.16	0.00694	.	0.825456	0.10868	N	0.625297	T	0.25082	0.0609	N	0.24115	0.695	0.09310	N	1	B;B;B	0.11235	0.0;0.0;0.004	B;B;B	0.09377	0.001;0.001;0.004	T	0.16188	-1.0411	10	0.56958	D	0.05	0.007	0.2312	0.00180	0.232:0.2334:0.2499:0.2848	.	317;331;646	F5H262;A2VDJ8;Q6ZSY5	.;.;PPR3F_HUMAN	L	300;317;646;300;300	ENSP00000420687:M300L;ENSP00000415548:M317L;ENSP00000055335:M646L;ENSP00000417535:M300L;ENSP00000365359:M300L	ENSP00000055335:M646L	M	+	1	0	PPP1R3F	49030032	0.001000	0.12720	0.009000	0.14445	0.399000	0.30720	-1.250000	0.02885	-2.120000	0.00826	-1.949000	0.00487	ATG	-	NULL		0.587	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R3F	protein_coding	OTTHUMT00000060819.2	A	NM_033215		49030032	1	no_errors	NM_033215	genbank	human	validated	54_36p	missense	SNP	0.13	T
STIP1P3	441505	genome.wustl.edu	37	X	85340511	85340511	+	IGR	SNP	C	C	G			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	G	C	C	Unknown	Valid	Somatic	4	Capture	Sanger_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chrX:85340511C>G								CHM (37945 upstream) : DACH2 (62950 downstream)																							CACAAAGCTCCCAACACTTAT	0.448																																																0			X																																								85227167	SO:0001628	intergenic_variant	441505																															X.37:g.85340511C>G			85227167		RNA	SNP	-	NULL		37	NULL		X																																																																																			-	-	0	0.448					LOC441505			C			85227167	-1	pseudogene	XR_016229	genbank	human	model	54_36p	rna	SNP	1	G
CD99L2	83692	genome.wustl.edu	37	X	149938798	149938798	+	Missense_Mutation	SNP	C	C	T			TCGA-13-1506-01A-01W-0549-09	TCGA-13-1506-10A-01W-0550-09	C	C	C	T	C	C	Unknown	Valid	Somatic	4	Capture	454_PCR_WGA	1	dbGAP	Illumina GAIIx	7534b542-88f8-445c-ae4a-9f44fb6798a8	c8e62840-3b96-452f-b0c1-1f755f41931f	g.chrX:149938798C>T	ENST00000370377.3	-	10	817	c.700G>A	c.(700-702)Gtg>Atg	p.V234M	CD99L2_ENST00000466436.1_Missense_Mutation_p.V185M|CD99L2_ENST00000355149.3_Missense_Mutation_p.V162M|CD99L2_ENST00000346693.4_5'UTR|CD99L2_ENST00000437787.2_Missense_Mutation_p.V161M	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	234					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V234M(1)		endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TCACATACCACGGCTTCCAGG	0.532																																																1	Substitution - Missense(1)	ovary(1)	X											240.0	138.0	173.0					X																	149938798		2203	4300	6503	149689456	SO:0001583	missense	83692			BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.700G>A	X.37:g.149938798C>T	ENSP00000359403:p.Val234Met		149689456	A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Missense_Mutation	SNP	-	p.V234M	ENST00000370377.3	37	c.700	CCDS35427.1	X	.	.	.	.	.	.	.	.	.	.	C	14.82	2.649224	0.47362	.	.	ENSG00000102181	ENST00000370377;ENST00000438086;ENST00000355149;ENST00000437787;ENST00000466436	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.09	4.23	0.50019	.	0.067840	0.64402	D	0.000016	T	0.51822	0.1697	M	0.80028	2.48	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.998;0.999	T	0.54997	-0.8209	9	.	.	.	-7.6682	13.3308	0.60485	0.0:0.9209:0.0:0.0791	.	161;162;185;234	E9PD27;Q8TCZ2-3;Q8TCZ2-2;Q8TCZ2	.;.;.;C99L2_HUMAN	M	234;244;162;161;185	ENSP00000359403:V234M;ENSP00000347275:V162M;ENSP00000394858:V161M;ENSP00000417697:V185M	.	V	-	1	0	CD99L2	149689456	1.000000	0.71417	0.010000	0.14722	0.357000	0.29423	6.314000	0.72848	1.064000	0.40671	-0.344000	0.07964	GTG	-	NULL		0.532	CD99L2-001	KNOWN	basic|CCDS	protein_coding	CD99L2	protein_coding	OTTHUMT00000061199.1	C	NM_031462		149689456	-1	no_errors	NM_031462	genbank	human	validated	54_36p	missense	SNP	1	T
